Pharmaceutical composition comprising il-12 and agent for blockade of t-cell inhibitory molecules for tumour therapy

Abstract

To provide a pharmaceutical composition for treatment of malignant neoplastic disease.SOLUTION: A pharmaceutical composition comprises an IL-12 polypeptide having a biological activity of IL-12 or a nucleic acid expression vector comprising a sequence encoding such an IL-12 polypeptide, and a non-agonist CTLA-4 ligand or non-agonist PD-1 ligand, particularly an anti-CTLA-4 or anti-PD-1 immunoglobulin G.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to compositions and methods for treating cancer, particularly the immunotherapy of malignant neoplastic diseases such as glioma, by administering effective doses of a polypeptide having the biological activity of IL-12 and a non-agonistic ligand of a T cell downregulator, particularly a non-agonistic ligand for CTLA-4 and / or Programmed 1 (PD-1). [Background technology]

[0002] Glioblastoma multiforme (GBM) is the most aggressive astrocytic tumor. It exhibits an infiltrative and destructive growth pattern and is the most common and most aggressive malignant primary brain tumor in humans, accounting for 20% of all intracranial tumors. In most European countries and North America, the incidence of GBM ranges from 3 to 3.5 new cases per 100,000 per year. The clinical history of the disease is usually short (less than 3 months in more than 50% of cases), and patients diagnosed with GBM have a median survival of 14 to 18 months, despite invasive surgery, radiation therapy, and chemotherapy. The resistance of gliomas to conventional treatment regimens represents one of the greatest challenges in modern neuro-oncology.

[0003] Interleukin (IL)-12 is the prototype of a group of heterodimeric cytokines with primarily inflammatory properties. IL-12 polarizes naive helper T cells to adopt a TH1 phenotype and stimulates cytotoxic T cells and NK cells. IL-12 binds to the IL-12 receptor (IL-12R), a heterodimeric receptor formed by IL-12R-β1 and IL-12R-β2. This receptor complex is expressed primarily by T cells, although other lymphocyte subpopulations have also been shown to be responsive to IL-12.

[0004] Therapeutic applications of IL-12 in various tumor entities have been suggested. However, systemic administration at effective doses caused significant adverse events, including death, and clinical trials in cancer patients had to be halted. Recent studies have focused primarily on the different routes of administration of IL-12, but the exact mechanism by which IL-12 exerts its tumor-suppressing properties remains an open question.

[0005] Both CTLA-4 and PD-1 are members of the extended CD28 / CTLA-4 family of T cell regulators. PD-1 is expressed on the surface of activated T cells, B cells, and macrophages. PD-1 (CD279; Uniprot Q15116) has two ligands, PD-L1 (B7-H1, CD274) and PD-L2 (B7-DC, CD273), which are members of the B7 family.

[0006] CTLA-4 (Uniprot ID No P16410) is expressed on the surface of T helper cells and transmits inhibitory signals to T lymphocytes. CTLA-4 and CD28 bind to CD80 (B7-1) and CD86 (B7-2) on antigen-presenting cells. CTLA-4 transmits inhibitory signals to T cells, whereas CD28 transmits stimulatory signals. Systemic anti-CTLA-4 treatment has been approved for clinical use and shows clinical benefit. This treatment has also been tested against various other solid cancers (Non-Patent Document 1; Non-Patent Document 2). A commercially available antibody against CTLA-4 is available under the generic name ipilimumab (sold as Yervoy).

[0007] Various anti-PD-L1 antibodies (e.g., MDX-1105 / BMS-936559) and anti-PD-1 antibodies are currently in clinical trials (e.g., MDX-1106 / BMS-936558 / ONO-4538 or MK-3475 / SCH900475 or AMP-224).

[0008] The glycoprotein immunoglobulin G (IgG) is the major effector molecule of the humoral immune response in humans. There are four different subgroups of human IgG, called IgG1, IgG2, IgG3 and IgG4. These four subclasses show over 95% homology in the amino acid sequence of the heavy chain constant domain but differ with respect to the structure and flexibility of the hinge region, in particular the number of intra-heavy chain disulfide bonds in this domain. These structural differences between the IgG subclasses are also reflected in their susceptibility to proteolytic enzymes such as papain, plasmin, trypsin and pepsin.

[0009] There is only one known isoform of human IgG4. In contrast to human IgG1, IgG2, and IgG3, human IgG4 does not activate complement. Furthermore, IgG4 is less sensitive to proteolytic enzymes than IgG2 and IgG3. [Prior art documents] [Non-patent literature]

[0010] [Non-Patent Document 1] Hodi et al., N Engl J Med 363, 711-723 (2010) [Non-Patent Document 2] Graziani et al., Pharmacol Res (2012) Jan;65(1):9-22 Summary of the Invention [Problem to be solved by the invention]

[0011] The problem underlying the present invention is the provision of improved means and methods for the treatment of solid tumors, in particular gliomas. [Means for solving the problem]

[0012] During studies focusing on the clinical therapeutic potential of IL-12 in advanced stage GBM in relevant rodent models, it was surprisingly found that the combination of IL-12 and blockade of co-inhibitory signals with anti-CTLA-4 antibodies resulted in near-complete tumor eradication and cure, even in advanced disease stages.Similarly, the combination of IL-12 and blockade of co-inhibitory signals with anti-PD-1 antibodies resulted in tumor regression.

[0013] According to a first aspect of the present invention there is provided a pharmaceutical composition for use in the therapy of solid tumours, particularly brain tumours, in particular gliomas, said pharmaceutical composition comprising: an IL-12 polypeptide; a T cell inhibitory blocker selected from a non-agonist CTLA-4 ligand and a non-agonist PD-1 or PD-L1 or PD-L2 ligand; Includes.

[0014] In the context of the present invention, an IL-12 polypeptide is a polypeptide having an amino acid sequence that includes the sequence of p35 (Uniprot ID 29459, SEQ ID NO: 05) or a functional homologue thereof and that includes the sequence of p40 (Uniprot ID 29460, SEQ ID NO: 06) or a functional homologue thereof. In one embodiment, an IL-12 polypeptide has an amino acid sequence that includes both the p35 and p40 sequences or homologs thereof as part of the same contiguous amino acid stretch. In another embodiment, an IL-12 polypeptide includes two different amino acid stretches, one including the p35 sequence and the other including the p40 sequence. The term "IL-12 polypeptide" does not exclude the presence of non-IL-12 sequences, such as immunoglobulin sequences and fragments thereof, fused to the IL-12 sequences described herein.

[0015] The IL-12 polypeptide has a biological activity of IL-12. In the context of the present invention, the biological activity of IL-12 is the stimulation of NK cells or T cells by said IL-12 polypeptide, most notably the stimulation of T effector cells acting via perforin.

[0016] In one embodiment of the pharmaceutical composition, the IL-12 polypeptide comprises a polypeptide sequence that is at least 95%, 96%, 97%, 98% or 99% identical to the sequence of human p35 (SEQ ID NO:05) and a polypeptide sequence that is at least 95%, 96%, 97%, 98% or 99% identical to the sequence of human p40 (SEQ ID NO:06).

[0017] In the context of the present invention, identity is a single quantitative parameter that describes the result of a position-by-position sequence comparison. Methods for sequence comparison are known in the art, the publicly available BLAST algorithm is an example.

[0018] In one embodiment, the IL-12 polypeptide is recombinant human IL-12. In one embodiment, the IL-12 polypeptide is synthetic human IL-12. In one embodiment, the IL-12 polypeptide is a fusion peptide comprising a crystallizable fragment of human immunoglobulin (Fc region). According to one embodiment, the IL-12 polypeptide comprises a crystallizable fragment of human immunoglobulin G. In the context of the present invention, crystallizable fragment refers to the second and third constant domains of an IgG molecule. The crystallizable fragment region (Fc region) is the tail region of an immunoglobulin antibody that interacts with cell surface receptors (Fc receptors) and proteins of the complement system. In an IgG antibody isotype, the Fc region is composed of two identical protein fragments derived from the second and third constant domains of the two heavy chains of the antibody.

[0019] According to one embodiment, the IL-12 polypeptide comprises a crystallizable fragment of human immunoglobulin G4. According to one embodiment, the IL-12 polypeptide has or comprises the sequence of SEQ ID NO: 01. According to another embodiment, the IL-12 polypeptide comprises a sequence that is at least 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID NO: 01.

[0020] Embodiments in which the IL-12 polypeptide chains are fused to an immunoglobulin Fc fragment exhibit different pharmacokinetic behavior than recombinant cytokines, which may confer advantages for some applications.

[0021] In one embodiment, the IL-12 polypeptide component of the pharmaceutical composition is provided in a dosage form for local (intratumoral) administration or delivery, which may be a sustained release or depot form in which the IL-12 polypeptide is released over a period of hours to weeks. In one embodiment, the IL-12 polypeptide component of the pharmaceutical composition is administered by convection enhanced delivery (CED) or a variation thereof, such as a device as set forth in US2011137289(A1), which is incorporated herein by reference.

[0022] In one embodiment, the IL-12 polypeptide is administered systemically in conjunction with systemic CTLA-4 / PD-1 / PD-L1 / PD-L2 blockade. Heterodimeric recombinant IL-12 (Peprotech) administered systemically in conjunction with systemic CTLA-4 blockade (ip) achieved a significant improvement in survival compared to each agent administered alone (see FIG. 11).

[0023] In the context of the present invention, a non-agonist CTLA-4 ligand is a molecule that selectively binds to CTLA-4 under conditions prevalent in peripheral blood without inducing the biological effects of CTLA-4 interaction with any of the physiological ligands of CTLA-4, in particular CD80 and / or CD86.

[0024] In the context of the present invention, a non-agonist PD-1 ligand is a molecule that selectively binds to PD-1 under conditions prevalent in peripheral blood without inducing the biological effects of PD-1's interaction with any of its physiological ligands, in particular PD-L1 or PD-L2. Non-agonist PD-L1 (PD-L2) ligands are molecules that selectively bind to PD-L1 (or PD-L2) under conditions prevalent in peripheral blood, without inducing the biological effects of PD-L1 (PD-L2) interaction with any of its physiological ligands, particularly PD-1.

[0025] In some embodiments, the non-agonist CTLA-4 ligand is a polypeptide that binds to CTLA-4. In some embodiments, the non-agonist PD-1 ligand is a polypeptide that binds to PD-1.

[0026] A non-agonistic CTLA-4 ligand in the sense of the present invention is at least 10 -7 M, 10 -8 M or 10 -9 A nonagonist PD-1 ligand or a nonagonist PD-L1 (PD-L2) ligand in the sense of the present invention is a molecule capable of binding to CTLA-4 with a dissociation constant of at least 10 M and inhibiting the biological activity of its respective target. -7 M, 10 -8 M or 10 -9 It refers to a molecule that can bind to PD-1 (PD-L1, PD-L2) with a dissociation constant of M and inhibit the biological activity of its respective target.

[0027] A non-agonist polypeptide ligand can be an antibody, antibody fragment, antibody-like molecule, or oligopeptide, any of which inhibits CTLA-4, PD-1, or PD-L1 (PD-L2), respectively, by binding to them.

[0028] An antibody fragment can be the Fab or Fv domain of an antibody, or a single-chain antibody fragment, which is a fusion protein consisting of the variable regions of the light and heavy chains of an antibody linked by a peptide linker. The inhibitor may also be a single domain antibody consisting of isolated variable domains from a heavy or light chain. Furthermore, the antibody may also be a heavy chain antibody consisting of only a heavy chain, such as those found in camelids. The antibody-like molecule may also be a repeat protein, such as an engineered ankyrin repeat protein (Molecular Partners, Zurich).

[0029] The oligopeptides according to the above aspects of the invention may be peptides derived from the recognition sites of the physiological ligands of CTLA-4, PD-1 or PD-L1 or PD-L2, such oligopeptide ligands competing with the physiological ligands for binding to CTLA-4, PD-1 or PD-L1 or PD-L2, respectively.

[0030] In particular, a non-agonistic CTLA-4 ligand, or a non-agonistic PD-1 ligand, or a non-agonistic PD-L1 ligand, or a non-agonistic PD-L2 ligand, upon binding to CTLA-4, PD-1, PD-L1, or PD-L2, respectively, on the surface of a T cell, does not result in attenuation of T cell activity. In certain embodiments, the term "non-agonist CTLA-4 ligand" or "non-agonist PD-1 ligand" encompasses both antagonists of CTLA-4 or PD-1 and ligands that are neutral with respect to CTLA-4 or PD-1 signaling. In some embodiments, a non-agonistic CTLA-4 ligand used in the present invention, when bound to CTLA-4, is capable of sterically blocking the interaction of CTLA-4 with its binding partners CD80 and / or CD86, and a non-agonistic PD-1 ligand used in the present invention, when bound to PD-1, is capable of sterically blocking the interaction of PD-1 with its binding partners PD-L1 and / or PD-L2.

[0031] In one embodiment, the non-agonist CTLA-4 ligand is a gamma immunoglobulin that binds to CTLA-4 without eliciting the physiological response of the interaction of CTLA-4 with its binding partners CD80 and / or CD86.

[0032] In some embodiments, the non-agonist PD-1 ligand is a gamma immunoglobulin that binds to PD-1 without eliciting the physiological response of the interaction of PD-1 with its binding partners PD-L1 and / or PD-L2.

[0033] In some embodiments, the non-agonist PD-L1 (PD-L2) ligand is a gamma immunoglobulin that binds to PD-L1 (PD-L2) without eliciting the physiological response of the interaction of PD-1 with its binding partners PD-L1 and / or PD-L2.

[0034] Non-limiting examples of CTLA-4 ligands include the clinically approved antibodies tremelimumab (CAS 745013-59-6) and ipilimumab (CAS No. 477202-00-9; Yervoy).

[0035] Non-limiting examples of PD-1 / PD-L1 or PD-L2 ligands include antibodies MDX-1105 / BMS-936559, MDX-1106 / BMS-936558 / ONO-4538, MK-3475 / SCH900475, or AMP-224, currently in clinical development.

[0036] As used herein, the term "gamma immunoglobulin" is intended to encompass both intact immunoglobulin molecules and functional fragments thereof, the function of which is to bind to CTLA-4, PD-1 or PD-L1 (PD-L2) as expanded above.

[0037] In one embodiment, the combination therapy comprises two different dosage forms, the IL-12 polypeptide is provided in a dosage form for intratumoral or local delivery in the vicinity of the tumor, and the nonagonist CTLA-4 ligand or nonagonist PD-1 ligand is provided in a dosage form for systemic delivery, in particular by intravenous injection. However, the nonagonist CTLA-4 ligand or nonagonist PD-1 ligand may be applied locally, as well as the IL-12 polypeptide. According to another embodiment, the IL-12 polypeptide is applied directly to the tumor-draining lymph nodes.

[0038] According to another embodiment, the combination therapy comprises a single dosage form, whereby said IL-12 polypeptide is provided for intracranial delivery, for example by injection.

[0039] According to another aspect of the present invention, a pharmaceutical composition is provided as indicated above for use in the therapy of malignant neoplastic disease, in particular solid cancer lesions. In one embodiment, said malignant neoplastic disease is glioma. In one embodiment, said malignant neoplastic disease is secondary brain tumor (brain metastasis of a neoplastic lesion originating outside the brain). In one embodiment, the disease is glioblastoma multiforme. In one embodiment, the malignant neoplastic disease is meningioma. In one embodiment, the malignant neoplastic disease is melanoma. In one embodiment, the malignant neoplastic disease is pancreatic cancer. In one embodiment, the malignant neoplastic disease is lung cancer. In one embodiment, the malignant neoplastic disease is prostate cancer. In one embodiment, the malignant neoplastic disease is bladder cancer.

[0040] Cancerous lesions have a tendency to spread to adjacent tissues as well as to different parts of the body, depending on their origin. 20-40% of all cancers cause brain metastases, with lung, breast and skin cancers (melanoma) being the most common sources of brain metastases (Sofietti et al., J Neurol 249, 1357-1369 (2002)). Similar to primary malignant brain tumors, brain metastases have a poor prognosis even with treatment and are rapidly fatal. T cells are a key effector cell population for IL-12-mediated tumor elimination in the brain. Combination treatment of IL-12 with anti-CTLA-4, anti-PD-1, anti-PD-L1 or anti-PD-L2 specifically targets T cells, activating and repolarizing them. Patients with secondary brain tumors also benefit from this combination treatment, as brain metastases grow in the same immune compartment as primary brain tumors.

[0041] In one embodiment, the pharmaceutical composition comprises an IL-12 polypeptide having the biological activity of IL-12 provided as a fusion protein comprising the amino acid sequence of human p40, the amino acid sequence of human p35 and a crystallizable fragment of human IgG4, said IL-12 polypeptide formulated in a dosage form for intratumoral delivery. According to this embodiment, the pharmaceutical composition further comprises immunoglobulin G directed against CTLA-4 or PD-1 as a non-agonist CTLA-4 ligand and / or a non-agonist PD-1 ligand, formulated in a dosage form for systemic delivery. According to this embodiment, the pharmaceutical composition is provided for the treatment of malignant neoplastic diseases, in particular glioma, glioblastoma multiforme, meningioma, melanoma, pancreatic cancer, lung cancer, prostate cancer or bladder cancer.

[0042] According to yet another aspect of the invention, an IL-12 polypeptide having the biological activity of IL-12 and a nonagonistic CTLA-4 ligand and / or a nonagonistic PD-1 ligand are used in the manufacture of a pharmaceutical composition for use in the therapy of malignant neoplastic diseases, in particular gliomas, and other solid tissue tumors, such as glioblastoma multiforme, meningiomas, melanomas, pancreatic cancer, lung cancer, prostate cancer or bladder cancer.

[0043] According to yet another aspect of the present invention, there is provided a method for treating a patient suffering from a malignant neoplastic disease, in particular glioma, and other solid tissue tumors, comprising administering to said patient an IL-12 polypeptide having the biological activity of IL-12 and a nonagonistic CTLA-4 ligand and / or a nonagonistic PD-1 ligand.

[0044] According to another aspect of the invention, the combination therapy comprises an IL-12 nucleic acid expression vector encoding an IL-12 polypeptide having an IL-12 biological activity, Nonagonist CTLA-4 ligands and Non-agonist PD-1 or PD-L1 or PD-L2 ligands and a T cell inhibitory blocker selected from:

[0045] The CTLA-4 ligand and the non-agonist PD-1 ligand are embodied by polypeptides, in particular antibodies, as indicated above. A non-limiting example of an encoded IL-12 polypeptide is a fusion of an immunoglobulin G fragment with the IL-12 constituent polypeptide chain, human IL-12 or a functional equivalent thereof. One non-limiting example is a fusion construct having the constituent polypeptides of IL-12 linked by a short amino acid sequence as shown in FIG. 1, the amino acid sequence of which is shown as SEQ ID NO:01 and the encoding nucleic acid sequence of which is shown as SEQ ID NO:07.

[0046] According to yet another aspect of the present invention, a. a polypeptide sequence that is at least 95% identical to the sequence of human p35 (SEQ ID NO:05), and b. a polypeptide sequence that is at least 95% identical to the sequence of human p40 (SEQ ID NO:06), and C human immunoglobulin G subgroup 4 crystallizable fragment A polypeptide peptide is provided comprising:

[0047] In some embodiments, the polypeptide comprises or consists essentially of a sequence that is at least 95%, 96%, 97%, 98%, 99% identical to, or is, SEQ ID NO:01.

[0048] The advantage of using fusion proteins of cytokines and crystallizable fragments of immunoglobulins rather than recombinant cytokines is improved pharmacokinetics (Belladonna et al., J Immunol 168, 5448-5454 (2002); Schmidt, Curr Opin Drug Discov Devel / 12, 284-295 (2009); Eisenring et al., Nat Immunol 11, 1030-1038 (2010)).

[0049] The IL-12 nucleic acid expression vector according to this aspect of the invention can be, by way of non-limiting example, a "naked" DNA expression plasmid that includes a nucleic acid sequence encoding an IL-12 polypeptide under the control of a promoter sequence operable in human tumor cells, for delivery to tumors, e.g., by intracranial injection. The IL-12 nucleic acid expression vector can also be a viral vector, e.g., an adeno-associated virus, an adenovirus, a lentivirus, or a herpes virus.

[0050] Such an IL-12 nucleic acid expression vector may be provided in a dosage form for intratumoral delivery in combination with a protein nonagonist CTLA-4 ligand and / or a nonagonist PD-1 ligand as set forth above.Similarly, the scope of the present invention also encompasses the use of such an IL-12 nucleic acid expression vector in combination with a nonagonist CTLA-4 ligand and / or a nonagonist PD-1 ligand in a method for the manufacture of a pharmaceutical composition for use in the therapy of malignant neoplastic diseases, in particular glioma, glioblastoma multiforme, meningioma, melanoma, pancreatic cancer, lung cancer, prostate cancer or bladder cancer. Similarly, a method is provided for treating a patient suffering from a malignant neoplastic disease, in particular a glioma, or other solid tissue tumor, comprising administering to said patient an IL-12 nucleic acid expression vector having IL-12 biological activity and a non-agonistic CTLA-4 ligand and / or a non-agonistic PD-1 ligand. [Brief description of the drawings]

[0051] [Figure 1a] The structure and sequence of the fusion protein shown in SEQ ID NO: 01 are shown. The subunits p40 and p35 of IL-12 are shown as rectangles. These subunits are linked by a linker (G4S)3. The last six amino acids of subunits CH2, CH3 and CH1 of the crystallizable fragment of immunoglobulin are shown as oblongs. [Figure 1b] The fusion protein shown in sequence number 01 is shown, the left image shows an immunoblot using reducing conditions visualized with HRP-conjugated polyclonal anti-human Fc antibody, and the right image shows silver staining of the fusion protein under non-reducing conditions (DTT-) and reducing conditions (DTT+). [Figure 1c] Figure 1 shows IFN-γ production in human peripheral blood mononuclear cells (PBMCs) as assessed by enzyme-linked immunosorbent assay (ELISA). Cells were stimulated with either commercially available heterodimeric recombinant human IL-12 (rhIL-12) or purified fusion protein shown in SEQ ID NO: 01 (hIL-12Fc) in the presence of an antibody against CD3 (polyclonal T cell stimulation). Unstimulated: no IL-12 or anti-CD3 stimulation (baseline control). Experiments were performed in triplicate and error bars represent representative sem data of three independent experiments. [Diagram 2] Immunohistochemistry of formalin-fixed tumor sections from syngeneic C57 / Bl6 mice 5 weeks after stimulation with 2x104 Gl261 IL-12Fc or Gl261 Fc cells was performed with antibodies against F4 / 80 and counterstained with hematoxylin (representative example, n=6 mice per group). Scale bar indicates 2 mm, arrow indicates residual Gl261 IL-12Fc (SEQ ID NO: 02) tumor. [Diagram 3]Non-invasive bioluminescence imaging (BLI) of mouse gliomas in syngeneic C57 / Bl6 mice (n=5-6 mice per group) after implantation of 2x104 Gl261 cells constitutively expressing photinus pyralis luciferase and releasing a fusion protein of IL-12 and a crystallizable fragment of mouse immunoglobulin G3 (Gl261 IL-12FC (SEQ ID NO: 02)) or Fc alone (Gl261 Fc) as a control. Top panel: Quantification of tumor growth correlated with photon flux (p / s) within the region of interest (ROI) versus days after injection of modified glioma cells. Bottom panel: Kaplan-Meier survival analysis. Data are representative of two independent experiments. [Figure 4] Non-invasive bioluminescence imaging (BLI) of mouse gliomas in WT animals and various mouse mutants (n=5-7 mice per group) after implantation of 2x104 Gl261 cells that constitutively express firefly luciferase and release a fusion protein of IL-12 and a crystallizable fragment of mouse immunoglobulin G3 (Gl261 IL-12Fc (SEQ ID NO: 02)). Top panel: Quantification of tumor growth by the BLI method versus days after injection of the modified glioma cells. Bottom panel: Kaplan-Meier survival analysis. A) Gl261 IL-12Fc was implanted into mice lacking T and B cells (Rag1- / -) or NK cells (Il-15ra- / -) or both T, B, NK and lymphoid tissue inducer-like cells (Rag2- / - Il2rg- / -). B) Gl261 IL-12Fc was transferred into MHCII-deficient (Ia(b)- / -) and MHCCI-deficient (β2m- / -) mice lacking CD4+ or CD8+ T cells, respectively (n = 5–8 mice / group). Data are representative of two independent experiments. [Diagram 5]Figure 1 shows T cell memory formation in surviving wt animals previously stimulated with 2x104 Gl261 IL-12Fc (SEQ ID NO: 02) cells. Examples of bioluminescence emanating from the brains of surviving wt animals restimulated with Gl261 Fc cells compared to naive wt animals are shown (top panel, showing 1, 7 and 21 days after restimulation). Additionally, the bioluminescence of these tumors is shown in photons / second (p / s) within a region of interest (ROI) versus days after injection of modified glioma cells (bottom panel). Rapid clearance of control tumors in surviving wt animals was observed. Luminescence measured on day 1 suggested identical inoculum doses between these two groups, but only naive mice showed measurable signal from day 7 onwards, suggesting rapid and effective erasure of anti-glioma memory responses independent of the ectopically expressed proinflammatory cytokine (i.e., IL-12Fc (SEQ ID NO: 02)) in this case (n=4-6 mice / group). Data are representative of two independent experiments. [Figure 6] Non-invasive bioluminescence imaging (BLI) of mouse gliomas in different mouse mutants (n=4-8 mice per group) after implantation of 2x104 Gl261 Fc cells constitutively expressing Northern Firefly luciferase and releasing a fusion protein of IL-12 and a crystallizable fragment of mouse immunoglobulin G3 (Gl261 IL-12Fc (SEQ ID NO: 02)). A) wt (open circles) and IFNγ- / - (closed circles) animals. B) wt (open circles) and perforin- / - (closed circles) animals. Quantification of tumor growth correlated with photon flux (p / s) within a region of interest (ROI) versus days after injection of modified glioma cells (upper panel). Lower panel: Kaplan-Meier survival analysis. Data are representative of two independent experiments. [Figure 7]Tumor growth in wt mice inoculated with 2x104 Gl261 Fc cells. Treatment began on day 21 (arrows). Glioma-bearing animals were implanted with osmotic minipumps delivering IL-12Fc (SEQ ID NO: 02) (or PBS) to the tumor. Starting on day 22, animals received ip injections of αCTLA-4 blocking antibody or PBS followed by injections as indicated in the figure. Top graph: Quantification of ROI photon flux in tumor-bearing wt animals receiving the indicated treatments. Bottom graph: Kaplan-Meier survival analysis of the above animals; PBS / PBS vs. IL-12Fc / αCTLA-4 p=0.0045, PBS / PBS vs. IL-12Fc / PBS p=0.3435, PBS / αCTLA4 vs. IL-12Fc / αCTLA-4 p=0.0101; log-rank (Mantel-Cox) test. Data are representative of three independent experiments with 2-5 individuals per group. [Figure 8] Immunohistochemistry of tumor sections obtained from syngeneic C57 / B16 mice after stimulation with Gl261 Fc cells on day 21 and after local administration of IL-12Fc (SEQ ID NO: 02) in combination with systemic CTLA-4 blockade as described in Example 5. The sections were stained with hematoxylin and eosin. Scale bar indicates 2 mm. [Figure 9] Tumor growth in wt mice inoculated with 2x104 Gl261 Fc cells. Treatment began on day 21 (arrow). Glioma-bearing animals were implanted with osmotic minipumps delivering IL-12Fc (SEQ ID NO: 02) to the tumor. Starting on day 22, animals received ip injections of αPD-1 blocking antibody or isotype control antibody followed by injections as indicated in the figure. Top graph: Quantification of ROI photon flux in tumor-bearing wt animals receiving the indicated treatments. Bottom graph: Kaplan-Meier survival analysis of the above animals; PBS / isotype vs. IL-12Fc / αPD-1 p=0.0064, log-rank (Mantel-Cox) test. Data are representative of one experiment with 5-6 individuals per group. [Figure 10]Tumor growth in wt mice inoculated with 50 B16-F10 cells. Treatment began on day 5 (arrows). Glioma-bearing animals were implanted with osmotic minipumps delivering IL-12Fc (SEQ ID NO: 02) to the tumor. Beginning on day 6, animals received ip injections of αCTLA-4 blocking antibody or PBS followed by injections as indicated. Kaplan-Meier survival analysis; PBS / PBS vs. IL-12Fc / αCTLA-4 p=0.0028, log-rank (Mantel-Cox) test. Data are representative of one experiment with 6 animals per group. [Figure 11] The combination of systemic administration of recombinant heterodimeric IL-12 and injection of CTLA4-blocking 2x104 Gl261 Fc cells into the right striatum of wt mice is shown, and tumor growth was followed for 90 days. Systemic treatment: On day 21 (arrows), tumor-bearing animals were first treated with an intraperitoneal (ip) injection of 200 μg αCTLA-4 mouse IgG2b (9D9) (light grey triangles, n=8), 200 ng recombinant heterodimeric IL-12 (rIL-12) (dark grey triangles, n=9) or a combination of both (black triangles, n=9). Control groups received phosphate-buffered saline (PBS) (white triangles, n=7). Treatment continued with 100 μg αCTLA-4 or 100 ng rIL-12 or a combination of both 3 times / week until the end of the experiment. Top graph: Quantification of ROI photon flux in tumor-bearing wt animals receiving the indicated treatments. Bottom graph: Kaplan-Meier survival analysis of the animals above; indicated p-values ​​were calculated using the log-rank (Mantel-Cox) test; data pooled from two independent experiments. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0052] (Example) method animal C57BL / 6 mice were obtained from Janvier; - / - , Ia(b) - / - , Il12rb2 - / - , Rag1 - / - , Rag2 - / - Il2rg - / - , Prf1 - / -and Ifng - / - Mice were obtained from Jackson Laboratories. Il15ra - / - Mice were provided by S. Bulfone-Paus. All animals were maintained in-house under specific pathogen-free conditions with a 12-h light / dark cycle and food and water available ad libitum. All animal experiments were approved by the Swiss Cantonary veterinary office (16 / 2009).

[0053] Mouse tumor cell lines C57 / Bl6 murine glioma (Gl261) cells (kindly provided by A. Fontana, Experimental Immunology, University of Zurich) were transfected with pGl3-ctrl (Promega) and pGK-Puro (kindly provided by T. Buch, Technical University of Munich). Linearized constructs were electroporated at a ratio of 10:1 using an Eppendorf multiporator and selected with 0.8 μg / ml puromycin (Sigma-Aldrich) to generate luciferase-stable Gl261 cells. Single clones were isolated by limiting dilution and passaged in vivo by intracranial tumor inoculation, and tumors were dissociated after 4 weeks and reselected with 0.8 μg / ml puromycin. Cells were then electroporated with pCEP4-mIgG3, pCEP4-mIl-12mIgG3 (SEQ ID NO: 09) and pCEP4-mIl-23mIgG3 (SEQ ID NO: 08) (Eisenring et al, 2010) and subjected to bulk selection with 0.8 μg / ml puromycin and 0.23 mg / ml hygromycin (Sigma-Aldrich). Cytokine production was detected by ELISA (OptEIA Il-12 / 23p40, BD Pharmingen) and rt-PCR (IgG3fw: ACACACAGCCTGGACGC (SEQ ID NO: 03) IgG3rev: CATTTGAACTCCTTGCCCCT (SEQ ID NO: 04)). Gl261 cells and derived cell lines were maintained in Dulbecco's modified Eagle's medium (Gibco, Invitrogen) supplemented with 10% fetal calf serum (FCS) in the presence of the selected antibiotics indicated above at 37°C and 10% CO2. B16-F10 murine melanoma cells were purchased from ATCC.

[0054] Expression and purification of IL-12Fc IL-12Fc (SEQ ID NO:02) was expressed in 293T cells following calcium phosphate mediated transfection with 45 μg vector DNA (pCEP4-mIL-12IgG3, SEQ ID NO:09) / 15 cm tissue culture plate according to standard protocols. Supernatants were harvested 3 and 6 days after transfection, filter sterilized and diluted 1:1 in PBS. Protein was purified on a Protein G column (1 ml, HiTrap, GE Healthcare) eluted with 0.1 M glycine pH 2 using a purification device (AktaPrime) and dialyzed overnight in PBS pH 7.4. The concentration and purity of IL-12Fc (SEQ ID NO: 02) was measured by ELISA (OptEIA Il-12 / 23p40, BD Pharmingen) and SDS-PAGE followed by silver staining and immunoblotting. IL-12Fc was detected with rat anti-mouse IL-12p40 antibody (C17.8, BioExpress) and goat anti-rat HRP-conjugated antibody (Jackson). The same procedure was used for the expression of human IL-12Fc (SEQ ID NO: 01, 07).

[0055] Characterization of human IL-12Fc The concentration and purity of human IL-12Fc (SEQ ID NO: 01) were measured by ELISA (human IL-12(p70), Mabtech, #2455-1H-6) and SDS-PAGE followed by silver staining and immunoblotting. The human IgG4 tag was detected with a HRP-conjugated goat anti-human IgG antibody (#A0170, Sigma). For functional characterization of human IL-12Fc (SEQ ID NO: 01), PBMCs obtained according to the ethical guidelines of the University of Zurich were seeded at 100,000 cells / well in 96-well plates in RPMI medium supplemented with 10% fetal calf serum (FCS) and stimulated with either recombinant human IL-12 (Peprotech) or human IL-12Fc (SEQ ID NO: 01). Both cytokines were normalized to each other according to concentrations derived from human IL-12p70EL ISA (Mabtech, #2455-1H-6). PBMCs were stimulated in the presence of 1 μg / ml mouse IgG2a anti-human CD3 antibody (OKT3, Bio-X-cell). After 2 days of culture at 5% CO2 and 37°C, supernatants were harvested and anti-human IFN-γ ELISA (Mabtech, #3420-1H-6) was performed.

[0056] Orthotopic glioma inoculation Briefly, 6-10 week old mice were anesthetized with 3-5% isoflurane (Minrad) in an induction chamber after i.p. injection of flunixin (Biokema, 5 mg / kg body weight). The head hair was shaved with an electric hair trimmer. After being fixed in a stereotaxic frame (David Kopf Instruments), the scalp of the animals was disinfected with 10% iodine solution and the skin was incised along the midline. Anesthesia on the stereotactic frame was maintained with 3% isoflurane delivered through a nose adaptor (David Kopf Instruments). A blunt-tipped syringe (Hamilton, 75N, 26s / 2" / 2, 5 μl) was then attached to the operating arm of a microinjection pump and placed 1.5 mm lateral and 1 mm anterior to the bregma. The needle was lowered through a manually drilled burr hole to a depth of 4 mm from the dura surface and retracted 1 mm to create a small reservoir. Using a microinjection pump (UMP-3, World Precision Instruments Inc.), 2 × 10 4 Cells were injected in a volume of 2 μl at 1 μl / min. The needle was left in place for 2 min and then retracted at 1 mm / min. The burr hole was closed with bone wax (Aesculap, Braun) and the scalp wound was sealed with tissue glue (Indermil, Henkel).

[0057] In vivo bioluminescence imaging Tumor-bearing mice were carefully weighed, anesthetized with isoflurane (2–3%), and injected with D-luciferin (150 mg / kg body weight, CaliperLifesciences). Animals were transferred to the darkroom of a Xenogen IVIS 100 (CaliperLifesciences) imaging system, and anesthesia was maintained with 2% isoflurane via a nose cone. Ten minutes after injection, luminescence was recorded. Data were then analyzed using Living Image 2.5 software (CaliperLifesciences). A circular region of interest (ROI; 1.46 cm φ) was defined around the animal's head, and the photon flux in this area was read and plotted.

[0058] Treatment of Established Gliomas On day 21 after implantation of glioma cells, tumor-bearing animals were equally distributed into experimental groups based on their ROI photon flux. 5 Animals with less than p / s were considered non-carriers and excluded. 40-48 hours prior to implantation (2 days prior to treatment initiation), osmotic pumps (model 2004, 0.25 μl / h; Alzet) were filled with mouse IL-12Fc (SEQ ID NO: 02, 8.33 ng / μl in PBS) or PBS alone and primed in PBS at 37°C. Immediately prior to surgery, mice received an ip injection of flunixin (Biokema, 5 mg / kg body weight). Mice were anesthetized with 3–5% isoflurane, the scalp was disinfected, and a midline incision was made. The burr hole from the previous glioma injection was located, the bone wax and periosteum were removed, and the pump was placed in a skin pouch formed on the back of the animal. An injection cannula was lowered 3 mm from the burr hole to the estimated center of the tumor. This cannula was connected to the pump (Brain Infusion Kit III 1–3 mm, Alzet) by silicone tubing and held in place with cyanoacrylate glue. The skin was sutured with 4-0 nylon thread. After surgery, mice were treated with 0.1% (v / v) Borgal (Intervet) in drinking water for 3 days. Pumps were removed on day 49. Five doses of anti-mouse-CTLA-4 mouse-IgG2b antibody (clone 9D9, bio-X-cell; Peggs et al.; J Exp Med 206, 1717-1725 (2009)) or an equal volume of PBS were injected ip on days 22 (200 μg), 26 (100 μg), 29 (100 μg), 35 (100 μg) and 42 (100 μg).

[0059] Alternatively, animals received anti-mouse-PD-1 rat IgG2a (clone RMP1-14, bio-X-cell) or rat IgG2a isotype control antibody (clone 2A3, bio-X-cell) for the experiment shown in Figure 9. The dosing schedule and route of application were similar to the experiment shown in Figure 7. For treatment of established B16-F10 derived brain tumors, pumps were implanted 5 days after injection and anti-mouse-CTLA-4 mouse-IgG2b antibody (clone 9D9, bio-X-cell; Peggs et al.; J Exp Med 206, 1717-1725 (2009)) or an equal volume of PBS was injected ip on days 6 (200 μg), 11 (100 μg), 13 (100 μg) and 19 (100 μg).

[0060] Survival analysis of tumor-bearing animals Tumor-bearing animals were monitored by BLI for neurological symptoms and weighed weekly until day 21 after glioma inoculation. 5 Gl261 Fc animals showing ROI photon flux less than p / s were considered non-tumor bearing or slow-growing tumor bearing and were excluded from survival analysis (5-10%). From day 21 onwards, animals were checked daily. Animals showing symptoms as lethargy, severe hunched back and / or weight loss >20% of peak body weight were euthanized. B16-F10 tumor-bearing mice were scored daily starting from day 5 until the end of the experiment following the same scheme.

[0061] histology For histology, animals were euthanized with CO2, perfused transcardially with ice-cold PBS, and decapitated. Whole brains were carefully isolated, fixed in 4% formalin, embedded in paraffin, and 3 μm sections were processed for HE staining and / or immunohistochemistry to detect F4 / 80 (BM8; BMA biomedicals). Primary antibodies were detected with horseradish peroxidase-conjugated secondary antibodies. Staining was visualized with 3,3'-diaminobenzidine (DAB) as HRP substrate. Images were generated using an Olympus BX41 light microscope equipped with an Olympus ColorViewlllu camera and Olympus cell^B image acquisition software. Overall images of whole brain sections were cropped using Adobe Photoshop CS3.

[0062] statistical analysis For statistical analysis of Kaplan-Meier survival curves, the log-rank (Mantel-Cox) test was used to calculate the p-values ​​shown in each figure. A p-value of less than 0.05 was considered statistically significant. Analyses were performed using GraphPad Prism version 5.0a for Mac OSX (GraphPad Software Inc).

[0063] Example 1: Intratumoral expression of IL-12Fc promotes the elimination of experimental gliomas We designed and cloned a fusion protein consisting of the p40 subunit of human IL-12 linked to the p35 subunit via a flexible peptide linker, and then fused this single-chain construct to the constant region of the human IgG4 heavy chain (Figure 1A). We called this human single-chain fusion protein IL-12Fc (SEQ ID NO: 01). We expressed this protein in HEK293 human embryonic kidney cells and detected the dimeric as well as the monomeric form under native conditions. Under reducing conditions, only the monomeric form is detectable (Figure 1B). IL-12Fc (SEQ ID NO: 01) has similar functional properties to the commercially available heterodimeric IL-12 (purchased from Peprotech). To determine whether IL-12Fc (SEQ ID NO: 01) may be suitable to overcome the local immunosuppressive environment induced by gliomas and to clarify the effector mechanisms involved, we expressed the mouse form of this cytokine (Belladonna et al., J Immunol 168, 5448-5454 (2002), IL-12Fc (SEQ ID NO: 02)) in Gl261 mouse glioma cells. To measure intracranial tumor growth noninvasively by bioluminescence imaging (BLI), we first engineered a Gl261 cell line that constitutively expresses firefly luciferase, which we designated Gl261-luc. We then engineered this cell line to constantly release a fusion protein of IL-12 and the crystallizable fragment of mouse immunoglobulin G3 (IL-12Fc; SEQ ID NO: 02, 09) or Fc alone (SEQ ID NO: 08) as a control (designated "Gl261 IL-12Fc" and "Gl261 Fc", respectively). The selected mouse protein sequence of this fusion construct is homologous to the human variant (SEQ ID NO: 01) and consists of the subunits p40 and p35 of IL-12 linked by a linker (G4S)3, and the last six amino acids of subunits CH2, CH3 and CH1 of the crystallizable fragment of IgG3 (wherein CH1 and CH2 are linked by a hinge region). The vectors for the expression of the control fragment and the IL-12 fusion construct are shown in SEQ ID NO: 08 and 09, respectively. The point of using fusion proteins rather than recombinant cytokines was to know whether they would show improved pharmacokinetics. We confirmed the secretion of IL-12Fc (SEQ ID NO: 02) by ELISA for the subunits p40 and p70. We further confirmed the expression of the Fc tail by RT-PCR. When implanted intracranially into the right striatum, luminescence measurements and tumor volumes assessed by stereological methods showed a strong correlation (data not shown).

[0064] We then implanted Gl261 IL-12Fc and Fc into the right striatum of syngeneic C57Bl / 6 mice and followed tumor growth by non-invasive bioluminescence imaging (BLI).After an initial increase in luminescence, all groups showed a decline around day 14 post-injection. Animals bearing Fc-expressing tumors showed a rapid increase in BLI and reached discontinuation criteria quickly, in some cases even before 35 days post-injection. In contrast, BLI measurements in animals injected with IL-12Fc-expressing Gl261 tumors declined to levels near the limit of detection after day 21 (data not shown). Consistent with this finding, we were only able to detect residual tumors in some animals in this group, whereas animals injected with the Fc control showed significant tumor formation when analyzed histologically (Figure 2). When animals engrafted with Gl261 IL-12Fc or Gl261 Fc cells were followed for up to 90 days, we observed that after initial establishment, a high percentage of mice bearing IL-12Fc-secreting tumors cleared the tumor (Figure 3).

[0065] Example 2: T cells are the major effector cell type in IL-12Fc-mediated glioma elimination To confirm that secretion of IL-12Fc by Gl261 IL-12Fc acts on the host rather than on the tumor cells themselves, we confirmed that the increase in Gl261 IL-12Fc and Gl261 Fc was equivalent in mice lacking the receptor for IL-12. IL-12rβ2 - / - The uncontrolled increase of Gl261 IL-12 in animals indicates that IL-12Fc acts specifically on certain cell types in recipient mice (data not shown). T cells and NK cells belong to the most prominent IL-12-responsive leukocytes. To systematically examine the functional relevance of the influx of these cells via IL-12Fc, we stimulated a series of mouse mutants with intracranial Gl261 IL-12Fc. We administered Gl261 IL-12Fc cells to mice lacking T and B cells (Rag1 - / - ) or mice lacking conventional NK cells (Il-15ra - / - ) or mice lacking both T cells, B cells, NK cells, and lymphoid tissue inducer-like cells (Rag2 - / - Il2rg - / - ) (Figure 4A). After the initial induction period, 14 days after injection, all groups showed a strong increase in luminescence until day 28, reflecting strong tumor growth. Between days 28 and 42, most animals died of tumors. - / - Only mice with Rag2 were able to control tumors - / - Il2rg - / - and Rag1 - / - The survival of mice treated with IL-15ra was significantly increased compared to control mice. - / - The ability of mice to eliminate Gl261 IL-12 indicates that NK cells were largely sacrificed.

[0066] Next, we developed MHCII-deficient mice (Ia(b) - / - ) and MHCI-deficient mice (β2m - / - In contrast to wt mice, Ia(b) mice lacked CD4 T cells, and the contribution of CD4 and CD8 T cells was examined. - / - Mice were unable to control Gl261 IL-12Fc tumors and β2m - / - The mice succumbed to gliomas shortly thereafter (Figure 4B). Both mutant groups had shorter survival times than the wild-type group. These data clearly demonstrate that IL-12Fc-mediated tumor elimination depends on the activity of T cells, including helper T cells and CTLs.

[0067] Example 3: Anti-tumor memory responses are independent of ectopically expressed IL-12FC To further characterize T cell-dependent tumor control, we examined surviving wt animals previously stimulated with Gl261 IL-12Fc cells for T cell memory formation (Figure 5). These animals were treated as described in Figure 3 / Example 1. In contrast to primary stimulation, we injected Gl261 Fc cells in this case into the contralateral hemisphere of surviving or naive wt animals. We observed rapid elimination of control tumors within a few days: luminescence measured on day 1 suggested identical inoculum doses between the two groups, but only naive mice showed measurable signal from day 7 onwards, suggesting rapid and effective erasure of anti-glioma memory responses, in this case independent of ectopically expressed proinflammatory cytokines.

[0068] Example 4: CTLs are the main effector cells for IL-12Fc-mediated glioma elimination IL-12 is a T H It is well established that IL-12 polarizes naive T cells to adopt a IL-1 phenotype (Trinchieri, Nat Rev Immunol 3, 133-146 (2003)). To further clarify the mechanistic understanding underlying IL-12-induced elimination of experimental gliomas, the inventors investigated the mechanism by which IL-12 polarizes naive T cells to adopt a IL-1 phenotype (Trinchieri, Nat Rev Immunol 3, 133-146 (2003)). H Mice deficient in IFN-γ, a characteristic cytokine of IFN-γ (Ifng - / - ) were stimulated with IL-12Fc-expressing Gl261 cells (FIG. 6A). The animals were treated as described in FIG. 3 / Example 1. Surprisingly, we observed tumor elimination similar to that observed in wt animals, suggesting that this mechanism of elimination is independent of IFN-γ. Conversely, IL-12 also stimulates the cytotoxic activity of CTLs. CD8+ When analyzing the role of perforin, a cytolytic molecule expressed primarily on CTL and Nk cells, we found clear differences in the survival curves (FIG. 6B). Perforin is a CD8 + It is expressed primarily by CTL and NK cells and is expressed by CD4 + It is a cytolytic molecule that is also expressed by T cells. To further explore the mechanism of IL-12Fc-induced glioma elimination, perforin-deficient mice (prf1 - / - ) were stimulated with IL-12Fc-expressing Gl261 cells. - / - In contrast, perforin-deficient animals (prf1 - / - ) failed to control tumors, further supporting the notion that CTLs are the primary effector cells in glioma elimination mediated by IL-12Fc. - / - There was a clear difference in the survival curves of

[0069] Example 5: Combination of local administration of IL-12Fc and systemic CTLA-4 blockade is effective against advanced stage experimental gliomas To further enhance and prolong the activation phenotype of T cells, in the next series of experiments, we blocked the co-inhibitory molecule CTLA-4 with a neutralizing antibody. IL-12 was administered locally to mice bearing advanced stage tumors. Treatment was performed on animals that had been stimulated with Gl261 Fc 21 days earlier and were already showing a strong bioluminescence signal (indicating advanced stage glioma growth). Local treatment: On day 21, glioma-bearing animals were implanted with osmotic minipumps delivering 50 ng IL-12Fc / day (or PBS) to the tumor. Empty pumps were removed from surviving animals 28 days later (49 days after tumor injection). Systemic treatment: On day 22, tumor-bearing animals received 200 μg αCTLA-4 mouse IgG2b (9D9) or PBS ip. Treatment was continued with 100 μg αCTLA-4 on days 26, 29, 35, and 42 (Figure 7). Neither IL-12Fc nor anti-CTLA-4 alone conferred a significant survival benefit. Remarkably, the combination of local IL-12Fc administration directly to the tumor site and systemic CTLA-4 blockade led to complete tumor regression (Figure 8). Ninety days after inoculation, histological evaluation of brain tissue from surviving animals showed no signs of either demyelination or infiltrates. The combination of local IL-12Fc administration and systemic PD-1 blockade also resulted in a significant increase in surviving animals, although the frequency was lower than with systemic CTLA-4 blockade (Figure 9). The above combination therapy (Figure 7) confers a significant survival benefit even in the case of intracranial growth of B16-F10 syngeneic mouse melanoma cells (Figure 10). This is not a complete model of secondary brain tumors, since it skips various stages of metastasis formation. Thus, even in more aggressive cases, the combination treatment extends survival.

[0070] Preventive treatment of tumors in preclinical models may allow the study of immune mechanisms and the interaction between tumor cells and the tumor microenvironment. However, preventive therapy, in other words, has limited clinical relevance for treating cancer patients. Therefore, we decided to choose a very late time point for intervention in an aggressive and aggressive disease model. To closely mimic the clinical situation, we allowed tumors to progress to a size likely to cause significant neurological symptoms in humans, where monotherapy with locally applied (intratumoral) IL-12 had a significant, but minimal, survival benefit. We have previously found a weak synergy when combining systemic IL-12 treatment with systemic CTLA-4 blockade.When local IL-12 injection was combined with systemic CTLA-4 blockade, the antiglioma effect was significant.

Claims

1. a nucleic acid expression vector comprising a sequence encoding an IL-12 polypeptide; a T cell inhibitory blocker selected from a nonagonistic CTLA-4 antibody, a nonagonistic PD-1 antibody, and a nonagonistic PD-L1 antibody; A pharmaceutical composition for use in the therapy of malignant neoplastic diseases comprising the nucleic acid expression vector is provided by administration to a tumor, to the vicinity of a tumor, or to a lymph node associated with a tumor, and the T cell inhibitory blocking agent is provided in a formulation for systemic delivery; Pharmaceutical compositions.

2. The IL-12 polypeptide is a. a polypeptide sequence at least 95% identical to the sequence of human p35 (SEQ ID NO:05); b. a polypeptide sequence that is at least 95% identical to the sequence of human p40 (SEQ ID NO: 06); The pharmaceutical composition of claim 1 , comprising:

3. The pharmaceutical composition according to claim 1 or 2, wherein the nucleic acid expression vector comprising a sequence encoding the IL-12 polypeptide is provided in a dosage form for intratumoral injection.

4. The pharmaceutical composition according to any one of claims 1 to 3, wherein the T-cell inhibitory blocker is provided in a dosage form for intravenous injection.

5. The pharmaceutical composition according to any one of claims 1 to 4, wherein the nucleic acid expression vector is a DNA expression plasmid comprising a nucleic acid sequence encoding an IL-12 polypeptide under the control of a promoter sequence operable in human tumor cells.

6. The pharmaceutical composition according to any one of claims 1 to 5, wherein the nucleic acid expression vector is an adenovirus, an adeno-associated virus, a lentivirus or a herpesvirus.

7. The pharmaceutical composition according to any one of claims 1 to 6, wherein the malignant neoplastic disease is glioma, glioblastoma multiforme, meningioma, secondary brain cancer, brain metastasis, melanoma, pancreatic cancer, lung cancer, prostate cancer or bladder cancer.

8. the non-agonist CTLA-4 antibody is a gamma immunoglobulin that binds CTLA-4; and / or the non-agonist PD-1 or PD-L1 antibody is a gamma immunoglobulin that binds to PD-1 or PD-L1; The pharmaceutical composition according to any one of claims 1 to 7.

9. 9. The pharmaceutical composition according to claim 8, for use in the therapy of the malignant neoplastic disease, wherein the malignant neoplastic disease is meningioma, secondary brain cancer, brain metastasis, pancreatic cancer, lung cancer, prostate cancer or bladder cancer.

10. 1. Use of a nucleic acid expression vector comprising a sequence encoding an IL-12 polypeptide having the biological activity of IL-12 and a T cell inhibitory blocking agent selected from a nonagonist CTLA-4 antibody, a nonagonist PD-1 antibody, and a nonagonist PD-L1 antibody, in the manufacture of a pharmaceutical composition for use in the therapy of a malignant neoplastic disease, wherein the nucleic acid expression vector is provided in a dosage form for administration to a tumor, to the vicinity of a tumor, or to a lymph node associated with a tumor.

11. The use according to claim 10, wherein the malignant neoplastic disease is glioma, glioblastoma multiforme, meningioma, secondary brain cancer, brain metastasis, melanoma, pancreatic cancer, lung cancer, prostate cancer or bladder cancer.

Images