Transpiration suppressing agent using jasmonic acid or the like

Abstract

To provide a transpiration suppressing composition.SOLUTION: There is provided a composition for suppressing transpiration of plant body or part thereof that contains jasmonic acid or the like. The present disclosure also provides a method for suppressing transpiration of a plant body or a part thereof, which includes a step of applying jasmonic acid derivatives to the plant body or a part thereof. The jasmonic acid or the like may include, but are not limited to, prohydrojasmonic acid. Target plants may include, but are not limited to, emergent plants or wet plants.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present disclosure relates to a transpiration suppression technology. More specifically, the present disclosure relates to a reversible transpiration suppression technology using jasmonic acids. [Background technology]

[0002] Climate change caused by global warming is a serious problem in the agricultural sector, and in paddy rice, problems include damage to leaves when transplanting seedlings, dry damage, and reduced yield and quality due to hypertranspiration caused by high temperatures during ripening. One solution to these problems is to suppress hypertranspiration by applying anti-transpiration agents. Summary of the Invention [Means for solving the problem]

[0003] The present disclosure makes it possible to rapidly suppress transpiration in plants (e.g., rice) by applying jasmonic acids, and to prevent a decrease in quality and yield due to planting damage, drought damage, and hypertranspiration caused by high temperatures during ripening. Without wishing to be bound by theory, the present disclosure solves the problem that since stomata are physically closed, it is difficult to reversibly increase transpiration again, and a decrease in yield and quality occurs depending on the application time and weather conditions.

[0004] When applied, the agent used in the present disclosure induces temporary stomatal closure, thereby suppressing transpiration. However, this is a reversible reaction, making it possible to flexibly suppress transpiration in response to changes in weather conditions, etc.

[0005] It is contemplated that one or more of the above features may be provided in combinations other than those specifically described. Still further embodiments and advantages of the present invention will be recognized by those skilled in the art upon reading and understanding the following detailed description, if necessary. Effect of the Invention

[0006] The present disclosure has solved a serious problem in the agricultural field, which is climate change caused by global warming. For example, in the case of rice, the problem of planting damage to leaves and dry damage when transplanting seedlings, and reduced yield and quality due to hypertranspiration caused by high temperatures during ripening have been solved. The present disclosure has solved the problem of suppressing hypertranspiration by applying an antitranspiration agent. In particular, the present disclosure makes it possible to quickly suppress transpiration in plants such as rice by applying jasmonic acids such as prohydrojasmone, thereby preventing planting damage, dry damage, and reduced quality and yield due to hypertranspiration caused by high temperatures during ripening.

[0007] The transpiration suppressing effect of the present disclosure in plants such as rice is characterized in that the effect is reversible, as compared with existing transpiration suppressants. [Brief description of the drawings]

[0008] [Figure 1] Figure 1 shows the transpiration suppression effect of Microcrystal Wax confirmed by thermal imaging. The thermal image (left) and visible image (right) of a plant 2 days (top) and 7 days (bottom) after spray application of 5-fold or 10-fold diluted Microcrystal Wax are shown. [Diagram 2] Figure 2 shows the transpiration suppression effect of paraffin wax confirmed by thermal imaging. The thermal image (left) and visible image (right) of a plant 2 days (top) and 7 days (bottom) after spray application of 100-fold or 200-fold diluted paraffin wax are shown. [Diagram 3] Figure 3 shows the transpiration suppression effect of Microcrystal Wax confirmed by thermal images. Thermal images (left) and visible images (right) of a plant before (top) and 0.5 hours (bottom) after spray application of 5-fold or 10-fold diluted Microcrystal Wax are shown. [Figure 4] Figure 4 shows the transpiration suppression effect of paraffin wax confirmed by thermal imaging. Thermal images (left) and visible images (right) of a plant before (top) and 0.5 hours (bottom) after spray application of 5-fold or 10-fold diluted paraffin wax are shown. [Diagram 5]The transpiration suppression effect of PDJ was confirmed by thermal images in Figure 5. Thermal images (left) and visible images (right) of plants before (A, B), 0.5 hours after (C, D), 2 days after (E, F), and 7 days after (G, H) spray application of PDJ diluted 2,000 or 20,000 times are shown. [Figure 6] Figure 6 shows the results of RNAseq analysis using PDJ-treated glumes. For each gene, the gene expression level of the control is shown as 1. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0009] The present disclosure will be described below. Throughout this specification, the singular expression should be understood to include the concept of the plural form, unless otherwise specified. Therefore, the singular article (for example, in the case of English, "a", "an", "the", etc.) should be understood to include the concept of the plural form, unless otherwise specified. In addition, it should be understood that the terms used in this specification are used in the sense commonly used in the field, unless otherwise specified. Therefore, unless otherwise defined, all technical terms and scientific and technical terms used in this specification have the same meaning as commonly understood by those skilled in the art to which this disclosure belongs. In case of conflict, the present specification (including definitions) shall prevail.

[0010] (definition) In this specification, the term "about" refers to plus or minus 10% of the numerical value that follows, unless otherwise specified.

[0011] As used herein, "transpiration suppression" refers to the suppression of water transpiration when applied to all or a part of a plant (e.g., leaves, panicles, etc.) compared to when the compound is not applied. The transpiration suppression effect may be a direct effect based on the component, or, if the component is a gene or the like, may be realized by a gene product or the like expressed as a result of application or incorporation into the plant.

[0012] As used herein, the term "reversible transpiration inhibition" refers to the fact that the transpiration inhibition effect is reversible, that is, that once the transpiration inhibition effect is achieved, it can return to the original state (the transpiration inhibition effect disappears or is reduced).

[0013] In one embodiment, the transpiration evaluated by the method for confirming the transpiration suppressing effect of the present disclosure is suppressed to 80% or less, preferably 50% or less, more preferably 35% or less, and most preferably 20% or less, compared to the transpiration of a plant not using the transpiration suppressing component of the present invention. The dosage form of the transpiration suppressing component can be, for example, a liquid, fine powder, or paste, but other dosage forms may also be used as long as they do not impair the stability of the active ingredient contained in the transpiration suppressing component of the present disclosure and can be used in the use examples described below.

[0014] In this specification, the term "jasmonic acids" includes jasmonic acid and jasmonic acid derivatives. Jasmonic acid includes free jasmonic acid and salts of jasmonic acid. The salts of jasmonic acid are not particularly limited, but include, for example, sodium salt, potassium salt, magnesium salt, and calcium salt. The derivatives of jasmonic acid include methyl jasmonate, prohydrojasmone, jasmonic acid glucoside, epijasmonic acid, methyl epijasmonate, dihydrojasmonic acid, tuberonic acid, and amino acid derivatives of jasmonic acid. The amino acid derivatives of jasmonic acid include isoleucine jasmonate, phenylalanine jasmonate, and valine jasmonate. These jasmonic acid-related compounds may be included alone as a transpiration suppressing component, or may be included in any combination.

[0015] In this specification, "prohydrojasmone" is registered as propyl = (1RS, 2RS)-(3-oxo-2-pentylcyclopentyl) acetate containing 10 ± 2% of propyl = (1RS, 2SR)-(3-oxo-2-pentylcyclopentyl) acetate in the pesticide registration, and is known as a plant growth regulator of jasmonic acid derivatives, but for the purpose of this disclosure, this ratio can be arbitrary. Prohydrojasmone is an artificially produced jasmonic acid derivative that is commonly used as a plant growth regulator in various fruits and rice seedlings. Prohydrojasmone has been confirmed to affect various biological processes in a manner similar to jasmonic acid. Prohydrojasmone promotes anthocyanin accumulation in grapes and apples, improves hand-picking efficiency of Unshu mandarins, induces a defense response against cutworms in corn, and has effects on phenolic compounds, anthocyanin accumulation, and antioxidant activity in komatsuna and lettuce. It is also a growth regulator that inhibits germination and root growth in both indica and japonica varieties of rice.

[0016] In this disclosure, the effect of prohydrojasmone (PDJ) on transpiration was investigated in comparison with commercially available microcrystalline wax and paraffin agents. Takanari is a high-yielding indica variety that exhibits higher transpiration than common japonica varieties (Fukuda et al., 2018). In some examples of this disclosure, PDJ activity in preventing transpiration in rice was demonstrated using Takanari. The results of the examples of this disclosure showed that PDJ functions in a different manner than commercially available agents and can be used to reduce excessive transpiration in rice.

[0017] In this specification, "plant spraying" refers to spraying a target component directly onto a plant. In plant spraying, the target component may be mainly sprayed onto the plant, and a small amount of the component may be incidentally sprayed into the environment. In plant spraying, for example, the target component is directly applied to the plant, thereby achieving the effect intended by the present disclosure. Examples of methods for plant spraying include, but are not limited to, directly applying the transpiration-suppressing component, spraying the target component onto the underside of the leaves, and applying the transpiration-suppressing component to the entire plant including the ears after ear emergence. Specifically, plant spraying can be said to be a concept that includes foliar spraying, floral spraying, flower ear spraying, tree spraying, and the like.

[0018] In this specification, "environmental spraying" refers to spraying a target component into the environment surrounding a plant body. In environmental spraying, it is sufficient that the target component is mainly sprayed into the environment, and a small amount of the component may be sprayed incidentally onto the plant body. In environmental spraying, for example, the effect intended by the present disclosure can be achieved by spraying the target component into the environment. Examples of environmental spraying methods include spraying into the environment of a plant body, and also include, but are not limited to, soil treatment in which the component is applied directly into the soil in advance and base application in which the component is sprayed at the base of the plant. Environmental spraying can be said to be a concept that includes water surface spraying, soil spraying, base spraying, irrigation water spraying, etc.

[0019] In this specification, the term "application" refers to the act of rubbing a drug or active ingredient onto a target area.

[0020] In the present disclosure, any formulation that can be used with pesticides can be used, for example, dust, DL dust, FD (flow dust), granule, jumbo, powder granule, microgranule, fine granule, powder, hydrated powder, flowable sol (SC), granular water dispersible agent, dry flowable water soluble agent, granular water soluble agent, emulsion, EW agent, liquid, ME liquid, oil, surf agent, aerosol, paste, smoking agent, fumigant, microcapsule, and pack agent can be used.

[0021] As used herein, the term "liquid preparation" refers to a drug that is provided in a liquid state at room temperature.

[0022] In this specification, the term "dust" refers to a formulation in which the agricultural chemical raw material is diluted with fine mineral powder such as clay, and decomposition inhibitors are added as necessary to form a fine powder of, for example, 45 μm or less. It refers to a formulation to be used as is. A formulation that uses a bulking agent with less fine powder of 10 μm or less to reduce scattering (drift), and further uses a flocculant to aggregate the mixed fine powder and make it less likely to scatter is also called DL powder. DL is an abbreviation for DRIFT LESS. A formulation that is made into an ultra-fine powder of 2 μm or less to extend the time it floats in the air, and is designed to be sprayed from the outside of a greenhouse and spread evenly inside, is also called FD agent or flow dust.

[0023] In this specification, "granules" refers to agents that are solid at room temperature and are provided in the form of granules. Under the Agricultural Chemicals Control Law, they are fine granules with a particle size of 300 to 1700 μm, and are used as is. There are various shapes depending on the manufacturing method, such as types in which the agricultural chemical raw materials are kneaded into minerals such as clay (mainly cylindrical), and types in which the raw materials are impregnated into porous minerals (mainly fine sand-like). There are also pellet-shaped and tablet-shaped ones with larger particle sizes. In this specification, "jumbo agents" correspond to registered granules under the Agricultural Chemicals Control Law. There are tablets (tablet-shaped) weighing 50 g each, and pack agents in which granules, tablets, and powder are wrapped in 50 g of water-soluble film, and 10 to 20 pieces per 10 are are thrown into rice paddies from the ridges. Since no spraying equipment is used, it is labor-saving. Most of them are herbicides.

[0024] In this specification, "wettable powder" refers to a powder formulation that dissolves in water and is used by suspending it in water, and when the preparation is left to stand, it settles. In this specification, "flowable agent" refers to a formulation in which the active ingredient is made into fine particles (average particle size 1 to 5 μm) and dispersed in a liquid with an appropriate surfactant.

[0025] In this specification, the term "water-soluble" refers to a water-soluble powder, granule, or other preparation that is dissolved in water for use. Since the active ingredient is completely dissolved in water, the preparation does not precipitate.

[0026] In this specification, the term "emulsion concentrate" refers to an oily liquid formulation in which a poorly water-soluble agricultural chemical active ingredient is dissolved in an organic solvent and an emulsifier is added. It is used in an emulsified state by diluting it with water.

[0027] In this specification, "microcapsules" refers to preparations containing micro-sized capsules in which the target ingredient is coated with a polymer membrane or the like. By microencapsulating, the drug's effectiveness is increased and inhalation toxicity, drug damage, and paint contamination are reduced. The appearance of the preparation is liquid, similar to that of a flowable preparation.

[0028] In this specification, the term "aerosol" refers to a spray agent contained in a can (cylinder) that sprays the target ingredient by the internal gas pressure. It has the advantage of being easy to use.

[0029] In this specification, the term "plant body" is used in the broadest sense in the art, and refers to an organism that performs life phenomena and lives without moving by photosynthesis. A plant body typically has various characteristics such as cell structure, proliferation (self-reproduction), growth, regulation, metabolism, and repair ability, and usually has as its basic attribute proliferation involving genetics governed by nucleic acids and metabolism governed by proteins. The plant body may be either an angiosperm or gymnosperm cell, either a dicotyledonous or monocotyledonous plant cell, or either a herbaceous plant or a woody plant. Examples of herbaceous plants include cereal plants, turf grasses, and vegetables, and examples of woody plants include evergreen broad-leaved trees, deciduous broad-leaved trees, and the like. Specifically, the plant may include, but is not limited to, horticultural crops such as rice, wheat, barley, corn, grapes, apples, pears, peaches, cherries, persimmons, citrus, soybeans, green beans, strawberries, potatoes, cabbage, lettuce, tomatoes, cucumbers, eggplants, watermelons, sugar beets, spinach, snow peas, pumpkins, sugarcane, tobacco, peppers, sweet potatoes, taro, konjac, cotton, sunflowers, tulips, chrysanthemums, and turfgrass. In addition, the term "plant body" as used in the present invention refers to a plant body including all parts that constitute the plant body. In the present specification, preferably, such a plant body may be fertile. More preferably, such a plant body may produce seeds. It is understood that the composition and method of the present disclosure may be applied to any plant having leaves.

[0030] In the present specification, a "part of a plant" may be, for example, a specific part of a plant, such as a stem, a leaf, a root, a seed, a flower, or a fruit, or may be a combination of multiple organs including a stem, a leaf, a seed, etc. A part of a plant may include an above-ground part (e.g., a leaf, a stem, a node, or a leaf, a stem, a node, and an ear), an underground part, etc.

[0031] In this specification, the term "seed" refers to a seed that stores nutrients for germination of a young plant and is used for agricultural reproduction. Specific examples include grains such as rice, corn, cottonseed, wheat, and barley, pearl millet, foxtail millet, finger millet, barnyard millet, sorghum, pearl barley, oats, rye, and other gramineous cereals, sunflower seeds, pumpkin seeds, beans, and rapeseed seeds. Alternatively, the present disclosure may be directed to edible parts of crops (cereal seeds and fruit of fruit trees).

[0032] In this specification, "aerial parts" refers to parts of a plant body that include leaves and stems during vegetative growth and leaves, stems, inflorescences, and flowers during reproductive growth. For example, in a grass plant, the "aerial parts" during vegetative growth are the parts consisting of leaves, stems, and nodes, while the "aerial parts" during reproductive growth are the parts consisting of leaves, stems, nodes, and panicles (rachises and glumes).

[0033] In the present disclosure, the plant body may be a part of the plant body that is edible other than the seed. For example, the part of the plant body may be the fruit of a vegetable such as a tomato, cucumber, eggplant, snow pea, pumpkin, or pepper. Alternatively, the part of the plant body may be a leafy vegetable such as spinach, mizuna, or nozawana. The part of the plant body may also be an edible underground part such as taro, potato, sweet potato, konjac, lotus root, or lily root. The plant body or part thereof used in the present disclosure may also not be edible. The plant body or part thereof may be a bulb such as a seed potato, lily, or tulip, or a seed bulb such as a scallion.

[0034] In this specification, the term "aquatic plant" refers to a plant whose roots are immersed in water in its normal life cycle. For example, floating plants, floating-leaf plants, submerged plants, emergent plants, and wetland plants are applicable. Freshwater, brackish water, and seawater are not important, but freshwater is preferred. "Floating plant" refers to a plant whose roots are exposed in the water without spreading to the bottom of the water, and whose entire plant body floats on the water surface. For example, Lemnaceae plants such as Lemna aoukikusa and Lemna minor, and Pontederiaceae plants such as Eichhorniacrassipes are applicable. "Floating-leaf plant" refers to a plant whose roots spread to the bottom of the water and whose leaves float on or near the water surface. For example, Nymphaeaceae plants such as Nymphaeatetragona and Brasenia schreberi, Trapaceae plants such as Trapajaponica, and Menyanthaceae plants such as Nymphoidespeltata are included. "Submerged plants" refers to plants that have roots on the bottom of the water and whose entire plant body is below the water surface. For example, Hydrocharitaceae plants such as Hydrillaverticillata, Potamogetonaceae plants such as Potamogeton crispus, and Charophyceae algae such as Charabraunii are included.

[0035] In this specification, the term "emergent plants" refers to plants that have roots in the water bottom and upper parts of the plant body such as leaves and stems that extend above the water surface. Examples of such plants include plants of the Poaceae family such as rice (Oryza sativa), waterweed (Zizania latifolia), and reed (Phragmites australis), plants of the Nelumbonaceae family such as lotus (Nelumbonucifera), plants of the Nymphaeaceae family such as water lily (Nuphar japonicum), and plants of the Typhaceae family such as cattail (Typhalatifolia). In this specification, the term "wetland plant" refers to a plant that lives in places where its roots can be submerged in water, such as wetlands or around rivers or ponds, but where most of the plant body, excluding the roots and rhizomes, is not submerged in water. Examples of wetland plants include plants of the Lythraceae family, such as Lythrum anceps, plants of the Orchidaceae family, such as Habenaria radiata, and plants of the Iridaceae family, such as Irispseudacorus.

[0036] As used herein, the term "stomatal closure" refers to the closure of stomata in a plant body, and can be observed under a microscope.

[0037] As used herein, "planting pain" refers to damage that occurs when planting or transplanting a plant (e.g., rice or vegetables), and includes damage such as temporary cessation of growth or loss of leaves due to roots being cut.

[0038] In this specification, "dryness damage" refers to damage that occurs when an appropriate amount of rain does not fall at appropriate intervals due to drought or light rain, causing a soil moisture deficiency and no measures such as irrigation are taken, or when the necessary amount of water is not supplied to the plant body due to weather conditions such as high temperature and dryness.

[0039] As used herein, the term "harvest quality" refers to the quality of the intended agricultural product (for example, rice in the case of rice).

[0040] As used herein, "yield (of a harvested crop)" refers to the yield of a target agricultural product (e.g., rice in the case of rice), and is usually expressed as the yield per planted area (e.g., per 10 ares in the case of rice).

[0041] (Preferred embodiment) The preferred embodiments of the present disclosure are described below. The embodiments provided below are provided for a better understanding of the present disclosure, and it is understood that the scope of the present disclosure should not be limited to the following description. Therefore, it is clear that a person skilled in the art can appropriately modify the present disclosure by referring to the description in this specification. It is also understood that the following embodiments of the present disclosure can be used alone or in combination.

[0042] The embodiments described below are all comprehensive or specific examples. The numerical values, shapes, materials, components, component arrangement and connection forms, steps, and order of steps shown in the following embodiments are merely examples and are not intended to limit the scope of the claims. Furthermore, among the components in the following embodiments, components that are not described in an independent claim showing a top concept are described as optional components.

[0043] (Anti-transpiration agent) In this aspect, the present disclosure provides a composition for suppressing transpiration of a plant body.

[0044] In one aspect, the present disclosure provides a composition for reversible transpiration suppression of a plant or a part thereof, comprising jasmonic acids. In the present disclosure, when jasmonic acids are applied to a plant, transpiration suppression of the plant can be performed, and this can be preferably performed reversibly. The composition of the present disclosure may be provided in a form that can be used as it is as a dilution solution, or may be provided as a concentrated solution or concentrate (also referred to as a stock solution in this specification) intended to be diluted at or before use. Therefore, when the composition of the present disclosure is provided as a stock solution, it can be provided as a dilution solution by diluting it with an appropriate dilution medium (for example, water, an organic solvent (such as alcohol), a mixture thereof, etc.).

[0045] The jasmonic acids used in the present disclosure may be jasmonic acid, a jasmonic acid derivative, or a mixture thereof (e.g., a mixture of jasmonic acid and one or more jasmonic acid derivatives, or a mixture of two or more different jasmonic acid derivatives). In a preferred embodiment, the jasmonic acid derivative includes prohydrojasmone. Alternatively, the prohydrojasmone or a derivative thereof that may be used in the present disclosure may be methyl jasmonate, prohydrojasmone, isoleucine jasmonate, phenylalanine jasmonate, valine jasmonate, jasmonic acid glucoside, epijasmonic acid, methyl epijasmonate, etc. In a preferred embodiment, the jasmonic acid derivative is prohydrojasmone.

[0046] The present disclosure can be used for any plant, but preferably for monocotyledonous plants. In a preferred embodiment, the present disclosure can be for cereals. Alternatively, the present disclosure can be for graminaceous plants (e.g., rice, preferably paddy rice) and the like.

[0047] In one embodiment, the subject of the present disclosure may be an above-ground part, an edible part of a crop, or a seed. The present disclosure can provide reversible transpiration suppression. If transpiration suppression is irreversible, the absorption of water and nutrient elements using the transpiration flow will also decrease, resulting in a decrease in crop yield and quality, so it is desirable for it to be temporary and reversible.

[0048] The plants targeted by the present disclosure may be any vegetation, but are preferably aquatic plants, and more preferably, may be, but are not limited to, emerged plants or wetland plants.

[0049] The composition of the present disclosure may take any dosage form, and may be a dust, DL dust, FD agent (flow dust), granule, jumbo agent, dust granule, fine granule, fine granule, powder, wettable powder, flowable sol (SC), granule water dispersible agent, dry flowable water soluble agent, granule water soluble agent, emulsion, EW agent, liquid, ME liquid, oil, surf agent, aerosol, paste, smoke agent, fumigant, microcapsule, or pack, and preferably a liquid, granule, flowable agent, jumbo agent, emulsion, granule water dispersible agent, dust, microcapsule, or aerosol.

[0050] In one embodiment, the jasmonic acid may be prohydrojasmone. When prohydrojasmone is applied, it is used to suppress transpiration for a period of 0.5 hours or more and less than 2 days after application.

[0051] Antitranspiration can be achieved by using natural or synthetic plant hormones and their derivatives that promote adaptation to abiotic and biotic stresses such as heat and water deficit. Antitranspiration agents can be used to prevent excessive transpiration by closing stomata, reducing transpiration and thus increasing leaf temperature under heat stress.

[0052] The technology of the present disclosure solves the concerns about serious water shortages in agricultural production and food supply caused by global warming. Water shortages have been reported to affect crop production in Europe, India, South America, and the United States. Rising temperatures lead to increased transpiration in plants due to upregulation of stomatal conductance and reduced leaf water potential. The present disclosure has solved these problems. According to the technology of the present disclosure, as a solution to improve water shortage tolerance in rice, excessive transpiration can be delayed using a transpiration inhibitor. Commercially available microcrystalline wax and paraffin wax agents that have been used for this purpose in the past can physically cover the leaf surface and reduce water loss, but have the disadvantage that the effect is irreversible. However, according to the technology of the present disclosure, reversible transpiration inhibition can be achieved.

[0053] In one embodiment, the present disclosure demonstrated the superiority of prohydrojasmone (PDJ) in suppressing transpiration in the indica rice cultivar Takanari in greenhouse conditions compared to commercially available microcrystalline wax and paraffin agents. Microcrystalline wax and paraffin agents suppressed transpiration by about 30-50% 3 hours after application, and the suppression of transpiration lasted for 7 days after treatment, depending on the concentration and agent used, whereas PDJ suppressed transpiration by about 40-80% compared to the control 0.5 hours after treatment, and the effect lasted for 1 day. However, the effect was almost gone 7 days after treatment. Thus, PDJ affects transpiration in a different manner than commercially available products and can be used to reduce excess transpiration in rice, especially when initial, transient, reversible suppression is required.

[0054] In the present disclosure, the composition of the present disclosure functions to inhibit transpiration in a manner different from the physical inhibition caused by microcrystalline wax and paraffin wax.For example, the transpiration inhibitor used in the present disclosure physically seals stomata or leaf surface when applied, and its effect can disappear 3 hours after application, or up to 7 days after application, and it has been shown to have short- to medium-term effect and be reversible.

[0055] Jasmonates, such as their methyl esters (MeJA), have been reported to induce water stress tolerance in several plant species, including soybean and barley, and 12-oxo-phytodienoic acid (12-OPDA) is also known to function as a regulator of stomatal closure together with ABA in Arabidopsis thaliana. In light of these reports, JA, its derivatives and precursors play important roles in adaptation to drought stress through stomatal closure, but the effective concentrations and timing vary depending on the compound and plant species.

[0056] In the composition of the present disclosure, the active ingredient PDJ etc. can be used at any concentration, but the range is 0.01 to 1000 (μmol / L), preferably 0.1 to 500 (μmol / L), more preferably 10 to 100 (μmol / L). For example, PDJ acts quickly and is active in a relatively small amount. The effect of PDJ etc. can be observed 0.5 hours to 2 days after application when about 10 μmol / L is applied.

[0057] The composition of the present disclosure is mediated by a hormone response, so its effect is reversible. Stomatal closure is controlled by various signals such as light, humidity, and sugar decomposition, and the long-term inhibitory effect of external application of PDJ is unstable, and negative feedback control may be induced depending on the concentration and application time of PDJ.

[0058] The compositions of the present disclosure can be used as inhibitors of excessive transpiration in plants of interest such as rice due to their early, transient and reversible inhibition. These properties are important in adapting to transient heat stresses such as the Föhn phenomenon and water shortages, where rapid recovery from suppressed transpiration is necessary for normal growth and yield.

[0059] Thus, according to the present disclosure, by applying a plant hormone derivative as a transpiration suppressing component, it is possible to induce stomatal closure temporarily and cause transpiration suppression. Since this transpiration suppression is a reversible reaction, effective transpiration suppression is possible by applying the compound in a flexible manner in response to changes in weather conditions, etc.

[0060] The present disclosure can be used, for example, in the cultivation of rice. The present disclosure can also suppress hypertranspiration in response to a sudden high temperature forecast, and can be used to suppress the translocation of heavy metals, etc.

[0061] (Method for suppressing transpiration of plants) The present disclosure also provides a method for suppressing transpiration of a plant body. Preferably, the suppression of transpiration may be reversible.

[0062] In one aspect, the present disclosure provides a method for suppressing transpiration of a plant body, comprising a step of applying jasmonic acids to the plant body. The method of the present disclosure may employ any of the embodiments and features described in the present specification, particularly in the section (transpiration suppressant), in combination as necessary. In one embodiment, the present disclosure provides a composition containing jasmonic acids directly as a liquid that can be used as is (also referred to as a diluted liquid in the present specification), and the jasmonic acids may be applied as is. Alternatively, in another exemplary embodiment, when the present disclosure provides jasmonic acids as a concentrated liquid, the method may include a step of diluting the jasmonic acids with an appropriate dilution medium (e.g., water, an organic solvent (e.g., alcohol), a mixture thereof, etc.) at or before use.

[0063] The application in the present disclosure may be any method such as spraying, coating, addition to the cultivation environment (also referred to as environmental spraying), etc. In addition to spraying on plants, spraying in the environment may be considered as the spraying.

[0064] When spraying on plants, it is effective to spray on the underside of leaves where there are many stomata. When spraying on leaves, the spray may contain an auxiliary agent that is retained on the leaf surface. Such an auxiliary agent may include a surfactant.

[0065] In the case of environmental spraying, since it is expected that the product will be absorbed mainly through the roots, it can be sprayed by hand from a product bag, by mechanical spraying using a manual sprayer, a power sprayer, an unmanned helicopter or a drone, or by soil treatment or application at the base of plants.

[0066] (Reducing plant planting pain) The composition or method of the present disclosure can reduce or eliminate planting pain in plants. Planting pain refers to damage that occurs when planting or replanting a plant (e.g., rice or vegetables), and the plant's roots are cut, causing it to temporarily stop growing or its leaves to fall off. By using the technology of the present disclosure, such damage can be suppressed or eliminated.

[0067] To reduce or eliminate planting pain, it is effective to use it 0.5-24 hours before transplanting or planting. If drought, light rain, high temperatures, dryness, etc. are predicted before transplanting seedlings, it is possible to reduce or eliminate planting pain by using it before these phenomena are predicted to occur.

[0068] (Reduction of drought damage to plants) The composition or method of the present disclosure can reduce or eliminate drought damage to plants. Drought damage refers to damage caused by water deficiency in plants (e.g., rice, vegetable seedlings). Drought damage is damage caused by lack of water due to, for example, drought, and occurs when an appropriate amount of rain does not fall at appropriate intervals and measures such as irrigation are not taken at the same time. The composition or method of the present disclosure can suppress or eliminate such damage.

[0069] In order to reduce or eliminate drought damage, it is effective to use it 0.5 to 24 hours before drought, light rain, high temperature and dryness, etc. are predicted. When drought, light rain, high temperature and dryness, etc. are predicted, it is possible to reduce or eliminate drought damage by using it before the occurrence of these phenomena.

[0070] (Reduction of loss in quality or yield of harvested plant matter) The composition or method of the present disclosure can also reduce or improve the quality of the harvested product. The suppression of the decrease in quality and yield can be confirmed by grain identification, the number of unhulled grains per ear (total number of unhulled grains divided by number of ears), and the weight of 1,000 grains of brown rice (calculated by counting the number of grains per 20 g of polished brown rice). When cultivated in an environment where planting damage or drought damage occurs, the use of the present disclosure can suppress or improve the decrease in the quality and / or yield of the harvested product (for example, rice in rice), which is a remarkable effect.

[0071] During the reproductive growth period, especially in the ripening period from one week before heading to three weeks after heading, if drought, light rain, high temperatures, dryness, or hot, dry winds (Föhn) are predicted, it is possible to reduce or eliminate any decline in the quality or yield of the harvested crop by applying this product 0.5 to 24 hours before the predicted occurrence of such phenomena. If the above weather conditions continue, it is acceptable to apply this product several times every 3 to 7 days.

[0072] (Pesticide use) The composition of the present disclosure can be used as an inhibitor of excessive transpiration in plants (e.g., rice) due to the transient and reversible inhibition. The composition of the present disclosure can be used in the early stages of plant growth. These properties are important in adapting to transient heat stress such as the Föhn phenomenon and water shortages. Transient and reversible inhibition is particularly useful because early recovery from the suppressed state of transpiration is necessary for normal growth and harvest.

[0073] For example, if drought, light rain, high temperatures, dryness, etc. are predicted before transplanting seedlings, applying the product 0.5 to 24 hours before transplanting can reduce drought damage that occurs at the time of transplanting. Also, if drought, light rain, high temperatures, dryness, hot dry winds (Föhn winds), etc. are predicted during the reproductive growth period, or in the case of paddy rice, especially during the ripening period from one week before heading to three weeks after heading, applying the product 0.5 to 24 hours before these phenomena are predicted to occur can not only reduce the decline in quality and yield, but can also improve quality and yield depending on the application conditions. If light rain, high temperatures, dryness, hot dry winds (Föhn winds), etc. are predicted throughout the cultivation period, spray application should be performed 0.5 to 24 hours before transplanting.

[0074] (Cultivation method) In this specification, the cultivation of plants can be carried out by any method known in the art. The cultivation method of plants is described in, for example, the rice cultivation guideline (Niigata Prefecture Agriculture, Forestry and Fisheries Department) and the like, which can be appropriately referred to in this disclosure, and the necessary descriptions (preferably the whole) are incorporated by reference in this specification as necessary.

[0075] (Note) In this specification, "or" is used when "at least one or more" of the items listed in the sentence can be employed. The same applies to "alternative." In this specification, when it is specified that "within a range of two values," the range includes the two values ​​themselves.

[0076] All references cited herein, including scientific literature, patents, patent applications, and the like, are hereby incorporated by reference in their entirety to the same extent as if each was specifically set forth.

[0077] The present disclosure has been described above by showing preferred embodiments for ease of understanding. The present disclosure will be described below based on examples, but the above description and the following examples are provided for illustrative purposes only and are not provided for the purpose of limiting the present disclosure. The present invention will be described in more detail below by reference examples, examples and test examples, but they are provided for illustrative purposes only and the present disclosure is not limited thereto. The compound names shown in the following reference examples and examples do not necessarily follow the IUPAC nomenclature. Abbreviations may be used to simplify the description, but these abbreviations have the same meaning as described above. The scope of the present disclosure is not limited to the embodiments or examples specifically described in this specification, but is limited only by the claims. EXAMPLES

[0078] Where necessary, the handling of organisms used in the following examples was in compliance with the standards set by the Japanese government or the National Agriculture and Food Research Organization. In addition, although the reagents used were specifically products described in the examples, equivalent products from other manufacturers (Sigma-Aldrich, Wako Pure Chemical Industries, Nacalai Tesques, Kanto Chemical, etc.) can be used instead.

[0079] (Example 1: Rice: Comparison of conventional antitranspirants and PDJ) In this example, a comparison is made between a conventional antidesiccant and PDJ.

[0080] Materials and Methods (Plant growth conditions) Seeds of the indica variety Takanari were sterilized with 5% ipconazole and 4.6% copper hydroxide, and then germinated by soaking in 1 / 10 MS medium containing MS vitamins at 25.0°C under continuous white fluorescent light. Germinated seeds were grown in seedling soil containing nitrogen, phosphorus, and potassium for 10-14 days under the same conditions as above, and five seedlings were transplanted into pots (150mm x 150mm) containing 350g of soil. They were grown in a greenhouse under natural photoperiod conditions of 25°C / 20°C (day / night) until the maximum tillering stage, which was 5-6 weeks.

[0081] (Application of drugs) To evaluate the inhibition of transpiration, 20 plants were sprayed with 100 ml of 2,000- or 20,000-fold diluted PDJ (5% by weight PDJ, final concentrations 98.3 μM and 9.83 μM, respectively, Jasmomate; Meiji Seika Pharma Co., Ltd., Japan), 5- or 10-fold diluted microcrystalline wax (Greener; 10% microcrystalline wax, Greener LLC, JP), or 100- or 200-fold diluted paraffin wax (Abion C; 36% paraffin wax, Abion Co., Ltd., Japan) using a plastic spray bottle according to the manufacturer's instructions. Control plants were sprayed with a 2,000-fold diluted solution of the solvent for PDJ, or tap water for the other cases.

[0082] (Measurement of transpiration rate) Transpiration was measured as described above using a porometer (AP4, Delta-T, UK) at 0.5 h, 1 day, 2 days, and 7 days after PDJ treatment, and at 3 h, 2 days, and 7 days after paraffin wax and microcrystalline wax treatment. At the same time, thermal images were taken using a thermo camera (Thermal Shot F30S, NEC / Avio) at 0 h, 0.5 h, 2 days, and 7 days after PDJ treatment, and at 2 days and 7 days after paraffin wax and microcrystalline wax treatment. The thermal images were analyzed using image analysis software (NS9500LT, Avio, Japan). Two independent similar experiments were performed.

[0083] (result) In this example, we first examined the experimental conditions using microcrystalline wax, which is commonly used to suppress transpiration in various plants including rice. Stomatal conductance was measured using a porometer on the expanded leaves of the indica rice cultivar Takanari sprayed with microcrystalline wax. Transpiration was suppressed by about 50% 3 hours after spraying a 5-fold or 10-fold diluted solution of microcrystalline wax. The effect lasted for 2 days regardless of the drug concentration. The effect was also observed 7 days after treatment (Table 1). [Table 1]

[0084] The suppression of transpiration in foliage can also be monitored by foliage temperature (Fukuda et al., 2018, Iseki and Olaleye, 2020). For this purpose, thermal images were taken using a thermal camera. The foliage temperature of the control plants was also found to be lower than that of the plants sprayed with microcrystalline wax two days after treatment. The difference between the treatment and control groups was still visible seven days after treatment (Figure 1).

[0085] Paraffin wax diluted 100 or 200 times reduced the amount of evaporation by about 35% to 50% 3 hours after spraying, regardless of the drug concentration. This effect lasted for 2 days and was detectable even 7 days after treatment (Table 2). [Table 2]

[0086] However, foliage temperatures in thermal images 2 and 7 days after treatment were not significantly different from foliage temperatures in control images (Figure 2).

[0087] In plants sprayed with paraffin wax, transpiration was clearly suppressed, although it could not be monitored by thermal imaging. The reason why foliage temperature could not reflect the suppressive effect of paraffin wax is unclear, but may be due to the presence of surfactants in the solvent.

[0088] These chemicals physically coat the leaf surface and their effects cannot be measured by the porometer until they dry to a waxy coating. Therefore, early responses were not detected by the porometer. Thus, thermal images of plants sprayed with microcrystalline wax or paraffin wax taken 0.5 hours later did not initially show any clear difference from plants sprayed with these chemicals (Figures 3 and 4).

[0089] In this example, the difference between the microcrystalline wax and the paraffin wax was not clarified, but both agents were clearly able to inhibit transpiration in a greenhouse under natural light conditions.

[0090] Using the method used to confirm the effect of applying microcrystalline wax and paraffin wax, the transpiration suppression effect of PDJ was investigated by applying a 2,000-fold or 20,000-fold diluted PDJ solution to fully expanded leaves. Regardless of the concentration, PDJ treatment reduced transpiration by approximately 40% to 80% 0.5 hours after spraying. Inhibition by PDJ was observed 1 day after spraying and disappeared 2 and 7 days after spraying with the 20,000-fold diluted solution. The disappearance of the inhibitory effect observed 1 day after spraying with the 2,000-fold diluted solution was faster than that of the 20,000-fold diluted solution (Table 3). [Table 3]

[0091] This result suggests that the concentration in the 20,000-fold dilution was sufficient to inhibit transpiration, and the 2000-fold dilution may have induced a negative feedback response earlier than the 20,000-fold dilution. Therefore, the concentration of PDJ should be selected according to its intended use. Leaf temperature was monitored 0.5 and 3 hours after PDJ treatment, and 2 and 7 days after PDJ treatment. Although the difference in the concentration of PDJ sprayed was unclear, the leaf temperature of the control plants was lower than that of the PDJ-sprayed plants 0.5 hours after treatment. The effect of PDJ was not observed 2 and 7 days after treatment. This is consistent with the stomatal conductance measurement data (Figure 5).

[0092] Compared with other agents, PDJ suppressed transpiration in rice plants earlier and more transiently, suggesting that PDJ inhibits transpiration in a manner different from the physical inhibition caused by commercially available microcrystalline wax and paraffin wax agents. These agents physically seal the stomata or leaf surface, and their effects were observed from 3 hours after treatment up to 7 days after treatment. This result indicates that the transpiration inhibition effects of microcrystalline wax and paraffin wax agents are not transient, but continue for about a week.

[0093] PDJ is a derivative of JA and therefore partially functions similarly to JA. Classically, JA methyl ester (MeJA) induces water stress tolerance in several plant species, including soybean and barley (Horton, 1991; Wang et al., 2020). 12-oxo-phytodienoic acid (12-OPDA), a precursor of JA, functions as a regulator of stomatal closure together with ABA in Arabidopsis (Savchenko, et al., 2014). In light of these reports, JA, its derivatives and precursors play an important role in adapting to drought stress through stomatal closure, but the effective concentration and timing vary depending on the compound and plant species. PDJ acts rapidly and is active in relatively small amounts. The effect was detected 0.5 hours after spraying a 20,000-fold diluted solution of PDJ (20,000-fold diluted solution (9.8 μM) of a 5% by weight solution of PDJ) and was observed 1 day after spraying, but disappeared 2 days after spraying (Table 3, Figure 5).

[0094] Of course, hormone responses are reversible, and stomatal closure is controlled by various signals, such as light, humidity, and glycolysis (Daszkowska-Golec and Szarejko, 2013; Lawson and Matthews, 2020). Therefore, the long-term inhibitory effect of external application of PDJ is unstable, and negative feedback regulation may be induced depending on the PDJ concentration.

[0095] In summary, PDJ can be used as an inhibitor of excessive transpiration in rice, especially due to its early, transient and reversible inhibition. These properties are important in adapting to transient heat stress such as the Föhn phenomenon and water shortage. Meanwhile, early recovery from the suppressed state of transpiration is necessary for normal growth and yield. However, MeJA has been reported to inhibit stomatal development in Arabidopsis (Deng et al., 2020).

[0096] (Example 2: Suppression of pain during transplantation of seedlings) (method) If drought, light rain, high temperatures, dryness, etc. are predicted before transplanting seedlings, spray PDJ diluted 20,000 times or, in some cases, 2000 times, for paddy rice, 0.5 to 24 hours before transplanting. (result) Spray application of PDJ can reduce planting damage when transplanting seedlings.

[0097] (Example 3: Suppression of yield and quality loss due to hypertranspiration caused by drought damage and high temperatures during ripening) (method) During the reproductive growth period, especially in the ripening period from one week before heading to three weeks after heading, when drought, light rain, high temperatures, dryness, or hot, dry winds (Föhn) are predicted, PDJ diluted 20,000-fold or, in some cases, 2000-fold should be sprayed 0.5 to 24 hours before the ripening period. If the above weather conditions continue, PDJ may be applied several times every 3 to 7 days. (result) Spray application of PDJ can suppress yield and quality losses caused by drought damage and hypertranspiration due to high temperatures during ripening.

[0098] (Example 4: Suppression of rice leaf blight (Nagasaki Prefecture) and white head (Niigata Prefecture) by high-temperature dry wind (Föhn)) (method) If light rain, high temperatures, dryness, or hot, dry winds (Föhn) are predicted throughout the cultivation period, spray PDJ diluted 20,000-fold or, in some cases, 2000-fold, 0.5-24 hours prior to the cultivation period. If the above weather conditions continue, spraying may be performed several times every 3-7 days. (result) Spray application of PDJ can suppress rice leaf blight and white head caused by hot, dry winds (Föhn).

[0099] Example 5: Agent The composition of the present disclosure may be provided in any formulation, for example, as a liquid formulation as described below. These can be produced by mixing the components shown. Jasmomate liquid concentrate Propyl=3 oxo-2-pentyl cyclopentyl acetate (Common name: Prohydojasmone) 1.0-10.0w / v% (e.g., 5.0w / v%) 1-Propanol 30.0~40.0w / v% (e.g., 33.0w / v%) Surfactant 25.0~35.0w / v% (e.g., 30.0%w / v%) Water remaining An instruction sheet can be attached to instruct the user to use the solution at an appropriate dilution (e.g., 2000-fold dilution (e.g., PDJ final concentration 100 μM)).

[0100] Example 6: Gene Expression Analysis Conventionally grown, commonly cultivated cultivar Hinohikari was transplanted to 1 / 5000a Wagner pots at the panicle differentiation stage, and 20 mL of 2,000-fold diluted PDJ (Jasmomate, Meiji Seika Pharma Co., Ltd., Japan) was sprayed into each pot on the 7th day after heading. Total RNA was extracted from the spikelets that were left standing overnight in an artificial incubation room set at 32 / 28°C (day / night), and RNAseq analysis was performed. Plants sprayed with a 2,000-fold diluted solution of the solvent were used as control plants.

[0101] The RNASeq analysis is as follows. Total RNA was extracted from the spikelets that had been left to stand overnight after PDJ treatment, and a library was created using the KAPA Stranded mRNA-Seq Kit (KAPABIOSYSTEMS). 14 cycles of PCR amplification were performed, and the adapters from the Fast Gene Adapter Kit (Fast Gene) were used. The quality of the library was checked using the Fragment Analyzer High Sensitivity NGS Fragment Analysis Kit (Advanced Analytical Technologies), and sequencing was performed using NextSeq500 under the condition of 2x76bp. The obtained reads were quality checked using Sickle (ver. 1.33), and bases with values ​​less than 20 were removed, and reads with fragment lengths of 30 bases or less and their paired reads were discarded. The filtered reads were mapped to the reference sequence (The Rice Annotation Project Database http: / / rapdb.dna.affrc.go.jp / download / irgsp1.html) using Hisat2 (ver.2.1.0), and bam files were obtained using Samtools (ver.1.3). Read sequences mapped to gene regions were counted using feature Counts (ver.1.5.0p3). After normalization using the iDEGES normalization method, differentially expressed genes were identified using DESeq.

[0102] The sequences of the primers used are as follows: (Primer sequences used in library construction) (Index Ligation) Ad153_5T_1-index / 5Phos / AGTCGGAGGCCAAGCGGTCTTAGGAAGACAATGAAGCGTTGCAACTCCTTGGCTCACA (SEQ ID NO: 1) Ad153_5T_1-index / 5Phos / AGTCGGAGGCCAAGCGGTCTTAGGAAGACAACGTGCGATCCCAACTCCTTGGCTCACA (SEQ ID NO: 2) MGI Tech Co.,Ltd Tech. Support Center Field Application Support Team Ad153_5T_1-index / 5Phos / AGTCGGAGGCCAAGCGGTCTTAGGAAGACAATCGGAAGGCACAACTCCTTGGCTCACA (SEQ ID NO: 3) Ad153_5T_1-index / 5Phos / AGTCGGAGGCCAAGCGGTCTTAGGAAGACAACCGATGTCGCCAACTCCTTGGCTCACA (SEQ ID NO: 4) Ad153_5T_1-index / 5Phos / AGTCGGAGGCCAAGCGGTCTTAGGAAGACAAACTTAGAATGCAACTCCTTGGCTCACA (SEQ ID NO: 5) Ad153_5T_1-index / 5Phos / AGTCGGAGGCCAAGCGGTCTTAGGAAGACAATCCAAGCCTGCAACTCCTTGGCTCACA (SEQ ID NO: 6) Ad153_5T_1-index / 5Phos / AGTCGGAGGCCAAGCGGTCTTAGGAAGACAAAGACGATGATCAACTCCTTGGCTCACA (SEQ ID NO: 7) Ad153_5T_1-index / 5Phos / AGTCGGAGGCCAAGCGGTCTTAGGAAGACAAAGTCTCGTGTCAACTCCTTGGCTCACA (SEQ ID NO: 8) Ad153Ω_Bottom_2: TTGTCTTCCTAAGGAACGACATGGCTACGATCCGACTT (SEQ ID NO: 9) (PCR amplification) Ad153_PCR2_2: TGTGAGCCAAGGAGTTG (SEQ ID NO: 10) Ad153_PCR2_1: / 5Phos / GAACGACATGGCTACGA (SEQ ID NO: 11) (Sequence) Read 1 sequencing primer: GCTCACAGAACGACATGGCTACGATCCGACTT (SEQ ID NO: 12) Read 2 sequencing primer: TTGTCTTCCTAAGACCGCTTGGCCTCCGACTT (SEQ ID NO: 13) (adapter sequence) Read 1 side: AAGTCGGAGCCAAGCGGTCTTAGGAAGACAA (SEQ ID NO: 14) Read 2 side: AAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTG (SEQ ID NO: 15)

[0103] The results are shown in Figure 6. For each gene, the expression level of the control is shown as 1. These results indicate that gene products related to transpiration are suppressed.

[0104] (Note) While the present invention has been illustrated by way of preferred embodiments thereof, it is understood that the scope of the present invention should be interpreted only by the claims. It is understood that the patents, patent applications, and other documents cited in this specification are incorporated by reference into this specification in the same manner as if the contents themselves were specifically set forth herein. [Industrial Applicability]

[0105] The present disclosure can be used in agriculture, particularly in the cultivation of cereals. [Sequence List Free Text]

[0106] SEQ ID NO: 1: Primer sequence for index ligation SEQ ID NO: 2: Primer sequence for index ligation SEQ ID NO: 3: Primer sequence for index ligation SEQ ID NO: 4: Primer sequence for index ligation SEQ ID NO: 5: Primer sequence for index ligation SEQ ID NO: 6: Primer sequence for index ligation SEQ ID NO: 7: Primer sequence for index ligation SEQ ID NO: 8: Primer sequence for index ligation SEQ ID NO: 9: Primer sequence for index ligation SEQ ID NO: 10: Primer sequence for PCR amplification SEQ ID NO: 11: Primer sequence for PCR amplification SEQ ID NO: 12: Sequencing primer sequence SEQ ID NO: 13: Sequencing primer sequence SEQ ID NO: 14: Adapter sequence SEQ ID NO: 15: Adapter sequence

Claims

1. A composition for relieving planting pain in a plant, the composition comprising jasmonic acids.

2. A composition for reducing drought damage in a plant body, the composition comprising jasmonic acids.

3. A composition for reducing a decline in the quality or yield of a plant harvest, the composition comprising jasmonic acids.

4. The composition according to any one of claims 1 to 3, wherein the jasmonates include jasmonic acid or a jasmonic acid derivative.

5. The composition according to claim 4 , wherein the jasmonic acid derivative is prohydrojasmone or a derivative thereof.

6. 5. The composition of claim 4, wherein the jasmonic acid derivative is selected from the group consisting of methyl jasmonate, prohydrojasmone, isoleucine jasmonate, phenylalanine jasmonate, valine jasmonate, jasmonic acid glucoside, epijasmonic acid, methyl epijasmonate, dihydrojasmonic acid and tuberonic acid.

7. The composition according to claims 4 to 6, wherein the jasmonic acid derivative is prohydrojasmone.

8. The composition according to any one of claims 1 to 7, wherein the plant body is a monocotyledonous plant.

9. The composition according to any one of claims 1 to 8, wherein the plant is a cereal.

10. The composition according to any one of claims 1 to 9, wherein the plant body is a grass family plant.

11. The composition according to any one of claims 1 to 10, wherein the plant body is an aquatic plant.

12. The composition according to any one of claims 1 to 7, wherein the plant body is an emergent plant or a wetland plant.

13. The composition according to any one of claims 1 to 7, wherein the plant body is rice.

14. The composition according to any one of claims 1 to 13, which is in a dosage form selected from the group consisting of a liquid formulation, a granule, a flowable formulation, a jumbo formulation, an emulsifiable concentrate, a water dispersible granule, a dust, a microcapsule formulation and an aerosol.

15. The composition according to any one of claims 1 to 14, wherein the jasmonic acid is prohydrojasmone, and the prohydrojasmone is used after dilution to 10 µM to 100 µM.

16. The composition according to any one of claims 1 to 15, wherein the jasmonic acid is prohydrojasmone, and the prohydrojasmone is used for transpiration inhibition for 0.5 hours or more and less than 2 days after application.

Images