Adeno-associated virus virion for treatment of ornithine transcarbamylase deficiency

Abstract

To provide a novel therapeutic approach to ornithine transcarbamylase deficiency.SOLUTION: The present application provides a modified adeno-associated virus vector that efficiently transfers genes to a liver in a living body (human, for example) by expressing ornithine transcarbamylase and reducing attack from neutralizing antibodies in blood. The present application provides a modified adeno-associated virus vector or the like, expressing ornithine transcarbamylase, comprising a modified VP1 protein including an amino acid sequence with at least one of position 472, position 587, and position 706 substituted with another amino acid in the amino acid sequence of VP1 protein, and not showing a cross-reaction with a neutralizing antibody to AAV2.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention provides a method for treating urea cycle disorders that is not susceptible to neutralizing antibodies in serum. Recombinant adeno-associated virus (rAAV) vectors More specifically, the present invention relates to a recombinant ornithine transcarbamylase (OTC). It is possible to produce a vaccine that has reduced cross-reactivity with neutralizing antibodies in the serum of living organisms, and is effective against living organisms (e.g., A modified rAAV that enables highly efficient gene transfer to the liver of a human, and a method for producing the same comprising the steps of: It relates to pharmaceutical compositions. [Background technology]

[0002] Ornithine transcarbamylase (OTC) is an enzyme involved in the metabolism of ammonia in the urea cycle. OTC is an enzyme that regulates the metabolism of the liver and its deficiency is caused by loss-of-function mutations in the OTC gene located on the X chromosome. Deficiency is the most common urea cycle disorder. It is an X-linked genetic disorder, but females Various symptoms may appear in both sexes. This causes hyperammonemia. Clinical symptoms include vomiting, decreased ability to suckle, hyperpnea, convulsions, and loss of consciousness. Symptoms include disability, behavioral abnormalities, and developmental disorders. In boys, the condition is more common in newborns and can be fatal. In girls, the condition may be discovered when liver dysfunction occurs. In the acute phase, blood glucose levels are increased and blood glucose levels are increased. Fluid purification therapy is necessary, and if hyperammonia attacks occur repeatedly, living donor liver transplantation is indicated. Even after treatment begins, the effects on the central nervous system are inevitable, and the resulting intellectual disability can lead to social impairment. In many cases, these patients are forced to live an independent life. Given the above circumstances, the development of effective treatment methods is urgently needed. This is an urgent issue (Non-Patent Document 1).

[0003] Adeno-associated virus (AAV)-based gene transfer vectors are used to infect neurons, hepatocytes (liver cells), and Parenchymal cells, retinal cells, muscle cells, cardiac muscle cells, vascular endothelial cells, fat cells, and other cells in the body It is possible to introduce genes into the erythrocyte and express them for a long period of time (Patent Documents 1 to 3). Clinical applications of rheumatoid arthritis, retinitis pigmentosa, Parkinson's disease, etc. are progressing as gene therapy vectors. In addition, the use of sgRNA and CAS9 protein in gene editing has been reported recently. It is frequently used as a vector for introducing genes (Patent Document 3, Non-Patent Document 4). For hepatic idiopathies, a gene therapy is used to introduce AAV vectors expressing factor VIII or factor IX into hepatocytes. Promising results have been reported in gene therapy (Patent Document 4, Non-Patent Documents 5 and 6).

[0004] In the gene therapy for OTC deficiency described above, the human liver is used as the target organ, and the adeno-associated virus type 8 is used to The AAV8 vector has been used (Non-Patent Document 7). The efficiency of gene transfer into the liver of mice is high, but the efficiency of gene transfer into the human liver is low. AAV3B, which is said to have a higher gene transfer efficiency than AAV8, is a virulent vector that is found in more than 80% of adults. Because it cross-reacts with neutralizing antibodies against AV2 (Non-Patent Documents 8-10), it is expected to be effective in many patients. In addition, gene therapy cannot be applied to patients who were ineligible for gene therapy because they have neutralizing antibodies. and to repeat gene therapy for patients who did not achieve sufficient results from the first gene therapy. Progress is being made in such areas as: [Prior art documents] [Chartered documents]

[0005]

Patent Document 1

Patent document 2

Patent document 3

Patent document 4

Non-licensed literature

[0006] [Non-licensed document 1] Nakamura K, et al., Pediatr Int. ;56(4):506-9, 2014

Non-licensed Document 2

Non-licensed Document 4

Non-licensed Document 5

Non-licensed Document 6

Non-licensed Document 7

Non-licensed Document 8

[0007] Therefore, cross-reactivity against neutralizing antibodies in serum against AAV2, etc. is reduced, and hepatocytes AAV vectors with high gene transfer efficiency for the target organism, such as novel AAV vectors derived from AAV3B and AAV8, are being developed. Diseases caused by genomic damage to liver cells by vectors (e.g. ornithine transcarbaminase There is a need to establish a treatment for this condition. [Means for solving the problem]

[0008] In order to solve the above problems, the present inventors have developed ornithine transcarbamylase. A modified AA antibody that exhibits reduced cross-reactivity against neutralizing antibodies in serum (e.g., AAV2 neutralizing antibodies) The present invention was completed by creating the V vector.

[0009] That is, the present invention relates to a method for detecting neutralizing antibodies in serum that express ornithine transcarbamylase. AAV vectors with reduced cross-reactivity to the host and high gene transfer efficiency into hepatocytes - recombinant adeno-associated virus vectors for gene therapy targeted to hepatocytes, The invention, exemplified below, including pharmaceutical compositions containing the same, is provided. [1] In the amino acid sequence of SEQ ID NO: 2 or 3, the 472nd serine and the 587th serine and an amino acid in which at least one of the asparagines at position 706 is replaced with another amino acid. amino acid sequence, or the substituted amino acid sequence, Amino acid sequence with 1 to 6 deletions, substitutions, insertions, and / or additions in addition to the first residue A capsid protein comprising The amino acid sequence of SEQ ID NO: 11, or 90% or more of the amino acid sequence of SEQ ID NO: 11 and having ornithine transcarbamylase activity. Polynucleotides encoding proteins An adeno-associated virus vector comprising a nucleotide sequence that interacts with at least a neutralizing antibody against AAV type 2. A non-differentiated, adeno-associated viral vector. [2] The serine at position 472, the serine at position 587, and the asparagine at position 706 are They consist of glycine, alanine, valine, leucine, threonine and isoleucine. The capsid protein has an amino acid sequence substituted with an amino acid selected from the group consisting of The adeno-associated virus vector according to [1] above. [3] Among the serine at position 472, the serine at position 587, and the asparagine at position 706, At least one capsid protein has an amino acid sequence substituted with alanine. The adeno-associated virus vector according to [1] above. [4] The capsid protein is a protein having the amino acid sequence set forth in SEQ ID NO:4. The adeno-associated virus vector according to [1] above, which comprises a protein. [5] The neutralizing antibody is an adeno-associated virus of a type different from AAV3 (e.g., AAV3B) or AAV8. The adeno-associated virus vector described in [1] above, which is an antibody against virulence. [6] The adeno-associated virus according to [1] above, wherein the neutralizing antibody is an antibody against AAV2. Russ Vector. [7] The above-mentioned [1], which has a viral genome including a liver cell-specific promoter sequence. The adeno-associated viral vector described herein. [8] The liver cell-specific promoter sequence is an ApoE promoter, an antitrypsin promoter, promoter, cKit promoter, and liver-specific transcription factors (HNF-1, HNF-2, HNF-3, HNF-6 , C / ERP, DBP) promoters, albumin promoter, thyroxine-binding globulin (TBG) promoter, and HCRhAAT promoter or a polynucleotide sequence having 90% or more homology to these promoters. The adeno-associated virus vector according to the above-mentioned [1], which contains a promoter that functions specifically in the liver. Kutor. [9] In the amino acid sequence of SEQ ID NO: 2 or 3, serine at position 472 and serine at position 587 are At least one of the serine at position 1 and the asparagine at position 706 is replaced with another amino acid. or the substituted amino acid sequence, Amino acid sequence with deletion, substitution, insertion and / or addition of 1 to 6 residues in addition to residue 706 a capsid protein comprising a nucleic acid sequence; The amino acid sequence of SEQ ID NO: 11, or 90% or more of the amino acid sequence of SEQ ID NO: 11 and having ornithine transcarbamylase activity. Polynucleotides encoding proteins An adeno-associated virus vector comprising:

[10] In the amino acid sequence of SEQ ID NO: 2 or 3, serine at position 472 and serine at position 587 are At least one of the serine at position 1 and the asparagine at position 706 is replaced with another amino acid. The amino acid sequence is a sequence in which 1 to 6 amino acid residues are deleted or substituted at other residue positions. , an inserted or added amino acid sequence, The serine at position 472, the serine at position 587, and the asparagine at position 706 are each From the group consisting of glycine, alanine, valine, leucine, threonine and isoleucine an amino acid sequence substituted with selected amino acids; at least one of the serine at position 472, the serine at position 587 and the asparagine at position 706 an amino acid sequence in which one amino acid has been substituted by alanine, or Amino acid sequence set forth in SEQ ID NO:4 A polynucleotide encoding any one of the sequences.

[11] A method comprising the step of: A pharmaceutical composition for transferring genes into the liver of a living organism.

[12] The pharmaceutical composition described in

[11] above, wherein the living body is a human.

[13] For the treatment of ornithine transcarbamylase deficiency, see above

[11] or

[12] The pharmaceutical composition described in. Effect of the Invention

[0010] The present invention relates to a method for expressing recombinant ornithine transcarbamylase (OTC) and targeting AAV2 or the like. AA has reduced cross-reactivity to neutralizing antibodies and has high gene transfer efficiency into hepatocytes. Further, the present invention provides an AAV vector derived from an AAV3B or AAV8 vector. By using AAV vectors, it is possible to target viruses that are not eligible for gene therapy because they have neutralizing antibodies. Gene therapy for patients who have already had a genetic disorder, or for patients who have not had a satisfactory response to the first gene therapy By using the AAV vector of the present invention, it is possible to carry out gene therapy. It can improve ornithine transcarbamylase gene transfer into hepatocytes. , and is particularly useful in the treatment of ornithine transcarbamylase deficiency. [Brief description of the drawings]

[0011] [Figure 1A] FIG. 1A shows an alignment of the VP1 protein amino acids of AAV3A, AAV3B and AAV.GT5. [Figure 1B] FIG. 1B shows a continuation of FIG. 1A. [Figure 1C] Figure 1C shows an alignment of the Rep protein amino acid sequences of AAV3A, AAV3B and AAV.GT5 (shown as ARep, BRep and baRep, respectively). [Figure 1D] FIG. 1D shows a continuation of FIG. 1C. [Figure 2A] FIG. 2A shows the amount of GFP expression in human liver-derived HepG2 cells by AAV.GT5. [Figure 2B] FIG. 2B shows the state of the GFP-expressing cells transfected with the gene shown in FIG. 2A. [Figure 2C] Figure 2C shows the amount of luciferase expression in human liver-derived HepG2 cells by AAV.GT5. [Figure 3A] Figure 3A shows the amount of GFP expression in human liver-derived PXB cells of AAV.GT5. [Figure 3B] FIG. 3B shows the state of the GFP-expressing cells transfected with the gene shown in FIG. 3A. [Figure 4A] FIG. 4A shows the results of comparing the amount of luciferase expression in HEK293 cells by each AAV vector after reaction with serum (serum #01) containing a neutralizing antibody against AAV. [Figure 4B]FIG. 4B shows the results of comparing the amount of luciferase expression in HEK293 cells by each AAV vector after reaction with serum (serum #02) containing a neutralizing antibody against AAV. [Figure 4C] FIG. 4C shows the results of comparing the amount of luciferase expression in HEK293 cells by each AAV vector after reaction with serum (serum #03) containing a neutralizing antibody against AAV. [Figure 4D] FIG. 4D shows the results of comparing the amount of luciferase expression in HEK293 cells by each AAV vector after reaction with serum containing a neutralizing antibody against AAV (serum #04). [Figure 4E] FIG. 4E shows the results of comparing the amount of luciferase expression in HEK293 cells by each AAV vector after reaction with serum (serum #05) containing a neutralizing antibody against AAV. [Figure 4F] FIG. 4F shows the results of comparing the amount of luciferase expression in HEK293 cells by each AAV vector after reaction with serum (serum #06) containing a neutralizing antibody against AAV. [Figure 4G] FIG. 4G shows the results of comparing the amount of luciferase expression in HEK293 cells by each AAV vector after reaction with serum (serum #07) containing a neutralizing antibody against AAV. [Figure 4H] FIG. 4H shows the results of comparing the amount of luciferase expression in HEK293 cells by each AAV vector after reaction with serum (serum #08) containing a neutralizing antibody against AAV. [Figure 4I] FIG. 4I shows the results of comparing the amount of luciferase expression in HEK293 cells by each AAV vector after reaction with serum (serum #09) containing a neutralizing antibody against AAV. [Figure 4J] Figure 4J shows the results of comparing the amount of luciferase expression in HEK293 cells by each AAV vector after reaction with serum containing a neutralizing antibody against AAV (serum #10). [Figure 5A]FIG. 5A shows the structure of the recombinant viral genome AAV.GT5-HCRhAAT promoter-human OTC-WPRE. [Figure 5B] (Continuation of Figure 5A) [Figure 6] FIG. 6 shows the expression level of recombinant OTC mRNA in mouse PBX cells. [Figure 7] FIG. 7 shows the protein expression level of recombinant OTC in mouse PBX cells. [Figure 8] FIG. 8 shows the protein activity of recombinant OTC in mouse PBX cells. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0012] The present invention relates to a method for expressing recombinant ornithine transcarbamylase (OTC) and transfecting it into liver cells. A recombinant adeno-associated virus vector that improves the efficiency of gene transfer in a mouse model, The present invention provides pharmaceutical compositions containing the same.

[0013] 1. Recombinant adeno-associated virus vector according to the present invention 1.1. About adeno-associated viruses Adeno-associated viruses include many of the known blood group viruses. Hepatocytes (liver parenchymal cells) Examples of adeno-associated viruses that show tropism against adenoviruses include types 2 and 3 (3A and 3B In the present invention, the following viruses are used to deliver the antibodies to hepatocytes in vivo: Examples of vectors for this purpose include various adenovirus vectors described in Patent Document 1 (WO 2008 / 124724). A no-associated virus vector can be used.

[0014] Naturally occurring adeno-associated viruses are non-pathogenic. This characteristic can be exploited to express desired genes. Various recombinant virus vectors carrying genes have been constructed and are used for gene therapy. (For example, WO2003 / 018821, WO2003 / 053476, WO2007 / 001010, Pharmaceutical Journal 126(11)1021 The wild-type AAV genome has a total nucleotide length of approximately 5 kb. It is a single-stranded DNA molecule, either the sense or antisense strand. The AAV genome is generally The genome contains approximately 145 nucleotide-long inverted terminal ends at both the 5' and 3' ends. The ITRs function as the replication origin of the AAV genome and regulate the replication of this genome. It has multiple functions, including as a packaging signal for the virion of the . It is known that (for example, see the above-mentioned reference, Yakugaku Zasshi 126(11)1021-1028, etc. The internal region of the wild-type AAV genome, flanked by the ITRs (hereafter referred to as the internal region), is involved in AAV replication (rep) The rep gene and the capsid gene are The proteins involved in viral replication (Rep) and the viral envelope (the icosahedral shell) are Capsid proteins that form the serotype particles (e.g., at least one of VP1, VP2, and VP3) For further details, see, for example, Human Gene Therapy, 13, pp. 345-354. , 2002, Neuronal Development 45, pp.92-103, 2001, Experimental Medicine 20, pp.1296-1300, 2002 , Pharmaceutical Journal 126(11)1021-1028; Hum Gene Ther, 16, 541-550, 2005, etc.

[0015] The rAAV vectors of the present invention are derived from naturally occurring adeno-associated viruses type 1 (AAV1), type 2 (AAV2), and type 3 (AAV4). Type (AAV3A / AAV3B), Type 4 (AAV4), Type 5 (AAV5), Type 6 (AAV6), Type 7 (AAV7), Type 8 (AAV8), type 9 (AAV9), type 10 (AAV10), and type RH10 (AAVrh10; Hu, C. et al., Molecular The vector is derived from the HIV-1 virus vector (J. Immunol. 2014, vol. 22 no. 10 oct. 2014, 1792-1802). The nucleotide sequences of these adeno-associated virus genomes are known and are not limited thereto. GenBank accession numbers are AF063497.1 (AAV1), AF043303 (AAV2), NC_001729 (AAV3), NC_001829.1(AAV4), NC_006152.1(AAV5), AF028704.1(AAV6), NC_006260.1(AAV7) ), NC_006261.1 (AAV8), AY530579 (AAV9), and AY631965.1 (AAV10) nucleotide sequences can be referred to. In the present invention, AAV2, AAV3B (AF028705.1), AAV8, etc. are used for targeting hepatocytes. or AAV9-derived capsid proteins (VP1, VP2, VP3, etc.) can be used. The amino acid sequences of each of these capsid proteins are known, e.g., The sequences can be found at the above GenBank accession numbers corresponding to the above sequences.

[0016] 1.2. Capsid Protein of the Present Invention The rAAV vector used in the present invention contains a mutated (modified) capsid protein. Such mutant capsid proteins include those having the amino acid sequence set forth in SEQ ID NO: 2 or 3. In the sequence, among serine at position 472, serine at position 587, and asparagine at position 706, At least one, for example one, preferably two, more preferably all three, of the amino acids a capsid protein having a mutant amino acid sequence substituted with Multiple amino acids at residue positions other than 472, 587, and 706 relative to the sequence Capsid proteins that contain amino acid sequences with deleted, substituted, inserted and / or added residues. These deletions, substitutions, insertions and / or may simultaneously include a combination of two or more of the additions. In addition, the rAAV vector used in the present invention has the amino acid sequence shown in SEQ ID NO: 2 or 3. In the present invention, the serine at position 472 is at least one of the serine at position 587 and the asparagine at position 706. At least one, for example one, preferably two, more preferably all three are glycine, arylene an amino acid selected from the group consisting of leucine, valine, leucine, threonine and isoleucine; A sequence of amino acids substituted with acid, preferably with alanine (e.g., SEQ ID NO: 4) a capsid protein having an amino acid sequence of Multiple amino acid residue deletions at residue positions other than 472, 587, and 706; This includes capsid proteins that contain substitutions, insertions and / or additional amino acid sequences. A combination of two or more of these deletions, substitutions, insertions and additions may be included simultaneously. The number of deletions, substitutions, insertions and / or additions of amino acid residues may be, for example, 1 ~74 pieces, 1~70 pieces, 1~60 pieces, 1~50 pieces, 1~40 pieces, 1~35 pieces, 1~30 pieces, 1~25 pieces, 1~20 pieces, 1~15 pieces, 1~14 pieces, 1~13 pieces, 1~12 pieces, 1~11 pieces, 1~10 pieces, 1~9 pieces (1~several pieces), 1~8 pieces , 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 1 to 2 or 1. Generally, the smaller the number of deletions, substitutions, insertions and / or additions of amino acid residues, the more preferable. . The mutant capsid protein of the rAAV vector used in the present invention preferably has the sequence Approximately 90% or more, 91% or more of any of the amino acid sequences (735 to 738 residues) of Nos. 2 to 4; 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, 99.1% or more, 99.2% or more, 99.3% or more, 99.4% or more, 99.5% or more, 99.6% or more, 99.7% or more and having an amino acid sequence with an identity of 99.8% or more, 99.9% or more, and a capsid protein. The protein may be a protein that can function as a protein. In the present invention, the term "functioning as a capsid protein" refers to a protein that enhances the infectivity of a target cell. The capsid used in the present invention refers to a protein capable of forming a viral vector having the capsid. The protein may be used alone or in combination with other capsid protein members (e.g., VP2, VP3, etc.). The viral vector can be combined with the target cell. For example, a polynucleotide containing a therapeutic gene of interest for delivery to liver cells is Will be packaged. Preferably, the viral vector comprising the mutant capsid protein is a wild-type capsid. It has the same or higher infectiousness as a viral vector containing a viral protein, specifically is preferably 50%, 60%, or 70% higher than the infectivity per genome weight of the wild-type virus. , 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher The infectivity can be measured by a method known in the art, for example, β-galactosidase. Reporters using reporters such as tosidase, GFP protein, and luciferase An assay can be used.

[0017] Examples of amino acid residues which can be substituted for each other in the protein (polypeptide) of the present invention are as follows: As shown below, amino acid residues in the same group can be substituted for each other. Group A: leucine, isoleucine, norleucine, valine, norvaline, alanine, 2-aminoleucine Minobutanic acid, methionine, o-methylserine, t-butylglycine, t-butylalanine, cyclohexylalanine; Group B: Aspartic acid, glutamic acid, isoaspartic acid, isoglutamic acid, 2-amino Aminoadipic acid, 2-aminosuberic acid; Group C: asparagine, glutamine; D group: lysine, arginine, ornithine, 2,4-diaminobutanoic acid, 2,3-diaminopropionate onic acid; Group E: proline, 3-hydroxyproline, 4-hydroxyproline; Group F: serine, threonine, homoserine; Group G: phenylalanine, tyrosine. Proteins containing the desired amino acid residue substitutions can be prepared by conventional genetic engineering techniques, chemical synthesis, or other methods. Such genetic manipulation procedures can be carried out according to techniques known to those skilled in the art. See, e.g., Molecular Cloning 4th Edition, J. Sambrook et al., Cold Spring Harbor Lab. Press. 2012, Current Protocols in Molecular Biology, John Wiley & Sons 1987 -2018 (ISSN:1934-3647, etc.) can be referred to.

[0018] The rAAV viral vector used in the present invention contains The genome of the virus may contain a gene encoding the Rep protein for replication. The Rep protein recognizes the ITR sequence and the sequence thereof in order to replicate the rAAV of the present invention. The ability to replicate genomes in a sequence-dependent manner, and the ability to incorporate wild-type AAV genomes (or rAAV The function of packaging the rAAV genome and the function of forming the rAAV vector of the present invention are compared with the wild type. As long as it has the same degree, preferably about 90% or more, 91% or more, 92% or more, 93% or more, or 94% or more , 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, 99.1% or more, 99.2% or more, 99.3 % or more, 99.4% or more, 99.5% or more, 99.6% or more, 99.7% or more, 99.8% or more, 99.9% or more Alternatively, the amino acid sequence may be 60 or less residues, 50 or less residues, 40 or less residues, 30 or less, 20 or less, 15 or less, 10 or less, or 5 or less amino acid residues missing The gene may contain deletions, substitutions, insertions and / or additions, where the gene is as similar to the wild type. The specific activity of the wild type is 50%, 60%, 70%, 80%, 90% or more. In the present invention, a known AAV3-derived Rep protein, for example, AAV3-derived Rep protein, is preferably used. Rep protein of AV3A, AAV3B, or a fusion protein thereof (amino acid sequence of SEQ ID NO: 8) Arrays) and the like are used, but are not limited to these.

[0019] In one embodiment of the present invention, the wild-type AAV genome is a nucleic acid sequence encoding a capsid. The VP1, VP2 and / or VP3 proteins and the Rep proteins are The polynucleotides encoding these proteins are incorporated into an AAV helper plasmid, Used to obtain the rAAV of the present invention. The capsid proteins (VP1, VP2 and / or VP3), and the Rep proteins may be one, two, three or more, as appropriate. These capsid proteins may be integrated into one or more plasmids. One or more of the proteins, Rep proteins, and Rep proteins may be included in the AAV genome. Preferably, the capsid proteins (VP1, VP2 and / or VP3) and the Rep protein All proteins are encoded by a single polynucleotide and provided as an AAV helper plasmid. It will be offered.

[0020] 1.3. Viral genome (1) About the rAAV viral genome The polynucleotides (i.e., polynucleotides) packaged in the rAAV vectors of the invention The nucleotide sequence is an internal region located between the 5' and 3' ITRs of the wild-type genome. (i.e., one or both of the rep and cap genes) Polynucleotides encoding proteins (genome editing tools and / or repair genes) and a gene cassette containing a promoter sequence for transcribing the polynucleotide. Preferably, the ITRs located on the 5' and 3' sides are replaced with are located at the 5' and 3' ends of the AAV genome, respectively. In the genome, the ITRs located at the 5' and 3' ends are AAV1, AAV2, AAV3, AAV6, AAV 8 or AAV9 genome, but not limited to these specific AAVs. Generally, the ITR region is easily transformed into a sequence in which the complementary sequence is replaced (flip and flop sequence). In order to achieve this structure, the ITRs in the rAAV genome of the present invention have the 5' and 3' orientations reversed. Polynucleotides to be replaced with internal regions in the rAAV genome of the present invention (i.e., the genome editing means and / or repair gene) is In other words, the full length of the rAAV genome of the present invention is preferably the same as that of the wild-type. The length is preferably about the same as 5 kb, for example, about 2 to 6 kb, and more preferably about 4 to 6 kb. The length of the therapeutic gene to be incorporated into the rAAV genome of the present invention is determined by the promoter, polyadenylation sequence, and Subtract the length of the transcriptional regulatory region, including the length of the transcriptional regulatory region (for example, assuming a length of about 1 to 1.5 kb). Preferably, the length is about 0.01 to 3.7 kb, more preferably about 0.01 to 2.5 kb, and even more preferably about 0.01 to 2.5 kb. The length is preferably about 0.01 to 2 kb, but is not limited thereto. The rAAV genome is then modified using known techniques such as inserting an IRES sequence, T2A sequence, etc. As long as the total length of the vector is within the above range, two or more therapeutic genes can be integrated at the same time. When the rAAV of the present invention expresses two or more proteins, each protein can be expressed by a covalent linker. The genes to be loaded may be arranged in the same orientation or in different orientations.

[0021] Generally, the polynucleotide is packaged in a recombinant adeno-associated viral vector. When the peptide is single-stranded, the gene of interest (e.g., a therapeutic gene) takes a long time to be expressed ( In this case, the gene of interest to be introduced is self-complementary. ry:sc) type, the time to expression can be shortened. For example, see Foust KD et al. (Nat Biotechnol. 2009 Jan;27(1):59-65). The polynucleotides packaged in the rAAV vectors of the present invention may be of the non-sc type. Preferably, the rAAV vector of the present invention is packaged in The polynucleotide is of the non-sc type.

[0022] The capsid protein used in the present invention may be, for example, a polypeptide based on codon preference in a host cell. The preferred polynucleotides used in the present invention can be encoded by appropriately modified polynucleotides based on the above. The polynucleotide encoding the novel capsid protein is, for example, any of SEQ ID NOs: 2 to 4. In a polynucleotide sequence encoding an amino acid sequence, one or more (e.g., 1 to 50 , 1~40 pieces, 1~30 pieces, 1~25 pieces, 1~20 pieces, 1~15 pieces, 1~10 pieces, 1~9 pieces (1~several pieces), 1~8 nucleotides (1–7, 1–6, 1–5, 1–4, 1–3, 1–2, 1, etc.) A polynucleotide having a deletion, substitution, insertion and / or addition, which is selected from SEQ ID NOs: 2 to 4. or a protein comprising the amino acid sequence of SEQ ID NO: 2 to 4 as described above. The amino acid sequence includes an amino acid sequence in which one or more amino acids are deleted, substituted, inserted and / or added. Capsid proteins that function as capsid proteins (capsomerization is possible) are encoded by Any two of these deletions, substitutions, insertions and / or additions may be included. The above nucleotide deletions, substitutions, insertions and / or deletions may be included in the above combinations. Generally, the smaller the number of additions, the more preferable. The nucleotide sequence may be, for example, a polynucleotide encoding the amino acid sequence of SEQ ID NO: 2 to 4, or capable of hybridizing to its complementary sequence under stringent hybridization conditions A polynucleotide having an amino acid sequence of any one of SEQ ID NOs: 2 to 4, or In the amino acid sequences of SEQ ID NOs: 2 to 4, one or more of the above amino acids are deleted, substituted, or inserted. and / or a polynucleotide encoding a capsid protein containing an additional amino acid sequence. Contains leotide.

[0023] Hybridization can be carried out by known methods or methods based thereon, for example, molecular LA cloning (Molecular Cloning 4th Edition, J. Sambrook et al., Cold Spring The method can be carried out according to the method described in (E. G. Harbor Lab. Press. 2012). When using the library, the method described in the instruction manual provided by the manufacturer In this case, "stringent conditions" refers to low stringency conditions. The conditions may be any of low stringency, moderate stringency and high stringency. "Low stringency conditions" include, for example, 5x SSC, 5x Denhardt's solution, 0.5% SDS, 50 % formamide, 32°C. In addition, "moderate stringent conditions" are, for example, The conditions were 5x SSC, 5x Denhardt's solution, 0.5% SDS, 50% formamide, and 42°C. The "stringent conditions" are, for example, 5x SSC, 5x Denhardt's solution, 0.5% SDS, 50% hormonal The conditions are: 1) 100°C, 200°F, 50°C. Under these conditions, the higher the temperature, the higher the homology. However, the hybridization sequence is slow, and the DNA that is expected to be obtained efficiently is expected to be stable. Factors that affect reactivity include temperature, probe concentration, probe length, and ionic strength. A number of factors, such as temperature, time, and salt concentration, are considered, and a person skilled in the art can appropriately select these factors. It is possible to achieve similar stringency by

[0024] Hybridizable polynucleotides include those that can be searched for using homology search software such as FASTA and BLAST. The control polynucleotide was calculated using the default parameters by the software. For example, 70% or more, 80% or more, 90% or more, 91% or more, 92% or more, 93% or more, compared to the octide sequence. % or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, 99.1% or more, 99.2% or more, 99.3% or more, 99.4% or more, 99.5% or more, 99.6% or more, 99.7% or more, 99.8% or more The above-mentioned homology may be a polynucleotide having 99.9% or more identity. Generally, the larger the value, the better.

[0025] The identity or homology of amino acid sequence or polynucleotide sequence is based on that of curlin and The BLAST algorithm by Arthur (Proc. Natl. Acad. Sci. USA 872264-2268, 1990 ; Proc. Natl. Acad. Sci USA 90: 5873, 1993). Programs called BLASTN and BLASTX based on the algorithm have been developed (Altschul SF, e (J Mol Biol 215: 403, 1990). When analyzing base sequences using BLASTN, the parameters are For example, the Expect threshold is set to 100 and the Word size is set to 12. When analyzing amino acid sequences, the parameters are, for example, Expect threshold=50, Word s ize=3. When using BLAST and Gapped BLAST programs, it is preferable to use The default parameters of the program are used, but these parameters are within the range known to those skilled in the art. This may be changed as appropriate.

[0026] 2. Cross-reactivity of neutralizing antibodies The adeno-associated virus vector of the present invention is a vector that is capable of inhibiting type 2 AAV (AAV) that is present at least in serum. AV2), optionally further comprising AAV type 1 (AAV1) and / or AAV type 8 (AAV8) or other It does not cross-react with neutralizing antibodies against wild-type AAV. In the present invention, a neutralizing antibody is an antibody that prevents an antigen from having toxicity, infectivity, or other activity against a living body. In the present invention, the term "antibody" refers to an antibody that binds to an antigen and reduces or eliminates its activity. "Neutralizing" in the context of antibody activity refers to the neutralization of anti-adenoassociated virus (ADA) antibodies in serum, e.g. When antibodies (e.g., IgG, IgM, IgA) bind to the AAV vector, which is an antigen, the AAV This neutralization reaction reduces or eliminates the gene transfer ability of the vector. For example, binding between an AAV vector and an antibody, or binding between the Fc portion of an antibody and the first component of complement (C1), etc. As a result, the AAV vector is able to infect target cells (transduce genes). In the present invention, the neutralizing antibody is accompanied by a serum component. That is, they bind to complements and other antibodies and are directly involved in neutralization reactions such as inactivating or removing antigens. Such ingredients are also intended to be included.

[0027] In the present invention, the cross-reaction of a neutralizing antibody refers to a cross-reaction of a neutralizing antibody with an original target antigen (e.g., AA V2) to a target substance (e.g., AAV3). "Does not cross-react with neutralizing antibodies" means that neutralizing antibodies bind to target substances that are not the original target antigens. In the binding reaction, it is preferable that the binding does not function sufficiently, and preferably does not bind detectably. or, even if detectable, the amount of binding of the target substance (mono) compared to the original target antigen This refers to a significant reduction in the amount of target substance (mol ratio or mass ratio). As for the amount of binding, it is several percent (about 5%), about 10%, about 15%, about 20% compared to the amount of binding of the original target antigen. %, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, and about 60% binding amount. This ratio can be obtained using a known method such as a method for measuring the amount of protein bound to the antibody. Alternatively, the cross-reactivity of neutralizing antibodies may be due to the binding of the protein encoded within the recombinant virus. Comparison can also be made by indirect measurement using a reporter gene or the like.

[0028] The neutralizing antibodies of the present invention are preferably of mammalian origin, more preferably of primate origin. The neutralizing antibodies used in the present invention are of particular interest, and are most preferably of human origin. If the antibody is not present, it is a neutralizing antibody against AAV2. Normally, humans do not possess antibodies against AAV2. It is highly likely that most of these antibodies are not neutralizing antibodies, but The incidence rate has been reported to be 18-32% (Chirmule N. et al., Gene Ther 6: 1574-1583, 1999; Moskalenko M, et al., J Virol 74: 1761-1766, 2000). It is known that most human serum, including the human body, contains neutralizing antibodies against AAV3A and AAV3B (Fu H et al., Hum Gene Ther Clin Dev 2017;28:187-196, Ling CJ et al. Integr Med 2015;13:341- 346) This indicates that the VP1 protein of AAV2 (SEQ ID NO:1) and the VP1 protein of AAV3A or AAV3B The amino acid identity with the protein (SEQ ID NO: 2 or 3) is relatively high (specifically, about 87 to 88 %). Furthermore, the neutralizing antibodies used in the present invention may be of multiple isotypes (e.g., IgG, IgM, IgA, etc.). Therefore, the neutralizing antibody against AAV2 according to the present invention can be prepared by preliminarily determining the antibody concentration. It is necessary to verify the performance of the antibody or antibody titer. Such verification methods are publicly known. For example, see Ito et al., Ann Clin Biochem 46: 508-510, 2009. Specifically, the titer of neutralizing antibodies (antibody titer) can be determined by using HEK293 cells. AAV2 vectors containing reporter genes such as β-galactosidase and luciferase for cells This can be analyzed by assessing the inhibitory potential of introducing a β-actin into the target protein (Ito et al., supra).

[0029] The neutralizing antibody used in the present invention has an antibody titer of 1:4 to 1:640, preferably 1:16 to 1:254, more preferably 1:16 to 1:254. More preferably, the antibody titer is 1:32 to 1:128. , "(e) Verification of cross-reactivity with neutralizing antibodies in serum" and "(3) Antibody titer of neutralizing antibodies" in the Examples Please refer to the descriptions in "Measurement of In addition, the specific procedure for the assay method to confirm the cross-reactivity of neutralizing antibodies is as follows: C, et al., Gene Ther 19: 288-294, 2012, Meliani A, et al., Hum Gene Ther Methos 26:45-53, 2015, or the like can be used.

[0030] The adeno-associated virus vector of the present invention has a higher neutralizing antibody level in serum than the wild-type vector. Specifically, the viral vector of the present invention (e.g., The capsid protein having the amino acid sequence of sequence number 4) is a neutralizing antibody in serum. After treatment by the body, the ability to transfer genes to target cells is increased by at least 60%, preferably by 70%. 0% or more, more preferably 75% or more, even more preferably 80% or more, 85% or more, 90% or more, 95% or more Here, the gene transfer ability can be compared using, for example, a reporter assay. , in situ hybridization, radioisotope labeling, and other known assays. On the other hand, a wild-type viral vector (e.g., SEQ ID NO: 2 or The capsid protein having the amino acid sequence of 3) also showed high neutralizing antibody titers in serum. After processing by the body, the ability to transfer genes into target cells is reduced by about 60%, about 50%, about 40%, or less. Less than 0%, less than about 35%, less than about 30% may be retained. Alternatively, the viral vector of the present invention has a lower serum concentration than a wild-type viral vector. After treatment with a neutralizing antibody in the target cell, the antibody has a 1.2-fold or more, preferably a 1.5-fold or more More preferably, the amount of gene to be introduced is 1.75 times or more, and even more preferably, 2 times or more. That is why.

[0031] In the present invention, for example, a neutralizing antibody against AAV2 can also cross-react with AAV3, etc. It is known that it may have neutralizing activity (Fu H et al., Hum Gene Ther Clin Dev 2017; 28:187- 196, Ling CJ et al. Integr Med 2015;13:341-346, Mimuro J, et al., J Med Virol 86: 199 0-1997, 2014.) Here, the amino acid sequence between the capsid protein VP1 of AAV2 and the capsid protein VP1 of AAV3A is The sequence identity between the two VP1 genes is calculated to be 87%, and between AAV2 VP1 and AAV3B VP1, 88% (these sequences are The study used the Blastp website (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) Furthermore, a study on epitope mapping of anti-AAV2 neutralizing antibodies was conducted by Moskalen et al. Ko, M. et al. (J Virol 74: 1761-1766, 2000). In addition, the following are known as extracellular receptors involved in AAV infection of cells: (Summerfold et al., Mol Ther 24: 2016;Pillay et al., Nature 530:108-112, 201 6). Primary Receptor AAV2, 3, 6: Heparan sulfate proteoglycan AAV9: N-terminal galactose AAV1, 4, 5, 6: Specific N-linked or O-linked sialic acid moieties Secondary Receptors AAV2: fibroblast growth factor receptors and integrins AAV2, 3: Hepatocyte growth factor receptor (c-Met) AAV5: Platelet-derived growth factor, which can be modified by sialic acid Based on the disclosure of this application and the above-mentioned knowledge regarding the receptor, the recombinant virus according to the present invention Based on the vector, it is less susceptible to inhibition by the body's neutralizing antibodies against AAV2, etc. It is also possible to design, screen and obtain recombinant vectors.

[0032] 3. Genes contained in the viral vector of the present invention In one embodiment, the rAAV vector of the invention preferably contains a liver-specific promoter. and a polynucleotide comprising a gene of interest operably linked to its promoter. The present invention relates to a method for producing a nucleic acid comprising the steps of: The promoter to be used is a promoter specific to cells in the liver, for example, a promoter specific to liver parenchymal cells. Promoters specific to hepatocytes, non-parenchymal liver cells (stellate cells, etc.) can be used. Specific examples of such promoter sequences include the ApoE promoter and antitrypsin promoter, cKit promoter, liver-specific transcription factors (HNF-1, HNF-2, HNF-3, HNF-6, C / ERP, DBP, etc.) promoters, thyroxine-binding globulin (TBG) promoter (Ran FA, et al., Nature 520(7546):186-91, 2015), and other liver-specific proteins (Al Promoters such as bumin, synthetic promoters that combine these promoters, etc. These promoters include, but are not limited to, those described in the art. It can be combined with an enhancer, preferably a liver-specific enhancer. Such enhancers include the ApoE enhancer. The enhancers can be used alone or in any combination of two or more. In addition, a synthetic promoter using the above liver-specific promoter and enhancer is also provided. The rAAV vectors of the present invention are preferably liver-specific, more preferably or hepatocyte (liver parenchymal cell) specific ApoE promoter, antitrypsin promoter, The TBG promoter or the HCRhAAT promoter, a known synthetic promoter (e.g., The nucleic acid sequence may include a nucleic acid sequence having nucleotides 397 to 1046 of sequence number 12.

[0033] In addition, the liver-specific promoter (or enhancer) used in the present invention is In the polynucleotide sequence of the promoter, one or more (e.g., 1 to 100, 1 to 5 0 pieces, 1~40 pieces, 1~30 pieces, 1~25 pieces, 1~20 pieces, 1~15 pieces, 1~10 pieces, 1~9 pieces (1~several pieces), 1 ~8, 1~7, 1~6, 1~5, 1~4, 1~3, 1~2, 1, etc.) of nucleotides A polynucleotide comprising a sequence having deletions, substitutions, insertions and / or additions, A promoter capable of functioning as an organ-specific promoter may also be used. The fact that it can function as a specific promoter is that, for example, cells derived from the liver and When compared in reporter assays with cells derived from the liver, the non-liver derived cells showed no detectable expressing the reporter at about the threshold level of expression, or about 25% or less compared to liver-derived cells; Expressing less than about 20%, less than about 15%, less than about 10% or less of the reporter is referred to as In addition, the polynucleotide having the above deletion, substitution, insertion and / or addition may be The specific activity against the promoter sequence of the The fewer the number of the above mutations, the more preferable.

[0034] The AAV vector of the present invention can be used to treat diseases associated with genomic damage in liver cells. ornithine transcarbamylase deficiency, hemophilia, acute intermittent porphyria, These include Lson disease, phenylketonuria, and familial hypercholesterolemia. In order to carry out the above-mentioned treatment, the recombinant viral vector used in the present invention can be used to The therapeutic gene may include a gene (polynucleotide) that encodes a protein. Examples of such enzymes include ornithine transcarbamylase (OTC), carbamoyl phosphate synthase, and Intase I (CPS1), blood coagulation factor VIII (FVIII), blood coagulation factor IX (FIX), hepatocyte growth factor These include, but are not limited to, proteins such as hepatocyte growth factor (HGF) and hepatocyte growth factor receptor (c-Kit). Not determined.

[0035] Ornithine transcarbamylase deficiency is a genetic disorder caused by ornithine transcarbamylase This is a disorder that affects children and is caused by a malfunction of the urea cycle in the liver. In the liver, urea is produced from ammonia, which is toxic to the body, and this pathway is called the urea cycle. An example of an enzyme involved in the urea cycle is ornithine transcarbaminase. OTC, carbamoyl phosphate synthase I (CPS1), argininosuccinate synthase (ASS), argininosuccinate lyase (ASL), arginase I (ARG1), N-acetylglutamate These include ornithine / citrulline antiporter (ORNT1), and natriuretic acid synthase (NAGS). Genetic abnormalities in these enzymes result in urea cycle disorders. Of the protein abnormalities, OTC deficiency is the most common. The mature OTC expresses a protein of approximately 36 kda (in humans) encoded on the X chromosome (sequence number OTC is composed of a trimer of the amino acid sequence shown in Figure 11. Ornithine is converted to citrulline in the circulating bloodstream (Figure 3). [ka] (From Iwanami Shoten "Iwanami Biology Dictionary, 4th Edition")

[0036] The OTC used in the present invention is an enzyme that converts ornithine to citrulline. Examples are not particularly limited, and preferably those derived from mammals, more preferably those derived from humans. For example, the OTC used in the present invention may be a protein having the amino acid sequence of SEQ ID NO: 11. In addition, the ornithine transcarbamylase activity was significantly higher than that of the wild type. In comparison, it is preferable to use 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more. Alternatively, a mutant that retains 99% or more of the specific activity can be used. For example, the amino acid sequence of SEQ ID NO: 11 is 60% or more, 70% or more, 80% or more, 90% or more. or more, an amino acid sequence having an identity of 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more Examples of such structures include, but are not limited to, those having rows.

[0037] The OTC measurement method includes, for example, a method based on enzyme activity (Pierson et al. (1977) J. Biol. Chem. 252, 6464-6469), and immunoassay (WO 2006 / 073073). In the above, any method known in the art for measuring OTC can be used.

[0038] The therapeutic gene used in the present invention is, for example, a gene for inhibiting the function of a target ( The nucleic acid sequence may be, but is not limited to, an antisense nucleotide, CAS9, etc. As used herein, antisense nucleotides are intended to refer to nucleic acids that alter the function of a targeted endogenous gene. A polynucleotide for enhancing (e.g., disrupting, reducing) expression of an endogenous protein, Such a polynucleotide refers to a polynucleotide that changes (e.g., decreases) the current level. Nucleotides include, for example, antisense molecules, ribozymes, interfering RNA (iRNA), These include, but are not limited to, microRNA (miRNA) and sgRNA. Methods for preparing and using siRNA, shRNA, or miRNA are publicly known from many publications (Patent Publication No. Publication No. 2002-516062; US Publication No. 2002 / 086356A; Nature Genetics, 24(2), 180-183, 2000 Feb., etc.). Furthermore, the recombinant virus vector used in the present invention can be used to It may also include a therapeutic gene.

[0039] 4. Pharmaceutical Compositions In a further embodiment of the invention, a pharmaceutical composition comprising the rAAV vector (rAAV virion) of the invention is provided. A pharmaceutical composition comprising the rAAV vector of the present invention (hereinafter, the pharmaceutical composition of the present invention) is provided. By using this compound, it is possible to deliver therapeutic genes to the liver cells of a subject with high efficiency. It is possible to introduce a therapeutic gene into a target cell, and the target disease can be treated by expressing the therapeutic gene introduced. The rAAV vector containing such a therapeutic gene is used in the pharmaceutical composition of the present invention. Such a therapeutic gene can be, for example, a gene for genome editing as described above. These include, but are not limited to, genome repair means.

[0040] In one embodiment, the rAAV vector of the invention preferably contains a promoter specific for cells of the liver. The rAAV vector of the present invention comprises a gene operably linked to a motor and its promoter. The vector can contain genes that are useful in treating diseases such as hemophilia, and these genes can be incorporated into cells of the liver, preferably hepatocytes.

[0041] When the pharmaceutical composition of the present invention is used, it can be administered, for example, orally, parenterally (intravenously), intramuscularly, or intraoral. It can be administered intramuscularly, rectally, vaginally, transdermally, nasally or via inhalation, but parenterally. Preferably, the active ingredient of the pharmaceutical composition of the present invention is administered intravenously. More preferably, the active ingredient is administered intravenously. may be formulated alone or in combination, and may be combined with a pharma- ceutical acceptable carrier. Alternatively, the composition may be provided in the form of a formulation by incorporating additives for formulation. The active ingredient can be contained in the preparation in an amount of, for example, 0.1 to 99.9% by weight.

[0042] The active ingredients of the pharmaceutical composition of the present invention may be formulated singly or in combination. This is then mixed with a pharma- ceutically acceptable carrier or pharmaceutical additive to provide the product in the form of a pharmaceutical preparation. In this case, the active ingredient of the present invention may be, for example, a 10% or 10% formulation. 5 ~10 16 vg / m L (900 fg / mL to 90 mg / mL), titer is 10 6 ~10 15 vg / mL (9.0 pg / mL~9.0 mg / mL), titer 10 7 ~10 14 vg / mL (90 pg / mL~900 μg / mL), titer 10 8 ~10 13 vg / mL (900 pg / mL to 90 μg / mL ), titer 10 9 ~10 12 vg / mL (9 ng / mL~9 μg / mL), titer 10 10 ~10 11 vg / mL (90 ng / mL to 90 The amount of the soluble ... Examples of the agent include excipients, disintegrants, disintegration aids, binders, lubricants, coating agents, colorants, etc. Agents such as bases, diluents, solubilizers, solubilizing agents, isotonicity agents, pH adjusters, and stabilizers can be used. do.

[0043] Examples of preparations suitable for parenteral administration include injections, suppositories, etc. In this case, the active ingredient of the present invention is dissolved in either sesame oil or peanut oil, or A solution of pyrene glycol or sorbitol can be used. The aqueous solution may be suitably buffered (preferably to a pH of 8 or greater) if necessary, and the liquid diluent may be diluted with water. Such a liquid diluent can be, for example, physiological saline. The prepared aqueous solution is suitable for intravenous injection, while the oily solution is suitable for intra-articular injection, intramuscular injection and The preparation of all these solutions under sterile conditions is carried out according to standard procedures well known to those skilled in the art. This can be easily achieved by conventional pharmaceutical techniques. Furthermore, the active ingredient of the present invention can be administered locally, such as on the skin. It is also possible to administer the compound orally, in a cream, jelly or other suitable form in accordance with standard pharmaceutical practice. It is preferably administered topically in the form of a paste or ointment.

[0044] Examples of formulations suitable for oral administration include powders, tablets, capsules, fine granules, and granules. For oral administration, microcrystalline cellulose, Various excipients such as sodium citrate, calcium carbonate, dipotassium phosphate, glycine The agent is a starch, preferably corn, potato or tapioca starch, and an alginate. Various disintegrants, such as acids and certain double silicates, as well as polyvinylpyrrolidone, sucrose, and zeolite. It can be used together with granule-forming binders such as gum latin and gum arabic.

[0045] The dosage of the pharmaceutical composition of the present invention is not particularly limited, and may vary depending on the type of disease, the age and symptoms of the patient, and the dosage. Select an appropriate dosage depending on various conditions such as route, purpose of treatment, and whether or not you are using concomitant medication. The dosage of the pharmaceutical composition of the present invention is, for example, about 100 mg / day for an adult (e.g., body weight 60 kg). The amount is, but is not limited to, 1 to 5000 mg, preferably 10 to 1000 mg per unit. The daily dose may be administered in two to four separate doses. The dosage unit is vg (vector For example, if you use the genome, 10 6 ~10 14 vg, preferably 10 8 ~10 1 3 vg, more preferably 10 9 ~10 12 It is possible to select a dose in the range of vg. The present invention is not limited to these.

[0046] 5. Administration of the Viral Vector of the Present Invention The viral vectors of the present invention are preferably administered to a subject in a safer and easier manner by peripheral administration. As used herein, peripheral administration includes intravenous administration, intraarterial administration, intraperitoneal administration, This refers to administration routes that are generally understood by those skilled in the art as peripheral administration, such as intracardiac administration and intramuscular administration.

[0047] The viral vector of the present invention is administered to a subject to infect liver cells, and the infected cells The present invention provides a method for genome editing in a human subject, comprising: The viral vector of the present invention can preferably infect and transfect hepatic parenchymal cells. The viral vector of the present invention is preferably capable of inducing genome editing upon administration. The ratio of cells to be subjected to genome editing among hepatic parenchymal cells in the liver of the subject is preferably 70% or more. Above, 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more Above, 96% or more, 97% or more, 98% or more, 99% or more, 99.1% or more, 99.2% or more, 99.3% or more, 99.4% or more, 99.5% or more, 99.6% or more, 99.7% or more, 99.8% or more, 99.9% or more, or 10 The probability is 0%.

[0048] 6. Preparation kit for the rAAV vector of the present invention In another embodiment, the present invention provides a kit for producing the rAAV of the present invention. Such a kit may, for example, include: (a) a first polynucleotide for expressing a capsid protein such as VP1; and (b) a second polynucleotide that is packaged into the rAAV vector. For example, the first polynucleotide can include the amino acid sequence of SEQ ID NO:4. a first polynucleotide containing a gene encoding a therapeutic gene of interest; Preferably, the gene for incorporation of such a therapeutic gene is included. The nucleic acid sequence may include various restriction enzyme cleavage sites.

[0049] A kit for producing rAAV virions of the present invention can include any of the compositions described herein. The kit of the present invention may further comprise a component (e.g., an AdV helper, etc.). Also included are instructions describing protocols for producing rAAV virions using the kits of the invention. It may also be included in the above.

[0050] 7. Other terms used in this specification The meanings of the terms used in this specification are as follows. For terms not explained, it is intended to refer to the scope of meaning of the terms as commonly understood by those skilled in the art. It is illustrated.

[0051] As used herein, unless otherwise specified, the term "viral vector" refers to a The terms "virus virion" and "virus particle" are used interchangeably. An "adeno-associated viral vector" includes an adeno-associated virus that contains a genetic modification.

[0052] As used herein, the term "polynucleotide" includes "nucleic acid," "gene," or or "nucleic acid molecule" is used interchangeably to mean a polymer of nucleotides. As used herein, the term "nucleotide sequence" is understood to mean "nucleic acid sequence" or "base sequence." Used interchangeably, deoxyribonucleotides (abbreviated as A, G, C, and T) For example, a polynucleotide comprising the nucleotide sequence of SEQ ID NO:1 may be used. "or a fragment thereof" refers to each of the deoxynucleotides A, G, C and and / or a polynucleotide comprising the sequence indicated by T or a fragment thereof. do.

[0053] The "viral genome" and "polynucleotide" of the present invention each refer to a DNA form (e.g. For example, cDNA or genomic DNA, but in some cases may exist in the form of RNA (e.g., mRNA). Viral genomes and polynucleotides as used herein Each of the DNA strands may be double-stranded or single-stranded DNA. In the case of single-stranded DNA or RNA, the coding strand ( the non-coding strand (also known as the antisense strand) or ) may also be used. Unless otherwise specified, in the present specification, the rAAV genome encodes a promoter, a gene of interest, When describing the location of genes such as the DNA fragment and polyadenylation signal, rAAV If the genome is the sense strand, the strand itself is used. If the genome is the antisense strand, the In the present specification, where the context is clear, the term "recombination" is used to refer to a The "r" may sometimes be omitted.

[0054] As used herein, the terms "protein" and "polypeptide" are used interchangeably. As used herein, a polypeptide is intended to mean a polymer of amino acids. According to the convention of labeling, the left end is the N-terminus (amino terminus) and the right end is the C-terminus (carboxyl terminus). A partial peptide of the polypeptide of the present invention (hereinafter, abbreviated as the partial peptide of the present invention) The peptides that may be present in the present invention are preferably partial peptides of the polypeptides of the present invention. has the same properties as the above-mentioned polypeptide of the present invention.

[0055] As used herein, the term "plasmid" refers to any of a variety of known genetic elements, e.g., This refers to a plasmid, phage, transposon, cosmid, chromosome, etc. It is capable of replicating in a host and transporting gene sequences between cells. In the present invention, the plasmid is a vector containing various known nucleotides (DNA, RNA, PNA and mixtures thereof). and may be single-stranded or double-stranded, but is preferably double-stranded. For example, As used herein, the term "rAAV vector plasmid" refers to a rAAV vector, unless otherwise specified. The present invention is intended to include the duplex formed by the target genome and its complementary strand. The plasmid used in the present invention may be linear or circular.

[0056] As used herein, the term "packaging" refers to the production of a single-stranded viral genome. Preparation of the genome, assembly of the envelope protein (capsid), and encapsulation of the viral genome This refers to events including encapsidation of the appropriate plasmid vector ( When multiple plasmids (usually multiple plasmids) are introduced into a packaging-competent cell line under appropriate conditions, When the virus is expressed, a recombinant virus particle (i.e., a virus virion or a virus vector) is assembled. and secreted into the culture.

[0057] In the present specification, terms not specifically explained have the meanings that are commonly understood by those skilled in the art. The term "subject matter" is intended to refer to the range of EXAMPLES

[0058] The present invention will be described in more detail below with reference to examples. The scope of the present invention is limited only by the following examples. However, the present invention is not limited to the above.

[0059] A. Materials and Methods (a) AAV vector Five types of AAV vectors were used: AAV2, AAV3B, AAV.GT5, AAV8, and AAV-LK03. AAV.GT5 contains three amino acid substitutions in the VP1 envelope protein of AAV3A and 3B, namely, the 472nd amino acid substitution Serine (S) to alanine (A), serine (S) at position 587 to alanine (A), asparagine at position 706 It contains an amino acid sequence in which cysteine ​​(N) is replaced by alanine (A). Three types of genes were used to encode proteins to be expressed by each AAV vector. For green fluorescent protein (AcGFP), the cytomegalovirus promoter (CMV) An expression cassette consisting of cDNA for the chromatin-encoding fluorescent protein (AcGFP) and SV40 poly(A) was inserted into the inverted tRNA vector of AAV3A. The vector was inserted between the interterminal repeats (ITR) of AAV2-CMV-AcGFP, AAV3B-CMV-AcGFP, and AAV.GT5-CMV- We created four types of luciferase: AcGFP, AAV8-CMV-AcGFP, and AAV8-CMV-AcGFP. The sequence encoding the enzyme was inserted into the vector, and the vectors were AAV2-CMV-Luciferase, AAV3B-CMV-Luciferase, and AAV.GT5- We produced four types of luciferase: CMV-Luciferase, AAV-LK03-CMV-Luciferase, and AAV-LK03-CMV-Luciferase. Enhancer of the hepatic regulatory region of the gene and the human antitrypsin promoter (HCRhAAT), OTC The expression cassette consisting of the cDNA of the SV40 gene and the SV40 poly(A) was inserted into the inverted terminal repeats (IT R) to generate two vectors, AAV.GT5-HCRhAAT-OTC and AAV8- HCRhAAT-OTC. AAV2: GenBank Accession # NC_001401.2 (complete genome sequence) (The amino acid sequence of AAV2 capsid protein VP1 is shown in SEQ ID NO:1.) AAV3A: GenBank Accession # U48704 (genome sequence) (The amino acid sequence of AAV3A capsid protein VP1 is shown in SEQ ID NO:2.) AAV3B: GenBank Accession # AF028705.1 (genome sequence) (The amino acid sequence of AAV3B capsid protein VP1 is shown in SEQ ID NO:3.) AAV.GT5: (created in this application) (The amino acid sequence of capsid protein VP1 is shown in SEQ ID NO:4.) AAV8: GenBank Accession # NC_006261 (genome sequence) (The amino acid sequence of AAV8 capsid protein VP1 is shown in SEQ ID NO:5.) AAV-LK03: (The amino acid sequence of the capsid protein VP1 is shown in SEQ ID NO:9.) (Lisow Ski L. et al., Nature. 2014 February 20; 506(7488): 382-386)

[0060] (b) Cell culture 1) HEK 293 cells 2×10 4 or 5×10 4 HEK293 cells were seeded at 100 cells / well and incubated in 10% fetal calf serum (FCS)- DME. M / F12 medium (Thermo Fisher Scientific) was used for incubation at 5% CO 2 , and cultured at 37°C. 2)HepG2 cells 2×10 4 or 5×10 4 HepG2 cells were seeded at 100 cells / well and incubated in 10% FCS-DMEM Low glucose medium. (Thermo Fisher Scientific) using 5% CO 2 , and cultured at 37°C. 3) PXB cells (Phoenix Bio) These cells were extracted from the liver of PXB mice, and more than 90% of them were human hepatocytes. 7×10 4 (96 we ll plate) or 7.4×10 5 (12 well plate) cells / well were seeded and cultured in dedicated dHCGM medium. Culture medium (Phoenix Bio) was used with 5% CO 2 , and cultured at 37°C.

[0061] The activity of neutralizing antibodies against AAV2 was examined by Melian A et al., HUMAN GENE THERAPY METHODS, 26:45-5 2, 2015, and the neutralizing antibody titer was 1:32 to 1:128 or 1:128 or more. Serum samples from 10 individuals were used.

[0062] (c) Vector infection Various AAV vectors expressing GFP (AAV2-CMV-AcGFP, AAV8-CMV-AcGFP, etc.) , AAV3B-CMV-AcGFP, or AAV.GT5-CMV-AcGFP) at 2 × 10 3 ~1×10 4 vg / cell, Lucfer AAV vectors expressing luciferase (AAV2-CMV-Luciferase, AAV3B-CMV-Luciferase, AAV.GT5-CMV AAV-LK03-CMV-Luciferase, AAV-LK03-CMV-Luciferase) were administered at 400 or 800 vg / cell to vectors expressing OTC. Vectors (AAV.GT5-HCRhAAT-OTC, AAV8-HCRhAAT-OTC) were 4 × 10 4 Add vg / cell to each cultured cell. Then, the cells were cultured for 1 to 10 days.

[0063] (d) Assessment of GFP or luciferase expression To measure GFP expression, various AAVs were transfected using a plate reader (Biotech Japan). The fluorescence intensity of GFP expressed by the vectors was measured and compared. Images of the entire field of view were taken using a fluorescence microscope (Olympus IX83). To measure luciferase activity, each cell was added with cell lysis buffer, luciferin, etc. Reagents containing Bright-Glo TM Luciferase Assay System (Promega) was added to the plate. The luminescence intensities were measured and compared using a Fluorescence Intensity Analyzer (Biotech Japan).

[0064] (e) Verification of cross-reactivity with neutralizing antibodies in serum Resistance to neutralizing antibodies was confirmed using luciferase as a reporter. As examples, AAV2, AAV3B, and AAV-LK03 (a modified AAV resistant to known neutralizing antibodies: Perocheau, D .P. et al. (2018) HUMAN GENE THERAPY, 30,1, 79-87) was used. Ten types of serum collected from healthy subjects were diluted two-fold with FCS from 1:2 to 1:128. . 4 types of AAV (AAV.GT5-CMV-Luciferase, AAV-LK03-CMV-Luciferase, AAV3B-CMV-Luciferas e, and AAV2-CMV-Luciferase) were mixed with the serum in a 1:1 ratio and incubated at 37°C for 1 hour. After 24 hours, luciferase was detected using the Luciferase Assay Kit. The luminescence activity of the enzyme was measured. As a control, AAV mixed with FCS instead of the sample serum was set at 100%. The relative luminescence activity of each AAV was expressed as a percentage. The maximum dilution rate was determined as the neutralizing antibody titer.

[0065] (f) Preparation of ornithine carbamyltransferase (OTC) expression vector Human ornithine carbamyltransferase was produced using conventional genetic engineering techniques. Each AAV vector incorporating the cDNA (SEQ ID NO: 10) was prepared.

[0066] (g) Confirmation of OTC expression 7.4×10 5 PXB cells were seeded in three 12-well plates at 10 / well and cultured in dedicated dHCGM medium (Phoenix (Sbio) was used with 5% CO 2 After 6 days of culture, AAV.GT5-HCR-hAAT-OTC and AAV8-HCRhAAT-OTC at 4 × 10 4 vg / cell were administered to 4 wells in each group. The medium was replaced 3 and 7 days after administration, and the cells were incubated at 37°C, 5% CO. O 2 The culture was terminated 10 days after administration, and OTC mRNA, OTC protein, and OTC Enzyme activity measurements were carried out. (Measurement of OTC mRNA) RNeasy Mini Kit was used to identify PXB cells (n=4) injected with AAV.GT5-HCRhAAT-OTC or AAV8-HCRhAAT-OTC. Total RNA was purified using QIAGEN. cDNA was synthesized from 100 ng of total RNA and reverse transcriptase was performed. The High Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (App The cDNA sample was diluted 6-fold with nuclease-free water. The Ct value was measured using the SYBR Green method of real time PCR (Applied Biosystems). was constructed with an optimized OTC sequence. OTC Forward: ACCGGCGAAGAGATCAAGTA (SEQ ID NO: 13) OTC Reverse: ATCATGCCCAGAGACTTTCC (SEQ ID NO: 14) In addition, the following sequence was used for standardization in detecting GAPDH. GAPDH Forward: AATTCCATGGCACCGTCAAG (SEQ ID NO: 15) GAPDH Reverse: ATCGCCCCACTTGATTTTGG (SEQ ID NO: 16) The expression level of each mRNA was analyzed using the comparative Ct method (ΔΔCt method). The GAPDH gene was used as an internal standard. The OTC phase of the AAV.GT5-HCRhAAT-OTC administration group when the expression level of the AAV8-HCRhAAT-OTC administration group was set to 1. The relative amount was calculated. (OTC protein measurement) After the culture was terminated, PXB cells were rinsed with PBS and then added RIPA Buffer + protease inhibitors at 100 μl / well. The cells were lysed by adding Laemmli Buffer + βME. The protein was reduced by heating at 37°C. 4-15% polyacrylamide gel, electrophoresis in Tris / glycine / SDS buffer, PVDF After transferring to a membrane and blocking, the antibody was reacted with OTC antibody (1:2000, SantaCruz) at 4℃ overnight. After washing six times with 1% PBST, the plate was incubated with HRP-anti-mouse-IgG (1:5000, GE Healthcare) at room temperature for 60 minutes. After washing six times with 0.1% PBST, ECL Prime Western Blotting Detection Reagent (GE Healthcare) was added. The chemiluminescence was generated using a fluoroscopy (Fluscare) and detected using an Amersham Imager 600. The bands were then analyzed using the built-in analysis software. Similarly, the volume value was measured using a GAPDH antibody (1:10000, Abcam) to detect the housekeeping protein. The amount of OTC was measured and compared using the corrected OTC volume value / GAPDH volume value. (OTC activity measurement) The PXB cells were detached from the dish and centrifuged (1000 rpm, 3 minutes, room temperature) to remove the medium. The cells were then washed twice with PBS. Mitochondrial lysis buffer (0.5% Triton X-100 [v / v] in dHO) was added. 2 HO, 10 mM HEPES, 2 mM DTT [pH 7.4]) and homogenized on ice. The supernatant was collected and the protein content was measured. reaction solution (5mM ornithine, 15mM carbamyl phosphate, 270mM trimethane) Add Stop solution (0.5ml) to make the total volume 700μl. Incubate at 37℃ for 60 minutes, then add Stop solution (0.5ml). .5% antipyrine / 50% sulfuric acid (w / v): 0.8% 2,3-butanedion monoxime :distilled Water [1:1:1.5]) was added to the wells. The wells were then boiled for 15 minutes in the dark. The absorbance at 490 nm was measured. The enzyme activity was expressed as μmol of citrulline peroxidase. The results were expressed as induced / mg of liver protein / hr.

[0067] B. Results (1) Construction of mutant AAV.GT5 A DNA containing the fusion Rep sequence of the adeno-associated virus AAV3A and AAV3B, and the VP sequence of AAV3B was The AAV3B VP1 was artificially synthesized to generate the S472A, S587A, and N706A mutations. Through genetic engineering, we obtained the adeno-associated virus variant AAV.GT5. Amino acid sequences of VP1 proteins of AAV3A, AAV3B, and AAV.GT5 (SEQ ID NOs: 2 to 4) and the alignment of the Rep protein amino acid sequences (SEQ ID NOs: 6 to 8) are shown in Figures 1A to 1D As shown in.

[0068] (2) Confirmation of the infectivity of AAV.GT5 to human liver-derived cell lines HepG2 and PXB The infectivity of the AAV.GT5 prepared above into human liver-derived HepG2 cells was confirmed. HepG2 cells 5×10 4 The day after seeding cells / well onto a 96-well optical bottom plate, AAV8- CMV-AcGFP, AAV2-CMV-AcGFP, AAV3B-CMV-AcGFP and AAV.GT5-CMV-AcGFP 5×10 8 vg / well The mice were incubated at 37°C, 5% CO 2 After culturing in an incubator for 7 days, the GFP signal was detected using a plate reader. The fluorescence intensity was measured and compared quantitatively (Table 1 and Figure 2A). The state of the cells at this time is shown in Figure 2. Shown in B. [Table 1] Based on the GFP intensity measurements, AAV.GT5 showed approximately 1.1-fold (107.9%) higher expression than AAV3B. Therefore, AAV.GT5 is capable of gene transfer into human liver-derived cells at a level equal to or greater than that of AAV3B. On the other hand, AAV8 and AAV2 were less effective in transfecting human liver-derived cells than AAV3B and AAV.GT5. The transduction efficiency was lower (Figure 2A).

[0069] In the above GFP expression assay system, both AAV.GT5 and AAV3B were at the upper limit of the assay range. Therefore, the difference in the amount of the human liver-derived The infectivity of each rAAV vector in HepG2 cells was confirmed using luciferase. In addition, AAV3B and AAV-LK03 were used as controls. AAV.GT5-CMV-Luciferase, AAV-LK03-CMV-Luciferase, and AAV3B-CMV-Luciferase HepG2 cells 2×10 4 MOI=800 vg / cell for cells seeded one day after plating. and cultured. Two days after AAV administration, the luciferase activity was assayed using the Bright-Glo Luciferase Assay System (Promega). The activity was measured (n=4). The graph of the measured luminescence intensity (RLU) and the relative values ​​are shown in Figure 2C. show. The RLU measurements showed that AAV.GT5 had 2.0-fold higher expression than AAV3B, and 1.0-fold higher expression than AAV-LK03. The expression was confirmed to be 1.3-fold higher than that of the control (Table 2 and FIG. 2C). [Table 2] Gene transfer to PXB cells, which are more than 90% human hepatocytes, was performed using human liver cells extracted from PXB mice. The results of the transfection are shown in Figures 3A and 3B. PXB cells (Phoenix Bio) 7 × 10 4 cell / wel Six days after seeding on a 96-well plate, AAV8-CMV-AcGFP, AAV2-CMV-AcGFP, and AAV3B-CMV-AcGFP were and AAV.GT5-CMV-AcGFP 5 × 10 8 vg / well. 2 incubator After culturing for 7 days at 4°C, the GFP fluorescence intensity was measured using a plate reader and quantitatively compared (Table 3). (Fig. 3A). The state of the cells at this time is shown in Fig. 3B. [Table 3] As in HepG2 cells, the amount of GFP expression in PXB cells was similar to that of AAV.GT5-CMV-AcGFP. This was about 1.1 times the original amount. Therefore, AAV.GT5 is capable of transducing genes into these human liver-derived cells at a level equivalent to or greater than that of AAV3B. On the other hand, AAV8 and AAV2 were more effective at transferring genes to human hepatocytes than AAV3B and AAV.GT5. The transfer efficiency was low (Figures 2 and 3).

[0070] (3) Measurement of neutralizing antibody titer Following the procedure in (e) above, 10 types of sera (serum #01 to #10) were used to detect AAV.GT5, AAV-LK03, and AA The maximum dilution rate (neutralizing antibody titer) that suppressed luciferase activity by V3B and AAV2 to less than 50% was obtained. These results are shown in Table 4. Among the 10 sera tested, AAV.GT5 had the lowest neutralizing antibody titer. The neutralizing antibody titer against AAV.GT5 was 1 / 8 to 1 / 4 that of AAV-LK03 and AAV3B. That was about it. [Table 4]

[0071] Furthermore, when neutralizing antibody titers were measured, gene expression by AAV.GT5, AAV-LK03, AAV3B, and AAV2 was The results are shown in Figures 4A to 4J. The increase of about 4-fold in neutralizing antibody titer is very large in expression level when compared at the same serum dilution rate. This resulted in a significant difference.

[0072] (4) Preparation of OTC expression vector In order to express recombinant OTC using AAV.GT5, the following DNA (referred to as AAV.GT5-OTC) was prepared: A more detailed sequence structure is shown in FIG. 5A, FIG. 5B and SEQ ID NO:12. [ka]

[0073] (5) Comparison of OTC expression by recombinant AAV vectors Using PXB cells extracted from the liver of PXB mice, which are more than 90% human hepatocytes, The infection and expression efficiency of AAV.GT5-OTC in human liver cells was compared with that of AAV8-OTC. The comparison results of OTC mRNA expression levels by AAV.GT5 are shown in Table 5 and Figure 6. [Table 5] AAV.GT5 was confirmed to increase OTC mRNA expression by approximately 90-fold compared to the control. Ta.

[0074] In addition, the comparison results of the protein expression levels of OTC by AAV.GT5 are shown in Table 6 and Figure 7. [Table 6] Similar to the results of mRNA expression, AAV.GT5 expressed approximately 86-fold more protein than the control. We confirmed an improvement in

[0075] Furthermore, the comparative results of the enzyme activity of OTC by AAV.GT5 are shown in Table 7 and Figure 8. [Table 7] These results suggest that AAV.GT5-OTC, when used as a therapeutic agent, is a highly potent OTC inhibitor. Advantages such as a significant reduction in expression and / or viral vector dosage are expected. [Industrial Applicability]

[0076] The recombinant adeno-associated virus vector of the present invention reduces attacks from neutralizing antibodies in living organisms. For example, in the presence of a neutralizing antibody, gene transfer efficiency to target cells is approximately four times higher. Furthermore, we were able to express human ornithine transcarbaminase under the control of a liver-specific promoter. The enzyme protein could be expressed approximately 90-fold more efficiently than the control. Thus, a recombinant human ornithine transcarbamylase protein expressing the present invention is Ornithine transcarbamylase-deficient mice were infected with adeno-associated virus vectors. It is believed that this will make it possible to treat injuries more efficiently. [Sequence List Free Text]

[0077] SEQ ID NO: 1: Amino acid sequence of AAV2 capsid protein SEQ ID NO:2: Amino acid sequence of AAV3A capsid protein SEQ ID NO:3: Amino acid sequence of AAV3B capsid protein SEQ ID NO: 4: Amino acid sequence of AAV.GT5 modified capsid protein (S472A, S587A, N706A) column SEQ ID NO: 5: Amino acid sequence of AAV8 capsid protein SEQ ID NO: 6: Amino acid sequence of the Rep protein (ARep) of AAV3A SEQ ID NO: 7: Amino acid sequence of the Rep protein (BRep) of AAV3B SEQ ID NO: 8: Amino acid sequence of the Rep protein (baRep) of AAV.GT5 SEQ ID NO: 9: Amino acid sequence of AAV-LK03 capsid protein SEQ ID NO: 10: cDNA sequence of ornithine transcarbamylase (OTC) SEQ ID NO: 11: Amino acid sequence of ornithine transcarbamylase (OTC) SEQ ID NO: 12: Sequence of the OTC expression vector (AAV.GT5-HCRhAAT promoter-human OTC-WPRE) SEQ ID NO: 13: OTC Forward primer for detecting OTC mRNA expression SEQ ID NO: 14: OTC mRNA expression detection primer OTC Reverse SEQ ID NO: 15: GAPDH Forward primer for detecting GAPDH mRNA expression SEQ ID NO: 16: GAPDH Reverse primer for detecting GAPDH mRNA expression

Claims

1. In the amino acid sequence of SEQ ID NO: 2 or 3, serine at position 472, serine at position 587, and and an amino acid in which at least one of asparagine at position 706 is replaced with another amino acid. or the 472nd, 587th and 706th residues of said substituted amino acid sequence. In addition to the base, the amino acid sequence includes 1 to 6 residues deleted, substituted, inserted and / or added. Capsid proteins, and The amino acid sequence of SEQ ID NO: 11, or 90% or more of the amino acid sequence of SEQ ID NO: 11 and having ornithine transcarbamylase activity. Polynucleotides encoding proteins An adeno-associated virus vector comprising at least one of the 2 types of AAV and a neutralizing antibody. A non-differentiated, adeno-associated viral vector.

2. The serine at position 472, the serine at position 587, and the asparagine at position 706 are each From the group consisting of glycine, alanine, valine, leucine, threonine and isoleucine The capsid protein has an amino acid sequence substituted with a selected amino acid. The adeno-associated virus vector according to claim 1.

3. at least one of the serine at position 472, the serine at position 587 and the asparagine at position 706 a capsid protein having an amino acid sequence in which one of the amino acids is replaced by an alanine; The adeno-associated virus vector according to claim 1.

4. The capsid protein has the amino acid sequence set forth in SEQ ID NO:

4. The adeno-associated virus vector of claim 1 .

5. The neutralizing antibody is an antibody against an adeno-associated virus of a type different from AAV3 or AAV8. The adeno-associated virus vector of claim 1.

6. The adeno-associated virus vector according to claim 1, wherein the neutralizing antibody is an antibody against AAV2. Tha.

7. The antigen of claim 1, having a viral genome including a liver cell-specific promoter sequence. Deno-associated virus vectors.

8. The liver cell-specific promoter sequence is an ApoE promoter, an antitrypsin promoter, cKit promoter, liver-specific transcription factors (HNF-1, HNF-2, HNF-3, HNF-6, C / ERP , DBP) promoter, albumin promoter, thyroxine-binding globulin (TBG) promoter promoter, and HCRhAAT promoter, or or a polynucleotide sequence having 90% or more homology to these promoters, The adeno-associated virus vector of claim 1 , comprising a heterologously functioning promoter.

9. In the amino acid sequence of SEQ ID NO: 2 or 3, the 472nd serine and the 587th serine are and an amino acid in which at least one of the asparagines at position 706 is replaced with another amino acid. amino acid sequence or the substituted amino acid sequence, Amino acid sequence with 1 to 6 deletions, substitutions, insertions and / or additions in addition to the first residue A capsid protein comprising The amino acid sequence of SEQ ID NO: 11, or 90% or more of the amino acid sequence of SEQ ID NO: 11 and having ornithine transcarbamylase activity. Polynucleotides encoding proteins An adeno-associated virus vector comprising:

10. In the amino acid sequence of SEQ ID NO: 2 or 3, the 472nd serine and the 587th serine are and at least one of the asparagines at position 706 is replaced with another amino acid. an amino acid sequence in which 1 to 6 amino acid residues are deleted, substituted, inserted or deleted at other residue positions; or an added amino acid sequence, The serine at position 472, the serine at position 587, and the asparagine at position 706 are each From the group consisting of glycine, alanine, valine, leucine, threonine and isoleucine an amino acid sequence substituted with selected amino acids; at least one of the serine at position 472, the serine at position 587 and the asparagine at position 706 an amino acid sequence in which one of the amino acids has been substituted by alanine, or Amino acid sequence set forth in SEQ ID NO:4 A polynucleotide encoding any one of the sequences.

11. A liver of a living organism, comprising the adeno-associated virus vector according to any one of claims 1 to 9. A pharmaceutical composition for gene transfer into a mammal.

12. The pharmaceutical composition of claim 11 , wherein the living organism is a human.

13. The method according to claim 11 or 12 for the treatment of ornithine transcarbamylase deficiency. A pharmaceutical composition comprising:

Images