Methods of reducing type 2 cytokine-mediated inflammation using neuromedin peptides

Abstract

To provide methods of reducing type 2 cytokine-mediated inflammation using neuromedin peptides.SOLUTION: Methods are provided for reducing type 2 cytokine-mediated inflammation, for example by reducing IL-5 and Il-13 activity, using native and variant neuromedin B (Nmb) peptides or coding sequences. Such methods can be used to treat an inflammatory disorder, such as asthma, COPD or an allergic reaction. Also provided are modified Nmb peptides. It is shown herein that Nb-induced ILC2 responses are exaggerated in the absence of basophils resulting in increased inflammation and reduced lung function.SELECTED DRAWING: None

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Application No. 62 / 741,188, filed October 4, 2018, which is incorporated by reference in its entirety.

[0002] The present application provides methods of reducing type 2 cytokine-mediated inflammation, for example, by reducing interleukin (IL)-5 and IL-13 activity using native and variant neuromedin peptides. In some examples, such methods are used to treat inflammatory disorders, for example, asthma or allergic reactions.

[0003] Acknowledgements for Government Support This invention was made with Government support under R01 AI131634-01 awarded by the National Institutes of Health (NIH). The Government has certain rights in this invention. [Background technology]

[0004] background Type 2 cytokine responses, characterized by the production of interleukin (IL)-4, 5, 9, and 13, promote immunity against helminth parasites, initiate tissue repair, and regulate metabolic health, but are also implicated in inflammation associated with allergy and asthma (1-4). Communication between specialized innate immune cell populations can dictate the strength of type 2 cytokine responses (5). For example, basophils provide signals to type 2 innate lymphoid cells (ILC2s), thereby promoting the production of IL-5 and IL-13 (6, 7). Furthermore, neuromedin U (NMU), a neuron-derived peptide, directly activates ILC2s, thereby promoting immunity against Nippostrongylus brasiliensis (Nb) (8, 9). However, whether the immune and nervous systems communicate to limit type 2 inflammation and promote tissue integrity remains poorly defined. Summary of the Invention [Means for solving the problem]

[0005] It is shown herein that in the absence of basophils, Nb-induced ILC2 responses are exaggerated, resulting in increased inflammation and reduced lung function. Furthermore, ILC2s from basophil-depleted mice are shown to have reduced levels of expression of the neuromedin B (Nmb) receptor, which is associated with their enhanced activation. In vivo administration of Nmb peptide reduced infection-induced ILC2 responses, pulmonary eosinophils, and parasite clearance. Furthermore, treatment with Nmb was sufficient to reduce the expression of IL-5 and IL-13 by purified pulmonary ILC2s from control mice, but not basophil-depleted mice. Furthermore, Nmb also inhibited the expression of activated type 2 helper T (T H2) It was also sufficient to reduce IL-5 and IL-13 expression by T cells. Collectively, these data demonstrate that the ability of ILC2s to respond to neuron-derived signals necessary to limit inflammation and maintain tissue integrity is mediated by basophils. Furthermore, these data also demonstrate that Nmb treatment is sufficient to reduce both innate and acquired sources of IL-5 and IL-13 that promote type 2 inflammation.

[0006] Based on these observations, provided herein are methods of treating a disorder in a mammalian subject, e.g., an inflammatory disorder, e.g., a disorder associated with unwanted interleukin-5 (IL-5) and / or IL-13 production / activity. In some examples, such methods include reducing IL-5 activity, reducing IL-13 activity, reducing ILC2 responses, or increasing T H The method of the present invention reduces the eosinophilia 2 response, reduces eosinophilia, or a combination thereof, thereby treating the disorder. Exemplary disorders that can be treated include airway disorders (e.g., asthma, sinusitis, idiopathic pulmonary fibrosis, rhinitis, eosinophilic polyangiitis granulomatosis, eosinophilic esophagitis, or COPD), and skin disorders (e.g., eczema, atopic dermatitis, or urticarial). Other exemplary disorders are provided in Table 1.

[0007] The method includes administering to a mammalian subject, e.g., a human or veterinary subject, a therapeutically effective amount of at least one Neuromedin B (Nmb) protein, or at least one nucleic acid molecule encoding at least one Nmb protein, thereby treating the disorder. In some examples, the at least one Nmb protein has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NO:1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37. In some examples, instead of using Nmb protein, a Neuromedin C (Nmc) protein is used, or a nucleic acid molecule encoding an Nmc protein, such as a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NO: 38. In some examples, at least one nucleic acid molecule encodes an Nmb protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37. In other examples, the nucleic acid molecule encodes an Nmc protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NO:38.In some examples, at least two different Nmb proteins are used, for example, (1) at least one Nmb protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NO:3, 4, 5, 6, 11, 12, 13, 14, 20, 22, 26, 27, 28, 29, 30, 31, 32, 35, 36, or 37, which is not SEQ ID NO:1, and (2) at least one Nmb protein that contains at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NO:26, 27, 29, 35, or 36, which is not SEQ ID NO:1. In some examples, at least two different Nmb proteins are used, for example, (1) SEQ ID NO: 1, and (2) at least one Nmb protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NO: 3, 4, 5, 6, 11, 12, 13, 14, 20, 22, 26, 27, 28, 29, 30, 31, 32, 35, 36, or 37 that is not SEQ ID NO: 1. In further examples, at least one Nmb protein and at least one Nmc protein are used. In some examples, at least one nucleic acid molecule has at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 2 and can be part of a plasmid or a viral vector, for example, a lentiviral vector or an adeno-associated viral vector. In examples where a nucleic acid molecule is administered, such a nucleic acid molecule may be operably linked to a promoter, e.g., a constitutive promoter. In some examples, the administering step includes injection (e.g., intravenous, intramuscular, intraperitoneal, or intradermal), oral administration, inhalation administration, or topical administration.

[0008] In some embodiments, the method upregulates the expression of one or more of a first set of genes comprising Sprr2a2, Serpinb2, Il1b, Xist, and Tsix. In other embodiments, the method downregulates the expression of one or more of a second set of genes comprising Hgs2, Nkg7, Klra7, P2rx7, Ly6c2, and Mcpt2. In further embodiments, the method upregulates the expression of one or more of a first set of genes comprising Sprr2a2, Serpinb2, Il1b, Xist, and Tsix, and downregulates the expression of one or more of a second set of genes comprising Hgs2, Nkg7, Klra7, P2rx7, Ly6c2, and Mcpt2. In other embodiments, the method reduces the level of cellular infiltration in the lungs of a subject, for example, a subject with an inflammatory disorder or airway disorder.

[0009] At least one Nmb or Nmc protein or at least one nucleic acid molecule encoding at least one Nmb or Nmc protein can be present in a pharmaceutical composition, for example, one that includes a pharma- ceutically acceptable carrier, for example, water or saline.Such a composition can include other therapeutic molecules.In some examples, at least two separate administrations of a therapeutically effective amount of at least one Nmb or Nmc protein or at least one nucleic acid molecule encoding at least one Nmb or Nmc protein are provided to a subject, for example, at least two separate administrations that are at least one week, at least two weeks, at least three weeks, at least four weeks, at least one month, at least two months, at least three months, at least six months, at least nine months, or at least one year apart. In some examples, the administering step occurs within 5 minutes, 10 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 12 hours, 24 hours, 48 ​​hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, or 3 months from the onset of the disorder. The method may include administering to the subject a therapeutically effective amount of another therapeutic agent (see, for example, Table 1). In some examples, the additional therapeutic agent is prostaglandin E2 (PGE2).

[0010] Also provided is a composition comprising an isolated Nmb protein that comprises at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:1 and a liposome, wherein the Nmb protein is encapsulated in the liposome. Also provided is a composition comprising an isolated Nmb protein that comprises at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:1 and a pharma- ceutically acceptable carrier. Also provided are compositions comprising an isolated protein comprising at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37, which is not SEQ ID NO:1 or 38, and a pharma- ceutically acceptable carrier. In some examples, such compositions comprise liposomes, and the non-native Nmb protein is encapsulated in the liposome. Also provided are compositions comprising: (1) at least a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NO:3, 4, 5, 6, 11, 12, 13, 14, 20, 22, 26, 27, 28, 29, 30, 31, 32, 35, 36, or 37, which is not SEQ ID NO:1; and / or (2) at least one protein that comprises at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NO:26, 27, 29, 35, or 36, which is not SEQ ID NO:1 or 38.

[0011] The disclosed method and composition may also utilize fusion or chimeric protein (or the nucleic acid molecule encoding it), where Nmb protein or Nmc protein or non-natural Nmb protein is a fusion protein comprising Nmb protein or Nmc protein or non-natural Nmb protein and cell-penetrating peptide.Nmb protein or Nmc protein or non-natural Nmb protein can be N-terminal or C-terminal to cell-penetrating peptide.In addition, Nmb protein or Nmc protein or non-natural Nmb protein and cell-penetrating peptide can be separated by a linker.

[0012] The above and other objects and features of the present disclosure will become more apparent from the following detailed description, which proceeds with reference to the accompanying drawings. [Brief description of the drawings]

[0013] [Figure 1-1] Figures 1A-1F show that basophils regulate helminth-induced inflammation. (A) Intestinal worm counts were quantified in control or basophil-depleted mice (basophil-depleted) at day 7 after Nb infection. (B) Type 2 cytokine expression in the lungs of control and basophil-depleted mice was determined by real-time PCR at day 7 after Nb infection. (C) Basophils present in the lungs were determined by in vivo staining with CD200R. (D) The percentage of basophils present in the lungs was quantified after Nb infection. (E) Lung pathology was assessed by hematoxylin and eosin staining at day 7 after Nb infection. (F) Oxygen levels were determined by pulse oximetry for control and basophil-depleted mice after Nb infection. P values ​​were determined by two-tailed Student's t-test. [Figure 1-2]Figures 1A-1F show that basophils regulate helminth-induced inflammation. (A) Intestinal worm counts were quantified in control or basophil-depleted mice (basophil-depleted) at day 7 after Nb infection. (B) Type 2 cytokine expression in the lungs of control and basophil-depleted mice was determined by real-time PCR at day 7 after Nb infection. (C) Basophils present in the lungs were determined by in vivo staining with CD200R. (D) The percentage of basophils present in the lungs was quantified after Nb infection. (E) Lung pathology was assessed by hematoxylin and eosin staining at day 7 after Nb infection. (F) Oxygen levels were determined by pulse oximetry for control and basophil-depleted mice after Nb infection. P values ​​were determined by two-tailed Student's t-test. [Diagram 2] Figures 2A-2B show lung pathology assessed at day 7 post-Nb infection by (A) periodic acid-Schiff staining and (B) hematoxylin and eosin staining. (A) Individual images were digitally aligned together to obtain a larger overview. [Figure 3-1] Figures 3A-3H show that basophils negatively regulate ILC2 responses. (A) Neutrophils, (B) Eosinophils, and (C) ILC2s in bronchoalveolar lavage (BAL) were quantified at day 7 post-Nb infection in control or basophil-depleted mice. Intracellular cytokine staining for (D) IL-5 and (E) IL-13 was performed on lineage-negative, CD90+, CD127+ ILC2s in BAL at day 7 post-Nb infection to quantitate cytokine-positive cells. Basophils were adoptively transferred (intratracheally) into basophil-depleted mice after Nb infection, and the numbers of (F) ILC2s, (G) IL-5+ ILC2s and IL-13+ ILC2s, and (H) eosinophils in BAL were quantified. P values ​​were determined by two-tailed Student's t-test. [Figure 3-2]Figures 3A-3H show that basophils negatively regulate ILC2 responses. (A) Neutrophils, (B) Eosinophils, and (C) ILC2s in bronchoalveolar lavage (BAL) were quantified at day 7 post-Nb infection in control or basophil-depleted mice. Intracellular cytokine staining for (D) IL-5 and (E) IL-13 was performed on lineage-negative, CD90+, CD127+ ILC2s in BAL at day 7 post-Nb infection to quantitate cytokine-positive cells. Basophils were adoptively transferred (intratracheally) into basophil-depleted mice after Nb infection, and the numbers of (F) ILC2s, (G) IL-5+ ILC2s and IL-13+ ILC2s, and (H) eosinophils in BAL were quantified. P values ​​were determined by two-tailed Student's t-test. [Figure 3-3] Figures 3A-3H show that basophils negatively regulate ILC2 responses. (A) Neutrophils, (B) Eosinophils, and (C) ILC2s in bronchoalveolar lavage (BAL) were quantified at day 7 post-Nb infection in control or basophil-depleted mice. Intracellular cytokine staining for (D) IL-5 and (E) IL-13 was performed on lineage-negative, CD90+, CD127+ ILC2s in BAL at day 7 post-Nb infection to quantitate cytokine-positive cells. Basophils were adoptively transferred (intratracheally) into basophil-depleted mice after Nb infection, and the numbers of (F) ILC2s, (G) IL-5+ ILC2s and IL-13+ ILC2s, and (H) eosinophils in BAL were quantified. P values ​​were determined by two-tailed Student's t-test. [Figure 4-1] Figures 4A-4G show that (A) neutrophils, (B) eosinophils, and (C) ILC2s in the lungs were quantified in control or basophil-depleted mice at day 7 post-Nb infection. (D) Intracellular cytokine staining for IL-5 and IL-13 was performed on lineage-negative, CD90+, CD127+ ILC2s in the lungs at day 7 post-Nb infection to quantitate cytokine-positive cells. Basophils were adoptively transferred (intratracheally) into basophil-depleted mice after Nb infection and the numbers of (E) ILC2s, (F) IL-5+ ILC2s and IL-13+ ILC2s, and (G) eosinophils in the lungs were quantified. P values ​​were determined by two-tailed Student's t-test. [Figure 4-2]Figures 4A-4G show that (A) neutrophils, (B) eosinophils, and (C) ILC2s in the lungs were quantified in control or basophil-depleted mice at day 7 post-Nb infection. (D) Intracellular cytokine staining for IL-5 and IL-13 was performed on lineage-negative, CD90+, CD127+ ILC2s in the lungs at day 7 post-Nb infection to quantitate cytokine-positive cells. Basophils were adoptively transferred (intratracheally) into basophil-depleted mice after Nb infection and the numbers of (E) ILC2s, (F) IL-5+ ILC2s and IL-13+ ILC2s, and (G) eosinophils in the lungs were quantified. P values ​​were determined by two-tailed Student's t-test. [Figure 5-1] Figures 5A-5H show that basophils promote expression of the Nmb receptor (Nmbr) in ILC2s. Rag2-deficient mice were treated with the basophil-depleting antibody Ba103, and (A) the numbers of IL-5+ILC2s, IL-13+ILC2s, and (B) eosinophils were quantified in the BAL at day 7 post-Nb infection. Ribonucleic acid (RNA) sequencing analysis of preparatively purified ILC2s from lungs of control and basophil-depleted mice was performed at day 7 post-Nb. (C) Venn diagram showing genes differentially expressed by 2.0-fold or more between control or basophil-depleted ILC2s. DAVID pathway analysis of 899 genes enriched in control ILC2s was performed. (D) Genes enriched in control ILC2s defining the rhodopsin-like pathway. Expression of (E) Mcpt8, (F) Nmb, and (G) Nmbr in lungs of control or basophil-depleted mice was determined by real-time PCR at day 7 post-Nb. (H) Expression of Nmbr by control or basophil-depleted ILC2s purified from lungs at day 7 post-Nb. P values ​​were determined by two-tailed Student's t test. [Figure 5-2]Figures 5A-5H show that basophils promote expression of the Nmb receptor (Nmbr) in ILC2s. Rag2-deficient mice were treated with the basophil-depleting antibody Ba103, and (A) the numbers of IL-5+ILC2s, IL-13+ILC2s, and (B) eosinophils were quantified in the BAL at day 7 post-Nb infection. Ribonucleic acid (RNA) sequencing analysis of preparatively purified ILC2s from lungs of control and basophil-depleted mice was performed at day 7 post-Nb. (C) Venn diagram showing genes differentially expressed by 2.0-fold or more between control or basophil-depleted ILC2s. DAVID pathway analysis of 899 genes enriched in control ILC2s was performed. (D) Genes enriched in control ILC2s defining the rhodopsin-like pathway. Expression of (E) Mcpt8, (F) Nmb, and (G) Nmbr in lungs of control or basophil-depleted mice was determined by real-time PCR at day 7 post-Nb. (H) Expression of Nmbr by control or basophil-depleted ILC2s purified from lungs at day 7 post-Nb. P values ​​were determined by two-tailed Student's t test. [Figure 6-1] Figures 6A-6E show that Nmb suppresses type 2 cytokine responses. (A) Nb-infected mice were treated with PBS or Nmb (intratracheally) and ILC2s were quantified in the BAL. (B) Expression of IL-5 and IL-13 in the lungs of mice treated with PBS or Nmb was determined by real-type PCR at 7 days post-Nb. (C) Eosinophils were quantified in the BAL at 7 days post-Nb infection and (D) worm numbers were determined. ILC2s were purified from lungs of control or basophil-depleted mice at 7 days post-Nb and cultured with IL-2 and IL-7 (overnight) in the presence or absence of Nmb and (E) levels of IL-5 and IL-13 in culture supernatants were determined by ELISA. P values ​​were determined by two-tailed Student's t-test. [Figure 6-2]Figures 6A-6E show that Nmb suppresses type 2 cytokine responses. (A) Nb-infected mice were treated with PBS or Nmb (intratracheally) and ILC2s were quantified in the BAL. (B) Expression of IL-5 and IL-13 in the lungs of mice treated with PBS or Nmb was determined by real-type PCR at 7 days post-Nb. (C) Eosinophils were quantified in the BAL at 7 days post-Nb infection and (D) worm numbers were determined. ILC2s were purified from lungs of control or basophil-depleted mice at 7 days post-Nb and cultured with IL-2 and IL-7 (overnight) in the presence or absence of Nmb and (E) levels of IL-5 and IL-13 in culture supernatants were determined by ELISA. P values ​​were determined by two-tailed Student's t-test. [Figure 7-1] Figures 7A-7I show that Nmb treatment is sufficient to suppress allergic airway inflammation. Papain-challenged mice were treated with PBS or Nmb (intratracheally) and (A) lung ILC2s, (B) IL-5+ and IL-13+ ILC2s, and (C) eosinophils were assessed. (B) Mesenteric lymph nodes (MLNs) were isolated 7 days after Nb, single cell suspensions were treated with anti-CD3 and anti-CD28 in the presence or absence of Nmb for 48 hours, and (E) IL-5 and (F) IL-13 were quantified in cell-free supernatants by ELISA. (F-I) Modified versions of Nmb (see Table 2) were tested for their ability to alter IL-5 and IL-13 production from anti-CD3 and anti-CD28 MLN cells isolated 7 days after Nb. P values ​​were determined by two-tailed Student's t-test. Blue asterisks represent a comparison between media-treated controls and native Nmb. Red asterisks represent a comparison between media-treated controls and modified versions of Nmb shown in Table 2. (*, p<0.05), (**, p<0.01), (***, p<0.001), or (F-I). [Figure 7-2]Figures 7A-7I show that Nmb treatment is sufficient to suppress allergic airway inflammation. Papain-challenged mice were treated with PBS or Nmb (intratracheally) and (A) lung ILC2s, (B) IL-5+ and IL-13+ ILC2s, and (C) eosinophils were assessed. (B) Mesenteric lymph nodes (MLNs) were isolated 7 days after Nb, single cell suspensions were treated with anti-CD3 and anti-CD28 in the presence or absence of Nmb for 48 hours, and (E) IL-5 and (F) IL-13 were quantified in cell-free supernatants by ELISA. (F-I) Modified versions of Nmb (see Table 2) were tested for their ability to alter IL-5 and IL-13 production from anti-CD3 and anti-CD28 MLN cells isolated 7 days after Nb. P values ​​were determined by two-tailed Student's t-test. Blue asterisks represent a comparison between media-treated controls and native Nmb. Red asterisks represent a comparison between media-treated controls and modified versions of Nmb shown in Table 2. (*, p<0.05), (**, p<0.01), (***, p<0.001), or (F-I). [Figure 8] In Figures 8A-8B, mesenteric lymph nodes (MLNs) were isolated 7 days after Nb, single cell suspensions were treated with anti-CD3 and anti-CD28 in the presence or absence of native Nmb or modified versions of this peptide for 48 hours, and (A) IL-5 and (B) IL-13 were quantified in cell-free supernatants by ELISA. P values ​​were determined by two-tailed Student's t-test. Blue asterisks represent comparisons between media-treated controls and native Nmb. Red asterisks represent comparisons between media-treated controls and modified versions of Nmb shown in Table 2. (*, p<0.05), (**, p<0.01), (***, p<0.001). [Figure 9]Figure 9 shows that basophils regulate NMBR expression. ILC2s were purified from the lungs of Nb-infected mice (day 7) and stimulated with survival cytokines (IL-7 and IL-2) and also with activated basophils, IL-4, or IL-33 overnight. NMBR expression was monitored by flow cytometry analysis after culture. Data are presented as geographic mean fluorescence intensity (GMFI). Statistical comparisons were performed using Student's t-test. [Figure 10] Figures 10A-10B show that NMB inhibits type 2 cytokine production from IL-33-activated ILC2s. ILC2s were purified from the lungs of Nb-infected mice (day 7) and cultured with survival cytokines (IL-2, IL-7) in the presence or absence of Nmb and / or IL-33. After overnight culture, supernatants were tested for the presence of IL-5 (Figure 10A) and IL-13 (Figure 10B) by standard ELISA. Statistical comparisons were performed using Student's t-test. [Figure 11] Figures 11A-11B show that NMBR-mediated signaling in hematopoietic cells is required to regulate type 2 cytokine production. Intracellular staining for IL-5 (Figure 11A) and IL-13 (Figure 11B) was performed on ILC2s isolated from the BAL of naive or Nb-infected Vav1-Cre, NMBR-flox, or Vav1-Cre-NMBR-flox mice (day 7). Statistical comparisons were performed using Student's t-test. [Figure 12] Figure 12 shows that NMBR-mediated signaling in hematopoietic cells is required to regulate cell infiltration in the lung. Lung pathology (H and E staining) was evaluated for naive or Nb-infected Vav1-Cre, NMBR-flox, or Vav1-Cre-NMBR-flox mice (day 7). [Figure 13]Figure 13 shows that NMBR is expressed by several immune cell populations. Naive mice (filled symbols) and Nb-infected mice (day 7) (open symbols) were evaluated for expression of NMBR in various immune cell populations: lymphocytes (lymph), alveolar macrophages (Alv Mac), non-alveolar macrophages (NAM), eosinophils (Eos), and neutrophils (Neut). [Figure 14] Figure 14 shows that prostaglandin E2 upregulates NMBR expression in lymphocytes. Lung ILC2 were purified from mouse lungs on day 7 of Nb infection and cultured with a combination of survival cytokines (IL-2 and IL-7) and / or activation cytokines (IL-25 and IL-33). In addition, cultures were treated with NMB or prostaglandin E2 (PGE2), and NMBR expression was measured by flow cytometry analysis on day 4 after culture. Statistical analysis was performed using Student's t-test. Negative NMBR staining as determined by isotype control antibody is also shown (isotype). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0014] Sequence Listing The nucleic acid and amino acid sequences listed in the accompanying sequence listing are shown using standard abbreviations for nucleotide bases and three letter codes for amino acids, as defined in 37 CFR 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood to be included by any reference to the presented strand.

[0015] SEQ ID NO:1 is an exemplary native human Nmb protein sequence.

[0016] SEQ ID NO:2 is an exemplary coding sequence for native human Nmb.

[0017] SEQ ID NOs:3-37 are exemplary non-naturally occurring Nmb protein sequences.

[0018] SEQ ID NO:38 is an exemplary native human Neuromedin C protein sequence.

[0019] SEQ ID NOs:39-58 are exemplary cell-penetrating peptides.

[0020] Detailed Description Unless otherwise indicated, technical terms are used according to conventional usage. Definitions of common terms in molecular biology can be found in Benjamin Lewin, Genes VII, published by Oxford University Press. University Press, 1999, Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994, and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995, as well as other similar references.

[0021] As used herein, the singular forms "a," "an," and " "The" refers to both the singular and the plural, unless the context clearly indicates otherwise. As used herein, the term "comprise" means "include". Thus, "comprising an Nmb peptide" means "including an Nmb peptide" without excluding other elements. It should be further understood that any and all base sizes for nucleic acids are approximate and are provided for illustrative purposes unless otherwise indicated. Although many methods and materials similar or equivalent to those described herein can be used, particularly suitable methods and materials are described below. In the event of a conflict, the present specification, including explanations of terms, will take precedence. In addition, the materials, methods, and examples are illustrative only and are not intended to be limiting. All references, including patent applications and patents, and sequences associated with the GenBank® accession numbers listed (as of October 4, 2018), are incorporated herein by reference in their entirety.

[0022] In order to facilitate review of the various embodiments of the disclosure, the following explanations of specific terms are provided.

[0023] I. Terminology Administration: Providing or giving an agent, such as an Nmb nucleic acid molecule or protein, to a subject by any effective route. Exemplary routes of administration include, but are not limited to, injection (e.g., intravenous, intramuscular, intradermal, intraperitoneal, or injection into the CNS, e.g., into the spine or brain), oral, intranasal, transdermal, vaginal, rectal, or inhalation.

[0024] Aerosol: Any gas suspension of fine solid or liquid particles. Thus, the term "aerosolized" refers to the form of microscopic solid or liquid particles dispersed or suspended in air or gas. In one example, the microscopic solid has a mass median aerodynamic diameter of 1 μm to 20 μm. The term "nebulize" refers to the act of converting or atomizing (a liquid) into a fine spray. Thus, the term "dry powder aerosol" refers to any microscopic solid suspended in a gas, typically air. The disclosed compositions (e.g., those containing Nmb nucleic acid molecules or proteins) can also be formulated as sustained release preparations. Aerosol delivery refers to the administration (e.g., to the respiratory tract) of an agent (e.g., Nmb nucleic acid molecules or proteins) formulated as an aerosol.

[0025] Airway disorder or disease: In general, airway disorders / diseases include any disorder / disease involving the airways of the lungs. In specific, non-limiting examples, the lung disorder / disease is asthma or chronic obstructive pulmonary disease (COPD).

[0026] Allergen: Any substance that causes an allergic response or reaction. Common allergens include dust, pollen, plants, pets (e.g., cat or dog dander), medicines, certain foods (e.g., eggs, milk, peanuts, shellfish), insect venom, viruses, or bacteria. (Adverse) reactions can occur after exposure of a subject via ingestion, inhalation, injection, or skin contact. Any allergen can be treated using the disclosed methods.

[0027] Allergic reaction: a form of hypersensitivity (e.g., to normally harmless entities) characterized by excessive activation of mast cells and basophils by IgE resulting in an extreme inflammatory response. Common allergic reactions include eczema, hives, hay fever, and asthma. These include breath, food allergies, and reactions to the venom of stinging insects, such as wasps and bees.

[0028] Amidation or amide derivative: A post-translational modification to form an amide, for example, an Nmb peptide (e.g., any of SEQ ID NOs: 1 and 3-37) or an Nmc peptide (e.g., SEQ ID NO: 38). Thus, in some examples, the Nmb or Nmc peptide provided herein is amidated and can be used in the disclosed methods. In addition, in amidation, the C-terminal amino acid (peptide-COOH) is modified to form an amide (peptide-CONH2). An amide can be formed by post-translational C-terminal amidation. The amino acid to be modified can be followed by glycine, which results in an amide group. In some examples, the amide increases the biological activity of the Nmb or Nmc peptide.

[0029] Anaphylaxis: A clinical syndrome representing the most severe systemic allergic reaction. It results from immunologically induced release of mast cell and / or basophil mediators, including type 2 cytokines, following exposure to a specific antigen in previously sensitized individuals. Although any substance has the potential to trigger anaphylaxis, the most common causes of IgE-mediated anaphylaxis are insect bites, medicines, latex, peanuts and tree nuts (e.g., walnuts, hazelnuts, almonds, cashews, pecans, and pistachios), shellfish and fish, milk, eggs, and wheat. Type 2 cytokines activate activated ILC2 and T H When produced by 2 cells, IgE is produced, thereby stimulating basophils and mast cells to respond to subsequent exposure to allergens. Exercise-induced anaphylaxis and idiopathic anaphylaxis also occur, which are mediated by different mechanisms. In some examples, the disclosed methods (e.g., administering Nmb peptides) are used to treat or prevent anaphylaxis.

[0030] Asthma: Asthma is a general term that describes several syndromes or phenotypes of the respiratory system. In these disorders, often in response to one or more "triggers," such as exposure to environmental stimuli (or allergens), chemicals, cold air, exercise, or viruses, or from completely unknown causes, the airways constrict, become inflamed, and become covered with excessive amounts of mucus. This airway narrowing causes symptoms such as wheezing, shortness of breath, chest tightness, and coughing. The disorder is a chronic or recurrent inflammatory condition in which the airways develop increased responsiveness to various stimuli, characterized by bronchial hyperresponsiveness, inflammation, increased mucus production, and intermittent airway obstruction. In more severely affected patients, the obstruction can be a fixed, as opposed to intermittent, condition. In a typical allergic asthmatic response, IgE antibodies formed by a Th2 inflammatory process bind primarily to mast cells present in the pulmonary interstitium, which is in close association with the bronchioles and small bronchi. Cellular triggering leads to the release of several substances, including but not limited to cytokines, chemokines, and arachidonic acid-derived mediators, resulting in bronchoconstriction, airway hyperresponsiveness, excessive mucus secretion, and airway inflammation. However, there is good evidence to suggest that not all asthma is allergic, and that patients with more severe forms of asthma have Th1 inflammation as well as Th2 inflammation.

[0031] Mild asthma, defined by international guidelines as intermittent symptoms, has relatively normal lung function and few exacerbations. The disclosed Nmb nucleic acid molecules and peptides can be used to treat mild asthma, for example, in combination with low doses of inhaled corticosteroids (CS) or bronchodilators. Moderate asthma is defined as more persistent and severe symptoms, occasional exacerbations, and / or worsening lung function. The disclosed Nmb nucleic acid molecules and peptides can be used to treat moderate asthma, for example, in combination with higher doses of inhaled CS and long-acting beta agonists (LABA) or leukotriene modifiers. Severe asthma is defined in the ATS-ERS severe asthma guidelines as asthma that requires treatment with high doses of inhaled CS in combination with a second control substance (LABA or leukotriene modifier) ​​or the use of systemic CS to maintain disease control (less exacerbations, fewer symptoms, and better lung function), or asthma that fails to achieve control despite these treatments. The disclosed Nmb nucleic acid molecules and peptides can be used, for example, in combination with such agents to treat severe asthma.

[0032] Bronchodilator: an antispasmodic or other drug that dilates the bronchi or bronchioles. Bronchodilators relax the smooth muscles of the airways, widening the airways. Bronchodilator medications typically do not counter inflammation. Examples include short-acting (e.g., salbutamol) and long-acting (e.g., formoterol) beta-2 adrenergic agonists, and anticholinergics (e.g., tiotropium and ipratropium bromide).

[0033] Cell permeability: The ability of a molecule to cross a cell membrane (e.g., a mammalian cell). In some examples, cell permeability includes permeability via various means of transport, e.g., passive diffusion and transporter-mediated permeation. Certain agents can enhance cell permeability (i.e., cell permeability enhancers), including peptides, e.g., cell permeability peptides, e.g., those contained in tags, protein-based agents, e.g., pore-forming or channel-forming proteins, virus-based agents, lipid- or polymer-based agents, or inorganic agents. In one example, an Nmb peptide (e.g., any one of SEQ ID NOs: 1 and 3-37) can be coupled to a tag, e.g., a peptide tag (also referred to as a cell permeability peptide (CPP)) that increases its cell permeability (e.g., transactivator of transcription, TAT, e.g., TAT 48-57 ;TAT 47-57 ; or TAT 49-57 ; penetratin; Pep-1; substance P, SP; polyarginine, e.g., R5-R12; pVEC; transportan; MAP; diatos peptide vector 1047, DPV1047, VECTOCELL®; MPG; ADP ribosylation factor, ARF, e.g., ARF 1-22 ;BPrPr (for example, BPrPr 1-28 );p28;VT5;Bac 7, for example, Bac 1-24; C105Y; PFVYLI (SEQ ID NO: 58); Pep-7, SynB1 [RGGRLSYSRRRFSTSTGR, SEQ ID NO: 39], SynB3 [RRLSYSRRRF, SEQ ID NO: 40], PTD-4 [PIRRRKKLRRLK, SEQ ID NO: 41], PTD-5 [RRQRRTSKLMKR, SEQ ID NO: 42], FHV Coat-(35-49) [RRRRNRTRRNRRRVR, SEQ ID NO: 43], BMV Gag-(7-25) [KMTRAQRRAAARRNRWTAR, SEQ ID NO: 44], HTLV-II Rex-(4-16) [TRRQRTRRARRNR, SEQ ID NO: 45], D-Tat [GRKKRRQRRRPPQ, SEQ ID NO: 46], R9-Tat GRRRRRRRRRPPQ [SEQ ID NO: 47] and penetratin [RQIKWFQNRRMKWKK, SEQ ID NO: 48]), amphiphilic peptides (e.g., MAP [KLALKLALKLALALKLA; SEQ ID NO: 49], SBP [MGLGLHLLVLAAALQGAWSQPKKKRKV; SEQ ID NO: 50], FBP [GALFLGWLGAAGSTMGAWSQPKKKRKV; SEQ ID NO: 51], MPG ac-GALFLGFLGAAGSTMGAWSQPKKKRKV-cya; SEQ ID NO: 52], MPG(ΔNLS) [ac-GALFLGFLGAAGSTMGAWSQPKSKRKV-cya; SEQ ID NO: 53], Pep-2 [ac-KETWFETWFTEWSQPKKKRKV-cya; SEQ ID NO: 54], and transportan [GWTLNSAGYLLGKINLKALAALAKKIL, SEQ ID NO: 55]), periodic sequences (e.g., pVec, polyarginine RxN (4 < N < 17) chimera, polylysine KxN (4 < N < 17) chimera, (RAca)6R, (RAbu)6R, (RG)6R, (RM)6R, (RT)6R, (RS)6R, R10, (RA)6R, R7, and pep-1 [ac-KETWWETWWTEWSQPKKKRKV-cya, SEQ ID NO: 56]), and Cr10 (cyclic polyarginine CPP), or nucleic acids encoding such peptide tags.

[0034] Chimeric or fusion protein: A protein comprising a first peptide (e.g., Nmb) and a second peptide (e.g., a cell-penetrating peptide), where the first and second proteins are different. Chimeric polypeptides also encompass polypeptides comprising two or more non-contiguous portions derived from the same polypeptide. In some examples, chimeric proteins include Nmb / cell-penetrating peptide fusion proteins, where the cell-penetrating peptide is at the N-terminus or C-terminus of Nmb. Two or more different peptides can be joined directly or indirectly, for example, using a linker (e.g., 1-30 amino acids).

[0035] Chronic obstructive pulmonary disease: a type of obstructive lung disease characterized by long-term breathing problems and poor airflow. Airflow limitation is usually progressive and is associated with an abnormal inflammatory response of the lungs to non-toxic particles or gases. Primary symptoms include shortness of breath and coughing with phlegm production. Smoking is the most common cause of COPD. The disclosed Nmb nucleic acid molecules and peptides can be used to treat COPD, for example, in combination with bronchodilators, corticosteroids, antibiotics, supplemental oxygen, or a combination thereof.

[0036] cDNA (complementary DNA): A piece of DNA that lacks internal non-coding segments (introns) and regulatory sequences that determine transcription. cDNA can be synthesized from messenger RNA by reverse transcription.

[0037] Contacting: Bringing into direct physical association, including in solid or liquid form. Contacting can occur in vitro or ex vivo, for example, by adding a reagent to a sample (e.g., one containing ILC2 cells), or in vivo, by administration to a subject.

[0038] Control: A reference standard. In some embodiments, the control is a healthy subject. In other embodiments, the control is a subject with a disorder listed in Table 1. In still other embodiments, the control is a historical control or a standard reference value or range of values ​​(e.g., a group of previously tested control subjects with a known prognosis or outcome or subjects exhibiting baseline or normal values). The difference between the test subject and the control can be an increase or a decrease. The difference can be a qualitative or quantitative difference, e.g., a statistically significant difference. In some examples, the difference is an increase or decrease of at least about 5%, e.g., at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, at least about 300%, at least about 350%, at least about 400%, at least about 500%, or greater than 500% compared to the control.

[0039] Degenerate variant: A nucleotide sequence encoding a peptide, such as Nmb, that contains sequences that are degenerate as a result of the genetic code. There are 20 naturally occurring amino acids, most of which are specified by more than one codon. Thus, all degenerate nucleotide sequences are included in the present disclosure, as long as the amino acid sequence of the peptide encoded by the nucleotide sequence is unchanged.

[0040] Effective amount or therapeutically effective amount: For example, an amount of an agent (e.g., an Nmb protein or a nucleic acid molecule encoding Nmb) that is sufficient to achieve a beneficial or desired result in a subject being treated. For example, this may be the amount of Nmb protein or a nucleic acid molecule encoding Nmb required to reduce or suppress inflammation (e.g., type 2 cytokine-mediated inflammation), asthma attacks, allergic reactions, improve symptoms and lung function, or a combination thereof. When administered to a subject, a dosage will generally be used that will achieve a target tissue concentration (e.g., in the airways) that has been shown to achieve the desired in vivo effect.

[0041] The therapeutically effective amount may vary depending on one or more of the subject and disease state being treated, the subject's weight and age, the severity of the disease state, the manner of administration, etc., which can be determined by one of skill in the art. Beneficial therapeutic effects can include alleviating a disease, symptom, disorder, or condition; reducing or preventing the onset of a disease, symptom, disorder, or condition; and generally combating a disease, symptom, disorder, or condition.In one embodiment, an "effective amount" refers to: (1) reducing inflammation, e.g., in the lungs or at the site of an allergic response, e.g., a reduction of at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, or at least 90% compared to administration of the Nmb protein or nucleic acid molecule; (2) reducing IL-5, e.g., in ILC2s and / or T cells, e.g., a reduction of at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, or at least 90% compared to administration of the Nmb protein or nucleic acid molecule; (3) reducing IL-13, e.g., in ILC2s and / or T cells, e.g., a reduction of at least 5%, at least 10%, at least 15%, at least (4) to reduce an ILC2 and / or T cell response, e.g., the number of proliferative and / or activated ILC2 and / or T cells present, e.g., a decrease of at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, or at least 90%, compared to without administration of the Nmb protein or nucleic acid molecule; and / or (5) to reduce eosinophilia, e.g., in the lungs or peripheral blood, e.g., a decrease of at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, or at least 90%, compared to without administration of the Nmb protein or nucleic acid molecule.

[0042] Eosinophilia: A condition in which the eosinophil count in peripheral blood is greater than approximately 450-500 cells / μL (e.g., as determined by complete blood count (CBC)) or an increase in the number of eosinophils in non-blood tissues observed on histopathology. Eosinophils normally comprise less than 5-7% of circulating leukocytes. Exemplary causes include allergic reactions and parasitic infections.

[0043] Expectorant: A drug or chemical that induces the expulsion of mucus, phlegm, and other fluids from the lungs and airways, for example, by coughing. One example of such an agent is guaifenesin.

[0044] Increase or decrease: a statistically significant positive or negative change in number from a control value (value before treatment with Nmb protein or nucleic acid molecule, or value in a subject with a similar disorder not treated with Nmb protein or nucleic acid molecule). An increase is a positive change, for example, an increase of at least 50%, at least 100%, at least 200%, at least 300%, at least 400%, or at least 500%, compared to a control value. A decrease is a negative change, for example, a decrease of at least 20%, at least 25%, at least 50%, at least 75%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or at least 100%, compared to a control value. In some cases, the decrease is less than 100%, for example, a decrease of not more than 90%, not more than 95%, or not more than 99%.

[0045] Type 2 innate lymphoid cells (ILC2): A type of innate lymphoid cell derived from a common lymphoid progenitor. These cells lack antigen-specific B or T cell receptors due to the lack of recombination activation genes. ILC2s produce type 2 cytokines (e.g., IL-4, IL-5, IL-9, IL-13).

[0046] Interleukin-5 (IL-5): (e.g., OMIM 147850): An interleukin produced by type 2 helper cells (Th2 cells), ILC2 cells, and mast cells. IL-5 stimulates B cell growth and increases immunoglobulin secretion, primarily IgA. It also mediates eosinophil activation. IL-5 has been implicated in the etiology of several allergic diseases, including allergic rhinitis and asthma. Exemplary drugs that target IL-5 include mepolizumab, benralizumab, and reslizumab, which can be used in combination with the Nmb proteins or nucleic acid molecules disclosed herein to treat, for example, asthma (e.g., eosinophilic asthma) or eosinophilic granulomatosis with polyangiitis (EGPA).

[0047] IL-5 sequences are publicly available, for example, from the GenBank® sequence database (e.g., accession numbers NP_000870.1 (mature peptide, amino acids 20-134), CAA29607.1, and NP_001006951.1 provide exemplary IL-5 protein sequences, while accession numbers NM_000879.2, X06271.1, and NM_001006950.1 provide exemplary IL-5 nucleic acid sequences). IL-5 variants, for example those having at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity to such accession numbers, are contemplated.

[0048] Interleukin-13 (IL-13) (e.g., OMIM 147683): ​​A cytokine secreted by Th2 cells, CD4 cells, natural killer T cells, mast cells, basophils, eosinophils, and ILC2 cells. IL-13 is a central regulator in IgE synthesis, goblet cell hyperplasia, mucus hypersecretion, airway hyperresponsiveness, fibrosis, and chitinase upregulation. It is a mediator of different diseases, including allergic inflammation and asthma. Exemplary drugs that target IL-13 include tralokinumab and lebrikizumab, which can be used in combination with the Nmb protein or nucleic acid molecule disclosed herein to treat, for example, asthma, atopic dermatitis, or Hodgkin's lymphoma.

[0049] IL-13 sequences are publicly available, for example, from the GenBank® sequence database (e.g., accession numbers NP_002179.2 (mature peptide, amino acids 21-132), NP_032381.1 (mature peptide, amino acids 22-131), and NP_446280.1 (mature peptide, amino acids 21-131) provide exemplary IL-13 protein sequences, while accession numbers NM_002188.2, NM_008355.3, and NM_001003384.1 provide exemplary IL-13 nucleic acid sequences). IL-13 variants, for example those having at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity to such accession numbers, are contemplated.

[0050] Inhalation device: a device for administering vapor or volatile medicine by inhalation. Inhalation devices are often used to administer medicine locally to the airways, for example, to treat asthma. In some examples, the inhalation device is a dry powder inhalation device. In other examples, the inhalation device is a metered dose inhalation device. In some examples, the inhalation device contains an Nmb protein disclosed herein (e.g., any one of SEQ ID NOs: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37), or a nucleic acid molecule encoding same (e.g., SEQ ID NO: 2) (or a vector containing such a nucleic acid molecule).

[0051] Inhibit: To reduce, limit, or block the action or function of a molecule. In some examples, IL-5 and / or IL-13 activity (e.g., protein expression) is reduced or inhibited by an Nmb protein disclosed herein (e.g., any one of SEQ ID NOs: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37), or a nucleic acid molecule encoding same (e.g., SEQ ID NO: 2) (or a vector containing such a nucleic acid molecule). For example, an Nmb protein disclosed herein (e.g., any one of SEQ ID NOs: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37), or a nucleic acid molecule encoding same (e.g., SEQ ID NO: 2) (or a vector containing such a nucleic acid molecule) reduces or inhibits IL-5 and / or IL-13 activity by, e.g., at least 10%, at least 20%, at least 40%, at least 45%, at least 50%, at least 60%, at least 75%, or at least 90% compared to no administration of the Nmb protein or nucleic acid molecule.

[0052] Isolated: An "isolated" biological component (e.g., a protein or nucleic acid, or a cell) is substantially separated from, produced separately from, or purified from other biological components in the cells or tissues of the organism in which the component originated, e.g., other cells, chromosomal and extrachromosomal DNA and RNA, and proteins. "Isolated" nucleic acids and proteins include nucleic acids and proteins purified by standard purification methods. The term also encompasses nucleic acids and proteins (e.g., Nmb proteins and nucleic acid molecules) prepared by recombinant expression in a host cell, as well as chemically synthesized nucleic acids and proteins. An isolated Nmb protein, Nmb nucleic acid, or cell (e.g., an ILC2 cell) is, in some instances, at least 50% pure, e.g., at least 75%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 100% pure.

[0053] Linker or spacer: A molecule that joins together (e.g., covalently joins) two or more moieties (e.g., one of these moieties is an Nmb peptide), but does not have specific biological activity and does not significantly negatively affect the activity or function of these moieties. The linker is preferably biocompatible. The linker can be selected to provide or affect the properties of the joined moieties, such as the folding, conformation, hydrophobicity, and / or spacing of the moieties. In some examples, the linker includes reactive sites at each end, each of which can form a covalent bond with one of the moieties included in the compounds described herein. In some examples, the linker includes a peptide, a straight or branched carbon linker, or a heterocyclic carbon linker.

[0054] Nebulizer: A device that turns a liquid form of a drug into a fine spray (aerosol) that can be inhaled, for example, to deliver medicines (e.g., those containing Nmb protein or nucleic acid molecules) to the deep respiratory tract.

[0055] Neuromedin B (Nmb): (e.g., OMIM 162340): Part of the neuromedin peptide family, which includes neuromedins A, B, C, K, L, N, S, and U. Nmb is a bombesin-related peptide expressed in mammalian central nervous system, lung, gastrointestinal tract, and adipose tissue. Nmb acts by binding to its high affinity cell surface receptor, the neuromedin B receptor (NMBR). Upon binding to its receptor, Nmb has been reported to regulate cell growth, body temperature, blood pressure, and glucose levels. It is shown herein that Nmb can also reduce type 2 cytokine-mediated inflammation, for example, by reducing the expression of IL-5 and IL-13.

[0056] The sequence of the Nmb decapeptide is highly conserved across mammalian species: GNLWATGHFM (SEQ ID NO: 1) and can be encoded by the sequence ggcaacctctgggccaccggtcacttcatg (SEQ ID NO: 2). This decapeptide is sometimes known as neuromedin B, or neuromedin B 23-32.

[0057] Full-length Nmb sequences from which decapeptides can be identified are publicly available, for example, from the GenBank® sequence database (e.g., accession numbers AAA59934.1, AAH28490.1, and A37178 provide exemplary protein sequences, while accession numbers BC007407.2, BC028490.1, and EU375564.1 provide exemplary nucleic acid sequences). Nmb variants, e.g., those having at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 98%, or at least 99% sequence identity to SEQ ID NO:1, e.g., any one of SEQ ID NOs:3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, and 37, can be generated and used to generate therapeutic recombinant nucleic acid molecules and proteins, e.g., for treating inflammatory disorders, e.g., those listed in Table 1, using the methods provided herein.

[0058] Non-natural or engineered: these terms are used interchangeably herein and refer to the involvement of human hands. When referring to a nucleic acid molecule or polypeptide (e.g., Nmb molecule), this term refers to the nucleic acid molecule or polypeptide being at least substantially free of at least one other component with which they are naturally associated and found in nature in nature. In addition, this term can refer to the nucleic acid molecule or polypeptide, e.g., variant Nmb molecule, having a sequence that is not found in nature.

[0059] Operably linked: A first nucleic acid sequence is operably linked to a second nucleic acid sequence when the first nucleic acid sequence is placed into a functional relationship with the second nucleic acid sequence. For example, a promoter is operably linked to a coding sequence if it affects the transcription or expression of the coding sequence (e.g., the Nmb decapeptide coding sequence). Generally, operably linked DNA sequences are contiguous and, where necessary to join two protein coding regions, in the same reading frame.

[0060] Pharmaceutically acceptable carriers: Useful pharma- ceutically acceptable carriers are conventional. Remington's Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, PA, 22nd Edition, 2013, describes compositions and formulations suitable for pharmaceutical delivery of the Nmb proteins disclosed herein.

[0061] Generally, the nature of the carrier will depend on the specific mode of administration used. For example, parenteral formulations usually contain injectable fluids, including pharma- ceutically and physiologically acceptable fluids, such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol, etc., as vehicles. For solid compositions (e.g., in powder, pill, tablet, or capsule forms), conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate. In addition to biologically neutral carriers, pharmaceutical compositions to be administered may contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents, for example, sodium acetate or sorbitan monolaurate.

[0062] Polypeptide, peptide, and protein: These terms are used interchangeably herein to refer to polymers of amino acids of any length, such as amino acids chemically bonded together by amide bonds (CONH). The polymer may be linear or branched, and may contain modified amino acids or may be interrupted by non-amino acids. The term also encompasses amino acid polymers that have been modified, such as disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling moiety. As used herein, the term "amino acid" includes natural and / or unnatural or synthetic amino acids, including glycine and both D or L optical isomers, as well as amino acid analogs and peptidomimetics. In some examples, the peptide is an Nmb peptide, such as an Nmb decapeptide.

[0063] Purified: The term "purified" does not require absolute purity, but is intended in a relative sense. Thus, for example, a purified nucleic acid is one in which the nucleic acid is more enriched than the nucleic acid is in its natural environment within a cell. Similarly, a purified peptide preparation is one in which the protein is more enriched than it is, for example, in a cell. Substantial purification refers to purification from other proteins or cellular components. In one embodiment, the preparation comprises at least 50% (e.g., 70%, 80%, 90%, 95%, 98%, or 99%) of the total protein content in the preparation, wherein any one of the Nmb proteins disclosed herein (e.g., SEQ ID NOs: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, and 37) comprises at least 50% (e.g., 70%, 80%, 90%, 95%, 98%, or 99%) of the total protein content in the preparation. The Nmb proteins disclosed herein (e.g., any one of SEQ ID NOs: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, and 37) can be purified (and / or synthesized) by any means (e.g., as described in Guide to Protein Purification, ed. Deutscher, Meth. Enzymol. 185, Academic Press, San Diego, 2 nd Edition, 2009 and Scopes, Protein Purification: Principles and Practice, Springer Verlag, New York, 3 rd (See, for example, IEEE International Conference on Commerce and Industry, Vol. 13, No. 1, 199

[0064] Sequence identity / similarity: The similarity between amino acid (or nucleotide) sequences is expressed as the similarity between the sequences, otherwise referred to as sequence identity. Sequence identity is often measured in terms of the percentage of identity (or similarity or homology); the higher the percentage, the more similar the two sequences are.

[0065] Methods and algorithms for aligning sequences for comparison are described in Smith and Waterman, Adv. Appl. Math. 2:482, 1981; Needleman and Wunsch, J. Mol. Biol. 48:443, 1970; Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85:2444, 1988; Higgins and Sharp, Gene 73:237, 1988; Higgins and Sharp, CABIOS 5:151, 1989, Corpet et al., Nucleic Acids Research 16:10881, 1988, and Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85:2444, 1988. Altschul et al., Nature Genet. 6:119, 1994 A detailed discussion of sequence alignment methods and homology calculations is presented.

[0066] NCBI's Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. Mol. Biol. 215:403, 1990) It is available from several sources, including the National Center for Biotechnology Information (NCBI, Bethesda, MD) and on the Internet, for use with the sequence analysis programs blastp, blastn, blastx, tblastn, and tblastx. Instructions on how to use this program to determine sequence identity are available on the Internet at the NCBI website.

[0067] Variants of protein and nucleic acid sequences (including Nmb sequences provided herein) are typically characterized by having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity counted over the full length alignment with amino acid sequences using NCBI Blast 2.0 with gapped blastp set to default parameters. For comparison of amino acid sequences of more than about 30 amino acids, the Blast 2 sequence function is used with the default BLOSUM62 matrix set to default parameters (gap existence cost of 11 and gap cost per residue of 1). When aligning short peptides (fewer than approximately 30 amino acids), the alignment can be performed using the Blast 2 sequence function with the PAM30 matrix set to default parameters (gap open penalty of 9, gap extension penalty of 1). Methods for determining sequence identity over such short windows are available on the Internet at the NCBI website. These sequence identity ranges are provided for guidance only, and it is entirely possible that strongly significant homologs may be available that do not fall within the ranges provided.

[0068] Subject: A mammal, e.g., a human or veterinary subject. Mammals include, but are not limited to, mice, monkeys, humans, farm animals, sport animals, and pet animals. In one embodiment, the subject is a non-human mammalian subject, e.g., a monkey or other non-human primate, mouse, rat, rabbit, pig, goat, sheep, dog, cat, boar, bull, horse, or cow. In some examples, the subject is a laboratory animal / organism, e.g., a mouse, rabbit, or rat. In some examples, the subject has an inflammatory disorder, e.g., those listed in Table 1 (e.g., asthma, COPD, or allergic reaction).

[0069] Treating or Treatment: Refers to a therapeutic intervention that ameliorates the signs or symptoms of a disease or condition associated with a disease or pathology (e.g., those listed in Table 1, e.g., airway disorders such as asthma or chronic obstructive pulmonary disease, or allergic reactions). Treatment can induce remission or cure of such conditions. In a specific example, treatment includes reducing inflammation.

[0070] Reduction or suppression of signs or symptoms associated with a disease (e.g., an airway disease or other disorder listed in Table 1) can be evidenced, for example, by a delay in the onset of clinical symptoms of the disease in a susceptible subject, a reduction in the severity of some or all clinical symptoms of the disease, a slower progression of the disease (e.g., by extending the lifespan of a subject with the disease), a reduction in the number of relapses of the disease, an improvement in the general health or well-being of the subject, or other parameters known in the art that are specific to a particular disease.

[0071] Treatment can be evaluated by objective or subjective parameters, including the results of physical exams and other clinical tests, etc. In one example, treatment using the disclosed methods (1) reduces inflammation, e.g., in the lungs or at the site of an allergic reaction, e.g., by at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, or at least 90% reduction compared to without administration of the Nmb protein or nucleic acid molecule, (2) reduces IL-5, e.g., in ILC2 and / or T cells, e.g., by at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, or at least 90% reduction compared to without administration of the Nmb protein or nucleic acid molecule, (3) reduces IL-13, e.g., in ILC2 and / or T cells, e.g., by at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, or at least 90% reduction compared to without administration of the Nmb protein or nucleic acid molecule, (4) reduces IL-13, e.g., in ILC2 and / or T cells, e.g., by at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, or at least 90% reduction compared to without administration of the Nmb protein or nucleic acid molecule, (5) reduces IL-20, e.g., by at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least (4) reducing ILC2 and / or T cell responses, e.g., the number of proliferative and / or activated ILC2 and / or T cells present, e.g., a reduction of at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, or at least 90% compared to without administration of the Nmb protein or nucleic acid molecule; and / or (5) reducing eosinophilia, e.g., in the lungs or peripheral blood, e.g., a reduction of at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, or at least 90% compared to without administration of the Nmb protein or nucleic acid molecule.

[0072] Under sufficient conditions: A phrase used to describe any environment that allows for a desired activity. In one example, this includes administering an effective amount of a composition comprising one or more Nmb proteins disclosed herein (e.g., one or more of SEQ ID NOs: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, and 37), or a nucleic acid molecule encoding same (e.g., SEQ ID NO: 2) (or a vector comprising such a nucleic acid molecule) sufficient to permit a desired activity (e.g., reducing inflammation associated with IL-5 and / or IL-13).

[0073] Unit dose: A physically discrete unit containing a predetermined amount of active material, either individually or collectively, calculated to produce a desired effect, e.g., a therapeutic effect. A single unit dose or multiple unit doses can be used to provide a desired effect, e.g., treatment of a disorder, e.g., those listed in Table 1, e.g., asthma, COPD, or an allergic reaction.

[0074] Vector: A nucleic acid molecule that is introduced into a cell, thereby producing a transformed cell. A vector may contain a nucleic acid sequence that allows it to replicate in a host cell, such as an origin of replication. A vector may contain one or more therapeutic genes (e.g., those encoding the Nmb peptides provided herein) and / or selectable marker genes and other genetic elements. A vector transduces, transforms, or infects a cell, thereby causing the cell to express a nucleic acid and / or protein other than that native to the cell. A vector may optionally include materials that aid in achieving entry of the nucleic acid into the cell, such as viral particles, liposomes, protein coatings, or others. In one example, the vector is a viral vector, such as an AAV or lentiviral vector.

[0075] II. Overview Basophils can amplify type 2 cytokine responses through their IL-4 production and ability to promote activation of other cell types, including ILC2 and TH2 cells (2, 5, 10). Moreover, basophilia is a common property of type 2 cytokine-mediated inflammation after helminth infection or induction of allergic inflammation (2, 10). Even though basophil responses are a hallmark of type 2 inflammation, the role that these cryptic cells play in regulating type 2 responses remains controversial. For example, basophil populations expand rapidly after Nb infection, yet depletion of these cells has little or no effect on anti-helminth immunity and parasite clearance (2, 11). Thus, Nb-induced basophils do not contribute to parasite clearance but may perform other unidentified functions.

[0076] The data presented herein demonstrate that ILC2 and T HWe identify a previously unrecognized aspect of the exchange between the nervous and immune systems that can negatively regulate type 2 cell responses. Previous studies have demonstrated that expression of Neuromedin U by cholinergic neurons can promote ILC2 activation and amplify immunity to helminth parasites (8, 9), indicating that the nervous and immune systems work together in a manner that allows optimal sensing and clearance of pathogens. The work presented herein shows that as the nervous and immune systems co-evolved, they also arose mechanisms to negatively regulate inflammatory responses via Neuromedin B signaling to help maintain tissue integrity. Furthermore, the data herein identify an additional level of complexity, showing that basophils promote Nmbr expression by immune cells, enabling them to receive neuron-derived signals. Thus, other specialized innate immune cells help mediate a means of communication between neurons and type 2 cytokine-producing immune cells. The data further suggest that prostaglandin E2 (PGE2) also promotes Nmbr expression by lymphocytes. Basophils are a strong source of PGE2, so these data suggest that basophils regulate the ability of Nmb to inhibit inflammation via PGE2. These data highlight the highly coordinated cellular events required to initiate and allow careful regulation of the persistence of inflammation at mucosal sites after exposure to infectious agents or allergens. In addition, the data presented herein identify a previously unrecognized role of Nmb as a negative regulator of type 2 cytokine responses that can be used therapeutically to treat multiple forms of allergic disease and chronic inflammation as well as other diseases.

[0077] III. Method of Treatment Provided herein are methods for treating a disorder in a mammalian subject, e.g., an inflammatory disorder, e.g., an inflammatory disorder caused by type 2 cytokines. In some examples, the disorder is associated with undesirable interleukin-5 (IL-5) and / or IL-13 activity. Examples of such disorders are provided in Table 1 and include allergies, airway disorders (e.g., asthma, sinusitis, idiopathic pulmonary fibrosis, rhinitis, eosinophilic granulomatosis with polyangiitis, eosinophilic esophagitis, and COPD), skin disorders (e.g., eczema, atopic dermatitis, and urticarial), and eosinophilic disorders (e.g., eosinophilic esophagitis, eosinophilic gastritis, eosinophilic gastroenteritis, eosinophilic enteritis, eosinophilic colitis, eosinophilic asthma, eosinophilic gastrointestinal disorders (EGID), eosinophilic fasciitis, EGPA, eosinophilic lung disorder, hypereosinophilic syndrome (HES), or eosinophilic leukemia). In one example, the disorder to be treated is Hodgkin's lymphoma. Thus, a mammalian subject, e.g., a human or veterinary subject, having such a disorder can be treated with the disclosed methods.

[0078] Administration of a therapeutically effective amount of one or more Nmb or Nmc proteins, or one or more nucleic acid molecules encoding one or more Nmb or Nmc proteins, can (1) reduce inflammation, e.g., in the lungs or at the site of an allergic response, e.g., by at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, or at least 90% compared to administration of the Nmb protein or nucleic acid molecule; (2) reduce IL-5 activity (e.g., nucleic acid or protein expression), e.g., by at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, or at least 90% compared to administration of the Nmb protein or nucleic acid molecule; (3) reduce IL-13 activity (e.g., nucleic acid or protein expression), e.g., by at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, or at least 90% compared to administration of the Nmb protein or nucleic acid molecule; (3) reducing the expression of a marker gene (e.g., a reduction of at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, or at least 90% compared to administration of the Nmb protein or nucleic acid molecule; (4) reducing the ILC2 and / or T cell response, e.g., the number of proliferative and / or activated ILC2 and / or T cells present, e.g., a reduction of at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, or at least 90% compared to administration of the Nmb protein or nucleic acid molecule; and / or (5) reducing eosinophilia, e.g., in the lungs or peripheral blood, e.g., by at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, or at least 90% compared to administration of the Nmb protein or nucleic acid molecule.or at least a 90% reduction, thereby treating the disorder.

[0079] The disclosed methods of treatment include administering to a subject a therapeutically effective amount of at least one Neuromedin B (Nmb) protein or Neuromedin C (Nmc) protein, or at least one nucleic acid molecule encoding at least one Nmb protein or Nmc protein, thereby treating the disorder. The Nmb or Nmc protein or nucleic acid molecule may be present in a pharmaceutical composition, such as one that includes saline or water.

[0080] Thus, in some examples, at least two different Nmb proteins are administered, for example, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different Nmb proteins (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, and 37). In some examples, at least one of the administered Nmb proteins has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NO: 3, 4, 5, 6, 11, 12, 13, 14, 20, 22, 26, 27, 28, 29, 30, 31, 32, 35, 36, or 37. In some examples, at least one of the administered Nmb proteins has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NO: 26, 27, 29, 35, or 36. In some examples, at least two Nmb proteins are administered: (1) one having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NO:3, 4, 5, 6, 11, 12, 13, 14, 20, 22, 26, 27, 28, 29, 30, 31, 32, 35, 36, or 37, and (2) one having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NO:26, 27, 29, 35, or 36.In some examples, at least two Nmb proteins are administered: (1) one having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NOs: 3, 4, 6, 7, 9, 10, 11, 12, 14, 15, 19, 21, 22, 26, 27, 28, 29, 30, 32, 34, 35, 36, 37, and (2) one having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NOs: 3, 4, 5, 6, 9, 11, 12, 13, 14, 18, 19, 20, 21, 22, 23 (wherein the two Nmb proteins are different). In some examples, at least two Nmb proteins are administered: (1) one comprising or consisting of SEQ ID NO:1, and (2) one comprising or consisting of SEQ ID NO:3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37.

[0081] In some examples, the nucleic acid molecule that encodes at least one Nmb protein encodes more than one Nmb protein, for example, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different Nmb proteins. In some examples, the method comprises administering a plurality of different nucleic acid molecules, each encoding at least one Nmb protein. The nucleic acid molecule that is administered may be part of a plasmid or a viral vector, for example, a lentivirus or an adeno-associated viral vector. In addition, the nucleic acid molecule that is administered may be operably linked to a promoter, for example, a constitutive promoter or other enhancer element.

[0082] Exemplary modes of administration include injection (e.g., intravenous, intramuscular, intraperitoneal, or intradermal), oral administration, intranasal administration, inhalation administration, or topical administration. One or more doses, e.g., at least two, at least three, at least four, or at least five doses, of a therapeutically effective amount of at least one Nmb protein or Nmc protein or at least one nucleic acid molecule encoding at least one Nmb protein or Nmc protein may be administered. For example, the method may include at least two separate administrations separated by at least one week, at least two weeks, at least three weeks, at least four weeks, at least one month, at least two months, at least three months, at least six months, at least nine months, or at least one year. In some examples, the administering step occurs within 5 minutes, within 10 minutes, within 30 minutes, within 1 hour, within 2 hours, within 3 hours, within 4 hours, within 5 hours, within 6 hours, within 12 hours, within 24 hours, within 48 hours, within 72 hours, within 96 hours, within 1 week, within 2 weeks, within 3 weeks, within 4 weeks, within 1 month, within 2 months, or within 3 months of the onset of the disorder.

[0083] In some examples, at least one Nmb protein administered has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NO:1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37. In some examples, at least one nucleic acid molecule administered encodes at least one Nmb protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NO:1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37. In some examples, the coding sequence of at least one administered Nmb nucleic acid molecule has at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2, where the coding sequence may be inserted into or part of a vector. In some examples, the Neuromedin C (Nmc) protein has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NO:38. In other examples, the nucleic acid molecule encodes an Nmc protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NO:38.

[0084] In some examples, the method includes administering to the subject a therapeutically effective amount of another therapeutic agent, such as one or more of those provided in Table 1. In one example, the method includes administering to the subject a therapeutically effective amount of PGE2. [Table 1-1] [Table 1-2] [Table 1-3]

[0085] A. Neuromedin Protein An exemplary Nmb decapeptide is set forth in SEQ ID NO: 1 (human), with variants thereof set forth in SEQ ID NOs: 3-37. In some examples, the Nmb protein comprises or consists of the protein sequence of SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37. An exemplary Nmb coding sequence is set forth in SEQ ID NO: 2. In some examples, the Nmb nucleic acid sequence comprises or consists of the sequence of SEQ ID NO: 2, which in some examples is part of a plasmid or vector, and in some examples is operably linked to a promoter (e.g., a constitutive promoter).

[0086] In one example, the disclosed method utilizes an Nmb protein (e.g., a mammalian Nmb protein), i.e., an Nmb protein is administered to a subject. An example of such a protein is shown in SEQ ID NO: 1 (a native Nmb protein). A native or variant Nmb protein can be used. In one example, variant Nmb peptides are produced by manipulating the Nmb nucleotide sequence. In some examples, variant Nmb sequences, e.g., those containing one or more amino acid substitutions, additions, deletions, or combinations thereof, are used, so long as the protein retains the ability to reduce IL-5 activity, reduce IL-13 activity, reduce eosinophilia, reduce inflammation, reduce ILC2 response, or combinations thereof. Exemplary methods for measuring IL-5 activity (e.g., measuring DNA or protein expression), IL-13 activity (e.g., measuring DNA or protein expression), eosinophilia, inflammation, as well as ILC2 response are described herein. Regions of Nmb likely to tolerate substitutions can be determined by aligning sequences, where amino acids that are conserved between species are unlikely to tolerate substitutions, while amino acids that vary at certain positions are likely to tolerate substitutions. In addition, alanine scans and truncation scans can be utilized (see Example 7).

[0087] A variant Nmb protein, e.g., a variant of SEQ ID NO: 1, may contain one or more mutations, e.g., a single insertion, a single deletion, or a single amino acid substitution. In some examples, the mutant Nmb protein contains 1-5 insertions, 1-5 deletions, 1-5 substitutions, or any combination thereof (e.g., a single insertion with 1-5 substitutions). In some examples, the variant Nmb protein (e.g., SEQ ID NO: 1) has 1, 2, 3, 4, or 5 amino acid changes, e.g., 1, 2, 3, 4, or 5 amino acid substitutions (e.g., conservative amino acid substitutions), 1, 2, 3, 4, or 5 amino acid insertions, or 1, 2, or 3 amino acid deletions, or a combination thereof. In some examples, SEQ ID NO:1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37 has 1, 2, 3, 4, or 5 amino acid changes, for example, 1, 2, 3, 4, or 5 amino acid insertions, 1, 2, or 3 amino acid deletions, 1, 2, 3, 4, or 5 amino acid substitutions, or any combination thereof (e.g., 1 or 2 amino acid deletions along with 1, 2, 3, 4, or 5 amino acid substitutions). In one example, SEQ ID NO:1 includes amino acid substitutions, e.g., alanine or conservative amino acid substitutions, at amino acids 1, 2, 3, 4, 10. In one example, SEQ ID NO:1 includes two, three, four, or five amino acid substitutions, e.g., alanine or conservative amino acid substitutions, at amino acids 1, 2, 3, 4, and / or 10. In one example, SEQ ID NO:1 includes one, two, three, or four amino acid deletions, e.g., at amino acids 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, e.g., at amino acid 5 and / or amino acid 7. In one example, SEQ ID NO:1 includes two, three, or four consecutive amino acid deletions, e.g., at amino acids 1 and 2, 1-3, 1-4, 2-3, 2-4, 2-5, etc.In one example, SEQ ID NO:1 includes amino acid substitutions, e.g., alanine or conservative amino acid substitutions, at amino acids 1, 2, 3, 4, 10, and one or two amino acid deletions at amino acids 5 and / or 7. In one example, SEQ ID NO:1 includes a cap, e.g., a methanesulfonyl cap, NHMe cap, or OH cap, at the N-terminus or C-terminus.

[0088] One type of modification or mutation includes replacing amino acids with amino acid residues that have similar biochemical properties, i.e., conservative substitution (e.g., 1, 2, 3, 4, or 5 conservative substitutions).Typically, conservative substitutions have little or no effect on the activity of the resulting Nmb peptide.For example, conservative substitutions are amino acid substitutions in SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37 that do not substantially affect the ability of Nmb peptide to reduce IL-5 activity, reduce IL-13 activity, reduce eosinophilia, reduce inflammation, reduce ILC2 response, or a combination thereof in mammals. Alanine scanning can be used to identify which amino acid residues within an Nmb protein, e.g., SEQ ID NO: 1, can tolerate amino acid substitutions (see Example 7). In one example, these activities of Nmb (e.g., SEQ ID NO: 1) are not altered by more than 25%, e.g., not altered by more than 20%, e.g., not altered by more than 10%, when alanine or other conservative amino acids are substituted for one, two, three, four, or five naturally occurring amino acids. Examples of amino acids that can be substituted for original amino acids in a protein (e.g., Nmb) and are considered to be conservative substitutions include Ser and Ala; Lys and Arg; Gln or His and Asn; Glu and Asp; Ser and Cys; Asn and Gln; Asp and Glu; Pro and Gly; Asn or Gln and His; Leu or Val and Ile; Ile or Val and Leu; Arg or Gln and Lys; Leu or Ile and Met; Met, Leu, or Tyr and Phe; Thr and Ser; Ser and Thr; Tyr and Trp; Trp or Phe and Tyr; and Ile or Leu and Val.

[0089] More substantial changes can be made by using less conservative substitutions, e.g., by selecting residues that are more significantly different in their effect on maintaining (a) the structure of the polypeptide backbone, e.g., as a sheet or helix configuration, (b) the charge or hydrophobicity of the polypeptide at the target site, or (c) the bulk of the side chains, in the scope of the substitution. In general, the substitutions predicted to result in the most significant changes in polypeptide function are (a) those in which a hydrophilic residue, e.g., serine or threonine, is substituted for (or by) a hydrophobic residue, e.g., leucine, isoleucine, phenylalanine, valine, or alanine; (b) those in which a cysteine ​​or proline is substituted for (or by) any other residue; (c) those in which a residue having a positively charged side chain, e.g., lysine, arginine, or histidine, is substituted for (or by) a negatively charged residue, e.g., glutamic acid or aspartic acid; or (d) those in which a residue having a bulky side chain, e.g., phenylalanine, is substituted for (or by) one having no side chain, e.g., glycine. The effects of these amino acid substitutions (or other deletions or additions) can be assessed by analyzing the function of the Nmb protein, e.g., SEQ ID NO:1, by analyzing the ability of the variant Nmb protein to reduce IL-5 activity, reduce IL-13 activity, reduce eosinophilia, reduce inflammation, reduce ILC2 responses, or combinations thereof, in a mammal.

[0090] In some examples, the Nmb protein (e.g., SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or Nmc protein (e.g., SEQ ID NO: 38) used in the disclosed method or composition is pegylated at one or more positions. In some examples, the Nmb protein or Nmc protein used in the disclosed method or composition comprises an immunoglobulin FC domain. The conserved FC fragment of an antibody can be incorporated into either the n-terminus or c-terminus of the Nmb protein or Nmc protein to enhance the stability of the protein and thus enhance the serum half-life. The FC domain can also be used as a means to purify the protein on protein A or protein G sepharose beads.

[0091] Nmb protein (e.g., SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or Nmc protein (e.g., SEQ ID NO: 38) can be tagged with a cell-penetrating peptide (CPP) to facilitate intracellular integration. Thus, in some examples, the Nmb protein or Nmc protein used is a fusion protein comprising (1) an Nmb protein or an Nmc protein, and (2) a cell-penetrating peptide. The cell-penetrating peptide can be at the N- or C-terminus of the Nmb or Nmc protein. Cell-penetrating peptides are short peptides (40 amino acids or less) that are usually highly cationic and are usually rich in arginine and lysine that can facilitate cellular uptake / integration of proteins.Exemplary cell-permeable peptides that can be used include hydrophilic peptides (e.g., TAT [YGRKKRRQRRR, SEQ ID NO: 57], SynB1 [RGGRLSYSRRRFSTSTGR, SEQ ID NO: 39], SynB3 [RRLSYSRRRF, SEQ ID NO: 40], PTD-4 [PIRRRKKLRRLK, SEQ ID NO: 41], PTD-5 [RRQRRTSKLMKR, SEQ ID NO: 42], FHV Coat-(35-49) [RRRRNRTRRNRRRVR, SEQ ID NO: 43], BMV Gag-(7-25) [KMTRAQRRAAARRNRWTAR, SEQ ID NO: 44], HTLV-II Rex-(4-16) [TRRQRTRRARRNR, SEQ ID NO: 45], D-Tat [GRKKRRQRRRPPQ, SEQ ID NO: 46], R9-Tat GRRRRRRRRRPPQ [SEQ ID NO: 47], and penetratin [RQIKWFQNRRMKWKK, SEQ ID NO: 48]), amphiphilic peptides (e.g., MAP [KLALKLALKLALALKLA; SEQ ID NO: 49], SBP [MGLGLHLLVLAAALQGAWSQPKKKRKV; SEQ ID NO: 50], FBP [GALFLGWLGAAGSTMGAWSQPKKKRKV; SEQ ID NO: 51], MPG ac-GALFLGFLGAAGSTMGAWSQPKKKRKV-cya; SEQ ID NO: 52], MPG(ΔNLS) [ac-GALFLGFLGAAGSTMGAWSQPKSKRKV-cya; SEQ ID NO: 53], Pep-2 [ac-KETWFETWFTEWSQPKKKRKV-cya; SEQ ID NO: 54], and transportan [GWTLNSAGYLLGKINLKALAALAKKIL, SEQ ID NO: 55]), periodic sequences (e.g., pVec, polyarginine RxN (4 < N < 17) chimeras, polylysine KxN (4 < N < 17) chimeras, (RAca)6R, (RAbu)6R, (RG)6R, (RM)6R, (RT)6R, (RS)6R, R10, (RA)6R, R7, and pep-1 [ac-KETWWETWWTEWSQPKKKRKV-cya, SEQ ID NO: 56]), Cr10 (cyclic polyarginine CPP), TAT. 48-57 , TAT 47-57 , or TAT 49-57; penetratin; Pep-1; substance P, SP; polyarginines, e.g., R5-R12; pVEC; transportan; MAP; Diatos Peptide Vector 1047, DPV1047, VECTOCELL®; MPG; ADP-ribosylation factor, ARF, e.g., ARF 1-22 ;BPrPr (for example, BPrPr 1-28 );p28;VT5;Bac 7, for example, Bac 1-24 ; C105Y; PFVYLI (SEQ ID NO:58); and Pep-7.

[0092] An Nmb protein (e.g., SEQ ID NO:1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or an Nmc protein (e.g., SEQ ID NO:38) can include an N-terminal cap, e.g., formyl, acetyl, acyl of 2-18 carbons, aryl acyl (such as benzoyl), heteroaryl acyl (such as 2-acetylpyridine), carbamate (such as t-butyl carbamate), succinyl, alkyl, or aryl sulfonamide, and / or a C-terminal cap, e.g., amide, acid, aldehyde, and ester (aryl, alkyl, heteroaryl, heteroalkyl, e.g., polyethylene glycol of 2-20 repeating units).

[0093] B. Protein Production Isolation and purification of recombinantly expressed Nmb or Nmc proteins can be performed by conventional means, such as preparative chromatography and immunological separation. After expression, Nmb or Nmc proteins can be purified according to standard procedures, including ammonium sulfate precipitation, affinity columns, column chromatography, and the like (see generally, R. Scopes, Protein Purification, Springer-Verlag, NY, 1982). Substantially pure compositions of at least about 90-95% homogeneity are disclosed herein, and 98-99% or greater homogeneity may be used for pharmaceutical purposes.

[0094] In addition to recombinant methods, Nmb or Nmc proteins (or variants thereof as described above) can also be constructed in whole or in part using standard peptide synthesis. In one example, Nmb or Nmc proteins are synthesized by condensation of the amino and carboxyl termini of short fragments. Peptide bonds can be formed by activation of the carboxyl termini (e.g., by use of the coupling reagent N,N'-dicylohexylcarbodimide).

[0095] C. Modifications to Proteins The Nmb proteins that can be used in the disclosed methods and compositions include synthetic embodiments of the Nmb peptides described herein.In addition, analogs (non-peptide organic molecules), derivatives (chemically functionalized peptide molecules obtained by starting with the disclosed peptide sequences), and variants (homologs) of these peptides can be utilized in the methods described herein.Each Nmb peptide and Nmc peptide of the present disclosure is composed of a sequence of amino acids, which can be either natural and other L- and / or D-amino acids.

[0096] The Nmb and Nmc peptides may be modified by a variety of chemical techniques to produce derivatives that have essentially the same activity as the unmodified Nmb and Nmc peptides, and, if desired, other desirable properties. For example, the carboxylic acid groups of the peptides, whether at the carboxyl terminus or in the side chain, may be provided in the form of salts of pharma- ceutically acceptable cations, or may be C1-C2-C3-C4-C5-C6-C7-C8-C9-C10-C11-C12-C13-C14-C15-C16-C17-C18-C21-C3-C19-C22-C3-C4-C19-C23-C3-C18-C24-C19-C25-C3-C19-C26-C3-C19-C27-C3-C19-C28-C3-C19 16 can be esterified to form an ester or can be represented by the formula NR1R2, where R1 and R2 are each independently H or C1-C 16 The amino groups of the peptides, whether amino-terminated or side chain, may be in the form of pharma- ceutically acceptable acid addition salts, such as salts of HCl, HBr, acetic acid, benzoic acid, toluenesulfonic acid, maleic acid, and other tartaric acids, and other organic salts, or may be converted to amides of C1-C 16 It may be modified to an alkyl or dialkylamino, or further converted to an amide to incorporate certain functionality for attachment of ligand molecules.

[0097] Hydroxyl groups on the peptide side chains are added to the C1-C6 peptides to introduce hydrophobic character to the peptides. 16 Alkoxy or C1-C 16 Alternatively, the hydroxyl groups may be sulfated or phosphorylated to introduce a negative charge and increase water solubility. Alternatively, the side chain hydroxyls or / and the asparagine and / or aspartic acid side chains may be glycosylated, such as serine / threonine glycopeptides or N-acetyl glycopeptides, which can modulate the properties of the peptide. The phenyl and phenol rings of the peptide side chains may be substituted with one or more halogen atoms, e.g., fluorine, chlorine, bromine, or iodine, or may be substituted with C1-C 16 Alkyl, C1-C 16They may be substituted with alkoxy, carboxylic acids and their esters, or amides of such carboxylic acids. Methylene groups of peptide side chains may be extended to homologous C2-C4 alkylenes. Thiols may be protected with any one of several well-recognized protecting groups, for example, acetamide groups. Thiols may react with maleimides or disulfides.

[0098] The embodiment of peptidomimetics and organomimetics is envisioned, in which the three-dimensional arrangement of the chemical components of peptidomimetics and organomimetics mimics the three-dimensional arrangement of peptide backbone and constituent amino acid side chains, such that such peptidomimetics and organomimetics of Nmb or Nmc peptides have a measurable or enhanced ability to reduce type 2 cytokine production and, as a result, reduce inflammation.For computer modeling applications, a pharmacophore is the ideal three-dimensional definition of the structural requirements of biological activity.Peptidomimetics and organomimetics can be designed to fit each pharmacophore using computer modeling software (using computer-aided drug design or CADD). For a description of the techniques used in CADD, see Walters, "Computer-Assisted Modeling of Drugs," in Klegerman & Groves, eds., 1993, Pharmaceutical Biotechnology, Interpharm Press: Buffalo Grove, IL, pp. 165-174 and Principles of Pharmacology, Munson (ed.) 1995, Ch. 102. Mimetics are also included.

[0099] In some examples, an Nmb protein (e.g., SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or Nmc protein (e.g., SEQ ID NO: 38) used in the disclosed methods or compositions comprises one or more modified amino acids (e.g., 1, 2, 3, 4, or 5 modified amino acids). Exemplary Nmb or Nmc peptides are derivative peptides that may be modified by glycosylation, pegylation, phosphorylation, or any similar process that retains at least one biological function of the peptide from which it is derived (e.g., reduces IL-5 activity, reduces IL-13 activity, reduces eosinophilia, reduces inflammation, reduces ILC2 response, or a combination thereof). Nmb or Nmc peptides may also include one or more unnatural amino acids. For example, non-classical amino acids or chemical amino acid analogs can be introduced as a substitution or addition into an Nmb peptide (e.g., SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or an Nmc peptide (e.g., SEQ ID NO: 38). Non-classical amino acids include, but are not limited to, D-isomers of the common amino acids, 2,4-diaminobutyric acid, alpha-aminoisobutyric acid, 4-aminobutyric acid, Abu, 2-aminobutyric acid, gamma-Abu, epsilon-Ahx, 6-aminohexanoic acid, Aib, 2-aminoisobutyric acid, 3-aminopropionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, homocitrulline, cysteic acid, t-butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine, beta-alanine, fluoro-amino acids, designer amino acids such as beta-methyl amino acids, C alpha-methyl amino acids, N alpha-methyl amino acids, and common amino acid analogs.Additionally, the amino acids can be D (dextrorotatory) or L (levorotatory). In other specific examples, branched versions of the Nmb and Nmc peptides listed herein are provided, for example, by replacing one or more amino acids in the sequence with an amino acid or amino acid analog having a free side chain capable of forming a peptide bond with one or more amino acids (thus forming a "branched chain"). Cyclic peptides are also contemplated.

[0100] Also included are peptide derivatives that are differentially modified during or after synthesis, for example, by benzylation, glycosylation, acetylation, phosphorylation, amidation, pegylation, derivatization with protecting / blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc. In specific embodiments, an Nmb peptide (e.g., SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or an Nmc peptide (e.g., SEQ ID NO: 38) is acetylated at the N-terminus and / or amidated at the C-terminus. In one example, an Nmb peptide (e.g., SEQ ID NO:1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or an Nmc peptide (e.g., SEQ ID NO: 38) comprises a carboxy-terminal amide.

[0101] Peptide mimetics are compounds based on or derived from peptides and proteins. Peptide mimetics can be obtained by structural modification of known peptide sequences using unnatural amino acids, conformational constraints, homogenous rearrangements, etc. The subject peptidomimetics constitute a continuum of structural space between peptides and non-peptide synthetic structures, and thus peptidomimetics can be useful in explaining pharmacophores and aiding in the translation of peptides into non-peptide compounds with the activity of the parent peptide.

[0102] Mimetopes of Nmb peptides (e.g., SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or Nmc peptides (e.g., SEQ ID NO: 38) are included in the present disclosure. Such peptidomimetics may have attributes such as being non-hydrolyzable (e.g., increased stability to proteases or other physiological conditions that degrade peptides). By way of example, peptide analogs can include, for example, benzodiazepines (e.g., see Freidinger et al. al. in Peptides: Chemistry and Biology, GR Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988), substituted gamma lactam rings (Garvey et al. in Peptides: Chemistry and Biology, GR Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988, pl23), C-7 mimetics (Huffman et al. in Peptides: Chemistry and Biology, GR Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988, pl23), Publisher: Leiden, Netherlands, 1988, p. 105), keto-methylene pseudopentaerythritol Peptides (Ewenson et al. (1986) J Med Chem 29:295; and Ewenson et al. in Peptides: Structure and Function (Proceedings of the 9th American Peptide Symposium) Pierce Chemical Co. Rockland, Ill., 1985), β-turn A dipeptide core (Nagai et al. (1985) Tetrahedron Lett 26:647; and Sato et al. (1986) J Chem Soc Perkin Trans 1: 1231), a β-amino alcohol (Gordon et al. (1985) Biochem Biophys Res Commun126:419 and Dann et al. (1986) Biochem Biophys Res Commun 134:71), diaminoketones (Natarajan et al. al. (1984) Biochem Biophys Res Commun 124:141), and methyleneamino Modification (Roark et al. in Peptides: Chemistry and Biology, GR Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988, p134) See also, generally, Session III: Analytic and synthetic methods, in Peptides: Chemistry and Biology, GR Marshall ed., ESCOM Publisher: Leiden, Netherlands, 1988).

[0103] In addition to the various side chain replacements that can be performed to generate peptidomimetics, the present disclosure contemplates the use of conformationally restricted mimetics of peptide secondary structures. Surrogates for the amide bond of peptides have been developed. Commonly used surrogates for the amide bond include the following groups: (i) trans-olefins, (ii) fluoroalkenes, (iii) methyleneamino, (iv) phosphonamide, and (v) sulfonamide. In addition, peptidomimetics based on more substantial modifications of the peptide backbone can be used. Peptidomimetics that fall into this category include: (i) retro-inverso ) analogs, and (ii) N-alkylglycine analogs (so-called peptoids). Additionally, methods of combinatorial chemistry can be used to produce peptidomimetics. For example, one embodiment of the so-called "peptide morphing" strategy involves the creation of a library of peptide analogs containing a wide range of peptide bond alternatives. The present invention focuses on random generation of rallies. In an exemplary embodiment, a peptidomimetic of an Nmb peptide (e.g., SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or an Nmc peptide (e.g., SEQ ID NO: 38) can be derived as a retro-inverso analog of the peptide. Such retro-inverso analogs can be made according to known methods, such as those described by Sisto et al., U.S. Pat. No. 4,522,752. Retro-inverso analogs can be generated, for example, as described in PCT Publication WO 00 / 01720. Mixed peptides can be generated, for example, those containing several regular peptide linkages. As a general guideline, the sites most susceptible to proteolysis are typically altered, while the less susceptible amide linkages are best suited for mimetic switching. The final product or an intermediate thereof can be purified.

[0104] An Nmb peptide (e.g., SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or an Nmc peptide (e.g., SEQ ID NO: 38) may contain at least one amino acid or all amino acids that are D stereoisomers. An Nmb peptide or an Nmc peptide may contain at least one amino acid that is inverted. The inverted amino acid may be a D stereoisomer. All amino acids of the peptide may be inverted and / or all amino acids may be D stereoisomers. In another exemplary embodiment, a peptidomimetic may be derived as a retro-enantioanalogue of a peptide. Such retro-enantio analogs can be synthesized using commercially available D-amino acids (or analogs thereof) and standard solid-phase or liquid-phase peptide synthesis techniques, for example, as described in PCT Publication WO00 / 01720. The final product can be purified by HPLC to obtain pure retro-enantio analogs. In yet another exemplary embodiment, trans-olefin derivatives of the subject peptides can be made. Trans-olefin analogs can be synthesized according to the method of YK Shue et al. (1987) Tetrahedron Letters 28:3225 and as described in PCT Publication WO00 / 01720. It is further possible to couple the pseudodipeptides synthesized by the above-mentioned method to other pseudodipeptides to make peptide analogs with some olefinic functionality instead of amide functionality. Yet another class of peptidomimetic derivatives includes phosphonate derivatives. The synthesis of such phosphonate derivatives can be adapted from known synthetic schemes (e.g., Loots et al. in Peptides: Chemistry and Biology, (Escom Science Publishers, Leiden, 1988, p. 118), Petrillo et al. in Peptides: Structure and Function (Proceedings of the 9th American Peptide Symposium, Pierce Chemical Co. Rockland, Ill., 1985).

[0105] Other peptidomimetic structures are known and can be readily adapted for use in the subject peptidomimetics. For example, peptidomimetics can be 1-azabicyclo[4.3.0]nonane surrogates (see Kim et al. (1997) J. Org. Chem. 62:2847), or N-acylpiperazine acids (see Xi et al. (1998) J. Am. Chem. Soc. 120:80). , 32, 33, 34, 35, 36, or 37) or Nmc peptides (e.g., SEQ ID NO:38) may be replaced with aryl and bi-aryl moieties, e.g., monocyclic or bicyclic aromatic or heteroaromatic nuclei, or biaromatic, aromatic-heteroaromatic, or biheteroaromatic nuclei. The subject peptidomimetics can be optimized, for example, by combinatorial synthesis techniques combined with high-throughput screening. In addition, other examples of mimetopes include, but are not limited to, protein-based compounds, carbohydrate-based compounds, lipid-based compounds, nucleic acid-based compounds, natural organic compounds, synthetically derived organic compounds, anti-idiotypic antibodies, and / or catalytic antibodies, or fragments thereof. Mimetopes can be obtained, for example, by screening libraries of natural and synthetic compounds for compounds that can inhibit fibrillogenesis. Mimetopes can also be obtained, for example, from libraries of natural and synthetic compounds, particularly chemical or combinatorial libraries (libraries of compounds that differ in sequence or size but have the same building blocks). Mimetopes can also be obtained, for example, by rational drug design. In the rational drug design procedure, the three-dimensional structure of the compounds of the present invention can be analyzed, for example, by nuclear magnetic resonance (NMR) or X-ray crystallography. The three-dimensional structure can then be used, for example, to predict the structure of potential mimetopes by computer modeling.The predicted mimetope structures can then be produced, for example, by chemical synthesis, recombinant DNA technology, or by isolating the mimetope from natural sources (eg, plants, animals, bacteria, and fungi).

[0106] D. Neuromedin Nucleic Acid Molecules and Vectors An exemplary Nmb coding sequence is set forth in SEQ ID NO: 2. In some examples, an Nmb nucleic acid molecule that encodes Nmb comprises or consists of the sequence of SEQ ID NO: 2. In some examples, an Nmb nucleic acid molecule encodes the protein of SEQ ID NO: 1 or a variant thereof (e.g., those described above). In some examples, an Nmb nucleic acid sequence comprises or consists of SEQ ID NO: 2, which in some examples is part of a plasmid or vector, and in some examples is operably linked to a promoter (e.g., a constitutive promoter).

[0107] In one example, the disclosed methods utilize an Nmb or Nmc nucleic acid sequence (e.g., a cDNA, genomic, or RNA sequence), i.e., an Nmb or Nmc nucleic acid molecule is administered to a subject and the encoded Nmb or Nmc protein is expressed in a cell into which the nucleic acid molecule has been introduced. The Nmb or Nmc nucleic acid molecule may encode a native or variant Nmb or Nmc protein, as described above.

[0108] Based on the genetic code, a nucleic acid sequence encoding any Nmb protein (e.g., SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or Nmc protein (e.g., SEQ ID NO: 38) can be generated. In some examples, such sequences are optimized for expression in a host cell, e.g., a host cell used to express the Nmb or Nmc protein. Such nucleic acids can be used directly (e.g., administered to a subject) or can be used to produce an Nmb or Nmc protein that is administered to a subject.

[0109] In one example, a nucleic acid molecule encoding an Nmb protein comprises or consists of the sequence of SEQ ID NO: 2. Also provided are cells, plasmids, and viral vectors containing such nucleic acids, which may also include a promoter operably linked to the Nmb or Nmc coding sequence.

[0110] In one example, the nucleic acid sequence encoding the Nmb protein has at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 99%, or at least 99% sequence identity to SEQ ID NO: 2. Such sequences can be readily produced using the amino acid sequences and genetic code provided herein. In addition, one skilled in the art can readily construct various clones containing functionally equivalent nucleic acids, e.g., nucleic acids that differ in sequence but encode the same Nmb protein sequence.

[0111] Nucleic acid molecules include DNA, cDNA, mRNA and RNA sequences that code Nmb or Nmc protein. Silent mutations in coding sequences arise from the degeneracy (i.e. redundancy) of genetic code, which allows more than one codon to code for the same amino acid residue. Thus, for example, leucine can be coded by CTT, CTC, CTA, CTG, TTA or TTG, serine can be coded by TCT, TCC, TCA, TCG, AGT or AGC, asparagine can be coded by AAT or AAC, aspartic acid can be coded by GAT or GAC, cysteine ​​can be coded by TGT or TGC, alanine can be coded by GCT, GCC, GCA or GCG, glutamine can be coded by CAA or CAG, tyrosine can be coded by TAT or TAC, and isoleucine can be coded by ATT, ATC or ATA. Tables showing the standard genetic code can be found in a variety of sources (e.g., Stryer, 1988, Biochemistry, 3 rd (See, Edition, WH 5 Freeman and Co., NY).

[0112] The codon preference and codon usage table of a particular species can be used to engineer isolated nucleic acid molecules encoding Nmb proteins (e.g., those encoding proteins having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NO:1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or isolated nucleic acid molecules encoding Nmc proteins (e.g., those encoding proteins having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NO:38) that utilize the codon usage preference of that particular species. For example, the Nmb proteins used in the disclosed methods can be designed to have codons that are preferentially used by the particular organism of interest (eg, human or mouse).

[0113] A nucleic acid encoding an Nmb protein (e.g., having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2, or having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37). a nucleic acid molecule encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38) or a nucleic acid encoding an Nmc protein (e.g., one encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38) can be used in It can be cloned or amplified by in vitro methods such as polymerase chain reaction (PCR), ligase chain reaction (LCR), transcription-based amplification system (TAS), self-sustained sequence replication system (3SR), and Qβ replicase amplification system (QB). In addition, a nucleic acid encoding an Nmb protein (e.g., having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2, or having at least 50%, at least 60%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:1, Nucleic acid molecules encoding proteins having at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38) or nucleic acids encoding Nmc proteins (e.g., those encoding proteins having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38) can be cloned using cloning techniques (e.g., Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring, Harbor, NY, 1989, and Ausubel et al., (1987) in "Current Protocols in Molecular Biology," John Wiley and Sons, New York, NY).

[0114] A nucleic acid sequence encoding an Nmb protein (e.g., having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2, or having at least 50%, at least 60%, at least 70%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:1, Nucleic acid molecules encoding proteins having at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38) or nucleic acid sequences encoding Nmc proteins (e.g., those encoding proteins having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38) can be prepared by, for example, cloning appropriate sequences or by the phosphotriester method of Narang et al., Meth. Enzymol. 68:90-99, 1979, the phosphodiester method of Brown et al., Meth. Enzymol. 68:109-151, 1979, the phosphodiester method of Beaucage et al., Tetra. Lett. 22:1859-1862, Can be prepared by any suitable method, including by direct chemical synthesis by methods such as the diethyl phosphoramidite method of 1981, the solid-phase phosphoramidite triester method described by Beaucage & Caruthers, Tetra. Letts. 22(20):1859-1862, 1981, using an automated synthesizer described in Needham-VanDevanter et al., Nucl. Acids Res. 12:6159-6168, 1984, and the solid support method of U.S. Patent No. 4,458,066. Chemical synthesis can obtain single-stranded oligonucleotide. It can be converted into double-stranded DNA by hybridization with complementary sequence or by polymerization with DNA polymerase using this single strand as template.

[0115] In one example, an Nmb protein (e.g., having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or an Nmc protein (e.g., having at least 50%, at least A cDNA encoding an Nmb protein (a nucleic acid molecule having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2) or a cDNA encoding an Nmc protein is prepared by inserting a cDNA encoding an Nmb protein (a nucleic acid molecule having at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2) into a vector. The insertion can be made such that the Nmb or Nmc protein is read in frame and the Nmb or Nmc protein is produced.

[0116] Nmb nucleic acid coding sequences (e.g., having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2, or having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97% sequence identity to SEQ ID NO:1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) , at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38) or Nmc nucleic acid coding sequences (e.g., encoding proteins with at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38) can be engineered to allow for the insertion or integration of sequences and can be inserted into expression vectors, including but not limited to plasmids, viruses, or other vehicles, capable of expression in either prokaryotes or eukaryotes. Hosts can include microorganisms, yeast, insects, plants, and mammalian organisms. The vector can encode a selectable marker, such as a thymidine kinase gene, an antibiotic resistance gene, or a fluorescent protein.

[0117] A nucleic acid sequence encoding an Nmb protein (e.g., having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2, or at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37). A nucleic acid molecule encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 38) or a nucleic acid sequence encoding an Nmc protein (e.g., encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 38) can be operably linked to an expression control sequence. An expression control sequence operably linked to an Nmb or Nmc protein coding sequence is ligated such that expression of the Nmb or Nmc coding sequence is achieved under conditions compatible with the expression control sequences. Exemplary expression control sequences include, but are not limited to, promoters, enhancers, transcription terminators, a start codon (i.e., ATG) in front of the Nmb or Nmc protein-encoding gene, splicing signals for introns, maintaining the correct reading frame of the gene to allow proper translation of mRNA, and stop codons.

[0118] In one embodiment, the vector is used for expression in yeast, such as S. cerevisiae, P. pastoris, or Kluyveromyces lactis. Exemplary promoters for use in yeast expression systems include constitutive promoters, plasma membrane H promoters, and the like.+-ATPase (PMA1), glyceraldehyde-3-phosphate dehydrogenase (GPD), phosphoglycerate kinase-1 (PGK1), alcohol dehydrogenase-1 (ADH1), and pleiotropic drug resistance pump (PDR5). In addition, inducible promoters such as GAL1-10 (induced by galactose), PHO5 (induced by low extracellular inorganic phosphate), and tandem heat shock HSE elements (induced by temperature increase to 37°C) are useful. Promoters that induce variable expression in response to titratable inducers include the methionine-responsive MET3 and MET25 promoters, and the copper-dependent CUP1 promoter. Any of these promoters can be cloned into multicopy (2μ) or single copy (CEN) plasmids to provide an additional level of expression level control. The plasmids can contain nutritional markers (e.g., URA3, ADE3, HIS1, and others) for selection in yeast, and antibiotic resistance (AMP) for propagation in bacteria. Plasmids for expression in K. lactis are known, such as pKLAC1, and thus, in one example, after amplification in bacteria, the plasmid can be introduced into the corresponding yeast auxotroph by methods similar to bacterial transformation.Nucleic acid molecules encoding Nmb proteins (e.g., those having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2, or those having at least 50%, at least 60%, at least 70% to SEQ ID NOs:1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37). , at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38) or nucleic acid molecules encoding Nmc proteins (e.g., those encoding proteins having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38) can also be designed for expression in insect cells.

[0119] at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, A yeast strain can be expressed with Nmc protein (e.g., with at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38). For example, seven pleiotropic drug resistance transporters YOR1, SNQ2, PDR5, YCF1, PDR10, PDR11, and PDR15, together with their activating transcription factors PDR1 and PDR3, have been simultaneously depleted in yeast host cells, rendering the resulting strain sensitive to drugs. Yeast strains with altered plasma membrane lipid composition can also be utilized, for example, erg6 mutants defective in ergosterol biosynthesis. Proteins that are highly sensitive to proteolysis can be expressed in yeast cells lacking the major vacuolar endopeptidase Pep4, which controls the activation of other vacuolar hydrolases. Heterologous expression in strains carrying a temperature-sensitive (ts) allele of the gene can be used when the corresponding null mutant is inviable.

[0120] Viral vectors encoding Nmb proteins (e.g., nucleic acid molecules having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2, or at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:1, Viral vectors encoding Nmc proteins (e.g., those containing nucleic acid molecules encoding proteins with at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 38) or Nmc proteins (e.g., those encoding proteins with at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 38) can also be prepared. Exemplary viral vectors include polyoma, SV40, adenovirus, vaccinia virus, adeno-associated virus (AVV), herpes viruses including HSV and EBV, Sindbis virus, alphaviruses, and retroviruses of avian, murine, and human origin. Baculovirus (Autographa californica nuclear polyhedrosis virus, AcMNPV) vectors can also be used. Other suitable vectors include retroviral vectors, orthopox vectors, avipox vectors, fowlpox vectors, capripox vectors, swinepox vectors, adenovirus vectors, herpes virus vectors, alphavirus vectors, baculovirus vectors, Sindbis virus vectors, vaccinia virus vectors, and poliovirus vectors.Certain exemplary vectors are poxvirus vectors, such as vaccinia virus, fowlpox virus, and highly attenuated vaccinia virus (MVA), adenovirus, baculovirus, and the like. Useful poxviruses include orthopox, swinepox, avipox, and capripoxvirus. Orthopox includes vaccinia, amplexus, and raccoonpox. One example of a useful orthopox is vaccinia. Avipox includes fowlpox, canarypox, and pigeonpox. Capripox includes goatpox and sheeppox. In one example, swinepox is swinepox. Other viral vectors that can be used include other DNA viruses, such as herpesvirus and adenovirus, and RNA viruses, such as retrovirus and polio.

[0121] Viral vectors encoding Nmb proteins (e.g., nucleic acid molecules having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2, or at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100% sequence identity to SEQ ID NO:1, A viral vector encoding an Nmb protein (e.g., a nucleic acid molecule encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38) or an Nmc protein may contain at least one expression control element operably linked to the nucleic acid sequence encoding the Nmb protein or the Nmc protein. The expression control element is inserted into the vector to control and regulate expression of the nucleic acid sequence. Examples of expression control elements useful in these vectors include, but are not limited to, the lac system, the operator and promoter regions of phage lambda, yeast promoters, and promoters derived from polyoma, adenovirus, retrovirus, or SV40. Additional operational elements include, but are not limited to, leader sequences, termination codons, polyadenylation signals, and any other sequences required for proper transcription and subsequent translation of the nucleic acid sequence encoding the Nmb protein in a host system. Expression vectors may contain additional elements required for the transfer and subsequent replication of the expression vector containing the nucleic acid sequence in a host system.Examples of such elements include, but are not limited to, an origin of replication and a selectable marker. Such vectors can be constructed using conventional methods (Ausubel et al., (1987) in "Current Protocols in Molecular Biology," John Wiley and Sons, New York, NY) and are commercially available.

[0122] In one example, a viral vector encoding an Nmb protein (e.g., a nucleic acid molecule having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2, or at least 50%, at least 60%, at least 70%, at least 80%, at least 9 ... The viral vector encoding an Nmc protein (e.g., a nucleic acid molecule encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 38) or a viral vector encoding an Nmc protein (e.g., a nucleic acid molecule encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 38) is a lentiviral or AAV vector and includes a promoter operably linked to the Nmb coding sequence. In some examples, the promoter is a constitutive promoter, such as CMV, beta actin, or T7, or a tissue-specific promoter, such as a lung-specific promoter (e.g., a lung-specific surfactant protein B gene promoter, SP-B promoter, or CC10 promoter) or a skin-specific promoter (e.g., a kerain 14 promoter, a filaggrin promoter, or a transglutaminase 3 promoter).

[0123] Recombinant viruses containing a heterologous DNA sequence encoding an Nmb protein (e.g., a nucleic acid molecule having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2, or at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:1, Methods are known for preparing recombinant viruses containing heterologous DNA sequences encoding Nmc proteins (e.g., nucleic acid molecules encoding proteins having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38) or Nmc proteins. Such techniques include, for example, homologous recombination between viral sequences flanking the Nmb or Nmc coding sequence in a donor plasmid and the homologous sequences present in the parent virus. Vectors can be constructed, for example, by inserting heterologous DNA using unique restriction endonuclease sites that are naturally present or artificially inserted into the parent viral vector.

[0124] When the cell into which the Nmb or Nmc coding sequence is to be introduced is a eukaryotic cell, transfection methods include calcium phosphate co-precipitation, mechanical procedures such as microinjection, electroporation, insertion of plasmids encapsulated in liposomes, or viral vectors. The eukaryotic cell also can include a nucleic acid molecule having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2, or at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:1, 38) or a polynucleotide sequence encoding an Nmc protein (e.g., a nucleic acid molecule encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 38), as well as a second foreign DNA molecule encoding a selectable phenotype, e.g., a herpes simplex thymidine kinase gene, can be co-transformed. Another method is to use a eukaryotic viral vector, e.g., Simian Virus 40 (SV40) or bovine papilloma virus, to transiently infect or transform eukaryotic cells to express the protein (see, e.g., Eukaryotic Viral Vectors, Cold Spring Harbor Laboratory, (See Gluzman ed., 1982). Expression systems, e.g., plasmids and vectors The vector can be used to produce Nmb protein in higher eukaryotic cells, including, for example, COS, CHO, HeLa, and myeloma cell lines.

[0125] E. Administration and Dosing an Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37), or an Nmc protein a protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38), or a nucleic acid encoding an Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% sequence identity to SEQ ID NO:2), , at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity, or at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NOs: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37. A pharmaceutical composition comprising a nucleic acid encoding a Nmc protein (e.g., a nucleic acid molecule encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 38) can be administered in a variety of dosage forms, depending on the particular mode of administration selected.The composition may be formulated with a suitable pharma- ceutically acceptable carrier (e.g., water or saline). Such compositions may be administered to subjects with neurological disorders using the disclosed methods. In one example, the pharmaceutical composition is suitable for injection, e.g., into the skin, vein, or muscle.

[0126] In some embodiments, the pharmaceutical composition comprises a sequence identical to at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of an Nmb protein (e.g., SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37). a nucleic acid encoding an Nmc protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38), or an Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% sequence identity to SEQ ID NO:2), , at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity, or at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NOs: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37. The composition may consist essentially of a nucleic acid encoding a Nmc protein (e.g., a nucleic acid molecule encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 38), or a nucleic acid encoding an Nmc protein (e.g., a nucleic acid molecule encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 38), and a pharma- ceutically acceptable carrier. In these embodiments, no additional therapeutically active agents are included in the composition.

[0127] In other embodiments, the pharmaceutical composition comprises a sequence identical to at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of an Nmb protein, e.g., SEQ ID NO:1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37. a nucleic acid encoding an Nmc protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38), or an Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 99%, or 100% sequence identity to SEQ ID NO:2), or an Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 99%, a nucleic acid molecule having 5%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity, or at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37; the nucleic acid molecule encoding a protein having at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 38), or a nucleic acid encoding an Nmc protein (e.g., a nucleic acid molecule encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 38), and a pharma- ceutically acceptable carrier.Additional therapeutic agents may be included, such as agents for the treatment of inflammatory disorders caused by type 2 cytokines (e.g., disorders shown in Table 1). Thus, the pharmaceutical composition may include a therapeutically effective amount of another agent. Examples of such agents include, without limitation, PGE2, those listed in Section "F" below and in Table 1, or combinations thereof.

[0128] Pharmaceutically acceptable carriers and excipients useful in this disclosure are conventional. See, for example, Remington: The Science and Practice of Pharmacy, The University of the Sciences in Philadelphia, Editor, Lippincott, Williams, & Wilkins, Philadelphia, PA, 22 st See, for example, The American Journal of Clinical Chemistry, Vol. 13, No. 1, 2013. For example, parenteral formulations usually contain an injectable fluid that is a pharma- ceutical and physiologically acceptable fluid vehicle, such as water, physiological saline, other balanced salt solutions, aqueous dextrose, glycerol, and the like. For solid compositions (e.g., in powder, pill, tablet, or capsule forms), conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate. In addition to biologically neutral carriers, the pharmaceutical composition to be administered may contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, pH buffering agents, and the like, for example, sodium acetate or sorbitan monolaurate. Excipients that can be included are, for example, other proteins, such as human serum albumin or plasma preparations.

[0129] In some embodiments, an Nmb protein (e.g., having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) is used. a nucleic acid encoding an Nmc protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38), or a nucleic acid encoding an Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 90% or 100% sequence identity to SEQ ID NO:2), 6%, at least 97%, at least 98%, at least 99%, or 100% sequence identity or at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, or at least 100% sequence identity to SEQ ID NOs: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37. The nucleic acid encoding an Nmc protein (e.g., a nucleic acid molecule encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 38) is included in a controlled release formulation, e.g., a microencapsulated formulation.A wide variety of biodegradable and biocompatible polymers, methods can be used, and a wide variety of methods for encapsulating synthetic compounds, proteins, and nucleic acids can be used (see, e.g., U.S. Patent Publication Nos. 2007 / 0148074, 2007 / 0092575, and 2006 / 0246139; U.S. Patent Nos. 4,522,811, 5,753,234, and 7,081,489; PCT Publication WO / 2006 / 052285; Benita, Microencapsulation: Methods and Industrial Applications, 2007). nd ed., CRC Press, 2006).

[0130] In other embodiments, a Nmb protein (e.g., a nucleotide sequence having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) is used. or a nucleic acid encoding an Nmc protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38), or a nucleic acid encoding an Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least Nucleic acid molecules having 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity, or at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to SEQ ID NOs: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37. 6%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 38) or nucleic acids encoding Nmc proteins (e.g., nucleic acid molecules encoding proteins having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 38) are included in the nanodispersion system. See, e.g., U.S. Patent No. 6,780,324, U.S. Patent Publication No. 2009 / 0175953.For example, the nanodispersion system includes a biologically active agent and a dispersing agent (eg, a polymer, copolymer, or a low molecular weight surfactant). Exemplary polymers or copolymers that can be used include polyvinylpyrrolidone (PVP), poly(D,L-lactic acid) (PLA), poly(D,L-lactic acid-co-glycolic acid (PLGA), poly(ethylene glycol). Exemplary low molecular weight surfactants include sodium dodecyl sulfate, hexadecylpyridinium chloride, polysorbates, sorbitan, poly(oxyethylene) alkyl ethers, poly(oxyethylene) alkyl esters, and combinations thereof. In one example, the nanodispersion system includes PVP and ODP, or variants thereof (e.g., 80 / 20 weight / weight). In some examples, the nanodispersions are prepared using a solvent evaporation method, see, for example, Kanaze et al., Drug Dev. Indus. Pharm. 36:292-301, 2010; Kanaze et al., J. Appl. Polymer Sci. 102:460-471, 2006. Regarding administration of nucleic acids, one approach to administration of nucleic acids. is direct treatment with a viral vector, e.g., a lentivirus or AAV vector. As described above, the Nmb protein (e.g., SEQ ID NOs: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2, e.g., a nucleic acid molecule having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 10 2, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37), or a nucleic acid molecule encoding an Nmc protein (e.g., a nucleic acid molecule encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38) may be placed under the control of a promoter to increase expression of the Nmb or Nmc protein.

[0131] an Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37), or an Nmc protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38), 2) or an Nmc coding sequence (e.g., a nucleic acid molecule encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38) can be administered alone or in various combinations and in combination with other therapeutic compositions.In addition, an Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) or an Nmc protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, A nucleic acid molecule encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2) or a Nmc coding sequence (e.g., a nucleic acid molecule encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38) can be administered systemically or locally.

[0132] Many types of release delivery systems can be used. Examples include polymer-based systems such as poly(lactide-glycolide), copolyoxylates, polycaprolactones, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and polyanhydrides. Drug-containing microcapsules of the aforementioned polymers are described, for example, in U.S. Pat. No. 5,075,109. Delivery systems also include non-polymeric systems such as lipids, including sterols, for example, cholesterol, cholesterol esters, and fatty acids or neutral fats, for example, mono-, di-, and triglycerides; hydrogel release systems; silastic systems; peptide-based systems; wax coatings; tableting with conventional binders and excipients; partially fused implants, and the like. Specific examples include (a) an Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37), or an Nmc protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90% sequence identity to SEQ ID NO:38), 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 120, 121, 122, 123, 124, 125, 126, 127, 128,or 37), or a nucleic acid molecule encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 38, or a Nmc coding sequence (e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 39, or 40). These include, but are not limited to, (a) erosion systems in which the nucleic acid molecule encoding the protein has at least 8%, at least 99%, or 100% sequence identity with the active ingredient is contained in a matrix, such as those described in U.S. Pat. Nos. 4,452,775, 4,667,014, 4,748,034, 5,239,660, and 6,218,371, and (b) diffusion systems in which the active ingredient permeates through a polymer at a controlled rate, such as those described in U.S. Pat. Nos. 3,832,253 and 3,854,480. In addition, pump-based hardware delivery systems can be used, some of which are adapted for implantation.

[0133] Long-term sustained release implants may be suitable for treating chronic conditions, such as inflammatory disorders (see, e.g., Table 1). Long-term release, as used herein, means that the implant is constructed and arranged to deliver therapeutic levels of the active ingredient for at least 30 days or at least 60 days. Long-term sustained release implants include the release systems described above. These systems have been described for use with nucleic acids (see, U.S. Pat. No. 6,218,371). For in vivo use, nucleic acids and peptides are relatively resistant to degradation (e.g., via endonucleases and exonucleases). Thus, modifications of Nmb or Nmc proteins, such as the inclusion of a C-terminal amide, can be used.

[0134] In some examples, an Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37), or a N a nucleic acid encoding an mc protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38), or an Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or 100% sequence identity to SEQ ID NO:2); %, at least 99%, or 100% sequence identity to SEQ ID NOs: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37. The Nmc coding sequence (e.g., a nucleic acid molecule encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38) can be, for example, in the form of an aerosol spray (which can contain solid or liquid particles) in the presence of a propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane,Topical administration to the airways may be by use of dichlorotetrafluoroethane, carbon dioxide or other suitable gas, for example from pressurized packs or a nebulizer. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base, for example lactose or starch.

[0135] In some embodiments, a nucleic acid sequence that has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to an Nmb protein (e.g., SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37). a nucleic acid encoding a Nmc protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38), or a nucleic acid encoding a Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least or 37. In one embodiment, an Nmc coding sequence (e.g., a nucleic acid molecule encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 38) is administered by inhalation.For example, an Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37), or N a nucleic acid encoding an mc protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38), or an Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least or a nucleic acid molecule having 98%, at least 99%, or 100% sequence identity to SEQ ID NO:1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37. 0% sequence identity to SEQ ID NO: 38), or a nucleic acid molecule encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 38) is administered in an aerosolized form, for example, using a nebulizer, a metered dose inhaler (MDI), or a dry powder inhaler (DPI).Useful technologies include micropump nebulizers (e.g., the AEROGEN GO® system), jet nebulizers designed to produce a large fine particle fraction (e.g., the PARI LC STAR®), jet nebulizers that generate less shear during nebulization (e.g., the HUDSON MICROMIST®), and ultrasonic nebulizers (e.g., the DeVilbiss ULTRA-NEB®).

[0136] Formulations suitable for use with either jet or ultrasonic nebulizers may contain Nmb protein or nucleic acid molecules dissolved in water at a concentration of about 0.1-25 mg per mL of solution. The formulation may also include a buffer and a simple sugar (e.g., for protein stabilization and regulation of osmotic pressure). Nebulizer formulations may also contain surfactants to reduce or prevent surface-induced aggregation of Nmb or Nmc protein or nucleic acid molecules caused by atomization of the solution in forming the aerosol (U.S. Patent Application Publication No. 2007 / 0065367).

[0137] Formulations for use with MDI devices generally include micronized powders containing Nmb or Nmc proteins or nucleic acid molecules suspended in a propellant with the aid of a surfactant. The propellant can be any conventional material used for this purpose, such as hydrochlorofluorocarbons, hydrofluorocarbons, or hydrocarbons, including trichlorofluoromethane, dichlorodifluoromethane, dichlorotetrafluoroethanol, and 1,1,1,2-tetrafluoroethane, or combinations thereof. Suitable surfactants include sorbitan trioleate and soybean lecithin. Oleic acid can also be useful as a surfactant (US Patent Application Publication No. 2007 / 0065367). The device of the inhalation system may deliver a single dose (e.g., by a blister pack) or it may be a multi-dose design. To ensure dosing accuracy, delivery of the formulation can be programmed via a microprocessor to occur at a certain point in the inhalation cycle. In some cases, the MDI is portable and handheld.

[0138] Dry powder inhalation devices (DPIs) can also be used as aerosol delivery devices. The basic design of a DPI includes a metering system, a powdered composition, and a method for dispersing the composition. Forces such as rotation and vibration can be used to disperse the composition. The metering and dispersing system can be mechanically or electrically driven and can be microprocessor programmable. The device can be portable and handheld. The inhalation device can be of multi- or single-dose design and can use options such as hard gelatin capsules or blister packs for precise unit doses. The Nmb or Nmc protein or nucleic acid molecule can be dispersed from the device by passive inhalation (e.g., the patient's own inhalation effort) or an active dispersion system can be used. Dry powders of therapeutic compositions can be sized by processes such as jet milling, spray drying, and supercritical fluid manufacturing. Acceptable excipients, such as the sugars mannitol and maltose, can be used in the preparation of powdered formulations.

[0139] Nmb proteins (e.g., proteins having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NOs: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37), and is an Nmc protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38), or a nucleic acid encoding an Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2), Nucleic acid molecules having 97%, at least 98%, at least 99%, or 100% sequence identity or at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% sequence identity to SEQ ID NO:1, A nucleic acid molecule encoding a protein having at least 99%, or 100% sequence identity to SEQ ID NO: 38), or an Nmc coding sequence (e.g., a nucleic acid molecule encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 38) can be dissolved in a carrier, e.g., saline, and nebulized using the device described above.Relevant aerosols can be collected using the NEXT GENERATION IMPACTOR® (NGI) (MSP Corp., Shoreview, MN), which uses a series of aerodynamic stages to separate and collect the aerosol into distinct fractions based on droplet size, such as those deposited in the small airways and alveoli.

[0140] Aerosol particle size is often expressed as the mass median aerodynamic diameter (MMAD), a parameter based on size, shape, and density. For spherical particles, the MMAD is calculated as: MMD(p 1 / 2 ), where MMD is the mass median diameter and r is the bulk density. For non-spherical particles, MMAD is equal to MMD(p / x) 1 / 2 where X is a shape factor. Thus, a particle with greater than unit density will have an actual diameter smaller than its MMAD.

[0141] The deposition site of the particles in the respiratory tract is bounded based on particle size. In one example, particles of about 1 to about 500 microns are utilized, such as particles of about 25 to about 250 microns, or about 10 to about 25 microns. In other embodiments, particles of about 1 to 50 microns are utilized. For use with a metered dose inhaler device, for administration to the lungs, particles less than about 10 microns can be utilized, such as particles of about 2 to about 8 microns, such as particles of about 1 to about 5 microns, such as particles of 2 to 3 microns.

[0142] The dosage form of the pharmaceutical composition can be determined by the mode of administration selected. For example, in addition to injections, topical, inhalation, oral, and suppository formulations can be used. Topical preparations can include eye drops, ointments, sprays, patches, and the like. Inhalation preparations can be liquid (e.g., solutions or suspensions), and can include mists, sprays, and the like. Oral preparations can be liquid (e.g., syrups, solutions, or suspensions), or solid (e.g., powders, pills, tablets, or capsules). Suppository preparations can also be in solid, gel, or suspension form. For solid compositions, conventional non-toxic solid carriers can include pharmaceutical grades of mannitol, lactose, cellulose, starch, or magnesium stearate.

[0143] In some examples, an Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37), or an Nm c protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38), or an Nmb coding sequence (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least A therapeutically effective amount of a nucleic acid molecule encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 38) or an Nmc coding sequence (e.g., a nucleic acid molecule encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 38) may be administered to: (1) reduce inflammation, e.g., in the lungs or at the site of an allergic response, e.g., by increasing the amount of Nmb or Nmc protein or nuclei; (2) reducing IL-5, e.g., in ILC2 and / or T cells, e.g., by at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, or at least 90% compared to administration of the nucleic acid molecule without the administration of the nucleic acid molecule;(3) reducing IL-13, e.g., in ILC2 and / or T cells, e.g., by at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, or at least 90% compared to administration of the Nmb or Nmc protein or nucleic acid molecule; (4) reducing an ILC2 and / or T response, e.g., the number of proliferative and / or activated ILC2 and / or T cells present, e.g., by at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, or at least 90% compared to administration of the Nmb or Nmc protein or nucleic acid molecule. %, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, or at least 90% reduction, etc., and / or (5) the amount of Nmb or Nmc protein or nucleic acid encoding Nmb or Nmc necessary to reduce eosinophilia, e.g., in the lungs or peripheral blood, e.g., a reduction of at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, or at least 90%, etc., compared to no administration of the Nmb or Nmc protein or nucleic acid molecule.

[0144] at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 100%, at least 101%, at least 102%, at least 103%, at least 104%, at least 105%, at least 106%, at least 107%, at least 108%, at least 109%, at least 110%, at least 111%, at least 112, at least 113, at least 114, at least 115, at least 116, at least 117, at least 118, at least 119, at least 120, at least 122, at least 123, at least 124, at least 125, at least 126, at least 127, at least 128, at least 129, at least 130, at least 131, at least 132, at least 133, at least 134, at least 135, at least 136, at least 137, at least 138, at least 139, at least 140, at least 141, at least 142, at least 143, at least 144, at least 145, at least 146, at least 147, at least 148, at least 149, at least 150, at least 151, at least 152, at least 153, at least 154, at least 155, at least 156, at least 157, at least 158, at least 159, at least 160, at least 161, at least 162, at least 163, at least 164, at least Pharmaceutical compositions comprising an Nmc protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 38) or an Nmc protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 38) can be formulated in unit dosage forms suitable for individual administration of precise dosages. In one non-limiting example, the unit dosage form contains at least about 1 μg to about 1 g, e.g., about 1 mg to 100 mg, 10 mg to about 100 mg, about 50 mg to about 500 mg, about 50 mg to about 100 mg, about 100 mg to about 900 mg, about 250 mg to about 750 mg, or about 400 mg to about 600 mg of Nmb protein (e.g., at least about 1 mg to about 100 mg, for SEQ ID NOs: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37). In some embodiments, the nucleic acid sequence of the present invention comprises a nucleic acid sequence having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38) or an Nmc protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38).In other examples, a peptide having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to an Nmb protein (e.g., SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37). A therapeutically effective amount of a medicament for treating a pulmonary edema (e.g., a pulmonary edema) or Nmc protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 38) is from about 0.01 mg / kg to about 50 mg / kg, e.g., from about 0.1 mg / kg to about 10 mg / kg, from about 0.1 mg / kg to about 1 mg / kg, or from about 1 mg / kg to about 10 mg / kg. In other examples, the nucleic acid sequence of the Nmb protein (e.g., SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) can be at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or A therapeutically effective amount of Nmc protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38) is from about 0.1 ug / kg to about 10 ug / kg, from about 0.1 ug / kg to about 1 ug / kg, for example, about 0.8 ug / kg.In particular examples, a sequence similar to that of an Nmb protein (e.g., SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) can be used to identify a sequence similar to that of an Nmb protein (e.g., SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37), A therapeutically effective amount of Nmc protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 38) is from about 1 mg / kg to about 10 mg / kg, for example, about 2 mg / kg.

[0145] Other suitable ranges include doses of Nmb or Nmc protein of about 100 μg / kg to 10 mg / kg body weight or more (e.g., about 0.1-10 mg / kg, about 1-20 mg / kg, about 5-50 mg / kg, or about 10-100 mg / kg). In certain embodiments, the effective dosage is selected within a narrower range, e.g., 5-40 mg / kg, 10-35 mg / kg, or 20-25 mg / kg. In other examples, the dosage is about 1-100 mg, e.g., about 1-10 mg, about 5-25 mg, about 10-50 mg, about 25-60 mg, or about 50-100 mg (e.g., about 1 mg, 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 70 mg, 80 mg, 90 mg, or 100 mg). In particular examples, the dosage is about 20-60 mg, and in one non-limiting example, about 25 mg.

[0146] Nmb coding sequences (e.g., those encoding proteins having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37, e.g., those encoding proteins having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2, e.g., Pharmaceutical compositions comprising an Nmc coding sequence (e.g., a nucleic acid molecule encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 38) or an Nmc coding sequence (e.g., a nucleic acid molecule encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 38) can be formulated in a unit dosage form suitable for individual administration of precise dosage amounts. Generally, the number of recombinant viral vectors carrying a nucleic acid coding sequence for an Nmb protein to be administered is based on the titer of the viral particles.In one non-limiting example, for example, the viral vector may comprise a nucleic acid encoding an Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37), or an Nmc coding sequence (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 38). When used for administration of a nucleic acid molecule encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 2, for example, a vector containing a nucleic acid molecule having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 2, the unit dosage (e.g., 0.5 to 1.5 μl) is about 10 per mammal. 5 ~about 10 10 plaque forming units (pfu) / ml. Thus, in some examples, the recipient subject receives about 10 5 ~about 10 10 In some cases, the recipient subject is administered a dose of the recombinant virus of at least 10 pfu / ml per mammal. 5 pfu / ml, at least 10 per mammal 6 pfu / ml, at least 10 per mammal 7 pfu / ml, at least 10 per mammal 8 pfu / ml, at least 10 per mammal 9 pfu / ml, or at least 10 per mammal 10pfu / ml. Exemplary methods for administering the composition to a mammal include, but are not limited to, injection of the composition into the affected tissue (e.g., skin or lung), or intravenous, subcutaneous, intradermal, or intramuscular administration.

[0147] at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97% relative to an Nmb protein (e.g., SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) , at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 38), or an Nmc protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 38), or an Nmb coding Compositions of the disclosure that include a sequence (e.g., a nucleic acid molecule having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2), or an Nmc coding sequence (e.g., a nucleic acid molecule encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38) can be administered to a human or other animal by any means, including orally, intravenously, intramuscularly, intraperitoneally, intranasally, intradermally, intraparenchymal, intraventricularly, intrathecally (e.g., cisterna magna and lumbar), subcutaneously, by inhalation, or by suppository. In one non-limiting example, the composition is administered by injection. In some cases, site-specific administration of the composition may be used, for example, by administering the Nmb or Nmc protein or coding sequence to skin tissue or into the lungs (eg, by inhalation).

[0148] Treatment may involve a single administration, or multiple administrations (eg, at least two separate administrations), eg, dosing over a period ranging from several days to several months, or even years. For example, a therapeutically effective amount of an Nmb protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37), or an Nmc protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2), or a nucleic acid molecule encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38), may be administered in a single dose, or in multiple doses, e.g., daily, weekly, monthly, or yearly, during the course of treatment. In certain non-limiting examples, treatment includes administration once a month, once a year, or every other month. In some cases, when multiple doses are administered, at least two separate administrations may be separated by at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 1 month, at least 2 months, at least 3 months, at least 6 months, at least 9 months, or at least 1 year.

[0149] In some cases, administration of the first dose (and in some cases, the only dose) occurs within 1 minute, within 10 minutes, within 15 minutes, within 30 minutes, within 1 hour, within 2 hours, within 3 hours, within 4 hours, within 5 hours, within 6 hours, within 12 hours, within 24 hours, within 48 hours, within 72 hours, within 96 hours, within 1 week, within 2 weeks, within 3 weeks, within 4 weeks, within 1 month, within 2 months, or within 3 months of onset of the disorder (e.g., type 2 cytokine inflammation), e.g., within 1-24 hours, within 2-24 hours, within 4-24 hours, or within 1-96 hours of onset of the disorder.

[0150] In some embodiments, the present invention is directed to a method for the preparation of a nucleic acid sequence similar to that of SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37), or a nucleic acid sequence similar to that of SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37), or a nucleic acid sequence similar to that of SEQ ID NO: 38, A nucleic acid molecule encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2) or a nucleic acid molecule encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38) is administered prophylactically before exposure to an allergy trigger. For example, a patient with asthma can be treated with a Nmb or Nmc protein or nucleic acid molecule before exercise or before exposure to an environmental trigger, such as air pollutants or allergens. Preventive treatment can also be useful for treating subjects at risk of exposure to chemicals, such as first responders to chemical accidents.Nmb or Nmc protein or nucleic acid molecule can also be administered prophylactically to asymptomatic individuals who are repeatedly exposed to agents known to trigger asthma episodes in subjects.In one example, an effective amount of Nmb or Nmc protein or nucleic acid molecule can be administered to healthy individuals who are repeatedly exposed to allergens known to induce asthma episodes.In other embodiments, Nmb or Nmc protein or nucleic acid molecule is administered to subjects who require or have previously undergone corticosteroid (CS) therapy.Nmb or Nmc protein or nucleic acid molecule can be administered to patients suffering from asthma before participating in activities that trigger asthma attacks, to reduce the severity of asthma episodes or to completely avoid them.Thus, in some embodiments, administration of Nmb or Nmc protein or nucleic acid molecule prevents asthma episodes.In some embodiments, Nmb or Nmc protein or nucleic acid molecule is administered to those who suffer from daily symptoms to chronically improve their symptoms.

[0151] In some examples, efficacy can be measured by: (1) a reduction in inflammation, e.g., in the lungs or at the site of an allergic response, e.g., a reduction of at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, or at least 90% compared to administration of the Nmb or Nmc protein or nucleic acid molecule; (2) a reduction in IL-5, e.g., a reduction of at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, or at least 90% compared to administration of the Nmb or Nmc protein or nucleic acid molecule; (3) a reduction in IL-13, e.g., a reduction of at least 5%, at least 10%, at least 15%, at least 20% compared to administration of the Nmb or Nmc protein or nucleic acid molecule; (4) a reduction in the number of proliferative and / or activated ILC2 and / or T cells present, such as a reduction of at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, or at least 90% compared to without administration of the Nmb or Nmc protein or nucleic acid molecule, and / or (5) a reduction in eosinophilia in the lungs or peripheral blood, such as a reduction of at least 5%, at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 75%, or at least 90% compared to without administration of the Nmb or Nmc protein or nucleic acid molecule.

[0152] In some examples, the effectiveness of treatment is measured by monitoring lung function.For example, various measurable parameters of lung function can be examined before, during, or after treatment.Lung function can be monitored by examining any of several physically measurable operations of the lung, including but not limited to inhalation flow rate, exhalation flow rate, and lung volume.A statistically significant increase in one or more of these parameters indicates the effectiveness of treatment.A reduction in symptoms, exacerbations of asthma, use of rescue inhalation device, or measures of inflammation is also evidence of effectiveness.

[0153] The most commonly used methods of measuring lung function in clinical practice involve timed measurements of inspiratory and expiratory maneuvers to measure specific parameters. For example, FVC measures the total volume in liters that a patient forcefully exhales after an initial deep inspiration. This parameter, when assessed in conjunction with FEV1, allows for a quantitative assessment of bronchoconstriction. A statistically significant increase in FVC or FEV1, as determined by a formula, reflects a reduction in bronchoconstriction and indicates that a therapy is effective.

[0154] In addition to measuring the volume of exhaled air as an index of lung function, the flow rate in liters per minute measured over different parts of the exhalation cycle can be useful for determining the state of the lung function of a patient.Specifically, the peak expiratory flow rate, which is taken as the highest airflow rate in liters per minute during forced maximum exhalation, correlates well with the overall lung function in patients with asthma and other respiratory diseases.Therefore, a statistically significant increase in peak expiratory flow rate after administering TPO inhibitor indicates that the treatment is effective.

[0155] F. Administration of Additional Treatments In some examples, the amino acid sequence of the Nmb protein (e.g., SEQ ID NO: 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37) is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 100%, at least 102%, at least 104%, at least 106%, at least 108%, at least 109%, at least 200%, at least 201%, at least 202%, at least 203%, at least 204%, at least 205%, at least 206%, at least 207%, at least 208%, at least 209%, at least 300%, at least 301%, at least 302%, at least 303%, at least 304%, at least 305%, at least 306%, at least 307%, at least 308%, at least 309%, at least 310%, at least 311%, at least 312%, at least 313%, at least 314%, at least 315%, at least 316%, at least 317%, at least 318%, at least 319%, at least 320%, at least 321%, at least 322%, at least 323%, at least 324%, at least 325%, at least 326%, at least 327 %, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38), or Nmc protein (e.g., a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38). ), or an Nmb coding sequence (e.g., having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2), or an Nmc coding sequence (e.g., a nucleic acid molecule encoding a protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38) is administered in combination (e.g., sequentially, simultaneously, or contemporaneously) with one or more other agents, such as those useful in the treatment of inflammatory disorders or other disorders listed in Table 1. The terms "combined administration" or "co-administration" refer to both simultaneous and sequential administration of active agents.

[0156] In some examples, Nmb or Nmc protein or Nmb or Nmc coding sequence is administered to the subject in combination with an effective dose of a corticosteroid (e.g., methylprednisolone or prednisone), an antihistamine, or both. In some examples, Nmb protein or Nmb coding sequence is administered to the subject in combination with an effective dose of an IL-4 inhibitor (e.g., dupilumab), an IL-5 inhibitor (e.g., mepolizumab, benralizumab, and reslizumab), an IL-13 inhibitor (e.g., tralokinumab and lebrikizumab), or a combination thereof. In another example, Nmb or Nmc protein or Nmb or Nmc coding sequence is administered to the subject in combination with an effective dose of PGE2.

[0157] In some examples, the Nmb or Nmc protein or Nmb or Nmc coding sequence is administered to the subject in combination with an effective dose of an agent for preventing or treating one or more signs or symptoms associated with an airway disorder (e.g., asthma or COPD). For example, one or more β-agonists, including beta-2 agonists (e.g., salbutamol), one or more leukotriene antagonists / formation inhibitors (e.g., zileuton, ZYFLO®, Abbott Laboratories, montelukast, SINGULAIR®, Merck and Company, and others), IgE-blocking antibodies, expectorants, or combinations thereof may also be administered.

[0158] In some examples, Nmb or Nmc protein or Nmb or Nmc coding sequence is administered in combination with an effective dose of one or more other therapeutic agents to a subject having an inflammatory disorder, such as allergy or allergic reaction, sinusitis, asthma (including mild, moderate, or severe, eosinophilic asthma), COPD, idiopathic pulmonary fibrosis (IPF), rhinitis, EGPA, eosinophilic esophagitis, eczema, urticarial, chronic pruritus, angioedema, conjunctivitis, or atopic dermatitis. For example, if the subject has an allergic reaction (e.g., seasonal allergies or an allergic reaction to dust / mold, foods (e.g., shellfish, eggs, milk, nuts, wheat), animals (e.g., dander), plants, drugs (e.g., antibiotics, e.g., sulfa or penicillin, aspirin, NSAIDs, anticonvulsants, chemotherapy drugs), insects (e.g., cockroaches, and venom of bees, hornets, wasps, Japanese yellow hornets, and fire ants), pathogens (e.g., viruses, bacteria, fungi, parasites), or chemicals (e.g., latex), the method may further include administering a therapeutically effective amount of one or more of a decongestant, an antihistamine, a corticosteroid, an immunotherapeutic drug, and epinephrine. For example, if the subject has sinusitis, the method may include administering a therapeutically effective amount of one or more of a decongestant, an antihistamine, a corticosteroid, an immunotherapeutic drug, and epinephrine. For example, if the subject has asthma (including mild, moderate, or severe, eosinophilic asthma), the method may further include administering a therapeutically effective amount of one or more of a corticosteroid, a glucocorticoid, a bronchodilator (e.g., a short-acting (e.g., salbutamol) or long-acting (e.g., formoterol) beta-2 adrenergic agonist, an anticholinergic (e.g., tiotropium and ipratropium bromide), a long-acting beta agonist (LABA) leukotriene modifier, an IL-4 inhibitor (e.g., dupilumab), mepolizumab, benralizumab, reslizumab, tralokinumab, and lebrikizumab.For example, if the subject has COPD, the method may further include administering a therapeutically effective amount of one or more of a corticosteroid, a bronchodilator (e.g., a short-acting (e.g., salbutamol) or long-acting (e.g., formoterol) beta-2 adrenergic agonist, an anticholinergic (e.g., tiotropium and ipratropium bromide), an antibiotic (e.g., erythromycin), and supplemental oxygen. For example, if the subject has idiopathic pulmonary fibrosis (IDF), the method may further include administering a therapeutically effective amount of one or more of a corticosteroid, a bronchodilator (e.g., a short-acting (e.g., salbutamol) or long-acting (e.g., formoterol) beta-2 adrenergic agonist, an anticholinergic (e.g., tiotropium and ipratropium bromide), an antibiotic (e.g., erythromycin), and supplemental oxygen. For example, if the subject has rhinitis, the method may further include administering a therapeutically effective amount of one or more of an antihistamine nasal spray, a corticosteroid nasal spray, an anticholinergic nasal spray (e.g., ipratropium), and a decongestant (e.g., pseudoephedrine or phenylephrine). For example, if the subject has EGPA, the method further includes administering a therapeutically effective amount of one or more of mepolizumab, a glucocorticoid (e.g., prednisolone), an immunosuppressant (e.g., azathioprine and cyclophosphamide), and methotrexate. For example, if the subject has eosinophilic esophagitis, the method further includes administering a therapeutically effective amount of one or more of a topical corticosteroid (e.g., budesonide, fluticasone) and / or a proton pump inhibitor (e.g., omega-3 fatty acids). For example, if the subject has eczema, the method may further include administering a therapeutically effective amount of a corticosteroid (e.g., hydrocortisone, clobetasol propionate) and / or an immunosuppressant (e.g., pimecrolimus, tacrolimus). For example, if the subject has urticaria, the method may further include administering a therapeutically effective amount of a corticosteroid (e.g., hydrocortisone, clobetasol propionate) and / or an immunosuppressant (e.g., pimecrolimus, tacrolimus). In this case, the method may further include administering a therapeutically effective amount of one or more of an antihistamine (e.g., diphenhydramine, hydroxyzine, loratadine, cetirizine, desloratadine), a leukotriene antagonist (e.g., montelukast and zafirlukast), an oral glucocorticoid, an anti-inflammatory drug, omalizumab, and an inflammation suppressor. For example, if the subject has chronic pruritus, the method may further include administering a therapeutically effective amount of one or more of a corticosteroid (e.g., cortisone and prednisone), a calcineurin inhibitor (e.g., pimecrolimus and tacrolimus), and an antidepressant (e.g., prozac and zoloft). For example, if the subject has angioedema, the method may further include administering a therapeutically effective amount of an antihistamine (e.g., cetirizine) and / or an androgen. For example, if the subject has conjunctivitis, the method may further include administering a therapeutically effective amount of one or more of an antihistamine (e.g., diphenhydramine), a mast cell stabilizer (e.g., cromolyn), or an antibiotic. For example, if the subject has atopic dermatitis, the method may further include administering a therapeutically effective amount of one or more of tralokinumab, a topical corticosteroid (e.g., hydrocortisone), a topical calcineurin inhibitor (e.g., tacrolimus or pimecrolimus), and a systemic immunosuppressant (e.g., cyclospoine, methotrexate, interferon gamma-1b). For example, if the subject has an eosinophilic disorder (e.g., eosinophilic esophagitis, eosinophilic gastritis, eosinophilic gastroenteritis, eosinophilic enteritis, eosinophilic colitis, eosinophilic asthma, eosinophilic gastrointestinal disorder (EGID), eosinophilic fasciitis, EGPA, eosinophilic lung disorder, hypereosinophilic syndrome (HES)), the method may further include administering a therapeutically effective amount of one or more of a topical or systemic steroid (e.g., a corticosteroid, a glucocorticoid, e.g., prednisone), an amino acid-based diet, and an immunosuppressant (e.g., azathioprine and cyclophosphamide).In some examples, an Nmb or Nmc protein or Nmb or Nmc coding sequence is administered to a subject having a parasitic or fungal infection, and the method may further include administering a therapeutically effective amount of an antifungal agent (e.g., polyenes (e.g., amphotericin B, nystatin, natamycin), azoles (e.g., fluconazole, itraconazole, voriconazole), allylamines (e.g., terbinafine), and echinocandins (e.g., caspofungin), and / or antiparasitic agents (e.g., antihelminthic, antiprotozoal, antiamoebic).

[0159] In some examples, an Nmb or Nmc protein or an Nmb or Nmc coding sequence is administered to a subject with eosinophilic leukemia (chronic, acute, or clonal), and the method may further include administering a therapeutically effective amount of one or more of a chemotherapeutic agent (e.g., cytarabine, anthracycline, histamine dihydrochloride, interleukin 2), Gleevec, a tyrosine kinase inhibitor (e.g., sorafenib, midostalin, ponatinib), and hematopoietic stem cell transplantation.

[0160] In some examples, an Nmb or Nmc protein or an Nmb or Nmc coding sequence is administered to a subject with Hodgkin's lymphoma, and the method may further include administering a therapeutically effective amount of one or more of lebrikizumab, MOPP, radiation therapy, ABVD (adriamycin, bleomycin, vinblastine, dacarbazine), Stanford V (adriamycin, bleomycin, vinblastine, vincristine, chlormethine, etoposide, prednisone), and BEACOPP (doxorubicin, bleomycin, vincristine, cyclophosphamide, procarbazine, etoposide, prednisone).

[0161] IV. Composition Compositions that can be used with the disclosed methods are also provided. In one example, the composition comprises an isolated Nmb protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 1, or an isolated Nmc protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 38, and a liposome, wherein the Nmb or Nmc protein is encapsulated in the liposome. In one example, the composition comprises an Nmb fusion protein (or a nucleic acid molecule encoding such a fusion protein) composed of: (1) an Nmb protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:1, or an Nmc protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:38; and (2) a cell-permeable peptide. In one example, the composition comprises an isolated non-naturally occurring Nmb protein (which is not SEQ ID NO: 1) that comprises at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37, a pharma- ceutically acceptable carrier, and optionally a liposome.In one example, the composition includes at least one non-naturally occurring Nmb protein, e.g., one that has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NO:3, 4, 5, 6, 11, 12, 13, 14, 20, 22, 26, 27, 28, 29, 30, 31, 32, 35, 36, or 37, but not SEQ ID NO:1, and / or one that has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NO:26, 27, 29, 35, or 36, but not SEQ ID NO:1. In one example, the composition includes (1) a naturally occurring Nmb protein (e.g., SEQ ID NO:1), and (2) a non-naturally occurring Nmb protein, e.g., one that comprises at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37 (which is not SEQ ID NO:1). In one example, the composition comprises (1) one or more of SEQ ID NOs: 3, 4, 6, 7, 9, 10, 11, 12, 14, 15, and 19, and (2) one or more of SEQ ID NOs: 3, 4, 5, 6, 9, 11, 12, 13, 14, 18, 19, 20, 21, 22, and 23 (wherein the composition may further comprise a native Nmb protein, e.g., SEQ ID NO: 1).

[0162] In one example, the composition comprises an isolated non-naturally occurring Nmb protein (e.g., not SEQ ID NO: 1) having at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37, and a pharma- ceutically acceptable carrier (e.g., water or saline). In some examples, the non-naturally occurring Nmb protein is encapsulated in a liposome. In some examples, the non-naturally occurring Nmb protein is part of a fusion protein (or a nucleic acid molecule encoding such a fusion protein) that is composed of (1) a non-naturally occurring Nmb protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, or 37, and (2) a cell penetrating peptide. In some examples, the composition comprises a non-naturally occurring Nmb coding sequence in place of the non-naturally occurring Nmb protein. In other examples, the Nmc protein is part of a fusion protein (or a nucleic acid molecule encoding such a fusion protein) that is composed of (1) an Nmc protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 38, and (2) a cell-penetrating peptide. Such compositions may further include other materials, such as a pharma- ceutically acceptable carrier, such as water or saline. In some examples, the composition includes an Nmb or Nmc coding sequence in place of the Nmb or Nmc protein.

[0163] Exemplary cell-permeable peptides that can be used include hydrophilic peptides (e.g., TAT [YGRKKRRQRRR, SEQ ID NO: 57], SynB1 [RGGRLSYSRRRFSTSTGR, SEQ ID NO: 39], SynB3 [RRLSYSRRRF, SEQ ID NO: 40], PTD-4 [PIRRRKKLRRLK, SEQ ID NO: 41], PTD-5 [RRQRRTSKLMKR, SEQ ID NO: 42], FHV Coat-(35-49) [RRRRNRTRRNRRRVR, SEQ ID NO: 43], BMV Gag-(7-25) [KMTRAQRRAAARRNRWTAR, SEQ ID NO: 44], HTLV-II Rex-(4-16) [TRRQRTRRARRNR, SEQ ID NO: 45], D-Tat [GRKKRRQRRRPPQ, SEQ ID NO: 46], R9-Tat GRRRRRRRRRPPQ [SEQ ID NO: 47], and penetratin [RQIKWFQNRRMKWKK, SEQ ID NO: 48]), amphiphilic peptides (e.g., MAP [KLALKLALKLALALKLA; SEQ ID NO: 49], SBP [MGLGLHLLVLAAALQGAWSQPKKKRKV; SEQ ID NO: 50], FBP [GALFLGWLGAAGSTMGAWSQPKKKRKV; SEQ ID NO: 51], MPG ac-GALFLGFLGAAGSTMGAWSQPKKKRKV-cya; SEQ ID NO: 52], MPG(ΔNLS) [ac-GALFLGFLGAAGSTMGAWSQPKSKRKV-cya; SEQ ID NO: 53], Pep-2 [ac-KETWFETWFTEWSQPKKKRKV-cya; SEQ ID NO: 54], and transportan [GWTLNSAGYLLGKINLKALAALAKKIL, SEQ ID NO: 55]), periodic sequences (e.g., pVec, polyarginine RxN (4 < N < 17) chimeras, polylysine KxN (4 < N < 17) chimeras, (RAca)6R, (RAbu)6R, (RG)6R, (RM)6R, (RT)6R, (RS)6R, R10, (RA)6R, R7, and pep-1 [ac-KETWWETWWTEWSQPKKKRKV-cya, SEQ ID NO: 56]), Cr10 (cyclic polyarginine CPP), TAT 48-57 TAT 47-57 or TAT 49-57; penetratin; Pep-1; substance P, SP; polyarginines, e.g., R5-R12; pVEC; transportan; MAP; Diatos Peptide Vector 1047, DPV1047, VECTOCELL®; MPG; ADP-ribosylation factor, ARF, e.g., ARF 1-22 ;BPrPr (for example, BPrPr 1-28 );p28;VT5;Bac 7, for example, Bac 1-24 ; C105Y; PFVYLI (SEQ ID NO:58); and Pep-7.

[0164] In some cases, the composition is a liquid. In some cases, the composition is freeze-dried or lyophilized.

[0165] Such pharmaceutical compositions may further comprise one or more diluents, fillers, binders and other excipients according to the mode of administration and dosage form.The examples of therapeutically inert inorganic or organic carriers include, but are not limited to, lactose, corn starch or its derivatives, talc, vegetable oils, waxes, fats, polyols such as polyethylene glycol, water, saccharose, alcohol, glycerin, etc.Various preservatives, emulsifiers, dispersants, flavorings, wetting agents, antioxidants, sweeteners, colorings, stabilizers, salts, buffers, etc. may also be added.

[0166] In some examples, the compositions further comprise one or more carriers, auxiliary substances, or stabilizers, such as buffers (e.g., phosphate, citrate, Tris, or sodium acetate, and other organic acids), antioxidants, such as ascorbic acid, low molecular weight polypeptides (less than approximately 10 residues), proteins, such as serum albumin, gelatin, or immunoglobulins, hydrophilic polymers, such as polyvinylpyrrolidone, amino acids, such as glycine, glutamine, asparagine, arginine, leucine, or lysine, monosaccharides, disaccharides, and other carbohydrates, such as glucose, sucrose, mannose, lactose, citrate, trehalose, maltodextrin, or dextrin, chelating agents, such as EDTA, sugar alcohols, such as mannitol or sorbitol, salt-forming counterions, such as sodium, and / or non-ionic surfactants, such as Tween, Pluronic, or polyethylene glycol (PEG).

[0167] In some cases, the composition is included in a nebulizer, a metered dose inhaler (MDI), or a dry powder inhaler (DPI). A formulation for dispensing from a powder inhalation device may include a finely divided dry powder containing the Nmb peptide or nucleic acid molecule, and may also include a bulking agent, e.g., lactose, sorbitol, sucrose, or mannitol, in an amount that facilitates dispersion of the powder from the device, e.g., 50-90% by weight of the formulation. The compound may be prepared in a particulate form with an average particle size of less than 10 μM, e.g., 0.5-5 μM, for delivery to the distal lung (US Patent Application Publication No. 2007 / 0065367). EXAMPLES

[0168] The present disclosure is illustrated by the following non-limiting examples.

[0169] Example 1 material and method This example provides the materials and methods used in the examples that follow.

[0170] mouse 8-10 week old C57BL(6) wild type (WT), Mcpt8 tm1(cre)Lksy , ROSA26iDTR, and Rag2KO mice were purchased from Jackson Laboratory and were analyzed as previously described (Sullivan et al., Natl. J. Pharmacol. 2014). Immunol. 2011 Jun;12(6):527-35, 2011), Mcpt8 tm1(cre)Lksy Basophil-depleted mice were obtained by crossing the mice with ROSA26iDTR mice. All mice were maintained in a specific pathogen-free facility.

[0171] N. brasiliensis infection and administration of substances Methods for maintenance, collection, infection, and isolation of N. brasiliensis larvae were performed as previously described (Camberis et al., 2003, Animal model of Nippostrongylus brasiliensis and Heligmosomoides polygyrus. Current protocols in immunology / edited by John E. Coligan ... [et al.] Chapter 19:Unit 19.12.) Mice were injected subcutaneously with approximately 500 N. brasiliensis liensis larvae. For basophil depletion, wild-type and basophil-depleted mice were treated intraperitoneally with 0.375 μg diphtheria toxin every other day, and mice were sacrificed on days 3–7 after N. brasiliensis infection. For neuromedin B treatment, mice were anesthetized and treated with 10 μg neuromedin B (MP Biomedicals) dissolved in 50 μL PBS administered by intratracheal instillation. For antibody-mediated basophil depletion, Rag2-deficient mice were treated intraperitoneally with 20 μg anti-FceR1 alpha antibody (clone MAR-1, eBioscience) or anti-CD200R3 antibody (clone Ba103, hycult biotech) on days 1, 3, and 5 after N. brasiliensis infection.

[0172] Adoption Wild-type mice were injected (intraperitoneally) with a combination of recombinant IL-3 (1 μg) and α-IL-3 antibody (0.5 μg) (BioLegend: clone MP2-8F8) in 200 μL PBS every 3 days for 8 days. At necropsy, single cell suspensions of spleens were prepared and basophil populations were pre-purified. 15,000 basophils were resuspended in 50 μL PBS and transferred to each mouse by intratracheal instillation on days 3, 4, 5, and 6 post-infection.

[0173] Intravascular in vivo staining The intravascular in vivo staining protocol was performed as previously described (Laidlaw et al., Immunity 41:633-645, 2014). Briefly, mice were injected with 3 μg of fluorescently labeled antibody targeting CD200R (clone OX110, eBioscience) diluted in 300 μL PBS 5 min prior to euthanasia.

[0174] Preparation of lung and bronchoalveolar lavage (BAL) cell suspensions For post-necropsy BAL collection, 5 mL of PBS was injected and aspirated from the trachea of ​​each mouse, and the volume of collected BAL was recorded after collection. After BAL collection, lungs were harvested at necropsy and single cell suspensions for flow cytometry analysis were prepared as previously described (Jungblut et al., J Vis Exp 29:1266, 2009). Briefly, Lung tissue was minced and incubated in HBSS containing 2.5% FBS, collagenase D (2 mg / mL, Roche), and DNAse I (80 U / mL, Roche) for 30 min at 37°C. Cell suspensions were filtered through a 100 μM filter and analyzed by flow cytometry. Additionally, lung tissue sections were taken for real-time PCR and histological analysis.

[0175] Flow cytometry and cell sorting Cells were immunoblotted with monoclonal anti-mouse fluorescently conjugated antibodies from eBioscience or BD Biosciences: B220 (RA3-6B2), c-Kit (ACK2), CD3 (145-2C11), CD4 (GK1.5), CD5 (53-73), CD19 (1D3), NK1.1 (PK136), CD11b (MI / 70), CD11c (N418), IgE (23G3), FcεRI (MAR- Cells were stained for CD45 (30-F11), CD90 (5E10), CD127 (A7R34), F4 / 80 (BM8), γδTCR (eBioGL3), Siglec-F (E50-2440), Ly6G (1A8), Ly6C (AL-21), IL-5 (TRFK5), IL-13 (eBio13A), and Ter-119 (TER-119). For intracellular staining, cells were incubated with leukocyte activation cocktail, BD GolgiPlug™ (BD Biosciences), for 5 h at 37°C according to the manufacturer's instructions. Basophils were stained for CD45 + CD3 - CD19 - FceR1 + CD49b + Eosinophils were analyzed as CD45+ CD11b + Siglec-F + CD11c - Neutrophils were analyzed as viable CD45 + CD11b + Ly6G + ILC2s were analyzed as CD45 + CD3 - CD19 - CD11b - CD11c - NK1.1 - B220 - CD5 - Ter-119 - Gamma delta TCR - CD90 + CD127 + IL-5 + IL-13 + Samples were acquired on a BD Fortessa flow cytometer (BD Biosciences) and analyzed using FlowJo software (v10.0.5, Tree Cells were analyzed using a FACSAria II (BD Bioscience).

[0176] ILC2 in vitro culture Lung cells were isolated from the lungs of wild-type or basophil-depleted mice on day 7 after N. brasiliensis infection. ILC populations (CD45 + Lin - CD90 + CD127 + ) was pre-purified and 10,000 cells were cultured for 24 h in the presence of 100 ng / mL IL-2, IL-7, and vehicle (PBS) or 10 μg / mL neuromedin B. IL-5 and IL-13 were quantified in cell-free supernatants by ELISA.

[0177] RNA isolation and quantitative real-time PCR analysis RNA from lung tissue sections was isolated by homogenization with TRIzol (Invitrogen), followed by phenol-chloroform extraction and isopropanol precipitation. cDNA was generated using Superscript reverse transcriptase (Invitrogen) according to standard protocols and used as input for real-type PCR. Real-time data was analyzed using the ΔΔCT method using SYBR Green chemistry (Applied Biosystems) with β-actin serving as an endogenous housekeeping gene. All reactions were performed on an ABI 7500 Fast Real-Time PCR System (Applied Biosystems). Samples were normalized to naive controls. The following QuantiTech primer assays from Qiagen were used: Mcpt1 (QT00157864), IL-4 (QT00160678), IL-5 (QT00099715), IL-13 (QT00099554), Mcpt8 (QT00131565), Nmb (QT00105945), Nmbr1 (QT00312494), Muc5ac (QT01161104).

[0178] Pulse oximetry. Oxygen saturation was assessed using a MouseOx Plus® (Starr Lifesciences Corp) according to the manufacturer's instructions. Briefly, hair around the thighs was removed 1 day before N. brasiliensis infection, mice were anesthetized with 5% isoflurane, and oxygen saturation was monitored at approximately 5-minute intervals using a thigh sensor.

[0179] statistics Results are presented as mean ± standard error of the mean. Statistical analysis was performed using Student's t-test in GraphPad Prism version 6.

[0180] Example 2 Basophils regulate helminth-induced inflammation Parameters of type 2 cytokine-mediated inflammation induced by Nbs in the presence and absence of basophils were examined.

[0181] Although lineage-specific depletion of basophils (11) did not alter gastrointestinal inflammation or shedding of infected worms (Fig. 1A), basophil depletion resulted in a significant increase in type 2 cytokine responses in the lungs (Fig. 1B). An in vivo staining protocol used to distinguish blood- and tissue-resident cells (12) revealed that tissue-resident basophil populations were evident in the lungs as early as day 3 postinfection, peaking at day 5 (Fig. 1C, 1D).

[0182] Effector cells activated in the context of type 2 cytokine responses have been reported to promote parasite clearance, but they also promote the integrity of parasite-affected tissues (2). Because Nb larvae exit the lung tissue 3 days postinfection, before the arrival of the majority of basophils, basophils may regulate inflammation to restore lung function rather than functioning to limit parasite numbers. Supporting this hypothesis, Nb-infected mice depleted of basophils showed altered lung pathology characterized by increased mucus production (Figure 2A) and inflammatory cell infiltration (Figures 1E, 2B), and had significantly reduced oxygen levels compared to control mice (Figure 1F). Taken together, these data indicate that the basophil population negatively regulates infection-induced type 2 cytokine responses and helps maintain lung function after infection.

[0183] Example 3 Basophils negatively regulate ILC2 responses Microscopic analysis of the lung pathology observed in Example 2 demonstrated that basophil-depleted mice had elevated infection-induced eosinophil responses.

[0184] Flow cytometric analysis of bronchoalveolar lavage (BAL) fluid and lung infiltrates confirmed that infection-induced neutrophilia was not significantly altered (Figures 3A, 4A), but basophil-depleted mice showed a significant increase in BAL and pulmonary eosinophil responses (Figures 3B, 4B). Nb-induced eosinophil responses and mucus production are dependent on IL-5 and IL-13 produced by type 2 innate lymphoid cells (ILCS2) and / or CD4+ T cells (1-3). Lung basophil responses occur during the innate window, when ILC2 responses are critical during the first few days (days 3-5) after infection (13, 14). Furthermore, the ability of basophils to communicate with ILC2 and modify their activation state has been demonstrated (2).

[0185] Therefore, we determined whether basophil-depleted animals showed elevated infection-induced ILC2 responses that correlated with increased mucus production and eosinophilia (14). Interestingly, ILC2 populations were increased in both BAL and lung tissues of basophil-depleted mice compared to controls (Figures 3C, 4C). Furthermore, increases in ILC2s producing IL-5 and IL-13 were also detected in BAL and lung tissues of basophil-depleted mice after infection (Figures 3D, 3E, 4D). To exclude the possibility of off-target depletion effects, a gain-of-function approach was used. Diphtheria toxin receptor (DTR)-negative basophils were introduced into basophil-depleted mice. Intratracheal transfer of DTR-negative basophils into basophil-depleted mice was sufficient to suppress ILC2 responses and eosinophilia back to wild-type levels in both BAL and lungs (Figures 3F–3H, 4E–4G). Taken together, these loss- and gain-of-function approaches indicate that basophils negatively regulate pulmonary ILC2 responses following Nb infection.

[0186] Example 4 Basophils promote Nmbr expression in ILC2 To confirm that the effect of basophil depletion occurs independently of acquired lymphocytes, mice lacking the recombination activating gene (Rag2) were treated with the basophil-depleting antibody Ba103. Rag2- / - mice treated with Ba103 showed a significant increase in Nb-induced ILC2 responses (Figure 5A) and increased eosinophilia (Figure 5B) compared to control mice. Taken together, both loss-of-function and gain-of-function approaches indicate that basophils negatively regulate pulmonary ILC2 responses following Nb infection.

[0187] To identify the mechanisms by which basophils regulate ILC2s, whole-genome transcriptional profiling was performed on lung ILC2s after Nb. ILC2s from control animals were enriched for pathways related to sensory transduction, seven-transmembrane domain receptors (7TM), G protein-coupled receptor signaling, and rhodopsin-like signaling compared to ILC2s sorted from basophil-depleted mice (Figure 5C).

[0188] Notably, one of the effector genes associated with these pathways was neuromedin B receptor (Nmbr) (Figure 5D). Neuromedin B (Nmb) is part of the neuromedin peptide family, which includes neuromedins A, B, C, K, L, N, S, and U (15, 16). Neuromedin B is a bombesin-like peptide expressed in the mammalian central nervous system, lung, gastrointestinal tract, and adipose tissue (15, 17). Previous studies have suggested that Nmb and its receptors are localized to neurons found in the submucosa (18). Upon binding to its receptor, Nmb has been reported to regulate cell growth, body temperature, blood pressure, and glucose levels, however, its ability to regulate immunity and inflammation remains to be defined (15).

[0189] To investigate whether basophils regulate the Nmb signaling pathway in the lung after Nb infection, we examined the expression of Nmb and its receptor in the presence or absence of basophils (confirmed by reduced Mcpt8 expression) (Figure 5E). No changes in Nmb expression were detected after Nb infection (Figure 5F), however, Nmbr was expressed at significantly higher levels in infected animals. Furthermore, basophil depletion resulted in a significant reduction in Nmbr expression in the lung (Figure 5G). Consistent with the RNAseq analysis, Nmbr expression was also significantly reduced in ILC2s purified from basophil-deficient mice compared to controls (Figure 5H).

[0190] Example 5 Nmb suppresses type 2 cytokine responses To determine whether Nmb acts as a negative regulator of type 2 cytokine responses, mice were infected with Nippostrongylus and treated with recombinant native Nmb (SEQ ID NO: 1). Seven days after infection, parameters of type 2 cytokine-dependent inflammation were assessed.

[0191] Surprisingly, although Nmb treatment had no effect on infection-induced neutrophilia, mice treated with Nmb showed reduced ILC2 responses (Figure 6A), IL-5 and IL-13 expression (Figure 6B), eosinophilia (Figure 6C), and were unable to clear infected worms as efficiently as control mice (Figure 6D). These data indicate that Nmb acts as a negative regulator of type 2 cytokine-mediated immunity.

[0192] To determine whether Nmb can directly inhibit Nb-activated ILC2s in the lung and whether basophils regulate this process, pulmonary ILC2s from Nb-infected control and basophil-depleted mice were purified and cultured overnight in the presence or absence of Nmb. Surprisingly, treatment with Nmb significantly reduced IL-5 and IL-13 production by ILC2s isolated from basophil-sufficient mice, but not from basophil-depleted mice (Figure 6E).

[0193] Example 6 Nmb treatment is sufficient to suppress allergic airway inflammation ILC2 responses are major contributors to type 2 cytokine production, eosinophilia, and mucus production associated with allergic inflammation (14). Furthermore, activated ILC2s play a role in the activation of TH2 cells, which are key regulators of allergic inflammation (13, 14). Thus, ILC2s represent a significant therapeutic potential cell population that can be targeted to treat numerous forms of allergic disease. The data presented above show that Nmb can inhibit ILC2 responses in the context of parasitic helminth infection. To show that Nmb can be used to treat allergic inflammation, the following experiments were performed.

[0194] We utilized a well-established model of papain-induced allergic airway inflammation, known to be ILC2-dependent (19, 20). Mice treated with papain showed elevated percentages of ILC2 (Figure 7A), elevated expression of IL-5 and IL-13 by ILC2 (Figure 7B), and pulmonary eosinophilia (Figure 7C). Importantly, in vivo administration of Nmb was sufficient to reduce papain-induced ILC2 responses and eosinophilia (Figures 7A-7C), demonstrating that Nmb can be used therapeutically to treat allergic inflammation. Thus, Nmb negatively regulates ILC2 responses both in vivo and in vitro.

[0195] ILC2s share many common features with their adaptive TH2 counterparts, and therefore it is possible that Nmb also has the ability to inhibit TH2 cells (13, 14). At the time points assessed after Nb, the majority of type 2 cytokines are ILC2-derived (14), and any effect that Nmb has on TH2 cell responses may be difficult to detect. To address this, lung-draining LNs were isolated 7 days after Nb and stimulated with anti-CD3 and anti-CD28 in both the presence or absence of recombinant Nmb to activate T cells. LN cells treated with anti-CD3 and anti-CD28 produced increased amounts of IL-5 and IL-13 (Figures 7D, 7E). Cultures treated with Nmb showed a significant reduction in the levels of IL-5 and 13 (Figures 7D, 7E). These data suggest that Nmb inhibits activated T H We also demonstrate that it inhibits cytokine production from IL-2 cells.

[0196] Example 7 Nmb protein variants The above results demonstrate that Nmb operates as a negative regulator of both ILC2 and TH2 cell responses and is sufficient to reduce type 2 cytokine-mediated inflammation, for example, in subjects with parasitic infection and / or allergic airway inflammation. Thus, Nmb can be used to reduce type 2 cytokine-mediated inflammation. Native Nmb is a 10-mer peptide (SEQ ID NO: 1) that operates through its ability to bind to the Nmb receptor (15). This example shows the results of an alanine scan (Table 2) in which various residues of Nmb are systematically replaced with alanine, and the resulting ability of the variant Nmb peptide to inhibit type 2 cytokine production by TH2 cells. Additionally, a cap was added to the native form of Nmb (SEQ ID NO: 1) and its bioactivity was monitored (Figure 5A). [Table 2-1] [Table 2-2]

[0197] Peptides C, F, and K (SEQ ID NOs: 5, 8, and 13, respectively) showed a significant reduction in the ability to inhibit IL-5 production compared to the native form of Nmb (SEQ ID NO: 1), but none of the Nmb variant peptides showed a significant enhancement in the ability to inhibit IL-5 production (Figure 7F). In contrast, peptides F and H (SEQ ID NOs: 8 and 10, respectively) had a significant reduction in the ability to inhibit IL-13 production, and peptides A, B, C, D, I, J, K, and L (SEQ ID NOs: 3, 4, 5, 6, 11, 12, 13, and 14, respectively) had a significantly greater ability to inhibit IL-13 compared to native Nmb (Figure 7G).

[0198] T H The ability of truncated versions of Nmb (Table 2, SEQ ID NOs: 16-25) to regulate type 2 cytokine production from T.2 cells was tested. H The truncated peptides N, O, P, R, U, V, and W (SEQ ID NO: 16, 17, 18, 20, 23, 24, and 25, respectively) showed a reduced ability to suppress IL-5 production (Figure 7H). Interestingly, truncated peptide V (SEQ ID NO: 24) showed a reduced ability to inhibit IL-13, whereas peptides R and T (SEQ ID NO: 20 and 22, respectively) showed a reduced ability to inhibit T. H 2 cells (Figure 7I).

[0199] T H The effect of offset length (Table 2, SEQ ID NOs: 26-36) on the ability of Nmb to modulate type 2 cytokine production from T.2 cells was examined. As already shown above, native Nmb inhibits T.2 cytokine production from T.2 cells. H Offset peptides X (SEQ ID NO:26), Y (SEQ ID NO:27), AA (SEQ ID NO:29), AG (SEQ ID NO:35), and AH (SEQ ID NO:36) were sufficient to reduce IL-5 and IL-13 production from activated T HIn addition, peptides X (SEQ ID NO:26), Y (SEQ ID NO:27), Z (SEQ ID NO:28), AA (SEQ ID NO:29), AB (SEQ ID NO:30), AC (SEQ ID NO:31), AD (SEQ ID NO:32), AG (SEQ ID NO:35), AH (SEQ ID NO:36), and AI (SEQ ID NO:37) had a significantly enhanced ability to suppress IL-5 production from T H 2 cells (Figure 8B).

[0200] Taken together, these data indicate that Nmb can be modified to inhibit type 2 cytokine production and that these modified peptides may have greater therapeutic potential to modify type 2 inflammation than the native version of Nmb (SEQ ID NO:1).

[0201] In addition, these data indicate that combinations of Nmb variant peptides, such as a combination of at least one variant peptide that reduces IL-5 and at least one variant peptide that reduces IL-13, such as the peptide combinations shown in Table 3, can be used in the disclosed methods. Additionally, these data indicate that native Nmb (SEQ ID NO:1) can be used in combination with one or more Nmb variant peptides, such as (1) native Nmb and at least one variant peptide that reduces IL-5, (2) native Nmb and at least one variant peptide that reduces IL-13, or (3) native Nmb and at least one variant peptide that reduces IL-5 and at least one variant peptide that reduces IL-13 (e.g., the peptides shown in Table 3). In one example, the method uses at least one Nmb variant peptide having enhanced ability to reduce IL-5, such as one or more of peptides X (SEQ ID NO:26), Y (SEQ ID NO:27), AA (SEQ ID NO:29), AG (SEQ ID NO:35), and AH (SEQ ID NO:36). In one example, the method uses at least one Nmb variant peptide having enhanced ability to reduce IL-13, such as one or more of peptides A, B, C, D, I, J, K, L, R, T, X, Y, Z, AA, AB, AC, AD, AG, AH, and AI (SEQ ID NOs:3, 4, 5, 6, 11, 12, 13, 14, 20, 22, 26, 27, 28, 29, 30, 31, 32, 35, 36, and 37, respectively). [Table 3]

[0202] Example 8 Neuromedin C protein In some examples, instead of (or in addition to) using Nmb protein (or variants thereof) in the disclosed methods and compositions, Neuromedin C protein (or variants thereof) is used. An exemplary natural Neuromedin C protein is GNHWAVGHLM (SEQ ID NO: 38). Alternatively, a nucleic acid molecule encoding Neuromedin C is used. Thus, a protein having at least at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NO: 38, or one nucleic acid molecule encoding at least one Neuromedin C protein having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NO: 38 can be used in the disclosed methods. Previous studies in mammals suggest that Nmb and Nmc can interact with a common receptor (PMID 1720612). Thus, Nmc and Nmb may initiate a common signaling pathway that can inhibit type 2 inflammation.

[0203] Example 9 Basophils regulate Nmbr expression NMBR expression by lung ILC2 is reduced when basophils are depleted following Nb infection. To determine whether basophils directly mediate NMBR expression or whether they operate through an intermediate pathway, ILC2 were purified from the lungs of Nb-infected mice (day 7) and cultured with the survival cytokines IL-2 and IL-7. In addition, ILC2 were cultured overnight with activated basophils, IL-4, or IL-33. NMBR expression was subsequently monitored by flow cytometry analysis after culture. The data obtained showed that ILC2 treated with IL-4 or IL-33, cytokines known to promote ILC2 activation (21, 23, 24), did not show changes in NMBR expression levels, whereas ILC2 cultured with activated basophils showed a significant increase in NMBR expression (Figure 9). Taken together, these results demonstrate that activated basophils are sufficient to directly regulate NMBR expression by ILC2.

[0204] These studies show that Nb-induced ILC2 responses are exaggerated in the absence of basophils. Furthermore, the data suggest that reduced NMB-NMBR signaling in the absence of basophils may result in an enhanced ILC2 activation state. However, ILC2 responses are also known to be regulated by several other factors after Nb challenge. Specifically, IL-33 has been reported to be a key regulator of pulmonary ILC2 responses after Nb infection (24). To address whether altered ILC2 activity in the absence of basophils was the result of reduced availability of IL-33 rather than alterations in the NMB-NMBR signaling pathway, ILC2s were purified from the lungs of Nb-infected mice (day 7) and cultured with survival cytokines (IL-2, IL-7) and / or IL-33 as well as NMB. After overnight culture, the supernatants were tested for the presence of IL-5 and IL-13 by standard ELISA. Statistical comparisons were performed using Student's t-test. The data show that NMB inhibits type 2 cytokine production from activated ILC2. Notably, NMB was sufficient to significantly reduce IL-5 and IL-13 production from ILC2 at steady state (Figures 10A-10B). Furthermore, these data reveal that although IL-33 treatment led to increased levels of IL-5 and IL-13, NMB treatment still led to a significant reduction in type 2 cytokines. Taken together, these studies demonstrate that NMB operates as a negative regulator of ILC2 even in the presence of high amounts of IL-33.

[0205] The disclosed studies suggest that NMB-NMBR signaling in hematopoietic cells is required for proper regulation of type 2 cytokine responses. To further evaluate this possibility, novel NMBR-flox mice were generated and crossed with Vav1-Cre expressing mice. Vav1 is expressed by all hematopoietic cells (22), and crossing them with the novel floxed mouse model resulted in selective deletion of NMBR in all immune cells. These mice were then infected with Nb and type 2 cytokine responses and lung pathology were evaluated. Intracellular staining for IL-5 (Figure 11A) and IL-13 (Figure 11B) was performed on ILC2s isolated from the BAL of naive or Nb infected Vav1-Cre, NMBR-flox, or Vav1-Cre-NMBR-flox mice (day 7). Statistical comparisons were performed using Student's t-test. The data indicate that NMBR-mediated signaling in hematopoietic cells is required to regulate type 2 cytokine production. Consistent with previous data, genetic deletion of NMBR in immune cells resulted in a significant elevation of IL-5 and IL-13 production by isolated ILC2s in the BAL of infected animals (Figures 11A-11B). Lung pathology (H and E staining) was assessed for naïve or Nb-infected Vav1-Cre, NMBR-flox, or Vav1-Cre-NMBRflox mice (day 7). NMBR-flox-Vav1-Cre mice showed increased cellular infiltration in the lungs and significantly worsened lung pathology (Figure 12). This indicates that NMBR-mediated signaling in hematopoietic cells is required to regulate (e.g., reduce) cellular infiltration in the lungs. These genetic approaches further confirm the importance of NMB-NMBR signaling in immune cells in properly regulating type 2 cytokine-mediated inflammation.

[0206] The data presented above suggest that NMB is a key negative regulator of type 2 cytokine responses by lymphocytes. To further understand how NMB may alter lymphocyte activation, ILC2s were purified from the lungs of Nb-infected mice and cultured overnight with survival cytokines (IL-2, IL-7) with or without Nmb. Gene expression was then assessed by RNA sequencing analysis. Specifically, after culture, cells were subjected to RNA sequencing to identify genes that were significantly up- or down-regulated (>1.5-fold) by NMB treatment (Table 4). This allowed for the identification of NMB signaling pathways. The results show that NMB treatment led to the up-regulation of several genes, including Sprr2a2, Serpinb2, Il1b, Xist, and Tsix, among others. Furthermore, NMB treatment led to the down-regulation of Hgs2, Nkg7, Klra7, P2rx7, Ly6c2, and Mcpt2, among others. Taken together, these data suggest that NMB may act by affecting the genes listed in Table 4, and that these genes may have substantial therapeutic potential. [Table 4]

[0207] The mouse model discussed above demonstrated that NMBR expression in CD45+ cells is required to properly regulate type 2 cytokine-mediated inflammation (Figures 11A-B, 12). To fully determine which cell types may require this signaling pathway to be properly regulated, expression of NMBR in lung immune cells was assessed at steady state and 7 days post-Nb. The data show that NMBR is expressed by several immune cell populations. ILC2, CD4+ and CD4- lymphocytes, alveolar macrophages, non-alveolar macrophages, eosinophils, and neutrophils were found to express various levels of NMBR (Figure 13). These data suggest that NMB may regulate inflammation through diverse cellular targets.

[0208] Example 10 Prostaglandin E2 upregulates NMBR expression in lymphocytes To fully determine the mechanism by which basophils regulate NMBR expression in lymphocytes, ILC2s were cultured with a combination of survival and activation cytokines in the presence or absence of NMB or prostaglandin E2 (PGE2). The combination of IL-25, IL-33, and NMB failed to upregulate NMBR expression by ILC2s, whereas treatment with PGE2 resulted in a significant upregulation of NMBR levels (Figure 14). These data suggest that basophils, a well-described source of prostaglandins, may regulate NMBR expression through the release of PGE2.

[0209] In light of data suggesting that PGE2 promotes Nmbr expression by lymphocytes, an embodiment of a method for treating a disorder (e.g., an inflammatory disorder) may include administering to a subject an effective amount of an Nmb peptide or nucleic acid disclosed herein and an effective amount of PGE2.

[0210] [ka] [ka]

[0211] In view of the numerous possible embodiments to which the principles of this disclosure may be applied, it is to be understood that the illustrated embodiments are merely illustrative of the invention and should not be construed as limiting the scope of the invention, which is rather defined by the following claims. Accordingly, all that comes within the scope and spirit of these claims is claimed as invention. In certain embodiments, for example, the following items are provided: (Item 1) 1. A method of treating a disorder in a mammalian subject, comprising: administering to the subject a therapeutically effective amount of at least one Neuromedin B (Nmb) protein, or at least one nucleic acid molecule encoding at least one Nmb protein. thereby treating said disorder. (Item 2) 2. The method of claim 1, wherein the disorder is an inflammatory disorder. (Item 3) 3. The method of claim 1 or 2, wherein the disorder is associated with unwanted interleukin-5 (IL-5) and / or IL-13 activity, and wherein a therapeutically effective amount of one or more Nmb proteins or one or more nucleic acid molecules encoding one or more Nmb proteins is administered to reduce IL-5 and / or IL-13 activity, thereby treating the disorder. (Item 4) 2. The method of claim 1, wherein the disorder is an allergy, an eosinophilic disorder, or an airway disorder. (Item 5) 5. The method of claim 4, wherein the airway disorder is asthma, sinusitis, idiopathic pulmonary fibrosis, rhinitis, eosinophilic granulomatosis with polyangiitis, eosinophilic esophagitis, or COPD. (Item 6) 2. The method of claim 1, wherein the disorder is a skin disorder. (Item 7) 7. The method of claim 6, wherein the skin disorder is eczema, atopic dermatitis, or urticaria. (Item 8) The method of claim 1, wherein the disorder is one listed in Table 1. (Item 9) The at least one Nmb protein is selected from the group consisting of SEQ ID NOs: 26, 27, 29, 35, 36, 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 28, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60 9. The method of any one of items 1 to 8, wherein the at least one nucleic acid molecule comprises at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NO: 26, 27, 29, 35, 36, 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 28, 30, 31, 32, 33, 34, or 37. (Item 10) 10. The method of claim 9, wherein the at least one nucleic acid molecule comprises at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:2. (Item 11) 11. The method of any one of items 1 to 10, wherein the at least one nucleic acid molecule comprises a plasmid or a viral vector. (Item 12) Item 12. The method of item 11, wherein the viral vector is a lentiviral vector or an adeno-associated viral vector. (Item 13) 13. The method of any one of items 1 to 12, wherein the at least one nucleic acid molecule is operably linked to a promoter. (Item 14) 14. The method of any one of items 1 to 13, wherein the administering step comprises injection, oral administration, inhalation administration, or topical administration. (Item 15) The method according to any one of claims 1 to 14, wherein the mammalian subject is a human subject. 16. The method of any one of items 1 to 15, wherein the therapeutically effective amount of the at least one Nmb protein or at least one nucleic acid molecule encoding at least one Nmb protein is present in a pharmaceutical composition. (Item 17) 17. The method of any one of items 1 to 16, wherein the administering step comprises at least two separate administrations of the therapeutically effective amount of the at least one Nmb protein or at least one nucleic acid molecule encoding at least one Nmb protein. (Item 18) 20. The method of claim 17, wherein the at least two separate administrations are separated by at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 1 month, at least 2 months, at least 3 months, at least 6 months, at least 9 months, or at least 1 year. (Item 19) 19. The method of any one of items 1 to 18, wherein the administering step occurs within 5 minutes, within 10 minutes, within 30 minutes, within 1 hour, within 2 hours, within 3 hours, within 4 hours, within 5 hours, within 6 hours, within 12 hours, within 24 hours, within 48 hours, within 72 hours, within 96 hours, within 1 week, within 2 weeks, within 3 weeks, within 4 weeks, within 1 month, within 2 months, or within 3 months of onset of the disorder. (Item 20) 20. The method of any one of items 1 to 19, further comprising administering to the subject a therapeutically effective amount of another therapeutic agent. (Item 21) 21. The method of any one of items 1 to 20, wherein the method reduces inflammation, reduces IL-5 activity, reduces IL-13 activity, reduces an ILC2 response, reduces eosinophilia, or a combination thereof. (Item 22) 22. The method of any one of items 1 to 21, wherein the at least one Nmb protein is a non-naturally occurring Nmb protein that comprises at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NO: 26, 27, 29, 35, 36, 3, 4, 5, 6, 11, 12, 13, 14, 20, 22, 28, 30, 31, 32, or 37. (Item 23) 23. The method of any one of items 1 to 22, wherein the at least one Nmb protein is a non-naturally occurring Nmb protein that comprises at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NO: 26, 27, 29, 35, or 36. (Item 24) an isolated Nmb protein comprising at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO:1; Liposomes and wherein said Nmb protein is encapsulated in said liposome. (Item 25) an isolated protein (not SEQ ID NO: 1) that comprises at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 26, 27, 29, 35, 36, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 28, 30, 31, 32, 33, 34, or 37; A pharma- ceutically acceptable carrier; A composition comprising: Optionally, the composition comprises a liposome, wherein said protein is encapsulated in said liposome. (Item 26) at least one protein that comprises at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NO: 26, 27, 29, 35, 36, 3, 4, 5, 6, 11, 12, 13, 14, 20, 22, 28, 30, 31, 32, or 37 that is not SEQ ID NO: 1; and / or At least one protein that contains at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NO:26, 27, 29, 35, or 36 that is not SEQ ID NO:1. A composition comprising: (Item 27) 27. The composition of claim 26, further comprising the protein of SEQ ID NO:1. (Item 28) 28. The method of any one of items 1 to 23, or the composition of any one of items 24 to 27, wherein the Nmb protein or proteins are fusion proteins comprising the Nmb protein or proteins and a cell penetrating peptide. (Item 29) 6. The method of claim 5, wherein the airway disorder is idiopathic pulmonary fibrosis or COPD and the method reduces IL-13 activity. (Item 30) 24. The method of any one of items 1 to 23, further comprising administering to the subject a therapeutically effective amount of at least one Neuromedin C (Nmc) protein, or at least one nucleic acid molecule encoding at least one Nmc protein, thereby treating the disorder. (Item 31) 1. A method of treating a disorder in a mammalian subject, comprising: administering to the subject a therapeutically effective amount of at least one Neuromedin C (Nmc) protein, or at least one nucleic acid molecule encoding at least one Nmc protein. thereby treating said disorder. (Item 32) 32. The method of claim 30 or 31, wherein the at least one Nmc protein comprises at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NO:38, or the at least one nucleic acid molecule encodes at least one Nmb protein that comprises at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% sequence identity to SEQ ID NO:38. (Item 33) 33. The method of item 31 or 32, wherein the disorder is an inflammatory disorder. (Item 34) 34. The method of any one of items 31 to 33, wherein the disorder is an allergy, an eosinophilic disorder, or an airway disorder. (Item 35) 35. The method of claim 34, wherein the airway disorder is asthma, sinusitis, idiopathic pulmonary fibrosis, rhinitis, eosinophilic granulomatosis with polyangiitis, eosinophilic esophagitis, or COPD. (Item 36) 33. The method of claim 31 or 32, wherein the disorder is a skin disorder. (Item 37) 37. The method of claim 36, wherein the skin disorder is eczema, atopic dermatitis, or urticaria. (Item 38) 38. The method of any one of items 31 to 37, wherein the disorder is one listed in Table 1. (Item 39) 39. The method of any one of items 1 to 5 and 28 to 38, wherein expression of one or more of a first set of genes comprising Sprr2a2, Serpinb2, Il1b, Xist, and Tsix is ​​upregulated. (Item 40) 40. The method of any one of items 1 to 23 and 28 to 39, wherein expression of one or more of a second set of genes comprising Hgs2, Nkg7, Klra7, P2rx7, Ly6c2, and Mcpt2 is downregulated. (Item 41) 41. The method of any one of items 1 to 23 and 28 to 40, wherein the disorder is an inflammatory disorder and the method reduces the level of cellular infiltration in the lungs of the subject. (Item 42) 42. The method of any one of items 1 to 23 and 28 to 41, further comprising administering to the subject a therapeutically effective amount of prostaglandin E2 (PGE2).

Claims

[Claim 1] The invention described in the specification.

Images