Vascular smooth muscle cell-tropic capsid, adeno-associated virus vector, pharmaceutical composition, therapeutic method, method for transfecting nucleic acid, and method for producing capsid

Abstract

To provide a vascular smooth muscle cell-tropic capsid which has an enhanced rate of infection to a vascular smooth muscle.SOLUTION: The present invention provides a capsid of an adeno-associated virus, the capsid being characterized in that a factor of tropism for vascular smooth muscle cells is added thereto. The factor of tropism is a peptide that is presented on the surface of a virus particle. The peptide includes any one of "RENKLGE", "KDTVPRE", "TETGKTA", "STPAAKE", "RNREPTE", "ARNGTTE", "KDTAERQ", "NRGGNQD", "NRPDTNS", and "TRATSQE" in cases where vascular smooth muscle cells of a mouse (Mus musculus) are to be infected. The peptide includes any one of "NRPETNP", "SHDPSKE", "SEIRRDQ", "NRNKHEE", "RQDNKME", "THPPAPQ", "TRGGGSE", "TEKQTNS", "RVTMGSE", and "ATKNQNE" in cases where vascular smooth muscle cells of human (Homo sapiens) are to be infected.SELECTED DRAWING: Figure 4

Description

[Technical field]

[0001] The present invention relates to a vascular smooth muscle cell-targeting capsid of an adeno-associated virus that targets vascular smooth muscle cells, an adeno-associated virus vector, a pharmaceutical composition, a method of treatment, a method of introducing nucleic acid, and a method of producing the capsid. [Background technology]

[0002] Since its discovery in 1965, adeno-associated virus (hereinafter referred to as "AAV") has been known to exist as a non-pathogenic virus. AAV is a virus that is not capable of replicating on its own, but is able to replicate within host cells by relying on adenoviruses, herpes viruses, etc., and there have been no reports of its pathogenicity in humans. For this reason, in recent years, AAV is expected to be used in gene therapy and regenerative medicine as a safe tool for gene transfer, since it is non-pathogenic. So far, more than 100 types of wild-type AAV have been identified. These AAVs have different amino acid sequences in the envelope protein (hereinafter referred to as "capsid") that constitutes the outermost surface of the AAV. The difference in the amino acid sequence of the capsid is related to the infection specificity of each AAV for organs and cell types (hereinafter referred to as "tropism").

[0003] Patent Document 1 describes an AAV capsid protein that has one or more modifications in its amino acid sequence relative to the parent AAV capsid protein and, when present in an AAV virion, confers increased infectivity of one or more types of muscle cells compared to the infectivity of the muscle cells by AAV virions containing the unmodified parent AAV capsid protein. [Prior art documents] [Patent documents]

[0004] [Patent Document 1] Special Publication No. 2020-537508 Summary of the Invention [Problem to be solved by the invention]

[0005] However, although the AAV using the capsid protein described in Patent Document 1 has increased infectivity in skeletal muscle, its infection rate in vascular smooth muscle is insufficient.

[0006] The present invention has been made in view of the above circumstances, and an object of the present invention is to solve the above-mentioned problems. [Means for solving the problem]

[0007] The vascular smooth muscle cell-tropic capsid of the present invention is an adeno-associated virus capsid, characterized in that a tropism factor for vascular smooth muscle cells is added thereto. The vascular smooth muscle cell-targeting capsid of the present invention is characterized in that the tropism factor is a peptide displayed on the surface of the virus particle. The vascular smooth muscle cell-targeting capsid of the present invention is characterized in that, when the peptide is intended to infect vascular smooth muscle cells of a mouse (Mus musculus), it contains any of the amino acid sequences of "RENKLGE" (sequence number 5), "KDTVPRE" (sequence number 6), "TETGKTA" (sequence number 7), "STPAAKE" (sequence number 8), "RNREPTE" (sequence number 9), "ARNGTTE" (sequence number 10), "KDTAERQ" (sequence number 11), "NRGGNQD" (sequence number 12), "NRPDTNS" (sequence number 13), and "TRATSQE" (sequence number 14). The vascular smooth muscle cell-targeting capsid of the present invention is characterized in that, when the peptide is intended to infect human (Homo sapiens) vascular smooth muscle cells, it contains any of the amino acid sequences of "NRPETNP" (sequence number 15), "SHDPSKE" (sequence number 16), "SEIRRDQ" (sequence number 17), "NRNKHEE" (sequence number 18), "RQDNKME" (sequence number 19), "THPPAPQ" (sequence number 20), "TRGGGSE" (sequence number 21), "TEKQTNS" (sequence number 22), "RVTMGSE" (sequence number 23), and "ATKNQNE" (sequence number 24). The adeno-associated virus vector of the present invention is characterized by comprising the above-mentioned vascular smooth muscle cell-targeting capsid. The pharmaceutical composition of the present invention is characterized by comprising the vascular smooth muscle cell-targeting capsid. The pharmaceutical composition of the present invention is characterized in that it is the vascular smooth muscle cell-targeting capsid that contains a composition for treating a disease. The therapeutic method of the present invention is a method for treating an animal, which is characterized by introducing a therapeutic composition into the vascular smooth muscle cells using the vascular smooth muscle cell-targeting capsid. The nucleic acid transfer method of the present invention is characterized in that a nucleic acid molecule is transferred into the vascular smooth muscle cells using the adeno-associated virus vector. The method for producing a capsid of the present invention is a method for producing an adeno-associated virus capsid, and is characterized by adding a tropism factor for vascular smooth muscle cells. Effect of the Invention

[0008] According to the present invention, by adding a tropism factor to vascular smooth muscle cells, it is possible to provide a vascular smooth muscle cell-targeting capsid that can produce an AAV with a higher infection rate for vascular smooth muscle than conventional AAVs. [Brief description of the drawings]

[0009] [Figure 1] FIG. 1 is a conceptual diagram of a method for producing a vascular smooth muscle-tropic AAV in accordance with an embodiment of the present invention. [Diagram 2] FIG. 1 is a schematic diagram showing the structure of a plasmid other than the AAV capsid in an embodiment of the present invention. [Diagram 3] FIG. 1 is a conceptual diagram showing the structure of an AAV sequence-added capsid plasmid according to an embodiment of the present invention. [Figure 4] 1 shows photographs and a graph illustrating the results of screening mouse aortic smooth muscle cells according to an example of the present invention. [Diagram 5] 1 shows photographs and graphs illustrating the results of screening human cerebral small vessel smooth muscle cells according to an embodiment of the present invention. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0010] <Embodiment Mode> Adeno-associated virus (AAV) vectors enable safe gene transfer over a long period of time. This is due to their non-pathogenicity and low integration into the host genome. In addition, AAV vectors do not grow in the absence of a helper virus, and the number of introduced gene copies per cell gradually decreases in actively dividing cells, which also contributes to safety. In addition, AAV vectors can be stored for a long period of time and are capable of highly efficient gene transfer into both dividing and non-dividing cells. On the other hand, in recent years, the need for gene therapy specific to vascular smooth muscle has increased in a wide range of diseases, including cerebral small vessel disease. However, no AAV with clear tropism to vascular smooth muscle existed. In other words, the efficiency of gene transfer to vascular smooth muscle with conventional AAV vectors was not high. Furthermore, no AAV vector aimed at gene transfer to vascular smooth muscle had been developed.

[0011] For this reason, the present inventors conducted extensive experiments, randomly altered a portion of the amino acid sequence of the capsid protein, which is the surface structure of AAV, and infected cultured vascular smooth muscle cells. The cultured vascular smooth muscle cells were then collected and analyzed to identify the amino acid sequence of AAV with a suitable tropism for gene transfer to vascular smooth muscle. As a result, they succeeded in producing an AAV capsid to which a tropism factor for vascular smooth muscle cells was added. By using this vascular smooth muscle cell-targeting capsid, it became possible to produce an AAV with a clear tropism for vascular smooth muscle, and the present invention was completed.

[0012] More specifically, wild-type AAV is a single-stranded DNA virus with a diameter of 25 nm, which is composed of two genes: Rep, which is a gene mainly involved in replication, and Cap, which mainly codes for the capsid that constitutes the surface. Furthermore, since AAV does not have the ability to replicate autonomously, it is necessary to simultaneously introduce an adenovirus-derived helper gene for proliferation in cultured cells. In this embodiment, seven random amino acids were inserted into the amino acid sequence of the AAV capsid, which was predicted to be located at the outermost layer, to produce an AAV. This AAV was infected into cultured vascular smooth muscle cells, and the AAV genome was collected and amplified by PCR to produce AAV again. This screening cycle was repeated to produce an AAV vector with excellent gene transfer efficiency into vascular smooth muscle. The following provides details of the vascular smooth muscle cell-targeting capsid according to this embodiment, as well as the AAV containing the same, pharmaceutical composition, treatment method, nucleic acid introduction method, and capsid production method.

[0013] [Vascular smooth muscle cell-targeting capsid, capsid production method, AAV vector] The vascular smooth muscle cell-targeted capsid of this embodiment is an AAV capsid, characterized in that a tropism factor for vascular smooth muscle cells is added.

[0014] In this embodiment, vascular smooth muscle cells are the main cells of the smooth muscle that constitutes mature blood vessels. The vascular smooth muscle constituted by these vascular smooth muscle cells regulates the diameter of blood vessels by contracting and relaxing. When smooth muscle contracts, the diameter of blood vessels narrows and blood pressure increases.

[0015] In this embodiment, the tropism factor for vascular smooth muscle cells may be a peptide presented on the surface of a virus particle. More specifically, the peptide serving as the tropism factor for vascular smooth muscle cells may be presented on the surface of the capsid after AAV is assembled. For example, this peptide may be added to a position between the 587th and 588th amino acids of VP1 of wild-type AAV2, which is known to be presented on the surface of the capsid. Furthermore, this peptide does not have to be at this position as long as it is presented on the surface of the capsid. In addition, in order to avoid steric hindrance, this peptide may be added via a sequence such as a linker or spacer. The sequence of this linker or spacer may be, for example, a sequence common to those skilled in the art, such as a GS linker, which is a sequence of "GGGGS" x 3.

[0016] More specifically, in this embodiment, when the target of infection is vascular smooth muscle cells of a mouse (Mus musculus), the peptide may contain, for example, any of the amino acid sequences of "RENKLGE" (SEQ ID NO: 5), "KDTVPRE" (SEQ ID NO: 6), "TETGKTA" (SEQ ID NO: 7), "STPAAKE" (SEQ ID NO: 8), "RNREPTE" (SEQ ID NO: 9), "ARNGTTE" (SEQ ID NO: 10), "KDTAERQ" (SEQ ID NO: 11), "NRGGNQD" (SEQ ID NO: 12), "NRPDTNS" (SEQ ID NO: 13), and "TRATSQE" (SEQ ID NO: 14). Among these, the peptides of SEQ ID NOs: 5 and 6 have particularly high tropism toward vascular smooth muscle cells of a mouse and can be preferably used.

[0017] In addition, in this embodiment, when the peptide is intended to infect human (Homo sapiens) vascular smooth muscle cells, it may contain, for example, any of the amino acid sequences of "NRPETNP" (SEQ ID NO: 15), "SHDPSKE" (SEQ ID NO: 16), "SEIRRDQ" (SEQ ID NO: 17), "NRNKHEE" (SEQ ID NO: 18), "RQDNKME" (SEQ ID NO: 19), "THPPAPQ" (SEQ ID NO: 20), "TRGGGSE" (SEQ ID NO: 21), "TEKQTNS" (SEQ ID NO: 22), "RVTMGSE" (SEQ ID NO: 23), and "ATKNQNE" (SEQ ID NO: 24). Among these, the peptides of SEQ ID NOs: 15 and 16 have particularly high tropism toward human vascular smooth muscle cells and can be preferably used.

[0018] The capsid production method according to this embodiment is a method for producing AAV capsids, and is characterized by the addition of a tropism factor for vascular smooth muscle cells. That is, the vascular smooth muscle cell-targeting capsid according to the present embodiment can be configured to produce one to which a vascular smooth muscle cell-targeting factor, such as the above-mentioned peptide, has been added. For this reason, the sequence of DNA or RNA into which the capsid according to the present embodiment is translated may contain a codon sequence into which the above-mentioned peptide is translated. That is, as the tropism factor according to the present embodiment, the DNA or RNA required for the production of AAV may contain a codon into which the sequence of this peptide is translated. For example, this codon may be optimized to be more easily translated depending on the species of organism, making it easier to produce the AAV shown below.

[0019] The AAV vector according to the present embodiment is characterized by comprising this vascular smooth muscle cell-targeting capsid. That is, the AAV vector according to the present embodiment may be composed of a DNA or RNA sequence for various AAVs such that a vascular smooth muscle cell-targeting capsid is generated during translation and assembled with other AAV components. Here, the AAV vector according to this embodiment may be provided as a single AAV vector containing the DNA or RNA sequence of the capsid to which the above-mentioned peptide has been added, or may be provided separately as an AAV vector in which the capsid is not translated and a vector in which the capsid has been added to which the above-mentioned peptide has been added, as shown in the examples below.

[0020] As the type of AAV used in the AAV vector according to the present embodiment, AAV2 or AAV9 is particularly suitable because it confers vascular smooth muscle targeting. In addition, a combination of multiple AAVs, an artificially produced AAV, other types of AAV, AAV with mutations, etc. can also be used.

[0021] The AAV vector and AAV production method of this embodiment can be carried out using techniques commonly known to those skilled in the art by translating the above-mentioned AAV vector together with a helper gene derived from adenovirus, herpes virus, etc. within a cell to generate AAV virus particles, which can then be purified using various techniques such as ultracentrifugation. The produced AAV can be stored for long periods of time using techniques common to those skilled in the art, such as in a specific preservation solution, or dried, refrigerated, frozen, etc.

[0022] Pharmaceutical Compositions The medical composition (medicine, pharmaceutical composition) according to this embodiment is characterized by comprising the above-mentioned vascular smooth muscle cell-targeting capsid. Specifically, the pharmaceutical composition according to this embodiment is a vascular smooth muscle cell-targeting capsid containing a disease treatment composition, and is characterized in that the therapeutic composition is introduced into vascular smooth muscle cells. That is, the pharmaceutical composition according to this embodiment delivers a substance (therapeutic composition) for treating a vascular disease in which vascular smooth muscle cells are the treatment target, into vascular smooth muscle cells.

[0023] More specifically, the nucleic acid molecule is introduced into vascular smooth muscle cells by an AAV vector equipped with a vascular smooth muscle cell-directed capsid. This nucleic acid molecule can be used as a pharmaceutical agent for gene therapy or the like by functioning in vascular smooth muscle cells through transcription, translation, etc. That is, in this embodiment, the nucleic acid molecule may be a therapeutic composition. This makes it possible to improve the pathological condition by producing therapeutic proteins such as enzymes, structural proteins, functional proteins, metabolites, and other pharmacological substances required for the disease, or by regulating gene expression. In addition, the nucleic acid molecule can be a pharmaceutical agent such as an antisense, siRNA, or ribozyme nucleic acid molecule, in addition to the above-mentioned therapeutic proteins. It is also possible to perform gene therapy via an action on genes or pathways whose expression is to be regulated. In this way, the AAV vector of this embodiment can be used as a tool to treat diseases.

[0024] Furthermore, the pharmaceutical composition of this embodiment may contain a drug, which is a therapeutic composition other than nucleic acid, in the vascular smooth muscle cell-targeting capsid. This drug may be a small molecule drug, an antibody drug, a neurotransmitter, a hormone, other drugs, a health promotion drug, a nutritional supplement, etc. for the following various diseases, disorders, and symptoms (hereinafter simply referred to as "diseases") associated with vascular smooth muscle cells. In other words, the vascular smooth muscle cell-targeting capsid of this embodiment can also be used as a DDS (Drug Delivery System) with vascular smooth muscle cell targeting.

[0025] The target of the medical composition according to this embodiment may be a disease related to vascular smooth muscle cells. More specifically, the medical composition according to this embodiment can be used, for example, for the treatment of cerebral small vessel disease (cerebral SVD).

[0026] The cerebral small vessel disease according to the present embodiment is a broad concept, and is classified into Type 1 to Type 6. Type 1 is lifestyle-related arteriosclerosis, and representative pathologies include fibrinoid necrosis, lipohyaline degeneration, microatheroma, and microaneurysm. Type 2 is cerebral amyloid angiopathy. Type 3 is hereditary cerebral small vessel disease, and includes Fabry disease, CADASIL (Cerebral Autosomal Dominant Arteriopathy with Subcortical Infarct and Leukoencephalopathy), CARASIL (Cerebral Autosomal Recessive Arteriopathy with Subcortical Ischaemic Strokes and Leukoencephalopathy), CARASAL (Cathepsin A Related Arteriopathy with Strokes and Leukoencephalopathy), PADMAL (Pontine Autosomal Dominant Microangiopathy with Leukoencephalopathy), and the like. Type 4 is an immune-mediated small vessel disease, such as Wegener's granulomatosis, Churg-Strauss syndrome, and IgA vasculitis. Type 5 is venous collagenosis. Type 6 also includes post-radiotherapy vasculitis and non-amyloidotic microvascular degeneration. More specifically, the medical composition according to this embodiment can be used in gene therapy for hereditary cerebral small vessel diseases, such as Faby disease and CADASIL, which are caused by congenital abnormalities in a single gene.

[0027] In addition, the medical composition according to this embodiment can also be used to treat diseases other than cerebral small vessel disease that involve pathological conditions related to vascular smooth muscle cells. The treatment of these diseases may involve, for example, removing atherosclerotic plaques of oxidized LDL related to systemic arteriosclerosis by the immune system or the like. Alternatively, when abnormal proteins such as β-amyloid accumulate in vascular smooth muscle cells, the compound can be used in a treatment to remove these proteins. Furthermore, it is also possible to carry out treatments such as increasing vascular plasticity itself or controlling the permeability of the blood-brain barrier.

[0028] The medical composition according to the present invention may also contain any pharma- ceutically acceptable carrier, such as a liposome carrier, colloidal gold particles, polypeptides, lipopolysaccharides, polysaccharides, lipid membranes, and the like.

[0029] Furthermore, the medical composition according to this embodiment may contain, as a pharma- ceutically acceptable carrier, for example, physiological saline, an isotonic solution containing glucose or other auxiliary drugs, for example, D-sorbitol, D-mannose, D-mannitol, sodium chloride, etc. Furthermore, it may be administered together with a suitable solubilizing agent, for example, alcohol, specifically ethanol, polyalcohol, for example, propylene glycol, polyethylene glycol, nonionic surfactant, for example, polysorbate 80(TM), HCO-50, etc. Furthermore, it may further contain a suitable excipient, etc.

[0030] The medical composition according to the present embodiment may also contain a suitable pharma- ceutically acceptable carrier to prepare a pharma- ceutically acceptable carrier. The carrier may contain a biocompatible material such as silicone, collagen, gelatin, etc. The carrier may also be provided as an emulsion. Furthermore, the medical composition according to the present embodiment may contain any one or any combination of pharmaceutical additives such as diluents, flavorings, preservatives, excipients, disintegrants, lubricants, binders, emulsifiers, plasticizers, etc.

[0031] The administration route of the medical composition according to the present embodiment is not particularly limited, and it can be administered parenterally or orally. Parenteral administration can be, for example, intravenous, intraarterial, nasal, subcutaneous, intradermal, intramuscular, or intraperitoneal administration, or direct administration to cerebral blood vessels, etc. The pharmaceutical agent for vascular smooth muscle according to the embodiment of the present invention can be formulated using pharma- ceutically acceptable carriers well known in the art in an administration form suitable for parenteral or oral administration.

[0032] When the medical composition according to this embodiment is used for the above-mentioned treatment, the administration interval and dosage can be appropriately selected and changed depending on various conditions such as the state of the disease and the condition of the subject. The single dose and number of doses of the medical composition according to this embodiment can be appropriately selected and changed depending on the purpose of administration, and further on various conditions such as the age and weight of the patient, the symptoms and severity of the disease, etc. The number and period of administration may be only once, or it may be administered once to several times a day for about several weeks, and the state of the disease may be monitored, and administration may be repeated or repeated depending on the state.

[0033] In addition, the medical composition according to this embodiment can be used in combination with other compositions, etc. The composition of the present invention may be administered simultaneously with the other compositions, or may be administered at intervals, with no particular restriction on the order of administration. In addition, in an embodiment of the present invention, the period during which the disease is improved or alleviated is not particularly limited, but may be temporary improvement or alleviation, or improvement or alleviation for a certain period of time.

[0034] [Treatment and drug discovery methods] The therapeutic method according to this embodiment is a method for treating animals, and is characterized by introducing a medical composition containing the above-mentioned vascular smooth muscle cell-targeting capsid into vascular smooth muscle cells. When gene therapy is performed, the method of nucleic acid introduction according to this embodiment may involve introducing a nucleic acid molecule into vascular smooth muscle cells using an AAV vector containing the above-mentioned vascular smooth muscle cell-targeting capsid. Alternatively, when a drug is contained within the above-mentioned vascular smooth muscle cell-targeting capsid, the drug may be delivered to vascular smooth muscle cells to treat a disease.

[0035] Specifically, the pharmaceutical for vascular smooth muscle according to the embodiment of the present invention can be used for animal therapy, which treats animals. The animals may be, for example, mammals such as mice (Mus musculus), rats, ferrets, hamsters, guinea pigs, rabbits, dogs, cats, sheep, pigs, cows, horses, humans (Homo sapiens), and non-human primates such as monkeys and apes. In addition to mammals, the pharmaceutical may also include fish, birds including poultry, and reptiles.

[0036] That is, the pharmaceutical agent for vascular smooth muscle according to the embodiment of the present invention can be used for treating various animals and promoting the growth of livestock, in addition to treating humans. In addition, in countries, including Japan, where the treatment methods performed by doctors are not industrially applicable, the treatment methods according to this embodiment may exclude treatment on humans.

[0037] In addition, the pharmaceutical for vascular smooth muscle according to the embodiment of the present invention can be used to treat a part of the body of an animal, or an organ or tissue extracted or excreted from an animal. This treatment is in a broad sense, and can also be applied to culture in a bioreactor or a model animal, culture of cultured organs for human transplantation, etc.

[0038] In addition, by introducing a nucleic acid molecule into vascular smooth muscle cells using the AAV vector containing the above-mentioned vascular smooth muscle cell-targeting capsid according to this embodiment, it is possible to treat disease model cells or to prepare disease model cells themselves for use in drug discovery. In this case, it is possible to confirm the effect of a medical composition on a disease model by translating the above-mentioned nucleic acid molecule in the cytoplasm.

[0039] Alternatively, the AAV vector according to the present embodiment can be used to create a disease model animal. In this case, since the AAV gene is difficult to transfer into the nucleus, a reverse transcriptase gene or the like may be included so that it can be incorporated into the nucleus. In this way, the AAV vector of this embodiment can be used for drug discovery in the development of gene therapy for human diseases.

[0040] With the above configuration, the following effects can be obtained. Conventionally, there has been hope for treatment using non-pathogenic AAV vectors. However, as mentioned above, conventional AAVs have not been found to have a high gene transfer efficiency into vascular smooth muscle, and none of them have shown clear vascular smooth muscle tropism. For this reason, there has been a technical need for AAVs aimed at gene transfer into vascular smooth muscle to treat vascular diseases.

[0041] In contrast, the vascular smooth muscle cell-targeting capsid according to the present embodiment has a tropism factor added thereto, making it possible to produce an AAV with a higher infection rate for vascular smooth muscle cells than conventional AAV vectors. In other words, it is possible to provide an AAV vector with superior tropism for gene transfer into vascular smooth muscle cells.

[0042] This enables effective gene transfer into vascular smooth muscle to treat vascular disease. That is, by loading any gene into the AAV vector according to this embodiment and administering it, it is expected that the efficiency of gene transfer into vascular smooth muscle can be improved. In addition, the AAV vector according to this embodiment can be loaded with a substance that serves as a therapeutic agent for a disease and used for the treatment. Therefore, effective gene therapy for vascular disease is expected. In particular, effective treatment can be expected by sufficient gene transfer for gene therapy for hereditary cerebral small vessel disease in which a single gene abnormality is congenitally present, treatment for vascular disease such as cerebral infarction, etc. In addition, AAV vectors are not pathogenic or self-replicating, and therefore, in tissues with poor division capacity such as vascular smooth muscle, long-term expression is expected to result in sustained therapeutic effects.

[0043] The pharmaceutical according to the embodiment of the present invention can be used in combination with other compositions, etc. The composition of the present invention may be administered, sprayed, applied, etc., simultaneously with other compositions. In addition, AAV vectors can be used for non-medicinal purposes. EXAMPLES

[0044] The AAV vector according to the embodiment of the present invention will be described in more detail below based on an experiment as an example, but this example is merely an example and is not intended to be limiting.

[0045] Materials and Methods In this example, wild-type strains AAV2 and AAV9 were used to artificially modify the Cap region, which mainly codes for the capsid, by inserting seven random amino acids between the 587th and 588th amino acids in the sequence of the capsid protein VP1, which is thought to protrude from the surface, and screening was performed using cultured vascular smooth muscle cells.

[0046] Specifically, in this example, the following screening process was repeated multiple times to prepare an adeno-associated virus vector that was conferred tropism to vascular smooth muscle: (1) By using a construct using the sequences of SEQ ID NOs: 1, 2, and 3, a randomized amino acid sequence of seven amino acids was added to a part of the capsid protein, which is the surface structure of the AAV vector. (2) We produced AAVs carrying capsids with randomized amino acid sequences and infected cultured vascular smooth muscle cells. (3) Using the sequences of SEQ ID NOs: 1, 2, and 4, vascular smooth muscle cells infected with the AAV were recovered, and the relationship between the amino acid sequence of the infectious viral capsid and infectivity was analyzed. (4) As a result, we identified an amino acid sequence that is added to the capsid protein of AAV, which has high infectivity (high tropism, excellent gene transfer) for vascular smooth muscle cells, as a tropism factor for vascular smooth muscle cells. Below, we describe the details of the production and screening of this AAV vector.

[0047] (Creation of artificially modified AAV2) According to Figure 2, Assembly-Activating Protein (AAP) encoded by part of Cap is also necessary for AAV particle formation, so for the purpose of expressing AAP, a plasmid (pUC-GW-Amp_Rep2_Cap9Stop_AAP, 6633bp) was prepared by modifying the pUC-GW-Amp vector (manufactured by Azenta Life Sciences) so that there is a mutation that becomes a stop codon only in the capsid protein reading frame of Cap of AAV9 (Genbank AY530579.1) (synthesis requested from GENEWIZ). In other words, this plasmid expresses Rep and AAP but does not express capsid protein, so it is referred to as "non-capsid plasmid" below.

[0048] Next, a template sequence for inserting a seven-amino acid random sequence between the 587th and 588th positions of the AAV2 capsid protein VP1 was prepared (synthesis was requested from Azenta Life Sciences). This template sequence is shown in SEQ ID NO: 1. For the assembly described below, this template sequence was prepared by changing the "CTC" of the restriction enzyme XhoI recognition site to "CTT" from the wild-type sequence in Genbank NC_001401.2, and changing "GTC" to "GTT" to create a new recognition site for the restriction enzyme HpaI.

[0049] Then, for the template sequence, a linear chain into which a random sequence was inserted was amplified by PCR using the Fwd primer "CAGACGCCGCGGCCCTCGAGCA" shown in SEQ ID NO: 2 and the Rev primer "GCCTTGTGTGTTAACATCTGCGGTAGCTGCTTGTCTNNNNNNNNNNNNNNNNNNNNNNNNNGTTGCCTCTCTGGAGGTTGGTAGA" shown in SEQ ID NO: 3. The base "N" in SEQ ID NO: 3 is random (arbitrary) of A, G, C, or T. That is, 21 bases were made to correspond to the translation of a random peptide of 7 codons. PCR was performed using Toyobo Co., Ltd. #KMM-201, KOD One (registered trademark) PCR Master Mix, with 30 cycles of 98°C for 10 seconds, 58°C for 5 seconds, and 68°C for 1 second to obtain a PCR product.

[0050] According to FIG. 3, pAAV-2Cap-acceptor, an AAV2 capsid plasmid into which this PCR product is incorporated, was prepared (synthesis requested from Azenta Life Sciences). This plasmid was linearized by treating with the restriction enzymes XhoI and HpaI. Similarly, the PCR product described above was also linearized by treating with the restriction enzymes XhoI and HpaI. These were recombined with NEBuilder HiFi DNA Assembly Master Mix (registered trademark) (New England Biolabs, #E2621) to make them circular (hereinafter referred to as "sequence-added capsid plasmid").

[0051] Similarly, an AAV9 capsid plasmid, pAAV-9Cap-acceptor, was prepared (synthesis was requested from Azenta Life Sciences), and the PCR product was also recombined into this to produce a sequence-added capsid plasmid.

[0052] Thereafter, in the same manner as in the AAV production method generally used by those skilled in the art, the above-mentioned "non-capsid plasmid", the AAV2 or AAV9 "sequence-added capsid plasmid", and an adenovirus-derived helper plasmid (Agilent Technologies) were transfected into 293 cells (ATGC), and AAV was collected 72 hours later. These produced AAVs are hereinafter referred to as "randomized AAVs".

[0053] (Screening of candidate sequences) The randomized AAVs were administered to culture media overlaying mouse aortic smooth muscle cells (ATCC, #CRL2797) or human brain small vessel smooth muscle cells (Human Brain Vascular Smooth Muscle Cells, ScienceCell Research Laboratories, #1100). Cells infected with AAV express the fluorescent protein mCherry. After 72 hours, mCherry-expressing cells were collected using a cell sorter (BD FACSAria(TM) II cell sorter, Becton Dickinson). DNA from the collected cells was extracted using the DNeasy Blood & Tissue Kit(50) (Qiagen, #69504).

[0054] The extracted DNA was used as a template for PCR amplification using the collection (recovery) Fwd primer "CAGACGCCGCGGCCCTCGAGCA" shown in SEQ ID NO: 2 and the Rev primer "AGAACGCCTTGTGTGTTAACATCTGCG" shown in SEQ ID NO: 4. PCR was performed using Toyobo, #KMM-201, KOD One (registered trademark) PCR Master Mix, with 30 cycles of 98°C for 10 seconds, 58°C for 5 seconds, and 68°C for 1 second. The amplified product was treated with restriction enzymes XhoI and HpaI as in the above example. Then, the pAAV-2Cap-acceptor plasmid in FIG. 3 or the pAAV-9Cap-acceptor plasmid for AAV9 (not shown) was recombined with NEBuilder HiFi DNA Assembly Master Mix (registered trademark) to form a circular plasmid. This circular plasmid has either a sequence added to the capsid plasmid or a randomized sequence.

[0055] This circular plasmid was purified and, together with the non-capsid plasmid and the helper plasmid, was administered again to cultured smooth muscle cells to infect them as described above. After 72 hours, the cells were harvested, and mCherry-expressing cells were harvested as described above. Each of the harvested mCherry-expressing cells was subjected to sequence analysis (outsourced to FASMAC) to confirm the DNA sequence of the peptide site added to the capsid. These infection and recovery cycles, that is, screening, were performed multiple times to examine the distribution of the inserted peptide sequences. Hereafter, the period up to the first recovery with the cell sorter will be referred to as the "first screening," the period up to the second recovery with the cell sorter will be referred to as the "second screening," and subsequent screenings will be referred to as the "third screening," the "fourth screening," and so on.

[0056] 〔result〕 (Results of vascular smooth muscle-targeting AAV experiments) FIG. 4 shows the results of screening in mouse aortic smooth muscle cells. Figure 4(a) is a photograph showing the PCR products observed during the first recovery. The two lanes to the left of the DNA marker lane, underlined and marked with "2", are the positive control for AAV2, and the next lane, underlined and marked with "9", is the positive control for AAV9. This positive control was obtained by PCR of the randomized AAV as produced and examining the expression of the band. The next two lanes from the left show the PCR products for AAV2 and AAV9, respectively, when the mCherry-positive cells from the first screening were collected using a cell sorter. These are underlined and indicated by "2" and "9," respectively. After collection using the cell sorter, a band was observed for AAV2, but no band was observed for AAV9. This suggests that only AAV2 infects mouse aortic smooth muscle cells.

[0057] FIG. 4(b) is a graph showing the proportion of sequences when mouse aortic smooth muscle cells were infected and harvested. In the second screening cycle of infecting and harvesting cultured cells, the proportion of the top two sequences in terms of frequency increased. That is, the proportion (frequency) of cells infected with AAV2 in which these top two peptide sequences were added to the capsid was high among the harvested cells. Specifically, in the screening using mouse vascular smooth muscle cells, the amino acid sequences "RENKLGE" (SEQ ID NO: 5), "KDTVPRE" (SEQ ID NO: 6), "TETGKTA" (SEQ ID NO: 7), "STPAAKE" (SEQ ID NO: 8), "RNREPTE" (SEQ ID NO: 9), "ARNGTTE" (SEQ ID NO: 10), "KDTAERQ" (SEQ ID NO: 11), "NRGGNQD" (SEQ ID NO: 12), "NRPDTNS" (SEQ ID NO: 13), and "TRATSQE" (SEQ ID NO: 14), in order of frequency from the top, were found to be added between the 587th and 588th amino acids of VP1 of wild-type AAV2 during the second screening. Furthermore, as the screening cycle continued, the proportion of the top two sequences in terms of frequency increased further, but the frequencies of the sequences below them sometimes changed.

[0058] FIG. 5 shows the results of screening in human cerebral small vessel smooth muscle cells. Figure 5(a) is a photograph showing the PCR products for AAV2 and AAV9 when the mCherry-positive cells in the first screening were collected by a cell sorter. They are underlined and indicated by "2" and "9", respectively. As with the mouse aortic smooth muscle cells described above, after collection by the cell sorter, a band was observed for AAV2, but no band was observed for AAV9. Therefore, it was thought that only AAV2 infects human cerebral small vessel smooth muscle cells as well.

[0059] FIG. 5(b) is a graph showing the proportion of sequences when human brain small vessel smooth muscle cells were infected and recovered, similar to FIG. 4(b). In this cycle of screening in human brain small vessel smooth muscle cells, the proportion of the top two sequences in terms of frequency was high from the first round. Specifically, in the screening using human vascular smooth muscle cells, the amino acid sequences "NRPETNP" (SEQ ID NO: 15), "SHDPSKE" (SEQ ID NO: 16), "SEIRRDQ" (SEQ ID NO: 17), "NRNKHEE" (SEQ ID NO: 18), "RQDNKME" (SEQ ID NO: 19), "THPPAPQ" (SEQ ID NO: 20), "TRGGGSE" (SEQ ID NO: 21), "TEKQTNS" (SEQ ID NO: 22), "RVTMGSE" (SEQ ID NO: 23), and "ATKNQNE" (SEQ ID NO: 24) were found to be added between the 587th and 588th amino acids of wild-type AAV2 VP1 in order of frequency from top to bottom in the second screening. Furthermore, as the screening cycle continued, the proportion of the top two sequences in terms of frequency further increased and became almost dominant.

[0060] As described above, by artificially inserting the sequences corresponding to the codons of these peptides into AAV, excellent gene transfer efficiency into vascular smooth muscle was achieved.

[0061] It goes without saying that the configurations and operations of the above-described embodiments are merely examples and can be modified as appropriate without departing from the spirit and scope of the present invention. [Industrial Applicability]

[0062] According to the present invention, by using an AAV vector present in blood as a vascular smooth muscle-specific biomarker, it is expected that pharmaceuticals for the early diagnosis and treatment of vascular smooth muscle will be provided, and the present invention can be used industrially.

Claims

1. An adeno-associated virus capsid, Vascular smooth muscle cell targeting factors added A vascular smooth muscle cell-targeting capsid characterized by:

2. The tropism factor is a peptide displayed on the surface of the viral particle. The vascular smooth muscle cell-targeting capsid according to claim 1 .

3. When the peptide is intended to infect vascular smooth muscle cells of mice (Mus musculus), it includes any one of the amino acid sequences of "RENKLGE" (SEQ ID NO: 5), "KDTVPRE" (SEQ ID NO: 6), "TETGKTA" (SEQ ID NO: 7), "STPAAKE" (SEQ ID NO: 8), "RNREPTE" (SEQ ID NO: 9), "ARNGTTE" (SEQ ID NO: 10), "KDTAERQ" (SEQ ID NO: 11), "NRGGNQD" (SEQ ID NO: 12), "NRPDTNS" (SEQ ID NO: 13), and "TRATSQE" (SEQ ID NO: 14). The vascular smooth muscle cell-targeting capsid according to claim 2 .

4. When the peptide is intended to infect vascular smooth muscle cells of humans (Homo sapiens), it includes any one of the amino acid sequences of "NRPETNP" (SEQ ID NO: 15), "SHDPSKE" (SEQ ID NO: 16), "SEIRRDQ" (SEQ ID NO: 17), "NRNKHEE" (SEQ ID NO: 18), "RQDNKME" (SEQ ID NO: 19), "THPPAPQ" (SEQ ID NO: 20), "TRGGGSE" (SEQ ID NO: 21), "TEKQTNS" (SEQ ID NO: 22), "RVTMGSE" (SEQ ID NO: 23), and "ATKNQNE" (SEQ ID NO: 24). The vascular smooth muscle cell-targeting capsid according to claim 2 .

5. The vascular smooth muscle cell-targeting capsid according to any one of claims 1 to 4 is provided. An adeno-associated virus vector.

6. The vascular smooth muscle cell-targeting capsid according to any one of claims 1 to 4 is provided. A pharmaceutical composition comprising:

7. A composition for treating a disease is a vascular smooth muscle cell-targeting capsid according to any one of claims 1 to 4. A pharmaceutical composition comprising:

8. 1. A method for treating an animal, comprising: The therapeutic composition is delivered to the vascular smooth muscle cell by the vascular smooth muscle cell-targeting capsid according to any one of claims 1 to 4. A method of treatment comprising:

9. The nucleic acid molecule is introduced into the vascular smooth muscle cells by the adeno-associated virus vector according to claim 5. A method for introducing nucleic acid comprising the steps of:

10. A method for producing an adeno-associated virus capsid, comprising: Adding tropism factors to vascular smooth muscle cells A method for producing a capsid.

Images