Oligonucleotides for inducing paternal UBE3a expression

Abstract

To provide oligonucleotides that are capable of inducing expression of ubiquitin-protein ligase E3A (UBE3A) from the paternal allele in animal or human neurons.SOLUTION: The oligonucleotides target the suppressor of the UBE3A paternal allele by hybridization to SNHG14 long non-coding RNA downstream of SNORD109B. The present invention further relates to pharmaceutical compositions and methods for treatment of Angelman syndrome.SELECTED DRAWING: Figure 1

Description

[Technical field]

[0001] The present invention relates to oligonucleotides (oligomers) that are complementary to SNHG14 downstream of SNORD109B and that hybridize to SNHG14 to induce paternal expression of ubiquitin-protein ligase E3A (UBE3A) in animals or humans.The present invention further relates to pharmaceutical compositions and methods for the treatment of Angelman syndrome. [Background technology]

[0002] Angelman syndrome is a neurogenetic disorder caused by the deletion or inactivation of the maternally derived UBE3A gene on chromosome 15q11.2. The paternal copy of the UBE3A gene is genomic imprinted and silenced in neurons by an endogenous antisense transcript of UBE3A designated SNHG14 (also known as UBE3A-ATS) (Meng et al. 2012 Hum Mol Genet. Vol. 21 pp. 3001-12). Cell types other than neurons appear to express UBE3A genes derived from both maternal and paternal alleles.

[0003] Angelman syndrome is characterized by severe intellectual and developmental disability, sleep disorders, seizures, seizure-like movements, EEG abnormalities, frequent laughing or smiling, and severe speech impairment.

[0004] WO2012 / 064806 discloses a method for inducing UBE3A expression in cells using a topoisomerase inhibitor. This method can be used to treat Angelman syndrome. However, no antisense oligonucleotide is disclosed.

[0005] WO2014 / 004572 discloses oligonucleotides with 2'-O-methoxyethyl-RNA (MOE) modifications targeting mouse UBE3A-ATS. These oligonucleotides have only been tested in mouse-related assays. There is no evolutionary conservation between mouse and human in the regions downstream of MBII-52 snoRNA (also known as SNORD115) and upstream of UBE3A pre-mRNA. Thus, oligonucleotides targeting mouse UBE3A-ATS cannot be translated into oligonucleotides that function in humans. Also, no oligonucleotides targeting human UBE3A-ATS are disclosed. Summary of the Invention

[0006] Objective of the invention The present invention identifies novel oligonucleotides that induce expression of human paternal UBE3A in neuronal cells without significantly affecting the expression of paternal SNORD115, SNORD116, and SNRPN transcripts.

[0007] Summary of the Invention The present invention relates to oligonucleotides that target nucleic acids capable of suppressing the expression of UBE3A and treat or prevent diseases associated with decreased UBE3A activity, particularly in neuronal cells.

[0008] Thus, in a first aspect, the present invention provides an oligonucleotide having at least 98% complementarity with a portion of human SNHG14 long non-translated RNA corresponding to position 25278410 to position 25419462 of human chromosome 15 of genome version GRCh38.p2, comprising a contiguous nucleotide sequence of 10 to 30 nucleotides in length. This region is also similar to SEQ ID NO: 1. The oligonucleotide may be an antisense oligonucleotide, preferably with a gapmer design. The oligonucleotide is preferably capable of inducing expression of UBE3A, in particular expression of paternal UBE3A in neuronal cells, by degradation, reduction or removal of UBE3A repressors, in particular reduction of SNHG14 long non-translated RNA transcripts downstream of SNORD109B. Re-expression of UBE3A is achieved without significantly affecting expression of SNORD115. Degradation of the target nucleic acid is preferably achieved by recruitment of nucleases.

[0009] In a further aspect, the present invention provides a pharmaceutical composition comprising an oligonucleotide of the invention and a pharma- ceutically acceptable diluent, carrier, salt, and / or adjuvants.

[0010] In a further aspect, the present invention provides a method for inducing expression of UBE3A in a target cell in vivo or in vitro, comprising administering an effective amount of an oligonucleotide or composition of the present invention to said cell in which expression of paternal UBE3A is suppressed.

[0011] In a further aspect, the present invention provides a method for treating or preventing a disease, disorder, or dysfunction associated with the in vivo activity of UBE3A, comprising administering a therapeutically or prophylactically effective amount of an oligonucleotide of the present invention to a subject suffering from or suspected of suffering from the disease, disorder, or dysfunction.

[0012] In a further aspect, the oligonucleotide or composition of the invention is used to treat or prevent Angelman syndrome. [Brief description of the drawings]

[0013] [Figure 1] In FIG. 1, the top strand shows the region of the SNHG14 transcript (UBE3A-ATS) downstream of SNORD109B. Each filled box indicates the position of the oligonucleotide in the tested mouse. The bottom strand shows the UBE3A coding region, and each filled box indicates an exon. Exon 1 is located at approximately 160 kb. These oligonucleotides are located in the antisense region of exon 9 (located at approximately 97 kb), exon 10 (located at approximately 92 kb), exon 13 (located at approximately 77 kb), and exon 16 (located at approximately 60 kb) at the 5' end. [Diagram 2] FIG. 2 shows the ability of oligonucleotides tested in Example 2 to induce re-expression of UBE3A in human neuronal cell cultures. Oligonucleotides complementary to a region of human SNHG14 long untranslated RNA between SNORD109B and the upstream region of the UBE3A coding region (position 1 to position 55318 of SEQ ID NO:1) are shown with a "● (non-overlapping)". Oligonucleotides complementary to a region of human SNHG14 long untranslated RNA that is antisense to the UBE3A·mRNA precursor (position 55319 to position 141053 of SEQ ID NO:1) are shown with a "▲ (overlapping)". Oligonucleotides with human and rhesus conservation from Table 3 are shown at the bottom of each plot as a "□" (gray box). Conservation between human:rhesus:mouse is shown as a black box. Oligonucleotide concentrations were 0.2, 1, and 5 microM, as indicated to the right of each plot. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0014] definition Oligonucleotides The term "oligonucleotide" as used herein is generally defined as a molecule that contains two or more covalently linked nucleosides, as generally understood by those skilled in the art. Such covalently linked nucleosides may also be referred to as nucleic acid molecules or oligomers. Oligonucleotides are generally prepared by solid-phase chemical synthesis in a laboratory and purified. When referring to the sequence of an oligonucleotide, it refers to the sequence or order of the nucleobase moieties of the covalently linked nucleotides or nucleosides or their modifications. The oligonucleotides of the present invention are artificial, chemically synthesized, and typically purified or isolated. The oligonucleotides of the present invention may contain one or more modified nucleosides or nucleotides.

[0015] Antisense oligonucleotides The term "antisense oligonucleotide" as used herein is defined as the oligonucleotide that can regulate the expression of target gene by hybridizing to target nucleic acid, particularly the continuous sequence of target nucleic acid.These antisense oligonucleotides are not essentially double-stranded, and therefore are not siRNA.Preferably, the antisense oligonucleotide of the present invention is single-stranded.

[0016] Contiguous nucleotide sequence The term "contiguous nucleotide sequence" as used herein refers to a region of an oligonucleotide that is complementary to a target nucleic acid. This term is used interchangeably herein with the terms "contiguous nucleobase sequence" and "oligonucleotide motif sequence." In some embodiments, all nucleotides of an oligonucleotide are present in a contiguous nucleotide sequence. In some embodiments, an oligonucleotide comprises a contiguous nucleotide sequence, and may optionally further comprise nucleotides (e.g., a nucleotide linker region that may be used to attach a functional group to the contiguous nucleotide sequence). The nucleotide linker region may or may not be complementary to a target nucleic acid.

[0017] nucleotide Nucleotides are the building blocks of oligonucleotides and polynucleotides, and for the purposes of the present invention, include both naturally occurring and non-naturally occurring nucleotides. In nature, nucleotides (e.g., DNA and RNA nucleotides) contain a ribose sugar moiety, a nucleobase moiety, and one or more phosphate groups (not present in nucleosides). Nucleosides and nucleotides may also be referred to interchangeably as "units" or "monomers."

[0018] Modified Nucleosides As used herein, the term "modified nucleoside" or "nucleoside modification" refers to a nucleoside that is modified relative to an equivalent DNA or RNA nucleoside by introducing one or more modifications into the sugar or (nucleo) base moieties. In a preferred embodiment, the modified nucleoside comprises a modified sugar moiety. The term "modified nucleoside" may also be used interchangeably herein as the term "nucleoside analogue," modified "unit," or modified "monomer."

[0019] Modified Internucleoside Linkages The term "modified internucleoside linkage" as used herein is generally defined as a linkage other than a phosphodiester (PO) linkage that covalently links two nucleosides, as understood by those skilled in the art. A nucleotide having a modified internucleoside linkage is also referred to as a "modified nucleotide". In some embodiments, the modified internucleoside linkage enhances the nuclease resistance of an oligonucleotide compared to a phosphodiester linkage. In the case of naturally occurring oligonucleotides, the internucleoside linkage comprises a phosphate group that forms a phosphodiester bond between adjacent nucleosides. The modified internucleoside linkage is particularly useful for stabilizing oligonucleotides for in vivo use and may act to protect the DNA nucleoside or RNA nucleoside regions of the oligonucleotides of the invention (e.g., within the gap region of a gapmer oligonucleotide, within the region of modified nucleosides, etc.) from cleavage by nucleases.

[0020] In one embodiment, the oligonucleotide comprises one or more internucleoside linkages that have been altered from natural phosphodiester, e.g., to linkages that are more resistant to nuclease attack. Nuclease resistance may be determined by incubating the oligonucleotide in serum or using a nuclease resistance assay (e.g., snake venom phosphodiesterase (SVPD)). Both methods are well known in the art. An internucleoside linkage that can increase the nuclease resistance of an oligonucleotide is referred to as a nuclease-resistant internucleoside linkage. In a preferred embodiment, at least 50% of the internucleoside linkages of the oligonucleotide or its consecutive nucleotide sequence are modified. For example, at least 60%, at least 70%, at least 80, or at least 90% of the internucleoside linkages of the oligonucleotide or its consecutive nucleotide sequence are modified. In some embodiments, all of the internucleoside linkages of the oligonucleotide or its consecutive nucleotide sequence are modified. It is recognized that in some embodiments, the nucleoside that links the oligonucleotide of the present invention to a non-nucleotide functional group (e.g., a conjugate) may be a phosphodiester. In some embodiments, all of the internucleoside linkages of the oligonucleotide or contiguous nucleotide sequence thereof are nuclease resistant internucleoside linkages.

[0021] The modified internucleoside linkage may be selected from the group including phosphorothioate, diphosphorothioate, and boranophosphate. In a preferred embodiment, the modified internucleoside linkage is one that is compatible with RNase H recruitment of the oligonucleotides of the invention, e.g., phosphorothioate, diphosphorothioate, or boranophosphate.

[0022] In some embodiments, the internucleoside linkage comprises sulfur (S), e.g., a phosphorothioate internucleoside linkage.

[0023] Phosphorothioate internucleoside linkages are particularly useful due to their nuclease resistance, favorable pharmacokinetics, and ease of manufacture. In preferred embodiments, at least 50% of the internucleoside linkages of the oligonucleotide or its consecutive nucleotide sequence are phosphorothioate. For example, at least 60%, at least 70%, at least 80, or at least 90% of the internucleoside linkages of the oligonucleotide or its consecutive nucleotide sequence are phosphorothioate. In some embodiments, all of the oligonucleotide or its consecutive nucleotide sequence are phosphorothioate.

[0024] In some embodiments, the oligonucleotide comprises one or more neutral internucleoside linkages, particularly those selected from phosphotriester, methylphosphonate, MMI, amide-3, formacetal, or thioformacetal.

[0025] Further internucleoside linkages are disclosed in WO2009 / 124238, which is incorporated herein by reference. In one embodiment, the internucleoside linkage is selected from the linkers disclosed in WO2007 / 031091, which is incorporated herein by reference. In particular, the internucleoside linkage is -OP(O)2-O-, -OP(O,S)-O-, -OP(S)2-O-, -SP(O)2-O-, -SP(O,S)-O-, -SP(S)2-O-, -OP(O)2-S-, -OP(O,S)-S-, -SP(O)2-S-, -O-PO(R H )-O-, O-PO(OCH3)-O-, -O-PO(NR H )-O-, -O-PO(OCH2CH2S-R)-O-, -O-PO(BH3)-O-, -O-PO(NHR H )-O-, -OP(O)2-NR H -, -NR H -P(O)2-O-, -NR H -CO-O-, -NR H -CO-NR H - and / or said internucleoside linker may be selected from -O-CO-O-, -O-CO-NRH -, -NR H -CO-CH2-, -O-CH2-CO-NR H -, -O-CH2-CH2-NR H -, -CO-NR H -CH2-, -CH2-NR H CO-, -O-CH2-CH2-S-, -S-CH2-CH2-O-, -S-CH2-CH2-S-, -CH2-SO2-CH2-, -CH2-CO-NR H -, -O-CH2-CH2-NR H -CO-, -CH2-NCH3-O-CH2-, where R H is selected from hydrogen and C1-4 alkyl.

[0026] Nuclease-resistant linkages (e.g., phosphorothioate linkages) are particularly useful in regions of oligonucleotides that can recruit nucleases when they form a duplex with a target nucleic acid (e.g., region G of a gapmer) or with unmodified nucleoside regions of the headmers and tailmers. However, phosphorothioate linkages may also be useful in non-nuclease recruiting and / or affinity enhancing regions (e.g., regions F and F' of a gapmer) or with modified nucleoside regions of the headmers and tailmers.

[0027] However, each of the design regions may contain internucleoside linkages other than phosphorothioate (e.g., phosphodiester linkages), particularly in regions where modified nucleosides (e.g., LNA) protect the linkage from nuclease degradation. In particular, the inclusion of phosphodiester linkages (e.g., one or two linkages) between or adjacent to modified nucleoside units (typically in non-nuclease recruiting regions) can modify the bioavailability and / or biodistribution of the oligonucleotide. See WO2008 / 113832 (herein incorporated by reference).

[0028] In one embodiment, all of the internucleoside linkages of the oligonucleotide are phosphorothioate and / or boranophosphate linkages. Preferably, all of the internucleoside linkages of the oligonucleotide are phosphorothioate linkages.

[0029] Nucleic acid bases The term "nucleobase" includes purine (e.g., adenine and guanine) and pyrimidine (e.g., uracil, thymine, and cytosine) moieties present in nucleosides and nucleotides that form hydrogen bonds in nucleic acid hybridization. In the context of the present invention, the term "nucleobase" also encompasses modified nucleobases that may differ from naturally occurring nucleobases but are functional during nucleic acid hybridization. In this context, "nucleobase" refers to both naturally occurring nucleobases (e.g., adenine, guanine, cytosine, thymidine, uracil, xanthine, and hypoxanthine) and non-naturally occurring variants. Such variants are described, for example, in Hirao et al (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1.

[0030] In some embodiments, the nucleobase moiety is modified by changing the purine or pyrimidine to a modified purine or pyrimidine (e.g., a substituted purine or substituted pyrimidine).For example, the nucleobase is selected from isocytosine, pseudoisocytosine, 5-methylcytosine, 5-thiozolocytosine, 5-propynylcytosine, 5-propynyluracil, 5-bromouracil, 5-thiazolauracil, 2-thiouracil, 2'-thiothymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine, and 2-chloro-6-aminopurine.

[0031] The nucleobase moieties may be represented by letter codes (e.g., A, T, G, C, or U) each representing a corresponding nucleobase, where each letter may optionally include a modified nucleobase of equivalent functionality. For example, in the exemplified oligonucleotides, the nucleobase moieties are selected from A, T, G, C, and 5-methylcytosine. In the case of LNA gapmers, 5-methylcytosine LNA nucleosides may optionally be used.

[0032] Modified Oligonucleotides The term "modified oligonucleotide" refers to an oligonucleotide containing one or more sugar-modified nucleosides and / or modified internucleoside linkages. The term "chimeric" oligonucleotide has been used in the literature to refer to oligonucleotides having modified nucleosides.

[0033] Complementarity The term "complementarity" refers to the Watson-Crick base pairing ability of nucleosides / nucleotides. Watson-Crick base pairs are guanine (G)-cytosine (C) and adenine (A)-thymine (T) / uracil (U). Obviously, oligonucleotides may contain nucleosides with modified nucleobases, e.g., 5-methylcytosine is often used instead of cytosine. Thus, the term "complementarity" encompasses Watson-Crick base pairs of unmodified and modified nucleobases (see, e.g., Hirao et al (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1).

[0034] The term "% complementary" as used herein refers to the percentage of nucleotides in a contiguous nucleotide sequence of a nucleic acid molecule (e.g., an oligonucleotide) that is complementary (i.e., forms Watson-Crick base pairs) at a given position to the contiguous nucleotide sequence of a particular nucleic acid molecule (e.g., a target nucleic acid). This percentage is calculated by dividing the number of sequence bases that form pairs between two sequences by the total number of oligonucleotides, and multiplying by 100. In such a comparison, nucleic acid bases / nucleotides that do not match (base pair) are said to be mismatched.

[0035] As used herein, the term "fully complementary" refers to 100% complementarity.

[0036] Hybridization As used herein, the term "hybridizing" or "hybridize" refers to two nucleic acid strands (e.g., an oligonucleotide and a target nucleic acid) forming hydrogen bonds between base pairs of each other's strands, thereby forming a duplex. The binding affinity between two nucleic acid strands is the strength of hybridization. This binding affinity is often measured by the melting temperature (T), which is defined as the temperature at which half of the oligonucleotide becomes duplexed with the target nucleic acid. m ) under physiological conditions, T m is not strictly proportional to affinity (Mergny and Lacroix, 2003, Oligonucleotides 13:515-537). The standard Gibbs free energy ΔG° is a more accurate representation of binding affinity, ΔG°=-RTln(K d ) (where R is the gas constant and T is the absolute temperature) gives the dissociation constant (K d) is related to the energy of the reaction between the oligonucleotide and the target nucleic acid. Thus, a very low ΔG° of the reaction between the oligonucleotide and the target nucleic acid reflects a high strength of hybridization between the oligonucleotide and the target nucleic acid. ΔG° is the energy associated with a reaction at an aqueous concentration of 1M, pH of 7, and temperature of 37°C. The hybridization of the oligonucleotide to the target nucleic acid is a spontaneous reaction, and in the case of a spontaneous reaction, ΔG° is less than zero. ΔG° may be measured experimentally, for example, using the isothermal titration calorimetry (ITC) method described in Hansen et al., 1965, Chem. Comm. 36-38 and Holdgate et al., 2005, Drug Discov Today. Those skilled in the art are aware that commercially available equipment is available for measuring ΔG°. ΔG° may also be estimated numerically by the neighborhood model described in SantaLucia, 1998, Proc Natl Acad Sci USA. 95: 1460-1465, using appropriately derived thermodynamic parameters described in Sugimoto et al., 1995, Biochemistry 34:11211-11216 and McTigue et al., 2004, Biochemistry 43:5388-5405. To have the potential to modulate the intended nucleic acid target by hybridization, the oligonucleotides of the invention hybridize to the target nucleic acid with an estimated ΔG° value of less than -10 kcal for oligonucleotides 10-30 nucleotides in length. In some embodiments, the degree or strength of hybridization is measured by the standard Gibbs free energy ΔG°. The oligonucleotides may hybridize to the target nucleic acid with estimated ΔG° values ​​in the ranges of less than -10 kcal, less than -15 kcal, less than -20 kcal, and less than -25 kcal for oligonucleotides 8 to 30 nucleotides in length. In some embodiments, the oligonucleotides hybridize to the target nucleic acid with estimated ΔG° values ​​of -10 to -60 kcal (e.g., -12 to -40, -15 to -30 kcal), or -16 to -27 kcal (e.g., -18 to -25 kcal).

[0037] target The term "target" refers to a protein which it is desirable to modulate.

[0038] target nucleic acid The target nucleic acid is the intended target to which the oligonucleotide of the present invention hybridizes, and may be, for example, a gene, RNA, non-translated RNA, long non-translated RNA, mRNA, pre-mRNA, mature mRNA, or cDNA sequence. In some embodiments, the target nucleic acid is a non-translated RNA, a long non-translated RNA, or a subsequence thereof. When applied in vivo or in vitro, the oligonucleotide of the present invention can reduce the amount of SNHG14 transcript downstream of SNORD109B, thereby relieving the repression of paternal UBE3A transcript in the intended target cell. The consecutive sequence of nucleobases of the oligonucleotide of the present invention is complementary to the target nucleic acid, measured over the entire length of the oligonucleotide. This sequence may optionally have one or two mismatch exceptions, and may optionally exclude a nucleotide-based linker region that may link the oligonucleotide to any functional group (e.g., a conjugate).

[0039] Target sequence The oligonucleotide comprises a contiguous nucleotide sequence that is complementary or hybridizes to a subsequence of a target nucleic acid molecule. As used herein, the term "target sequence" refers to a sequence of nucleotides present in a target nucleic acid that comprises a nucleobase sequence that is complementary to an oligonucleotide of the present invention. In some embodiments, a target sequence comprises a region of a target nucleic acid that is complementary to a contiguous nucleotide sequence of an oligonucleotide of the present invention. In some embodiments, a target sequence may be longer than the complementary sequence of a single oligonucleotide, e.g., it may represent a preferred region of a target nucleic acid that can be targeted by several oligonucleotides of the present invention.

[0040] The oligonucleotides of the present invention comprise a contiguous nucleotide sequence that is complementary to a target nucleic acid (eg, a target sequence).

[0041] The oligonucleotides described above comprise a contiguous nucleotide sequence of at least 8 nucleotides that is complementary to or hybridizes to a target sequence present in a target nucleic acid molecule. The contiguous nucleotide sequence (hence the target sequence) comprises at least 8 contiguous nucleotides, e.g., 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 contiguous nucleotides, e.g., 12-25, e.g., 14-18 contiguous nucleotides.

[0042] target cell As used herein, the term "target cell" refers to a cell expressing a target nucleic acid. In some embodiments, the target cell may be in vivo or in vitro. In some embodiments, the target cell is a mammalian cell, such as a rodent cell, a mouse cell, a rat cell, a primate cell (e.g., a monkey cell or a human cell). In a preferred embodiment, the target cell is a neuronal cell. Naturally occurring variants

[0043] The term "naturally occurring variants" as used herein refers to variants of the SNHG14 transcript downstream of the SNORD109B gene, or variants of transcripts derived from the same genetic locus as the target nucleic acid that may differ due to the degeneracy of the genetic code resulting in multiple codons in long untranslated RNA. Thus, oligonucleotides of the invention may be designed to target the target nucleic acid, and these naturally occurring variants.

[0044] Regulation of expression The term "modulation of expression" as used herein is understood as a general term that describes the ability of an oligonucleotide to change the amount of UBE3A protein when compared to the amount of UBE3A before administration of the oligonucleotide. Alternatively, modulation of expression may be determined with reference to a control experiment in which the oligonucleotide of the invention is not administered. The modulation achieved by an oligonucleotide relates to its ability to reduce, remove, prevent, decrease, or release the repression of paternal UBE3A transcript, for example, by degrading or removing the untranslated SNHG14 transcript downstream of SNORD109B, or by inhibiting or preventing the polymerase activity associated with the SNHG14 transcript downstream of SNORD109B. Modulation may also be viewed as the ability of an oligonucleotide to restore, increase, or improve the expression of paternal UBE3A, for example, by removing or inhibiting the inhibitory mechanism affected by the untranslated SNHG14 transcript downstream of SNORD109B.

[0045] High-affinity modified nucleosides A high affinity modified nucleoside is a modified nucleotide that, when incorporated into an oligonucleotide, enhances the affinity of the oligonucleotide for a complementary target. This affinity can be measured, for example, by increasing the melting temperature (T m ) The high affinity modified nucleosides of the invention preferably increase the melting temperature by +0.5 to +12°C, more preferably +1.5 to +10°C, and most preferably +3 to +8°C per modified nucleoside. A wide variety of high affinity modified nucleosides are known in the art, including many 2'-substituted nucleosides, locked nucleic acids (LNAs), and the like (see, e.g., Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213).

[0046] sugar modification Oligomers of the invention may contain one or more nucleosides having modified sugar moieties, ie, modifications in the sugar moiety compared to the ribose sugar moiety found in DNA and RNA.

[0047] A variety of nucleosides have been engineered with modifications to the ribose sugar moiety, primarily for the purpose of improving certain properties of oligonucleotides (eg, affinity and / or nuclease resistance).

[0048] Such modifications include those in which the ribose ring structure is modified by replacing it with, for example, a hexose ring (HNA), a bicyclic ring (LNA) typically having a biradical bridge between the C2 and C4 carbons of the ribose ring, or an unlinked ribose ring (e.g., UNA), typically lacking a bond between the C2 and C3 carbons. Other sugar-modified nucleosides include, for example, bicyclohexose nucleic acids (WO2011 / 017521) or tricyclic nucleic acids (WO2013 / 154798). Modified nucleosides also include nucleosides in which the sugar moiety is replaced with a non-sugar moiety, for example, in the case of peptide nucleic acids (PNAs) or morpholino nucleic acids.

[0049] Sugar modifications also include modifications made by changing the substituents of the ribose ring to groups other than hydrogen or to the 2'-OH group found naturally in DNA and RNA nucleosides. Substituents may be introduced, for example, at the 2', 3', 4', or 5' positions. Nucleosides having modified sugar moieties also include 2'-modified nucleosides (e.g., 2'-substituted nucleosides). Indeed, there has been much attention paid to the development of 2'-substituted nucleosides, and many 2'-substituted nucleosides have been found to have useful properties when incorporated into oligonucleotides, such as improved nucleoside tolerance and affinity.

[0050] 2'-Modified Nucleosides 2'-sugar modified nucleosides are nucleosides that have a substituent other than H or -OH at the 2' position (2'-substituted nucleosides) or contain a 2'-linked biradical. 2'-sugar modified nucleosides include 2'-substituted nucleosides and LNA (2'-4' biradical bridge) nucleosides. For example, 2'-modified sugars may increase the binding affinity and / or nuclease resistance of oligonucleotides. Examples of 2'-substituted modified nucleosides include 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA, and 2'-fluoro-ANA (F-ANA). For further examples, see, e.g., Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213; and Deleavey and Damha, Chemistry and Biology 2012, 19, 937. Below are some examples of 2'-substituted modified nucleosides. [ka] [ka]

[0051] Locked Nucleic Acid Nucleosides (LNA) LNA nucleosides are modified nucleosides that contain a linker group (called a biradical or bridge) between the C2'- and C4'-positions of the ribose sugar ring of the nucleotide. These nucleosides are also referred to in the literature as bridged nucleic acids or bicyclic nucleic acids (BNAs).

[0052] In some embodiments, the modified nucleosides or LNA nucleosides of the oligomers of the invention have the general structure of Formula I or II. [ka] [ka] In the formula, W is -O-, -S-, -N(R a )-, -C(R a R b )-, and in some embodiments, -O-; B represents a nucleobase or a modified nucleobase moiety; Z represents an internucleoside linkage to an adjacent nucleoside or the 5'-terminus; Z * represents an internucleoside linkage to an adjacent nucleoside or the 3'-terminus.

[0053] X is -C(R a R b )-, -C(R a )=C(R b )-, -C(R a )=N-, -O-, -Si(R a )2-, -S-, -SO2-, -N(R a )-, and >C=Z.

[0054] In some embodiments, X is -O-, -S-, NH-, NR a R b , -CH2-, CR a R b , -C(=CH2)-, and -C(=CR a R b )-. In some embodiments, X is --O--.

[0055] Y is -C(R a R b )-, -C(R a )=C(R b )-, -C(R a )=N-, -O-, -Si(R a )2-, -S-, -SO2-, -N(R a )-, and >C=Z.

[0056] In some embodiments, Y is -CH-, -C(R a R b )-, -CH2CH2-, -C(R a R b )-C(R a R b )-, -CH2CH2CH2-, -C(R a R b )C(R a R b )C(R a R b )-, -C(R a )=C(R b )-, and -C(R a )=N-. In some embodiments, Y is -CH-, -CHR a -, -CHCH3-, CR a R b - is selected from the group consisting of:

[0057] Or, -XY- together are -C(R a R b )-, -C(R a )=C(R b )-, -C(R a )=N-, -O-, -Si(R a )2-, -S-, -SO2-, -N(R a )-, and >C=Z.

[0058] In some embodiments, -XY- is -X-CH2-, -X-CR2-, a R b -, -X-CHR a- , -XC(HCH3) - , -OY-, -O-CH2-, -S-CH2-, -NH-CH2-, -O-CHCH3-, -CH2-O-CH2, -O-CH(CH3CH3)-, -O-CH2-CH2-, OCH2-CH2-CH2-, -O-CH2OCH2-, -O-NCH2-, -C(=CH2)-CH2-, -NR a -CH2-, NO-CH2, -S-CR a R b-, and -S-CHR a -represents a biradical selected from the group consisting of:

[0059] In some embodiments, -XY- represents -O-CH2- or -O-CH(CH3)-.

[0060] In the formula, Z is -O-, -S-, and -N(R a )-selected from, and R a and R b (when present) are each independently selected from the following group: hydrogen, optionally substituted C 1-6 -alkyl, optionally substituted C 2-6 -alkenyl, optionally substituted C 2-6 -alkynyl, hydroxy, optionally substituted C 1-6 -Alkoxy, C 2-6 -Alkoxyalkyl, C 2-6 -Alkenyloxy, carboxy, C 1-6 -Alkoxycarbonyl, C 1-6 -Alkylcarbonyl, formyl, aryl, aryloxycarbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxycarbonyl, heteroaryloxy, heteroarylcarbonyl, amino, mono- and di(C 1-6 -alkyl)amino, carbamoyl, mono and di(C 1-6 -alkyl)-amino-carbonyl, amino-C 1-6 -Alkylaminocarbonyl, mono- and di(C 1-6 -alkyl)amino-C 1-6 -Alkylaminocarbonyl, C 1-6 -Alkylcarbonylamino, carbamide, C 1-6 -Alkanoyloxy, sulfono, C 1-6 -Alkyl sulfonyloxy, nitro, azido, sulfanyl, C 1-6 -alkylthio, halogen (wherein aryl and heteroaryl are optionally substituted, and where two geminal substituents R a and R bmay both represent optionally substituted methylene (=CH2), and for all chiral centers, the asymmetric groups may be found in either the R or S configuration).

[0061] In the formula, R 1 , R 2 , R 3 , R 5 , and R 5* is independently selected from the group consisting of hydrogen, optionally substituted C 1-6 -alkyl, optionally substituted C 2-6 -alkenyl, optionally substituted C 2-6 -Alkynyl, hydroxy, C 1-6 -Alkoxy, C 2-6 -Alkoxyalkyl, C 2-6 -Alkenyloxy, carboxy, C 1-6 -Alkoxycarbonyl, C 1-6 -Alkylcarbonyl, formyl, aryl, aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxycarbonyl, heteroaryloxy, heteroarylcarbonyl, amino, mono- and di(C 1-6 -alkyl)amino, carbamoyl, mono and di(C 1-6 -alkyl)-aminocarbonyl, amino-C 1-6 -Alkylaminocarbonyl, mono- and di(C 1-6 -alkyl)amino-C 1-6 -Alkylaminocarbonyl, C 1-6 -Alkylcarbonylamino, carbamide, C 1-6 -Alkanoyloxy, sulfono, C 1-6 -Alkyl sulfonyloxy, nitro, azido, sulfanyl, C 1-6 -alkylthio, halogen (wherein the aryl and heteroaryl are optionally substituted and where the two geminal substituents attached to the same atom both represent oxo, thioxo, imino, or optionally substituted methylene).

[0062] In some cases, R 1 , R2 , R 3 , R 5 , and R 5* is independent, C 1-6 It is selected from alkyl (eg, methyl) and hydrogen.

[0063] In some cases, R 1 , R 2 , R 3 , R 5 , and R 5* are all hydrogen.

[0064] In some cases, R 1 , R 2 , R 3 are all hydrogen, and R 5 and R 5* Either one of them is hydrogen, and R 5 and R 5* The other is not hydrogen, e.g., C 1-6 Alkyl (eg, methyl).

[0065] In some cases, R a is either hydrogen or methyl. In some embodiments, when present, R b is either hydrogen or methyl.

[0066] In some cases, R a and R b One or both of are hydrogen.

[0067] In some cases, R a and R b One of the groups is hydrogen and the other is something other than hydrogen.

[0068] In some cases, R a and R b One of these is methyl and the other is hydrogen.

[0069] In some cases, R a and R b are all methyl.

[0070] In some embodiments, the biradical -XY- is -O-CH2-, W is O, and R 1 , R 2 , R 3 , R 5 , and R 5* are all hydrogen. Such LNA nucleosides are disclosed in WO99 / 014226, WO00 / 66604, WO98 / 039352, and WO2004 / 046160, which are all incorporated herein by reference. Examples of these include those commonly known as β-D-oxy LNA and α-L-oxy LNA nucleosides.

[0071] In some embodiments, the biradical -XY- is -S-CH2-, W is O, and R 1 , R 2 , R 3 , R 5 , and R 5* are all hydrogen. Such thio LNA nucleosides are disclosed in WO99 / 014226 and WO2004 / 046160, the contents of which are incorporated herein by reference.

[0072] In some embodiments, the biradical -XY- is -NH-CH-, W is O, and R 1 , R 2 , R 3 , R 5 , and R 5* are all hydrogen. Such amino LNA nucleosides are disclosed in WO99 / 014226 and WO2004 / 046160, the contents of which are incorporated herein by reference.

[0073] In some embodiments, the biradical -XY- is -O-CH-CH- or -O-CH-CH-CH-, W is O, and R 1 , R 2 , R 3 , R 5 , and R 5*are all hydrogen. Such LNA nucleosides are disclosed in WO00 / 047599 and Morita et al, Bioorganic & Med.Chem. Lett. 12 73-76, the contents of which are incorporated herein by reference. Examples of these include those commonly known as 2'-O-4'-C-ethylene-bridged nucleic acids (ENA).

[0074] In some embodiments, the biradical -XY- is -O-CH2-, W is O, and R 1 , R 2 , R 3 All of and R 5 and R 5* One of the groups is hydrogen, and the other is R 5 and R 5* The other is something other than hydrogen, e.g., C 1-6 and alkyl (e.g., methyl). Such 5'-substituted LNA nucleosides are disclosed in WO2007 / 134181, which is incorporated herein by reference.

[0075] In some embodiments, the biradical -XY- is -O-CR a R b - (wherein R a and R b is other than hydrogen, e.g., methyl; W is O; and R 1 , R 2 , R 3 All of and R 5 and R 5* One of the groups is hydrogen, and the other is R 5 and R 5* The other is something other than hydrogen, e.g., C 1-6 and alkyl (e.g., methyl). Such bis-modified LNA nucleosides are disclosed in WO2010 / 077578, which is incorporated herein by reference.

[0076] In some embodiments, the biradical -XY- represents a divalent linker group -O-CH(CHOCH)- (2'-O-methoxyethyl bicyclic nucleoside-, Seth at al., 2010, J. Org. Chem. Vol 75(5) pp. 1569-81). In some embodiments, the biradical -XY- represents a divalent linker group -O-CH(CHCH)- (2'-O-ethyl bicyclic nucleoside-, Seth at al., 2010, J. Org. Chem. Vol 75(5) pp. 1569-81). In some embodiments, the biradical -XY- represents a divalent linker group -O-CH(CHCH)- (2'-O-ethyl bicyclic nucleoside-, Seth at al., 2010, J. Org. Chem. Vol 75(5) pp. 1569-81). In some embodiments, the biradical -XY- represents a -O-CHR a -, W is O, R 1 , R 2 , R 3 , R 5 , and R 5* are all hydrogen. Such 6'-substituted LNA nucleosides are disclosed in WO10036698 and WO07090071, both of which are incorporated herein by reference.

[0077] In some embodiments, the biradical -XY- is -O-CH(CHOCH)-, W is O, and R 1 , R 2 , R 3 , R 5 , and R 5* are all hydrogen. Such LNA nucleosides are also known in the art as cyclic MOE (cMOE) and are disclosed in WO07090071.

[0078] In some embodiments, the biradical -XY- represents the divalent linker group -O-CH(CH)- in either the R- or S-configuration. In some embodiments, the biradicals -XY- together represent the divalent linker group -O-CH-O-CH- (Seth at al., 2010, J. Org. Chem). In some embodiments, the biradical -XY- is -O-CH(CH)-, W is O, and R 1 , R 2 , R 3 , R 5 , and R 5*are all hydrogen. Such 6'-methyl LNA nucleosides are also known in the art as cET nucleosides and may be either the (S)cET or (R)cET stereoisomers as disclosed in WO07090071 (β-D) and WO2010 / 036698 (α-L), both of which are incorporated herein by reference.

[0079] In some embodiments, the biradical -XY- is -O-CR a R b - (wherein R a Also b is not hydrogen, W is O, and R 1 , R 2 , R 3 , R 5 , and R 5* are all hydrogen. a and R b are both methyl. Such 6'-di-substituted LNA nucleosides are disclosed in WO2009006478, which is incorporated herein by reference.

[0080] In some embodiments, the biradical -XY- is -S-CHR a -, W is O, R 1 , R 2 , R 3 , R 5 , and R 5* are all hydrogen. Such 6'-substituted thio LNA nucleosides are disclosed in WO11156202, which is incorporated herein by reference. In some 6'-substituted thio LNA embodiments, R a is methyl.

[0081] In some embodiments, the biradical -XY- is -C(=CH2)-C(R a R b )-, for example, -C(=CH2)-CH2-, or -C(=CH2)-CH(CH3)-, W is O, and R 1 , R 2 , R 3 , R 5 , and R 5*are all hydrogen. Such vinylcarbo LNA nucleosides are disclosed in WO08154401 and WO09067647, both of which are incorporated herein by reference.

[0082] In some embodiments, the biradical -XY- is -N(-OR a )-, W is O, and R 1 , R 2 , R 3 , R 5 , and R 5* are all hydrogen. a is C 1-6 and alkyl (e.g., methyl). Such LNA nucleosides are also known as N-substituted LNAs and are disclosed in WO2008 / 150729, which is incorporated herein by reference. In some embodiments, the biradical -XY- is both a divalent linker group -O-NR a (Seth at al., 2010, J. Org. Chem). In some embodiments, the biradical -XY- represents -N(R a )-, W is O, and R 1 , R 2 , R 3 , R 5 , and R 5* are all hydrogen. a is C 1-6 Alkyl (eg, methyl).

[0083] In some cases, R 5 and R 5* One or both of are hydrogen, and if substituted, R 5 and R 5* The other is C 1-6 In such embodiments, R 1 , R 2 , R 3 may all be hydrogen, and the biradical -XY- may be -O-CH2- or -OC(HC a )—(e.g., —OC(HCH3)—).

[0084] In some embodiments, the biradical is -CR a R b -O-CR a R b - (e.g., CH2-O-CH2-), W is O, and R 1 , R 2 , R 3 , R 5 , and R 5* are all hydrogen. a is C 1-6 Alkyl (e.g., methyl). Such LNA nucleosides are also known as conformationally restricted nucleotides (CRN) and are disclosed in WO2013036868 (herein incorporated by reference).

[0085] In some embodiments, the biradical is -O-CR a R b -O-CR a R b - (e.g., O-CH2-O-CH2-), W is O, and R 1 , R 2 , R 3 , R 5 , and R 5* are all hydrogen. a is C 1-6 Alkyl (e.g., methyl). Such LNA nucleosides are also known as COC nucleotides and are disclosed in Mitsuoka et al., Nucleic Acids Research 2009 37(4), 1225-1238 (hereby incorporated by reference).

[0086] Unless otherwise specified, it is recognized that LNA nucleosides may be in either the β-D or α-L stereoisoform. Specific examples of LNA nucleosides are shown in Scheme 1. Scheme 1 [ka]

[0087] As shown in the examples above, in preferred embodiments of the invention, the LNA nucleosides of the oligonucleotides are β-D-oxy-LNA nucleosides.

[0088] Nuclease-mediated degradation Nuclease-mediated degradation refers to oligonucleotides that, when they form a duplex with a complementary nucleotide sequence, are capable of mediating the degradation of such sequence.

[0089] In some embodiments, the oligonucleotide may function by nuclease-mediated degradation of target nucleic acid. Here, the oligonucleotide of the present invention can recruit nuclease, particularly endonuclease, preferably endoribonuclease (RNase) (e.g., RNaseH). Examples of oligonucleotide designs that work by nuclease-mediated reaction mechanism are oligonucleotides that typically contain a region of at least 5 or 6 DNA nucleosides and are flanked on one or both sides by affinity-enhanced nucleosides (e.g., gapmers, headmers, and tailmers).

[0090] RNase H activity and recruitment RNase H activity of an antisense oligonucleotide refers to its ability to recruit RNase when duplexed with a complementary RNA molecule. WO01 / 23613 provides in vitro methods for determining RNase H activity. These may be used to determine RNase H recruitment. Typically, an oligonucleotide is considered capable of recruiting RNase H if, when provided with a complementary target nucleic acid sequence, its initial rate is at least 10% or 20% greater than the initial rate (measured in pmol / l / min) determined using an oligonucleotide having the same base sequence as the modified oligonucleotide under test but containing only DNA monomers (all monomers having phosphorothioate linkages). This initial rate is determined using the techniques described in Examples 91-95 of WO01 / 23613, which are incorporated herein by reference.

[0091] Gapmar As used herein, the term "gapmer" refers to an antisense oligonucleotide that contains a region (gap) of the oligonucleotide that recruits RNaseH. The gap is flanked at the 5' and 3' ends by one or more affinity-enhancing modified nucleosides (flanks). Various gapmer designs are described herein. Headmers and tailmers are oligonucleotides that can recruit RNaseH without one of the flanks, i.e., only one of the ends of the oligonucleotide contains affinity-enhancing modified nucleosides. Headmers are 3'-flankless (i.e., the 5'-flank contains affinity-enhancing modified nucleosides), whereas tailmers are 5'-flankless (i.e., the 3'-flank contains affinity-enhancing modified nucleosides).

[0092] LNA gapmer The term "LNA gapmer" is a gapmer oligonucleotide in which at least one of the affinity enhancing modified nucleosides is an LNA nucleoside.

[0093] Mixed winged gapmers The term "mixed winged gapmer" refers to an LNA gapmer whose flanking regions include at least one LNA nucleoside and at least one non-LNA modified nucleoside, such as at least one 2'-substituted modified nucleoside (e.g., 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA, and 2'-F-ANA nucleoside). In some embodiments, a mixed winged gapmer has one flanking region (e.g., the 5' or 3' flanking region) that includes an LNA nucleoside and the other flanking region (e.g., the 3' or 5' flanking region) that includes a 2'-substituted modified nucleoside.

[0094] Complex As used herein, the term "conjugate" refers to an oligonucleotide covalently linked to a non-nucleotide moiety (the conjugate moiety, region C, or a third region).

[0095] Conjugation of the oligonucleotides of the invention to one or more non-nucleotide moieties may improve the pharmacology of the oligonucleotide, for example, by affecting the activity, cellular distribution, cellular uptake, or stability of the oligonucleotide. In some embodiments, the conjugate moiety may modify or improve the pharmacokinetic properties of the oligonucleotide by improving the cellular distribution, bioavailability, metabolism, excretion, permeability, and / or cellular uptake of the oligonucleotide. In particular, the conjugate may target the oligonucleotide to a particular organ, tissue, or cell type, thereby improving the availability of the oligonucleotide in that organ, tissue, or cell type. At the same time, the conjugate may act to reduce the activity of the oligonucleotide in non-target cell types, tissues, or organs (e.g., non-target activity or activity of non-target cell types, tissues, or organs). WO93 / 07883 and WO2013 / 033230 provide suitable conjugate moieties and are incorporated herein by reference. WO2012 / 143379 provides a method for delivering a drug across the blood-brain barrier by binding to an antibody fragment having affinity for the transferrin receptor, and is incorporated herein by reference.

[0096] Oligonucleotide conjugates and their synthesis are also reported in reviews by Manoharan in Antisense Drug Technology, Principles, Strategies, and Applications, ST Crooke, ed., Ch. 16, Marcel Dekker, Inc., 2001 and Manoharan, Antisense and Nucleic Acid Drug Development, 2002, 12, 103, each of which is incorporated herein by reference.

[0097] In one embodiment, the non-nucleotide moiety (conjugate moiety) is selected from the group consisting of carbohydrates, cell surface receptor ligands, drug substances, hormones, lipophilic substances, polymers, proteins, peptides, toxins (e.g., bacterial toxins), vitamins, viral proteins (e.g., capsids), or combinations thereof. In some embodiments, the non-nucleotide moiety is an antibody or antibody fragment, e.g., an antibody or antibody fragment that facilitates delivery across the blood-brain barrier, particularly an antibody or antibody fragment that targets the transferrin receptor.

[0098] Linker A bond or linker refers to a bond between two atoms that connects one chemical group or segment of interest to another chemical group or segment of interest through one or more covalent bonds. The linking moiety can be attached to the oligonucleotide directly or via a linking moiety (e.g., a linker or tether). The linker serves to covalently link a third region (e.g., a conjugate moiety (region C)) to a first region (e.g., an oligonucleotide (region A)).

[0099] In some embodiments of the invention, the conjugate or oligonucleotide conjugate of the invention may optionally include a linker region (second region or region B and / or region Y) located between the oligonucleotide (region A or first region) and the conjugate moiety (region C or third region).

[0100] Region B refers to a biocleavable linker that includes or consists of a physiologically labile bond that is cleavable under conditions typically encountered in a mammalian body or conditions similar thereto. Conditions under which a physiologically labile linker undergoes chemical transformation (e.g., cleavage) include chemical conditions similar to those found or encountered in a mammalian cell, such as, for example, pH, temperature, oxidizing or reducing conditions, oxidizing or reducing agents, salt concentration, and the like. Mammalian intracellular conditions also include the presence of enzymatic activity typically present in mammalian cells, such as, for example, from proteolytic enzymes, hydrolases, or nucleases. In one embodiment, the biocleavable linker is susceptible to S1 nuclease cleavage. In a preferred embodiment, the nuclease-sensitive linker comprises 1-10 nucleosides, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleosides, more preferably 2-6 nucleosides. Most preferably, the linker comprises 2-4 linked nucleosides containing at least 2 consecutive phosphodiester bonds (e.g., at least 3, 4, or 5 consecutive phosphodiester bonds). Preferably, the nucleosides are DNA or RNA. Phosphodiester containing biocleavable linkers are described in more detail in WO2014 / 076195, which is incorporated herein by reference.

[0101] Region Y refers to a linker that is not necessarily biocleavable, but serves primarily to covalently link the conjugate moiety (region C, i.e., the third region) to the oligonucleotide (region A, i.e., the first region). Region Y linkers may comprise molecular chain structures or oligomers of repeating units (e.g., ethylene glycol), amino acid units, or aminoalkyl groups. The oligonucleotide conjugates of the invention may be constructed from the following region elements AC, ABC, ABYC, AYBC, or AYC. In some embodiments, the linker (region Y) is an aminoalkyl, such as a C2-C36 aminoalkyl group, including, for example, a C6-C12 aminoalkyl group. In a preferred embodiment, the linker (region Y) is a C6 aminoalkyl group.

[0102] Control The term "control" when used in the context of measuring the effect of an oligonucleotide generally refers to an untreated individual or target cell, or an individual or target cell treated with a non-targeting oligonucleotide (mimetic). However, a control can also be an individual treated with a standard method.

[0103] treatment As used herein, the term "treatment" refers to the treatment of an existing condition (e.g., a disease or disorder as referred to herein) or the prevention or prophylaxis of a condition. Thus, treatment as referred to herein can in some embodiments be prophylactic.

[0104] Detailed Description of the Invention target One aspect of the present invention is to regulate the expression level of porcine, primate or human UBE3A protein, particularly to increase the expression of paternal UBE3A in neuronal cells, particularly human neuronal cells. Human UBE3A protein exists in several isoforms as shown in Uniprot nr. Q05086. Some mutations in the maternal UBE3A gene may cause Angelman syndrome.

[0105] The target nucleic acid of the oligonucleotide of the invention is RNA, in particular long untranslated RNA. The long untranslated RNA targeted by the oligonucleotide of the invention is human SNHG14 (also known as UBE3A-ATS, Ensembl entry number ENSG00000224078, version GRCh38.p2). In particular, the target nucleic acid is the region downstream of SNORD109B (SEQ ID NO: 1) corresponding to position 25278410 to position 25419462 on chromosome 15. In rhesus monkeys (Macaca mulatta), the UBE3A repressor is defined as the region downstream of SNORD109A (SEQ ID NO: 2) corresponding to position 4222848 to position 4373084 (forward single strand) on chromosome 7 using Ensembl assembly MMUL 1.0.

[0106] In some embodiments, the target nucleic acid is SEQ ID NO:1, or a naturally occurring variant thereof.

[0107] In certain embodiments, the target nucleic acid corresponds to a region conserved between human (SEQ ID NO:1) and rhesus monkey (SEQ ID NO:2). In certain embodiments, the target nucleic acid corresponds to a region conserved between human (SEQ ID NO:1), rhesus monkey (SEQ ID NO:2), and mouse (SEQ ID NO:3).

[0108] In a particular embodiment, the target nucleic acid is an antisense region to the UBE3A pre-mRNA, which region corresponds to positions 55319 to 141053 of SEQ ID NO:1.

[0109] In a particular embodiment, the target nucleic acid is a region downstream of SNORD109B and upstream of the antisense region to the UBE3A pre-mRNA, which region corresponds to positions 1 to 55319 of SEQ ID NO:1.

[0110] In some embodiments, the target nucleic acid is present in a cell, in vitro or in vivo, such as a mammalian cell, particularly a human cell (the target cell). In certain embodiments, the target cell is a neuronal cell, preferably a human neuronal cell.

[0111] The target sequence may be a subsequence of the target nucleic acid. In some embodiments, the oligonucleotide targets a subsequence selected from the group consisting of exon 9, exon 10, exon 13, exon 14, intron 14, exon 15, intron 15, and the antisense region of exon 16 of UBE3A. In some embodiments, the oligonucleotide or contiguous nucleotide sequence hybridizes to or is complementary to a single stranded nucleic acid molecule selected from the group consisting of positions 55319-76274, 77483-77573, 92157-93403, and 97056-97354 of SEQ ID NO:1. In some embodiments, the oligonucleotide or contiguous nucleotide sequence hybridizes to or is complementary to a single stranded nucleic acid molecule selected from the group consisting of positions 60821-60849, 77567-77583, 92323-92339, and 97156-97172 of SEQ ID NO:1.

[0112] In some embodiments, the target nucleic acid is a region corresponding to positions 9200-9250 of SEQ ID NO:1.

[0113] In some variations, the target nucleic acid is a region corresponding to positions 11505-11555 of SEQ ID NO:1.

[0114] In some embodiments, the target nucleic acid is a region corresponding to positions 15100-15150 of SEQ ID NO:1.

[0115] In some embodiments, the target nucleic acid is a region corresponding to positions 30590-30740 of SEQ ID NO:1.

[0116] In some embodiments, the target nucleic acid is a region corresponding to positions 46380-46430 of SEQ ID NO:1.

[0117] The oligonucleotides of the present invention The present invention relates to oligonucleotides capable of modulating the expression of paternal UBE3A, in particular the induction or upregulation of paternal UBE3A expressed in neuronal cells. This modulation is achieved by hybridizing to a target nucleic acid located in the SNHG14 transcript of a long untranslated RNA downstream of SNORD109B. In certain embodiments, the oligonucleotides of the present invention hybridize to a subsequence of the target nucleic acid of SEQ ID NO: 1 with a ΔG° of less than -10 kcal (e.g., -10 to -60 kcal, -12 to -40, -15 to -30 kcal) or -16 to -27 kcal (e.g., -18 to -25 kcal).

[0118] The oligonucleotides of the invention are antisense oligonucleotides targeted to the porcine, rhesus and / or human SNHG14 transcript downstream of SNORD109B.

[0119] In some embodiments, the antisense oligonucleotides of the present invention can modulate the expression of the target by interfering with or reducing the repressor of the target.The oligonucleotides of the present invention preferably induce UBE3A expression in cells, particularly paternal UBE3A expression in neuronal cells, by degrading or eliminating the SNHG14 transcript downstream of SNORD109B.In some embodiments, the oligonucleotides of the present invention can increase the expression of UBE3A by at least 20%, more preferably at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 80%, 100%, 120%, 150%, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230%, 240%, or 250%, compared to the expression of UBE3A in neuronal cells treated with saline or non-targeting oligonucleotides. In additional embodiments, the oligonucleotides of the invention can reduce the amount of SNHG14 transcripts downstream of SNORD109B (particularly the portion of the transcript that is antisense to the UBE3A·mRNA pre-region) by at least 20%, more preferably 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95%, relative to the amount of SNHG14 transcripts downstream of SNORD109B in saline or non-targeting oligonucleotide treated neurons without reducing the amount of SNORD115 by more than 0%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 12%, 14%, 16%, 18%, 20%, 25%, or 30% relative to the amount of SNORD115 in saline or non-targeting oligonucleotide treated cells. SNRPN and SNORD116 transcripts are located upstream of SNORD115 transcripts. As a result, if the SNORD115 transcript is not reduced by the oligonucleotide, the SNRPN and SNORD116 transcripts are also not reduced. In a further embodiment, the amount of SNRPN and SNORD116 transcripts is not reduced by 0%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 12%, 14%, 16%, 18%, 20%, 25%, or 30% or more compared to the amount of SNRPN and SNORD116 in cells treated with saline or non-targeting oligonucleotide.

[0120] The modulation of the target is induced by hybridization of the consecutive nucleotide sequence of the oligonucleotide with the target nucleic acid. In some embodiments, the oligonucleotide of the present invention comprises a mismatch between the oligonucleotide and the target nucleic acid. Despite the mismatch, hybridization to the target nucleic acid may still be sufficient to show the desired modulation of UBE3A expression. As an advantage, the decrease in binding affinity due to the mismatch may be compensated for by increasing the number of oligonucleotide nucleotides and / or the number of modified nucleosides (e.g., 2'-modified nucleosides, including LNA) present in the oligonucleotide sequence, which increases the binding affinity to the target.

[0121] One aspect of the invention relates to an antisense oligonucleotide comprising a contiguous nucleotide sequence of 10 to 30 nucleotides in length that is at least 90% (eg, 95%, 98%, 100%) complementary to position 25278410 to position 25419462 of human chromosome 15.

[0122] In some embodiments, the oligonucleotide comprises a contiguous sequence that is at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or 100%) complementary to a region of the target nucleic acid set forth as SEQ ID NO:1, 2, or 3.

[0123] In a preferred embodiment, the oligonucleotide of the present invention, or its contiguous nucleotide sequence, is fully complementary (100% complementary) to a region of the target nucleic acid shown as SEQ ID NO: 1. Alternatively, some embodiments may contain one or two mismatches between the oligonucleotide and the target nucleic acid.

[0124] In some embodiments, the oligonucleotide sequences are 100% complementary to the corresponding target nucleic acid regions present in SEQ ID NO: 1 and SEQ ID NO: 2. In some embodiments, the oligonucleotide sequences are 100% complementary to the corresponding target nucleic acid regions present in SEQ ID NOs: 1, 2, and 3.

[0125] In some embodiments, the oligonucleotide comprises a contiguous nucleotide sequence 10-30 nucleotides in length that is at least 90%, e.g., 100%, complementary to a corresponding target nucleic acid region present in SEQ ID NO:1, the target nucleic acid region being selected from the group consisting of regions A1 to A3649 of Table 1. Table 1: Regions of SEQ ID NO:1 that may be targeted using oligonucleotides of the invention [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6] [Table 1-7] [Table 1-8] [Table 1-9] [Table 1-10] [Table 1-11] [Table 1-12] [Table 1-13]

Table 1-14

Table 1-15

Table 1-16

Table 1-17

Table 1-18

Table 1-19

Table 1-20

Table 1-21

Table 1-22

Table 1-23

Table 1-24

Table 1-25

Table 1-26

Table 1-27

Table 1-28

Table 1-29

[0126] In some embodiments, the oligonucleotide comprises a contiguous nucleotide sequence 10-30 nucleotides in length that is at least 90%, e.g., 100%, complementary to a corresponding target nucleic acid region present in SEQ ID NO:1, the target nucleic acid region being selected from the group consisting of regions B1 to B400 of Table 2. Table 2: Regions of SEQ ID NO:1 that may be targeted using oligonucleotides of the invention [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4]

[0127] In certain embodiments, the oligonucleotide or contiguous nucleotide sequence is complementary to a region (or subsequence) (or subsequence) of a target nucleic acid, the target nucleic acid region being selected from the group consisting of positions 1589-10889, 46089-53989, and 60789-62489 of SEQ ID NO:1.

[0128] In one embodiment, the oligonucleotide comprises a contiguous nucleotide sequence 10-30 nucleotides in length that is at least 90%, for example 100%, complementary to a target nucleic acid sequence from position 55319 to position 141053 of SEQ ID NO:1.

[0129] In one embodiment, the oligonucleotide comprises a contiguous nucleotide sequence 10-30 nucleotides in length that is at least 90%, e.g., 100%, complementary to a target nucleic acid sequence from position 1 to position 55318 of SEQ ID NO:1.

[0130] In some embodiments, the oligonucleotide comprises a contiguous nucleotide sequence 10-30 nucleotides in length that is at least 90% complementary to a subsequence of a target nucleic acid selected from the group corresponding to positions 55319-76274, 77483-77573, 92157-93403, and 97056-97354 of SEQ ID NO:1.

[0131] In some embodiments, the oligonucleotide comprises a contiguous nucleotide sequence 10-30 nucleotides in length that is at least 90% complementary to a subsequence of a target nucleic acid selected from the group corresponding to positions 60821-60849, 77567-77583, 92323-92339, and 97156-97172 of SEQ ID NO:1.

[0132] In some embodiments, the oligonucleotide comprises a contiguous nucleotide sequence 10-30 nucleotides in length that is at least 90% complementary to a subsequence of a target nucleic acid corresponding to positions 5218-5240 of SEQ ID NO:1.

[0133] In some embodiments, the oligonucleotide comprises a contiguous nucleotide sequence 10-30 nucleotides in length that is at least 90% complementary to a subsequence of a target nucleic acid corresponding to positions 5782-5803 of SEQ ID NO:1.

[0134] In some embodiments, the oligonucleotide comprises a contiguous nucleotide sequence 10-30 nucleotides in length that is at least 90% complementary to a subsequence of a target nucleic acid corresponding to positions 8113-8139 of SEQ ID NO:1.

[0135] In some embodiments, the oligonucleotide comprises a contiguous nucleotide sequence 10-30 nucleotides in length that is at least 90% complementary to a subsequence of a target nucleic acid corresponding to positions 9200-9250 of SEQ ID NO:1.

[0136] In some embodiments, the oligonucleotide comprises a contiguous nucleotide sequence 10-30 nucleotides in length that is at least 90% complementary to a subsequence of a target nucleic acid corresponding to positions 11505-11555 of SEQ ID NO:1.

[0137] In some embodiments, the oligonucleotide comprises a contiguous nucleotide sequence 10-30 nucleotides in length that is at least 90% complementary to a subsequence of a target nucleic acid corresponding to positions 13223-13242 of SEQ ID NO:1.

[0138] In some embodiments, the oligonucleotide comprises a contiguous nucleotide sequence 10-30 nucleotides in length that is at least 90% complementary to a subsequence of a target nucleic acid corresponding to positions 15100-15150 of SEQ ID NO:1.

[0139] In some embodiments, the oligonucleotide comprises a contiguous nucleotide sequence 10-30 nucleotides in length that is at least 90% complementary to a subsequence of a target nucleic acid corresponding to positions 15113-15180 of SEQ ID NO:1.

[0140] In some embodiments, the oligonucleotide comprises a contiguous nucleotide sequence 10-30 nucleotides in length that is at least 90% complementary to a subsequence of a target nucleic acid corresponding to positions 29635-29705 of SEQ ID NO:1.

[0141] In some embodiments, the oligonucleotide comprises a contiguous nucleotide sequence 10-30 nucleotides in length that is at least 90% complementary to a subsequence of a target nucleic acid corresponding to positions 30590-30740 of SEQ ID NO:1.

[0142] In some embodiments, the oligonucleotide comprises a contiguous nucleotide sequence 10-30 nucleotides in length that is at least 90% complementary to a subsequence of a target nucleic acid corresponding to positions 39800-39855 of SEQ ID NO:1.

[0143] In some embodiments, the oligonucleotide comprises a contiguous nucleotide sequence 10-30 nucleotides in length that is at least 90% complementary to a subsequence of the target nucleic acid to positions 44435-44460 of SEQ ID NO:1.

[0144] In some embodiments, the oligonucleotide comprises a contiguous nucleotide sequence 10-30 nucleotides in length that is at least 90% complementary to a subsequence of the target nucleic acid to positions 45245-45270 of SEQ ID NO:1.

[0145] In some embodiments, the oligonucleotide comprises a contiguous nucleotide sequence 10-30 nucleotides in length that is at least 90% complementary to a subsequence of the target nucleic acid to positions 46380-46430 of SEQ ID NO:1.

[0146] In some embodiments, the oligonucleotide comprises a contiguous nucleotide sequence 10-30 nucleotides in length that is at least 90% complementary to a subsequence of the target nucleic acid to positions 68915-68940 of SEQ ID NO:1.

[0147] In some embodiments, the oligonucleotide comprises or consists of 8 to 35 nucleosides in length, e.g., 10 to 30, 11 to 22, 12 to 18, 13 to 17, or 14 to 16 contiguous nucleotides in length. In a preferred embodiment, the oligonucleotide comprises or consists of 15 to 20 nucleotides in length.

[0148] In some embodiments, the oligonucleotide or contiguous nucleotide sequence thereof comprises or consists of 22 or fewer nucleotides, e.g., 20 or fewer nucleotides, 18 or fewer nucleotides, e.g., 14, 15, 16, or 17 nucleotides. Any range given herein is meant to include both endpoints of the range. Thus, when an oligonucleotide is said to comprise 10 to 30 nucleotides, both 10 and 30 nucleotides are included.

[0149] In some embodiments, the contiguous nucleotide sequence comprises or consists of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 contiguous nucleotides in length. In a preferred embodiment, the oligonucleotide comprises or consists of 16, 17, 18, or 19 nucleotides in length.

[0150] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 10 to 30 nucleotides in length having at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NOs: 4 to 150 (see the motif sequences shown in Table 3 in the Examples section).

[0151] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 10 to 30 nucleotides in length having at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NOs: 4 to 818 (see the motif sequences shown in Table 3 in the Examples section).

[0152] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 10 to 30 nucleotides in length having at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NOs: 4 to 678 (see the motif sequences shown in Table 3 in the Examples section).

[0153] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of a length of 10 to 30 nucleotides having at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NOs: 166, 167, 167, or 169 (see motif sequences shown in Table 3 in the Examples section).

[0154] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of a length of 10 to 30 nucleotides having at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NOs: 570, 571, 572, 679, 680, 681, 682, and 683 (see motif sequences shown in Table 3 in the Examples section).

[0155] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 10 to 30 nucleotides in length having at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NOs: 34, 186, 187, 188, 573, 574, 575, 576, 572, 684, 685, 686, 687, 688, 689, 690, 691, 692, 963, 964, 965, and 696 (see motif sequences in Table 3 in the Examples section).

[0156] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 10 to 30 nucleotides in length having at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NOs: 35, 199, 200, 201, 202, 203, 204, 205, 206, 207, 209, and 210 or SEQ ID NOs: 582, 583, and 584 (see motif sequences shown in Table 3 in the Examples section).

[0157] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of a length of 10 to 30 nucleotides having at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NOs: 221, 222, 223, 224, 225, 585, 586, 587, 588, 589, 698, 699,700, 701, 702, 703, 704, 705, 706, 707, 708, 709, 710, 711, 712, 713, 714, 715, 716, 717, and 718 (see motif sequences in Table 3 in the Examples section).

[0158] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of a length of 10 to 30 nucleotides having at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NOs: 236, 237, 238, 239, 240, and 590.

[0159] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of a length of 10 to 30 nucleotides having at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NOs: 241, 591, and 719 (see the motif sequences shown in Table 3 in the Examples section).

[0160] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence is selected from the group consisting of SEQ ID NOs: 46, 47, 48, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 613, 614, 615, 616, 617, 618, 619, 620, 621, 622, 623, 624, 625, 626, 627, 628, 629, 630, 631, 632, 633, 634, 635, 636, 637, 638, 639, 640, 641, 642, 643, 644, 645, 646, 647, 648, 649, 650, 651, 652, 653, 654, 655, 656, 657, 658, 659, 660, 661, 662, 663, 664, 665, 666, 667, 668, 669, 670, 671, 672, 673, 674, 675, 676, 677, 678, 679, 680, 681, 682, 683, 684, 685 16, 617, 618, 619, 620, 621, 622, 623, 624, 625, 626, 627, 628, 629, 630, 631, 632, 721, 722, 723, 724, 725, 726, 727, 728, 729, 730, 731, 732, 734, 735, 736, 737, 738, 739, 740, 741, 742, 743, 744, 745, 746, 747, 748 , 749, 750, 751, 752, 753, 754, 755, 756, 757, 758, 759, 760, 761, 762, 763, 764, 765, 766, 767, 768, 769, 770, 771, 772, 773, 774, 775, 776, 777, 778, 779, 780, 781, 782, 783, 784, 785, 786, 787, 788, 789, 790, 791, 7 and / or consisting of a sequence having at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of: 92, 793, 794, 795, 796, 797, 798, 799, 800, 800, 800, 800, 800, 801, 801, 802, 803, 804, 805, 806, and 807, and a length of 10 to 30 nucleotides.

[0161] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of a length of 10 to 30 nucleotides having at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NOs: 331, 332, 638, 639, 640, 808, 809, 810, 811, 812, 813, 814, and 815 (see motif sequences in Table 3 in the Examples section).

[0162] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of a length of 10 to 30 nucleotides having at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NOs: 409, 410, 411, 642, 643, 644, 645, 646, 816, 818, and 818 (see motif sequences in Table 3 in the Examples section).

[0163] It means that the consecutive nucleic acid base sequence (motif sequence) may be modified, for example, to enhance nuclease resistance and / or binding affinity to target nucleic acid. The modification is as described in the definition and "oligonucleotide design" section. Table 3 shows the preferred design of each motif sequence.

[0164] Oligonucleotide Design Oligonucleotide design refers to the pattern of nucleoside sugar modifications in an oligonucleotide sequence. The oligonucleotides of the invention include sugar-modified nucleosides and may also include DNA or RNA nucleosides. In some embodiments, the oligonucleotides include sugar-modified nucleosides and DNA nucleosides. Incorporation of modified nucleosides into the oligonucleotides of the invention may improve the affinity of the oligonucleotide to a target nucleic acid. In this case, the modified nucleoside may be referred to as an affinity-enhancing modified nucleotide.

[0165] In one embodiment, the oligonucleotide comprises at least one modified nucleoside, e.g., at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 modified nucleosides. In one embodiment, the oligonucleotide comprises 1-10 modified nucleosides, e.g., 2-9, 3-8, 4-7, 6-7 modified nucleosides. In some embodiments, at least one of the modified nucleosides is a locked nucleic acid (LNA). For example, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 of the modified nucleosides are LNA. In further embodiments, all of the modified nucleosides are LNA.

[0166] In one embodiment, the oligonucleotide of the present invention may contain modifications independently selected from these three types of modifications (modified sugar, modified nucleobase, and modified internucleoside linkage) or combinations thereof. The oligonucleotide preferably contains one or more sugar-modified nucleosides (e.g., 2'-sugar-modified nucleosides). The oligonucleotide of the present invention preferably contains one or more 2'-sugar-modified nucleosides independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabinonucleic acid (ANA), 2'-fluoro-ANA, and LNA nucleosides. More preferably, the one or more modified nucleosides are LNA.

[0167] In a further embodiment, the oligonucleotide comprises at least one modified internucleoside linkage. In a preferred embodiment, the internucleoside linkage in the contiguous nucleotide sequence is a phosphorothioate internucleoside linkage or a boranophosphate internucleoside linkage.

[0168] In some embodiments, the oligonucleotides of the invention include at least one modified nucleoside, which is 2'-MOE-RNA, e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 2'-MOE-RNA nucleoside units. In some embodiments, at least one of the modified nucleosides is 2'-fluoro DNA, e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 2'-fluoro-DNA nucleoside units.

[0169] In some embodiments, the oligonucleotide of the invention comprises at least one LNA unit, for example 1, 2, 3, 4, 5, 6, 7, or 8 LNA units, 2-6 LNA units, 3-7 LNA units, 4-8 LNA units, or 3, 4, 5, 6, or 7 LNA units. In some embodiments, the modified nucleosides are all LNA nucleosides. In further embodiments, the oligonucleotide may comprise β-D-oxy-LNA in either the β-D or α-L configuration, or a combination thereof, together with one or more of the following LNA units: thio-LNA, amino-LNA, oxy-LNA, and / or ENA. In further embodiments, all LNA cytosine units are 5-methylcytosine. In a preferred embodiment, the oligonucleotide or contiguous nucleotide sequence has at least one LNA unit at the 5' end of the nucleotide sequence and at least two LNA units at the 3' end.

[0170] In some embodiments, the oligonucleotides of the present invention comprise at least one LNA unit and at least one 2'-substituted modified nucleoside.

[0171] In some embodiments of the present invention, the oligonucleotide comprises both 2'-sugar modified nucleosides and DNA units. The oligonucleotide preferably comprises both LNA and DNA units. The total number of LNA and DNA units is preferably 8 to 30, for example 10 to 25, preferably 12 to 22, 12 to 18, more preferably 11 to 16. In some embodiments of the present invention, the nucleotide sequence of the oligonucleotide (e.g., a contiguous nucleotide sequence) comprises at least one or two LNA units, and the remaining nucleotide units are DNA units. In some embodiments, the oligonucleotide comprises only LNA nucleosides and naturally occurring nucleosides (e.g., RNA or DNA, most preferably DNA nucleosides), optionally with modified internucleoside linkages such as phosphorothioates.

[0172] In one aspect of the invention, the oligonucleotide of the invention is capable of recruiting RNaseH.

[0173] Gapmer Design In a preferred embodiment, the oligonucleotide of the present invention has a gapmer design or structure (also referred to herein simply as "gapmer"). In a gapmer structure, the oligonucleotide has at least three distinct structural regions, namely, a 5' flanking portion, a gap, and a 3' flanking portion, FG-F' structure, in a 5'→3' direction. In this design, the flanking regions (also referred to as wing regions) contain consecutive modified nucleoside stretches that are complementary to the UBE3A target nucleic acid. Meanwhile, the gap region G contains consecutive nucleotide stretches. The nucleosides are capable of recruiting nucleases, preferably endonucleases (e.g., RNases such as RNase H), when the oligonucleotide becomes duplexed with the target nucleic acid. The nucleosides capable of recruiting nucleases, particularly RNase H, may be selected from the group consisting of DNA, α-L-oxy-LNA, 2'-fluoro-ANA, and UNA. Regions F and F' adjacent to the 5' and 3' ends of region G preferably comprise non-nuclease recruiting nucleosides (nucleosides having a 3'-endo structure), more preferably one or more affinity enhancing modified nucleosides. In some embodiments, the 3' flanking portion comprises at least one LNA nucleoside, preferably at least two LNA nucleosides. In some embodiments, the 5' flanking portion comprises at least one LNA nucleoside. In some embodiments, both the 5'- and 3' flanking regions comprise LNA nucleosides. In some embodiments, all nucleosides in the flanking regions are LNA nucleosides. In other embodiments, the flanking regions may contain both LNA nucleosides and other nucleosides (e.g., DNA nucleosides and / or non-LNA modified nucleosides (e.g., 2'-substituted nucleosides) (mixed flanking). In this case, the gap is defined as a contiguous sequence of at least five RNase H recruiting nucleosides (nucleosides having a 2'-endo structure, preferably DNA) flanked at the 5' and 3' ends by affinity enhancing modified nucleosides, preferably LNA (e.g., β-D-oxy-LNA). As a result, the nucleosides of the 5' flanking region adjacent to the gap region and the 3' flanking region are modified nucleosides, preferably non-nuclease recruiting nucleosides.In oligonucleotides having mixed flanking, where the flanking contains DNA, the 5' nucleoside and 3' nucleoside are modified nucleosides.

[0174] Area F Region F (5' adjacent or 5' wing) attached to the 5' end of region G comprises, contains or consists of at least one modified nucleoside, e.g., at least 2, at least 3, at least 4, at least 5, at least 6, at least 7 modified nucleosides. In one embodiment, region F comprises or consists of 1-7 modified nucleosides, e.g., 2-6 modified nucleosides, 2-5 modified nucleosides, 2-4 modified nucleosides, 1-3 modified nucleosides (e.g., 1, 2, 3, or 4 modified nucleosides). In a further embodiment, an additional nucleoside may be attached to the 5' end of region F, representing region D, preferably comprising 1, 2, or 3 nucleoside units (e.g., DNA nucleosides). Region D may serve the function of a biocleavable (B) linker as described in the definition of "linker".

[0175] In some embodiments, the modified nucleosides of region F have a 3'-endo structure.

[0176] In one embodiment, one or more modified nucleosides of region F are 2'-modified nucleosides.

[0177] In further embodiments, the one or more 2'-modified nucleosides of region F are selected from 2'-O-alkyl-RNA units, 2'-O-methyl-RNA, 2'-amino-DNA units, 2'-fluoro-DNA units, 2'-alkoxy-RNA, MOE units, LNA units, arabinonucleic acid (ANA) units, and 2'-fluoro-ANA units.

[0178] In one embodiment of the invention, the modified nucleosides of region F are LNA nucleosides. In a further embodiment, the LNA nucleosides of region F are independently selected from the group consisting of oxy-LNA, thio-LNA, amino-LNA, cET, and / or ENA, in either the β-D or α-L configuration, or a combination thereof. In a preferred embodiment, region F comprises at least one β-oxy LNA unit at the 5'-end of the contiguous sequence.

[0179] area G Preferably, region G (gap region) comprises, contains or consists of at least 4, e.g., at least 5, e.g., at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 consecutive nucleosides capable of recruiting said nuclease, in particular RNase H. In a further embodiment, region G comprises, contains or consists of 5 to 12, 6 to 10, 7 to 9 (e.g., 8) consecutive nucleotide units capable of recruiting said nuclease.

[0180] In one embodiment, the nucleoside units of region G capable of recruiting nucleases are selected from the group consisting of DNA, α-L-LNA, C4'-alkylated DNA (PCT / EP2009 / 050349 and Vester et al., Bioorg. Med. Chem. Lett. 18 (2008) 2296-2300, both incorporated herein by reference), arabinose derived nucleosides like ANA and 2'F-ANA (Mangos et al. 2003 J. AM. CHEM. SOC. 125, 654-661), UNA (unlocked nucleic acid) (Fluiter et al., Mol. Biosyst., 2009, 10, 1039, both incorporated herein by reference). UNA is an unlocked nucleic acid, typically in which the bond between C2 and C3 of the ribose has been removed to form an unlocked "sugar" residue.

[0181] In a further embodiment, at least one nucleoside unit of the region G is a DNA nucleoside unit, for example, 1 to 16 DNA units, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 DNA units, preferably 2 to 13 DNA units (for example, 4 to 12 DNA units), more preferably 5 to 11, 10 to 16, 11 to 15, or 12 to 14 DNA units. In some embodiments, the region G is composed of 100% DNA units. In a preferred embodiment, G is composed of 10, 11, 12, 13, 14, or 15 DNA units.

[0182] In further embodiments, region G may consist of a mixture of DNA and other nucleosides capable of mediating RNase H cleavage. Region G may consist of at least 50% DNA, more preferably 60%, 70%, or 80% DNA, and even more preferably 90% or 95% DNA.

[0183] In a further embodiment, at least one nucleoside unit of region G is an α-L-LNA nucleoside unit, for example, at least one α-L-LNA unit, for example, 2, 3, 4, 5, 6, 7, 8 or 9 α-L-LNA units. In a further embodiment, region G comprises said at least one α-L-LNA, and said at least one α-L-LNA is an α-L-oxyLNA unit. In a further embodiment, region G comprises a combination of DNA and α-L-LNA nucleoside units.

[0184] In some embodiments, the size of the contiguous sequence of region G may be greater than this, 15, 16, 17, 18, 19, or 20 nucleoside units.

[0185] In some embodiments, the nucleosides of region G have a 2'-endo structure.

[0186] Area F' Region F' (3' adjacent or 3' wing) attached to the 3' end of region G comprises, contains or consists of at least one modified nucleoside, e.g., at least 2, at least 3, at least 4, at least 5, at least 6, at least 7 modified nucleosides. In one embodiment, region F' comprises or consists of 1 to 7 modified nucleosides, e.g., 2 to 6 modified nucleosides, 2 to 4 modified nucleosides, 1 to 3 modified nucleosides, 1, 2, 3, or 4 modified nucleosides. In a further embodiment, region F' comprises an additional nucleoside attached to the 3' end of region F', representing region D. Region D preferably comprises 1, 2, or 3 nucleoside units (e.g., DNA nucleosides). Region D' can function as a biocleavable (B) linker as described under "Linker".

[0187] In some variations, the modified nucleosides of region F' have a 3'-endo structure.

[0188] In a preferred embodiment, the modified nucleosides in region F' are LNA.

[0189] In further embodiments, the modified nucleosides of region F' are selected from 2'-O-alkyl-RNA units, 2'-O-methyl-RNA, 2'-amino-DNA units, 2'-fluoro-DNA units, 2'-alkoxy-RNA, MOE units, LNA units, arabinonucleic acid (ANA) units, and 2'-fluoro-ANA units.

[0190] In one embodiment of the invention, all modified nucleosides of region F' are LNA nucleosides. In a further embodiment, the LNA nucleosides of region F' are independently selected from the group consisting of oxy-LNA, thio-LNA, amino-LNA, cET and / or ENA, in either the β-D or α-L configuration, or a combination thereof. In a preferred embodiment, region F' has at least two β-D-oxy LNA units at the 3' end of the contiguous sequence.

[0191] Regions D and D' Regions D and D' may be attached to the 5' end of region F or the 3' end of region F', respectively.

[0192] Regions D and D' may independently comprise 1, 2, 3, 4, or 5 additional nucleotides. These additional nucleotides may or may not be complementary to the target nucleic acid. In this regard, in some embodiments, the oligonucleotides of the invention may comprise a contiguous nucleotide sequence capable of modulating the target flanked by additional nucleotides at the 5'-end and / or 3'-end. Such additional nucleotides may act as a nuclease-sensitive biocleavable linker (see definition of linker). In some embodiments, the additional 5'-end and / or 3'-end nucleotides are linked by phosphodiester bonds and may be DNA or RNA. In other embodiments, the additional 5'-end and / or 3'-end nucleotides are modified nucleotides that may be included, for example, to improve nuclease stability or to facilitate synthesis. In one embodiment, the oligonucleotides of the invention comprise regions D and / or D' in addition to the contiguous nucleotide sequence.

[0193] The gapmer oligonucleotides of the present invention can be represented by the formula: FG-F', especially F 1-7 -G 4-12 -F' 1-7 DFG-F', especially D 1-3 -F 1-7 -G 4-12 -F' 1-7 FG-F'-D', especially F 1-7 -G 4-12 -F' 1-7 -D' 1-3 DFG-F'-D', especially D 1-3 -F 1-7 -G 4-12 -F' 1-7 -D' 1-3

[0194] The preferred numbers and types of nucleosides in regions F, G and F', D and D' are described above. Also, the individual oligonucleotide design can greatly affect the properties of the oligonucleotide when used to regulate the expression of UBE3A.

[0195] In some embodiments, the oligonucleotide is a gapmer 14, 15, 16, 17, 18, 19, or 20 nucleotides in length, and each of regions F and F' independently consists of 2, 3, or 4 modified nucleoside units complementary to a portion of human SNHG14 long untranslated RNA that is antisense to UBE3A·pre-mRNA (the target nucleic acid), and region G consists of 10, 11, 12, 13, 14, or 15 nucleoside units that can recruit a nuclease when duplexed with the target nucleic acid.

[0196] In a further embodiment, the oligonucleotide is a gapmer in which regions F and F' each independently consist of 2, 3, 4, or 5 modified nucleoside units (e.g., nucleoside units containing 2'-O-methoxyethyl ribose sugars (2'-MOE)) or nucleoside units containing 2'-fluoro-deoxyribose sugars and / or LNA units, and region G consists of 9, 10, 11, 12, 13, 14, or 15 nucleoside units (e.g., DNA units), or other nuclease-mobilizing nucleosides (e.g., α-L-LNA, or a mixture of DNA and nuclease-mobilizing nucleosides).

[0197] In a particular embodiment, the oligonucleotide is a gapmer in which regions F and F' each consist of two LNA units and region G consists of 10, 11, 12, 13, 14, or 15 nucleoside units, preferably DNA units. Particular gapmer designs of this nature include 2-10-2, 2-11-2, 2-12-2, 2-13-2, 2-14-2, and 2-15-2.

[0198] In a particular embodiment, the oligonucleotide is a gapmer in which regions F and F' each independently consist of 3 LNA units and region G consists of 10, 11, 12, 13, 14, or 15 nucleoside units, preferably DNA units. Particular gapmer designs of this nature include 3-10-3, 3-11-3, 3-12-3, 3-13-3, 3-14-3, and 3-15-3.

[0199] In a particular embodiment, the oligonucleotide is a gapmer in which regions F and F' each consist of 4 LNA units and region G consists of 10, 11, 12, 13, 14 or 15 nucleoside units, preferably DNA units. Particular gapmer designs of this nature include 4-10-4, 4-11-4, 4-12-4, 4-13-4, 4-14-4 and 4-15-4.

[0200] Particular gapmer designs of this nature include FG-F' designs selected from the group consisting of a gap having 10 nucleosides and wings of, independently, 1 to 4 modified nucleosides, e.g., 1-10-1, 2-10-1, 1-10-2, 1-10-3, 3-10-1, 1-10-4, 4-10-1, 2-10-2, 2-10-3, 3-10-2, 2-10-4, 4-10-2, 3-10-3, 3-10-4, 4-10-3, and 4-10-4 gapmers.

[0201] Particular gapmer designs of this nature include FG-F' designs selected from the group consisting of a gap having 11 nucleosides and wings of independently from 1 to 4 modified nucleosides, e.g., 1-11-1, 2-11-1, 1-11-2, 1-11-3, 3-11-1, 1-11-4, 4-11-1, 2-11-2, 2-11-3, 3-11-2, 2-11-4, 4-11-2, 3-11-3, 3-11-4, 4-11-3, and 4-11-4 gapmers.

[0202] Particular gapmer designs of this nature include FG-F' designs selected from the group consisting of gaps having 12 nucleosides, such as 1-12-1, 2-12-1, 1-12-2, 1-12-3, 3-12-1, 1-12-4, 4-12-1, 2-12-2, 2-12-3, 3-12-2, 2-12-4, 4-12-2, 3-12-3, 3-12-4, 4-12-3, and 4-12-4 gapmers.

[0203] Particular gapmer designs of this nature include FG-F' designs selected from the group consisting of a gap having 13 nucleosides and wings of independently from 1 to 4 modified nucleosides, e.g., 1-13-1, 1-13-2, 1-13-3, 3-13-1, 1-13-4, 4-13-1, 2-13-1, 2-13-2, 2-13-3, 3-13-2, 2-13-4, 4-13-2, 3-13-3, 3-13-4, 4-13-3, and 4-13-4 gapmers.

[0204] Particular gapmer designs of this nature include FG-F' designs selected from the group consisting of a gap having 14 nucleosides and wings of independently 1 to 4 modified nucleosides, e.g., 1-14-1, 1-14-2, 2-14-1, 1-14-3, 3-14-1, 1-14-4, 4-14-1, 2-14-2, 2-14-3, 3-14-2, 2-14-4, 4-14-2, 3-14-3, 3-14-4, and 4-14-3 gapmers.

[0205] Particular gapmer designs of this nature include FG-F' designs selected from the group consisting of a gap having 15 nucleosides and wings of independently 1 to 4 modified nucleosides, e.g., 1-15-1, 1-15-2, 2-15-1, 1-15-3, 3-15-1, 1-15-4, 4-15-1, 2-15-2, 2-15-3, 3-15-2, 2-15-4, 4-15-2, 3-15-3, 3-15-4, and 4-15-3 gapmers.

[0206] Particular gapmer designs of this nature include a gap having 16 nucleosides, and wings FG-F' independently selected from the group consisting of 1 to 4 modified nucleosides, e.g., 1-16-1, 1-16-2, 2-16-1, 1-15-3, 3-16-1, 1-16-4, 4-16-1, 2-16-2, 2-16-3, 3-16-2, 2-16-4, 4-16-2, 3-16-3, 3-16-4, and 4-16-3 gapmers. In some embodiments, the FG-F' design is selected from 2-10-4, 3-10-3, and 4-10-2. In some embodiments, the FG-F' design is selected from 2-11-4, 3-11-2, 3-11-3, and 4-11-2.

[0207] In some embodiments, the FG-F' design is selected from 2-12-2, 2-12-3, 2-12-4, 3-12-2, 3-12-3, and 4-12-2. In some embodiments, the FG-F' design is selected from 2-13-2, 2-13-3, 2-13-4, 3-13-3, and 4-13-2. In some embodiments, the FG-F' design is selected from 2-14-2, 2-14-4, 3-14-3, and 4-14-2. In some embodiments, the FG-F' design is selected from 2-15-2 and 2-16-2. In some embodiments, the FG-F′ design is selected from the designs shown in Table 3.

[0208] In all instances, the FG-F' design may further comprise regions D and / or D', which may have 1, 2 or 3 nucleoside units (e.g., DNA units). It is preferred that the nucleosides of regions F and F' are modified nucleosides, and the nucleotides of region G are preferably unmodified nucleosides.

[0209] In each design, the preferred modified nucleoside is LNA.

[0210] In another embodiment, all of the internucleoside linkages in the gap of the gapmer are phosphorothioate and / or boranophosphate linkages. In another embodiment, all of the internucleoside linkages in the flanking portions of the gapmer (regions F and F') are phosphorothioate and / or boranophosphate linkages. In another preferred embodiment, all of the internucleoside linkages in regions D and D' of the gapmer are phosphodiester linkages.

[0211] In certain gapmers disclosed herein, cytosine (C) residues are shown as 5-methylcytosine, and in various embodiments, one or more of the Cs present in the oligonucleotide may be an unmodified C residue.

[0212] Further gapmer designs are disclosed in WO2004 / 046160, WO2007 / 146511, which are incorporated herein by reference.

[0213] In certain embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds in Table 3.

[0214] In certain embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds having compound identification numbers 4_1 to 150_2.

[0215] In certain embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds having compound identification numbers 4_1 to 678_1.

[0216] In certain embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds having compound identification numbers 4_1 to 818_1 (see oligonucleotide sequences shown in Table 3 in the Examples).

[0217] In certain embodiments of the invention, the oligonucleotide is an oligonucleotide compound having compound identification number 155_1 or 165_1.

[0218] In certain embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds having compound identification numbers 169_52, 169_50, or 169_56.

[0219] In certain embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds having compound identification numbers 172_1, 272_1, 572_7, 572_6, or 572_5.

[0220] In a particular embodiment of the invention, the oligonucleotide is the oligonucleotide compound having compound identification number 175_1.

[0221] In a particular embodiment of the invention, the oligonucleotide is the oligonucleotide compound having compound identification number 178_1.

[0222] In certain embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds having compound identification numbers 573_8, 186_1, or 187_1.

[0223] In a particular embodiment of the invention, the oligonucleotide is the oligonucleotide compound having compound identification number 186_1.

[0224] In certain embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds having compound identification numbers 200_1, 204_1, 206_1, 35_2, or 209_1.

[0225] In certain embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds having compound identification numbers 585_1, 585_8, 586_9, 586_5, 586_8, 586_4, or 586_6.

[0226] In a particular embodiment of the invention, the oligonucleotide is the oligonucleotide compound having compound identification number 233_1.

[0227] In certain embodiments of the invention, the oligonucleotide is an oligonucleotide compound having compound identification number 237_8 or 590_13.

[0228] In a particular embodiment of the invention, the oligonucleotide is the oligonucleotide compound having compound identification number 220_1.

[0229] In certain embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds having compound identification numbers 591_1, 592_2, 592_4, or 241_9.

[0230] In certain embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds having compound identification numbers 597_4, 598_4, 39_1, or 602_1.

[0231] In a particular embodiment of the invention, the oligonucleotide is the oligonucleotide compound having compound identification number 39_1.

[0232] In a particular embodiment of the invention, the oligonucleotide is the oligonucleotide compound having compound identification number 611_7.

[0233] In certain embodiments of the invention, the oligonucleotide is an oligonucleotide compound having compound identification number 271_1 or 278_1.

[0234] In certain aspects of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds having compound identification numbers 616_4, 621_2, 621_1, 622_3, 622_5, 622_4, 624_3, 624_5, 287_1, 625_6, 626_7, 626_8, 626_9, 48_1, 631_6, 631_1, 303_1, 304_6, or 304_10.

[0235] In a particular embodiment of the invention, the oligonucleotide is the oligonucleotide compound having compound identification number 636_8.

[0236] In certain embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds having compound identification numbers 638_8, 639_5, 331_1, or 640_4.

[0237] In certain embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds having compound identification numbers 359_1, 361_1, 361_5, 362_1, or 641_5.

[0238] In certain embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds having compound identification numbers 378_1, 379_1, 399_1.

[0239] In certain embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds having compound identification numbers 403_1, 405_1, 642_12, 642_13, 644_3, or 646_16.

[0240] In certain embodiments of the invention, the oligonucleotide is an oligonucleotide compound having compound identification number 85_1 or 425_5.

[0241] In a particular embodiment of the invention, the oligonucleotide is the oligonucleotide compound having compound identification number 116_1.

[0242] In certain embodiments of the invention, the oligonucleotide is an oligonucleotide compound having compound identification number 123_1 or 124_1.

[0243] In a particular embodiment of the invention, the oligonucleotide is the oligonucleotide compound having compound identification number 126_2. Manufacturing method

[0244] In a further aspect, the present invention provides a method for producing the oligonucleotide of the present invention. The method comprises reacting nucleotide units to thereby form covalently linked consecutive nucleotide units contained in said oligonucleotide. The method preferably uses phosphoramidite chemistry (see, for example, Caruthers et al, 1987, Methods in Enzymology vol. 154, pages 287-313). In a further embodiment, the method further comprises reacting the consecutive nucleotide sequence with a binding moiety (ligand). In a further aspect, a method for producing the composition of the present invention is provided. The method comprises mixing the oligonucleotide or composite oligonucleotide of the present invention with a pharma- ceutically acceptable diluent, solvent, carrier, salt, and / or auxiliary.

[0245] Pharmaceutical Compositions In a further aspect, the present invention provides a pharmaceutical composition comprising any of the above oligonucleotides and / or oligonucleotide complexes, and a pharma- ceutically acceptable diluent, carrier, salt, and / or adjuvant.Pharmaceutically acceptable diluents include phosphate buffered saline (PBS).Pharmaceutically acceptable salts include, but are not limited to, sodium salts and potassium salts.

[0246] WO2007 / 031091 provides suitable and preferred examples of pharma- ceutically acceptable diluents, carriers, and adjuvants (herein incorporated by reference). Suitable dosages, formulations, routes of administration, compositions, dosage forms, combinations with other therapeutic agents, and prodrug formulations are also provided in WO2007 / 031091.

[0247] To prepare pharmaceutical composition or formulation, the oligonucleotide or oligonucleotide complex of the present invention may be mixed with pharmaceutically acceptable active or inactive substances.The composition and method for the formulation of pharmaceutical composition depend on several criteria.Such criteria include but are not limited to, for example, route of administration, degree of disease, dosage, etc.

[0248] In some embodiments, the oligonucleotides or oligonucleotide conjugates of the invention are prodrugs. In particular, with respect to oligonucleotide conjugates, once the prodrug is delivered to the site of action (e.g., a target cell), the conjugate moiety is cleaved from the oligonucleotide.

[0249] Purpose The oligonucleotides of the invention may be used, for example, as research reagents for therapeutic and prophylactic purposes.

[0250] In particular, such oligonucleotides may be used in research to modulate the synthesis of UBE3A protein in cells (e.g., in vitro cell cultures) and experimental animals, facilitating functional analysis of the target or evaluation of its usefulness as a target for therapeutic intervention. Modulation of the target is accomplished by degrading or inhibiting the regulator of the gene or mRNA that produces the protein.

[0251] As a method of therapy, animals or humans suspected of having a disease or disorder may be treated by modulating the expression of UBE3A.

[0252] The invention provides a method for treating or preventing a disease, comprising administering to a subject suffering from or suspected of suffering from the disease a therapeutically or prophylactically effective amount of an oligonucleotide, oligonucleotide conjugate, or pharmaceutical composition of the invention.

[0253] The present invention also relates to an oligonucleotide, a composition or a complex as defined herein for use as a medicament.

[0254] The oligonucleotides, oligonucleotide conjugates, or pharmaceutical compositions according to the invention are typically administered in effective amounts.

[0255] The invention also provides the use of an oligonucleotide or oligonucleotide conjugate of the invention as described in the manufacture of a medicament for the treatment of a disorder referred to herein, or in a method of treating a disorder referred to herein.

[0256] The disease or disorder referred to herein is associated with the expression of UBE3A. In some embodiments, the disease or disorder may be associated with a mutation in the maternal UBE3A gene. In some embodiments, the target nucleic acid is a regulator of the paternal UBE3A gene.

[0257] The method of the present invention is preferably used for the treatment or prevention of a disease caused by an abnormal amount and / or activity of UBE3A, which may in particular result from a reduced amount and / or activity of the UBE3A protein.

[0258] The present invention further relates to the use of an oligonucleotide, an oligonucleotide conjugate or a pharmaceutical composition as defined herein for the manufacture of a medicament for the treatment of abnormal amounts and / or activity of UBE3A, in particular when the amount and / or activity of UBE3A is low.

[0259] In one aspect, the invention relates to the use of an oligonucleotide, an oligonucleotide conjugate, or a pharmaceutical composition for the treatment of Angelman Syndrome.

[0260] Administration The oligonucleotides or pharmaceutical compositions of the invention may be administered topically (e.g., via the skin, inhalation, eye, or ear), enterally (e.g., orally or through the gastrointestinal tract), or parenterally (e.g., intravenously, subcutaneously, intramuscularly, intracerebrally, intraventricularly, or intrathecally).

[0261] In a preferred embodiment, the oligonucleotide or pharmaceutical composition of the present invention is administered by parenteral administration route.Such routes include intravenous injection or infusion, intraarterial injection or infusion, subcutaneous injection or infusion, intraperitoneal injection or infusion, or intramuscular injection or infusion, intrathecal or intracranial administration (e.g., intracerebral or intraventricular administration).In one embodiment, the active oligonucleotide or oligonucleotide complex is administered by intracerebral or intraventricular administration.In another embodiment, the active oligonucleotide or oligonucleotide complex is administered by intrathecal administration.

[0262] The present invention also provides the use of an oligonucleotide or oligonucleotide conjugate of the invention as described in the manufacture of a medicament in a dosage form for intrathecal administration.

[0263] The present invention also provides the use of an oligonucleotide or oligonucleotide complex of the invention as described in the manufacture of a medicament in a dosage form for intracerebral or intraventricular administration.

[0264] The present invention also provides the use of an oligonucleotide or oligonucleotide complex of the invention as described in the manufacture of a medicament in a dosage form for intraventricular administration.

[0265] Combination Therapy In some embodiments, the oligonucleotides, oligonucleotide conjugates, or pharmaceutical compositions of the invention are used in combination therapy with other therapeutic agents, which may be, for example, anticonvulsants.

[0266] Implementation The following embodiments of the invention may be used in combination with all other embodiments described herein.

[0267] 1. An antisense oligonucleotide comprising or consisting of a contiguous nucleotide sequence of 10 to 30 nucleotides in length, capable of inducing human paternal UBE3A expression, particularly in neuronal cells. 2. The oligonucleotide of embodiment 1, wherein said contiguous nucleotide sequence has at least 95% complementarity to a portion of human SNHG14 long non-coding RNA downstream of SNORD109B corresponding to positions 25278410 to 25419462 on human chromosome 15. 3. The oligonucleotide of embodiment 1 or 2, wherein said oligonucleotide is capable of hybridizing to a target nucleic acid of SEQ ID NO: 1 with a ΔG° of less than 10 kcal. 4. The oligonucleotide of embodiments 1 to 3, wherein said contiguous nucleotide sequence has at least 95%, such as 98%, such as 100% complementarity to the target nucleic acid region of SEQ ID NO:1 and / or SEQ ID NO:2. 5. The oligonucleotide of embodiments 1 to 3, wherein the contiguous nucleotide sequence has 100% complementarity to the region of the target nucleic acid from position 1 to position 55318 of SEQ ID NO:1. 6. The oligonucleotide of any one of embodiments 1 to 4, wherein said contiguous nucleotide sequence has complementarity to a subsequence of a target nucleic acid selected from the group consisting of the regions set out in Table 1 or Table 2. 7. The oligonucleotide of any one of embodiments 1 to 4, wherein the contiguous nucleotide sequence has at least 98% complementarity to a portion of human SNHG14 long non-coding RNA that is antisense to UBE3A pre-mRNA. 8. The oligonucleotide of embodiment 1 to 4, or 7, wherein the oligonucleotide is capable of hybridizing to a target nucleic acid corresponding to position 55319 to position 141053 of SEQ ID NO: 1 with a ΔG° of less than 10 kcal. 9. The oligonucleotide of embodiments 1 to 4, or 7 to 8, wherein the contiguous nucleotide sequence has 100% complementarity to the region of the target nucleic acid from position 55319 to position 141053 of SEQ ID NO:1. 10. The oligonucleotide of embodiments 1 to 8, wherein the target nucleic acid is RNA. 11. The oligonucleotide of embodiment 10, wherein the RNA is a long non-coding RNA. 12. The oligonucleotide according to any one of the preceding claims, wherein said contiguous nucleotide sequence comprises or consists of at least 10 contiguous nucleotides, in particular 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 contiguous nucleotides. 13. The oligonucleotide of embodiments 1 to 12, wherein the contiguous nucleotide sequence comprises or consists of 12 to 22 nucleotides. 14. The oligonucleotide of embodiment 13, wherein the contiguous nucleotide sequence comprises or consists of 15 to 20 nucleotides. 15. The oligonucleotide according to any one of the preceding embodiments, wherein said oligonucleotide comprises or consists of 10 to 35 nucleotides in length. 16. The oligonucleotide of embodiment 15, wherein the oligonucleotide comprises or consists of 15 to 24 nucleotides in length. 17. The oligonucleotide of embodiment 15 or 17, wherein said oligonucleotide comprises or consists of 17 to 22 nucleotides in length. 18. The oligonucleotide of embodiments 1 to 17, wherein said oligonucleotide or said contiguous nucleotide sequence is single-stranded. 19. The oligonucleotide of embodiments 1 to 18, wherein said contiguous nucleotide sequence has complementarity to a subsequence of a target nucleic acid selected from the group consisting of the regions set out in Tables 1 or 2. 20. The oligonucleotide of embodiments 1 to 18, wherein the contiguous nucleotide sequence has 100% complementarity to a subsequence of a target nucleic acid selected from the group consisting of positions 1589 to 10889, 46089 to 53989, and 60789 to 62489 of SEQ ID NO:1. 21. The oligonucleotide of embodiments 1 to 18, wherein the contiguous nucleotide sequence has complementarity to a subsequence of a target nucleic acid corresponding to position 5218 to position 5240 of SEQ ID NO:1. 22. The oligonucleotide of embodiments 1 to 18, wherein the contiguous nucleotide sequence has complementarity to a subsequence of a target nucleic acid corresponding to position 5782 to position 5803 of SEQ ID NO:1. 23. The oligonucleotide of embodiments 1 to 18, wherein the contiguous nucleotide sequence has complementarity to a subsequence of a target nucleic acid corresponding to position 8113 to position 8139 of SEQ ID NO:1. 24. The oligonucleotide of embodiments 1 to 18, wherein the contiguous nucleotide sequence has complementarity to a subsequence of a target nucleic acid corresponding to position 9200 to position 9250 of SEQ ID NO:1. 25. The oligonucleotide of any one of embodiments 1 to 18, wherein the contiguous nucleotide sequence has complementarity to a subsequence of a target nucleic acid corresponding to position 11505 to position 11555 of SEQ ID NO:1. 26. The oligonucleotide of embodiments 1 to 18, wherein the contiguous nucleotide sequence has complementarity to a subsequence of a target nucleic acid corresponding to position 13223 to position 13242 of SEQ ID NO:1. 27. The oligonucleotide of embodiments 1 to 18, wherein the contiguous nucleotide sequence has complementarity to a subsequence of a target nucleic acid corresponding to positions 15100 to 15150 of SEQ ID NO:1. 28. The oligonucleotide of embodiments 1 to 18, wherein the contiguous nucleotide sequence has complementarity to a subsequence of a target nucleic acid corresponding to positions 15113 to 15180 of SEQ ID NO:1. 29. The oligonucleotide of embodiments 1 to 18, wherein the contiguous nucleotide sequence has complementarity to a subsequence of a target nucleic acid corresponding to position 29635 to position 29705 of SEQ ID NO:1. 30. The oligonucleotide of embodiments 1 to 18, wherein the contiguous nucleotide sequence has complementarity to a subsequence of a target nucleic acid corresponding to positions 30590 to 30740 of SEQ ID NO:1. 31. The oligonucleotide of embodiments 1 to 18, wherein the contiguous nucleotide sequence has complementarity to a subsequence of a target nucleic acid corresponding to positions 39800 to 39855 of SEQ ID NO:1. 32. The oligonucleotide of embodiments 1 to 18, wherein the contiguous nucleotide sequence has complementarity to a subsequence of a target nucleic acid corresponding to position 44435 to position 44460 of SEQ ID NO:1. 33. The oligonucleotide of embodiments 1 to 18, wherein the contiguous nucleotide sequence has complementarity to a subsequence of a target nucleic acid corresponding to position 45245 to position 45270 of SEQ ID NO:1. 34. The oligonucleotide of embodiments 1 to 18, wherein the contiguous nucleotide sequence has complementarity to a subsequence of a target nucleic acid corresponding to position 46380 to position 46430 of SEQ ID NO:1. 35. The oligonucleotide of embodiments 1 to 18, wherein the contiguous nucleotide sequence has complementarity to a subsequence of a target nucleic acid corresponding to positions 68915 to 68940 of SEQ ID NO:1. 36. The oligonucleotide of embodiments 1 to 35, wherein the oligonucleotide is neither siRNA nor self-complementary. 37. The contiguous nucleotide sequence is SEQ ID NO: 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 23, 24, 25, 26, 26, 27, 28, 29, 30, 31, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 44, 45, 45, 46, 47, 48, 49, 50, 51, 52, 53, 53, 54, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 95, 96, 96, 96, 97, 98, 99, 100, 101, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122 , 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169 , 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216 , 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263,264、265、266、267、268、269、270、271、272、273、274、275、276、277、278、279、280、281、282、283、284、285、286、287、288、289、290、291、292、293、294、295、296、297、298、299、300、301、302、303、304、304、305、306、307、308、309、310、311、312、313、314、315、316、317、318、319、320、321、322、323、324、325、326、327、328、329、330、331、332、333、334、335、336、337、338、339、340、341、342、343、344、345、346、347、348、349、350、351、352、353、354、355、356、357、358、359、360、361、362、363、364、365、366、367、368、369、370、371、372、373、374、375、376、377、378、379、380、381、382、383、384、385、386、387、388、389、390、391、392、393、394、395、396、397、398、399、400、401、402、403、404、405、406、407、408、409、410、411、412、413、414、415、416、417、418、419、420、421、422、423、424、425、426、427、428、429、430、431、432、433、434、435、436、437、438、439、440、441、442、443、444、445、446、447、448、449、450、451、452、453、454、455、456、457、458、459、460、461、462、463、464、465、466、467、468、469、470、471、472、473、474、475、476、477、478、479、480、481、482、483、484、485、486、487、488、489、490、491、492、493、494、495、496、497、498、499、500、501、502、503、504、505、506、507、508、509、510、511、512、513、514、515、516、517、518、519、520、521、522、523、524、525、526、527、528、529、530、531、532、533、534、535、536、537、538、539、540、541、542、543、544、545、546、547、548、549、550、551、552、553、554、555、556、557、558、559、560、561、562、563、564、565、566、567、568、569、570、571、572、573、574、575、576、577、578、579、580、581、582、583、584、585、586、587、588、589、590、591、592、593、594、595、596、596、597、598、599、600、601、602、603、604、605、606、607、608、609、610、611、612、613、614、615、616、617、618、619、620、621、622、623、624、625、626、627、628、629、630、631、632、633、634、635、636、637、638、639、640、641、642、643、644、645、646、647、648、649、650、651、652、653、654、655、656、657、658、659、660、661、662、663、664、665、666、667、668、669、670、671、672、673、674、675、676、677、678、679、680、681、682、683、684、685、686、687、688、689、690、691、692、693、694、695、696、697、698、699、700、702、703、704、705、706、707、708、709、710、711、712、713、714、715、716、717、718、719、719、720、721、722、723、724、725、726、727、728、729、730、731、732、733、734、735、736、737、738、739、740、741、742、743、744、745、746、747、748、749、750、751、752、754、755、756、757、758、759、760、761、762、37. The oligonucleotide of any one of claims 1 to 36, comprising or consisting of a sequence selected from the group consisting of: 763, 764, 765, 766, 767, 768, 769, 770, 772, 773, 774, 775, 776, 777, 778, 779, 780, 781, 782, 783, 784, 785, 786, 787, 788, 789, 790, 791, 792, 793, 794, 795, 796, 797, 798, 799, 800, 801, 802, 803, 804, 805, 806, 807, 808, 809, 810, 811, 812, 813, 814, 815, 816, 817 and 818. 38. The oligonucleotide of embodiments 1 to 36, wherein the contiguous nucleotide sequence comprises or consists of a sequence selected from the group consisting of SEQ ID NOs: 166, 167, 167 or 169 (see the motif sequences listed in Table 3 in the Examples section). 39. The oligonucleotide of embodiments 1 to 36, wherein the contiguous nucleotide sequence comprises or consists of a sequence selected from the group consisting of SEQ ID NOs: 570, 571, 572, 679, 680, 681, 682 and 683 (see the motif sequences listed in Table 3 in the Examples section). 40. The oligonucleotide of embodiments 1 to 36, wherein the contiguous nucleotide sequence comprises or consists of a sequence selected from the group consisting of SEQ ID NOs: 570, 571, 572, 679, 680, 681, 682 and 683 (see the motif sequences listed in Table 3 in the Examples section). 41. The oligonucleotide of embodiments 1 to 36, wherein the contiguous nucleotide sequence comprises or consists of a sequence selected from the group consisting of SEQ ID NOs: 35, 199 to 210 or SEQ ID NOs: 582 to 584 (see the motif sequences listed in Table 3 in the Examples section). 42. The oligonucleotide of embodiments 1 to 36, wherein the contiguous nucleotide sequence comprises or consists of a sequence selected from the group consisting of SEQ ID NOs: 236, 237, 238, 239, 240 and 590 (see the motif sequences listed in Table 3 in the Examples section). 43. The oligonucleotide of embodiments 1 to 36, wherein the contiguous nucleotide sequence comprises or consists of a sequence selected from the group consisting of SEQ ID NOs: 221 to 225 or SEQ ID NOs: 585 to 589 (see the motif sequences listed in Table 3 in the Examples section). 44. The oligonucleotide of embodiments 1 to 36, wherein the contiguous nucleotide sequence comprises or consists of a sequence selected from the group consisting of SEQ ID NO: 241 or 591 (see the motif sequences listed in Table 3 in the Examples section). 45. The oligonucleotide of embodiments 1 to 36, wherein the contiguous nucleotide sequence comprises or consists of a sequence selected from the group consisting of SEQ ID NOs: 46 to 48, 285 to 305, or SEQ ID NOs: 613 to 632, or 721 to 807 (see the motif sequences listed in Table 3 in the Examples section). 46. ​​The oligonucleotide of embodiments 1 to 36, wherein the contiguous nucleotide sequence comprises or consists of a sequence selected from the group consisting of SEQ ID NOs: 331, 332, 638, 639, 640, 808, 809, 810, 811, 812, 813, 814 and 815 (see the motif sequences listed in Table 3 in the Examples section). 47. The oligonucleotide of embodiments 1 to 36, wherein the contiguous nucleotide sequence comprises or consists of a sequence selected from the group consisting of SEQ ID NOs: 409 to 411 or SEQ ID NOs: 642 to 646 or 816 to 818 (see the motif sequences listed in Table 3 in the Examples section). 48. The oligonucleotide of embodiments 1 to 47, having 0 to 3 mismatches in contiguous nucleotide sequence compared to the target nucleic acid. 49. The oligonucleotide of embodiment 48, having one mismatch in contiguous nucleotide sequence compared to the target nucleic acid. 50. The oligonucleotide of embodiment 48, having two mismatches in consecutive nucleotide sequence compared to the target nucleic acid. 51. The oligonucleotide of embodiment 48, wherein the contiguous nucleotide sequence is perfectly complementary to the target nucleotide sequence. 52. The oligonucleotide of any one of the preceding embodiments, comprising one or more modified nucleosides. 53. The oligonucleotide of embodiment 52, wherein said one or more modified nucleosides are affinity-modified nucleosides. 54. The oligonucleotide of embodiment 52 or 53, wherein said one or more modified nucleosides are 2' sugar modified nucleosides. 55. The oligonucleotide of embodiment 54, wherein the one or more 2' sugar modified nucleosides are independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, 2'-fluoro-ANA and LNA nucleosides. 56. The oligonucleotide of embodiment 54, wherein said one or more modified nucleosides are LNA nucleosides. 57. The oligonucleotide of embodiment 56, wherein the modified LNA nucleotide is oxy-LNA. 58. The oligonucleotide of embodiment 57, wherein the modified nucleoside is β-D-oxy-LNA. 59. The oligonucleotide of embodiment 57, wherein the modified nucleoside is α-L-oxy-LNA. 60. The oligonucleotide of embodiment 56, wherein the modified LNA nucleotide is thio-LNA. 61. The oligonucleotide of embodiment 56, wherein the modified LNA nucleotide is amino-LNA. 62. The oligonucleotide of embodiment 56, wherein the modified LNA nucleotide is cET. 63. The oligonucleotide of embodiment 56, wherein the modified LNA nucleotide is ENA. 64. The oligonucleotide of embodiment 56, wherein the modified LNA nucleotide is selected from β-D-oxy-LNA, α-L-oxy-LNA, β-D-amino-LNA, α-L-amino-LNA, β-D-thio-LNA, α-L-thio-LNA, (S)cET, (R)cET, β-D-ENA and α-L-ENA. 65. The oligonucleotide of any one of the preceding embodiments, wherein the oligonucleotide comprises at least one modified internucleoside linkage. 66. The oligonucleotide of embodiment 65, wherein the modified internucleoside linkages are nuclease-resistant. 67. The oligonucleotide of embodiment 65 or 66, wherein at least 50% of the internucleoside linkages in said contiguous nucleotide sequence are phosphorothioate internucleoside linkages or boranophosphate internucleoside linkages. 68. The oligonucleotide of embodiment 65 or 66, wherein the internucleoside linkages in the consecutive nucleotide sequence are phosphorothioate internucleoside linkages. 69. The oligonucleotide of embodiments 1 to 68, wherein the oligonucleotide is capable of recruiting RNaseH. 70. The oligonucleotide of embodiment 69, wherein the oligonucleotide is a gapmer. 71. The oligonucleotide of embodiment 69 or 70, wherein the oligonucleotide is a gapmer of the formula 5'-FG-F'-3', where regions F and F' independently comprise or consist of 1 to 7 modified nucleosides, and G is a region of 6 to 16 nucleosides capable of recruiting RNase H. 72. The oligonucleotide of embodiment 71, wherein said modified nucleoside is a 2' sugar modified nucleoside independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabinonucleic acid (ANA), 2'-fluoro-ANA and LNA nucleosides. 73. The oligonucleotide of embodiment 71 or 72, wherein one or more of the modified nucleosides of regions F and F' is an LNA nucleoside. 74. The oligonucleotide of embodiment 73, wherein all of said modified nucleosides of regions F and F' are LNA nucleosides. 75. The oligonucleotide of embodiment 74, wherein regions F and F' consist of LNA nucleosides. 76. The oligonucleotide of embodiments 73 to 75, wherein all modified nucleosides in regions F and F' are oxy-LNA nucleosides. 77. The oligonucleotide of embodiment 73, wherein at least one of regions F or F' further comprises at least one 2'-substituted modified nucleoside independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, and 2'-fluoro-DNA. 78. The oligonucleotide of embodiments 73 to 77, wherein the RNase H-recruiting nucleosides of region G are independently selected from DNA, α-L-LNA, C4' alkylated DNA, ANA and 2'F-ANA, and UNA. 79. The oligonucleotide of embodiment 78, wherein said nucleosides of region G are DNA and / or α-L-LNA nucleosides. 80. The oligonucleotide of embodiment 78 or 79, wherein region G consists of at least 75% DNA nucleosides. 81. The oligonucleotide of embodiments 1 to 80, wherein said oligonucleotide is capable of increasing the expression of UBE3A by at least 30% compared to a control. 82. The oligonucleotide of embodiments 1 to 81, wherein the level of the SNHG14 transcript downstream of SNORD109B is reduced by at least 20% compared to a control. 83. The oligonucleotide of embodiments 1 to 82, wherein the expression of SNORD115 is not significantly affected compared to a control. 84. The oligonucleotide of embodiments 1 to 83, wherein the oligonucleotide is selected from compound identification numbers 4_1 to 678_1. 85. The oligonucleotides are selected from the group consisting of compound identification numbers 4_1, 4_2, 5_1, 5_2, 6_1, 6_2, 7_1, 7_2, 8_1, 9_1, 10_1, 11_1, 11_2, 12_1, 12_2, 13_1, 13_2, 14_1, 15_1, 16_1, 17_1, 17_2, 18_1, 18_2, 19_1, 19_2, 20_1, 21_1, 22_1, 23_1, 23_2, 24_1, 25_1, 26_1, 26_2, 27_1, 28_1, 28_2, 29_1, 29_2, 30_1, 31_1, 31_2, 32_1, 33_1, 34_1, 34_2, 34_3, 34_4, 34_5, 34_6, 34_7, 34_8, 34_9, 34_10, 34_11, 34_12, 34_13, 34_14, 34_15, 34_16, 34_17, 34_18, 34_19, 34_21, 34_22, 34_19, 34_23, 34_19, 34_24, 34_19, 34_19, 34_25, 34_19, 34_19, 34_26, 34_19, 34_19, 34_27, 34_ _3, 34_4, 34_5, 34_6, 34_7, 35_1, 35_2, 36_1, 37_1, 38_1, 38_2, 38_3, 38_4, 38_5, 38_6, 39_1, 39_2, 39_3, 39_4, 39_5, 40_1, 40_2, 40_3, 40_4, 40_5, 40 _6, 40_7, 40_8, 41_1, 42_1, 43_1, 44_1, 44_2, 45_1, 45_2, 46_1, 47_1, 48_1, 48_2, 48_3, 48_4, 48_5, 48_6, 48_7, 49_1, 50_1, 51_1, 52_1, 53_1, 53_2, 54 _1, 54_2, 54_3, 55_1, 55_2, 56_1, 57_1, 58_1, 58_2, 58_3, 59_1, 59_2, 60_1, 60_2, 60_3, 61_1, 62_1, 63_1, 64_1, 64_2, 65_1, 66_1, 67_1, 68_1, 69_1, 69 _2, 69_3, 70_1, 70_2, 70_3, 71_1, 72_1, 72_2, 73_1, 73_2, 73_3, 74_1, 74_2, 75_1, 75_2, 76_1, 77_1, 77_2, 77_3, 78_1, 79_1, 79_2, 79_3, 80_1, 80_2, 80 _3, 81_1, 82_1, 82_2, 83_1, 83_2, 84_1, 84_2, 85_1, 85_2, 86_1, 87_1, 88_1, 88_2, 89_1, 90_1, 91_1, 92_1, 93_1, 94_1, 95_1, 95_2, 96_1, 96_2, 96_3, 97 _1, 97_2, 97_3, 97_4, 98_1, 98_2, 98_3, 99_1, 99_2, 99_3, 99_4, 100_1, 100_2, 100_3, 101_1, 101_2, 101_3, 101_4, 102_1, 102_2, 102_3, 102_4, 103_1,103_2、103_3、103_4、104_1、104_2、104_3、105_1、105_2、105_3、105_4、106_1、106_2、106_3、106_4、107_1、107_2、107_3、107_4、108_1、108_2、108_3、108_4、109_1、109_2、109_3、109_4、110_1、110_2、111_1、111_2、111_3、112_1、112_2、113_1、114_1、115_1、116_1、117_1、118_1、119_1、120_1、120_2、121_1、122_1、123_1、124_1、125_1、126_1、126_2、127_1、128_1、128_2、128_3、128_4、129_1、129_2、130_1、131_1、132_1、132_2、132_3、133_1、133_2、133_3、133_4、134_1、134_2、135_1、135_2、136_1、137_1、138_1、139_1、140_1、141_1、142_1、143_1、144_1、145_1、145_2、146_1、146_2、147_1、148_1、149_1、150_1、150_2、151_1、152_1、153_1、154_1、155_1、156_1、157_1、158_1、159_1、160_1、161_1、162_1、163_1、164_1、165_1、166_1、167_1、168_1、169_1、169_10、169_11、169_12、169_13、169_14、169_15、169_16、169_17、169_18、169_19、169_2、169_20、169_21、169_22、169_23、169_24、169_25、169_26、169_27、169_28、169_29、169_3、169_30、169_31、169_32、169_33、169_34、169_35、169_36、169_37、169_38、169_39、169_4、169_40、169_41、169_42、169_43、169_44、169_45、169_46、169_47、169_48、169_49、169_5、169_50、169_51、169_52、169_53、169_54、169_55、169_56、169_57、169_6、169_7、169_8、169_9、169_58、169_59、169_60、169_61、169_62、170_1、171_1、172_1、173_1、174_1、175_1、176_1、177_1、178_1、179_1、180_1、181_1、182_1、183_1、184_1、185_1、186_1、187_1、188_1、189_1、190_1、191_1、192_1、193_1、194_1、195_1、196_1、197_1、198_1、199_1、200_1、201_1、202_1、203_1、204_1、205_1、206_1、207_1、208_1、208_2、208_3、208_4、208_5、208_6、208_7、209_1、209_10、209_2、209_3、209_4、209_5、209_6、209_7、209_8、209_9、210_1、211_1、212_1、213_1、214_1、215_1、216_1、217_1、218_1、219_1、220_1、221_1、222_1、223_1、224_1、225_1、226_1、227_1、228_1、229_1、230_1、231_1、232_1、233_1、234_1、235_1、236_1、236_10、236_11、236_12、236_13、236_14、236_15、236_16、236_2、236_3、236_4、236_5、236_6、236_7、236_8、236_9、236_17、236_18、236_19、236_20、236_21、237_1、237_10、237_11、237_12、237_13、237_14、237_15、237_16、237_2、237_3、237_4、237_5、237_6、237_7、237_8、237_9、237_17、237_18、237_19、237_20、237_21、238_1、239_1、239_10、239_11、239_12、239_13、239_14、239_15、239_16、239_2、239_3、239_4、239_5、239_6、239_7、239_8、239_9、239_17、239_18、239_19、239_20、239_21、240_1、241_1、241_10、241_2、241_3、241_4、241_5、241_6、241_7、241_8、241_9、241_11、241_12、241_13、241_14、241_15、242_1、243_1、244_1、244_2、244_3、244_4、244_5、245_1、246_1、247_1、248_1、249_1、250_1、251_1、252_1、253_1、254_1、255_1、256_1、257_1、258_1、259_1、260_1、261_1、262_1、263_1、264_1、265_1、266_1、267_1、268_1、269_1、270_1、271_1、272_1、273_1、274_1、275_1、276_1、277_1、278_1、279_1、280_1、281_1、282_1、283_1、284_1、285_1、285_2、285_3、285_4、285_5、285_6、285_7、285_8、285_9、285_10、285_11、286_1、287_1、288_1、289_1、290_1、291_1、292_1、293_1、294_1、295_1、296_1、297_1、298_1、299_1、300_1、301_1、302_1、303_1、304_1、304_10、304_2、304_3、304_4、304_5、304_6、304_7、304_8、304_9、304_11、304_12、304_13、304_14、304_15、305_1、306_1、307_1、308_1、309_1、310_1、311_1、312_1、313_1、314_1、315_1、316_1、317_1、318_1、319_1、320_1、321_1、322_1、323_1、324_1、325_1、326_1、327_1、328_1、329_1、330_1、331_1、332_1、333_1、334_1、335_1、336_1、337_1、338_1、339_1、340_1、341_1、342_1、343_1、344_1、345_1、346_1、347_1、348_1、349_1、350_1、351_1、352_1、353_1、354_1、355_1、356_1、357_1、358_1、359_1、360_1、361_1、361_10、361_2、361_3、361_4、361_5、361_6、361_7、361_8、361_9、362_1、362_10、362_2、362_3、362_4、362_5、362_6、362_7、362_8、362_9、363_1、364_1、365_1、366_1、367_1、368_1、369_1、370_1、371_1、372_1、373_1、374_1、375_1、376_1、377_1、378_1、379_1、380_1、381_1、382_1、383_1、384_1、385_1、386_1、387_1、388_1、389_1、390_1、391_1、392_1、393_1、394_1、395_1、396_1、397_1、398_1、399_1、400_1、401_1、402_1、403_1、404_1、405_1、406_1、407_1、408_1、409_1、410_1、411_1、412_1、413_1、414_1、415_1、416_1、417_1、418_1、419_1、420_1、421_1、422_1、423_1、424_1、425_1、425_10、425_2、425_3、425_4、425_5、425_6、425_7、425_8、425_9、426_1、427_1、428_1、429_1、430_1、431_1、432_1、433_1、434_1、435_1、436_1、437_1、438_1、439_1、440_1、441_1、442_1、443_1、444_1、445_1、446_1、447_1、448_1、449_1、450_1、451_1、452_1、453_1、454_1、455_1、456_1、457_1、458_1、459_1、460_1、461_1、462_1、463_1、464_1、465_1、466_1、467_1、468_1、469_1、470_1、471_1、472_1、473_1、474_1、475_1、476_1、477_1、478_1、479_1、480_1、481_1、482_1、483_1、484_1、485_1、486_1、487_1、488_1、489_1、490_1、491_1、492_1、493_1、494_1、495_1、496_1、497_1、498_1、499_1、500_1、501_1、502_1、503_1、504_1、505_1、506_1、507_1、508_1、509_1、510_1、511_1、512_1、513_1、514_1、515_1、516_1、517_1、518_1、519_1、520_1、521_1、522_1、523_1、524_1、525_1、526_1、527_1、528_1、529_1、530_1、531_1、532_1、533_1、534_1、535_1、536_1、537_1、538_1、539_1、540_1、541_1、542_1、543_1、544_1、545_1、546_1、547_1、548_1、549_1、550_1、551_1、552_1、553_1、554_1、555_1、556_1、557_1、558_1、559_1、560_1、561_1、562_1、563_1、564_1、565_1、566_1、567_1、568_1、569_1、570_1、570_2、570_3、570_4、570_5、570_6、570_7、570_8、570_9、570_10、570_11、570_12、570_13、570_14、571_1、571_2、571_3、571_4、571_5、571_6、571_7、571_8、571_9、571_10、571_11、571_12、571_13、571_14、572_1、572_2、572_3、572_4、572_5、572_6、572_7、572_8、572_9、572_10、572_11、572_12、572_13、572_14、573_1、573_2、573_3、573_4、573_5、573_6、573_7、573_8、573_9、573_10、573_11、573_12、573_13、573_14、574_1、574_2、574_3、574_4、574_5、574_6、574_7、574_8、574_9、574_10、574_11、574_12、574_13、574_14、575_1、575_2、575_3、575_4、575_5、575_6、575_7、575_8、575_9、575_10、575_11、575_12、575_13、575_14、576_1、576_2、576_3、576_4、576_5、576_6、576_7、576_8、576_9、576_10、576_11、576_12、576_13、576_14、577_1、577_2、577_3、577_4、577_5、577_6、577_7、577_8、577_9、577_10、577_11、577_12、577_13、577_14、578_1、578_2、578_3、578_4、578_5、578_6、578_7、578_8、578_9、579_1、579_2、579_3、579_4、579_5、579_6、579_7、579_8、579_9、580_1、580_2、580_3、580_4、580_5、580_6、580_7、580_8、580_9、581_1、581_2、581_3、581_4、581_5、581_6、581_7、581_8、581_9、582_1、582_2、582_3、582_4、582_5、582_6、582_7、582_8、582_9、583_1、583_2、583_3、583_4、583_5、583_6、583_7、583_8、583_9、584_1、584_2、584_3、584_4、584_5、584_6、584_7、584_8、585_1、585_2、585_3、585_4、585_5、585_6、585_7、585_8、585_9、585_10、585_11、585_12、585_13、585_14、586_1、586_2、586_3、586_4、586_5、586_6、586_7、586_8、586_9、586_10、586_11、586_12、586_13、586_14、587_1、587_2、587_3、587_4、587_5、587_6、587_7、587_8、587_9、587_10、587_11、587_12、587_13、587_14、588_1、588_2、588_3、588_4、588_5、588_6、588_7、588_8、588_9、588_10、588_11、588_12、588_13、588_14、589_1、589_2、589_3、589_4、589_5、589_6、589_7、589_8、589_9、589_10、589_11、589_12、589_13、589_14、590_1、590_10、590_11、590_12、590_13、590_14、590_15、590_2、590_3、590_4、590_5、590_6、590_7、590_8、590_9、590_16、590_17、590_18、590_19、590_20、591_1、591_2、592_1、592_2、592_3、592_4、592_5、592_6、592_7、592_8、592_9、592_10、592_11、592_12、592_13、592_14、593_1、593_2、593_3、593_4、594_1、594_2、594_3、594_4、595_1、595_2、595_3、595_4、596_1、596_2、596_3、596_4、597_1、597_2、597_3、597_4、598_1、598_2、598_3、598_4、599_1、599_2、599_3、599_4、600_1、600_2、600_3、600_4、601_1、601_2、601_3、601_4、602_1、602_2、602_3、602_4、603_1、603_2、603_3、603_4、604_1、604_2、604_3、604_4、605_1、605_2、605_3、605_4、606_1、606_2、606_3、606_4、607_1、607_2、607_3、607_4、608_1、608_2、608_3、608_4、608_5、608_6、608_7、608_8、608_9、609_1、609_2、609_3、609_4、609_5、609_6、609_7、609_8、609_9、610_1、610_2、610_3、610_4、610_5、610_6、610_7、610_8、610_9、611_1、611_2、611_3、611_4、611_5、611_6、611_7、611_8、611_9、612_1、612_2、612_3、612_4、612_5、612_6、612_7、612_8、612_9、613_1、613_2、613_3、613_4、613_5、613_6、613_7、613_8、613_9、613_10、614_1、614_2、614_3、614_4、614_5、614_6、614_7、614_8、614_9、614_10、615_1、615_2、615_3、615_4、615_5、615_6、615_7、615_8、615_9、615_10、616_1、616_2、616_3、616_4、616_5、616_6、616_7、616_8、616_9、616_10、617_1、617_2、617_3、617_4、617_5、617_6、617_7、617_8、617_9、617_10、618_1、618_2、618_3、618_4、618_5、618_6、618_7、618_8、618_9、618_10、619_1、619_2、619_3、619_4、619_5、619_6、619_7、619_8、619_9、619_10、620_1、620_2、620_3、620_4、620_5、620_6、620_7、620_8、620_9、620_10、621_1、621_2、621_3、621_4、621_5、621_6、621_7、621_8、621_9、621_10、621_11、622_1、622_2、622_3、622_4、622_5、622_6、622_7、622_8、622_9、622_10、623_1、623_2、623_3、623_4、623_5、623_6、623_7、623_8、623_9、623_10、624_1、624_2、624_3、624_4、624_5、624_6、624_7、624_8、624_9、624_10、625_1、625_2、625_3、625_4、625_5、625_6、625_7、625_8、625_9、625_10、625_11、625_12、625_13、625_14、626_1、626_2、626_3、626_4、626_5、626_6、626_7、626_8、626_9、626_10、626_11、626_12、626_13、626_14、627_1、627_2、627_3、627_4、627_5、627_6、627_7、627_8、627_9、627_10、627_11、627_12、627_13、62、 7_14、628_1、628_2、628_3、628_4、628_5、628_6、628_7、628_8、628_9、628_10、628_11、628_12、628_13、628_14、629_1、629_10、629_11、629_2、629_3、629_4、629_5、629_6、629_7、629_8、629_9、629_12、629_13、629_14、629_15、629_16、630_1、630_2、630_3、631_1、631_10、631_2、631_3、631_4、631_5、631_6、631_7、631_8、631_9、631_11、631_12、631_13、631_14、631_15、632_1、632_2、632_3、632_4、632_5、632_6、632_7、632_8、632_9、632_10、632_11、632_12、632_13、632_14、633_1、633_2、633_3、633_4、633_5、633_6、633_7、633_8、633_9、634_1、634_2、634_3、634_4、634_5、634_6、634_7、634_8、634_9、635_1、635_2、635_3、635_4、635_5、635_6、635_7、635_8、635_9、636_1、636_2、636_3、636_4、636_5、636_6、636_7、636_8、636_9、637_1、637_2、637_3、637_4、637_5、637_6、637_7、637_8、637_9、638_1、638_2、638_3、638_4、638_5、638_6、638_7、638_8、638_9、638_10、638_11、638_12、638_13、638_14、639_1、639_2、639_3、639_4、639_5、639_6、639_7、639_8、639_9、639_10、639_11、639_12、639_13、639_14、640_1、640_2、640_3、640_4、640_5、640_6、640_7、640_8、640_9、640_10、640_11、640_12、640_13、640_14、641_1、641_2、641_3、641_4、641_5、641_6、641_7、641_8、641_9、642_1、642_10、642_11、642_12、642_13、642_14、642_15、642_16、642_17、642_2、642_3、642_4、642_5、642_6、642_7、642_8、642_9、642_18、642_19、642_20、642_21、642_22、643_1、644_1、644_2、644_3、644_4、644_5、644_6、645_1、645_2、645_3、645_4、645_5、645_6、645_7、645_8、645_9、645_10、646_1、646_10、646_11、646_12、646_13、646_14、646_15、646_16、646_17、646_18、646_19、646_2、646_3、646_4、646_5、646_6、646_7、646_8、646_9、646_20、646_21、646_22、646_23、646_24、647_1、648_1、649_1、650_1、651_1、652_1、653_1、654_1、655_1、656_1、657_1、658_1、659_1、660_1、661_1、662_1、663_1、664_1、665_1、666_1、667_1、668_1、669_1、670_1、671_1、672_1、673_1、674_1、675_1、676_1、677_1、678_1、679_1、679_2、679_3、679_4、679_5、680_1、680_2、680_3、680_4、680_5、681_1、681_2、681_3、681_4、681_5、682_1、682_2、682_3、682_4、682_5、683_1、683_2、683_3、683_4、683_5、684_1、684_2、684_3、684_4、684_5、685_1、685_2、685_3、685_4、685_5、686_1、686_2、686_3、686_4、686_5、687_1、687_2、687_3、687_4、687_5、688_1、688_2、688_3、688_4、688_5、689_1、689_2、689_3、689_4、689_5、690_1、690_2、690_3、690_4、690_5、691_1、691_2、692_1、692_2、692_3、692_4、692_5、693_1、693_2、693_3、693_4、693_5、694_1、694_2、694_3、694_4、694_5、695_1、695_2、695_3、695_4、695_5、696_1、696_2、696_3、696_4、696_5、697_1、697_2、697_3、697_4、697_5、698_1、698_2、698_3、698_4、698_5、699_1、699_2、699_3、699_4、699_5、700_1、700_2、700_3、700_4、700_5、701_1、701_2、701_3、701_4、701_5、702_1、702_2、702_3、702_4、702_5、703_1、703_2、703_3、703_4、703_5、704_1、704_2、704_3、704_4、704_5、705_1、705_2、705_3、705_4、705_5、706_1、706_2、706_3、706_4、706_5、707_1、707_2、707_3、707_4、707_5、708_1、708_2、708_3、708_4、708_5、709_1、709_2、709_3、709_4、709_5、710_1、710_2、710_3、710_4、710_5、711_1、711_2、711_3、711_4、711_5、712_1、712_2、712_3、712_4、712_5、713_1、713_2、713_3、713_4、713_5、714_1、714_2、714_3、714_4、714_5、715_1、715_2、715_3、715_4、715_5、716_1、716_2、716_3、716_4、716_5、717_1、717_2、717_3、717_4、717_5、718_1、718_2、719_1、719_2、719_3、719_4、719_5、720_1、720_2、720_3、720_4、720_5、721_1、721_2、721_3、721_4、721_5、722_1、722_2、722_3、722_4、722_5、723_1、723_2、723_3、723_4、723_5、724_1、724_2、724_3、724_4、724_5、725_1、725_2、725_3、725_4、725_5、726_1、726_2、726_3、726_4、726_5、727_1、727_2、727_3、727_4、727_5、728_1、728_2、728_3、728_4、728_5、729_1、729_2、729_3、729_4、729_5、730_1、730_2、730_3、730_4、730_5、731_1、731_2、731_3、731_4、731_5、732_1、732_2、732_3、732_4、732_5、733_1、733_2、733_3、733_4、733_5、734_1、734_2、734_3、734_4、734_5、735_1、735_2、735_3、735_4、735_5、736_1、736_2、736_3、736_4、736_5、737_1、737_2、737_3、737_4、737_5、738_1、738_2、738_3、738_4、738_5、738_6、739_1、739_2、739_3、739_4、739_5、740_1、740_2、740_3、740_4、740_5、741_1、741_2、741_3、741_4、741_5、742_1、742_2、742_3、743_1、743_2、743_3、743_4、743_5、744_1、744_2、744_3、744_4、744_5、745_1、745_2、745_3、745_4、745_5、746_1、746_2、746_3、747_1、747_2、747_3、747_4、747_5、748_1、748_2、748_3、748_4、748_5、749_1、749_2、749_3、749_4、749_5、750_1、750_2、750_3、750_4、751_1、751_2、751_3、751_4、751_5、752_1、752_2、752_3、752_4、752_5、753_1、753_2、753_3、753_4、753_5、754_1、754_2、754_3、754_4、754_5、755_1、755_2、755_3、755_4、755_5、756_1、756_2、756_3、756_4、756_5、757_1、757_2、757_3、757_4、757_5、758_1、758_2、758_3、758_4、758_5、759_1、759_2、759_3、759_4、759_5、760_1、760_2、760_3、760_4、760_5、761_1、761_2、761_3、761_4、761_5、762_1、762_2、762_3、762_4、762_5、763_1、763_2、763_3、763_4、763_5、764_1、764_2、764_3、764_4、764_5、765_1、765_2、765_3、765_4、765_5、766_1、766_2、766_3、766_4、766_5、767_1、767_2、767_3、767_4、767_5、768_1、768_2、768_3、768_4、768_5、769_1、769_2、769_3、769_4、769_5、770_1、770_2、770_3、770_4、770_5、771_1、771_2、771_3、771_4、771_5、772_1、772_2、772_3、772_4、772_5、773_1、773_2、773_3、773_4、773_5、774_1、774_2、774_3、774_4、774_5、775_1、775_2、775_3、775_4、775_5、776_1、776_2、776_3、776_4、776_5、777_1、777_2、777_3、777_4、777_5、778_1、778_2、778_3、778_4、778_5、779_1、779_2、779_3、779_4、779_5、780_1、780_2、780_3、780_4、780_5、781_1、782_1、782_2、782_3、782_4、782_5、783_1、783_2、783_3、783_4、783_5、784_1、784_2、784_3、784_4、784_5、785_1、786_1、786_2、786_3、786_4、786_5、787_1、787_2、787_3、787_4、787_5、788_1、788_2、788_3、788_4、788_5、789_1、789_2、789_3、789_4、789_5、790_1、790_2、790_3、790_4、790_5、791_1、791_2、791_3、791_4、791_5、792_1、792_2、792_3、792_4、792_5、793_1、793_2、793_3、793_4、793_5、794_1、794_2、794_3、794_4、794_5、795_1、795_2、795_3、795_4、795_5, 796_1, 796_2, 796_3, 796_4, 796_5, 797_1, 797_2, 797_3, 797_4, 797_5, 798_1, 798_2, 798_3, 798_4, 798_5, 799_1, 799_2, 799_3, 799_4, 799_5, 800_1, 800_2, 800_3, 800_4, 800_5, 801_1, 801_2, 801 _3, 801_4, 801_5, 802_1, 802_2, 802_3, 802_4, 802_5, 803_1, 803_2, 803_3, 803_4, 803_5, 804_1, 804_2, 804_3, 804_4, 804_5, 805_1, 805_2, 805_3, 805_4, 805_5, 806_1, 806_2, 806_3, 806_4, 806_5, 807_1, 8 07_2, 807_3, 807_4, 807_5, 808_1, 808_2, 808_3, 808_4, 808_5, 809_1, 809_2, 809_3, 809_4, 809_5, 810_1, 810_2, 810_3, 810_4, 810_5, 811_1, 811_2, 811_3, 811_4, 811_5, 812_1, 812_2, 812_3, 812_4, 812_5 , 813_1, 813_2, 813_3, 813_4, 813_5, 814_1, 814_2, 814_3, 814_4, 814_5, 815_1, 815_2, 815_3, 815_4, 815_5, 816_1, 816_2, 816_3, 816_4, 816_5, 816_6, 817_1 and 818_1. 86. The oligonucleotide of embodiment 85, wherein the oligonucleotide is selected from compound identification numbers 155_1 or 165_1. 87. The oligonucleotide of embodiment 85, wherein the oligonucleotide is selected from the group consisting of compound numbers 169_52, 169_50 or 169_56. 88. The oligonucleotide of embodiment 85, wherein the oligonucleotide is selected from the group consisting of compound identification numbers 172_1, 272_1, 572_7, 572_6 or 572_5. 89. The oligonucleotide of embodiment 85, wherein the oligonucleotide is selected from compound identification number 175_1. 90. The oligonucleotide of embodiment 85, wherein the oligonucleotide is selected from compound identification number 178_1. 91. The oligonucleotide of embodiment 85, wherein the oligonucleotide is selected from compound identification numbers 573_8, 186_1 or 187_1. 92. The oligonucleotide of embodiment 85, wherein the oligonucleotide is selected from compound identification number 186_1. 93. The oligonucleotide of embodiment 85, wherein the oligonucleotide is selected from the group consisting of compound identification numbers 200_1, 204_1, 206_1, 35_2 or 209_1. 94. The oligonucleotide of embodiment 85, wherein the oligonucleotide is selected from the group consisting of compound identification numbers 585_1, 585_8, 586_9, 586_5, 586_8, 586_4 or 586_6. 95. The oligonucleotide of embodiment 85, wherein the oligonucleotide is selected from compound identification number 233_1. 96. The oligonucleotide of embodiment 85, wherein the oligonucleotide is selected from compound identification numbers 237_8 or 590_13. 97. The oligonucleotide of embodiment 85, wherein the oligonucleotide is selected from compound identification number 220_1. 98. The oligonucleotide of embodiment 85, wherein the oligonucleotide is selected from the group consisting of compound identification numbers 591_1, 592_2, 592_4 or 241_9. 99. The oligonucleotide of embodiment 85, wherein the oligonucleotide is selected from the group consisting of compound identification numbers 597_4, 598_4, 39_1 or 602_1. 100. The oligonucleotide of embodiment 85, wherein the oligonucleotide is selected from compound identification number 39_1. 101. The oligonucleotide of embodiment 85, wherein the oligonucleotide is selected from compound identification number 611_7. 102. The oligonucleotide of embodiment 85, wherein the oligonucleotide is selected from the group consisting of compound identification numbers 271_1 or 278_1. 103. The oligonucleotide of embodiment 85, wherein the oligonucleotide is selected from the group consisting of compound identification numbers 616_4, 621_2, 621_1, 622_3, 622_5, 622_4, 624_3, 624_5, 287_1, 625_6, 626_7, 626_8, 626_9, 48_1, 631_6, 631_1, 303_1, 304_6 or 304_10. 104. The oligonucleotide of embodiment 85, wherein the oligonucleotide is selected from compound identification number 636_8. 105. The oligonucleotide of embodiment 85, wherein the oligonucleotide is selected from the group consisting of compound identification numbers 638_8, 639_5, 331_1 or 640_4. 106. The oligonucleotide of embodiment 85, wherein the oligonucleotide is selected from the group consisting of compound identification numbers 359_1, 361_1, 361_5, 362_1 or 641_5. 107. The oligonucleotide of embodiment 85, wherein the oligonucleotide is selected from the group consisting of compound identification numbers 378_1, 379_1 or 399_1. 108. The oligonucleotide of embodiment 85, wherein said oligonucleotide is selected from the group consisting of compound identification numbers 403_1, 405_1, 642_12, 642_13, 644_3 or 646_16. 109. The oligonucleotide of embodiment 85, wherein the oligonucleotide is selected from compound identification numbers 85_1 or 425_5. 110. The oligonucleotide of embodiment 85, wherein the oligonucleotide is selected from compound identification number 116_1. 111. The oligonucleotide of embodiment 85, wherein the oligonucleotide is selected from compound identification numbers 123_1 or 124_1. 112. The oligonucleotide of embodiment 85, wherein the oligonucleotide is selected from compound identification number 126_2. 113. A conjugate comprising an oligonucleotide according to any one of embodiments 1 to 112 and at least one conjugation moiety covalently attached to said oligonucleotide. 114. The oligonucleotide conjugate of embodiment 113, wherein the conjugate moiety is selected from a carbohydrate, a cell surface receptor ligand, a drug substance, a hormone, a lipophilic substance, a macromolecule, a protein, a peptide, a toxin, a vitamin, a viral protein, or a combination thereof. 115. The oligonucleotide conjugate of embodiment 113 or 114, wherein the conjugated moiety is an antibody or an antibody fragment. 116. The oligonucleotide conjugate of embodiment 115, wherein the antibody or antibody fragment has affinity for the transferrin receptor. 117. The oligonucleotide conjugate of embodiments 113 to 115, comprising a linker located between the oligonucleotide and the conjugated moiety. 118. The oligonucleotide conjugate of embodiment 117, wherein the linker is a physiologically labile linker. 119. The oligonucleotide conjugate of embodiment 118, wherein the physiologically labile linker is a nuclease-sensitive linker. 120. The oligonucleotide conjugate of embodiment 118 or 119, wherein the oligonucleotide has the formula DFG-F' or FG-F'-D', where F, F', and G are as defined in embodiments 73 to 80, and D or D' contains one, two, or three DNA nucleosides having phosphorothioate internucleoside bonds. 121. The oligonucleotide conjugate of embodiments 113 to 120, which exhibits improved brain uptake of the conjugated oligonucleotide compared to non-conjugated oligonucleotides. 122. A pharmaceutical composition comprising an oligonucleotide according to embodiments 1 to 112 or a conjugate according to embodiments 113 to 121, and a pharma- ceutically acceptable diluent, carrier, salt and / or adjuvant. 123. A method for producing an oligonucleotide according to any one of embodiments 1 to 112, comprising reacting nucleotide units to thereby form covalently linked consecutive nucleotide units contained in the oligonucleotide. 124. The method of embodiment 123, further comprising reacting the contiguous nucleotide sequence with a non-nucleotide conjugate moiety. 125. A method for producing the composition of embodiment 122, comprising mixing an oligonucleotide with a pharma- ceutically acceptable diluent, carrier, salt, and / or adjuvant. 126. A method for inducing UBE3A expression in a target cell in which expression of paternal UBE3A is suppressed, in vivo or ex vivo, comprising administering to said cell an effective amount of an oligonucleotide according to any one of embodiments 1 to 112, a conjugate according to any one of embodiments 113 to 121, or a pharmaceutical composition according to embodiment 122. 127. The method of embodiment 126, wherein expression of UBE3A is increased by at least 40% compared to a control. 128. The method of embodiment 126 or 127, wherein the level of the SNHG14 transcript downstream of SNORD109B is reduced by at least 30% compared to a control. 129. The method of embodiments 126 to 128, wherein the target cell is a neuronal cell. 130. The method of embodiments 126 to 129, wherein the expression of SNORD115 is not significantly affected compared to a control. 131. A method for treating or preventing a disease, comprising administering to a subject suffering from or suspected of suffering from the disease a therapeutically or prophylactically effective amount of an oligonucleotide according to embodiments 1 to 112, or a conjugate according to embodiments 113 to 121, or a pharmaceutical composition according to embodiment 122. 132. An oligonucleotide according to embodiments 1 to 112, or a conjugate according to embodiments 113 to 121, or a pharmaceutical composition according to embodiment 122, for use in the treatment or prevention of a disease to be treated. 133. Use of an oligonucleotide according to embodiments 1 to 112 or a conjugate according to embodiments 113 to 121 for the preparation of a medicament for the treatment or prevention of a disease to be treated. 134. The method, oligonucleotide or use of embodiments 131 to 133, wherein the disease is associated with the in vivo activity of UBE3A. 135. The method, oligonucleotide or use according to embodiments 131 to 134, wherein the disease is associated with a decrease in the expression of UBE3A and / or a decrease in the activity of UBE3A in neuronal cells. 136. The method, oligonucleotide or use of embodiment 135, wherein the decreased expression of UBE3A and / or decreased activity of UBE3A is due to a mutation in the maternal allele of the UBE3A gene. 137. The method, oligonucleotide or use of embodiments 134 to 136, wherein the expression of UBE3A is increased by at least 30%, or at least 50%, or at least 70%, or at least 90%, or at least 100%, or at least 150% or at least 200% compared to the expression without the oligonucleotide of embodiments 1 to 112, or the complex of embodiments 113 to 121, or the pharmaceutical composition of embodiment 122. 138. The method, oligonucleotide or use of embodiments 131 to 137, wherein the disease is Angelman syndrome. 139. The method, oligonucleotide or use of embodiments 131 to 138, wherein the subject to be treated is a mammal. 140. The method, oligonucleotide or use of embodiment 139, wherein the subject is a human. 141. The method, oligonucleotide or use of embodiment 139 or 140, wherein the subject to be treated is an infant or a young child. EXAMPLES

[0268] Materials and Methods Table 3: A list of oligonucleotides or contiguous nucleobase sequences having complementarity to SEQ ID NO:1 (motif sequences indicated by SEQ ID NOs), oligonucleotide designs made from these, and specific oligonucleotide compounds (indicated by compound identification numbers) designed based on the motif sequences. [Table 3-1]

Table 3-2

Table 3-3

Table 3-4

Table 3-5

Table 3-6

Table 3-7

Table 3-8

Table 3-9

Table 3-10

Table 3-11

Table 3-12

Table 3-13

Table 3-14

Table 3-15

Table 3-16

Table 3-17

Table 3-18

Table 3-19

Table 3-20

Table 3-21

Table 3-22

Table 3-23

Table 3-24

Table 3-25

Table 3-26

Table 3-27

Table 3-28

Table 3-29

Table 3-30

Table 3-31

Table 3-32

Table 3-33

Table 3-34

Table 3-35

Table 3-36

Table 3-37

Table 3-38

Table 3-39

Table 3-40

Table 3-41

Table 3-42

Table 3-43

Table 3-44

Table 3-45

Table 3-46

Table 3-47

Table 3-48

Table 3-49

Table 3-50

Table 3-51

Table 3-52

[0269] The design refers to a gapmer design, FG-F', where each number represents the number of consecutive modified nucleosides, e.g., the number of 2' modified nucleosides (first number=5' flanking portion), followed by the number of DNA nucleosides (second number=interstitial region), followed by the number of modified nucleosides, e.g., the number of 2' modified nucleosides (third number=3' flanking portion), which may be preceded or followed by additional repeat regions of DNA and LNA (which need not be part of a contiguous sequence that is complementary to the target nucleic acid). In some oligonucleotides in Table 3, the flanking portions are mixed flanking portions, where such flanking portions begin and end with 2' modified nucleosides, in which case the interstitial region is greater than 5 and is not located at the 5' or 3' end of the design.

[0270] In oligonucleotide compounds, capital letters represent β-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA·C's are 5-methylcytosines, 5-methylDNA cytosines are represented by an "e", and all internucleoside linkages are phosphorothioate internucleoside linkages.

[0271] The oligonucleotide with the EX-EX numerical designation as the start of SEQ ID NO:1 is an exon-exon spanning oligonucleotide designed to have complementarity across the exon-exon junction (ENST00000554726) of SNHG14-023. The oligonucleotide originally spans exon 2 and exon 3 (i.e., has complementarity to a region of exon 2 and a region of exon 3).

[0272] Oligonucleotide synthesis Oligonucleotide synthesis is generally known to those skilled in the art. The following is the procedure adopted: The oligonucleotides of the invention were prepared with minor variations in the equipment, carriers and concentrations used.

[0273] Oligonucleotides are synthesized on a uridine universal support using the phosphoramidite method on a MerMade12 or Oligomaker DNA / RNA synthesizer on a 1-4 μmol scale. At the end of the synthesis, the oligonucleotides are cleaved from the solid support with aqueous ammonia at 60 °C for 5-16 h. The oligonucleotides are purified by reversed-phase HPLC (RP-HPLC) or solid-phase extraction, analyzed by UPLC, and the molecular weights are confirmed by ESI-MS.

[0274] Oligonucleotide extension: Coupling of β-cyanoethyl phosphoramidites (DNA-A(Bz), DNA-G(ibu), DNA-C(Bz), DNA-T, LNA-5-methyl-C(Bz), LNA-A(Bz), LNA-G(dmf), LNA-T or amino-C6 linker) is carried out using a 0.1 M solution of 5'-O-DMT protected amidite in acetonitrile and DCI (4,5-dicyanoimidazole) in acetonitrile (0.25 M) as activating agents. In the final cycle, a phosphoramidite with the desired modification is used, e.g., a C6 linker or such a conjugated group is attached. Thiolation for the introduction of phosphorothioate bonds is carried out using xanthan hydride (0.01 M in acetonitrile / pyridine (9:1)). Phosphorodiester bonds can be introduced using iodine in 0.02 M THF / pyridine / water (7:2:1). The remaining reagents are those typically used in oligonucleotide synthesis.

[0275] Purification by RP-HPLC: The crude product is purified by preparative RP-HPLC using a Phenomenex Jupiter C18 10μ, 150×10 mm column with 0.1 M ammonium acetate pH 8 and acetonitrile as buffers at a flow rate of 5 mL / min. The fractions are lyophilized to give the purified compound, typically as a white solid.

[0276] Abbreviation: DCI: 4,5-dicyanoimidazole DCM: dichloromethane DMF: Dimethylformamide DMT: 4,4'-dimethoxytrityl THF: tetrahydrofuran Bz: Benzoyl Ibu: Isobutyryl RP-HPLC: Reversed-phase high-performance liquid chromatography

[0277] T m evaluation Dilute the oligonucleotides and RNA target duplexes to 3 mM in 500 ml of RNase-free water and add 500 ml of 2xT m Mix with buffer (200 mM NaCl, 0.2 mM EDTA, 20 mM sodium phosphate, pH 7.0). Heat the solution to 95° C. for 3 min and then anneal at room temperature for 30 min. The duplex melting temperature (T m ) is measured on a Lambda 40 UV / VIS spectrophotometer equipped with a Peltier temperature programmer PTP6 using PE Templab software (Perkin Elmer). The temperature is increased from 20°C to 95°C and then decreased to 25°C and the absorbance at 260 nm is recorded. The first derivatives and local maxima of both the melting and annealing are plotted as duplex T m Used for evaluation.

[0278] 1. Preparation of Mouse Primary Cortical Neuronal Cultures Primary cortical neuronal cultures were prepared from 15-day-old mouse fetal brains according to standard methods. Briefly, culture plates were coated with poly-L-lysine (50 μg / ml poly-L-lysine, 10 mM sodium tetraborate, pH 8 buffer) for 2 to 3 hours at room temperature. Plates were washed with 1x PBS before use. Harvested mouse fetal brains were dissected with a razor, homogenized, and immersed in 38 ml of dissection medium (HBSS, 0.01 M Hepes, penicillin / streptomycin). Then, 2 ml of trypsin was added, and the cells were incubated at 37°C for 30 minutes and centrifuged. The obtained cells were dissolved in 20 ml of DMEM (+10% FBS) and further homogenized by passing through a syringe. Then, centrifuged at 500 rpm for 15 minutes. The obtained cells were dissolved in DMEM (+10% FBS) and plated in 96-well plates (0.1 × 10 cells in 100 μl). 6 The neuronal cultures were ready for use immediately after seeding.

[0279] Screening of oligonucleotides in mouse primary cortical neuronal cultures The cells were cultured in 96-well plates in growth medium (Gibco Neurobasal medium, B27 supplement, Glutamax, penicillin-streptomycin) and incubated with oligonucleotides at the desired concentrations for 3 days. Total RNA was isolated from cells and knockdown efficiency was measured by qPCR analysis using the Quanta Bioscience qScript™ XLT One-Step RT-qPCR ToughMix®, Low ROX™ Kit (95134-500). A commercially available Taqman test from Thermo Fisher Scientific was used to measure Ube3a_ATS with GAPDH for normalization.

[0280] Generation of human primary neuronal cell cultures All cell lines at all time points described were cultured at 37°C, 5% CO2 and 95% relative humidity.

[0281] Human induced pluripotent stem cell (hiPSC) cultures Human whole blood samples were obtained from patients diagnosed with Angelman syndrome. Subsequent culture of primary peripheral blood mononuclear cells (PMCSs) enriched for erythroblasts. Patient-specific iPSC lines were generated by reprogramming erythroblasts with the CytoTune-iPS Sendai Reprogramming Kit (Thermo Fisher Scientific). Derived iPSC lines were maintained in feeder-free conditions with hESC-normalized Matrigel (Corning) in mTESR1 (STEMCELL Technologies) with daily medium changes. Upon reaching confluence, colonies were dissociated into 50-200 μm sized cell clusters using a gentle cell dissociation reagent (STEMCELL Technologies) and subcultured at a ratio of 1:10 to 1:20 in the presence of 10 μM Y-27632 (Calbiochem).

[0282] Differentiation into neural progenitor cells (NPCs) For induction of neural differentiation, iPSC-derived cells were maintained in basal medium containing equal volumes of DMEM:F12 Glutamax medium and Neurobasal medium (Gibco, Invitrogen) supplemented with 1xB27 (Gibco, Invitrogen), 1xN2 (Gibco, Invitrogen), 0.1 mM β-mercaptoethanol (Gibco, Invitrogen) and the indicated supplements.

[0283] Neural progenitor cells (NPCs) were derived from hiPSCs by dual SMAD inhibition following a published procedure with minor modifications (Chambers et al. 2009 Nat Biotechnol. Vol. 3 pp.275-80, Boissart et al., 2013 Transl Psychiatry. 3:e294). HiPSCs were dissociated into single-cell suspensions with Accutase (Innovative Cell Technologies Inc.) and resuspended in basic medium further supplemented with 10 μM Y-27632 (Calbiochem), 5 ng / ml FGF (Peprotech), 10 μM SB-431542 (Calbiochem) and 100 nM LDN (Calbiochem). The single-cell suspension was transferred to AggreWell800 plates (STEMCELL Technologies) allowing the formation of aggregates consisting of 8000 cells. After 5 days, neural aggregates were transferred to poly-L-ornithine (Sigma) and laminin (Roche) coated plates and allowed to form neural rosettes under continued dual SMAD inhibition (SB-431542 and LDN) in basic medium supplemented with FGF. The neural rosettes were selectively isolated using STEMdiff™ Neural Rosette Selection Reagent (STEMCELL Technologies), replated on poly-L-ornithine and laminin 521 (BioLamina) coated dishes, and expanded in basic medium supplemented with 10 ng / ml FGF (Peprotech), 10 ng / ml EGF (RnD), and 20 ng / ml BDNF (Peprotech). Upon reaching confluence, cells were enzymatically dissociated with 0.05% trypsin / EDTA (Gibco, Invitrogen) and subcultured. Continual subculture in basic medium supplemented with FGF, EGF, and BDNF resulted in stable neural progenitor cell lines (NPC lines) within 10 to 20 passages, as determined by their self-renewal capacity and expression of the developmental stage-specific markers Sox2 and nestin.Upon specific stimulation, NPCs differentiate into neuronal (MAP2+, Tau+, HuC / D+) and astroglial (GFAP+) progeny (Dunkley et al., 2015 Proteomics Clin Appl. Vol. 7-8 pp.684-94).

[0284] The NPC culture conditions were as previously described with some modifications (Boissart et al., 2013 TransNPC culture l Psychiatry. 3:e294). Briefly, cells were maintained on dishes coated with laminin 521 (BioLamina) and cultured in basic medium (containing an equal volume of DMEM:F12 Glutamax medium and Neurobasal medium (Gibco, Invitrogen) supplemented with 1xB27 (Gibco, Invitrogen), 1xN2 (Gibco, Invitrogen), 0.1 mM β-mercaptoethanol (Gibco, Invitrogen)) supplemented with 10 ng / ml FGF (Peprotech), 10 ng / ml EGF (RnD), and 20 ng / ml BDNF (Peprotech).

[0285] Differentiation into neuronal cell cultures To induce neuronal differentiation of NPCs, cells were dissociated into single cell suspension with 0.05% trypsin / EDTA (Gibco, Invitrogen) and plated at a density of 12.000 cells / cm2 on dishes coated with laminin 521 (BioLamina) and maintained in basal medium supplemented with 200ng / ml Shh (Peprotech), 100ng / ml FGF8 (Peprotech), and 100μM ascorbic acid phosphate (Sigma) for 7 days. Cells were subsequently re-plated at a density of 45000 cells / cm2 in basal medium supplemented with 20ng / ml BDNF (Peprotech), 10ng / ml GDNF (Peprotech), 0.5mM cAMP (BIOLOG Life Science), and 100μM ascorbic acid phosphate (Sigma) and allowed to differentiate for 21 days. On day 21 of differentiation, differentiated neuronal cultures were replated in a screening-compatible plate format by dissociating the cultures into a single-cell suspension with Accutase (Innovative Cell Technologies Inc.). Cells were plated at a density of 200.000 cells / cm for the final oligonucleotide screening study. 2 Neuronal cultures were differentiated for an additional 7 days in basal medium supplemented with 20 ng / ml BDNF (Peprotech), 10 ng / ml GDNF (Peprotech), 0.5 mM cAMP (BIOLOG Life Science), and 100 μM ascorbic acid phosphate (Sigma). Differentiation medium was changed twice a week. After a total of 35 days of differentiation, neuronal cultures were ready for oligonucleotide treatment.

[0286] Screening of oligonucleotides in human neuronal cell cultures - 384-well system For screening, oligonucleotide stock solutions were pre-diluted in water to different predefined concentrations in 384-well microtiter plates (compound plates). The plate layout served as a treatment template. Two microliters of oligonucleotide dilutions from each well were transferred from the compound plate to the respective culture plate. All liquid handling was performed in laminar flow under sterile conditions using a semi-automated laboratory robotic system (Beckmancoulter). Neuronal cultures were cultured with oligonucleotides for 5 days without medium exchange. Subsequently, neuronal cultures were lysed and qPCR tests were performed with RealTime ready Cell lysis and RNA Virus Master kits (Roche). Liquid handling was performed using a liquid semi-automated laboratory robotic system (Beckmancoulter). Samples were analyzed with a Lightcycler480 real-time PCR system (Roche).

[0287] The activity of the oligonucleotides was assessed by qPCR monitoring the transcript abundance of UBE3A using the following primers and probe: UBE3a sense strand: forward primer: ATATGTGGAAGCCGGAATCT (SEQ ID NO: 837), Reverse primer: TCCCAGAACTCCCTAATCAGAA (SEQ ID NO: 838), Internal probe labeled with dye FAM: ATGACGGTGGCTATACCAGG (SEQ ID NO: 839)

[0288] RT-qPCR was multiplexed using PPIA (peptidyl prolyl isomerase A) as a housekeeping gene for normalization. PPIA primers and dye VIC-labeled probes were purchased from Thermo Fisher Scientific (assay ID Hs99999904_m1). Each plate contained a non-targeting oligonucleotide (mock) (TTGaataagtggaTGT (SEQ ID NO: 846)) as a negative control and a control oligonucleotide compound number 41_1, which up-regulates UBE3A mRNA expression.

[0289] The selectivity of the oligonucleotides was confirmed by counter-screening against the SNORD115 transcript, located upstream of SNORD109B on chromosome 15. Expression of SNORD115 was monitored by qPCR using the following primers and probe: Forward primer: GGGTCAATGATGAGAACCTTAT (SEQ ID NO: 840), Reverse primer: GGGCCTCAGCGTAATCCTATT (SEQ ID NO: 841), Internal probe labeled with dye FAM: TTCTGAAGAGAGGTGATGACTTAAAA (SEQ ID NO: 842) RT-qPCR was multiplexed using PPIA (Thermo Fisher Scientific) with oligonucleotide processing.

[0290] The reduction of SNHG14 transcripts (also called UBE3A repressor gene) downstream of SNORD109B was measured by RT-qPCR using the following primers and probe: Forward primer: ATCCGAGGCATGAATCTCAC (SEQ ID NO: 843), Reverse primer: CAGGCCAAAACCCTTGATAA (SEQ ID NO: 844), Internal probe labeled with dye FAM: TTGCTGAGCTTTTGCATC (SEQ ID NO: 845) RT-qPCR was multiplexed with PPIA (Thermo Fisher Scientific).

[0291] Data are expressed as the average % expression compared to mock across all plates and normalized to the control oligonucleotide to account for plate-to-plate variability.

[0292] Screening of oligonucleotides in human neuronal cell cultures - 96-well system For screening, oligonucleotide stock solutions were pre-diluted in water to different predefined concentrations in 96-well microtiter plates (compound plates). The plate layout served as a treatment template. Two microliters of oligonucleotide dilutions from each well were transferred from the compound plate to the respective culture plate. All liquid handling was performed in laminar flow under sterile conditions using a semi-automated laboratory robotic system (Beckmancoulter). Neuronal cultures were cultured with oligonucleotides for 5 days without medium exchange. Subsequently, neuronal cultures were lysed and RNA was purified using the RNA purification kit Pure Link Pro96 (12173011A) LifeTechnologies. Liquid handling was performed using a semi-automated laboratory robotic system (Beckmancoulter). qPCR analysis of Ube3a and Ube3a-ATS was performed on a ViiA™ 7 Real-Time PCR System (Thermo Fisher Scientific) using Quanta's qScript™ XLT 1-Step RT-qPCR ToughMix Low ROX (95134-50). The following primers and probes were used: qPCR UBE3a sense strand: Forward primer: ATATGTGGAAGCCGGAATCT (SEQ ID NO: 697), Reverse primer: TCCCAGAACTCCCTAATCAGAA (SEQ ID NO: 698), Internal probe labeled with dye FAM: ATGACGGTGGCTATACCAGG (SEQ ID NO: 699) qPCR of SNHG14 transcript downstream of SNORD109B (also known as UBE3A repressor gene): ThermoFisher commercial primer and probe set: Hs01372957_m1. These primers amplify an 87 bp exon-exon spanning sequence of Genbank transcript AF400500.1. QPCR GAPDH transcript: Commercially available primer and probe set from ThermoFisher: Gene signal: The following test details were used: Reference sequence: NM_002046.3, Probe exon position: 3, Amplicon size: 122 bp. Corresponding TaqMan assay ID: Hs99999905_m1.

[0293] RT-qPCR for both Ube3a and Ube3a-ATS were multiplexed using GAPDH as a housekeeping gene for normalization. Each plate contained a non-targeting oligonucleotide (mock) (TTGaataagtggaTGT (SEQ ID NO: 846)) as a negative control and a control oligonucleotide compound no. 21_1, which increased UBE3A·mRNA expression. In addition, to monitor for test noise and risk of false positive detection, we included an oligo panel that does not target oligo Ub3a or the SNHG14 transcript downstream of SNORD109B (also known as a UBE3A repressor gene). Control oligonucleotide:

number

[0294] Example 1 Oligonucleotide activity in mouse primary neuronal cell cultures Oligonucleotides targeted to a portion of the SNHG14 long non-coding RNA that is antisense to the UBE3A·mRNA precursor (positions 55319 to 141053 of SEQ ID NO:1) were tested for their ability to reduce the SNHG14 long non-coding RNA transcript that inhibits UBE3A expression (also referred to as UBE3A suppressor gene or UBE3A-SUP in the data tables) and to induce UBE3A·mRNA re-expression in mouse primary cortical neuronal cultures obtained as described above in Materials and Methods. The oligonucleotide concentration was 5 microM.

[0295] The oligonucleotides were screened according to the procedure for screening mouse cortical neuronal cultures described in Materials and Methods. The results are shown in Table 4. Table 4: Oligonucleotide activity in primary mouse neuronal cell cultures. [Table 4-1] [Table 4-2]

[0296] Example 2 Oligonucleotide activity in human neuronal cell cultures. Oligonucleotides targeting human SNHG14, a region downstream of SNORD109B corresponding to positions 25278410 to 25419462 on human chromosome 15 (SEQ ID NO:1), were tested in patient-derived human neuronal cell cultures (see procedures in Materials and Methods). The ability of the oligonucleotides to reduce SNHG14 transcripts (also referred to as UBE3A suppressor gene or UBE3A-SUP in the data tables) downstream of SNORD109B without affecting expression of SNORD115 was analyzed. Furthermore, the ability to induce UBE3A·mRNA re-expression was analyzed.

[0297] The oligonucleotides were screened according to the procedure for screening human neuronal cell cultures described above in the Materials and Methods section.

[0298] The results are shown in Table 5. UBE3A·mRNA expression was measured for all compounds, whereas knockdown of UBE3A-repressing genes and maintenance of SNORD1115 levels were not analyzed for all compounds. Table 5: Oligonucleotide activity in patient-derived neuronal cell cultures [Table 5-1] [Table 5-2] [Table 5-3] [Table 5-4] [Table 5-5]

[0299] Approximately 90% of the 187 compounds tested showed re-expression of UBE3A at 5 micromolar concentrations compared to the mimetic oligonucleotides. The number of oligonucleotides capable of inducing UBE3A expression was greater in the region between position 1 and position 55318 of SEQ ID NO:1 (non-overlapping region) than in the region with UBE3A coding region complementarity (overlapping region). Figure 2 shows the distribution of oligonucleotides by position on human chromosome 15 plotted against UBE3A·mRNA expression for mimetic oligonucleotides.

[0300] Of the oligonucleotides tested for SNORD115, there was no clear reduction in expression at 1 and 5 microM compared to mock.

[0301] Example 3 Activity of oligonucleotides targeting the SNHG14 transcript downstream of SNORD109B and upstream of the antisense region against the UBE3A pre-mRNA Oligonucleotides targeting positions 4806 to 54939 of SEQ ID NO:1 were tested in patient-derived human neuronal cell cultures (see Materials and Methods). The ability of the oligonucleotides to decrease the SNHG14 transcript (also referred to as UBE3A suppressor gene or UBE3A-SUP in the data tables) downstream of SNORD109B was analyzed. Furthermore, the ability to induce UBE3A·mRNA re-expression was analyzed.

[0302] The oligonucleotides were screened according to the procedure for screening human neuronal cell cultures described in the section "Materials and Methods" - "Screening Oligonucleotides in Human Neuronal Cell Cultures - 96-Well System". The results are shown in Table 6. Table 6: Oligonucleotide activity in patient-derived neuronal cell cultures [Table 6-1] [Table 6-2] [Table 6-3] [Table 6-4] [Table 6-5] [Table 6-6] [Table 6-7] [Table 6-8] [Table 6-9] [Table 6-10] [Table 6-11] [Table 6-12] [Table 6-13] [Table 6-14] [Table 6-15]

[0303] Example 4 Activity of oligonucleotides targeting the SNHG14 transcript in the antisense region against UBE3A·mRNA Oligonucleotides targeting positions 55337 to 136214 of SEQ ID NO:1 were tested in patient-derived human neuronal cell cultures (see Materials and Methods). The ability of the oligonucleotides to decrease the SNHG14 transcript (also referred to as UBE3A suppressor gene or UBE3A-SUP in the data tables) downstream of SNORD109B was analyzed. Furthermore, the ability to induce UBE3A·mRNA re-expression was analyzed.

[0304] The oligonucleotides were screened according to the procedure for screening human neuronal cell cultures described in "Materials and Methods" - "Screening Oligonucleotides in Human Neuronal Cell Cultures - 96-Well System". The results are shown in Table 7. Table 7: Oligonucleotide activity in patient-derived neuronal cell cultures [Table 7-1] [Table 7-2] [Table 7-3] [Table 7-4] [Table 7-5] [Table 7-6]

[0305] Example 5 Activity of oligonucleotides targeting the SNHG14 transcript downstream of SNORD109B and upstream of the antisense region against the UBE3A pre-mRNA

[0306] Oligonucleotides targeting positions 5224 to 51257 of SEQ ID NO:1 were tested in patient-derived human neuronal cell cultures (see Materials and Methods). The ability of the oligonucleotides to decrease the SNHG14 transcript (also referred to as UBE3A suppressor gene or UBE3A-SUP in the data tables) downstream of SNORD109B was analyzed. Furthermore, the ability to induce UBE3A·mRNA re-expression was analyzed.

[0307] The oligonucleotides were screened according to the procedure for screening human neuronal cell cultures described in Materials and Methods - Screening Oligonucleotides in Human Neuronal Cell Cultures - 96-well System with the following modifications. UBE3a sense strand primer

[0308] Commercially available primers and probes from ThermoFisher were used: Hs00166580_m1, which amplifies a 94 bp sequence at position 838 of the reference sequence number NM_000462.3.

[0309] Each plate contained a PBS reference (substitute for a non-targeting oligonucleotide) and a positive control oligonucleotide, compound no. 271_1, which increased UBE3A mRNA expression. No additional reference oligonucleotide was included.

[0310] Data are presented as the average % expression relative to the PBS reference across all plates and normalized to the positive control oligonucleotide to account for plate-to-plate variability in efficacy levels. Results are shown in Table 8. Table 8: Oligonucleotide activity in patient-derived neuronal cell cultures [Table 8-1] [Table 8-2] [Table 8-3] [Table 8-4] [Table 8-5] [Table 8-6] [Table 8-7] [Table 8-8] [Table 8-9] [Table 8-10] [Table 8-11] [Table 8-12] [Table 8-13] [Table 8-14] [Table 8-15] [Table 8-16] [Table 8-17] [Table 8-18] [Table 8-19]

[0311] Example 6 Activity of exon-exon spanning oligonucleotides Oligonucleotides designed to have complementarity across the exon-exon junction of SNHG14-023 (ENST00000554726) were analyzed for their ability to decrease the SNHG14 transcript (also referred to as UBE3A suppressor gene or UBE3A-SUP in the data table) downstream of SNORD109B and to induce UBE3A·mRNA re-expression. The oligonucleotides originally spanned exon 2 and exon 3 (i.e., they have complementarity to a region of exon 2 and a region of exon 3).

[0312] The oligonucleotides were screened according to the procedure described in Example 5 for screening of oligonucleotides in human neuronal cell cultures. The results are shown in Table 9. Table 9: Oligonucleotide activity in patient-derived neuronal cell cultures [Table 9]

[0313] Example 7 Testing the in vitro efficiency and efficacy of selected oligonucleotides Based on the screening of Examples 2 to 5, over 52 oligonucleotides were selected for efficacy and efficiency testing.

[0314] Oligonucleotides were screened in cells derived from human AS patients as described in Materials and Methods - Screening Oligonucleotides in Human Neuronal Cell Cultures - 96-well System with the following modifications: Commercially available primers and probes from ThermoFisher for UBE3a sense strand primer: Hs00166580_m1 was used, which amplifies a 94 bp sequence at position 838 of reference sequence number NM_000462.3.

[0315] Each plate contained a PBS reference (substitute for a non-target oligonucleotide) and positive control oligonucleotides, Compound Nos. 186_1 and 39_1, identified in the previous screen. Additional reference oligonucleotides, as described in Materials and Methods, were not included. Oligonucleotide test concentrations were 10 / 10. 0.5 A half-log dilution (=3.2-fold) was used to go from 31.6 μM to 1 nM. All oligonucleotides were tested in five independent experiments over five different weeks. During the data QC process, some plates were excluded from the analysis if there were obvious outliers, e.g. no PCR product detected. After this exclusion, there is a minimum of three independent experiments behind the reported values.

[0316] The EC50 (UBE3A·mRNA re-expression) and IC50 (reduction of SNHG14 transcript (also referred to as UBE3A suppressor gene or UBE3A-SUP in the data table) downstream of SNORD109B) were determined after curve fitting using a four-parameter sigmoidal dose-response model. Fitting was performed using the fitting engine available in Biobook software from IDBS (XLfit). From the curve fitting, the maximal obtainable increase in expression of UBE3A (UBE3A Max Up) and the maximal obtainable knockdown of UBE3A-SUP (UBE3A-SUP max Kd) were determined. Both are presented as % of the reference (PBS-treated cells). The results are shown in Table 10. Values ​​are reported as the geometric mean of each biological replicate. Table 10: Oligonucleotide EC50 and IC50 values, and maximum UBE3A expression increase and UBE3A suppressor gene knockdown. [Table 10-1] [Table 10-2] [Table 10-3]

Claims

1. 1. An antisense oligonucleotide comprising a contiguous nucleotide sequence of 10 to 30 nucleotides in length having at least 98% complementarity to positions 25278410 to 25419462 on human chromosome 15, wherein the antisense oligonucleotide is capable of inducing expression of human paternal UBE3A.

2. The oligonucleotide of claim 1 , wherein the contiguous nucleotide sequence is complementary to a region of a target nucleic acid of SEQ ID NO: 1 and / or SEQ ID NO:

2.

3. 3. The oligonucleotide of claim 1 or claim 2, wherein the contiguous nucleotide sequence is 100% complementary to the region of the target nucleic acid from position 1 to position 55318 of SEQ ID NO:

1.

4. The oligonucleotide of any one of claims 1 to 3, wherein the contiguous nucleotide sequence is complementary to a subsequence of a target nucleic acid, the subsequence being selected from the group consisting of the regions shown in Tables 1 or 2.

5. The oligonucleotide according to any one of claims 1 to 4, wherein the oligonucleotide comprises or consists of either 17 to 22 nucleotides or 15 to 20 nucleotides in length.

6. The oligonucleotide according to any one of claims 1 to 5, wherein the oligonucleotide is 20 nucleotides in length.

7. The oligonucleotide of any one of claims 1 to 6, comprising one or more modified nucleosides.

8. The oligonucleotide according to any one of claims 1 to 7, wherein 5-methylcytosine is used in place of cytosine in the oligonucleotide.

9. 9. The oligonucleotide of claim 7 or 8, wherein the one or more modified nucleosides are 2' sugar modified nucleosides.

10. 10. The oligonucleotide of claim 9, wherein the one or more 2' sugar modified nucleosides are independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabinonucleic acid (ANA), 2'-fluoro-ANA and LNA nucleosides.

11. The oligonucleotide of any one of claims 7 to 10, wherein the one or more modified nucleosides are 2'-O-methoxyethyl-RNA nucleosides.

12. The oligonucleotide of any one of claims 1 to 11, wherein the oligonucleotide comprises at least one modified internucleoside linkage.

13. 13. The oligonucleotide of claim 12, wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage.

14. 14. The oligonucleotide of claim 13, wherein at least 60% of the internucleoside linkages in the oligonucleotide are phosphorothioate internucleoside linkages.

15. The oligonucleotide of any one of claims 1 to 14, wherein the oligonucleotide is capable of recruiting RNase H.

16. The oligonucleotide of claim 15, wherein the oligonucleotide is a gapmer.

17. 17. The oligonucleotide of claim 15 or 16, wherein the oligonucleotide is a gapmer of the formula 5'-F-G-F'-3', where regions F and F' independently comprise 1 to 7 modified nucleosides and G is a region of 6 to 16 nucleosides capable of recruiting RNase H.

18. 18. The oligonucleoside of claim 17, wherein the modified nucleoside is a 2' sugar modified nucleoside independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabinonucleic acid (ANA), 2'-fluoro-ANA and LNA nucleosides.

19. 19. The oligonucleotide of any one of claims 1 to 18, wherein the oligonucleotide is a gapmer of the formula F-G-F', wherein each of the regions F and F' independently consists of 2, 3, 4 or 5 modified nucleoside units, and region G consists of 9, 10, 11, 12, 13, 14 or 15 nucleoside units.

20. 20. The oligonucleotide of any one of claims 1 to 19, wherein the oligonucleotide is a gapmer of formula F-G-F', where each of the F and F' regions independently consists of 2, 3, 4 or 5 2'-O-methoxyethyl-ribose sugar (2'-MOE) units, and the region G consists of 9, 10, 11, 12, 13, 14 or 15 DNA units.

21. 21. The oligonucleotide of any one of claims 17 to 20, wherein each of regions F and F' independently consists of five 2'-O-methoxyethyl-ribose sugar (2'-MOE) nucleoside units, and region G consists of 10 DNA nucleoside units.

22. An antisense oligonucleotide capable of inducing human paternal UBE3A expression, said antisense oligonucleotide comprising a contiguous nucleotide sequence that is 100% complementary to a region of a target nucleic acid from position 1 to position 55318 of SEQ ID NO:1, wherein said oligonucleotide is either 15-20 nucleotides in length or 17-22 nucleotides in length and comprises one or more modified nucleosides, wherein said one or more modified nucleotides are 2'-sugar modified nucleosides, wherein said one or more are independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabinonucleic acid (ANA), 2'-fluoro-ANA and LNA nucleosides, wherein said oligonucleotide comprises at least one modified internucleoside linkage, wherein said modified internucleoside linkage is a phosphorothioate linkage, and said oligonucleotide comprises The antisense oligonucleotide is a gapmer of the formula FGF', where each of the regions F and F' independently consists of 2, 3, 4 or 5 modified nucleoside units, and the G region consists of 9, 10, 11, 12, 13, 14 or 15 nucleoside units.

23. The oligonucleotide of any one of claims 1 to 22, wherein the oligonucleotide is in the form of a pharma- ceutically acceptable salt.

24. 24. The oligonucleotide of claim 23, wherein the oligonucleotide is in the form of a pharma- ceutically acceptable sodium salt.

25. 24. The oligonucleotide of claim 23, wherein the oligonucleotide is in the form of a pharma- ceutically acceptable potassium salt.

26. A conjugate comprising an oligonucleotide according to any one of claims 1 to 25 and at least one conjugate moiety covalently attached to said oligonucleotide.

27. A pharmaceutical composition comprising an oligonucleotide according to any one of claims 1 to 25, or a complex according to claim 26, and a pharma- ceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

28. An in vitro method for inducing UBE3A expression in a target cell in which expression of paternal UBE3A is suppressed, comprising administering to said cell an effective amount of an oligonucleotide according to any one of claims 1 to 25, or a complex according to claim 26, or a pharmaceutical composition according to claim 27.

29. 29. The method of claim 28, wherein expression of UBE3A is increased by at least 40% compared to a control.

30. 30. The method of claim 28 or claim 29, wherein the level of the SNHG14 transcript downstream of SNORD109B is reduced by at least 30% compared to a control.

31. The method according to any one of claims 28 to 30, wherein the target cell is a neuronal cell.

32. The method of any one of claims 28 to 31, wherein expression of SNORD115 is not significantly affected compared to a control.

33. An oligonucleotide according to any one of claims 1 to 25, or a conjugate according to claim 26, or a pharmaceutical composition according to claim 27, for use as a medicament for the treatment or prevention of a disease in a subject.

34. Use of an oligonucleotide according to any one of claims 1 to 25, or a conjugate according to claim 26, or a pharmaceutical composition according to claim 27, for the manufacture of a medicament for the treatment or prevention of a disease in a subject.

35. 35. The oligonucleotide, conjugate or pharmaceutical composition of claim 33 or the use of claim 34, wherein the disease is Angelman syndrome.