Mirna expression enhancer

Abstract

To provide a novel miRNA expression enhancer or the like.SOLUTION: The present invention provides an miRNA expression enhancer or the like, containing an ingredient that constitutes green tea, as an active ingredient.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention broadly relates to an miRNA expression enhancer that contains components constituting green tea as active ingredients, and a composition, particularly a food and drink composition, that contains the miRNA expression enhancer. [Background technology]

[0002] It is known that lack of sleep increases the risk of dementia. At the same time, sleep disorders are known to be one of the symptoms of dementia, and cognitive function and sleep have mutual effects. Therefore, it is necessary to improve both cognitive function and sleep quality.

[0003] It has been suggested that changes in certain miRNAs are associated with neurodevelopmental and neurodegenerative diseases, as well as cognitive impairment. For example, JP 2017-184642 A discloses that miRNAs such as miR-451a and miR-16-5p can be markers for dementia.

[0004] There are also papers reporting on the relationship between mild cognitive impairment (MCI) and miRNAs. microRNAs as Potential Biomarkers in Mild Cognitive Impairment Diagnosis”(Front Aging Neurosci. 2022 Jan 12;13:807764) lists miRNAs whose expression is upregulated and downregulated in cases of MCI (Table 2). [Prior art documents] [Patent documents]

[0005] [Patent Document 1] JP 2017-184642 A [Non-patent literature]

[0006] [Non-Patent Document 1] Natalia Ogonowski et al. “Systematic Review: microRNAs as Potential Biomarkers in Mild Cognitive Impairment Diagnosis” (Front Aging Neurosci. 2022 Jan 12;13:807764) Summary of the Invention [Problem to be solved by the invention]

[0007] The mechanism of cognitive impairment is complex, and the relationship with miRNAs remains unclear. [Means for solving the problem]

[0008] The present inventors discovered that components of green tea enhance the expression of specific miRNAs, and that these components can improve specific problems related to cognitive function, thereby completing the present invention.

[0009] That is, the present invention includes the following inventions. [1] An miRNA expression enhancer that contains components of green tea as active ingredients. [2] The miRNA enhancer according to [1], wherein the miRNA is one or more selected from the group consisting of miR-132-3p, miR-874-3p, miR-16-5p and miR-451a. [3] The active ingredient is one or more selected from the group consisting of theanine, caffeine, catechins, and vitamin K. The miRNA enhancer according to [1] or [2]. [4] The miRNA enhancer according to any one of [1] to [3], wherein the daily dose of matcha is 1.0 to 3.0 g. [5] The daily dose is Theanine is 20mg to 80mg. Caffeine is 50mg to 100mg. Catechins are 100mg to 250mg, The miRNA enhancer according to any one of [1] to [4], wherein the amount of vitamin K is 50 μg to 150 μg. [6] A composition comprising the miRNA expression enhancer according to any one of [1] to [5]. [7] The composition described in [6], which is a food or beverage composition or a pharmaceutical composition. [8] The composition described in [6] for maintaining or improving social cognitive function and sleep quality in a subject. [9] The composition described in [8], wherein the subject's age is 60 years or older and 84 years or younger.

[10] The composition described in [8] or [9], wherein the subject has subjective cognitive decline or mild cognitive impairment.

[11] The composition according to any one of [8] to

[10] , wherein the social cognitive function is evaluated by the facial expression recognition test of the Cognitrax test.

[12] The composition described in

[11] , wherein the improvement in social cognitive function is a reduction in incorrect responses in a facial expression recognition test.

[13] The composition described in any of [8] to

[10] , wherein sleep quality is assessed using the Pittsburgh Sleep Quality Index.

[14] The composition described in any of [8] to

[13] , wherein the active ingredient is administered to a subject daily for 12 months or more.

[15] The daily dose of the active ingredient is Theanine is 20mg to 80mg. Caffeine is 50mg to 100mg. Catechins are 100mg to 250mg, Vitamin K is 50μg to 150μg. The composition according to any one of [8] to

[14] . Effect of the Invention

[0010] In the report by Ogonowski et al. (see above), miR-132 is described as an miRNA whose expression is increased in cases of MCI. However, when subjects who were judged to have MCI were given green tea, the surprising effect of increasing miR-132 expression was confirmed in subjects whose social cognitive function improved in the Cognitrax test, a cognitive function testing service.

[0011] According to the present invention, it is also possible to provide a composition that improves both cognitive function and sleep quality. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0012] Hereinafter, the embodiments or implementations of the present invention will be described in detail, however, the present invention is not limited to these and various modifications are possible without departing from the gist of the present invention.

[0013] (miRNA expression enhancer) In one embodiment, there is provided an agent for enhancing miRNA expression, comprising a component constituting green tea as an active ingredient.

[0014] As used herein, "green tea" means tea made without fermenting the tea leaves. Examples of green tea include, but are not limited to, matcha, steamed tea, sencha, gyokuro, bancha, gyokuryokucha, kamairicha, steamed gyokuryokucha, kamairaisei gyokuryokucha, Chinese green tea, etc. Any type of green tea may be used alone or in combination.

[0015] In one embodiment, the green tea is matcha.

[0016] Green tea contains catechins, caffeine, amino acids such as theanine, vitamins, etc., and as used herein, "components constituting green tea" refers to one or more components that, among the components normally contained in green tea, enhance the expression of specific miRNAs and / or maintain or improve social cognitive function and sleep quality.

[0017] As used herein in the context of the components constituting green tea, "catechins" refers to one or more selected from the group consisting of catechin (C), gallocatechin (GC), catechin gallate (Cg), gallocatechin gallate (GCg), epicatechin (EC), epigallocatechin (EGC), epicatechin gallate (ECg) and epigallocatechin gallate (EGCg). Among them, epigallocatechin gallate is the major catechin, and epigallocatechin gallate may account for 50% or more of the catechins.

[0018] In one embodiment, the proportion of epigallocatechin gallate in the catechins contained in green tea is 0.40 to 0.80, preferably 0.50 to 0.75, more preferably 0.60 to 0.70, and particularly preferably 0.61 to 0.63.

[0019] As used herein in the context of the constituent components of green tea, "amino acids" refers to one or more selected from the group consisting of theanine, aspartic acid, glutamic acid, glycine, alanine, serine, tyrosine, cysteine, methionine, arginine, and lysine.

[0020] In one embodiment, the amino acid is theanine, preferably L-theanine.

[0021] As used herein in the context of the components that make up green tea, "vitamins" refers to fat-soluble vitamins selected from the group consisting of vitamin K, vitamin A, vitamin D, and vitamin E, as well as vitamin B1, vitamin B2, niacin, vitamin B6, vitamin B7, vitamin B8, vitamin B9, vitamin B10, vitamin B11, vitamin B12, vitamin B13, vitamin B14, vitamin B15, vitamin B16, vitamin B17, vitamin B18, vitamin B19, vitamin B20, vitamin B21, vitamin B22, vitamin B23, vitamin B24, vitamin B25, vitamin B26, vitamin B27, vitamin B28, vitamin B30, vitamin B31, vitamin B32, vitamin B33, vitamin B34, vitamin B35, vitamin B36, vitamin B37, vitamin B38, vitamin B40, vitamin B41, vitamin B42, vitamin B43, vitamin B44, vitamin B45, vitamin B46, vitamin B4 12, and water-soluble vitamins selected from the group consisting of folic acid, pantothenic acid, and vitamin C, and refers to one or more of these components.

[0022] In one embodiment, the vitamin is vitamin K selected from the group consisting of vitamin K1 and K2.

[0023] The components that make up green tea are not limited to those mentioned above, and other components that make up green tea may also include complex tannins, flavonols, γ-aminobutyric acid, saponin, soluble dietary fiber (pectin), minerals, etc.

[0024] The quality of green tea leaves varies depending on the variety of tea plant, the cultivation method and cultivation environment, the time of plucking of tea leaves (first harvest, second harvest, etc.) and the part (bud, leaf, stem) of the tea leaves, and also varies depending on the processing conditions of the tea leaves (steaming, rolling, drying, etc.). Accordingly, the content of the components contained in green tea leaves also varies in various ways, but a person skilled in the art can select green tea leaves containing the desired amounts of the above components.

[0025] Green tea contains a well-balanced amount of the active ingredients of the miRNA expression enhancer, and matcha in particular can be used preferably because it contains appropriate amounts of theanine, caffeine, catechins, and vitamin K.

[0026] The amount of green tea consumed may vary depending on the degree of the desired effect, the age, sex, etc. of the subject. For example, the daily amount of green tea consumed is about 0.1 g, about 0.2 g, about 0.3 g, about 0.4 g, about 0.5 g, about 0.6 g, about 0.7 g, about 0.8 g, about 0.9 g, about 1.0 g, about 1.1 g, about 1.2 g, about 1.3 g, about 1.4 g, about 1.5 g, about 1.6 g, about 1.7 g , about 1.8 g, about 1.9 g, about 2.0 g, about 2.1 g, about 2.2 g, about 2.3 g, about 2.4 g, about 2.5 g, about 2.6 g, about 2.7 g, about 2.8 g, about 2.9 g, about 3.0 g, about 3.1 g, about 3.2 g, about 3.3 g, about 3.4 g, about 3.5 g, about 3.6 g, about 3.7 g, about 3.8 g, about 3.9 g, and about 4.0 g.

[0027] As used herein, "daily dose" means "daily intake" or "daily administration."

[0028] In one embodiment, the green tea is matcha, and the daily dosage is about 1.0 g to about 3.0 g, preferably about 1.5 g to about 2.5 g, and more preferably about 1.8 g to about 2.2 g.

[0029] The amount of active ingredients contained in green tea varies depending on the type of green tea leaves, etc., and is not intended to be limiting, but if the daily amount of green tea is about 2.0 g, the amount of theanine is about 10 mg, about 15 mg, about 20 mg, about 30 mg, about 35 mg, about 40 mg, about 45 g, about 50 g, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, or about 90 mg. , caffeine is about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 95 mg, about 100 mg, about 105 mg or about 110 mg, and catechins are about 110 mg, about 115 mg, about 120 mg, about 125 mg, about 130 mg, about 135 mg, about 140 mg, about 145 mg, about 150 mg g, about 155 mg, about 160 mg, about 165 mg, about 170 mg, about 175 mg, about 180 mg, about 185 mg, about 190 mg, about 195 mg, about 200 mg, about 205 mg, about 210 mg, about 215 mg, about 220 mg, about 225 mg, about 230 mg, about 235 mg, about 240 mg, about 245 mg, about 250 mg, about 255 mg, or about 260 mg; and vitamin K is about 35 mg. μg, approximately 40 μg, approximately 45 μg, approximately 50 μg, approximately 55 μg, approximately 60 μg, approximately 65 μg, approximately 70 μg, approximately 75 μg, approximately 80 μg, approximately 85 μg, approximately 90 μg, approximately 95 μg, approximately 100 μg, approximately 10 5μg, about 110μg, about 115μg, about 120μg, about 125μg, about 130μg, about 135μg, about 140μg, about 145μg, about 150μg, about 155μg or about 160μg.

[0030] In one embodiment, the content of the active ingredient in a daily dose of green tea is: Theanine is about 20 mg to about 80 mg, Caffeine is about 50 mg to about 100 mg, Catechins are about 100 mg to about 250 mg, Vitamin K is about 45 μg to about 105 μg.

[0031] In a preferred embodiment, the content of the active ingredient in a daily dose of green tea is: Theanine is about 40 mg to about 60 mg, Caffeine is about 55 mg to about 75 mg, Catechins are about 95 mg to about 215 mg, Vitamin K is about 60 μg to about 90 μg.

[0032] In a more preferred embodiment, the content of the active ingredient in a daily dose of green tea is: Theanine is about 45 mg to about 55 mg, Caffeine is about 60 mg to about 70 mg, Catechins are about 100 mg to about 210 mg, Vitamin K is approximately 70 μg to approximately 80 μg.

[0033] In an even more preferred embodiment, the content of the active ingredient in a daily dose of green tea is: Theanine is about 45 mg to about 55 mg, Caffeine is about 60 mg to about 70 mg, Catechins are about 165 mg to about 175 mg, Vitamin K is approximately 70 μg to approximately 80 μg.

[0034] As used herein, "miRNA" refers to a short-stranded RNA molecule of 18-25 bases in length, in which nucleotides are covalently linked, that is expressed in humans. Preferably, the miRNA is a molecule having a base length selected from the group consisting of 19 bases, 20 bases, 21 bases, 22 bases, 23 bases, and 24 bases.

[0035] Some miRNAs are enhanced in expression in humans by the intake of green tea. As used herein, "enhanced expression" means that the expression level is increased compared to the control. Although there is no particular threshold for whether or not expression is enhanced, it is preferable that the expression level is statistically significantly increased.

[0036] The expression level of miRNA can be evaluated by known methods, such as real-time reverse transcription PCR (RT-qPCR), microarray, and next-generation sequencing.

[0037] Examples of miRNAs whose expression in humans is enhanced by the intake of green tea include 22-base-long miRNAs, such as miR-132-3p, miR-874-3p, miR-16-5p, and miR-451a. Among these, miR-132-3p and miR-874-3p are preferred.

[0038] The sequences of the mature forms of each miRNA are shown below. miR-132-3p: UAACAGUCUACAGCCAUGGUCG (SEQ ID NO: 1); miR-874-3p:CUGCCCUGGCCCGAGGGACCGA (SEQ ID NO:2); miR-16-5p: UAGCAGCACGUAAAUAUUGGCG (SEQ ID NO: 3); and miR-451a: AAACCGUUACCAUUACUGAGUU (SEQ ID NO: 4)

[0039] In one embodiment, the miRNAs whose expression is significantly enhanced by components constituting green tea are a combination of miR-132-3p and miR-874-3p.

[0040] Green tea or its components are preferably incorporated alone into the miRNA expression enhancer, but may be combined with other ingredients as long as the desired effect is not impaired.

[0041] The miRNA expression enhancer may be in the form of tea leaves themselves or processed products thereof, such as extracts or crushed products. The tea leaves can be subjected to an extraction process using water or an aqueous solvent to efficiently obtain the active ingredient. The aqueous solvent means water containing an organic solvent such as methanol, ethanol, isopropanol, or ethyl acetate. The water used may be hot water.

[0042] Powdered tea leaves are generally obtained by known grinding means such as a stone mill, a ball mill, a hammer mill, a jet mill, etc. Generally, green tea leaf powder prepared as green tea for drinking, green tea for food processing, etc. contains particles with a particle size of about 1 to 100 μm, with an average particle size of about 3 to 30 μm.

[0043] The particle size distribution can be adjusted by selecting the grinding means and classifying the powder. Two types of green tea leaf powder with different particle size distributions may be prepared using different grinding means and mixed appropriately. Two or more types of grinding may be combined and applied to the green tea leaves. However, it is desirable to take care not to cause thermal changes in the components. The classification of the powder can be performed using a sieve or a classifier, and the classifier may be any of the following types: gravity classification, inertial classification, and centrifugal classification. It can be appropriately selected depending on the green tea leaf powder to be classified and the particle size to be obtained. From the viewpoint of component outflow, etc., dry classification is preferable.

[0044] When the miRNA expression enhancer is a liquid, it can be enclosed in a known container, such as a plastic bottle such as a PET bottle, a metal can such as a steel or aluminum can, a bottle, or a paper container.

[0045] The miRNA expression enhancer may be in a powder or other form. In the case of a powder, it can be enclosed in a bag, a box, or a similar container. For example, the miRNA expression enhancer may be enclosed in a package such as a tea bag, and examples of the shape of such a package include a square type, a triangular pyramid type (so-called Tetra Pak (registered trademark)), a rounded bag, a W-chamber type, and the like. The miRNA expression enhancer may also be filled in a type of bag that is dripped like coffee by pouring water or hot water into the bag body.

[0046] (composition) In one embodiment, a composition comprising a miRNA expression enhancer is provided.

[0047] The dosage form of the composition containing the miRNA expression enhancer is not particularly limited, and the administration route can be appropriately determined by a person skilled in the art depending on the dosage form and the level of the miRNA expression enhancer to be improved, and examples thereof include oral administration or parenteral administration (intravenous, intraarterial, subcutaneous, intradermal, intramuscular, or intraperitoneal injection, transdermal, nasal, transmucosal, etc.). Oral administration is preferred.

[0048] The composition may contain an excipient other than green tea or its constituents. The excipient may be a solid excipient generally used in pharmaceutical preparations. Examples of the excipient include starches such as cornstarch, wheat flour, and rice flour, sugars such as lactose, sucrose, mannitol, sorbitol, and white sugar, dextrin, precipitated silica, gelatin, cellulose, and methylcellulose. One or more of these excipients may be appropriately selected and used.

[0049] The composition may be in liquid, powder or other form.

[0050] A composition containing a miRNA expression enhancer is prepared by adding and mixing, as necessary, fats and oils, seasonings, fragrances, etc. to green tea or its components and, optionally, an excipient. The composition may be provided in the form of a liquid, powder, capsule, or tablet, in which case it is easy to provide as a supplement, etc.

[0051] As used herein, "liquid" refers to a liquid preparation based on a liquid medium such as water or oil, including syrups. As used herein, "tablet" refers to a tablet formulation including pills as well as tablets. Tablets may be in a form such that the contents cannot be identified by taste, such as sugar-coated tablets. Capsules may be those generally used for pharmaceuticals, and both hard capsules and soft capsules can be used. Hard capsules can be prepared by filling a sample into a capsule coating formed using, for example, gelatin, hydroxypropylmethylcellulose, etc. Soft capsules can be obtained by sandwiching a sample between sheets of gelatin to which a plasticizer such as glycerin has been added, and then pressing the sample into the sheet.

[0052] The size and content of the capsules and tablets, as well as the number of servings per time, can be set so that the subject can take them without difficulty. In general, the intake conditions can be set so that the daily intake of green tea is about 1.0 g to about 3.0 g, preferably about 1.5 g to about 2.5 g, more preferably about 1.8 g to about 2.2 g.

[0053] The composition is preferably provided in the form of a food or drink, particularly a specific health food or functional food, or a pharmaceutical. The composition is expected to be taken by a subject who has or is suspected of having subjective cognitive decline or mild cognitive impairment. Subjects who have subjective cognitive decline or mild cognitive impairment exclude major depression patients, cognitively healthy individuals, and dementia patients.

[0054] The age of the subject is not intended to be particularly limited, but it is envisioned that the subject will be elderly, for example, elderly aged 60 to 84 years.

[0055] As used herein, "mild cognitive impairment" (MCI) refers to a precursor state to dementia, such as Alzheimer's disease. Patients with mild cognitive impairment have noticeable forgetfulness, but do not have any problems with daily life. It is said that 40% of people with MCI will develop dementia, such as Alzheimer's disease, within four years.

[0056] The diagnosis of MCI can be made according to criteria known to those skilled in the art. For example, the following diagnostic criteria for MCI are known: Type I: The subject reports memory loss and the study partner accepts it. Type II: The subject does not report any memory problems, but the study partner indicates that the subject has memory problems. Note: Students will be excluded if their only memory impairment is due to their own lack of memory and their study partner does not accept this. 1) MMSE-J score between 24 and 30 2) A score below the cutoff point on the Wechsler Memory Scale-R Logical Memory II, taking into account years of education Years of Education 0-7: 6 points or less 8-15 years of education: 9 points or less 16 years or more of education: 11 points or less 3) Comprehensive CDR (Clinical Dementia Scale) was 0.5

[0057] As used herein, "subjective cognitive decline" (SCD) refers to a stage preceding mild cognitive impairment (MCI), where cognitive decline is not objectively observed, but the individual is aware of forgetfulness. SCD can be diagnosed according to criteria known to those skilled in the art. For example, the following diagnostic criteria for SCD are known: Those who do not meet the diagnostic criteria for MCI but do not have dementia meet the following criteria. 1) Subjective complaint of forgetfulness (SCD) 2) Subjects with either an MMSE-J score of 27 to 30, mild hippocampal atrophy on MRI, or mild reduction in rCBF (regional cerebral blood flow) on SPECT 3) Comprehensive CDR (Clinical Dementia Scale) was 0

[0058] The compositions may be used to maintain or improve social cognitive function and sleep quality.

[0059] As used herein, the term "social cognitive function" refers to one of the cognitive functions assessed by the facial expression recognition test of the Cognitrax test, and generally refers to a cognitive function that is the basis of a series of social interactions, such as perceiving, interpreting, and responding to the "intentions," "tendencies," and "behaviors" of others.

[0060] The Cognitrax test is a cognitive function testing technology developed by CNS Vital Signs, a US company (Gualtieri CT, Johnson LG: Reliability and validity of a computerized neurocognitive test battery, CNS Vital Signs. Arch Clin Neuropsychol 2006;21:623-643.), and has the following characteristics, for example: -Measures a wide range of functional areas, including memory, attention, processing speed, and executive function. The results are quantified and displayed in comparison with age-standard values. -10 types of tests are provided, and you can select the test depending on the purpose of the inspection. By monitoring individual values ​​over time, it is possible to detect changes in memory and cognitive function. -Reaction times can be measured with millisecond accuracy, providing accurate and reliable measurements. Very low learning or ceiling effect.

[0061] The ten tests in the Cognitrax test are: 1. Verbal Memory Test (Verbal Memory (VBM)) 2. Visual Memory Test (VIM) 3. Finger Tapping Test (FTT) 4.SDC Test (Symbol Digit Coding (SDC)) 5. Stroop Test (ST) 6. Shifting Attention Test (SAT) 7. Continuous Performance (CPT) 8. Perception of Emotion (POET) 9. Non Verbal Reasoning (NVRT) 10. Four Part Continuous Performance (FPCPT)

[0062] The social cognitive function, which is expected to be improved by the intake of green tea, is evaluated by the facial expression recognition test in the Cognitrax test. The facial expression recognition test takes about two minutes, and participants respond by whether or not they agree with the facial expression of a photograph of a face displayed on the screen and the emotion (calm, happy, sad, angry) displayed underneath it. Facial expressions are classified into positive expressions (calm, happy) and negative expressions (sad, angry), and the number of correct responses and reaction time [milliseconds] for each positive and negative response are calculated, as well as the total number of correct responses for positive and negative responses, the average correct reaction time, the total number of missed correct responses, and the total number of incorrect responses.

[0063] An example of an improvement in social cognitive function is a significant improvement in the accuracy of emotion recognition from facial expressions in the facial expression recognition test of the Cognitrax test compared to a placebo. Specifically, if the social cognition score (correct responses minus incorrect responses) measured in the facial expression recognition test is significantly reduced, it is judged that social cognitive function has improved.

[0064] As used herein, "sleep quality" refers to the subjective quality of sleep and level of symptoms of sleep disorders as assessed using the Pittsburgh Sleep Quality Index (PSQI).

[0065] The Pittsburgh Sleep Quality Index (PSQI) is a scale for assessing the degree of sleep disorders. Subjects self-report their subjective assessment of seven items over the past month: quality of sleep, time to fall asleep, duration of sleep, sleep efficiency, difficulty falling asleep, use of sleeping pills, and difficulty waking during the day. Each item is assigned a score of 0 to 3, and the total score (0 to 21 points) is calculated and the assessment is made. The cutoff value is 5.5 points, and a score of 6 or more is considered to indicate a sleep disorder. An example of improvement in sleep quality is a significant improvement in the total score of the PSQI. Specifically, the lower the total score, the better the sleep quality is judged to be.

[0066] The green tea or its components to be administered for maintaining or improving social cognitive function and sleep quality can be appropriately determined by those skilled in the art. Although not intended to be limiting, the dosage of green tea is about 1.0 g to about 3.0 g per day, preferably about 1.5 g to about 2.5 g per day, more preferably about 1.8 g to about 2.2 g per day. The above dosage may be a single dosage once a day, or may be multiple dosages 2 to 3 times a day. The above dosage may be appropriately increased or decreased depending on the age, pathology, and symptoms of the subject.

[0067] Green tea, from which the active ingredient is derived, is incorporated into compositions, particularly foods, beverages, or pharmaceuticals, either in the form of the tea leaves themselves or processed products thereof, such as extracts or ground products.

[0068] As used herein, "food and drink" refers to processed foods, beverages, fruits and vegetables, and other items that are consumed. Examples of beverages include, but are not limited to, dairy beverages, lactic acid bacteria beverages, soy milk, soft drinks (including flavored water such as near water), nutritional drinks, sports drinks, fruit drinks, vegetable juices, dairy beverages, alcoholic beverages, jelly drinks, carbonated drinks, and other beverages and energy drinks.

[0069] Examples of containers for filling the beverage include, but are not limited to, commonly used containers such as plastic bottles, cans, paper bottles, jars, etc. It is preferable to use a container that can be sealed after being filled.

[0070] Examples of foods include sweets such as cookies, biscuits, chocolate, cakes, puddings, ice cream, sherbet, waffles, wafers, pancakes, donuts, popcorn, castella, caramel, candy, chewing gum, and Japanese sweets; breads such as white bread, sweet bread, and other breads; noodles such as udon, hiyamugi, somen, buckwheat, Chinese noodles, spaghetti, macaroni, rice vermicelli, and harusame; processed meat foods such as hamburger steaks, ham, bacon, and sausages; and instant foods such as curry, ramen, and soup, but are not limited to these.

[0071] Alternatively, the composition may be prepared in the form of granules, emulsion, cream, etc., and provided as food such as seasoning, sauce, dressing, etc. Such foods can be easily handled by providing them in small portions appropriately packaged according to the amount to be taken per serving.

[0072] When the composition is in the form of a pharmaceutical product, other pharmacologically acceptable ingredients may be added in addition to green tea. Such ingredients include pharma- ceutically acceptable additives such as buffers, stabilizers, and preservatives. Pharmaceutically acceptable ingredients are well known to those skilled in the art, and can be appropriately selected and used by those skilled in the art within the scope of their ordinary practice, for example, from ingredients listed in the specifications of the 17th Revised Japanese Pharmacopoeia, depending on the form of the preparation.

[0073] The number of times of ingestion per day and the time of ingestion (morning / afternoon, morning / afternoon / evening, relative to meals), the amount of ingestion per time, and the amount of ingestion per day are appropriately set, so it is advisable to prepare the composition in a form that is easy to ingest based on the ingestion conditions that have been set. It is preferable to take the composition continuously every day. The period of ingestion is not intended to be limited, but is preferably several months, for example, 2 months or more, 3 months or more, 4 months or more, 5 months or more, 6 months or more, 7 months or more, 8 months or more, 9 months or more, 10 months or more, 11 months or more, or 12 months or more. The period of ingestion is preferably 10 months or more, more preferably 11 months or more, and particularly preferably 12 months or more.

[0074] In one embodiment, the daily amount of each active ingredient constituting the composition is Theanine is about 20 mg to about 80 mg, Caffeine is about 50 mg to about 100 mg, Catechins are about 100 mg to about 250 mg, Vitamin K is about 45 μg to about 105 μg.

[0075] In a preferred embodiment, the daily amount of each of the active ingredients constituting the composition is about 40 mg to about 60 mg of theanine; Caffeine is about 55 mg to about 75 mg, Catechins are about 95 mg to about 215 mg, Vitamin K is about 60 μg to about 90 μg.

[0076] In a more preferred embodiment, the daily amount of each of the active ingredients constituting the composition is: Theanine is about 45 mg to about 55 mg, Caffeine is about 60 mg to about 70 mg, Catechins are about 100 mg to about 210 mg, Vitamin K is approximately 70 μg to approximately 80 μg.

[0077] In a further preferred embodiment, the daily amount of each of the active ingredients constituting the composition is: Theanine is about 45 mg to about 55 mg, Caffeine is about 60 mg to about 70 mg, Catechins are about 165 mg to about 175 mg, Vitamin K is approximately 70 μg to approximately 80 μg.

[0078] (marker) In one embodiment, a biomarker is provided, comprising one or more selected from the group consisting of miR-132-3p, miR-874-3p, miR-16-5p and miR-451a.

[0079] As used herein, the term "biomarker" refers to a substance that is an indicator of changes in social cognitive function and sleep quality in humans. The purpose of measuring a biomarker is to diagnose a disease or symptom early, to monitor the progress after treatment, to evaluate the effectiveness of treatment, etc. In the present invention, the biomarker can be suitably used to evaluate the maintenance or improvement of social cognitive function and sleep quality by green tea or its components.

[0080] In one embodiment, the biomarker consists of miR-132-3p and / or miR-874-3p.

[0081] (Method for determining increased miRNA expression) In one embodiment, a method is provided for determining upregulation of miRNA expression in a sample from a subject who has consumed green tea or a component thereof.

[0082] The subject is assumed to be a person who has or is suspected of having subjective cognitive decline or mild cognitive impairment. The subject is preferably a person who has consumed green tea or its components daily for a long period of time.

[0083] The age of the subject is not intended to be particularly limited, but it is envisioned that the subject will be elderly, for example, elderly aged 60 to 84 years.

[0084] Examples of specimens include blood or its components, cell or tissue extracts, or urine, cerebrospinal fluid, tracheal aspirate, bronchoalveolar lavage fluid, etc., from the subject from whom the specimen is derived. Blood components include whole blood, blood cells, serum, plasma, etc. Peripheral blood or peripheral blood mononuclear cells (PBMCs) derived from peripheral blood are preferred specimens. PBMCs can be prepared using known means such as density gradient centrifugation, immunomagnetic separation, and sedimentation.

[0085] Examples of miRNAs that are subject to this method include miR-132-3p, miR-874-3p, miR-16-5p, and miR-451a.

[0086] A miRNA is determined to be enhanced if its expression level is increased compared to a control. Although there is no particular threshold for whether expression is enhanced or not, it is preferable that the expression level is increased statistically significantly.

[0087] The expression level of miRNA can be evaluated by known methods, such as real-time reverse transcription PCR (RT-qPCR), microarray, next-generation sequencing, etc. The expression level can be evaluated over time, in which case the expression level measured previously may be used as a control.

[0088] (Evaluation method) In one embodiment, a method is provided in which green tea or a component thereof is administered to a subject to assess the maintenance or improvement of social cognitive function and sleep quality in a sample from the subject.

[0089] The subject is assumed to be a person who has or is suspected of having subjective cognitive decline or mild cognitive impairment. The subject is preferably a person who has consumed green tea or its components daily for a long period of time.

[0090] The age of the subject is not intended to be particularly limited, but it is envisioned that the subject will be elderly, for example, elderly aged 60 to 84 years.

[0091] The social cognitive function targeted by this method can be evaluated by the facial expression recognition test in the Cognitrax test. An example of an improvement in social cognitive function is a significant improvement in the accuracy of emotion recognition from facial expressions in the facial expression recognition test of the Cognitrax test compared to a placebo. Specifically, if the number of incorrect responses is significantly reduced in the social cognition score (correct responses-incorrect responses) measured in the facial expression recognition test, it is determined that the social cognitive function has improved.

[0092] The mild cognitive impairment targeted by this method can be evaluated using the Pittsburgh Sleep Quality Index (PSQI). An example of improvement in sleep quality is a significant improvement in the total score of PSQI. Specifically, the lower the total score, the better the quality of sleep is.

[0093] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples. EXAMPLES

[0094] Preparation of the improvement agent Matcha was used as the active ingredient of the improvement agent. Subjects in the matcha group took 2 g of matcha, which contains 171.0 mg of catechins (105.3 mg of epigallocatechin gallate), 48.6 mg of theanine, 66.2 mg of caffeine, and 76.6 μg of vitamin K, and 9 pork gelatin capsules (manufactured by Sunsho Pharmaceutical Co., Ltd.) containing starch as an excipient per day. Subjects in the placebo group, which served as a control, took 9 pork gelatin capsules (manufactured by Sunsho Pharmaceutical Co., Ltd.) containing 2 g of green-colored cornstarch.

[0095] subject person Screening was conducted on 124 people (potential subjects) who agreed to participate in the study. The screening items are shown in Table 1. The subjects in this study were those with SCD (subjective cognitive decline) or MCI (mild cognitive impairment), and excluded were those with major depression, those with normal cognitive function, and those with dementia. Neuropsychological tests and imaging tests were conducted as diagnostic tests. In addition, because this study used matcha as the test food, interviews were conducted to determine the amount of matcha intake in addition to green tea intake.

[0096] [Table 1]

[0097] As a result of the screening, eligibility of the subjects was examined according to the following inclusion and exclusion criteria, and those who the investigator determined to be eligible were enrolled as subjects.

[0098] Registration Criteria 1) Males and females aged 60-85 with MCI or SCD whose native language is Japanese 2) Those who have not been treated for any serious illness (cancer, myocardial infarction, stroke) within the past five years 3) Subjects who are not taking dementia medications (Aricept, Reminyl, Rivastac, Memantine) 4) Those who do not show atrophy associated with dementia in MRI images 5) Those who have not participated in day care interventions such as exercise interventions or cognitive function training 6) Those who can visit the designated facility on the scheduled visit date. 7) The cooperation of study partners is available. Study partners should be kept as constant as possible. Individuals who agree to APOE genotype analysis 8) Subjects who have the ability to consent, fully understand the purpose and content of this study, voluntarily volunteer to participate, and provide written consent

[0099] The subjects in this study had MCI or SCD, and were considered to have the ability to make decisions, so a proxy was not necessary. Therefore, the study partner was not a proxy, but someone who would check the intake of matcha or placebo capsules and accompany the subjects when they visited the hospital. The study partner was a spouse, child, or other person who had contact with the subjects for more than 10 hours a week and knew the subjects' daily lives well.

[0100] In addition, subjects who met any of the following criteria were excluded from this study. 1) People diagnosed with dementia 2) Those diagnosed with major depressive disorder (MDD) 3) Those with an MMSE-J score of less than 24 points 4) People who may have food allergies (matcha, green tea allergies) 5) Those who have been hospitalized and undergone treatment for head disorders such as stroke or subarachnoid hemorrhage 6) Subjects taking medications that may affect this study (antipsychotics, antianxiety medications, antidepressants, etc.) (However, this does not apply to subjects who have started taking medications 3 months prior to the start of the study and have not changed their medications during the study period. However, if there are any of the following changes to the above medications during the 3 months prior to the start of the study, the doctor's discretion will be applied: 1. Change in dosage, 2. Change in medication, 3. Discontinuation of one of the medications when two medications are being used at the same time.) 7) Those who regularly consume functional foods that may affect cognitive function, except if more than 4 weeks have passed since they stopped consuming them. 8) Subjects who have previously experienced ill-health or physical condition due to blood sampling 9)Subjects who are currently participating in or have completed another clinical trial within the last 4 weeks 10) Subjects who drink 7 or more cups of matcha tea per week 11) People who feel unwell when consuming caffeine 12) People with alcoholism 13) Subjects who have undergone surgery on the upper gastrointestinal tract, except those who are deemed appropriate for participation in this study by a physician. 14) Any other person who is deemed inappropriate for participation in this study by a doctor 15) Those who do not agree with the purpose of the test that is explained in advance

[0101] The subjects of this study were those diagnosed with MCI or SCD, and the diagnostic criteria are as follows: Diagnostic Criteria for MCI Type I: The subject reports memory loss and the study partner accepts it. Type II: The individual does not report memory problems, but the study partner indicates that they do. Note: Students will be excluded if their only memory impairment is due to their own lack of memory and their study partner does not accept this. 1) MMSE-J score between 24 and 30 2) A score below the cutoff point on the Wechsler Memory Scale-R Logical Memory II, taking into account years of education 0-7 years of education: 6 points or less 8-15 years of education: 9 points or less 16+ years of education: 11 points or less 3) Comprehensive CDR (Clinical Dementia Scale) was 0.5

[0102] Diagnostic Criteria for SCD Those who do not meet the diagnostic criteria for MCI but do not have dementia and meet the following criteria: 1) Subjective complaint of forgetfulness (SCD) 2) Subjects with either an MMSE-J score of 27 to 30, mild hippocampal atrophy on MRI, or mild reduction in rCBF (regional cerebral blood flow) on SPECT 3) Global CDR (Clinical Dementia Scale) was 0

[0103] Study design This study was conducted as a randomized, double-blind, placebo-controlled study. The primary outcome measures were the MoCA-J and activities of daily living (ADCS-MCI-ADL), and the secondary outcome measures were neuropsychological tests (MMSE-J, ADAS-cog, RBAN, and Cognitrax (CNS Vital Signs Japanese version, Stroop test, attention shift test, sustained processing test, facial expression recognition test)) to evaluate reaction time, overall attention, cognitive flexibility, executive function, social cognition, and simple attention. Sleep quality (Pittsburgh Sleep Quality Index: PSQI-J) and depressive symptoms (Geriatric Depression Scale: GDS) were also evaluated. Furthermore, blood biomarkers (miRNA) were measured to evaluate their relationship with cognitive function. Various tests were conducted before and after the intervention (baseline, 12 months later), as well as 6 months after the intervention.

[0104] Participants were randomized to take either nine placebo or matcha capsules daily for 12 months. After randomization, baseline measurements were taken and the intervention study began. The intervention consisted of taking 2 g (9 capsules) of matcha powder (Matcha) or cornstarch (Placebo) daily, and follow-up examinations were conducted at 6 and 12 months. The capsules were colored with cornstarch powder (placebo) so that it would not be possible to tell whether the capsules were matcha powder or cornstarch powder even when opened. Each day's worth of capsules (9 capsules) was sealed in a small bag for easy handling, and a large bag containing one month's worth of small bags was provided to participants for a three-month supply each.

[0105] Various inspection items MoCA-J The MoCA-J is a screening test for detecting mild cognitive impairment (MCI). It is a test that consists of items such as visuospatial and executive function, naming, memory, attention, repetition, word recall, abstract concept, delayed recall, and orientation, and has a maximum score of 30 points. A score of 25 or less is considered to be a suspected MCI.

[0106] MMSE-J The MMSE-J consists of 11 items: orientation to time, orientation to place, memory, attention and calculation, recall, naming, repetition, three-step commands, reading, writing, and drawing, and is evaluated based on the total score of these items.

[0107] ADAS-cognitive ADAS-cog is a test to evaluate cognitive impairment in Alzheimer's disease. Cognitive function is evaluated based on 11 items: word recall, oral language ability, auditory comprehension of language, difficulty finding words in spontaneous speech, following verbal commands, finger and object naming, constructional behavior, ideomotor ability, orientation, word recognition, and recall ability of test instructions. The score range is 0 to 70 points. Answering all questions correctly gives a score of 0, and answering all questions incorrectly gives a score of 70, so the higher the score, the worse the cognitive function.

[0108] RBANS The Repeatable Battery for the Assessment of Neuropsychological Status (RBANS) is a neuropsychological test task that can repeatedly assess higher brain dysfunction associated with various brain diseases in a short period of time (approximately 30 minutes). It can evaluate cognitive function in detail in the areas of immediate memory, visuospatial / construction, immediate memory, delayed memory, visuospatial / construction, language, and attention.

[0109] Cognitrax Trials Cognitrax is a cognitive function testing service developed by the US company CNS Vital Signs (Morrisville, North Carolina) to measure both reaction time and number of responses. In Japan, the service is provided by Health Solutions Co., Ltd. (Tokyo). Cognitrax consists of 10 test items. In this study, four of the 10 tests in Cognitrax were administered: the Stroop test, the attention shifting test, the sustained processing test, and the facial expression recognition test, and the "cognitive function domain score" shown in Table 2 was calculated.

[0110] [Table 2]

[0111] ADCS MCI-ADL The ADCS MCI-ADL is a scale that evaluates activities of daily living, and assesses the subject's actual recent activities of daily living through 24 questions posed to the subject's partner.

[0112] Pittsburgh Sleep Quality Index The Pittsburgh Sleep Quality Index (PSQI) is a scale for assessing the degree of sleep disorders, and participants are asked to self-report a subjective assessment of seven items over the past month: quality of sleep, time to fall asleep, duration of sleep, sleep efficiency, difficulty sleeping, use of sleeping pills, and difficulty waking during the day. Each item is assigned a score of 0 to 3, and the total score (0 to 21 points) is calculated and the assessment is made. The cutoff score is 5.5 points, and a score of 6 or more is considered to indicate a sleep disorder.

[0113] Measurement of blood miRNA Plasma collection After collecting an optimal amount of blood in an EDTA-2Na blood collection tube, the tube was inverted 8-10 times to gently mix the blood. The blood was centrifuged in a swing rotor centrifuge (1,380 g, 5 min, 22°C). The upper layer was collected without disturbing the middle layer (buffy coat layer). The collected supernatant fraction was dispensed into cryovials. Each tube had a volume of 250 μl, and a total of four tubes were prepared per subject and stored at -80°C until use.

[0114] Extraction of total RNA including microRNAs Total RNA was extracted from 200 μl of donated plasma using the miRNeasy Serum / Plasma Advanced Kit (Qiagen). Spike-in control (cel-miR-39-3p) was added to the plasma as a quality check index.

[0115] qPCR analysis In this intervention study, 11 miRNAs and a spike-in control (cel-miR-39-3p) shown in Table 3 were measured. cDNA was synthesized from a certain amount of plasma-derived total RNA using the Taqman Micro RNA Reverse Transcription Kit (Thermo Scientific) and reverse transcription primers individually designed for each miRNA. qPCR was performed using a portion of the synthesized cDNA solution as a template, TaqMan Fast Advanced Master Mix (Thermo Scientific) and Taqman miRNA assay (Thermo Scientific). qPCR was performed using a Quant Studio5 real-time PCR system (Thermo Scientific), and the Ct value of each miRNA was calculated. Measurements were performed with n=1 per sample. The quality of the data was confirmed based on the spike-in control data. Spike-in control Ct values ​​that were significantly high (i.e., low recovery rates) were subject to reanalysis because it was suspected that RNA extraction had failed.

[0116] [Table 3]

[0117] Preparation of synthetic miRNA mixture Five phosphorylated RNA oligos for the 11 designated miRNAs and the spike-in control (cel-miR-39-3p) were synthesized and dissolved in ultrapure water to prepare a synthetic RNA mixture solution.

[0118] Creating a standard curve using synthetic miRNA, setting the lower limit of quantification, and examining the data Using the synthetic RNA mixture solution prepared above, cDNA for each miRNA was synthesized (n=1). A serial dilution series was prepared using the cDNA, and qPCR was performed (n=5 for each). A standard curve was prepared within the dilution range in which no undetermined amplification occurred among the standard points for the n=5 analysis. The precision and accuracy of each dilution step were calculated when the standard curve was taken as the true value, and the maximum Ct value that satisfied precision ≥ 50% and accuracy ≥ 50% for each miRNA to be measured was taken as the lower limit of quantification Ct value. Samples within the lower limit of quantification were analyzed.

[0119] Calculation of relative levels of miRNA in blood The relative quantification value was calculated using the obtained Ct value. The algorithm for relative quantification was the ΔCt method. This method utilizes the fact that theoretically, a 1 cycle difference in Ct value is a quantitative difference of 2 times (a difference of 2n in n cycles), and normalizes the amount of the target gene with the amount of a correction gene (Spike in control gene) measured on the same plate, and then compares each sample to perform relative quantification and comparison.

[0120] statistical analysis For each evaluation item, the intervention effect was verified using a mixed effects model. Model equation (1) consisting of time effects (Baceline, 6 months, 12 months), group effects (matcha, placebo), and interaction between time and group Efficacy index = time + group + time * group (1) was constructed.

[0121] The estimated means (variables) of efficacy indicators for each group at each time point were defined as shown in Table 4 below. [Table 4]

[0122] Furthermore, we estimated the change over time (mean difference) (2). Δ(BL, 6M)= 6M - baseline or Δ(BL, 12M)= 12M-baseline (2) The difference between groups was defined by the following formula, and the mean difference (Estimate) between groups was estimated. Estimate ((mean difference A6M - A0M) - (mean difference B6M - B0M) ) (3) or Estimate ((difference of means A12M - A0M) - (difference of means B12M - B0M) ) (4) A null hypothesis (H) and an alternative hypothesis (K) were formulated (5) and a t-test was conducted. H: δ=0, K: δ≠0 (5)

[0123] The null hypothesis is "there is no change, there is no intervention effect," and rejecting the null hypothesis leads to the alternative hypothesis, "there is an intervention effect." When verifying the intervention effect using a mixed effects model, if an intervention effect is observed, there will be at least a time effect and a group effect, and furthermore an interaction between time and group will be observed.

[0124] Furthermore, if δ is negative, it is estimated that there is an intervention effect of matcha intake (higher values ​​are shown in the matcha intake group), and if it is positive, there is no intervention effect in the matcha group (higher values ​​are shown in the placebo group).

[0125] result Taking into consideration the above criteria, 99 patients were enrolled in this study. A total of 91 subjects, 46 of whom took matcha tea and 45 of whom took placebo, completed the 12-month study. The clinical characteristics of the patients in this study are shown in Table 5.

[0126] [Table 5]

[0127] The number of subjects was 50 in the placebo group (20 men, 30 women) and 49 in the matcha group (23 men, 26 women). The mean ages were 71.9 and 72.1 years, respectively, with no age bias (P = 0.907).

[0128] There were 35 subjects without APOE ε4 in the placebo group (ε2 / ε3 7, ε3 / ε3 28) and 35 subjects in the matcha group (ε2 / ε3 4, ε3 / ε3 31). There were 15 subjects with APOE ε4 in the placebo group (ε2 / ε4 1, ε3 / ε4 13, ε4 / ε4 1) and 14 subjects in the matcha group (ε3 / ε4 13, ε4 / ε4 1). The proportion of subjects with APOE ε4 was 30% in the placebo group and 28.6% in the matcha group, and no bias was observed in the APOE ε4 carrier rate (P = 0.876).

[0129] As described above, there was no bias in the distribution of age and APOEε4, indicating that random allocation was carried out correctly.

[0130] Table 6 below shows the baseline background of subjects, including neuropsychological tests, activities of daily living, and sleep surveys. No bias was observed between the matcha and placebo groups in any of the tests.

[0131] [Table 6]

[0132] Table 7 below shows the results of blood miRNA measurements at baseline. At baseline, bias was confirmed in the measurement value of hsa-miR-370-3p between the matcha intake group and the placebo intake group. No bias was observed in the measurement values ​​of any other miRNA between the matcha intake group and the placebo intake group.

[0133] [Table 7]

[0134] Effects of intervention on neuropsychological tests, activities of daily living, and sleep studies No group-based intervention effects (Baseline - 12 months) were observed in MoCa-J and ADCS-MCI-ADL, shown in Table 8 below.

[0135] [Table 8]

[0136] As shown in Table 9 below, an improvement due to the intervention was observed in the Cognitrax domain score "social cognition" (P = 0.028). Additionally, an improvement of 0.86 in the PSQI score was observed in the matcha intervention group (P = 0.088). Additionally, a trend toward an intervention effect by group was observed in the Cognitrax domain score "reaction time" (P = 0.207) and domain score "simple attention" (P = 0.181). No intervention effect was observed in other items.

[0137] [Table 9]

[0138] Table 10 shows the results of the mixed effects model verification of the intervention effect for the four Cognitrax tests. An intervention effect was observed for the "incorrect response" in the facial expression recognition test (P = 0.035). In addition, a tendency for an intervention effect by group was observed for the "Stroop reaction time" in the Stroop test (P = 0.102) and the "correct response time" in the attention shift test (P = 0.068), but no intervention effect was observed in other items.

[0139] [Table 10]

[0140] Intervention effects on miRNAs As shown in Table 11 below, the expression of miRNAs increased in miR-132-3p, miR-874-3p, miR-451a, and miR-16-5p. No changes were observed for other miRNAs.

[0141] [Table 11]

Claims

1. An agent for enhancing miRNA expression, comprising components of green tea as active ingredients.

2. The miRNA enhancer of claim 1, wherein the miRNA is one or more selected from the group consisting of miR-132-3p, miR-874-3p, miR-16-5p and miR-451a.

3. The active ingredient is one or more selected from the group consisting of theanine, caffeine, catechins, and vitamin K. The miRNA enhancer according to claim 1 or 2.

4. The miRNA enhancer according to claim 1 or 2, wherein the daily dose of matcha is 1.0 to 3.0 g.

5. The daily dose is Theanine is 20 mg to 80 mg, Caffeine is 50 mg to 100 mg, Catechins are 100 mg to 250 mg; The miRNA enhancer according to claim 1 or 2, wherein the amount of vitamin K is 50 μg to 150 μg.

6. A composition comprising the miRNA expression enhancer according to claim 1 or 2.

7. The composition according to claim 6, which is a food or beverage composition or a pharmaceutical composition.

8. The composition of claim 6 for maintaining or improving social cognitive function and sleep quality in a subject.

9. The composition of claim 8, wherein the subject is aged between 60 and 84 years.

10. The composition of claim 8, wherein the subject has subjective cognitive decline or mild cognitive impairment.

11. 9. The composition of claim 8, wherein social cognition function is assessed using the Facial Expression Recognition Test of the Cognitrax test.

12. The composition according to claim 11, wherein the improvement in social cognitive function is a reduction in incorrect responses in a facial expression recognition test.

13. The composition of claim 8, wherein sleep quality is assessed with the Pittsburgh Sleep Quality Index.

14. 9. The composition of claim 8, wherein the active ingredient is administered to the subject daily for 12 months or more.

15. The daily dose of the active ingredient is Theanine is 20 mg to 80 mg, Caffeine is 50 mg to 100 mg, Catechins are 100 mg to 250 mg; Vitamin K is 50 μg to 150 μg. The composition of claim 8.

Images