Method for predicting effect of platinum-based anticancer drug

Abstract

To provide a method for predicting the effect of platinum-based anticancer drugs.SOLUTION: The present invention discloses a method for predicting the effect of platinum-based anticancer drugs in a subject, the method including determining the genotype of a single nucleotide polymorphism (SNP) identified at rs12876842 in the subject. The present invention encompasses an oligonucleotide capable of binding to a genomic region adjacent to the SNP or a genomic region containing the SNP, as well as a composition or a kit containing oligonucleotide, used to predict the effect of platinum-based anticancer drugs.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present disclosure relates to a method for predicting the efficacy of a platinum-based anticancer drug. [Background technology]

[0002] Platinum-based anticancer drugs are central to the treatment of various cancers, including esophageal cancer, gastric cancer, and colon cancer. Platinum-based anticancer drugs are effective for some patients but not others, and in order to improve treatment outcomes, it is necessary to select and administer the drugs to patients who will benefit (and to select a different treatment for patients who will not benefit). In addition, platinum-based anticancer drugs have been reported to frequently cause side effects, including peripheral neuropathy. These side effects are known to persist for a long time, leading to a significant decrease in the patient's quality of life (QOL). Thus, there is a need to discover factors that can predict the therapeutic effectiveness of platinum-based anticancer drugs. Summary of the Invention [Problem to be solved by the invention]

[0003] An object of the present disclosure is to provide a method for predicting the therapeutic effect of a platinum-based anticancer drug. [Means for solving the problem]

[0004] In certain aspects, the present disclosure relates to a method for predicting efficacy of a platinum-based anticancer drug in a subject, comprising genotyping the subject for a single nucleotide polymorphism (SNP) identified at rs12876842.

[0005] In certain aspects, the present disclosure relates to oligonucleotides capable of binding to the genomic region adjacent to or including the SNP identified in rs12876842.

[0006] In one aspect, the present disclosure relates to a composition for predicting the efficacy of a platinum-based anticancer drug, comprising the oligonucleotide.

[0007] In one aspect, the present disclosure relates to a kit for predicting the efficacy of a platinum-based anticancer drug comprising the oligonucleotide. Effect of the Invention

[0008] This disclosure makes it possible to predict the therapeutic effect of platinum-based anticancer drugs based on genomic information. The SNPs of this disclosure are highly correlated with the therapeutic effect of platinum-based anticancer drugs, and this relationship has been confirmed in multiple independent cohorts. This disclosure contributes to improving the patient's QOL and reducing medical costs. In addition, this disclosure makes it possible to predict the therapeutic effect using a subject sample that is less invasive and easier to collect. For example, when the subject is a cancer patient, the therapeutic effect of platinum-based anticancer drugs can be predicted without collecting tissue from the lesion site containing cancer cells, and the invasiveness to the subject patient can be kept low. [Brief description of the drawings]

[0009] [Figure 1] FIG. 1 shows the results of genome-wide correlation analysis regarding the presence or absence of recurrence in esophageal cancer patients after first-line treatment with platinum-based anticancer drugs. [Diagram 2] Figure 2 shows the results of a Kaplan-Meier analysis of overall survival (OS) (left) and progression-free survival (PFS) (right) according to the rs12876842 genotype in 118 esophageal cancer patients who underwent first-line treatment including platinum-based anticancer drugs. [Diagram 3] Figure 3 shows the results of calculating the odds ratio between the rs12876842 genotype and treatment effect in cases extracted based on clinical and genomic information from Biobank Japan. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0010] Unless otherwise specified, terms used herein have the meanings commonly understood by those skilled in the art of organic chemistry, medicine, pharmacology, molecular biology, microbiology, etc. Below, definitions of some terms used herein are provided, but these definitions take precedence over the common understanding herein.

[0011] A single nucleotide polymorphism (SNP) refers to a state or site in which one nucleotide in genomic DNA differs, and generally occurs at a frequency of 1% or more. In this disclosure, SNPs are identified by their rs number, which is the ID of dbSNP (https: / / www.ncbi.nlm.nih.gov / snp / ), a database of the National Center for Biotechnology Information (NCBI).

[0012] The present disclosure includes examining the genotype of the SNP identified by rs12876842 (sometimes simply referred to as "rs12876842" in this specification). rs12876842 is present in chromosome 13 of the human genome. SEQ ID NO: 1 shows the sequence of a 1001-nucleotide-long region of the human genome containing rs12876842, and the 501st nucleotide corresponds to the position of rs12876842. Genotype refers to a combination of alleles. The major allele of rs12876842 is C, the minor allele is T, and the genotype of rs12876842 is CC, CT, or TT. ATTAATATATTCATCTTTATACCAACACCATCATAAAACACATTTTAAAAAATTTTTATGAAGGAAAAGGTCCACAAAGGCAAAAGTGCCAAGGCCCATCCCTGCTTAGAGGTGACCTGCTCCCCCCACTCCCAGAAGTTTCTGCTGCTCTGCCACCTGAGTCATTGCCAACTTTGCAAACAGCCACAGAAGAGCCATGATGTTATTATCTTGCATCAGAGAGCAACAGATGAACAGAAAGGCTAAGTATATTGGTCAGGGTCATCTTGAGAAACAGAACCAATGGAATATATATGCATATATATGTGAAGAGAATTATTGTGGCAATTGGCCAAGAAGTCCTACCTCTGCCATCTACACCCTGGACACCCAGGAAAGCCAGTTGCATAATTCAGTCCAAGTTCCGGAGCCCAAAGGTCCGAGAACCAAGAACCAATATCTAAAGGCAGGAGAAGAGGGAAGTCCCAGCTCAAGAAGAGAGAGGAAATTCCCCCTTCTTC NACCTTTTTTTTCTACTCGGGCCCTCAACGGATTGGATGATGCCCACCACATTGGTGAAGGGAGATCTTCTTTAGTCAGTCTACTAATCTTTTCAGGAAACACCCTCACAGACACACACAGAAATAA CATTTTAGCCGGGCATGGTGTCTCACGCCTGTAATTCCAGCACTTTGGGAGGCCGAGGTGGGTGGATCACGAGGTCAGGAGTTCAAGACCAGCCTAGCCAAAATGGTGAAACCCCATCTCTACTAAA TATACAAAATTAGCCAGGTGTGGTGGTGGGTGCTGCAATCCCAGCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGGAGGCAGAGGTTGCAGTGAGCCAATATTATGCCACTGCACT CCAGCCTGGGTGACAGAGTGAGATTCCATCTTAAAAAAAAAAAAAAGAAAAGAAATAACATTTTACCAGCTATCTGGGTGTCCCTTAGCTCAGCCACATTGACACATAAAATGAACCATC (SEQ ID NO: 1) N is C or T.

[0013] In one embodiment, if the genotype of the rs12876842 of the subject is CT or TT, the subject is predicted to be effective against platinum-based anticancer drugs. In a further embodiment, if the genotype of the rs12876842 of the subject is TT, the subject is predicted to be effective against platinum-based anticancer drugs. In one embodiment, if the genotype of the rs12876842 of the subject is CC, the subject is predicted to be ineffective against platinum-based anticancer drugs. The therapeutic effect prediction is not limited to the expression "effective" or "ineffective", and can be presented in similar positive and negative expressions such as "effective" or "ineffective", which can be used interchangeably.

[0014] The genotype of a subject can be examined using a sample collected from the subject and containing the subject's genomic DNA. The sample is not particularly limited as long as it contains the subject's genomic DNA in a state in which the genotype of rs12876842 can be determined. Examples of samples include blood (e.g., peripheral blood), lymphatic fluid, bone marrow fluid, and tissue (e.g., cancer tissue). In one embodiment, the sample is a blood sample. Those skilled in the art can perform the necessary processing for detecting SNPs on the sample collected from the subject.

[0015] The genotype of rs12876842 is not derived from a somatic mutation that has occurred in the subject, but from a germline variant inherited by the subject from the parents. Therefore, the sample taken from the subject to examine the genotype of rs12876842 does not need to contain genomic DNA derived from cancerous cells or tissues present in the subject, and a blood sample from the subject can be suitably used. By using a blood sample in this way, invasiveness to the subject can be reduced.

[0016] The genotype of the SNP may be determined by any method that a person skilled in the art can use to detect SNPs. The genotype of the SNP may be determined, for example, by using an oligonucleotide that can bind to a genomic region adjacent to the SNP identified by rs12876842 or a genomic region containing the SNP. Such methods include, for example, methods that utilize PCR (polymerase chain reaction), such as PCR-RFLP (restriction fragment length polymorphism), PCR-SSCP (single-strand conformation polymorphism), PCR-SSO (sequence specific oligonucleotide), ARMS (amplification refracting mutation system)-PCR, TaqMan TMExamples of such methods include PCR, ASP (allele specific primer)-PCR, direct sequencing, ASO (allele specific oligonucleotide) hybridization, SNaPshot (registered trademark) method, and Invader method.

[0017] In one embodiment, the oligonucleotide is a primer or a probe. The primer is an oligonucleotide that can be the origin of replication of a desired DNA region. The probe is an oligonucleotide that can identify the sequence of a desired DNA region based on the presence or absence of binding to the region. The sequences of the primer and the probe may be any sequences that can be used to distinguish the genotype of rs12876842, and can be appropriately determined by those skilled in the art according to the method of detecting SNP.

[0018] In one embodiment, the oligonucleotide is a primer capable of binding to a genomic region adjacent to rs12876842. The genomic region adjacent to rs12876842 may be at an appropriate distance from rs12876842 depending on the method for detecting SNP, and may be, for example, a region within 500 nucleotides from the SNP. In one embodiment, the primer can bind to a sequence of a region adjacent to the 501st base of SEQ ID NO: 1 or a sequence complementary thereto. The region adjacent to the 501st base of SEQ ID NO: 1 may be, for example, a region of 10 to 50, 10 to 40, 10 to 35, 15 to 35, 15 to 30, or 20 to 30 nucleotides in length. Two primers (also called forward primer and reverse primer) (primer pair) designed based on the sequences at both ends of a genomic region including rs12876842 may be used for detecting SNP.

[0019] In one embodiment, the primer comprises or consists of a sequence having 80, 85, 90, 95, 96, 97, 98, or 99% or more sequence identity with the sequence of the region adjacent to base 501 of SEQ ID NO: 1 or a sequence complementary thereto. In one embodiment, the primer comprises or consists of the sequence of the region adjacent to base 501 of SEQ ID NO: 1 or a sequence complementary thereto, or a sequence in which 1 to 10, 1 to 5, 1 to 3, 1, or 2 nucleotides have been altered in the sequence of the region adjacent to base 501 of SEQ ID NO: 1 or a sequence complementary thereto. In a further embodiment, the primer comprises or consists of the sequence of the region adjacent to base 501 of SEQ ID NO: 1 or a sequence complementary thereto.

[0020] In one embodiment, the oligonucleotide is a probe capable of binding to a genomic region containing a SNP identified by rs12876842. The probe may be capable of binding to a genomic region containing rs12876842 when rs12876842 is T (minor allele), or may be capable of binding to said region when rs12876842 is C (major allele). In one embodiment, the probe can bind to a genomic region containing rs12876842 when rs12876842 is T (minor allele). In one embodiment, the probe can bind to a sequence of a region containing base 501 of SEQ ID NO: 1 or a sequence complementary thereto. The region containing base 501 of SEQ ID NO: 1 may be, for example, a region of 10 to 50, 10 to 40, 10 to 35, 15 to 35, 15 to 30, or 20 to 30 nucleotides in length. In one embodiment, when the 501st position of SEQ ID NO:1 is T, the probe can bind to a sequence in a region including the 501st position of SEQ ID NO:1 or a sequence complementary thereto.

[0021] In one embodiment, the probe comprises or consists of a sequence having 80, 85, 90, 95, 96, 97, 98, or 99% or more sequence identity with the sequence of the region including base 501 of SEQ ID NO: 1 or a sequence complementary thereto. In one embodiment, the probe comprises or consists of the sequence of the region including base 501 of SEQ ID NO: 1 or a sequence complementary thereto, or a sequence in which 1 to 10, 1 to 5, 1 to 3, 1, or 2 nucleotides have been altered in the sequence of the region including base 501 of SEQ ID NO: 1 or a sequence complementary thereto. In a further embodiment, the probe comprises or consists of the sequence of the region including base 501 of SEQ ID NO: 1 or a sequence complementary thereto.

[0022] In one embodiment, the probe comprises or consists of a sequence having 80, 85, 90, 95, 96, 97, 98, or 99% or more sequence identity with the sequence of a region including base 501 of SEQ ID NO: 1 or a sequence complementary thereto, where base 501 of SEQ ID NO: 1 is T. In one embodiment, the probe comprises or consists of a sequence of a region including base 501 of SEQ ID NO: 1 or a sequence complementary thereto, or a sequence in which 1 to 10, 1 to 5, 1 to 3, 1, or 2 nucleotides have been altered in the sequence of a region including base 501 of SEQ ID NO: 1 or a sequence complementary thereto, where base 501 of SEQ ID NO: 1 is T. In a further embodiment, the probe comprises or consists of a sequence of a region including base 501 of SEQ ID NO: 1 or a sequence complementary thereto, where base 501 of SEQ ID NO: 1 is T.

[0023] Oligonucleotides of the present disclosure are typically 100 nucleotides or less in length. In certain embodiments, oligonucleotides are 10-50, 10-40, 10-35, 15-35, 15-30, or 20-30 nucleotides in length. In certain embodiments, oligonucleotides are 15-35 nucleotides in length.

[0024] In the present specification, when an oligonucleotide is said to be capable of binding to a predetermined sequence, it is sufficient that the oligonucleotide can form a double strand with the predetermined sequence under stringent conditions appropriate for the SNP detection method, and does not need to have a sequence completely complementary to the predetermined sequence. Examples of complementary base pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), and cytosine (C) and guanine (G).

[0025] In this disclosure, a nucleotide modification includes a deletion, substitution, insertion, and addition of a nucleotide. When more than one nucleotide is modified, each nucleotide modification is independently selected from a deletion, substitution, insertion, and addition.

[0026] An oligonucleotide is a compound that contains multiple nucleosides linked together by internucleoside bonds. The oligonucleotide of the present disclosure may be composed of natural nucleosides, non-natural nucleosides, or both. In addition, the internucleoside bonds of the oligonucleotide may be natural internucleoside bonds, non-natural internucleoside bonds, or both. Examples of unnatural nucleosides include LNA (Locked Nucleic Acid / 2'-O,4'-C-Methylene-bridged Nucleic Acid), AmNA (Amido-Bridged Nucleic Acid), ENA (Ethylene-bridged Nucleic Acid), peptide nucleic acid, and morpholino nucleic acid; nucleosides containing unnatural bases such as 5-methylcytosine, 5-hydroxymethylcytosine, 6-methyladenine, 6-methylguanine, 4-thiouracil, and 5-fluorouracil; and nucleosides containing sugar modifications such as 2'-F, 2'-O(CH2)2OCH3 (MOE). Examples of unnatural internucleoside bonds include phosphorothioate bonds, phosphorodithioate bonds, and alkylphosphonate bonds. An oligonucleotide may contain two or more types of nucleosides and / or internucleoside bonds. The oligonucleotides can be produced by oligonucleotide synthesis methods known to those skilled in the art, such as the phosphoramidite method.

[0027] The oligonucleotide may be labeled with an appropriate substance depending on the method for detecting SNP. Examples of the labeling substance include fluorescent substances (e.g., Cy3, Cy5), quenchers, luminescent substances (luciferin, etc.), enzymes (peroxidase, etc.), radioisotopes ( 3 H, 14 C. 32 P, and biotin. The oligonucleotide may also be immobilized on a solid phase.

[0028] The oligonucleotide of the present disclosure may be provided as a composition or kit for predicting the effect of a platinum-based anticancer drug. The composition may contain additives such as a buffer, a stabilizer, and a preservative in addition to the oligonucleotide of the present disclosure. The composition may be, for example, in liquid or lyophilized form. The kit may contain, in addition to the oligonucleotide of the present disclosure, reagents and / or containers necessary for processing a sample collected from a subject and detecting SNPs, and instructions. The composition and kit of the present disclosure may contain at least one oligonucleotide of the present disclosure, and may contain two or more. For example, the composition and kit of the present disclosure may contain two primers (e.g., one primer pair) or one probe and two primers (e.g., one primer pair).

[0029] A platinum-based anticancer drug is a compound containing a platinum complex, and exerts an anticancer effect by binding to intracellular DNA and inhibiting its replication. In one embodiment, the platinum-based anticancer drug is cisplatin, carboplatin, oxaliplatin, or nedaplatin.

[0030] In some embodiments, the subject is a cancer patient. In further embodiments, the subject is a cancer patient prior to or during treatment with a platinum-based anticancer drug. In further embodiments, the subject is a cancer patient prior to treatment with a platinum-based anticancer drug.

[0031] In some embodiments, the cancer is esophageal cancer, gastric cancer, colon cancer, pancreatic cancer, ovarian cancer, biliary tract cancer, or breast cancer. In further embodiments, the cancer is esophageal cancer or gastric cancer. In further embodiments, the cancer is esophageal cancer.

[0032] The predictive method of the present disclosure may further include examining another predictor of therapeutic effect. For example, the predictive method of the present disclosure may include examining the genotype of another SNP in the subject, such as the SNP identified in rs3815544.

[0033] If the prediction method of the present disclosure predicts that a platinum-based anticancer drug is effective for a subject, the subject can be treated with the platinum-based anticancer drug. Conversely, if the prediction method of the present disclosure predicts that a platinum-based anticancer drug is ineffective, it can be decided not to treat the subject with the platinum-based anticancer drug (and / or select another treatment method).

[0034] The present disclosure includes a method of treating cancer in a subject, comprising predicting the efficacy of a platinum-based anticancer drug in a subject by the prediction method of the present disclosure, and administering the platinum-based anticancer drug to a subject predicted to be efficacious with the platinum-based anticancer drug. In some embodiments, the platinum-based anticancer drug is cisplatin, carboplatin, oxaliplatin, or nedaplatin. In some embodiments, the cancer is esophageal cancer, gastric cancer, colon cancer, pancreatic cancer, ovarian cancer, biliary tract cancer, or breast cancer. In further embodiments, the cancer is esophageal cancer or gastric cancer. In further embodiments, the cancer is esophageal cancer.

[0035] The present disclosure includes a method for producing a nucleic acid molecule, comprising replicating and / or amplifying a genomic region containing a SNP identified by rs12876842 of a subject, and labeling the nucleic acid molecule obtained by the replication and / or amplification so as to distinguish whether the SNP is C or T. For example, different labeling substances can be used between the cases where the SNP is C and the case where the SNP is T. By using different labeling substances in this way, the nucleic acid molecule can be labeled so as to distinguish whether the SNP is C or T. For example, when replicating the genomic region, G is incorporated when the SNP is C, and A is incorporated when the SNP is T. Therefore, by using deoxyguanosine triphosphate (dGTP) and deoxyadenosine triphosphate (dATP) labeled with different labeling substances, the nucleic acid molecule can be labeled so as to distinguish whether the SNP is C or T. Alternatively, an oligonucleotide capable of binding to a genomic region containing the SNP when the SNP is C and an oligonucleotide capable of binding to a genomic region containing the SNP when the SNP is T are labeled with different labeling substances, and these oligonucleotides are used as primers or templates for replicating and / or amplifying the genomic region, thereby labeling a nucleic acid molecule so that it is possible to distinguish whether the SNP is C or T. As the labeling substance, any of those described herein can be used. In an embodiment, the present production method replicates and / or amplifies a genomic region using at least one of the oligonucleotides disclosed herein. The nucleic acid molecule may be, for example, 50 to 1000, 100 to 900, 200 to 800, 300 to 700, 400 to 600, or 400 to 500 nucleotides in length.

[0036] Exemplary embodiments of the present disclosure are described below.

[0037] [1] A method for predicting the efficacy of a platinum-based anticancer drug in a subject, the method comprising determining the genotype of the subject at a single nucleotide polymorphism (SNP) identified at rs12876842. [2] Item 2. The method according to item 1, wherein a platinum-based anticancer drug is predicted to be effective when the genotype is CT or TT. [3] Item 3. The method according to Item 2, wherein a platinum-based anticancer drug is predicted to be effective when the genotype is TT. [4] Item 4. The method according to any one of Items 1 to 3, wherein the subject is a cancer patient. [5] Item 5. The method according to item 4, wherein the cancer is esophageal cancer, gastric cancer, colon cancer, pancreatic cancer, ovarian cancer, biliary tract cancer, or breast cancer. [6] Item 6. The method according to item 5, wherein the cancer is esophageal cancer or gastric cancer. [7] Item 7. The method according to item 6, wherein the cancer is esophageal cancer. [8] Item 8. The method according to any one of Items 1 to 7, wherein the platinum-based anticancer drug is cisplatin, carboplatin, oxaliplatin, or nedaplatin. [9] Item 9. The method according to any one of Items 1 to 8, wherein the genotype is examined using a blood sample collected from the subject.

[0038]

[10] An oligonucleotide capable of binding to a genomic region adjacent to or including the SNP identified in rs12876842.

[11] Item 11. The oligonucleotide according to item 10, which is a primer or a probe.

[12] Item 12. The oligonucleotide according to item 10 or 11, which is a primer capable of binding to a genomic region adjacent to a SNP identified by rs12876842.

[13] Item 13. The oligonucleotide according to item 12, which can bind to a sequence adjacent to base 501 of SEQ ID NO: 1 or a sequence complementary thereto.

[14] Item 14. The oligonucleotide according to Item 12 or 13, comprising a sequence having 80, 85, 90, 95, 96, 97, 98, or 99% or more sequence identity with a sequence adjacent to base 501 of SEQ ID NO: 1 or a sequence complementary thereto.

[15] Item 14. The oligonucleotide according to Item 12 or 13, comprising a sequence of a region adjacent to base 501 of SEQ ID NO: 1 or a complementary sequence thereto, or a sequence in which 1 to 10, 1 to 5, 1 to 3, or 1 or 2 nucleotides have been modified in the sequence of a region adjacent to base 501 of SEQ ID NO: 1 or a complementary sequence thereto.

[16] 16. The oligonucleotide according to any one of items 12 to 15, comprising a sequence adjacent to base 501 of SEQ ID NO: 1 or a sequence complementary thereto.

[17] 17. The oligonucleotide according to any one of Items 13 to 16, wherein the region adjacent to base 501 of SEQ ID NO: 1 is a region having a length of 10 to 50 nucleotides.

[18] Item 12. The oligonucleotide according to item 10 or 11, which is a probe capable of binding to a genomic region containing a SNP identified by rs12876842.

[19] Item 19. The oligonucleotide according to item 18, which can bind to a sequence of a region including base 501 of SEQ ID NO: 1 or a sequence complementary thereto.

[20] 20. The oligonucleotide according to item 18 or 19, comprising a sequence having 80, 85, 90, 95, 96, 97, 98, or 99% or more sequence identity with a region including base 501 of SEQ ID NO: 1 or a complementary sequence thereto. [twenty one] 20. The oligonucleotide according to item 18 or 19, comprising a sequence of a region including the 501st base of SEQ ID NO: 1 or a complementary sequence thereto, or a sequence in which 1 to 10, 1 to 5, 1 to 3, or 1 or 2 nucleotides have been modified in the sequence of a region including the 501st base of SEQ ID NO: 1 or a complementary sequence thereto. [twenty two] 22. The oligonucleotide according to any one of items 18 to 21, comprising a sequence of a region including base 501 of SEQ ID NO: 1 or a sequence complementary thereto. [twenty three] 23. The oligonucleotide according to any one of Items 19 to 22, wherein the region containing the 501st base of SEQ ID NO: 1 is a region of 10 to 50 nucleotides in length. [twenty four] 24. The oligonucleotide according to any one of items 19 to 23, wherein the 501st position of SEQ ID NO: 1 is T. [twenty five] 25. The oligonucleotide according to any one of items 10 to 24, which has a length of 10 to 50 nucleotides.

[0039]

[26] 26. A composition for predicting the effect of a platinum-based anticancer drug, comprising at least one oligonucleotide according to any one of items 10 to 25.

[27] 26. A kit for predicting the effect of a platinum-based anticancer drug, comprising at least one oligonucleotide according to any one of items 10 to 25.

[0040]

[28] 1. A method of treating cancer in a subject, comprising: Predicting the efficacy of a platinum-based anticancer drug in a subject by the method according to any one of items 1 to 9; and Administering platinum-based anticancer drugs to subjects for whom platinum-based anticancer drugs are predicted to be effective. A method comprising:

[29] Item 29. The method according to Item 28, wherein the cancer is esophageal cancer, gastric cancer, colon cancer, pancreatic cancer, ovarian cancer, biliary tract cancer, or breast cancer.

[30] Item 30. The method according to Item 29, wherein the patient has esophageal cancer or gastric cancer.

[31] 31. The method of claim 30, wherein the cancer is esophageal cancer.

[32] Item 32. The method according to any one of Items 28 to 31, wherein the platinum-based anticancer drug is cisplatin, carboplatin, oxaliplatin, or nedaplatin.

[0041]

[33] A method for producing a nucleic acid molecule, comprising replicating and / or amplifying a genomic region containing a SNP identified in rs12876842 of a subject, wherein the nucleic acid molecule obtained by said replication and / or amplification is labeled so as to distinguish whether the SNP is C or T.

[34] A method according to item 33, comprising replicating and / or amplifying a genomic region using at least one of the oligonucleotides according to any one of items 10 to 25.

[0042] The present invention will be further illustrated by the following examples, which are not to be construed as limiting in any way. EXAMPLES

[0043] For the purpose of establishing predictors of therapeutic efficacy of platinum-based anticancer drugs, a genome-wide association analysis (GWAS) was performed on the therapeutic efficacy (presence or absence of recurrence) of chemoradiotherapy using platinum-based anticancer drugs for esophageal cancer, for which platinum-based anticancer drugs are the main treatment, as an exploratory cohort, and several candidate SNPs were detected. In a previous paper (Mori T. et al., Ther Adv Med Oncol 2022, 14:1-21), the inventors reported that a certain candidate SNP (rs3815544) is related to the methylation of the downstream MSX1 gene or its promoter region, and may affect therapeutic efficacy because it correlates with the expression level of the gene. In addition, recently, a correlation between the variation in expression levels of PDX1, EN2, and MSX1 due to genomic methylation and prognosis has been reported in colorectal cancer, in which platinum-based anticancer drugs are used (Lee Y. et al., Experimental & Molecular Medicine 2022, 54:156-168). Therefore, the GWAS data for esophageal cancer from the aforementioned paper was reexamined for SNPs around PDX1.

[0044] The first and second cohorts were as described in the previous paper, and consisted of 94 and 24 esophageal cancer patients who received chemoradiotherapy using platinum-based anticancer drugs (cisplatin, carboplatin, oxaliplatin, or nedaplatin) as first-line treatment, respectively. The analysis was performed as described in the previous paper. As a result, two SNPs (rs12876842 and rs9581943) with the lowest P value correlated with prognosis (presence or absence of recurrence) were selected as candidates (Figure 1, GWAS results for the first cohort of 94 cases).

[0045] In Figure 1, the X-axis shows the chromosomal position (chromosome 13; notation follows GRCh37), and the Y-axis shows the p-value for correlation (negative logarithm; 4 is p=10 -4 The black arrow on the x-axis indicates the location and transcription direction of the PDX1 gene. The odds ratio (OR) for recurrence of rs12876842 was calculated to be 0.22, i.e., the risk of recurrence was 0.22 times with the minor allele, with a statistical significance of p=0.00015. On the other hand, the risk of recurrence of rs9581943 was 2.55 times with the minor allele, with a statistical significance of p=0.0098.

[0046] The first analysis, GWAS, was a correlation analysis between the presence or absence of esophageal cancer recurrence and genotype, so the most important survival time for evaluating the effectiveness of treatment was not examined. Therefore, we analyzed the overall survival (OS) and progression-free survival (PFS) of esophageal cancer patients for rs12876842. The SNP genotype and OS or PFS were analyzed by the Kaplan-Meier method in a cohort of 118 patients with esophageal cancer (a total of 94 patients in the first cohort and 24 patients in the second cohort) who underwent first-line treatment including platinum-based anticancer drugs (Figure 2).

[0047] The median OS was not reached in the TT genotype, was 108.1 months (95% confidence interval, hereafter 95%CI: 67.6-148.6 months) in the TC, and was 30.5 months (95%CI: 23.7-37.3 months) in the CC. The Log Rank test showed significant differences between CC and TT (p=0.0089) and between CC and TC (p=0.0014). The median PFS was not reached in the TT genotype, was 112.0 months (95%CI: 67.0-157.0 months) in the TC, and was 8.37 months (95%CI: 2.9-13.9 months) in the CC. The Log Rank test showed significant differences between CC and TT (p=0.0062) and between CC and TC (p=0.0010). Thus, rs12876842 showed a significant difference in survival time for both CT and TT in the Log Rank test.

[0048] Furthermore, a multivariate analysis was performed using a Cox proportional hazards model including rs12876842, age, and stage of progression for OS or PFS. Table 1 shows the results of a multivariate analysis using a Cox proportional hazards model for OS and PFS according to the rs12876842 genotype (CC=0, CT=1, TT=2), stage of progression before treatment (UICC 8th edition, Stage0=0, stage1A / 1B=1, stage2A / 2B / 2C=2, stage3A / 3B / 3C=3, stage4A / 4B=4), and age after treatment in the 118 esophageal cancer patients who underwent first-line treatment including platinum-based anticancer drugs. [Table 1]

[0049] Even after taking into account age and tumor progression, the T allele of rs12876842 reduced the risk of death in OS by 0.46 times and the risk of death or progression in PFS by 0.47 times compared with the C allele. In other words, the rs12876842 genotype was shown to be a significant risk factor for both OS and PFS, independent of age and progression.

[0050] Next, we examined whether the above results could be reproduced in an external cohort. From the clinical genomic information of approximately 260,000 Japanese people registered in Biobank Japan (BBJ) (a project funded by the Japan Agency for Medical Research and Development, https: / / biobankjp.org), we extracted cases of esophageal cancer, gastric cancer, colorectal cancer, pancreatic cancer, ovarian cancer, biliary tract cancer, and breast cancer in which platinum-based anticancer drugs were administered as first-line treatment and there was data on the effectiveness of treatment assessed by post-treatment imaging tests using computed tomography (CT), and created a new cohort. We then calculated the odds ratio between the rs12876842 genotype and treatment effectiveness (response rate and tumor control rate) for these cohorts.

[0051] In gastric cancer, a similar odds ratio (OR=0.35) (high tumor control effect with minor alleles) was reproduced with a significant difference of p=0.006. In addition, although no significant difference was obtained (probably due to the limitation due to the number of cases, see Figure 3), similar odds ratios indicating the possibility of tumor control or response with minor alleles were obtained in the cohorts of colorectal cancer (OR=0.66) and pancreatic cancer, ovarian cancer, biliary tract cancer, and breast cancer (OR=0.68). BBJ is composed of cases registered and accumulated from hospitals all over Japan that agreed to participate, and is considered to be a group close to so-called real-world data, with no specific registration conditions imposed that would cause bias in cases regarding participation. In addition, the treatment effect assessment was based on objective assessment using CT scans at each hospital, and can be said to be a third-party evaluation independent of the inventors.

[0052] In Asians, the frequency of SNP (rs12876842:C→T) existing on one chromosome derived from the paternal or maternal lineage (i.e., rs12876842 genotype is CT) is about 44%. In Europeans, it is about 22%, in Africans, about 8%, in Latin Americans, about 13-18%, and globally about 20%. In addition, the frequency of SNP (rs12876842:C→T) homozygous (i.e., rs12876842 genotype is TT) is about 11% in Asians. From the above, for gastric cancer, the risk of platinum-based anticancer drugs not working for people with rs12876842 genotype CT (about 44% of Asians) is 0.35 times higher than that of people with rs12876842 genotype CC. In addition, the risk that people with the rs12876842 genotype TT (approximately 11% of Asians) will not respond to platinum-based anticancer drugs is 0.123 times (0.35 × 0.35 = 0.1225) higher than people with the rs12876842 genotype CC.

[0053] According to GTEX, a project run by Massachusetts Institute of Technology and Harvard University that establishes the relationship between genotypes and gene expression in each organ tissue, the rs12876842 genotype was significantly correlated with the expression level of the POLR1D gene in the esophagogastric junction mucosa (p=0.00001139) (https: / / gtexportal.org / home / snp / rs12876842). In addition, according to The Human Protein Atlas, a database of life prognosis for various cancer types based on gene expression levels run by Karolinska Institutet and Apsara University (both in Sweden), the POLR1D gene expression level was significantly correlated with the prognosis of ovarian cancer, colorectal cancer, and head and neck cancer (all p<0.05) (https: / / www.proteinatlas.org / ENSG00000186184-POLR1D / pathology).

[0054] The above results indicate that rs12876842 can be used as a predictor of efficacy when platinum-based anticancer drugs are used for cancer, such as esophageal cancer, gastric cancer, colon cancer, pancreatic cancer, ovarian cancer, biliary tract cancer, and breast cancer.

Claims

1. A method for predicting the efficacy of a platinum-based anticancer drug in a subject, the method comprising determining the subject's genotype at a single nucleotide polymorphism (SNP) identified at rs12876842.

2. The method according to claim 1, wherein a platinum-based anticancer drug is predicted to be effective when the genotype is CT or TT.

3. The method according to claim 2, wherein a platinum-based anticancer drug is predicted to be effective when the genotype is TT.

4. The method according to any one of claims 1 to 3, wherein the subject is a cancer patient.

5. The method according to any one of claims 1 to 3, wherein the platinum-based anticancer drug is cisplatin, carboplatin, oxaliplatin, or nedaplatin.

6. An oligonucleotide capable of binding to a genomic region adjacent to or including the SNP identified in rs12876842.

7. The oligonucleotide of claim 6, comprising a sequence having 90% or more sequence identity with a region adjacent to base 501 of SEQ ID NO:1 or a complementary sequence thereto.

8. The oligonucleotide according to claim 6, comprising a sequence having 90% or more sequence identity with a region including base 501 of SEQ ID NO:1 or a complementary sequence thereto.

9. A composition for predicting the effect of a platinum-based anticancer drug, comprising at least one oligonucleotide according to any one of claims 6 to 8.

10. A kit for predicting the effect of a platinum-based anticancer drug, comprising at least one oligonucleotide according to any one of claims 6 to 8.

11. A method for producing a nucleic acid molecule, comprising replicating and / or amplifying a genomic region containing a SNP identified by rs12876842 in a subject, wherein the nucleic acid molecule obtained by said replication and / or amplification is labeled so as to distinguish whether the SNP is C or T.

Images