Analysis of multiple analytes using single assay

Abstract

To provide analysis of multiple analytes using a single assay.SOLUTION: Embodiments of systems, methods and compositions provided herein relate to methods of simultaneously analyzing multiple analytes in a single sample using a single assay. Some embodiments relate to simultaneous analysis of DNA and RNA in a single sample, for example, to simultaneous generation of DNA and RNA libraries. In some embodiments, a cDNA library is derived from mRNA molecules and comprises nucleic acids having a first tag comprising a first barcode. In some embodiments, a gDNA library is derived from genomic DNA and comprises nucleic acids having a second tag comprising a second barcode.SELECTED DRAWING: None

Description

[Technical field]

[0001] The systems, methods, and compositions provided herein relate to assays for simultaneously analyzing multiple analytes in a single sample. In particular, embodiments disclosed herein relate to methods for analyzing DNA and RNA from a single sample in a single assay. [Background technology]

[0002] Detection of specific nucleic acid sequences present in biological samples has been used, for example, as a method for identifying and classifying microorganisms, diagnosing infectious diseases, detecting and characterizing genetic abnormalities, identifying genetic changes associated with cancer, determining genetic susceptibility to disease, and measuring response to various types of treatments. A common technique for detecting specific nucleic acid sequences in biological samples is nucleic acid sequencing.

[0003] Whole genome sequencing, genotyping, targeted resequencing, gene expression, single cell genomics, epigenomics, and protein expression analysis of tissue samples can be very important to identify disease biomarkers, accurately diagnose and prognose disease, and select appropriate treatments for patients. In many cases, this requires multiple assays to separately analyze specific analytes of interest, such as DNA, RNA, or protein. Various assays have been established to separately and individually analyze these analytes. However, comprehensive analysis of multiple analytes is time-consuming and laborious. Summary of the Invention [Means for solving the problem]

[0004] The present disclosure relates to systems, methods, and compositions for simultaneously analyzing multiple analytes in a sample using a single assay.

[0005] Some embodiments provided herein relate to a nucleic acid library. In some embodiments, the library comprises a complementary DNA (cDNA) library and a genomic DNA (gDNA) library. In some embodiments, the cDNA library is derived from an mRNA molecule and comprises a nucleic acid having a first tag comprising a first barcode. In some embodiments, the gDNA library is derived from a genomic DNA molecule and comprises a nucleic acid having a second tag comprising a second barcode. In some embodiments, the first barcode and the second barcode are the same or different, and the first barcode and the second barcode identify a common source of the cDNA library and the gDNA library. In some embodiments, the cDNA and gDNA libraries are co-compartmentalized and prepared in the same environment. In some embodiments, the tag for DNA and the tag for RNA are the same.

[0006] Some embodiments provided herein relate to a flow cell device. In some embodiments, the flow cell device comprises a first probe for capturing RNA, the first probe comprising a first barcode and a first substrate recognition sequence, and a second probe for capturing DNA, the second probe comprising a second barcode and a second substrate recognition sequence. In some embodiments, the first barcode and the second barcode are the same or different, and the first barcode and the second barcode identify a common source of RNA and DNA. In some embodiments, the first probe and the second probe are configured to simultaneously analyze RNA and DNA from a sample in a single compartment. The method of claim 19, wherein the first and second capture probes are immobilized on a solid support.

[0007] Some embodiments provided herein relate to a method for simultaneously analyzing DNA and RNA from a sample in a single compartment. In some embodiments, the method includes providing a sample containing DNA and RNA, where the RNA comprises a first tag and the DNA is differentially tagged with a second tag, contacting the sample in the single compartment with a first capture probe for capturing the RNA and a second capture probe for capturing the tagged DNA, hybridizing the first capture probe to the RNA and the second capture probe to the DNA, thereby capturing the RNA and DNA, and analyzing the DNA and RNA. In some embodiments, the first capture probe comprises a first barcode and the second capture probe comprises a second barcode, where the first barcode and the second barcode identify a common source of the RNA and DNA.

[0008] Some embodiments provided herein relate to a method for simultaneously generating a nucleic acid library comprising gDNA and cDNA in a single compartment. In some embodiments, the method includes providing a sample comprising DNA and RNA, where the RNA comprises a first tag and the DNA is differentially tagged with a second tag, contacting the sample in a single compartment with a first capture probe for capturing the RNA and a second capture probe for capturing the tagged DNA, hybridizing the RNA and DNA to the first and second probes, respectively, and simultaneously generating a cDNA library and a gDNA library from the hybridized RNA and DNA. In some embodiments, the first probe comprises a first barcode and the second probe comprises a second barcode, and the first barcode and the second barcode identify a common source of the RNA and DNA.

[0009] Some embodiments provided herein relate to a kit for simultaneously analyzing DNA and RNA in a sample in a single compartment. In some embodiments, the kit comprises a translocation reagent and a first probe complementary to a first tag and a second probe complementary to a second tag, the first probe and the second probe being immobilized on a solid support, the first probe comprising a first barcode, the second probe comprising a second barcode, and the first and second barcodes identifying a common source of DNA and RNA.

[0010] Some embodiments provided herein relate to a method of performing single cell ATAC-seq analysis. In some embodiments, the method includes providing a sample comprising a population of cells or nuclei, performing a sequence-preserving transposition on a target nucleic acid, distributing the population of cells or nuclei into individual droplets, where a single cell or nucleus is distributed into a single droplet, indexing the target nucleic acid, and analyzing the indexed nucleic acid.

[0011] Some embodiments provided herein relate to a method of combinatorial indexing (CPT-seq), in some embodiments, the method includes providing a sample comprising a population of cells or nuclei, performing individually indexed sequence-preserving transpositions on target nucleic acids, distributing the population of cells or nuclei into individual droplets, where a plurality of cells or nuclei are distributed into a single droplet, where a plurality of cells or nuclei within a single droplet have a unique index, indexing the target nucleic acids, and analyzing the indexed nucleic acids.

[0012] In any of the embodiments summarized herein, the analyte is obtained from a population of cells, a single cell, a population of cell nuclei, or a single cell nucleus.In any of the embodiments summarized herein, the analyte is analyzed using various analyses, depending on what the analyte is.For example, the analyses include DNA analysis, RNA analysis, protein analysis, tagmentation, nucleic acid amplification, nucleic acid sequencing, nucleic acid library creation, assay for transposase accessible chromatin using sequencing (ATAC-seq), continuous preserving transposition (CPT-seq), single cell combinatorial indexing sequencing (SCI-seq), or single cell genome amplification, or any combination thereof. [Brief description of the drawings]

[0013] [Figure 1A] FIG. 1B is a schematic diagram showing a conventional method for analyzing multiple analytes of interest in a sample, where each analyte of interest is analyzed separately in two different observations. FIG. 1B is a schematic diagram of one embodiment of a process for simultaneously measuring different analytes of interest in the same compartment. [Figure 1B] FIG. 1B is a schematic diagram showing a conventional method for analyzing multiple analytes of interest in a sample, where each analyte of interest is analyzed separately in two different observations. FIG. 1B is a schematic diagram of one embodiment of a process for simultaneously measuring different analytes of interest in the same compartment.

[0014] [Diagram 2] FIG. 1 is a schematic diagram showing one embodiment of a co-assay using different tags to bind DNA and RNA. The different tags are shown as being introduced into a single cell or nucleus with RNA or DNA. The single cell or nucleus is enclosed in a droplet or separated on a well of a plate. Barcodes are immobilized on a surface or added in solution to capture the DNA and RNA via the tags.

[0015] [Diagram 3]FIG. 1 is a schematic diagram showing one embodiment of a co-assay using the same tag to bind DNA and RNA. DNA is first fragmented by transposomes to include polyA tails. Both DNA fragments and mRNA are indexed using polyT oligonucleotides with barcodes immobilized on a surface or in solution. The transposition reaction performed on the DNA allows DNA to be distinguished from RNA by internal transposon-specific sequences.

[0016] [Figure 4] Schematic diagram showing one embodiment of the process for introducing polyA transposon into genomic DNA by transposition. Nuclei / cells are encapsulated with indexed oligonucleotides with polyT tails. The indexed oligonucleotides are hybridized and ligated to the transposed gDNA fragments, which are then hybridized with mRNA to generate the first cDNA. After synthesis of the second cDNA, the double-stranded cDNA and gDNA are transposed again to add PCR adaptors to the other end. The fragments are then amplified by PCR.

[0017] [Figure 5A] Schematic representation of Assay for Transposase-Accessible Chromatin Using Sequencing (ATAC-seq). Figure 5A shows a schematic of the general principle of ATAC-seq, and Figure 5B shows an overview of the steps for performing single-cell ATAC-seq. [Figure 5B] Schematic representation of Assay for Transposase-Accessible Chromatin Using Sequencing (ATAC-seq). Figure 5A shows a schematic of the general principle of ATAC-seq, and Figure 5B shows an overview of the steps for performing single-cell ATAC-seq.

[0018] [Figure 6A]A schematic diagram showing one embodiment of a bulk co-assay is shown. As shown in Figure 6A, cell nuclei are isolated and DNA is tagmented with polyA tails. The tagmented DNA and mRNA are captured with probes and purified for further analysis. Figure 6B shows further details of the DNA fragments used in the process of Figure 6A. [Figure 6B] A schematic diagram showing one embodiment of a bulk co-assay is shown. As shown in Figure 6A, cell nuclei are isolated and DNA is tagmented with polyA tails. The tagmented DNA and mRNA are captured with probes and purified for further analysis. Figure 6B shows further details of the DNA fragments used in the process of Figure 6A.

[0019] [Figure 7A] A schematic diagram showing one embodiment of a bead co-assay is shown. As shown in Figure 7A, cell nuclei are isolated and DNA is tagmented with polyA tails. The tagmented DNA and mRNA are captured using biotin capture. Figure 7B shows further details of the DNA fragments used in the process of Figure 7A. [Figure 7B] A schematic diagram showing one embodiment of a bead co-assay is shown. As shown in Figure 7A, cell nuclei are isolated and DNA is tagmented with polyA tails. The tagmented DNA and mRNA are captured using biotin capture. Figure 7B shows further details of the DNA fragments used in the process of Figure 7A.

[0020] [Figure 8] Data from the sequencing bulk co-assays are displayed in Figures 6A-6B. Fragments from the ATAC library have the signature ME sequence highlighted in Figure 8.

[0021] [Figure 9] Panels A and B of Figure 6 display data from the sequencing bulk co-assay of Figures 6A-6B. The generated libraries were sequenced. ATAC fragments show typical enrichment around promoter regions (Panel A), while RNA fragments for 3' counting show read accumulation around the ends of genes (Panel B).

[0022] [Figure 10] FIG. 1 is a schematic illustrating one embodiment of a co-assay performed using combinatorial indexing such as SCI-seq.

[0023] [Figure 11] FIG. 1 is a schematic illustrating one embodiment of a method for performing a co-assay using combinatorial sequencing.

[0024] [Figure 12] 1 depicts an exemplary embodiment of a sequencing workflow, showing a bead pool with barcodes inserted and displaying exemplary primers.

[0025] [Figure 13] A graph displaying the number of reads per cell is shown, showing that increasing transposase results in an increase in the number of reads per cell.

[0026] [Figure 14] 1 shows a graph demonstrating the sensitivity of single cells using ATAC-seq on a mixture of cell types. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0027] In the following detailed description, reference is made to the accompanying drawings, which form a part of this specification. In the drawings, like symbols typically identify like components unless the context dictates otherwise. The exemplary embodiments described in the detailed description, drawings, and claims are not intended to be limiting. Other embodiments may be utilized and other changes may be made without departing from the spirit or scope of the subject matter presented herein. It is readily understood that aspects of the present disclosure, as generally described herein and illustrated in the drawings, can be arranged, substituted, combined, separated, and designed in a wide variety of different configurations, all of which are expressly contemplated herein.

[0028] Embodiments of the systems, methods, and compositions provided herein relate to the simultaneous analysis of multiple analytes in a single sample. In some embodiments, the multiple analytes include DNA and RNA.

[0029] Conventional methods for analyzing multiple analytes from a single sample require the use of separate reagents and separate assays, including isolating each analyte of interest and then analyzing each analyte of interest, for example, as shown in FIG. 1A. Thus, analytes may be analyzed separately in time and / or space, for example, at different times or in different compartments. For example, it may be desirable to analyze both DNA and RNA from a single sample. Conventional methods analyze DNA using one assay and RNA using another assay separately, which increases the consumption of time, cost, and resources. Furthermore, the same sample may also contain additional analytes of interest, such as proteins, for which separate assays are also required.

[0030] Nucleic acid libraries are useful for determining gene products or for whole genome sequencing. Various types of libraries, including those used in epigenomics, can be generated, such as by assay of transposase-accessible chromatin using sequencing (ATAC-seq), a rapid and sensitive method of integrated epigenomic analysis, such as complementary DNA (cDNA) libraries generated from reverse transcribed RNA or genomic DNA (gDNA) libraries. Traditionally, these libraries are generated separately and independently. cDNA libraries can be useful for many applications, including, for example, the discovery of novel genes, for studying gene function, for determining mRNA expression, or for determining alternative splicing. gDNA libraries can be useful for many separate applications, including, for example, determining the complete genome of an organism, for studying the function of regulatory sequences, or for studying gene mutations. The methods, compositions, and systems described herein allow for the simultaneous generation of both cDNA and gDNA libraries.

[0031] One embodiment of the present invention is a system and method for analyzing multiple analytes in a single sample using a single assay, where each analyte of interest is analyzed simultaneously in a single compartment, for example as shown in FIG. 1B. Although FIG. 1B displays two analytes in a sample, it should be understood that there may be more than two analytes of interest, and each analyte of interest may be analyzed simultaneously. The systems, methods, and compositions described herein relate to the simultaneous analysis of multiple analytes in a single sample. Embodiments of the systems, methods, and compositions improve analytical efficiency by reducing assay complexity, cost, and time.

[0032] Some embodiments provided herein relate to a nucleic acid library. In some embodiments, the nucleic acid library comprises a cDNA library comprising a nucleic acid derived from an mRNA molecule and having a first tag configured to bind to a substrate and a barcode sequence, and a gDNA library comprising a nucleic acid derived from genomic DNA and having a second tag different from the first tag configured to bind to a substrate. In some embodiments, the nucleic acid library is made from a population of cells, a single cell, a population of cell nuclei, or a single cell nucleus. In some embodiments, the first tag is a polyA tag. In some embodiments, the second tag comprises a transposase specific element.

[0033] In some embodiments, the method includes tagging each analyte of interest with a tag to index each analyte of interest. In some embodiments, the method further includes capturing each analyte of interest with a probe complementary to the tag. In some embodiments, the method further includes analyzing each analyte of interest.

[0034] In some embodiments, the method includes simultaneously analyzing DNA and RNA from a sample. In some embodiments, the method includes providing a sample including DNA and RNA. In some embodiments, the RNA includes a first tag. In some embodiments, the method includes differentially tagging the DNA with a second tag. In some embodiments, the method includes contacting a solid support with the sample, the solid support including a first immobilized probe for capturing the RNA and a second immobilized probe for capturing the tagged DNA. In some embodiments, the method includes simultaneously capturing DNA and RNA on the solid support. In some embodiments, the method includes analyzing DNA and RNA.

[0035] As used herein, a sample includes any sample having an analyte of interest. A sample may be a biological sample, such as a biological sample having an analyte of interest, including, for example, whole blood, serum, interstitial fluid, lymphatic fluid, cerebrospinal fluid, sputum, urine, stool, milk, sweat, tears, umbilical cord, peripheral blood, bone marrow, cells or solid tissue. In some embodiments, the sample is a population of cells, a single cell, a population of cell nuclei, or a single cell nucleus. A sample may be obtained from a subject, from which it is desirable to analyze one or more analytes of interest. As used herein, a "subject" refers to an animal that is the subject of treatment, observation, or experimentation. "Animals" include cold- and warm-blooded vertebrates and invertebrates, such as fish, crustaceans, reptiles, and especially mammals. "Mammals" include, but are not limited to, mice, rats, rabbits, guinea pigs, dogs, cats, sheep, goats, cows, horses, primates such as monkeys, chimpanzees, and apes, and especially humans.

[0036] Some embodiments provided herein relate to methods for simultaneously analyzing multiple analytes of interest, where the analytes of interest are one or more of DNA, RNA, protein, or any other cellular biomolecule, or other target molecule of interest.

[0037] The sample may be a fluid or specimen obtained from an environmental source. For example, the fluid or specimen obtained from an environmental source may be obtained or derived from food, produce, poultry, meat, fish, beverages, dairy products, water (including wastewater), ponds, rivers, reservoirs, swimming pools, soil, food processing and / or packaging plants, agricultural sites, aquaculture (including hydroponic food farms), pharmaceutical manufacturing plants, animal colony facilities, or any combination thereof. In some embodiments, the sample is a fluid or specimen collected or derived from a cell culture or a microbial colony.

[0038] As used herein, "analyte", "target analyte", and "analyte of interest" are used interchangeably and refer to an analyte to be measured in the methods and systems disclosed herein. In some embodiments, the analyte may be a biomolecule. Non-limiting examples of biomolecules include macromolecules such as polynucleotides (e.g., DNA or RNA), proteins, lipids, and carbohydrates. In certain examples, the analyte may be a hormone, an antibody, a growth factor, a cytokine, an enzyme, a receptor (e.g., neural, hormonal, nutrient, and cell surface receptors) or their ligands, a cancer marker (e.g., PSA, TNF-α), a marker of myocardial infarction (e.g., troponin, creatine kinase, etc.), a toxin, a drug (e.g., a drug of intoxication), a metabolic agent (including, for example, a vitamin), and the like. Non-limiting embodiments of protein analytes include peptides, polypeptides, protein fragments, protein complexes, fusion proteins, recombinant proteins, phosphoproteins, glycoproteins, lipoproteins, oligonucleotide-tagged proteins, and the like. The target analyte may be a nucleic acid.

[0039] The target nucleic acid can include a sample in which the average size of the nucleic acids in the sample is about 2 kb, 1 kb, 500 bp, 400 bp, 200 bp, 100 bp, 50 bp, less than or greater than about, or a range between any two of the aforementioned sizes. In some embodiments, the average size of the nucleic acids in the sample is about 2000 nucleotides, 1000 nucleotides, 500 nucleotides, 400 nucleotides, 200 nucleotides, 100 nucleotides, 50 nucleotides, less than or greater than about, or a range between any two of the aforementioned sizes.

[0040] As used herein, "polynucleotide" and "nucleic acid" may be used interchangeably and may refer to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. Thus, these terms include single-stranded, double-stranded, or multi-stranded DNA or RNA. Examples of polynucleotides include genes or gene fragments, whole genomic DNA, genomic DNA, epigenomic DNA, genomic DNA fragments, exons, introns, messenger RNA (mRNA), regulatory RNA, transcribed RNA, ribosomal RNA, non-coding RNA (ncRNA), such as PIWI-interacting RNA (piRNA), small interfering RNA (siRNA), and long non-coding RNA (lncRNA), small hairpin RNA (shRNA), small nuclear RNA (snRNA), microRNA (miRNA), small nuclear RNA (snoRNA) and viral RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, primers, or amplified copies of any of the above. A polynucleotide can contain modified nucleotides, such as methylated nucleotides, and nucleotide analogs, including nucleotides with unnatural bases, nucleotides with modified natural bases, such as azapurines or deazapurines. A polynucleotide can be composed of a specific sequence of the four nucleotide bases: adenine (A); cytosine (C); guanine (G); and thymine (T). Uracil (U) can also be present as a natural substitute for thymine, for example, when the polynucleotide is RNA. Uracil can also be used in DNA. The term "nucleic acid sequence" can refer to the alphabetical representation of a polynucleotide or any nucleic acid molecule, including natural and unnatural bases.

[0041] Nucleic acids can include phosphodiester bonds and other types of backbones, including, for example, phosphoramide, phosphorothioate, phosphorodithioate, O-methyl phosphoramidite and peptide nucleic acid backbones and bonds. Nucleic acids can include any combination of deoxyribonucleotides and ribonucleotides, as well as any combination of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine, hypoxanthine, isocytosine, isoguanine, and base analogs such as nitropyrrole (including 3-nitropyrrole) and nitroindole (including 5-nitroindole). In some embodiments, nucleic acids can include at least one promiscuous base. Promiscuous bases can base pair with multiple different types of bases and can be useful, for example, when included in oligonucleotide primers or inserts used for random hybridization in complex nucleic acid samples, such as genomic DNA samples. Examples of promiscuous bases include inosine, which can pair with adenine, thymine, or cytosine. Other examples include hypoxanthine, 5-nitroindole, acyclic 5-nitroindole, 4-nitropyrazole, 4-nitroimidazole, and 3-nitropyrrole. Promiscuous bases capable of base pairing with at least two, three, or more than three bases can be used.

[0042] As used herein, the term simultaneous refers to actions occurring at the same time or substantially the same time. Thus, simultaneous analysis of multiple analytes refers to analyzing multiple analytes at the same time or substantially the same time in a single assay. Similarly, simultaneous collection or derivation of sequenceable elements refers to collection or derivation of sequenceable elements at the same time or substantially the same time.

[0043] As used herein, the term tag refers to a modification to one or more analytes of interest so that the analytes of interest can be subsequently isolated, identified, tracked, or analyzed. Thus, the tag can identify the analytes of interest in a sample. The tag can include, for example, a polyadenylation (polyA) tag. In some embodiments, the tag can include a nucleotide sequence having a length of at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 10 nucleotides, at least 15 nucleotides, at least 20 nucleotides, at least 25 nucleotides, at least 30 nucleotides, at least 35 nucleotides, at least 40 nucleotides, at least 45 nucleotides, at least 50 nucleotides, or more than 50 nucleotides, or a length within any two of the aforementioned lengths. In some embodiments, tagging is performed by tagmentation. As used herein, "tagmentation" can refer to the insertion of a transposon into a target nucleic acid such that the transposon cleaves the target nucleic acid and adds an adaptor sequence to the end of the cleaved target nucleic acid. Exemplary methods of tagging are disclosed in U.S. Patent Nos. 9,115,396, 9,080,211, 9,040,256, and U.S. Patent Application Publication No. 2014 / 0194324, each of which is incorporated herein by reference in its entirety. In some embodiments, the tag is the same or different for each analyte of interest. For example, each analyte of interest can be tagged with the same tag or with different tags. Differential tagging refers to tagging one analyte of interest, such as, for example, DNA, such that the tagging is different or distinguishable from the tagging of another analyte of interest, such as RNA. In some embodiments, the tag is different for each analyte, but the relationship of the tags is known in advance.

[0044] Transposon-based technologies can be utilized to fragment DNA, for example, as exemplified by the workflow of the NEXTERA™ XT and FLEX DNA Sample Preparation Kits (Illumina, Inc.), in which target nucleic acids such as genomic DNA are treated with a transposome complex that simultaneously fragments and tags (tagments) the target, thereby generating a population of fragmented nucleic acid molecules tagged with unique adapter sequences at the ends of the fragments.

[0045] A transposition reaction is a reaction in which one or more transposons are inserted into a target nucleic acid at random or near-random sites. Components of a transposition reaction include a transposase (or other enzymes capable of fragmenting and tagging nucleic acids as described herein, such as integrase), and a transposon element comprising a double-stranded transposon end sequence that binds to the transposase (or other enzymes as described herein), and an adapter sequence bound to one of the two transposon end sequences. One strand of the double-stranded transposon end sequence is transposed to one strand of the target nucleic acid, and the complementary transposon end sequence strand is not transposed (non-transposed transposon sequence). The adapter sequence can include one or more functional sequences or components (e.g., primer sequences, anchor sequences, universal sequences, spacer regions, or index tag sequences) as necessary or desired.

[0046] A "transposome complex" is composed of at least one transposase (or other enzyme described herein) and a transposon recognition sequence. In some such systems, the transposase binds to the transposon recognition sequence to form a functional complex capable of catalyzing a transposition reaction. In some embodiments, the transposon recognition sequence is a double-stranded transposon end sequence. The transposase binds to the transposase recognition site in the target nucleic acid and inserts the transposon recognition sequence into the target nucleic acid. In some such insertion events, one strand of the transposon recognition sequence (or end sequence) is translocated into the target nucleic acid, resulting in a cleavage event. Exemplary transposition procedures and systems that can be readily adapted for use with the transposases of the present disclosure are described, for example, in WO 10 / 048605, U.S. Patent Application Publication No. 2012 / 0301925, U.S. Patent Application Publication No. 2012 / 13470087, or U.S. Patent Application Publication No. 2013 / 0143774, each of which is incorporated by reference in its entirety.

[0047] Exemplary transposases that can be used with certain embodiments provided herein include (or are encoded by): Tn5 transposase (see Reznikoff et al., Biochem. Biophys. Res. Commun. 1999, 266, 729-734), Sleeping Beauty (SB) transposase, Vibrio harveyi (the transposase characterized by Agilent and used in their SureSelect QXT product), MuA transposase and Mu transposase recognition sites including R1 and R2 end sequences (Mizuuchi, K., Cell, 35:785, 1983; Savilahti, H, et al., EMBO J., 14:4893, 1995), Staphylococcus aureus Tn552 (Colegio, O. et al., EMBO J., 14:4893, 1995), and Staphylococcus aureus Tn552 (Colegio, O. et al., EMBO J., 14:4893, 1995). al., J. Bacteriol., 183:2384-8, 2001; Kirby, C. et al., Mol. Microbiol., 43:173-86, 2002), Ty1 (Devine & Boeke, Nucleic Acids Res., 22:3765-72, 1994 and WO 95 / 23875), transposon Tn7 (Craig, NL, Science, 271:1512, 1996; Craig, NL, Curr. Top. Microbiol. Immunol., 204:27-48, 1996), Tn / O and IS10 (Kleckner N. et al., Curr. Top. Microbiol. Immunol., 204:49-82, 1996), mariner transposase (Lampe, DJ et al., J. Bacteriol., 183:2384-8, 2001; Kirby, C. et al., Mol. Microbiol., 43:173-86, 2002), Ty2 (Devine & Boeke, Nucleic Acids Res., 22:3765-72, 1994 and WO 95 / 23875), transposon Tn7 (Craig, NL, Science, 271:1512, 1996; Craig, NL, Curr. Top. Microbiol. Immunol., 204:27-48, 1996), Tn / O and IS10 (Kleckner N. et al., Curr. Top. Microbiol. Immunol., 204:49-82, 1996), mariner transposase (Lampe, DJ et al., J. Bacteriol., 183:2384-8, 2 al., EMBO J., 15:5470-9, 1996), Tc1 (Plasterk, RH, Curr. Top. Microbiol. Immunol., 204:125-43, 1996), P elements (Gloor, GB, Methods Mol. Biol., 260:97-114, 2004), Tn3 (Ichikawa & Ohtsubo, J. Biol. Chem., 265:18829-32, 1990), bacterial insertion sequences (Ohtsubo & Sekine, Curr. Top. Microbiol.Immunol. 204:1-26, 1996), retroviruses (Brown et al., Proc. Natl. Acad. Sci. USA, 86:2525-9, 1989), and yeast retrotransposons (Boeke & Corce (s, Ann. Rev. Microbiol. 43:403-34, 1989). Further examples include IS5, Tn10, Tn903, IS911, and modified forms of the transposase family of enzymes (Zhang. et al.,(2009)PLoS Genet.5:e1000689.Epub (Oct. 16; Wilson C. et al. (2007) J. Microbiol. Methods 71:332-5), each of which is incorporated herein by reference in its entirety. The methods described herein can also include combinations of transposases, not just a single transposase.

[0048] In some embodiments, the transposase is Tn5, MuA, or Vibrio harveyi transposase, or an active variant thereof. In embodiments, the transposase is a Tn5 transposase or an active variant thereof. In some embodiments, the Tn5 transposase is a hyperactive Tn5 transposase (see, e.g., Reznikoff et al., WO 2001 / 009363, U.S. Pat. Nos. 5,925,545, 5,965,443, 7,083,980, and 7,608,434, and Goryshin and Reznikoff, J. Biol. Chem. 273:7367, 1998), or an active variant thereof. In some aspects, the Tn5 transposase is a Tn5 transposase described in WO 2015 / 160895, which is incorporated herein by reference. In some embodiments, the Tn5 transposase is a fusion protein. In some embodiments, the Tn5 transposase fusion protein comprises a fused elongation factor Ts (Tsf) tag. In some embodiments, the Tn5 transposase is a hyperactive Tn5 transposase comprising mutations at amino acids 54, 56, and 372 compared to the wild-type sequence. In some embodiments, the hyperactive Tn5 transposase is a fusion protein, and optionally, the fusion protein is the elongation factor Ts (Tsf). In some embodiments, the recognition site is a Tn5-type transposase recognition site (Goryshin et al., 2002). and Reznikoff, J. Biol. Chem., 273:7367, 1998). In one embodiment, a transposase recognition site that complexes with a hyperactive Tn5 transposase is used (e.g., EZ-Tn5™ transposase, Epicentre Biotechnologies, Madison, Wis.). In some embodiments, the Tn5 transposase is a wild-type Tn5 transposase.

[0049] In any of the embodiments of the method, composition, or system described herein, the transposon comprises a transposon end sequence. In some embodiments, the transposon end sequence is a mosaic end (ME) sequence. In some embodiments, the DNA is tagged using tagmentation, the DNA is tagged with a tag, and the tag contains a transposon-specific sequence, such as a ME sequence. Thus, the DNA is distinguished from the RNA in the sample based on the transposon-specific sequence.

[0050] In any of the embodiments of the methods, compositions, or systems described herein, the transposon comprises an adaptor sequence. The adaptor sequence may comprise one or more functional sequences or components selected from the group consisting of a primer sequence, an anchor sequence, a universal sequence, a spacer region, an index sequence, a capture sequence, a barcode sequence, a cleavage sequence, a sequencing-related sequence, and combinations thereof. In some embodiments, the adaptor sequence comprises a primer sequence. In other embodiments, the adaptor sequence comprises a primer sequence and an index or barcode sequence. The primer sequence may also be a universal sequence. The present disclosure is not limited to the types of adaptor sequences that may be used, and one of skill in the art will recognize additional sequences that may be used in library generation and next-generation sequencing. A universal sequence is a region of nucleotide sequence that is common to two or more nucleic acid fragments. Optionally, the two or more nucleic acid fragments also have regions of sequence divergence. A universal sequence that may be present in different members of a plurality of nucleic acid fragments may allow for the duplication or amplification of a plurality of different sequences using a single universal primer that is complementary to the universal sequence.

[0051] Adaptors include nucleic acids, such as single stranded nucleic acids. Adaptors can include short nucleic acids having a length of about 5 nucleotides, 10 nucleotides, 20 nucleotides, 30 nucleotides, 40 nucleotides, 50 nucleotides, 60 nucleotides, 70 nucleotides, 80 nucleotides, 90 nucleotides, 100 nucleotides, less than or equal to 5 ... less than or equal to 5 nucleotides, less than or equal to 5 nucleotides, less than or equal to 5 nucleotides, less than or equal to 5 nucleotides, less than or equal to 5 nucleotides, less than or equal to 5 nucleotides, less than or equal to 5 nucleotide

[0052] In any of the embodiments, adapter sequences or transposon end sequences including A14-ME, ME, B15-ME, ME', A14, B15, and ME are provided below: A14-ME: 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3' (SEQ ID NO: 1) B15-ME: 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3' (SEQ ID NO: 2) ME': 5'-phoS-CTGTCTCTTATACACATCT-3' (SEQ ID NO: 3) A14: 5'-TCGTCGGCAGCGTC-3' (SEQ ID NO: 4) B15: 5'-GTCTCGTGGGCTCGG-3' (SEQ ID NO: 5) ME: AGATGTGTATAAGAGACAG (SEQ ID NO: 6)

[0053] In some embodiments, a primer sequence is included to prepare a library for sequencing. In some embodiments, the primer sequence is a P5 primer sequence or a P7 primer sequence. P5 and P7 primers are used on the surface of commercially available flow cells sold by Illumina, Inc. for sequencing on various Illumina platforms. Primer sequences are described in U.S. Patent Application Publication No. 2011 / 0059865(A1), which is incorporated by reference in its entirety. Examples of P5 and P7 primers that may have an alkyne terminus at the 5' end include the following and derivatives or analogs thereof: P5: AATGATACGGGCGACCACCGAG AUCTACAC (SEQ ID NO: 7) P7: CAAGCAGAAGACGGCATACGAG * AT (sequence number 8). In some embodiments, the P7 sequence is G * In another example, the amino acid sequence includes a modified guanine at position 1, e.g., 8-oxoguanine. * is G *and the adjacent 3'A is a phosphorothioate bond. In some examples, the P5 and / or P7 primers include a non-natural linker. Optionally, one or both of the P5 and P7 primers can include a poly-T tail. The poly-T tail is generally located at the 5' end of the sequence shown above, e.g., between the 5' base and the terminal alkyne unit, but can be located at the 3' end in some cases. The poly-T sequence can include any number of T nucleotides, e.g., 2-20. Although P5 and P7 primers are given as examples, it should be understood that any suitable primer can be used in the examples presented herein. An index sequence having a primer sequence including P5 and P7 primer sequences serves to add P5 and P7 to activate the library for sequencing.

[0054] As used herein, the term probe refers to a capture molecule that has sufficient binding properties to specifically bind to a target analyte, such as a tag on the target analyte. For example, a probe can include a polynucleotide that has sufficient complementarity to specifically hybridize to a target nucleic acid. For example, a probe can include a polyT sequence to specifically bind to a polyA tag. In another example, a probe includes an antibody or protein tag. A capture probe can function as an affinity binding molecule to isolate a target nucleic acid from other nucleic acids and / or components in a mixture. A target nucleic acid can also be specifically bound by a capture probe through an intervening molecule, such as a linker, adapter, and other bridging nucleic acid, that has sufficient complementarity to specifically hybridize to both the target sequence and the capture probe.

[0055] In some embodiments, the probe further comprises a barcode. The barcode identifies the target as being from a particular sample. For example, the barcode is used to identify one or more analytes as being from a common source. The barcode that identifies one analyte may be the same or different from the barcode that identifies a different analyte. As long as the relationship between the barcodes is known, the barcode can be used to identify the analytes as being from a common source.

[0056] In some embodiments, the barcode can comprise a nucleic acid sequence that can be used to identify a polynucleotide in an array. The barcode can comprise a unique nucleotide sequence that can be distinguished from other barcodes. It can also be distinguished from other nucleotide sequences in the polynucleotide and in the target nucleic acid by the sequence of the barcode and also by the location of the barcode within the polynucleotide, for example, by the 5' location of the primer binding site. For example, in some embodiments, the sequence of the barcode can be present multiple times in the plurality of nucleic acids; however, barcodes located 5' to the primer binding site can be detected. The barcode can be of any desired sequence length sufficient to be a unique nucleotide sequence within the plurality of barcodes in the population and / or within the plurality of polynucleotides and target nucleic acids being analyzed or examined. In some embodiments, the barcode is a nucleic acid or region within the polynucleotide ranging from about 1-30 nucleotides or more. For example, a barcode can have a length of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 or more nucleotides. In some embodiments, a barcode can be 35, 40, 45, or 50 or more nucleotides. In some embodiments, a barcode can distinguish one polynucleotide from another polynucleotide in an array such that each barcode is different from another barcode. In some embodiments, a barcode can distinguish one population of polynucleotides from another population of polynucleotides in an array such that a set of barcodes is different from another set of barcodes.

[0057] In some embodiments, the barcode is directly inserted using transposition. In such embodiments, no binding event to a solid support is required. Thus, in any of the embodiments provided herein, the analyte of interest is analyzed simultaneously with or without a solid support.

[0058] In some embodiments, the probes can be immobilized on a solid support. The solid support can include, for example, an etched surface, a well, a coated well, an array, a flow cell device, a microfluidic channel, a bead, a magnetic bead, a column, a droplet, or a microparticle. In such embodiments, the analyte of interest is bound to the solid support by the immobilized probe and undergoes further processing or analysis on the solid support. In some embodiments, the immobilized probe and the solid support are used in solution. For example, the immobilized support can be a bead, and the probe attached to the bead is soluble in solution to capture the analyte of interest, such as DNA and RNA, in solution. In such embodiments, the tagged analyte of interest binds to the probe in solution and is barcoded in solution. The barcoded analyte of interest can undergo further processing or analysis in solution or can be pulled down using a pull-down assay that includes the use of magnetic beads.

[0059] The term flow cell as used herein refers to a chamber that includes a solid surface through which one or more fluidic reagents can flow. Examples of flow cells and related fluidic systems and detection platforms that can be easily used in the methods of the present disclosure include, for example, microfluidic devices, microstructures, microwells, microtiter plates, etc., as described, for example, in Bentley et al., Nature 456:53-59 (2008), WO 04 / 018497, U.S. Patent No. 7,057,026, WO 91 / 06678, WO 07 / 123744, U.S. Patent No. 7,329,492, U.S. Patent No. 7,211,414, U.S. Patent No. 7,315,019, U.S. Patent No. 7,405,281, and U.S. Patent Application No. 2008 / 0108082, each of which is incorporated herein by reference.

[0060] As used herein, an "array" can refer to a population of different microfeatures, such as microfeatures that contain polynucleotides bound or attached to a surface such that different microfeatures can be distinguished from one another according to their relative positions. An individual feature of an array can contain a single copy of a microfeature, or multiple copies of a microfeature can be present as a population of microfeatures in an individual feature of an array. The population of microfeatures in each feature is typically homogenous, with a single type of microfeature. Thus, multiple copies of a single nucleic acid sequence can be present in a feature, for example, on multiple nucleic acid molecules with the same sequence.

[0061] In some embodiments, a heterogeneous population of microfeatures may be present in a feature. In some embodiments, a feature may contain only a single microfeature type. In some embodiments, a feature may contain multiple different microfeature types, such as a mixture of nucleic acids with different sequences. Adjacent features of an array may be distinct from one another. Features may be adjacent to one another or may be separated by a gap. In embodiments where features are spaced apart, adjacent sites may be separated by, for example, a distance of less than 100 μm, 50 μm, 10 μm, 5 μm, 1 μm, 0.5 μm, 100 nm, 50 nm, 10 nm, 5 nm, 1 nm, 0.5 nm, or any distance within a range of any two of the aforementioned distances. The layout of features on an array may also be understood in terms of the center-to-center distance between adjacent features. Arrays useful in the present invention can have adjacent features with center-to-center spacings of less than about 100 μm, 50 μm, 10 μm, 5 μm, 1 μm, 0.5 μm, 100 nm, 50 nm, 10 nm, 5 nm, 1 nm, 0.5 nm, or any distance within a range of any two of the aforementioned distances. In some embodiments, the distance values ​​described herein can represent the average distance between adjacent features of the array. Thus, it is not necessary that all adjacent features be in a specified range, unless otherwise indicated, for example, by a specific statement that the distance constitutes a threshold distance between all adjacent features of the array. Embodiments can include arrays with various densities of features. Exemplary ranges of density for certain embodiments include about 10,000,000 features / cm. 2 ~Approximately 2,000,000,000 features / cm 2 ;Approximately 100,000,000 features / cm 2 ~Approximately 1,000,000,000 features / cm 2 ; Approximately 100,000 features / cm 2 ~Approximately 10,000,000 features / cm 2 , approximately 1,000,000 features / cm 2 ~Approximately 5,000,000 features / cm2 ; Approximately 10,000 features / cm 2 ~100,000 features / cm 2 ; Approximately 20,000 features / cm 2 ~50,000 features / cm 2 ; Approximately 1,000 features / cm 2 ~About 5,000 features / cm 2 , or any density within a range of any two of the aforementioned densities.

[0062] As used herein, a "surface" can refer to a portion of a substrate or support structure that is accessible for contact with a reagent, bead, or analyte. A surface can be substantially flat or planar. Alternatively, a surface can be rounded or contoured. Exemplary contours that can be included in a surface are wells, depressions, posts, ridges, channels, and the like. Exemplary materials that can be used as substrates or support structures include glass, such as modified or functionalized glass; plastics, such as acrylic, polystyrene or copolymers of styrene with another material, polypropylene, polyethylene, polybutylene, polyurethane, or Teflon; polysaccharides or cross-linked polysaccharides, such as agarose or sepharose; nylon; nitrocellulose; resins; silica or silica-based materials, including silicon and modified silicon; carbon fiber; metals; inorganic glasses; fiber optic bundles, or various other polymers. A single material or a mixture of several different materials can form a surface useful in the present invention. In some embodiments, the surface comprises a well.

[0063] As used herein, "beads" can refer to small objects made of rigid or semi-rigid materials. The objects can have shapes that can be characterized as, for example, spheres, ellipsoids, microspheres, or other recognized particle shapes, whether or not they have regular or irregular dimensions. Exemplary materials useful for beads include glass, such as modified or functionalized glass; plastics, such as acrylic, polystyrene or copolymers of styrene with another material, polypropylene, polyethylene, polybutylene, polyurethane, or Teflon; polysaccharides or cross-linked polysaccharides, such as agarose or sepharose; nylon; nitrocellulose; resins; silica or silica-based materials, including silicon and modified silicon; carbon fiber; metals; inorganic glasses; fiber optic bundles, or various other polymers. Exemplary beads include controlled pore glass beads, paramagnetic beads, thoria sol, sepharose beads, nanocrystals, and other materials known in the art. The beads may be made of biological or non-biological materials. Magnetic beads are particularly useful due to the ease of manipulation of magnetic beads using magnets. Beads used in certain embodiments may have a diameter, width, or length of 0.1 μm to 100 μm. The size of the beads may be selected to reduce the size and therefore increase the density while maintaining sufficient signal to analyze the features.

[0064] As used herein, "hybridization," "hybridize," or grammatical equivalents thereof, can refer to a reaction in which one or more polynucleotides react to form a complex formed at least in part by hydrogen bonds between the bases of the nucleotide residues. The hydrogen bonds can occur by Watson-Crick base pairing, Hoogsteen binding, or any other sequence-specific method. The complex can have two strands forming a double-stranded structure, three or more strands forming a multi-stranded complex, a single self-hybridizing strand, or any combination of these. The strands can also be cross-linked or bonded by forces in addition to hydrogen bonds.

[0065] As used herein, "extending", "extension", or any grammatical equivalent thereof, can refer to the addition of dNTPs to a primer, polynucleotide, or other nucleic acid molecule by an extension enzyme, such as a polymerase. For example, in some embodiments disclosed herein, the resulting extension primer contains sequence information of the nucleic acid. Although some embodiments are discussed as performing extension using a polymerase, such as a DNA polymerase, or a reverse transcriptase, extension can be performed in any other manner known in the art. For example, extension can be performed by ligating together oligonucleotides, such as oligonucleotides hybridized to the strand of interest.

[0066] As used herein, "ligation" or "ligate" or other grammatical equivalents thereof can refer to the joining of two nucleotide strands by phosphodiester bonds. Ligation can include chemical ligation. Such reactions can be catalyzed by ligases. Ligases refer to a class of enzymes that catalyze this reaction with the hydrolysis of ATP or a similar triphosphate.

[0067] Some embodiments provided herein relate to simultaneously analyzing multiple analytes in a sample using a single assay, the multiple analytes including DNA and RNA. In some embodiments, the target DNA and the target RNA are modified by tagging. Thus, in some embodiments, the method includes modifying the DNA in the sample with a first tag and modifying the RNA in the sample with a second tag. In some embodiments, the method includes capturing the modified DNA with a first probe complementary to the first tag and capturing the modified RNA with a second probe complementary to the second tag. In some embodiments, the method includes analyzing the captured DNA and RNA. As used herein, the terms "first tag" and "second tag" do not refer to a particular timing or sequence of tagging events. Rather, the terms are used simply to describe that a first analyte includes one tag, e.g., referred to as a first tag, and a second analyte includes another tag, e.g., referred to as a second tag. In any of the embodiments described herein, the first and second tags may be the same or different. The barcode identifies the analytes as being from a common source, while the tag identifies the analyte as a particular type, e.g., DNA or RNA.

[0068] In some embodiments, the method further comprises simultaneously analyzing additional analytes of interest in addition to DNA and RNA, e.g., analyzing proteins, In such embodiments, the additional analytes of interest, such as proteins, are modified with additional tags.

[0069] In some embodiments, the first and second tags (or further tags, if relevant) are different. In some embodiments, the first and second tags (or further tags, if relevant) are the same. In some embodiments, the first and second tags further comprise a substrate recognition sequence. The substrate recognition sequence is a sequence that recognizes and binds to a substrate, thereby immobilizing the tag. In some embodiments, the substrate recognition sequence of the first tag is the same as the substrate recognition sequence of the second tag.

[0070] In some embodiments, DNA is tagged via a tagmentation process, as shown in Figure 2. In the embodiment of Figure 2, a well plate 10 is shown having an isolated single cell or nucleus 15. The nucleus 15 contains DNA 20 and mRNA 21 within the nucleus 15. 25. Single cells or nuclei 15 may be encapsulated within droplets or separated into individual wells for analysis. DNA 20 is shown tagged with tag 1, which may be derived via tagmentation or other tagging processes, such as reverse transcription, ligation, or other means for tagging DNA. In the embodiment of FIG. 2, mRNA 25 is tagged with tag 2. FIG. 2 also shows probes 30, 35 immobilized on a solid support 40, which may be a bead or other surface. DNA Probe 30 specific for DNA 20 contains a tag 1 capture element, a capture element that specifically binds to tag 1 on DNA 20. Probe 35 specific for mRNA 25 contains a tag 2 capture element, a capture element that specifically binds to tag 2 on mRNA 25. Each probe also contains a barcode, thereby allowing indexing of the analytes of interest, in this case DNA and mRNA.

[0071] In some embodiments, the mRNA that includes a poly-A tail is not tagged. For example, in the embodiment shown in FIG. 3, the well plate 200 has nuclei 205 that include mRNA 210 with a poly-A tail 215, but are otherwise untagged. In the embodiment of FIG. 3, the gDNA 220 is tagged with a poly-A tail 215. After tagging of the gDNA 220, both the gDNA 220 and the mRNA 210 include the poly-A tail 215. The gDNA 220 can be tagged with the poly-A tail 215, for example, using tagmentation. As shown in FIG. 3, the gDNA 220 with the poly-A tail 215 and the mRNA 210 that also has the poly-A tail 215 can be captured with the same probe 225 that includes a poly-T capture element 230. The probe 225 is immobilized on a solid support 240. Thus, the gDNA 220 and the mRNA 210 are processed simultaneously and assigned the same barcode 235. The gDNA 220 can be distinguished from the mRNA 210 based on the transposon-specific sequences incorporated during the tagmentation process. This concept is explained in further detail with reference to FIG.

[0072] Figure 4 shows an exemplary method for simultaneously analyzing both gDNA and mRNA in a single sample. In this embodiment, a polyA transposon is introduced into genomic DNA by transposition. The nucleus / cell is encapsulated with an indexed probe with a polyT tail. The indexed probe is hybridized and then ligated to the transposed gDNA fragment and hybridized with the mRNA. This creates the first cDNA. After transposition, the gDNA contains a ME sequence, which is a tagmentation specific sequence. After synthesis of the second cDNA, the double-stranded cDNA and gDNA are transposed again to incorporate PCR adaptors. The fragments are then prepared for PCR amplification.

[0073] As used herein, the term "reagent" refers to an agent or mixture of two or more agents useful for reacting with, interacting with, diluting, or adding to a sample, and may include agents used in the assays described herein, including agents for lysis, nucleic acid analysis, nucleic acid amplification reactions, protein analysis, tagmentation reactions, ATAC-seq, CPT-seq, or SCI-seq reactions, or other assays. Thus, reagents may include, for example, buffers, chemicals, enzymes, polymerases, primers having a size of less than 50 base pairs, template nucleic acids, nucleotides, labels, dyes, or nucleases. In some embodiments, reagents include lysozyme, proteinase K, random hexamers, polymerases (e.g., Φ29 DNA polymerase, Taq polymerase, Bsu polymerase), transposases (e.g., Tn5), primers (e.g., P5 and P7 adaptor sequences), ligases, catalytic enzymes, deoxynucleotide triphosphates, buffers, or divalent cations.

[0074] In some embodiments, the sample comprises a single cell, and the single cell is fixed. In some embodiments, the cell may be fixed with a fixative. As used herein, a fixative generally refers to an agent capable of fixing a cell. For example, a fixed cell may stabilize a protein complex, a nucleic acid complex, or a protein-nucleic acid complex in the cell. Suitable fixatives and crosslinkers include alcohol or aldehyde-based fixatives, formaldehyde, glutaraldehyde, ethanol-based fixatives, methanol-based fixatives, acetone, acetic acid, osmium tetroxide, potassium dichromate, chromate, potassium permanganate, mercury, picrate, formalin, paraformaldehyde, bis[sulfosuccinimidyl]suberate (BS3), 3,3'-dithiobis[sulfosuccinimidylpropionate] (DTSSP), ethylene glycol bis[sulfosuccinimidyl succinate] These crosslinkers may include amine-reactive NHS-ester crosslinkers such as (sulfo-EGS), disuccinimidyl glutarate (DSG), dithiobis[succinimidyl propionate] (DSP), disuccinimidyl suberate (DSS), ethylene glycol bis[succinimidyl succinate] (EGS), NHS-ester / diazirine crosslinkers such as NHS-diazirine, NHS-LC-diazirine, NHS-SS-diazirine, sulfo-NHS-diazirine, sulfo-NHS-LC-diazirine, and sulfo-NHS-SS-diazirine. In some embodiments, fixing the cells preserves the internal state of the cells, thereby preventing alteration of the cells during subsequent analysis or performance of the assay.

[0075] In some embodiments, the sample includes a nucleic acid source, such as a single cell, a single nucleus, or a cell or nucleus population, and the single cell, single nucleus, cell or nucleus population is encapsulated in a droplet. In some embodiments, the cells are fixed prior to encapsulation. As used herein, a droplet is a bead for encapsulating a single cell and may include hydrogel beads made of a hydrogel composition. In some embodiments, the droplet is a homogenous droplet of hydrogel material or a hollow droplet with a polymeric hydrogel shell. Whether homogenous or hollow, the droplet may be capable of encapsulating a single cell. As used herein, the term "hydrogel" refers to a material formed when organic polymers (natural or synthetic) are crosslinked via covalent, ionic, or hydrogen bonds to produce a three-dimensional open lattice structure that traps water molecules to form a gel. In some embodiments, the hydrogel may be a biocompatible hydrogel. As used herein, the term "biocompatible hydrogel" refers to a polymer that forms a gel that is not toxic to living cells and allows sufficient diffusion of oxygen and nutrients to the trapped cells to maintain viability.In some embodiments, the hydrogel material includes alginate, acrylamide, or poly-ethylene glycol (PEG), PEG-acrylate, PEG-amine, PEG-carboxylate, PEG-dithiol, PEG-epoxide, PEG-isocyanate, PEG-maleimide, polyacrylic acid (PAA), poly(methyl methacrylate) (PMMA), polystyrene (PS), polystyrene sulfonate (PSS), polyvinylpyrrolidone (PVPON), N,N'-bis(acryloyl)cystamine, polypropylene oxide (PPO), poly(hydroxyethyl methacrylate) (PHEMA), poly(N-isopropylacrylamide) (PNIPAAm), poly(lactic acid) (PLA), poly(lactic-co-glycolic acid) (PLGA), polycaprolactone (PCT), polyvinylpyrrolidone (PVPON ... The hydrogel may be a polyacrylamide, polyvinylsulfonic acid (PCL), poly(vinylsulfonic acid) (PVSA), poly(L-aspartic acid), poly(L-glutamic acid), polylysine, agar, agarose, heparin, alginate sulfate, dextran sulfate, hyaluronan, pectin, carrageenan, gelatin, chitosan, cellulose, collagen, bisacrylamide, diacrylate, diallylamine, triallylamine, divinylsulfone, diethylene glycol diallyl ether, ethylene glycol diacrylate, polymethylene glycol diacrylate, polyethylene glycol diacrylate, trimethylpropane trimethacrylate, ethoxylated trimethylol triacrylate, or ethoxylated pentaerythritol tetraacrylate, or combinations or mixtures thereof. In some embodiments, the hydrogel is an alginate, acrylamide, or PEG-based material. In some embodiments, the hydrogel is a PEG-based material with acrylate-dithiol, epoxide-amine reaction chemistry. In some embodiments, the hydrogel forms a polymer shell that includes PEG-maleimide / dithiol oil, PEG-epoxide / amine oil, PEG-epoxide / PEG-amine, or PEG-dithiol / PEG-acrylate. In some embodiments, the hydrogel material is selected to avoid the generation of free radicals that can damage intracellular biomolecules.In some embodiments, the hydrogel polymer comprises 60-90% fluid, such as water, and 10-30% polymer. In certain embodiments, the water content of the hydrogel is about 70-80%. As used herein, the terms "about" or "approximately," when used to modify a numerical value, refer to variations that may occur in the numerical value. For example, variations may occur due to differences in the manufacture of a particular matrix or component. In one embodiment, the term "about" means within 1%, 5%, or up to 10% of the recited numerical value.

[0076] Hydrogels can be prepared by crosslinking hydrophilic biopolymers or synthetic polymers. Thus, in some embodiments, hydrogels can include a crosslinker. As used herein, the term "crosslinker" refers to a molecule that can form a three-dimensional network when reacted with an appropriate base monomer. Examples of hydrogel polymers that may include one or more crosslinkers include hyaluronan, chitosan, agar, heparin, sulfate, cellulose, alginate (including alginate sulfate), collagen, dextran (including dextran sulfate), pectin, carrageenan, polylysine, gelatin (including type A gelatin), agarose, (meth)acrylate-oligolactide-PEO-oligolactide-(meth)acrylate, PEO-PPO-PEO copolymer (Pluronic), poly(phosphazene), poly(methacrylate), poly(N-vinylpyrrolidone), PL(G)A-PEO-PL(G)A copolymer, poly(ethyleneimine), polyethylene glycol (PEG)-thiol, PEG-acrylate, acrylamide, N,N'-bis(acryloyl)cystamine, PEG, polypropylene oxide (PPO), polyacrylic acid, poly( hydroxyethyl methacrylate) (PHEMA), poly(methyl methacrylate) (PMMA), poly(N-isopropylacrylamide) (PNIPAAm), poly(lactic acid) (PLA), poly(lactic-co-glycolic acid) (PLGA), polycaprolactone (PCL), poly(vinyl sulfonic acid) (PVSA), poly(L-aspartic acid), poly(L-glutamic acid), bisacrylamide, diacrylate, diallylamine, triallylamine, divinyl sulfone, diethylene glycol diallyl ether, ethylene glycol diacrylate, polymethylene glycol diacrylate, polyethylene glycol diacrylate, trimethylpropane trimethacrylate, ethoxylated trimethylol triacrylate, or ethoxylated pentaerythritol tetraacrylate, or combinations thereof.Thus, for example, a combination can include a polymer and a crosslinker, such as polyethylene glycol (PEG)-thiol / PEG-acrylate, acrylamide / N,N'-bis(acryloyl)cystamine (BACy), or PEG / polypropylene oxide (PPO). In some embodiments, the polymer shell comprises a 4-arm polyethylene glycol (PEG). In some embodiments, the 4-arm polyethylene glycol (PEG) is selected from the group consisting of PEG-acrylate, PEG-amine, PEG-carboxylate, PEG-dithiol, PEG-epoxide, PEG-isocyanate, and PEG-maleimide.

[0077] In some embodiments, the crosslinker is an instantaneous crosslinker or a delayed crosslinker. An immediate crosslinker is a crosslinker that immediately crosslinks the hydrogel polymers, and is referred to herein as click chemistry. An immediate crosslinker may include dithiol oil + PEG-maleimide or PEG epoxide + amine oil. A delayed crosslinker is a crosslinker that slowly crosslinks the hydrogel polymers, and may include PEG-epoxide + PEG-amine or PEG-dithiol + PEG-acrylate. A delayed crosslinker may take more than a few hours to crosslink, for example, more than 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 hours to crosslink. In some embodiments provided herein, the droplets are formulated with an immediate crosslinker, which better preserves the state of the cells compared to delayed crosslinkers. Without wishing to be bound by theory, it is possible that the cells undergo physiological changes through intracellular signaling mechanisms during the longer crosslinking times.

[0078] In some embodiments, the crosslinker forms disulfide bonds in the hydrogel polymers, thereby linking the hydrogel polymers. In some embodiments, the hydrogel polymers form a hydrogel matrix with pores (e.g., a porous hydrogel matrix). These pores can hold sufficiently large particles, such as single cells or nucleic acids extracted therefrom, within the droplet, while allowing other materials, such as reagents, to pass through the pores, thereby entering or leaving the droplet. In some embodiments, the pore size of the droplet is fine-tuned by varying the ratio of the polymer concentration to the crosslinker concentration. In some embodiments, the ratio of polymer to crosslinker is 30:1, 25:1, 20:1, 19:1, 18:1, 17:1, 16:1, 15:1, 14:1, 13:1, 12:1, 11:1, 10:1, 9:1, 8:1, 7:1, 6:1, 5:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:15, 1:20, or 1:30, or a ratio within a range defined by any two of the foregoing ratios. In some embodiments, further functions such as DNA primers or charged chemical groups can be grafted onto the polymer matrix to meet the requirements of different applications.

[0079] As used herein, the term "porosity" refers to the volume fraction (dimensionless) of a hydrogel that is composed of open space, e.g., pores or other openings. Porosity thus measures the voids in a material and is the volume fraction of voids relative to the total volume as a percentage from 0 to 100% (or 0 to 1). The porosity of a hydrogel can range from 0.5 to 0.99, from about 0.75 to about 0.99, or from about 0.8 to about 0.95.

[0080] In some embodiments, the droplets can have any pore size that allows sufficient diffusion of reagents while retaining single cells or nucleic acids extracted therefrom. As used herein, the term "pore size" refers to the cross-sectional diameter or effective diameter of the pores. The term "pore size" can also refer to the average cross-sectional diameter or average effective diameter of the pores based on measurements of multiple pores. The effective diameter of a non-circular cross-section is equal to the diameter of a circular cross-section having the same cross-sectional area as the non-circular cross-section. In some embodiments, the hydrogel can swell when the hydrogel is hydrated. The size of the pore size can then change depending on the water content of the hydrogel. In some embodiments, the pores of the hydrogel can have pores of a size sufficient to retain cells encapsulated within the hydrogel, but allow reagents to pass through. In some embodiments, the interior of the droplet is an aqueous environment. In some embodiments, the single cells disposed within the droplet do not interact with and / or contact the polymer shell of the droplet. In some embodiments, a polymer shell is formed around cells and the cells are contacted with the polymer shell to bring it to the cell surface by passive adsorption or in a targeted manner, such as by being bound to an antibody or other specific binding molecule.

[0081] In some embodiments, the droplets are of a size sufficient to encapsulate a single cell. In some embodiments, the droplets have a diameter of about 20 μm to about 200 μm, e.g., 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 μm, or a diameter within a range defined by any two of the preceding values. The size of the droplets may vary depending on environmental factors. In some embodiments, the droplets expand when separated from the continuous oil phase and immersed in an aqueous phase. In some embodiments, the expansion of the droplets increases the efficiency of performing assays on genetic material within the encapsulated cells. In some embodiments, the expansion of the droplets creates a larger environment for indexed inserts to be amplified during PCR, which may otherwise be limited in current cell-based assays.

[0082] In some embodiments, the droplets are prepared by dynamic means such as vortex-assisted emulsion, microfluidic droplet generation, or valve-based microfluidics. In some embodiments, the droplets are formulated with a uniform size distribution. In some embodiments, the size of the droplets is fine-tuned by adjusting the size of the microfluidic device, the size of one or more channels, or the flow rate through the microfluidic channel. In some embodiments, the resulting droplets have a diameter in the range of 20-200 μm, for example, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 μm, or a diameter within a range defined by any two of the aforementioned values.

[0083] In some embodiments, analyzing one or more analytes may include various analyses depending on what the analytes are. For example, analyzing may include DNA analysis, RNA analysis, protein analysis, tagmentation, nucleic acid amplification, nucleic acid sequencing, nucleic acid library creation, assay for transposase accessible chromatin using sequencing (ATAC-seq), continuous conservative transposition (CPT-seq), single cell combinatorial indexing sequencing (SCI-seq), or single cell genome amplification, or any combination thereof.

[0084] DNA analysis refers to any technique used to amplify, sequence, or otherwise analyze DNA. DNA amplification can be accomplished using PCR techniques or pyrosequencing. DNA analysis can also include non-targeted non-PCR-based DNA sequencing (e.g., metagenomics) techniques. As a non-limiting example, DNA analysis can include sequencing the hypervariable regions of 16S rDNA (ribosomal DNA) and using sequencing for DNA-mediated species identification.

[0085] RNA analysis refers to any technique used to amplify, sequence, or otherwise analyze RNA. The same techniques used to analyze DNA can be used to amplify and sequence RNA. RNA, which is less stable than DNA, is the translation of DNA in response to a stimulus. Thus, RNA analysis can provide a more accurate picture of metabolically active members of a community and can be used to provide information about the community function of organisms in a sample. Furthermore, simultaneous analysis of both DNA and RNA can be beneficial to efficiently determine investigations related to both DNA and RNA. Nucleic acid sequencing refers to the use of sequencing to determine the order of nucleotides in the sequence of a nucleic acid molecule, such as DNA or RNA.

[0086] As used herein, the term "sequencing" refers to a method that results in the identification of at least 10 consecutive nucleotides of a polynucleotide (e.g., the identification of at least 20, at least 50, at least 100, or at least 200 or more consecutive nucleotides).

[0087] The term "next generation sequencing" or "high throughput sequencing" or "NGS" generally refers to high throughput sequencing technologies including, but not limited to, massively parallel signature sequencing, high throughput sequencing, sequencing by ligation (e.g., SOLiD), sequencing), proton ion semiconductor sequencing, DNA nanoball sequencing, single molecule sequencing, and nanopore sequencing, and may also refer to parallel sequencing by synthesis or sequencing by ligation platforms currently employed by companies such as Illumina, Life Technologies, or Roche. Next generation sequencing methods may also include nanopore sequencing methods or electronic detection-based methods such as the Ion Torrent technology commercialized by Life Technologies or the single molecule fluorescence-based methods commercialized by Pacific Biosciences.

[0088] Protein analysis refers to the study of proteins and may include proteomic analysis, determining post-translational modifications of a protein of interest, determining protein expression levels, or determining protein interactions with other molecules, including other proteins or nucleic acids.

[0089] As used herein, the term "tagmentation" refers to the modification of DNA by a transposome complex containing a transposase enzyme complexed with an adaptor containing a transposon end sequence. Tagmentation results in simultaneous fragmentation of the DNA and ligation of adaptors to the 5' ends of both strands of the double-stranded fragment. Following a purification step to remove the transposase enzyme, additional sequences can be added to the ends of the compatible fragments, for example, by PCR, ligation, or any other suitable method known to those skilled in the art.

[0090] Assay of transposase-accessible chromatin using sequencing (ATAC-seq) refers to a rapid and sensitive method of integrative epigenomic analysis. ATAC-seq captures open chromatin sites and reveals the interplay between the genomic location of open chromatin, DNA-binding proteins, individual nucleosomes, and higher order compaction in regulatory regions with nucleotide resolution. Classes of DNA-binding factors that strictly avoid, tolerate, or tend to overlap with nucleosomes have been discovered. Using ATAC-seq, we measured the continuous daily epigenome of resting human T cells, assessed from probands via standard blood draws, demonstrating the feasibility of reading out an individual's epigenome on a clinical timescale for monitoring health and disease. More specifically, ATAC-seq can be performed by treating chromatin from a single cell with an intercalating enzyme complex to generate tagged fragments of genomic DNA. In this step, chromatin is tagmented (e.g., fragmented and tagged in the same reaction) using an insertase such as Tn5 or MuA, which cuts genomic DNA in open regions of chromatin and adds adapters to both ends of the fragment. ATAC-seq allows transposition only in the open chromatin state, as outlined in Figure 5A, and is generally described in Buenrostro et al. (Nature Methods, 2013, 10, 1213-1218), which is incorporated herein by reference in its entirety.

[0091] In any of the methods, compositions, or system embodiments described herein, ATAC-seq can be performed on a single cell or in bulk. Single cell ATAC-seq allows for epigenetic analysis of single cells and can be performed in a compartment, for example, by encapsulating a single cell or a single nucleus in a droplet or bead. As used herein, the term compartment refers to either a physical or virtual designation of a confined space in which a reaction can occur. For example, a compartment can be a bead, a droplet, a well, or other physical parameter that defines an area in which components can be held, for example, a single cell can be subjected to experimentation and analysis. The term co-compartmentalization refers to being in a single compartment. For example, when two analytes are said to be co-compartmentalized, both analytes are in the same compartment. Co-compartmentalized reaction products refer to products that are located in the same compartment or prepared in the same compartment (e.g., prepared in a single environment under the same reaction conditions).

[0092] Encapsulation of single cells or single nuclei within beads or droplets can be performed by dispensing the single cells or nuclei within beads. Once encapsulated, the single cells are subjected to ATAC-seq as outlined in FIG. 5B. In single cell ATAC-seq, the cells (or nuclei) can be individually compartmentalized, tagmented, and analyzed. This allows for continuity-preserving transposition (CPT-seq) as it ensures that all DNA or library from a single cell is encapsulated in a single droplet. Usually, transposition inserts adaptors and fragments the DNA after removal of the transposase. Thus, fragmentation makes it impossible to obtain single cell resolution as it thereby scrambles the reads from various cells into the droplet. In contrast, the method provided herein allows the transposase to hold all the individual DNA / library fragments together, allowing all material from a single cell to be transferred into a single droplet. Then, all fragments from the cells in the single droplet can be indexed by PCR using barcoded primers (from the beads loaded into the droplet). CPT-seq is generally described in Amini et al. (Nat Genet, 2014, 46, 1343-1349), which is incorporated herein by reference in its entirety. Additionally, in some embodiments, single cell ATAC-seq can be used for combinatorial indexing. Combinatorial or split-and-pool indexing can be used to load multiple cells into the same well or droplet while maintaining single cell / single nucleus resolution. In some embodiments, indexes can be used for sample identification, experimental conditions, or the same cells. Combinatorial indexing can be used to increase droplet utilization and cell throughput, and can be used on single cells or nuclei.

[0093] In some cases, conditions may be adjusted to obtain the desired level of insertion into the chromatin (e.g., insertions occurring on average every 50-200 base pairs in the open region). The chromatin used in the method may be produced by any suitable method. In some embodiments, nuclei may be isolated and lysed, and the chromatin may be further purified, for example, from the nuclear envelope. In other embodiments, the chromatin may be isolated by contacting the isolated nuclei with a reaction buffer. In these embodiments, the isolated nuclei may be lysed when contacted with the reaction buffer (containing the insertion enzyme complex and other necessary reagents), thereby allowing the insertion enzyme complex to access the chromatin. In these embodiments, the method may include isolating nuclei from a population of cells, and combining the isolated nuclei with a transposase and an adaptor, which combination results in both the nuclei lysing to release the chromatin and the generation of adaptor-tagged fragments of genomic DNA. The chromatin does not require crosslinking, as in other methods (e.g., ChIP-SEQ).

[0094] After the chromatin is fragmented and tagged to generate tagged fragments of genomic DNA, at least a portion of the adaptor-tagged fragments are sequenced to generate a plurality of sequence reads. The fragments may be sequenced using any suitable method. For example, the fragments may be sequenced using Illumina's reversible terminator method, Roche's pyrosequencing method (454), Life Technologies' sequencing by ligation (SOLiD platform), or Life Technologies' Ion Torrent platform. Examples of such methods are described in the following references: Margulies et al. (Nature 2005 437: 376-80); Ronaghi et al. (Analytical Biochemistry 1996 242: 84-9); Shendure et al. (Science 2005 309: 1728-32); Imelfort et al. (Brief Bioinform. 2009 10: 609-18); Fox et al. (Methods Mol Biol. 2009; 553: 79-108); Appleby et al. (Methods Mol Biol. 2009;513:19-39) and Morozova et al. (Genomics. 2008 92:255-64), which are incorporated herein by reference for a general description of the method and certain steps of the method, including all starting products, methods for library preparation, reagents, and the final products of each step. As will be apparent, forward and reverse sequencing primer sites compatible with the selected next generation sequencing platform can be added to the ends of the fragments during the amplification step. In certain embodiments, the fragments can be amplified using PCR primers that hybridize to tags added to the fragments, and the primers used for PCR have 5' tails compatible with the particular sequencing platform. Methods for performing ATAC-seq are described in PCT Patent Application No. PCT / US2014 / 038825, which is incorporated herein by reference in its entirety.

[0095] As used herein, the term "chromatin" refers to a complex of molecules containing proteins and polynucleotides (e.g., DNA, RNA) as found in the nucleus of a eukaryotic cell. Chromatin is composed, in part, of histone proteins that form nucleosomes, genomic DNA, and other DNA-binding proteins (e.g., transcription factors) that typically bind to genomic DNA.

[0096] Contiguous preserving transposition sequencing (CPT-seq) refers to a method of sequencing while preserving contiguous information by using a transposase to maintain the association of template nucleic acid fragments adjacent to the target nucleic acid. For example, CPT can be performed on nucleic acids such as DNA or RNA. CPT nucleic acids can be captured and immobilized on a solid support by hybridization of complementary oligonucleotides with unique indexes or barcodes. In some embodiments, the oligonucleotides immobilized on the solid support can further include a primer binding site, a unique molecular index, in addition to the barcode. Advantageously, such use of transposomes to maintain the physical proximity of the fragmented nucleic acids increases the likelihood that fragmented nucleic acids from the same original molecule, e.g., chromosome, will receive the same unique barcode and index information from the oligonucleotides immobilized on the solid support. This results in a contiguous linked sequencing library with unique barcodes. The contiguous linked sequencing library can be sequenced to derive contiguous sequence information.

[0097] As used herein, the term "continuity information" refers to the spatial relationship between two or more DNA fragments based on shared information. The shared aspects of information can be related to the spatial relationship of adjacent, compartmental, and distance. Information on these relationships facilitates hierarchical assembly or mapping of sequence reads derived from DNA fragments. This continuity information improves the efficiency and accuracy of such assembly or mapping, because traditional assembly or mapping methods used in conjunction with conventional shotgun sequencing do not consider the relative genomic origin or coordinates of individual sequence reads with respect to the spatial relationship between two or more DNA fragments from which the individual sequence reads are derived.

[0098] Thus, according to embodiments described herein, methods for capturing continuity information may be accomplished by short-range continuity methods for determining adjacent spatial relationships, medium-range continuity methods for determining compartmental spatial relationships, or long-range continuity methods for determining distance spatial relationships. These methods facilitate the accuracy and quality of DNA sequence assembly or mapping, and may be used with any sequencing method as described herein.

[0099] The contiguous information includes the relative genomic origin or coordinates of individual sequence reads with respect to the spatial relationship between two or more DNA fragments from which the individual sequence reads are derived. In some embodiments, the contiguous information includes sequence information from non-redundant sequence reads.

[0100] In some embodiments, the contiguous information of the target nucleic acid sequence represents haplotype information. In some embodiments, the contiguous information of the target nucleic acid sequence represents genomic variants.

[0101] Single-cell combinatorial indexed sequencing (SCI-seq) is a sequencing method for simultaneously generating thousands of low-pass single-cell libraries for somatic copy number variant detection. Some embodiments provided herein relate to methods, compositions, and systems for simultaneously analyzing multiple analytes in a sample using a combinatorial indexing approach such as SCI-seq. For example, as shown in FIG. 10, SCI-seq can be used to simultaneously index DNA and RNA. After introduction of specific tags for DNA and RNA, cells / nuclei are physically split into multiple groups. For each group, DNA is labeled with a first barcode (barcode I in FIG. 10) and RNA is labeled with a second barcode (barcode J in FIG. 10). Labeling of DNA and RNA can be done simultaneously or sequentially. The groups can then be pooled together and randomly split into multiple groups, which can be further labeled with a third barcode (barcode K in FIG. 10). The pool-and-split process can be repeated for multiple rounds to increase indexing capacity. The collision rate of indexes (same barcode for different cells / nuclei) can be controlled by the number of barcodes per round and the number of cells / nuclei per group. Barcodes can be introduced by reverse transcriptase, by ligation, by tagmentation, or by other means for introducing barcodes. In some embodiments, the combinatorial sequencing techniques described herein do not require separation or isolation of nuclei from cells.

[0102] Figure 11 further illustrates the details of combinatorial sequencing, such as by SCI-seq, using indexing by ligation and extension. A transposon with tag 1 is inserted into genomic DNA by transposition. An oligonucleotide with barcode I and tag 2 is ligated to gDNA via tag 1 hybridization. The first cDNA synthesis is initiated by a poly-T oligonucleotide with barcode J and tag 2, followed by the second cDNA synthesis. Following the pool-and-split process, an oligonucleotide with barcode K is hybridized to both gDNA and cDNA in the tag 2 region and ligated by gap-filling ligation. Tag 3 can serve as an anchor for the next round of indexing after split-and-pool. After combinatorial indexing, the PCR / library adaptor at the other end can be added by a second round of transposition.

[0103] As used herein, the terms "isolated," "isolate," "purified," "purify," and their grammatical equivalents as used herein, unless otherwise specified, refer to a reduction in the amount of at least one contaminant (such as a protein and / or nucleic acid sequence) from a sample or from the source (e.g., a cell) from which the material was isolated. Purification thus results in an "enrichment," e.g., an increase in the amount of a desired protein and / or nucleic acid sequence in a sample.

[0104] Following lysis and isolation of the nucleic acids, amplification may be performed, such as multiple displacement amplification (MDA), a technique that is widely used to amplify small amounts of DNA, especially from single cells. In some embodiments, the nucleic acids are amplified, sequenced, or used for preparation of a nucleic acid library. As used herein, the terms "amplify" or "amplified" and "amplifying" used in reference to nucleic acids or nucleic acid reactions refer to in vitro methods of making copies of a particular nucleic acid, such as a target nucleic acid, for example, according to embodiments of the present invention. Many methods of amplifying nucleic acids are known in the art, and amplification reactions include polymerase chain reaction, ligase chain reaction, strand displacement amplification reaction, rolling circle amplification reaction, multiple annealing and looping amplification cycles (MALBAC), transcription-mediated amplification methods such as NASBA, and loop-mediated amplification methods (e.g., "LAMP" amplification using loop-forming sequences). The nucleic acid to be amplified may be DNA that comprises, consists of, or is derived from DNA or RNA, or a mixture of DNA and RNA, including modified DNA and / or RNA. The products resulting from the amplification of one or more nucleic acid molecules (e.g., "amplification products"), regardless of whether the starting nucleic acid is DNA, RNA, or both, can be either DNA or RNA, or a mixture of both DNA and RNA nucleosides or nucleotides, or can contain modified DNA or RNA nucleosides or nucleotides. A "copy" does not necessarily mean perfect sequence complementarity or identity to the target sequence. For example, a copy can include nucleotide analogs such as deoxyinosine or deoxyuridine, deliberate sequence modifications (such as those introduced via primers that contain sequences that are hybridizable to, but not complementary to, the target sequence, and / or sequence errors that occur during amplification.

[0105] The captured nucleic acid can be amplified according to any suitable amplification method known in the art. It will be understood that any of the amplification methods described herein or generally known in the art can be utilized with universal or target-specific primers to amplify the nucleic acid. Suitable methods for amplification include, but are not limited to, polymerase chain reaction (PCR), strand displacement amplification (SDA), transcription-mediated amplification (TMA) and nucleic acid sequence-based amplification (NASBA), as described in U.S. Pat. No. 8,003,354, which is incorporated herein by reference in its entirety. The above amplification methods can be used to amplify one or more nucleic acids of interest. For example, PCR, including multiplex PCR, SDA, TMA, NASBA, etc., can be utilized to amplify the nucleic acid. In some embodiments, primers specifically directed to the nucleic acid of interest are included in the amplification reaction.

[0106] Other suitable methods for amplification of nucleic acids include oligonucleotide extension and ligation, rolling circle amplification (RCA) (Lizardi et al., Nat. Genet. 19:225-232 (1998) which are incorporated herein by reference) and oligonucleotide ligation assay (OLA) techniques (generally described in U.S. Pat. Nos. 7,582,420, 5,185,243, 5,679,524 and 5,573,907; European Patent Application No. EP 0 159 141; and US Pat. No. 5,573,907, all of which are incorporated herein by reference). 320 308 B1, EP 0 336 731 B1, EP 0 439 182 B1; see WO 90 / 01069, WO 89 / 12696 and WO 89 / 09835). It will be understood that these amplification methods can be designed to amplify nucleic acids. For example, in some embodiments, the amplification method can include a ligation probe amplification or oligonucleotide ligation assay (OLA) reaction that includes a primer that is specifically directed to the nucleic acid of interest. In some embodiments, the amplification method can include a primer extension ligation reaction that includes a primer that is specifically directed to the nucleic acid of interest and that can pass through the hydrogel pores. As non-limiting examples of primer extension and ligation primers that can be specifically designed to amplify a nucleic acid of interest, amplification primers can include those used in the GoldenGate assay (Illumina, Inc., San Diego, Calif.) as exemplified in U.S. Pat. Nos. 7,582,420 and 7,611,869, each of which is incorporated herein by reference in its entirety.

[0107] In some embodiments, nucleic acids are amplified using cluster amplification methods, as exemplified by the disclosures of U.S. Patent Nos. 7,985,565 and 7,115,400, the contents of each of which are incorporated herein by reference in their entirety. The incorporated materials of U.S. Patent Nos. 7,985,565 and 7,115,400 describe a method of nucleic acid amplification that allows the amplification products to be immobilized on a solid support to form an array consisting of clusters or "colonies" of immobilized nucleic acid molecules. Each cluster or colony on such an array is formed from a plurality of identical immobilized polynucleotide strands and a plurality of identical immobilized complementary polynucleotide strands. Arrays so formed are generally referred to herein as "clustered arrays." The product of the solid-phase amplification reaction as described in US Patent Nos. 7,985,565 and 7,115,400 is a so-called "bridged" structure formed by annealing a pair of immobilized polynucleotide strands and immobilized complementary strands, both strands being immobilized on the solid support at their 5' ends, preferably via covalent bonds. Cluster amplification is an example of a method for generating immobilized amplicons using immobilized nucleic acid templates. Other suitable methods can also be used to generate immobilized amplicons from immobilized DNA fragments generated according to the methods provided herein. For example, one or more clusters or colonies can be formed by solid-phase PCR, regardless of whether one or both primers of each pair of amplification primers are immobilized.

[0108] Further amplification methods include isothermal amplification. Representative isothermal amplification methods that can be used can include, but are not limited to, multiple displacement amplification (MDA), as exemplified in, for example, Dean et al., Proc. Natl. Acad. Sci. USA 99:5261-66 (2002), or isothermal strand displacement nucleic acid amplification, as exemplified in U.S. Patent No. 6,214,587, each of which is incorporated herein by reference in its entirety. Other non-PCR-based methods that can be used in the present disclosure include strand displacement amplification (SDA), as described, for example, in Walker et al., Molecular Methods for Virus Detection, Academic Press, Inc., 1995, U.S. Patent Nos. 5,455,166 and 5,130,238, and Walker et al., Nucl. Acids. Res. 20:1691-96 (1992), or hyperbranched strand displacement amplification, as described, for example, in Lage et al., Genome Research 13:294-307 (2003), each of which is incorporated herein by reference in its entirety. Isothermal amplification methods can be used with strand-displacing Phi 29 polymerase or large fragment, 5'→3' exo- of Bst DNA polymerase for random primer amplification of genomic DNA. The use of these polymerases takes advantage of their high processivity and strand displacement activity. High processivity allows the polymerase to generate fragments of 10-20 kb in length. As noted above, polymerases with low processivity and strand displacement activity, such as Klenow polymerase, can be used to generate smaller fragments under isothermal conditions. Further description of the amplification reaction, conditions and components are described in detail in the disclosure of U.S. Pat. No. 7,670,810, which is incorporated herein by reference in its entirety. In some embodiments, random hexamers are annealed to denatured DNA, followed by strand displacement synthesis at a constant temperature in the presence of the catalytic enzyme Phi 29. This results in DNA amplification, as confirmed by an increase in fluorescence intensity (SYTOX stained DNA) after MDA.Independently, NEXTERA®-based tagmentation after lysis and cleanup and subsequent gDNA amplification by PCR can also be performed, as indicated by the substantial increase in fluorescence intensity after NEXTERA® tagmentation and PCR.

[0109] Another nucleic acid amplification method useful in the present disclosure is tagged PCR, which uses a population of two-domain primers with a constant 5' region followed by a random 3' region, as described, for example, in Grothues, et al. Nucleic Acids Res. 21(5):1321-2 (1993), which is incorporated herein by reference in its entirety. An initial round of amplification is carried out to allow multiple initiations on heat-denatured DNA based on individual hybridization from the randomly synthesized 3' region. Due to the nature of the 3' region, the initiation sites are believed to be random throughout the genome. Unbound primers can then be removed, and further replication can be carried out using primers complementary to the constant 5' region.

[0110] In some embodiments, the nucleic acid is fully or partially sequenced. The nucleic acid can be sequenced according to any suitable sequencing method, such as direct sequencing, including sequencing by synthesis, sequencing by ligation, sequencing by hybridization, nanopore sequencing, etc.

[0111] One sequencing method is sequencing by synthesis (SBS). In SBS, the extension of a nucleic acid primer along a nucleic acid template (e.g., a target nucleic acid or its amplicon) is monitored to determine the sequence of nucleotides in the template. The underlying chemical process can be polymerization (e.g., catalyzed by a polymerase enzyme). In certain polymer-based SBS embodiments, fluorescently labeled nucleotides are added to the primer (thereby extending the primer) in a template-dependent manner, so that the sequence of the template can be determined using detection of the order and type of nucleotides added to the primer.

[0112] One or more amplified nucleic acids can be subjected to SBS or other detection techniques that involve repeatedly delivering reagents in cycles. For example, to initiate a first SBS cycle, one or more labeled nucleotides, DNA polymerase, etc. can be flowed / passed through a droplet containing one or more amplified nucleic acid molecules. The site at which the labeled nucleotide is incorporated by primer extension can be detected. Optionally, the nucleotide can further include a reversible termination property that terminates further primer extension once the nucleotide is added to the primer. For example, a nucleotide analog with a reversible terminator portion can be added to the primer to prevent further extension from occurring until a deblocking agent is delivered to remove the portion. Thus, for embodiments using reversible termination, a deblocking reagent can be delivered to the flow cell (before or after detection is performed). Washing can be performed between the various delivery steps. The cycle can then be repeated n times to extend the primer with n nucleotides, thereby detecting a sequence of length n. Exemplary SBS procedures, fluidics systems and detection platforms that can be readily adapted for use with amplicons generated by the methods of the present disclosure are described, for example, in Bentley et al., Nature 456:53-59 (2008), WO 04 / 018497, U.S. Pat. No. 7,057,026, WO 91 / 06678, WO 07 / 123744, U.S. Pat. No. 7,329,492, U.S. Pat. No. 7,211,414, U.S. Pat. No. 7,315,019, U.S. Pat. No. 7,405,281, and U.S. Patent Application No. 2008 / 0108082, each of which is incorporated herein by reference.

[0113] Other sequencing procedures using cyclic reactions can be used, such as pyrosequencing. Pyrosequencing detects the release of inorganic pyrophosphate (PPi) when a specific nucleotide is incorporated into a nascent nucleic acid chain (Ronaghi, et al., Analytical Biochemistry 242(1), 84-9 (1996); Ronaghi, Genome Res. 11(1), 3-11 (2001); Ronaghi et al. Science 281(5375), 363 (1998); U.S. Patent Nos. 6,210,891; 6,258,568 and 6,274,320, each of which is incorporated herein by reference). In pyrosequencing, the released PPi can be detected by its immediate conversion to adenosine triphosphate (ATP) by ATP sulfurylase, and the level of ATP produced can be detected via luciferase-generated photons. Thus, the sequencing reaction can be monitored via a luminescence detection system. The excitation radiation source used in the fluorescence-based detection system is not necessary for the pyrosequencing procedure. Useful fluid systems, detectors, and procedures that can be adapted for the application of pyrosequencing to amplicons generated according to the present disclosure are described, for example, in WIPO Patent Application No. PCT / US11 / 57111, U.S. Patent Application No. 2005 / 0191698(A1), U.S. Patent No. 7,595,883, and U.S. Patent No. 7,244,559, each of which is incorporated herein by reference.

[0114] Some embodiments can utilize methods that include real-time monitoring of DNA polymerase activity. For example, nucleotide incorporation can be detected through fluorescence resonance energy transfer (FRET) interactions between fluorophore-bearing polymerase and γ-phosphate-labeled nucleotides, or using zero-mode waveguides (ZMW). Techniques and reagents for FRET-based sequencing are described, for example, in Levene et al. Science 299, 682-686 (2003); Lundquist et al. Opt. Lett. 33, 1026-1028 (2008); Korlach et al. Proc. Natl. Acad. Sci. USA 105, 1176-1181 (2008), the disclosures of which are incorporated herein by reference.

[0115] Some SBS embodiments include detection of protons released when nucleotides are incorporated into extension products. For example, sequencing based on detection of released protons can use commercially available electrical detectors and related technologies. Examples of such sequencing systems are pyrosequencing (e.g., commercially available platforms from 454 Life Sciences, a subsidiary of Roche), sequencing using γ-phosphate labeled nucleotides (e.g., commercially available platforms from Pacific Biosciences), sequencing using proton detection (e.g., commercially available platforms from Ion Torrent, a subsidiary of Life Technologies), or the sequencing methods and systems described in U.S. Patent Application Nos. 2009 / 0026082(A1); 2009 / 0127589(A1); 2010 / 0137143(A1); or 2010 / 0282617(A1), each of which is incorporated herein by reference. The methods described herein for amplifying target nucleic acids using kinetic exclusion can be easily adapted to substrates used to detect protons. More specifically, the methods described herein can be used to generate clonal populations of amplicons that are used to detect protons.

[0116] Another sequencing technique is nanopore sequencing (see, e.g., Deamer et al. Trends Biotechnol. 18, 147-151 (2000); Deamer et al. Acc. Chem. Res. 35:817-825 (2002); Li et al. Nat. Mater. 2:611-615 (2003), the disclosures of which are incorporated herein by reference). In some nanopore embodiments, the target nucleic acid or individual nucleotides removed from the target nucleic acid pass through the nanopore. As the nucleic acid or nucleotide passes through the nanopore, each nucleotide type can be identified by measuring the fluctuation in the electrical conductance of the pore. (U.S. Pat. No. 7,001,792; Soni et al. Clin. Chem. 53, 1996-2001 (2007); Healy, Nanomed. 2, 459-481 (2007); Cockroft, et al., J. Am. Chem. 1999, 2002, 2003, 2004). (see, e.g., J. Am. Chem. Soc. 130, 818-820 (2008), the disclosures of which are incorporated herein by reference).

[0117] Exemplary methods for array-based expression and genotyping that can be applied for detection according to the present disclosure are described in U.S. Pat. Nos. 7,582,420; 6,890,741; 6,913,884 or 6,355,431, or U.S. Patent Application Nos. 2005 / 0053980(A1); 2009 / 0186349(A1) or 2005 / 0181440(A1), each of which is incorporated herein by reference.

[0118] In the methods of isolating, amplifying, and sequencing nucleic acids as described herein, various reagents are used for isolating and preparing nucleic acids. Such reagents may include, for example, lysozyme, proteinase K, random hexamers, polymerases (e.g., Φ29 DNA polymerase, Taq polymerase, Bsu polymerase), transposases (e.g., Tn5), primers (e.g., P5 and P7 adapter sequences), ligases, catalytic enzymes, deoxynucleotide triphosphates, buffers, or divalent cations.

[0119] The adaptor may include a sequencing primer site, an amplification primer site, and an index. As used herein, an "index" may include a sequence of nucleotides that can be used as a molecular identifier and / or barcode to tag a nucleic acid and / or identify the source of the nucleic acid. In some embodiments, the index may be used to identify a single nucleic acid, or a subpopulation of nucleic acids. In some embodiments, a single cell may be used for combinatorial indexing, for example, using a continuous preserving transposition (CPT-seq) approach.

[0120] The index can be useful in identifying the source of the nucleic acid molecule. In some embodiments, the adaptors can be modified to prevent the formation of concatemers, for example, by adding blocking groups at one or both ends that prevent extension of the adaptor. Examples of 3' blocking groups include 3' spacer C3, dideoxynucleotides, and attachment to a substrate. Examples of 5' blocking groups include dephosphorylated 5' nucleotides, and attachment to a substrate.

[0121] An exemplary method includes dephosphorylating the 5' end of the target nucleic acid to prevent the formation of concatemers in a subsequent ligation step; ligating a first adaptor to the 3' end of the dephosphorylated target using a ligase in which the 3' end of the first adaptor is blocked; rephosphorylating the 5' end of the ligated target; and ligating a second adaptor to the 5' end of the dephosphorylated target using a single-stranded ligase in which the 5' end of the second adaptor is dephosphorylated.

[0122] Another example includes partially digesting the nucleic acid with a 5' exonuclease to form a double-stranded nucleic acid with a single-stranded 3' overhang. An adaptor comprising a 3' blocking group can be ligated to the 3' end of the double-stranded nucleic acid with a 3' overhang. The double-stranded nucleic acid with the ligated adaptor with a 3' overhang can be dehybridized to form a single-stranded nucleic acid. An adaptor comprising a non-phosphorylated 5' end can be ligated to the 5' end of the single-stranded nucleic acid.

[0123] Methods for dephosphorylating a nucleic acid, such as the 5' nucleotide of a nucleic acid, include contacting the nucleic acid with a phosphatase. Exemplary phosphatases include calf intestinal phosphatase, shrimp alkaline phosphatase, Antarctic phosphatase, and APEX alkaline phosphatase (Epicentre).

[0124] Methods for ligating nucleic acids include contacting the nucleic acids with a ligase. Exemplary ligases include T4 RNA ligase 1, T4 RNA ligase 2, RtcB ligase, Methanobacterium RNA ligase, and TS2126 RNA ligase (CIRCLIGASE).

[0125] Methods for phosphorylating a nucleic acid, such as the 5' nucleotide of a nucleic acid, include contacting the nucleic acid with a kinase. Exemplary kinases include T4 polynucleotide kinase.

[0126] Embodiments of the systems and methods provided herein include kits that include a translocation reagent and a first probe complementary to a first tag and a second probe complementary to a second tag, where the first and second probes are immobilized on a solid support. In some embodiments, the first and second probes include barcodes. In some embodiments, the first and second probes are poly-T probes. In some embodiments, the solid support is an etched surface, a well, an array, a flow cell device, a microfluidic channel, a bead, a magnetic bead, a column, a droplet, or a microparticle. EXAMPLES

[0127] Example 1 - Simultaneous preparation of DNA and RNA libraries from bulk cells The following example illustrates an embodiment for simultaneously analyzing DNA and RNA in a sample of bulk cells.

[0128] As shown in Figure 6A, cells were obtained, lysed, and cell nuclei were isolated. Total genomic DNA (gDNA) was tagmented using polyA transposon and transposomes. The transposomes enter the nucleus and tagment open chromatin (gDNA not bound to histones).

[0129] After tagmentation, both gDNA and RNA contained 3' polyA tails. Both gDNA and RNA were captured using polyT capture probes that hybridize to the 3' polyA tails of gDNA and RNA. The capture probes contained a first common sequence (CS1) for downstream amplification and molecular indexing of samples, cells, or for demultiplexing of molecules. To convert RNA to DNA, the capture probes were used as primers for cDNA synthesis by reverse transcriptase.

[0130] As shown in Figure 6B, gDNA and generated cDNA were purified from nuclei using column purification (ZYMO). Preparation of accessible chromatin with sequencing (ATAC) libraries was completed with extension / ligation reactions, and preparation of RNA libraries was completed with synthesis of the second strand of cDNA. A second round of tagmentation was used to incorporate a second consensus sequence (CS2) and molecular index. Sample cleanup was performed to remove Tn5, and the final sequencing library was generated by PCR using primers complementary to CS1 and CS2.

[0131] A similar method was used to simultaneously analyze DNA and RNA on beads. As shown in Figures 7A and 7B, the analysis can be performed to improve sample handling and / or to allow for full-length RNA libraries. Cells were obtained, lysed, and nuclei were isolated, as shown in the schematic diagrams in Figures 7A and 7B. gDNA was tagmented with two transposomes containing a polyA transposon and a common sequence (CS2). The transposomes enter the nucleus and tagment open chromatin (gDNA not bound to histones). A capture probe with a polyT tail containing a common sequence (CS1) was hybridized to the polyA tails of both the DNA and RNA libraries. To complete the preparation of the RNA library, the hybridization probe was used to prime cDNA synthesis. A second common sequence (CS2) was added to the RNA library using a template-switching oligonucleotide (TSO), which allows template-switching activity of reverse transcriptase and production of full-length RNA. To improve sample handling, the RNA and DNA libraries were bound to magnetic streptavidin beads using biotinylated capture probes. Washing, buffer exchange, and handling were easily performed for the bead-bound molecules.

[0132] Figure 8 shows the results of ATAC and RNA library preparation. The fragments of the ATAC library have a signature ME sequence, a transposon-specific sequence, boxed in Figure 8. As shown in Figure 9, the ATAC fragments show typical enrichment around promoter regions (Panel A), while the RNA fragments for 3' counting show read accumulation around the ends of genes (Panel B). Tables 1 and 2 summarize the results of ATAC-seq and RNA metrics for simultaneous DNA and RNA analysis. [Table 1] [Table 2] Example 2 – Single cell ATAC-seq

[0133] The following example illustrates an embodiment of performing single-cell ATAC-seq in a compartment.

[0134] Transposition into chromatin was performed as outlined in Figure 5B. After transposition, single cells or single nuclei were partitioned into compartments, in this case droplets. The transposase holds all the individual DNA / library fragments together, thereby allowing all the material from a single cell to be encapsulated within a single droplet. All fragments from cells within a single droplet were indexed by PCR using barcoded primers.

[0135] Mixed human and mouse cells were subjected to the process to ensure that single cells were properly distributed into single droplets. Samples included 500,000 human cells and 500,000 mouse cells. Each assay included 34,000 nuclei, which were pooled to generate one chip of droplet PCR containing approximately 300,000 droplets. The assay included 140,000 beads (11 μL of 3200 beads per channel). Four cycles of droplet PCR were performed, followed by 10 cycles in bulk. An example of the sequencing workflow is outlined in Figure 12, which provides barcoded sequences. As shown in Figure 13, increasing Tn5 transposase was observed to increase yield, sensitivity, and the proportion of transcription start sites (TSSs).

[0136] The barcodes identifying the sequence reads as either from mouse or human were read, and the results showed that the reads aligned to either mouse or human, as outlined in Figure 14, indicating that a single cell was encapsulated within a single droplet, thereby enabling distribution of a single cell and allowing analysis of a single cell. As expected, the output of the ATAC reads was distributed around the transcription start site.

[0137] As used herein, the term "comprising" is synonymous with "including," "containing," or "characterized by" and is inclusive or open-ended and does not exclude additional, unrecited elements or method steps.

[0138] The above description discloses some methods and materials of the present invention. The present invention is susceptible to modifications of the methods and materials, as well as changes in the manufacturing methods and equipment. Such modifications will become apparent to those skilled in the art from consideration of this disclosure or practice of the invention disclosed herein. Accordingly, the present invention is not intended to be limited to the specific embodiments disclosed herein, but is intended to cover all modifications and alternatives falling within the true scope and spirit of the invention.

[0139] All references cited herein, including, but not limited to, published and unpublished applications, patents, and literature references, are incorporated herein by reference in their entirety and made a part of this specification. To the extent that the publications and patents or patent applications incorporated by reference conflict with the disclosure contained herein, the present specification is intended to supersede and / or supersede such conflicting material.

Claims

1. 1. A flow cell apparatus comprising: A poly-T capture probe configured to hybridize to a 3' poly-A tail of an RNA and a 3' poly-A tail tagged to a DNA, and configured to simultaneously capture said DNA and RNA. Equipped with the polyT capture probe comprises a first consensus sequence (CS1); the poly-T capture probe is configured to confine the RNA and the DNA in a single compartment, thereby enabling simultaneous analysis of the RNA and the DNA from a sample; The RNA is converted to cDNA. Flow cell apparatus.

2. The flow cell apparatus of claim 1 , wherein the poly-T capture probe is immobilized on the flow cell apparatus.

3. 2. The flow cell apparatus of claim 1, wherein the CS1 is configured for use in downstream amplification, molecular indexing, or molecular demultiplexing.

4. The flow cell apparatus of claim 1 , wherein the sample is a population of cells, a single cell, a population of cell nuclei, or a single cell nucleus.

5. The flow cell device of claim 1 , wherein the RNA is converted to cDNA by reverse transcriptase.

6. 10. The flow cell device of claim 1, further comprising cDNA and gDNA purified from cell nuclei by column purification.

7. 2. The flow cell apparatus of claim 1, further comprising a second consensus sequence (CS2), A flow cell device, wherein the CS2 is configured to incorporate into the cDNA and the DNA to generate full length RNA and incorporate a molecular index.

8. The flow cell device of claim 7 , wherein the full length RNA is generated using a reverse transcriptase and the template switching activity of a template switching oligonucleotide (TSO).

9. 2. The flow cell apparatus of claim 1, wherein tagmentation comprises differentially tagging the DNA.

10. The flow cell device of claim 1 , wherein tagmentation comprises introducing a transposon-specific sequence.

11. 3. The flow cell device of claim 2, wherein the immobilized poly-T capture probe is immobilized on a substrate, an etched surface, a well, a coated well, a sealed well, an array, a flow cell device, a microfluidic channel, a bead, a magnetic bead, a column, a droplet, or a microparticle.

12. 2. The flow cell apparatus of claim 1, wherein the simultaneous analysis of the RNA and the DNA from a sample comprises DNA analysis, RNA analysis, protein analysis, generation of a nucleic acid library, assay for transposase accessible chromatin using sequencing (ATAC-seq), continuous conserved transpositions (CPT-seq), sequencing by combinatorial indexing of single cells (SCI-seq), single cell genomic amplification, or any combination thereof.

13. 10. The flow cell apparatus of claim 1, wherein the flow cell apparatus is configured to perform tagmentation, nucleic acid amplification, nucleic acid sequencing, or any combination thereof.

14. 2. The flow cell apparatus of claim 1, wherein the simultaneous analysis of the RNA and the DNA from a sample comprises analysis of proteins in a single compartment, the proteins being tagged.

15. The flow cell apparatus of claim 1 , wherein the sample comprises cells, and the cells are fixed with a fixative.

16. The flow cell apparatus of claim 15 , wherein the fixative comprises an alcohol or an aldehyde.

17. 16. The flow cell apparatus of claim 15, wherein the fixative comprises methanol, ethanol or paraformaldehyde.

18. 1. A kit for simultaneously analyzing DNA and RNA in a sample in a single compartment, comprising: A rearrangement reagent; A reverse transcriptase reagent; a poly-T capture probe configured to hybridize to a 3' poly-A tail of the RNA and to a 3' poly-A tail tagged onto the DNA; Including, the polyT capture probe comprises a first consensus sequence (CS1); the polyT capture probe is configured to confine the RNA and the DNA in the single compartment; the reverse transcriptase reagent is configured to convert the RNA to cDNA; kit.

19. 20. The kit of claim 18, wherein the CS1 is configured for use in downstream amplification, molecular indexing, or molecular demultiplexing.

20. 20. The kit of claim 18, further comprising a second consensus sequence (CS2): A kit configured such that the CS2 is incorporated into the cDNA and the DNA to generate full length RNA and incorporate a molecular index.

21. 21. The kit of claim 20, wherein the full length RNA is generated using a reverse transcriptase and the template switching activity of a template switching oligonucleotide (TSO).

22. 20. The kit of claim 18, wherein the translocation reagent is configured to perform tagmentation.

23. 20. The kit of claim 18, wherein tagmentation comprises differentially tagging the DNA.

24. 20. The kit of claim 18, wherein tagmentation comprises introducing a transposon-specific sequence.

25. 20. The kit of claim 18, wherein the simultaneously analyzing comprises DNA analysis, RNA analysis, protein analysis, generation of a nucleic acid library, assay for transposase accessible chromatin using sequencing (ATAC-seq), continuous conserved transposition (CPT-seq), sequencing by combinatorial indexing of single cells (SCI-seq), single cell genomic amplification, or any combination thereof.

26. 20. The kit of claim 18, wherein simultaneously analyzing comprises analyzing proteins in a single compartment, the proteins being tagged.

Images