Cancer-targeted, virus-encoded, regulatable t (catvert) or nk cell (catvern) linkers

Abstract

To provide recombinant polynucleotides and vectors containing an engineered (artificial) exon-intron-exon gene structure in a transgene, which undergoes splicing when expressed in a target cell.SOLUTION: This disclosure provides a method or a vector to express a therapeutic gene for a disease or condition, optionally under an external control. In some instances, the disease or condition is a cancer. In some cases, the vector expresses a polypeptide (referred to herein as "Dimert") which serves to join together an immune executioner cell with a cancer cell to trigger killing of the cancer cell.SELECTED DRAWING: None

Description

[Technical field]

[0001] Government support statement This invention was made with Government support under Grant No. W81XWH-19-1-0371 awarded by the Department of Defense. The Government has certain rights in this invention.

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority under 35 U.S.C. §119(e) to U.S. Provisional Application No. 62 / 808,264, filed February 20, 2019, the entire contents of which are incorporated herein by reference. [Background technology]

[0003] Gene transfer (i.e., gene therapy) as a treatment for disease is now a reality. In 2017, the FDA approved Luxturna, an adeno-associated virus (AAV) designed to stably express a normal copy of the RPE65 gene in retinal cells, for the treatment of congenital retinal dystrophies. In 2019, the FDA approved Zolgensma, an AAV designed to express SMN1 in motor neurons to treat spinal muscular atrophy. Ongoing clinical trials on the use of AAV vectors to replace gene functions for other diseases, such as a mini-version of the dystrophin gene for Duchenne muscular dystrophy and the factor VIII and factor IX genes for hemophilia A and B, respectively, are also showing very promising results.

[0004] In all the above examples, the goal is long-term gene expression to replace missing or defective genes. However, there may be gene therapy applications for only short-term expression of transgenes (genes expressed as therapeutic agents in gene therapy), for example in the treatment of time-limited diseases such as infectious diseases or cancer. Another illustrative example is the expression of bacterial protein Cas9 to induce CRISPR / Cas9 gene editing, where only transient expression of Cas9 is ideal to minimize potential immune responses to Cas9 and to minimize off-target gene mutations. Another application would be situations where gene therapy may cause undesirable side effects and it is desired to inactivate the gene. In these cases, methods are needed to activate and / or suppress transgene expression.

[0005] Thus, there is a need for novel methods that can activate transgene expression to utilize gene therapy platforms for short-term gene expression (weeks to months). An ideal system would place transgene expression under drug control, such that administration of the drug activates gene expression and cessation of the drug reverts to inactive gene expression. In such a scenario, drug administration is no longer required if side effects exist or transgene expression is no longer required. The present disclosure meets this need and also provides related advantages. Summary of the Invention [Problem to be solved by the invention]

[0006] The present disclosure provides a method or vector for expressing a gene for treating a disease or condition, optionally under external control.In some cases, the disease or condition is cancer.In some cases, the vector expresses a polypeptide (referred to herein as "dimer") that functions to bind immune effector cells together with cancer cells and cause the killing of cancer cells.

[0007] Provided herein is a recombinant polynucleotide or vector comprising, or alternatively consisting essentially of, or consisting of (a)-(d): (a) a first polynucleotide sequence comprising a first portion of an open reading frame encoding a first antibody or antigen-binding fragment thereof; (b) a second polynucleotide sequence comprising a second portion of an open reading frame encoding the first antibody or antigen-binding fragment thereof; (c) a third polynucleotide sequence encoding a second antibody or antigen-binding fragment thereof; and (d) a gene regulatory polynucleotide sequence located between the first and second polynucleotides. In further embodiments, the gene regulatory polynucleotide sequence comprises, consists essentially of, or consists of a splice donor site, an upstream intron, an exon containing more than one stop codon sequence in their respective reading frames, a downstream intron, and a splice acceptor site. In further embodiments, the gene regulatory polynucleotide sequence comprises one or more of binding sequences for an antisense oligonucleotide. In further embodiments, the antisense oligonucleotide is a morpholino oligonucleotide. In a further embodiment, the binding sequence for the morpholino oligonucleotide comprises a polynucleotide sequence at least 95% identical to SEQ ID NO: 24 (AATATGATCCAACAATAGAGGTAAATCTTG) or SEQ ID NO: 25 (GATCCAACAATAGAGGTAAATCTTGTTTTA). In another embodiment, the stop codon comprises an oligonucleotide of the group TAA, TAG, or TGA. In a further embodiment, the stop codon sequence comprises a polynucleotide sequence of TAAxTAGxTGAxTAGxTAAxTGAx (SEQ ID NO: 1), where x is any nucleotide, or alternatively, the stop codon sequence comprises a polynucleotide sequence of TAATTAGTTGATTAGTTAATTGAT (SEQ ID NO: 2), or an equivalent thereof. In another embodiment, the recombinant polynucleotide or vector encodes a bispecific or trispecific engager. In another embodiment, the bispecific cell engager is a bispecific engager.In another embodiment, the bispecific cell engager is a trispecific engager.

[0008] In a further embodiment, the first antibody or antigen-binding fragment thereof specifically binds to an activation antigen on an immune effector cell, and the second antibody or antigen-binding fragment thereof binds to a tumor antigen. In another embodiment, the first antibody or antigen-binding fragment thereof specifically binds to a tumor antigen, and the second antibody or antigen-binding fragment thereof binds to an activation antigen on an immune effector cell. In a further embodiment, the recombinant polynucleotide or vector also comprises a fourth polynucleotide sequence encoding a third antibody or antigen-binding fragment thereof, the third antibody or antigen-binding fragment thereof binds to an activation antigen or a tumor antigen on an immune effector cell. In one embodiment, the immune effector cell comprises a dendritic cell, a natural killer ("NK") cell, a macrophage, a T cell, a B cell, a neutrophil, an eosinophil, a basophil, a mast cell, or a combination thereof. In one embodiment, the immune effector cell is a T cell. In another embodiment, the immune effector cell is a NK cell. In another embodiment, the third antibody or antigen-binding fragment thereof binds to an activation antigen on an NK cell and induces an immune response mediated by NK cells.

[0009] In one embodiment, the activation antigen is a T cell surface molecule. In another embodiment, the activation antigen is a NK cell surface molecule. Non-limiting examples of activation antigens on immune effector cells include CD3, CD2, CD4, CD8, LFA1, CD45, NKG2D, NKp44, NKp46, NKp30, EphA2, DNAM, BT-H3, CD20, CD22, or combinations thereof.

[0010] In one aspect, the dimer (e.g., bispecific or trispecific cell engager) comprises a polypeptide sequence at least 95% identical to any one of SEQ ID NOs: 7-10. In another embodiment, the polypeptide sequence encodes an antigen-binding fragment for CD3, CD2, CD4, CD8, LFA1, CD45, IL21R, NKG2D, NKp44, NKp46, NKp30, or DNAM. In another embodiment, the polypeptide sequence encodes an antigen-binding fragment for CD3, CD19, GD2, or NKG2D. In another embodiment, the polypeptide encodes a first antigen-binding fragment and a second antigen-binding fragment. In another embodiment, the first antigen-binding fragment binds CD3 and the second antigen-binding fragment binds CD19. In another embodiment, the first antigen-binding fragment binds CD3 and the second antigen-binding fragment binds GD2. In another embodiment, the first antigen-binding fragment binds NKG2D and the second antigen-binding fragment binds GD2.

[0011] In one embodiment, the dimer (e.g., trispecific engager or antibody) comprises a first antigen-binding fragment, a second antigen-binding fragment and a third antigen-binding fragment. In another embodiment, the trispecific engager or antibody comprises three antigen-binding fragments that individually bind to NKG2D, IL21R and GD2. In a further aspect, the trispecific engager or antibody comprises a polypeptide sequence at least at least 95% identical to SEQ ID NO:11.

[0012] In one embodiment, the antigen-binding fragment that binds to IL-21R is IL-21. The amino acid and cDNA sequences of IL-12 are shown in SEQ ID NO:3 and SEQ ID NO:4, respectively. [ka]

[0013] In one embodiment, the antigen-binding fragment that binds to NKG2D comprises MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, ULBP6, Rae-1α, Rae-1β, Rae-1γ, Rae-1δ, Rae-1ε, H60a, H60b, H60c, MULT1, or fragments thereof. In one embodiment, the antigen-binding fragment that binds to NKG2D is MICA or a fragment thereof. The amino acid and cDNA sequences of MICA are shown in SEQ ID NO:5 and SEQ ID NO:6, respectively. [ka]

[0014] The MICA sequence, in one embodiment, comprises a wide-type variant. In one embodiment, the MICA variant is a sequence variant of MUC-30 that comprises a methionine instead of alanine mutation at position 129 of the wide-type MICA sequence. The amino acid and cDNA sequences of the MUC-30 variant are shown in SEQ ID NO:7 and SEQ ID NO:8, respectively. [ka] [ka]

[0015] In a further embodiment, the pre-mRNA encoding the trispecific antibody is expressed when said pre-mRNA is contacted with a morpholino oligonucleotide.

[0016] In one embodiment, the antigen binding domain is a single chain variable fragment or an antibody.

[0017] In a further embodiment, the recombinant polynucleotide or vector comprises a polynucleotide sequence encoding a secretory peptide. In another embodiment, the recombinant polynucleotide or vector further comprises a polynucleotide sequence encoding a dimerization domain. In another embodiment, the recombinant polynucleotide or vector comprises a 5' inverted repeat repeat (ITR) and a 3' ITR. In another embodiment, the vector comprises a sequence of SEQ ID NO: 4, 6, 8, 12, 14, 16-23, 30-33, or 40-46. Non-limiting examples of such vectors include recombinant viral vectors comprising a backbone vector selected from the group of retroviral vectors, lentiviral vectors, murine leukemia virus ("MLV") vectors, Epstein-Barr virus ("EBV") vectors, adenoviral vectors, herpes virus ("HSV") vectors, adeno-associated virus ("AAV") vectors, AAV vectors, or optionally self-complementary AAV vectors.

[0018] The recombinant polynucleotide or vector can be contained within a host cell, such as a prokaryotic or eukaryotic cell.

[0019] Recombinant polynucleotides, vectors and cells can be contained in compositions that contain vectors and / or host cells and carriers, such as pharmaceutically acceptable carriers.Recombinant polynucleotides, vectors and cells can be formulated for various modes of administration and can contain an effective amount of polynucleotides, vectors and / or host cells that are effective for the patient, disorder or disease, vector and mode of administration.In one embodiment, the mode of administration is systemic or intravenous.In another embodiment, administration is local administration by direct injection.In one embodiment, morpholino oligonucleotides are contacted with polynucleotides or vectors simultaneously or subsequently, for example as systemic or local injection.Alternatively, contact is before polynucleotides or vectors.

[0020] The recombinant polynucleotide or vector is useful for treating various diseases or disorders. In one embodiment, a method for delivering a transgene is provided. The method includes administering an effective amount of a recombinant polynucleotide or vector containing a transgene to a cell, tissue, or patient to be treated. In one embodiment, an effective amount of a morpholino oligonucleotide is administered to a cell, tissue, or patient to be treated. Non-limiting examples of transgenes are provided and are selected based on the purpose of the method. The cell or tissue can be mammalian, such as human. In one embodiment, the morpholino oligonucleotide is contacted with the vector simultaneously or subsequently. Alternatively, the morpholino oligonucleotide is contacted before the vector. In another embodiment, the vector is introduced into the cell by transfection, infection, transformation, electroporation, injection, microinjection, or a combination thereof.

[0021] A method of treating cancer in a subject in need of such treatment is provided. The method comprises, or alternatively consists essentially of, or consists of administering to the subject an effective amount of a recombinant polynucleotide or vector or cell described herein. In a further method, the method further comprises administering to the subject an effective amount of a morpholino oligonucleotide. In one embodiment, an effective amount of an anti-cancer agent is administered to the subject. Non-limiting examples of anti-cancer agents include anti-cancer peptides, polypeptides, nucleic acid molecules, small molecules, viral particles, or combinations thereof. In another embodiment, the vector is introduced into the cell by transfection, infection, transformation, electroporation, injection, microinjection, or combinations thereof.

[0022] In one embodiment of the disclosed method, the viral particle is an oncolytic HSV particle.

[0023] A further method provided by the present disclosure is a method of producing a bispecific or trispecific antibody in a cell comprising, or consisting essentially of, or consisting of contacting a cell comprising a polynucleotide or vector described herein with an effective amount of a morpholino oligonucleotide. In one embodiment, the morpholino oligonucleotide is contacted simultaneously with or subsequent to the vector. Alternatively, the morpholino oligonucleotide is contacted prior to the polynucleotide or vector. In one embodiment, the morpholino oligonucleotide comprises a sequence at least 95% identical to SEQ ID NO: 27 or 28. Non-limiting examples of bispecific antibodies comprise a polypeptide sequence at least 95% identical to SEQ ID NO: 13 or 15. In one embodiment, the bispecific antibody is encoded by a polynucleotide sequence at least 95% identical to SEQ ID NO: 14, 16, 22, 23, 30-33, or 40-46. In another embodiment, the trispecific antibody comprises a polypeptide sequence at least 95% identical to SEQ ID NO: 11. In one embodiment, the trispecific antibody is encoded by a polynucleotide sequence at least 95% identical to SEQ ID NO: 12.

[0024] In another embodiment, the polynucleotide or vector is introduced into a cell by transfection, infection, transformation, electroporation, injection, microinjection, or a combination thereof. Non-limiting examples of cells include fibroblasts, skeletal cells, epithelial cells, muscle cells, neuronal cells, endocrine cells, melanocytes, blood cells, or a combination thereof.

[0025] Further provided are kits comprising one or more of the polynucleotides, vectors, cells or compositions described herein, optionally together with instructional materials. [Brief description of the drawings]

[0026] [Figure 1]Figure 1 shows a strategy overview of the general concept of splicing using a 3-exon gene structure. Exons are designated 1, 2 or 3 and introns are represented by straight lines. Different splicing patterns are indicated with lowercase letters (a, b, c) and the resulting RNA structures are shown based on which of them is used. Oligos that can interfere with the splice donor (1D, 2D) or acceptor (2A, 3A) sites are shown as short blue lines and the expected expression of the different possible RNA isoforms is shown as "+" depending on which site is blocked by the oligo.

[0027] [Diagram 2] Figure 2 shows an overview of the strategy from Figure 1, using splice type 1, where exon 2 is normally included in the gene transcript. Transcripts containing all three exons spliced ​​together are expected to predominate, but in the presence of oligos blocking the exon 2 splice acceptor or donor site, transcripts with exon 1 fused to exon 3 will predominate.

[0028] [Diagram 3] Figure 3 outlines Strategy #1 for creating an engineered intron-exon STOP-intron in a transgene. Transcripts that retain these introns are non-functional because the introns have a premature stop codon and / or are out of frame. The "a+b" transcript is non-functional due to the stop codon in exon 2. Only transcripts in which exon 2 is skipped (utilizing splice c) are functional, which is low at baseline and activated by an oligo that blocks the splice site on exon 2.

[0029] [Figure 4] FIG. 4 shows a transgene regulatory map of the strategy shown in FIG.

[0030] [Diagram 5]Figure 5 shows a second strategy to create an engineered intron-exon STOP-intron in a transgene, taking advantage of "type 2 splice" where exon 2 is normally excluded in cancer cells but included in normal cells. In this scenario, the exon skipping oligo activates transgene expression (exons 1+3) in normal cells, and leaves transgene expression unchanged (or perhaps higher) in certain off-target skipping of the cellular gene, potentially as a "bonus" therapeutic effect.

[0031] [Figure 6] Figure 6 shows a third strategy to create an engineered intron-exon STOP-intron in a transgene, taking advantage of "type 3 splice" where exon 2 is normally included in certain cancer cells but excluded in normal cells. In this scenario, there is a baseline high level of active transgene (exons 1+3) in normal cells, and exon skipping oligos activate expression in tumor cells.

[0032] [Figure 7] FIG. 7 shows an exemplary CD3xGD2-HDD AAV construct.

[0033] [Figure 8] FIG. 8 shows a schematic representation of an assay for determining the structure and function of dimers disclosed herein.

[0034] [Figure 9] Figure 9 shows SDS-PAGE of whole cell lysates from transfected 293T cells. The three constructs in Figure 7, #1101, #1040 and #1124, which contain secreted peptides, retained less CD3xGD2-HDD dimate in transfected 293T cells compared to construct #1104 and the control pcDNA3-GFP construct.

[0035] [Figure 10]FIG. 10 shows that AAV vectors secreted CD3xGD2-HDD dimers that bound and activated human T cells.

[0036] [Figure 11] FIG. 11 shows secreted CD3xGD2-HDD dimers activate human T cells.

[0037] [Figure 12A] FIG. 12A shows that binding of CD3xGD2-HDD to T cells is dose-dependent.

[0038] [Figure 12B] FIG. 12B shows a bar graph of median staining levels normalized to unstained controls.

[0039] [Figure 13] Figure 13 shows a schematic representation of the binding assay for the anti-GD2 arm of the CD3xGD2-HDD dimer, which confirmed that both GD2 and CD3 binding are present on a single molecule.

[0040] [Figure 14] FIG. 14 shows an exemplary CD3xGD2-HDD dimer that binds to both CD3 and GD2.

[0041] [Figure 15] FIG. 15 shows a flow chart of an assay to determine whether CD3xGD2-HDD induces GD2+ target cell killing by T cells.

[0042] [Figure 16] FIG. 16 shows that secreted CD3xGD2-HDD induces T cell killing of neuroblastoma cells.

[0043] [Figure 17]FIG. 17 shows T cell-mediated cytotoxicity by CD3xGD2-HDD dimers in association with GD2 expression.

[0044] [Figure 18A] FIG. 18A shows a map of an exemplary AAV construct for testing CD19xCD3 dimer expression.

[0045] [Figure 18B] Figure 18B shows an exemplary CD19TransJoin genomic structure. Elements of the AAV-encoded transgene are indicated.

[0046] [Figure 18C] Figure 18C shows a pictorial representation of CD19 dimers interacting with cancer cells and T cells. CD19 dimers are produced by cells containing CD19TransJoin. As shown in this figure, "Ca" represents cancer cells and "T" represents T cells.

[0047] [Figure 19] FIG. 19 shows that supernatants from cells transfected with AAV CD19xCD3 constructs containing secretory sequences bind and activate T cells.

[0048] [Figure 20] FIG. 20 shows that supernatants from cells transfected with AAV vectors containing secreted peptides activate human T cells.

[0049] [Figure 21] FIG. 21 shows that AAV-secreted CD19xCD3 specifically binds CD19, but not CD45.

[0050] [Figure 22A] FIG. 22A shows that binding of CD19xCD3 to T cells is dose-dependent.

[0051] [Figure 22B]FIG. 22B shows a bar graph of median staining levels normalized to unstained controls.

[0052] [Figure 23A] FIG. 23A shows that binding of CD19xCD3 to B cells is dose-dependent.

[0053] [Figure 23B] FIG. 23B shows a bar graph of median staining levels normalized to unstained controls.

[0054] [Figure 24] FIG. 24 shows that CD3 dimers activate T cells with anti-CD28 costimulation better than anti-CD3 antibodies.

[0055] [Diagram 25] FIG. 25 shows that 293T cells provide the highest transduction efficiency for AAV8 vectors.

[0056] [Figure 26] FIG. 26 shows that dimer concentrations in the supernatants of AAV8-infected cells are dependent on AAV dose and transduction efficiency.

[0057] [Figure 27] FIG. 27 shows a single intravenous injection of CD19xCD3 TransJoin selectively depletes B cells in humanized mice.

[0058] [Figure 28] FIG. 28 shows a single intravenous injection of CD19xCD3 TransJoin resulting in long-term B cell depletion in humanized mice.

[0059] [Figure 29] FIG. 29 shows that a single intravenous injection of CD19xCD3 TransJoin eliminates CD19+ lymphomas in humanized mice.

[0060] [Diagram 30] FIG. 30 shows an overview of OncoSkip and TransSkip as described herein.

[0061] [Diagram 31] FIG. 31 shows that KRAS OncoSkip antisense morpholino induces exon skipping of endogenous KRAS in lung cancer cells.

[0062] [Diagram 32] FIG. 32 shows an exemplary AAV vector map of CD3xGD2-HDD TransSkip, showing the reverse engineered introns flanking the exons inserted into the CD3xGD2-HDD dimer coding sequence.

[0063] [Diagram 33] FIG. 33 shows an exemplary strategy for testing the activity of OncoSkip and TransSkip as described herein.

[0064] [Diagram 34] FIG. 34 shows an antisense morpholino inducing exon skipping of the CD3xGD2-HDD TransSkip transgene.

[0065] [Diagram 35] FIG. 35 shows KRAS OncoSkip induces secreted expression of CD3xGD2-HDD dimer in cells transfected with CD3xGD2-HDD TransSkip AAV vector.

[0066] [Diagram 36] FIG. 36 shows that exon skipping of CD3xGD2-HDD TransSkip by KRAS OncoSkip is an on-target effect.

[0067] [Figure 37]FIG. 37 shows that induction of CD3xGD2-HDD dimer expression as determined by T cell binding is an on-target effect.

[0068] [Figure 38] FIG. 38 shows an AAV genomic map of exemplary TransSkip splice variants to reduce baseline TransSkip "leakiness" but maintain inducible exon skipping.

[0069] [Figure 39] FIG. 39 shows CD3xGD2-HDD TransSkip splice variant K3 eliminates baseline but maintains inducible exon skipping.

[0070] [Diagram 40] FIG. 40 shows that the CD3xGD2-HDD TransSkip variant K3 does not show baseline dimate production but is more indicible by KRAS OncoSkip compared to other TransSkip variants tested.

[0071] [Diagram 41] FIG. 41 shows that OncoSkip-mediated induction of dimer expression from CD3xGD2-HDD TransSkip variants K3 and K5 is an on-target effect.

[0072] [Diagram 42] FIG. 42 shows that the secreted dimer derived by OncSkip from the AAV CD3xGD2-HDD TransSkip vector is functional in mediating T cell killing of neuroblastoma cells.

[0073] [Diagram 43]FIG. 43 shows that transgene exon skipping in cells infected with AV CD3xGD2-HDD TransSkip variant K3 is inducible and on-target by KRAS OncoSkip.

[0074] [Figure 44A] FIG. 44A shows an AAV genomic map of an exemplary CD19xCD3 TransSkip splice variant.

[0075] [Figure 44B] Figure 44B shows an exemplary CD19 TransSkip genomic structure. Elements of the AAV-encoded transgene are shown in the diagram.

[0076] [Figure 44C] Figure 44C shows a pictorial representation of CD19 dimers interacting with cancer cells and T cells. CD19 dimers are produced by cells containing CD19 TransSkip. As shown in this figure, "Ca" represents cancer cells and "T" represents T cells.

[0077] [Diagram 45] FIG. 45 shows that OncoSkip morpholinos KTS1 and KTS2 induce on-target exon skipping of CD19xCD3 TransSkip K1.

[0078] [Figure 46] FIG. 46 shows that KRAS OncoSkip induces secreted expression of CD19xCD3 dimer in cells transfected with the CD19xCD3 TransSkip K1 AAV vector.

[0079] [Figure 47] FIG. 47 shows CD19xCD3 TransSkip splice variant K3 eliminates baseline but maintains inducible exon skipping.

[0080] [Figure 48] FIG. 48 shows that induction of CD19×CD3 dimate expression from CD19×CD3 TransSkip K3 as determined by T cell binding is an on-target effect.

[0081] [Figure 49] FIG. 49 shows that induction of CD19xCD3 dimer expression from CD19xCD3 TransSkip K3 is repeatable. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0082] Detailed Description The embodiments according to the present disclosure will be described more completely below. However, aspects of the present disclosure can be embodied in different forms and should not be construed as being limited to the embodiments described herein. Rather, these embodiments are provided so that the present disclosure will be thorough and complete, and will fully convey the scope of the present invention to those skilled in the art. The terms used in the description herein are merely intended to describe specific embodiments, and are not intended to be limiting.

[0083] Unless otherwise defined, all terms (including technical and scientific terms) used herein have the same meaning as commonly understood by those skilled in the art. Terms as defined in commonly used dictionaries should be interpreted to have a meaning consistent with their meaning in the context of this application and related art, and it is further understood that they should not be interpreted in an idealized or overly formal sense unless expressly defined as such herein. Although not expressly defined below, such terms should be interpreted according to their general meaning.

[0084] The terms used in the description herein are for the purpose of describing particular embodiments only and are not intended to limit the invention. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety.

[0085] Unless otherwise indicated, the practice of the present technique employs conventional techniques of tissue culture, immunology, molecular biology, microbiology, cell biology, and recombinant DNA, which are within the skill of the art.

[0086] Unless the context dictates otherwise, it is specifically intended that the various features of the invention described herein can be used in any combination.Furthermore, the present disclosure also contemplates that in some embodiments, any feature or combination of features described herein can be excluded or omitted.To illustrate, if the specification states that a complex comprises components A, B, and C, it is specifically intended that any or any combination of A, B, or C can be omitted and can be excluded from the scope, either alone or in any combination.

[0087] Unless otherwise stated, all specified embodiments, features and terms are intended to include both the recited embodiment, feature or term and their biological equivalents.

[0088] All numerical designations, including ranges, such as pH, temperature, time, concentration and molecular weight, are approximate values ​​that are varied (+) or (-) by increments of 1.0 or 0.1, or by variations of + / -15%, or + / -10%, or + / -5%, or + / -2%, as appropriate. It should be understood, although not always explicitly stated, that all numerical designations are preceded by the term "about". It should also be understood, although not always explicitly stated, that the reagents described herein are merely exemplary, and that equivalent reagents to such are known in the art.

[0089] Throughout this disclosure, various publications, patents and published patent specifications are referenced by an identifying citation or by Arabic numerals. Full citations for publications identified by Arabic numerals are set forth immediately before the claims. The disclosures of these publications, patents and published patent specifications are incorporated by reference in their entireties into this disclosure in order to more fully describe the state of the art to which this invention pertains. definition

[0090] Unless otherwise indicated, the practice of the present technology employs conventional techniques of organic chemistry, pharmacology, immunology, molecular biology, microbiology, cell biology, and recombinant DNA, which are within the skill of the art. See, e.g., Sambrook, Fritsch and Maniatis, Molecular Cloning: A Laboratory Manual, 2nd edition (1989); Current Protocols In Molecular Biology (FM Ausubel et al., eds., (1987)); the series Methods in Enzymology (Academic Press, 1999); Press, Inc.): PCR 2: A Practical Approach (M. J. MacPherson, B. D. Hames and G. R. Taylor eds. (1995)); Harlow and Lane, eds. (1988) Antibodies, a Laboratory Manual, and Animal Cell Culture (R. I. Freshney, ed. (1987)).

[0091] As used in the description of this invention and the appended claims, the singular forms "a," "an," and "the" are intended to include the plural forms as well, unless the context clearly dictates otherwise.

[0092] As used herein, the term "comprising" is intended to mean that the compositions and methods include the recited elements but do not exclude other elements. As used herein, the transitional phrase (and grammatical variations) consisting essentially of should be interpreted to include the recited materials or steps, as well as materials or steps that do not substantially affect the basic and novel characteristics of the recited embodiment. Thus, the term "consisting essentially of" as used herein should not be interpreted as equivalent to "comprising." "Consisting of" is intended to mean excluding more than trace amounts of other ingredients and substantial method steps for administering the compositions disclosed herein. The embodiments defined by each of these transitional terms are within the scope of this disclosure.

[0093] The term "about" as used herein when referring to a measurable value, such as an amount or concentration, is intended to encompass a variation of 20%, 10%, 5%, 1%, 0.5%, or even 0.1% of the specified amount.

[0094] The terms "acceptable," "effective," or "sufficient" when used to describe the selection of any ingredient, range, dosage form, etc. disclosed herein intend that said ingredient, range, dosage form, etc. is appropriate for the purpose disclosed.

[0095] Also, as used herein, "and / or" refers to and includes any and all possible combinations of one or more of the associated listed items, as well as the absence of combinations when interpreted in the alternative ("or").

[0096] The term "adeno-associated virus" or "AAV" as used herein refers to a member of a class of viruses related to the name and belonging to the Dependoparvovirus genus of the Parvoviridae family. Multiple serotypes of this virus are known to be suitable for gene delivery, and all known serotypes can infect cells from various tissue types. At least eleven consecutively numbered AAV serotypes are known in the art. Non-limiting exemplary serotypes useful in the methods disclosed herein include any of the eleven serotypes, such as AAV2, AAV8, AAV9, or variant serotypes, such as AAV-DJ and AAV PHP.B. AAV particles contain three major viral proteins: VP1, VP2, and VP3. In one embodiment, AAV refers to those of serotype AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV PHP.B, AAVrh74 or AAV-DJ (a chimera obtained by shuffling eight different AAV wild types).

[0097] In some cases, AAV serotypes preferentially target tissue types. In some cases, the chart below shows exemplary tissue types and the AAV serotypes that target each tissue type. [Table 1]

[0098] As used herein, the term "cell" can refer to either prokaryotic or eukaryotic cells, obtained from the subject or from a commercially available source, as appropriate.

[0099] "Eukaryotic cells" includes all kingdoms of life except Monera. Eukaryotic cells can be easily identified through their membrane-bound nuclei. Animals, plants, fungi and protists are eukaryotes, i.e. organisms whose cells are organized into complex structures by internal membranes and cytoskeleton. The most characteristic membrane-bound structure is the nucleus. Unless specifically stated, the term "host" includes eukaryotic hosts, including, for example, yeast, higher plant, insect and mammalian cells. Non-limiting examples of eukaryotic cells or eukaryotic hosts include monkey, cow, pig, mouse, rat, bird, reptile and human, e.g., HEK293 and 293T cells.

[0100] "Prokaryotic cells", which usually lack a nucleus or any other membrane-bound organelles, are divided into two domains: bacteria and archaea. In addition to chromosomal DNA, these cells can also contain genetic information in circular loops called episomes. Bacterial cells are very small, roughly the size of an animal mitochondrion (approximately 1-2 μm in diameter and 10 μm in length). Prokaryotic cells are characterized by three main shapes: rod-shaped, spherical and spiral. Instead of undergoing an elaborate replication process like eukaryotes, bacterial cells divide by binary fission. Examples include, but are not limited to, the bacteria Bacillus, Escherichia coli and Salmonella.

[0101] The term "encoding" when applied to a nucleic acid sequence refers to a polynucleotide that is said to "encode" a polypeptide if, in its native state or when manipulated by methods well known to those of skill in the art, it can be transcribed and / or translated to produce an mRNA for a polypeptide and / or fragment thereof. The antisense strand is the complement of such a nucleic acid, and the coding sequence can be deduced from the antisense strand.

[0102] The term "equivalent" or "biological equivalent" is used interchangeably when referring to a particular molecule, biological or cellular material, and is intended to have minimal homology while still maintaining the desired structure or function. Non-limiting examples of equivalent polypeptides include polypeptides that have at least 60%, or alternatively at least 65%, or alternatively at least 70%, or alternatively at least 75%, or alternatively at least 80%, or alternatively at least 85%, or alternatively at least 90%, or alternatively at least 95% identity to the polypeptide sequence, or alternatively at least 96% identity, or alternatively at least 97% identity, or alternatively at least 98% identity, or alternatively at least 99% identity to the polypeptide sequence, or a polypeptide that has substantially the same or the same function as the reference polypeptide, in one embodiment, a polynucleotide that hybridizes under high stringency conditions to the polynucleotide that codes for such a polypeptide sequence that codes for the reference polypeptide, or its complement. High stringency conditions are described herein and are incorporated herein by reference. Alternatively, the equivalent is a polypeptide encoded by a polynucleotide or its complement having at least 70%, or alternatively at least 75%, or alternatively 80%, or alternatively at least 85%, or alternatively at least 90% identity, or alternatively at least 95% identity, or at least 96% identity, or at least 97% sequence identity, or alternatively at least 98% identity, or alternatively at least 99% identity to a reference polynucleotide, e.g., a wild-type or referenced polynucleotide.

[0103] Non-limiting examples of equivalent polynucleotides include polynucleotides having at least 60%, or alternatively at least 65%, or alternatively at least 70%, or alternatively at least 75%, or alternatively at least 80%, or alternatively at least 85%, or alternatively at least 90%, or alternatively at least 95%, or alternatively at least 96% identity, or alternatively at least 97% sequence identity, or alternatively at least 98% identity, or alternatively at least 99% identity to the reference polynucleotide. Equivalent also contemplates polynucleotides or their complements that hybridize to the reference polynucleotide under high stringency conditions.

[0104] A polynucleotide or polynucleotide region (or polypeptide or polypeptide region) having a certain percentage (e.g., 80%, 85%, 90% or 95%) of "sequence identity" to another sequence means that, when aligned, that percentage of bases (or amino acids) are identical when comparing the two sequences. Alignment and percent homology or sequence identity can be determined using software programs known in the art, such as those described in Current Protocols in Molecular Biology (Ausubel et al., eds. 1987) Supplement 30, section 7.7.18, Table 7.7.1. In certain embodiments, default parameters are used for alignment. A non-limiting exemplary alignment program is BLAST, using default parameters. In particular, exemplary programs include BLASTN and BLASTP, using the following default parameters: Genetic code = standard; filter = none; strand = both; cutoff = 60; expectation = 10; matrix = BLOSUM62; description = 50 sequences; sort = high score; database = non-redundant, GenBank + EMBL + DDBJ + PDB + GenBank CDS translation + SwissProtein + SPupdate + PIR. Details of these programs can be found at the following Internet address: ncbi.nlm.nih.gov / cgi-bin / BLAST. Sequence identity and percent identity can be determined by incorporating them into clustalW (available at the Web address: genome.jp / tools / clustalw / , last accessed on January 13, 2017).

[0105] "Homology" or "identity" or "similarity" refers to sequence similarity between two peptides or two nucleic acid molecules. Homology can be determined by comparing a position in each sequence that can be aligned for comparison. When a position in the compared sequences is occupied by the same base or amino acid, the molecules are homologous at that position. The degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. An "unrelated" or "non-homologous" sequence shares less than 40% identity, or less than 25% identity, with one of the sequences of the present disclosure.

[0106] "Homology" or "identity" or "similarity" can also refer to two nucleic acid molecules that hybridize under stringent conditions.

[0107] "Hybridization" refers to a reaction in which one or more polynucleotides react to form a complex stabilized through hydrogen bonding between the bases of the nucleotide residues. Hydrogen bonding can occur by Watson-Crick base pairing, Hoogsteen binding, or in any other sequence-specific manner. The complex may contain two strands forming a double-stranded structure, three or more strands forming a multistranded complex, a single self-hybridizing strand, or any combination of these. A hybridization reaction may constitute a step in a larger process, such as the initiation of a PCR reaction or the enzymatic cleavage of a polynucleotide by a ribozyme.

[0108] Examples of stringent hybridization conditions include an incubation temperature of about 25°C to about 37°C; a hybridization buffer concentration of about 6x saline sodium citrate (SSC) to about 10x SSC; a formamide concentration of about 0% to about 25%; and a wash solution of about 4x SSC to about 8x SSC. Examples of moderate hybridization conditions include an incubation temperature of about 40°C to about 50°C; a buffer concentration of about 9x SSC to about 2x SSC; a formamide concentration of about 30% to about 50%; and a wash solution of about 5x SSC to about 2x SSC. High stringency hybridization refers to a state in which hybridization of an oligonucleotide to a target sequence does not contain mismatches (i.e., perfect complementarity). Examples of high stringency conditions include an incubation temperature of about 55°C to about 68°C; a buffer concentration of about 1xSSC to about 0.1xSSC; a formamide concentration of about 55% to about 75%; and a wash solution of about 1xSSC, 0.1xSSC, or deionized water. In general, the hybridization incubation time is 5 minutes to 24 hours, with one, two or more wash steps, and the wash incubation time is about 1, 2 or 15 minutes. SSC is a 0.15M NaCl and 15mM citrate buffer. It is understood that equivalents of SSC using other buffer systems can be used.

[0109] As used herein, "expression" refers to the process by which a polynucleotide is transcribed into mRNA and / or the transcribed mRNA is subsequently translated into a peptide, polypeptide or protein. If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell.

[0110] "Gene" refers to a polynucleotide containing at least one open reading frame (ORF) that can encode a particular polypeptide or protein after being transcribed and translated. "Gene product" or "gene expression product" refers to the amino acid (e.g., peptide or polypeptide) produced when a gene is transcribed and translated.

[0111] "Under transcriptional control" is a term well understood in the art and indicates that transcription of a polynucleotide sequence, usually a DNA sequence, is dependent on being operably linked to elements that contribute to or facilitate the initiation of transcription. "Operably linked" refers to a polynucleotide positioned such that it can function within a cell. In one embodiment, the present invention provides a promoter operably linked to a downstream sequence.

[0112] The term "exon" refers to a nucleic acid sequence that comprises a protein-coding sequence. A gene typically contains more than one exon separated by intervening introns.

[0113] The term "intron" as used herein refers to a nucleic acid sequence flanked by a splice donor site at the 5' end and a splice acceptor site at the 3' end. In some embodiments, an intron is spliced ​​out or removed from an RNA or mRNA sequence expressed from a vector in which the intron is present.

[0114] The term "splice donor site" refers to a nucleic acid sequence or domain at the 5' end of an intron. In one embodiment, the splice donor site marks the start of the intron and / or the boundary of the intron with the immediately preceding coding sequence (or exon).

[0115] The term "splice acceptor site" as used herein refers to a nucleic acid sequence or domain at the 3' end of an intron. In one embodiment, the splice acceptor site marks the start of the intron and the boundary of the intron with the following coding sequence-exon. In another embodiment, the splice acceptor site comprises an intron branch point, which is the point where the 5' end of the intron is joined during the process of splicing. In some embodiments, the splice acceptor sequence and the intron branch site are located adjacent to each other as a single unit. In some embodiments, the splice acceptor sequence and the intron branch site can be further separated by moving the branch site further 5' of the splice acceptor sequence.

[0116] The term "splice site" as used herein refers to a nucleic acid sequence or domain that is present at either the 5' or 3' end of an intron as defined above.

[0117] The term "exon skipping" as used herein refers to the modification of pre-mRNA splicing by targeting splice donor and / or acceptor sites in pre-mRNA with one or more complementary antisense oligonucleotides. By blocking the access of spliceosomes to one or more splice donor or acceptor sites, one or more complementary antisense oligonucleotides can prevent the splicing reaction, thereby causing the deletion of one or more exons from the fully processed mRNA. In one embodiment, exon skipping is achieved in the nucleus during the maturation process of pre-mRNA. This includes the masking of key sequences involved in the splicing of targeted exons by using antisense oligonucleotides complementary to splice donor sequences in pre-mRNA.

[0118] The term "gene regulatory sequence" as used herein refers to a nucleic acid sequence capable of controlling the transcription, splicing or modification of a gene, an open reading frame or an exon or intron. The gene regulatory sequence of the present invention may include a promoter, a binding site for an antisense oligonucleotide and / or an enhancer. Thus, placing a gene under the regulatory control of a promoter or regulatory element means positioning the gene so that its expression is controlled by the regulatory sequence(s). Thus, in constructing a promoter-gene combination, the promoter is preferably positioned upstream of the gene at a distance from the transcription start site roughly equal to the distance between the promoter and the gene it controls in its natural context. Variation in this distance can be tolerated without loss of promoter function. Similarly, with respect to a heterologous gene placed under its control, the preferred positioning of a regulatory element such as an enhancer reflects its natural position with respect to the structural gene it naturally regulates. Enhancers, in contrast to promoter elements, are believed to be relatively position and orientation insensitive. In some embodiments, the gene regulatory sequence comprises one or more of a binding sequence for an antisense oligonucleotide, a binding sequence for doxycycline, or a polynucleotide sequence encoding a riboswitch. In some embodiments, the antisense oligonucleotide (ASO) comprises one or more modified nucleotides. In one embodiment, the antisense oligonucleotide is a morpholino oligonucleotide.

[0119] In some embodiments, the antisense oligonucleotides (ASOs) described herein comprise about 8 to about 50 nucleotides in length. In some cases, the ASOs comprise about 8 to about 30, about 8 to about 25, about 8 to about 20, about 8 to about 18, about 8 to about 15, about 10 to about 50, about 10 to about 30, about 10 to about 25, about 10 to about 20, about 10 to about 18, about 10 to about 15, about 12 to about 50, about 12 to about 30, about 12 to about 25, about 12 to about 20, about 12 to about 18, or about 12 to about 15 nucleotides in length. In some embodiments, the ASOs comprise 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40, or 50 nucleotides in length.

[0120] In some cases, the ASO comprises one or more modified nucleotides. In some cases, the ASO comprises about 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100% modified nucleotides. In other examples, the ASO comprises about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40 or more modified nucleotides. In some cases, the modification is at the 2' hydroxyl group of the ribose moiety. In some cases, the modification includes H, OR, R, halo, SH, SR, NH2, NHR, NR2, or CN, where R is an alkyl moiety. Exemplary alkyl moieties include, but are not limited to, halogen, sulfur, thiol, thioether, thioester, amine (primary, secondary, or tertiary), amide, ether, ester, alcohol, and oxygen. In some cases, the alkyl moiety further comprises a modification. In some cases, the modification is an azo group, a keto group, an aldehyde group, a carboxyl group, a nitro group, a nitroso, group, a nitrile group, a heterocycle (e.g., imidazole, hydrido, ladino or hydroxylamino) groups, isocyanate or cyanate groups, or sulfur-containing groups (e.g., sulfoxide, sulfone, sulfide, and disulfide). In some cases, the alkyl moiety further comprises a heterosubstitution. In some cases, the carbon of the heterocyclic group is replaced by nitrogen, oxygen, or sulfur. In some cases, the heterocyclic substitution includes, but is not limited to, morpholino, imidazole, and pyrrolidino. In some cases, the modification at the 2' hydroxyl group is a 2'-O-methyl modification or a 2'-O-methoxyethyl (2'-O-MOE) modification. In some cases, the modified nucleotide is a locked or bridged ribose modification (e.g., locked nucleic acid or LNA), an ethylene nucleic acid (ENA) (e.g., 2'-4'-ethylene bridged nucleic acid), a peptide nucleic acid, or a morpholino. In some cases, the modified nucleotide further comprises one or more modified internucleotide linkages.Exemplary modified internucleotide linkages include phosphorothioates, phosphorodithioates, methyl phosphonates, 5'-alkylene phosphonates, 5'-methyl phosphonates, 3'-alkylene phosphonates, boron trifluoridates, 3'-5' or 2'-5' linked boranophosphate esters and selenophosphates, phosphotriesters, thionoalkyl phosphotriesters, phosphonic acid hydrogen bonds, alkyl phosphonates, alkyl phosphonothioates, aryl phosphonothioates, phosphoroselenoates, phosphorodiselenoates, phosphinates, phosphoramidates, 3'-alkyl phosphoramidates, aminoalkyl phosphoramidates, thionophosphoramidates, phosphoropiperazidates, phosphoroaniline, and the like. These include, but are not limited to, thioates, phosphoroanilidates, ketones, sulfones, sulfonamides, carbonates, carbamates, methylenehydrazo, methylenedimethylhydrazo, formacetals, thioformacetals, oximes, methyleneimino, methylenemethylimino, thioamidates, bonds with riboacetyl groups, aminoethylglycines, silyl or siloxane bonds, alkyl or cycloalkyl bonds, e.g., of 1 to 10 carbons, with or without heteroatoms, which are saturated or unsaturated and / or substituted and / or contain heteroatoms, morpholino structures, amides, polyamides, where the bases are directly or indirectly attached to the aza nitrogens of the backbone, and combinations thereof.

[0121] The term "morpholino" as used herein refers to a polymer molecule having a backbone that supports bases that can form hydrogen bonds with polynucleotides. In some embodiments, the polymer on the morpholino lacks a pentose sugar backbone moiety, more specifically, a ribose backbone linked by a phosphodiester bond that is typical of nucleotides and nucleosides. In one embodiment, the morpholino oligonucleotide contains a nitrogen ring. In another embodiment, the morpholino is a stereochemically pure oligonucleotide (see, for example, wavelifesciences.com, last accessed on January 25, 2019) or a derivative thereof. In another embodiment, the morpholino comprises a sequence that is at least 95% identical to a stereochemically pure polynucleotide.

[0122] In another embodiment, the morpholino comprises a structure of about 8 to about 50, about 8 to about 30, about 10 to about 50, about 10 to about 30, or about 12 to about 30 nucleotides that includes a targeting sequence that is complementary to a target region of a selected pre-processed mRNA or pre-mRNA, such as an intron region of the pre-mRNA. In another embodiment, the morpholino antisense oligonucleotide promotes splicing of the targeted exon, resulting in a transcript lacking the targeted exon.

[0123] In some cases, the antisense oligonucleotide (ASO) is referred to herein as OncoSkip. As used herein, the term "OncoSkip" refers to an ASO designed to induce skipping of a target exon during splicing of a target transgene, thereby inducing expression of the target transgene. In some cases, the target transgene encodes a polypeptide that binds to a surface polypeptide (e.g., a surface receptor) of a target cell. In some cases, the target cell is a tumor cell or an immune cell. In some cases, the target transgene is a cancer gene. In such an example, the use of OncoSkip induces skipping of a target exon during splicing to induce expression of a cancer gene.

[0124] In some embodiments, the OncoSkip described herein comprises about 8 to about 50 nucleotides in length. In some cases, the OncoSkip comprises about 8 to about 30, about 8 to about 25, about 8 to about 20, about 8 to about 18, about 8 to about 15, about 10 to about 50, about 10 to about 30, about 10 to about 25, about 10 to about 20, about 10 to about 18, about 10 to about 15, about 12 to about 50, about 12 to about 30, about 12 to about 25, about 12 to about 20, about 12 to about 18, or about 12 to about 15 nucleotides in length. In some embodiments, the OncoSkip comprises 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 40, or 50 nucleotides in length.

[0125] In some embodiments, OncoSkip comprises one or more modified nucleotides, for example, about 5, 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100% modified nucleotides. In some cases, OncoSkip comprises about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40 or more modified nucleotides. In some cases, OncoSkip comprises one or more morpholino modified nucleotides. In some cases, OncoSkip comprises about 5, 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100% morpholino modified nucleotides. In some cases, OncoSkip comprises about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40 or more morpholino-modified nucleotides.

[0126] In some cases, OncoSkip works in concert with TransSkip. As used herein, the term "TransSkip" refers to a recombinant vector (e.g., a recombinant viral vector such as an AAV vector) that includes a transgene interrupted by an intron-exon-intron region, where the exon includes a stop codon that prevents normal expression of the polypeptide encoded by the transgene. In some cases, the transgene is further encompassed by a construct that includes a polynucleotide that codes for a dimer. In some cases, together with OncoSkip, OncoSkip skips an exon from the intron-exon-intron region during splicing to generate an mRNA that allows expression of the polypeptide encoded by the transgene. In the absence of OncoSkip, transgene expression from TransSkip is stopped due to the presence of a stop codon in the intron-exon-intron region.

[0127] As used herein, the term "dimer" refers to an engineered protein molecule that includes two or more single chain variable fragments (scFvs), where each scFv recognizes a surface polypeptide (e.g., a surface receptor) expressed on a cell, and the two cells are different. In some cases, the dimer targets two different cell types, such as a cancer cell and an immune cell, or two different immune cell types. Exemplary immune cell types include dendritic cells, natural killer (NK) cells, macrophages, T cells, B cells, monocytes, or neutrophils. In some cases, the immune cell is an effector immune cell. In some cases, the effector immune cell is an effector T (T eff ) cells (also referred to herein as tumor-infiltrating T cells). eff The cells include CD8+ T cells and non-regulatory CD4+ helper T cells. In some cases, the dimers target cancer cells and effector immune cells. In some cases, the dimers target cancer cells and T effIn some cases, the dimer targets two different cancer cells, such as two different cancer cells from the same cancer.

[0128] In some cases, the two or more scFvs of the dimer are linked by a linker. In some cases, the linker is a peptide linker that facilitates binding of each scFv to its respective target polypeptide. In some cases, the linker comprises a series of poly-Ala, poly-Gly, or a combination thereof. In some cases, the poly-Ala linker, poly-Gly linker, or peptide linker comprising a combination of Ala and Gly are each independently about 2 residues to about 50 residues in length. In some cases, the poly Ala linker, poly Gly linker, or peptide linker comprising a combination of Ala and Gly may each independently be from about 2 to about 45 residues, from about 4 to about 45 residues, from about 5 to about 45 residues, from about 8 to about 45 residues, from about 10 to about 45 residues, from about 15 to about 45 residues, from about 20 to about 45 residues, from about 30 to about 45 residues, from about 2 to about 40 residues, from about 4 to about 40 residues, from about 5 to about 40 residues, from about 8 to about 40 residues, from about The length is from 10 to about 40 residues, from about 15 to about 40 residues, from about 20 to about 40 residues, from about 30 to about 40 residues, from about 2 to about 30 residues, from about 4 to about 30 residues, from about 5 to about 30 residues, from about 8 to about 30 residues, from about 10 to about 30 residues, from about 15 to about 30 residues, from about 20 to about 30 residues, from about 2 to about 20 residues, from about 4 to about 20 residues, from about 5 to about 20 residues, from about 8 to about 20 residues, from about 10 to about 20 residues, or from about 15 to about 20 residues. In some cases, the poly-Ala linkers, poly-Gly linkers or peptide linkers comprising a combination of Ala and Gly are each independently about 2, 4, 5, 6, 8, 10, 12, 14, 15, 16, 18, 20, 25, 30, 35, 40, 45 or 50 residues in length.

[0129] In some cases, the linker is a (Gly4Ser)n linker, where n is an integer from 1 to 10. In some cases, n is an integer from 1 to 6, 1 to 4, or 1 to 3. In some cases, n is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In some cases, the linker is about 10 to about 50 amino acid residues in length, optionally about 10 to about 30, about 10 to about 25, or about 10 to about 20 amino acid residues in length. In some cases, the linker comprises one or more unnatural amino acids.

[0130] In some cases, the dimer further comprises an additional polypeptide. In some cases, the additional polypeptide enhances the avidity of the dimer for a target cell. In some cases, the additional polypeptide is a dimerization domain of human hepatocyte nuclear factor 1 alpha (HNF1α). In some cases, HNF1α comprises a polypeptide sequence having at least 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with MVSKLSQLQTELLAALLESGLSKEALIQALGE (SEQ ID NO: 47). In some cases, HNF1α is encoded by a polynucleotide having at least 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with ATGGTGAGCAAGCTGAGCCAGCTGCAGACCGAGCTGCTGGCCGCCCTGCTGGAGAGCGGCCTGAGCAAGGAGGCCCTGATCCAGGCCCTGGGCGAG (SEQ ID NO: 48). In some cases, the additional polypeptide does not induce any additional immunogenicity or toxicity.

[0131] In some embodiments, the further polypeptide is linked to the remainder of the dimer by a linker. Optionally, the linker comprises GSGGAP. As used herein, the GSGGAP peptide is also referred to herein as a spacer. Optionally, the linker comprises TPLGDTTHTSG. Optionally, the peptide TPLGDTTHTSG is derived from the hinge region of IgG3.

[0132] As used herein, the term "TransJoin" refers to a recombinant vector (e.g., a recombinant viral vector such as an AAV vector) that contains a polypeptide that encodes a dimer described herein, but does not contain an intron-exon-intron region in which the exon contains a stop codon. Thus, TransJoin is different from TransSkip, since TransJoin can express a dimer without the need for OncoSkip.

[0133] In some embodiments, TransJoin described herein is optimized for delivery of dimers to target cells or tissues of interest. In some cases, TransJoin comprises a promoter and enhancer pair, or a promoter and a regulatory element pair, that is optimized for delivery and / or expression to target cells or tissues. In some cases, TransJoin is optimized for constitutive expression of dimers for a certain period of time (e.g., by a promoter and enhancer pair, or a promoter and a regulatory element pair). In some cases, TransJoin is optimized for constitutive and stable expression of dimers for a certain period of time (e.g., by a promoter and enhancer pair, or a promoter and a regulatory element pair). In some cases, TransJoin comprises a promoter and a regulatory element, such as Woodchuck Hepatitis Virus (WHP) post-transcriptional regulatory element (WPRE), for enhanced expression, constitutive expression, stable expression, or a combination thereof.

[0134] In some embodiments, the TransJoin described herein comprises a promoter and enhancer pair or a promoter and regulatory element pair that is optimized for balanced expression of the dimer in a target cell or tissue. In some cases, balanced expression refers to a range of expression above which expression induces toxicity, but below which expression is not therapeutic. In some cases, the promoter and enhancer or promoter and regulatory element (e.g., WPRE) work in concert to balance the expression of the dimer to reach the target range. In some cases, balanced expression includes a wide range, for example, to provide a wide therapeutic window for the dimer.

[0135] In some embodiments, the TransJoin described herein further comprises a secretion consensus sequence, as described below, which is optimized for balanced expression of the dimer in the target cell or tissue. In some cases, balanced expression refers to a range of expression above which expression induces toxicity, but below which expression is not therapeutic. In some cases, the secretion consensus sequence works in concert with a promoter, enhancer, regulatory element (e.g., WPRE), or a combination thereof, to balance the expression of the dimer to reach the target range. In some cases, the balanced expression includes a wide range, for example, to provide a wide therapeutic window for the dimer.

[0136] As used above, a period of time includes 1 day, 2 days, 3 days, 4 days, 5 days, 7 days, 21 days, 28 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 8 months, 10 months, 1 year, 2 years or more.

[0137] As used herein, the term "isolated" refers to a molecule or biological or cellular material that is substantially free of other materials.

[0138] As used herein, the term "functional" may be used to modify any molecule, biologic, or cellular material with the intent of achieving a particular, specified effect.

[0139] As used herein, the terms "nucleic acid sequence" and "polynucleotide" are used interchangeably to refer to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides.Thus, the term includes, but is not limited to, single-stranded, double-stranded or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids or polymers that contain purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural or derivatized nucleotide bases.

[0140] As used herein, the term "promoter" refers to any sequence that regulates the expression of a coding sequence, such as a gene. A promoter can be, for example, constitutive, inducible, repressible, or tissue-specific. A "promoter" is a control sequence that is a region of a polynucleotide sequence at which the initiation and rate of transcription are controlled. A promoter can contain genetic elements to which regulatory proteins and molecules, such as RNA polymerase and other transcription factors, can bind. Non-limiting exemplary promoters include the Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter, the SV40 promoter, the dihydrofolate reductase promoter, the beta-actin promoter, the phosphoglycerol kinase (PGK) promoter, the U6 promoter, or the EF1 alpha truncated (EFS) promoter.

[0141] In some embodiments, the promoter is an EF1 alpha truncated (EFS) promoter. Optionally, the EF1 alpha truncated (EFS) promoter is [ka] or its equivalent.

[0142] Further non-limiting exemplary promoters with certain target specificity are provided herein below, including, but not limited to, cytomegalovirus (CMV), human polypeptide chain elongation factor (EF1a), SV40, phosphoglycerate kinase (PGK), such as PGK1 (human or mouse), P5, Ubc, human beta-actin, CAG, TRE, UAS, Ac5, polyhedrin, CaMKIIa, Gal1, TEF1, GDS, ADH1, CaMV35S, ubiquitin (Ubi), such as ubiquitin C (UbiC), H1, U6, alpha-1-antitrypsin, spleen focus forming virus (SFFV) and chicken beta-actin (CBA). Synthetic derived promoters can be used for ubiquitous or tissue-specific expression. Additionally, viral derived promoters, some of which are described above, such as CMV, HIV, adenovirus and AAV promoters, can be useful in the methods disclosed herein.

[0143] In some embodiments, the promoter is a tissue-specific promoter. In some cases, the tissue-specific promoter is an endogenous promoter or a promoter derived from a gene that is exclusively expressed in the target cell type. Exemplary tissue-specific promoters include, but are not limited to, liver-specific promoters such as ApoE / hAAT, LP1, SV40 / hAlb (InvivoGen); photoreceptor-specific promoters such as human rhodopsin kinase (GRK1) and cone arrestin (CAR); B-cell-specific promoters such as B29 (InvivoGen); hematopoietic cell-specific promoters such as CD45 promoter and SV40 / CD45 from InvivoGen; muscle cell-specific promoters such as desmin promoter (InvivoGen); pancreatic acinar cell-specific promoters such as elastase-1 promoter (InvivoGen); endothelial cell-specific promoters such as Flt-1 promoter (InvivoGen); and neuronal cell-specific promoters such as SYN1 promoter (InvivoGen).

[0144] In some embodiments, the promoter is linked to an enhancer to increase transcription efficiency. Non-limiting examples of enhancers include the RSV enhancer, the CMV enhancer, and the alpha-fetoprotein MERII enhancer.

[0145] Enhancers are regulatory elements that increase the expression of a target sequence. A "promoter / enhancer" is a polynucleotide that contains a sequence that can provide both promoter and enhancer functions. For example, the long terminal repeats of retroviruses contain both promoter and enhancer functions. Enhancers / promoters can be "endogenous" or "exogenous" or "heterologous." An "endogenous" enhancer / promoter is one that is naturally linked to a particular gene in a genome. An "exogenous" or "heterologous" enhancer / promoter is one that has been juxtaposed to a gene using genetic engineering (i.e., molecular biology techniques) such that transcription of that gene is induced by the linked enhancer / promoter.

[0146] In some embodiments, the vectors utilized herein (e.g., viral vectors such as AAV vectors) further comprise one or more additional regulatory elements. Exemplary regulatory elements include, but are not limited to, transcription terminators, polyadenylation sites, and inverted terminal repeats (ITRs), such as 5'ITR and 3'ITR. In some cases, the regulatory element comprises a Woodchuck Hepatitis Virus (WHP) post-transcriptional regulatory element (WPRE). In some cases, the exemplary WPRE comprises the nucleic acid sequence of SEQ ID NO:50 or an equivalent thereof. The sequence of SEQ ID NO:50 is shown below:

[0147] [ka]

[0148] The terms "protein", "peptide" and "polypeptide" are used interchangeably and in their broadest sense refer to a compound of two or more subunits of amino acids, amino acid analogs or peptidomimetics. The subunits may be linked by peptide bonds. In alternative embodiments, the subunits may be linked by other bonds, such as esters, ethers, etc. A protein or peptide must contain at least two amino acids, and there is no limit to the maximum number of amino acids that may make up a protein's or peptide's sequence. As used herein, the term "amino acid" refers to any of the natural and / or unnatural or synthetic amino acids, including glycine and both D and L optical isomers, amino acid analogs and peptidomimetics.

[0149] As used herein, the term "vector" refers to a non-chromosomal nucleic acid that contains an intact replicon such that the vector can replicate when placed in a cell, for example, by the process of transformation. Vectors can be viral or non-viral. Viral vectors include retroviruses, adenoviruses, herpes viruses, baculoviruses, modified baculoviruses, papovaviruses, or other modified naturally occurring viruses. Exemplary non-viral vectors for delivering nucleic acids include naked DNA; DNA complexed with cationic lipids, alone or in combination with cationic polymers; anionic and cationic liposomes; particles containing DNA-protein complexes and DNA condensed with cationic polymers, such as heterologous polylysine, oligopeptides of defined length, and polyethyleneimine, optionally contained in liposomes; and ternary complexes containing viruses and polylysine-DNA. In another embodiment, the vector is a recombinant viral vector comprising a backbone vector selected from the group of a retroviral vector, a lentiviral vector, a murine leukemia virus ("MLV") vector, an Epstein-Barr virus ("EBV") vector, an adenoviral vector, a herpes virus ("HSV") vector, or an adeno-associated virus ("AAV") vector. In another embodiment, the vector is an AAV vector, or optionally a self-complementary AAV vector.

[0150] "Viral vector" is defined as a recombinantly produced virus or virus particle that contains a polynucleotide to be delivered into a host cell, either in vivo, ex vivo or in vitro. Examples of viral vectors include retroviral vectors, AAV vectors, lentiviral vectors, adenoviral vectors, alphavirus vectors, and the like. Alphavirus vectors, such as Semliki Forest virus-based vectors and Sindbis virus-based vectors, have also been developed for use in gene therapy and immunotherapy. See Schlesinger and Dubensky (1999) Curr. Opin. Biotechnol. 5:434-439 and Ying et al. (1999) Nat. Med. 5(7):823-827. In some cases, the viral vector is an AAV vector, such as AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV PHP.B, AAVrh74 or AAV-DJ. In some cases, the viral vector is AAVrh74. In some cases, AAVrh74 comprises the vector sequence of GenBank accession number LP899424.1 (accessed on February 7, 2020).

[0151] In some embodiments, there is a limited carrying capacity of viral vector (e.g., AAV vector). For example, AAV vector has a carrying capacity limit of 4.7kb. Therefore, the combination of dimer with promoter, enhancer and other regulatory elements needs to be within the capacity of 4.7kb. In such an example, the promoter utilized herein is selected based on its nucleic acid length to allow packaging of dimer and other regulatory elements into viral vector, e.g., AAV vector. In some cases, the promoter for such use is SFFV, EF1α, PGK, UbiC, CMV, CBA or EFS. In some cases, the promoter is EFS.

[0152] In another embodiment, the promoter is an inducible promoter. In certain related embodiments, the promoter is an inducible tetracycline promoter. The Tet-Off and Tet-On gene expression systems provide researchers with ready access to regulated, high-level gene expression systems described by Gossen & Bujard (1992; Tet-Off) and Gossen et al. (1995; Tet-On). In the Tet-Off system, gene expression is turned on when tetracycline (Tc) or doxycycline (Dox; a Tc derivative) is removed from the medium. In contrast, in the Tet-On system, expression is turned on by adding Dox. In both systems, gene expression can be tightly regulated in response to changes in the concentration of Tc or Dox. The maximum expression levels in the Tet system are very high and compare favorably with those obtained from strong constitutive mammalian promoters such as CMV (Yin et al., 1996). Unlike other inducible mammalian expression systems, gene regulation in the Tet system is highly specific, so that interpretation of results is not complicated by pleiotropic effects or nonspecific induction. In E. coli, the Tet repressor protein (TetR) negatively regulates the genes of the tetracycline resistance operon on the Tn10 transposon. TetR blocks transcription of these genes by binding to the tet operator sequence (tetO) in the absence of Tc. TetR and tetO provide the basis for regulation and induction for use in mammalian experimental systems. In the Tet-On system, the regulatory protein is based on the "reverse" Tet repressor (rTetR), created by four amino acid changes in TetR (Hillen & Berens, 1994; Gossen et al., 1995). The resulting protein, rtTA (reverse tTA is also called tetracycline-activating protein), is encoded by the pTet-On regulator plasmid.

[0153] In a related embodiment, the vector further comprises, consists essentially of, or consists of a nucleic acid encoding a tetracycline activating protein and a promoter regulating expression of the tetracycline activating protein.

[0154] Other inducible systems useful in the vectors, isolated cells, viral packaging systems and methods described herein include regulation by ecdysone, estrogen, progesterone, chemical inducers of dimerization and isopropyl-β-D1-thiogalactopyranoside (EPTG).

[0155] As used herein, the term "recombinant expression system" or "recombinant vector" refers to one or more genetic constructs for the expression of specific genetic material formed by recombination.

[0156] "Gene delivery vehicle" is defined as any molecule that can carry inserted polynucleotide into host cell.Examples of gene delivery vehicles are biocompatible polymers, including liposomes, micelles, natural and synthetic polymers; lipoproteins; polypeptides; polysaccharides; lipopolysaccharides; artificial virus envelopes; metal particles; and bacteria or viruses, such as baculovirus, adenovirus and retrovirus, bacteriophages, cosmids, plasmids, fungal vectors and other recombinant vehicles typically used in the art that have been described for expression in various eukaryotic and prokaryotic hosts and can be used for gene therapy, in addition to simple protein expression.

[0157] The polynucleotides disclosed herein can be delivered to cells or tissues using gene delivery vehicles. As used herein, "gene delivery", "gene transfer", "transduction" and the like are terms that refer to the introduction of an exogenous polynucleotide (sometimes referred to as a "transgene") into a host cell, regardless of the method used for the transfer. Such methods include various well-known techniques, such as vector-mediated gene transfer (e.g., by viral infection / transfection, or various other protein-based or lipid-based gene delivery complexes), as well as techniques that facilitate the delivery of "naked" polynucleotides (such as electroporation, "gene gun" delivery, and various other techniques used for the transfer of polynucleotides). The transferred polynucleotide can be stably or transiently maintained in the host cell. Stable maintenance typically requires that the transferred polynucleotide contains an origin of replication compatible with the host cell, or is integrated into a host cell replicon, such as an extrachromosomal replicon (e.g., a plasmid), or into the nuclear or mitochondrial chromosome. As known in the art and described herein, many vectors are known to be capable of mediating the transfer of genes into mammalian cells.

[0158] A "plasmid" is an extrachromosomal DNA molecule that can replicate independently of chromosomal DNA and is separate from chromosomal DNA. Plasmids are often circular and double stranded. Plasmids provide a mechanism for horizontal gene transfer within a population of microorganisms and usually provide a selective advantage under given environmental conditions. Plasmids may carry genes that confer resistance to naturally occurring antibiotics in competitive niches, or the proteins produced may act as toxins under similar circumstances.

[0159] "Plasmids" used in genetic engineering are called "plasmid vectors". Many plasmids are commercially available for such use. The gene to be replicated is inserted into a copy of the plasmid that contains a gene that makes the cell resistant to a particular antibiotic and a multiple cloning site (MCS, or polylinker), a short region that contains several commonly used restriction sites that make it easy to insert a DNA fragment into this location. Another major use of plasmids is to make large amounts of proteins. In this case, researchers grow bacteria that contain a plasmid with the gene of interest. Just as bacteria produce proteins that confer antibiotic resistance, they can also be induced to produce large amounts of proteins from an inserted gene.

[0160] In the embodiment where gene transfer is mediated by DNA virus vectors such as adenovirus (Ad) or adeno-associated virus (AAV), vector construct refers to the polynucleotide and transgene that comprises the viral genome or a part thereof. Adenovirus (Ad) is a relatively well-characterized homogeneous group of viruses that includes more than 50 serotypes. Adenovirus does not require integration into the host cell genome. Recombinant Ad-derived vectors have also been constructed, especially those that reduce the possibility of recombination and the generation of wild-type virus. Such vectors are commercially available from sources such as Takara Bio USA (Mountain View, CA), Vector Biolabs (Philadelphia, PA) and Creative Biogene (Shirley, NY). Wild-type AAV has high infectivity and specificity to integrate into the genome of host cells. See Wold and Toth (2013) Curr. Gene. Ther. 13(6):421-433, Hermonat & Muzyczka (1984) Proc. Natl. Acad. Sci. USA 81:6466-6470 and Lebkowski et al. (1988) Mol. Cell. Biol. 8:3988-3996.

[0161] Vectors that contain both a promoter and a cloning site into which a polynucleotide can be operably linked are well known in the art. Such vectors are capable of transcribing RNA in vitro or in vivo and are available from Agilent. These vectors are commercially available from sources such as Biosciences, Inc. Technologies (Santa Clara, Calif.) and Promega Biotech (Madison, Wis.). To optimize expression and / or in vitro transcription, it may be necessary to remove, add, or modify the 5' and / or 3' untranslated portions of the clone to remove extra potentially inappropriate alternative translation initiation codons or other sequences that may disrupt or reduce expression at either the transcriptional or translational level. Alternatively, a consensus ribosome binding site can be inserted immediately 5' to the initiation codon to enhance expression.

[0162] As used herein, the term "engager," "engager molecule," or "activating antigen" refers to a molecule secreted from a cell that can activate an immune cell. In certain embodiments, the engager specifically activates immune effector cells according to a domain present in the engager. Illustrative examples of cells that secrete engagers include, but are not limited to, T cells, NK cells, NKT cells, CAR-T cells, mesenchymal stem cells (MSCs), neural stem cells, hematopoietic stem cells, or mixtures thereof. In another embodiment, the immune effector cells include dendritic cells, natural killer ("NK") cells, macrophages, T cells, B cells, or combinations thereof.

[0163] The term "antigen recognition domain" or "antigen binding domain" refers to the portion of an engager molecule that recognizes an antigen. In certain embodiments, the antigen may be of any nature, including but not limited to, a protein, a carbohydrate, and / or a synthetic molecule.

[0164] As used herein, the term "activating antigen" or "activation domain" refers to a portion of an engager molecule that interacts with an immune cell and induces a positive or negative immunoregulatory signal. Examples of positive immunoregulatory signals include signals that induce cell proliferation, cytokine secretion, or cytolytic activity. Examples of negative immunoregulatory signals include signals that inhibit cell proliferation, inhibit secretion of immunosuppressive factors, or induce cell death.

[0165] As used herein, the term "native immune cells" refers to immune cells that are naturally present in the immune system. Examples include, but are not limited to, T cells, NK cells, NKT cells, B cells, and dendritic cells.

[0166] As used herein, the term "engineered immune cells" refers to immune cells that have been genetically modified.

[0167] As used herein, the term "T cells" includes naive T cells, CD4+ T cells, CD8+ T cells, memory T cells, activated T cells, anergic T cells, tolerant T cells, chimeric B cells, and antigen-specific T cells.

[0168] As used herein, the term "antibody" refers not only to intact antibody molecules, but also to fragments of antibody molecules that retain immunogen-binding ability. Such fragments are also well known in the art and are used regularly both in vitro and in vivo. Thus, as used herein, the term "antibody" refers not only to intact immunoglobulin molecules, but also to the well-known active fragments F(ab')2 and Fab. F(ab')2 and Fab fragments, which lack the Fc fragment of intact antibodies, may be cleared more rapidly from the circulation and have less non-specific tissue binding than intact antibodies (Wahl et al., J. Nucl. Med. 24:316-325 (1983)). The antibodies of the present invention include whole native antibodies, monoclonal antibodies, human antibodies, humanized antibodies, camelized antibodies, multispecific antibodies, bispecific antibodies, chimeric antibodies, Fab, Fab', single chain V region fragments (scFv), single domain antibodies (e.g., nanobodies and single domain camel antibodies), V NAR Antibodies include antibodies, fragments, bispecific T cell engager (BiTE) antibodies, minibodies, disulfide-linked Fvs (sdFvs), and anti-idiotypic (anti-Id) antibodies, intrabodies, fusion polypeptides, non-conventional antibodies, and antigen-binding fragments of any of the above. In particular, antibodies include immunoglobulin molecules and immunologically active fragments of immunoglobulin molecules, i.e., molecules that contain an antigen-binding site. Immunoglobulin molecules can be of any type (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2), or subclass.

[0169] In certain embodiments, an antibody is a glycoprotein comprising at least two heavy (H) chains and two light (L) chains interconnected by disulfide bonds. Each heavy chain comprises a heavy chain variable region (herein referred to as V H ) and heavy chain constant (C H The heavy chain constant region is composed of three domains, CH1, CH2, and CH3. Each light chain comprises a light chain variable region (herein referred to as V Land light chain constant C L The light chain constant region consists of one domain, C L It consists of: V H and V L The regions can be further subdivided into regions of hypervariability, called complementarity determining regions (CDRs), interspersed with more conserved regions, called framework regions (FRs). H and V L is composed of three CDRs and four FRs arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The variable regions of the heavy and light chains contain binding domains that interact with antigens. The constant region of an antibody may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system. The terms "antigen-binding portion," "antigen-binding fragment," or "antigen-binding region" of an antibody, as used interchangeably herein, refer to a region or portion of an antibody that binds to an antigen and confers antigen specificity to the antibody, and fragments of antigen-binding proteins, e.g., antibodies, include one or more fragments of an antibody that retain the ability to specifically bind to an antigen (e.g., a peptide / HLA complex). It has been shown that the antigen-binding function of an antibody can be performed by fragments of a full-length antibody. Examples of antigen-binding portions encompassed by the term "antibody fragment" of an antibody include the V L , V H , C L and CHI domains; F(ab)2 fragment, a bivalent fragment containing two Fab fragments linked by a disulfide bridge at the hinge region; V H Fd fragment consisting of the V domain and the CHI domain; L Domains and V H Fv fragment consisting of domains; V H domains (Ward et al., Nature, 341:544-546 (1989)); and isolated complementarity determining regions (CDRs).

[0170] Antibodies and antibody fragments may be derived in whole or in part from mammals (e.g., humans, non-human primates, goats, guinea pigs, hamsters, horses, mice, rats, rabbits and sheep) or non-mammalian antibody-producing animals (e.g., chickens, ducks, geese, snakes, urodele amphibians). Antibodies and antibody fragments can be produced in animals or produced outside of animals, such as from yeast or phage (e.g., as single antibodies or antibody fragments or as part of an antibody library).

[0171] In addition, two domains of the Fv fragment, V L and V H are encoded by separate genes, they can be isolated using recombinant methods to L and V H The antibody fragments may be linked by a synthetic linker that allows the region to be produced as a single protein chain that pairs to form a monovalent molecule. These are known as single-chain Fvs (scFvs), see, for example, Bird et al., Science 242:423-426 (1988) and Huston et al., Proc. Natl. Acad. Sci. 85:5879-5883 (1988). These antibody fragments are obtained using conventional techniques known to those skilled in the art, and the fragments are screened for utility in the same way as intact antibodies.

[0172] An "isolated antibody" or "isolated antigen binding protein" is one that has been identified and separated and / or recovered from a component of its natural environment. A "synthetic antibody" or "recombinant antibody" is generally produced using recombinant techniques, or using peptide synthesis techniques known to those of skill in the art.

[0173] As used herein, the term "single chain variable fragment" or "scFv" refers to a V H :V L Covalently linked immunoglobulin (e.g., mouse or human) heavy chains (V H ) and light chain (V L) is a fusion protein of the variable regions of the heavy chain (V H ) and light chain (V L ) are directly connected or V H N-terminus of V L and the C-terminus of V H The C-terminus of V L The linker is typically rich in glycine for flexibility and also rich in serine or threonine for solubility. The linker can link the heavy and light chain variable regions of the extracellular antigen-binding domain.

[0174] Despite the removal of the constant region and the introduction of the linker, the scFv protein retains the specificity of the original immunoglobulin. Single-chain Fv polypeptide antibodies can be synthesized by the VFv method, as described by Huston et al. (Proc. Nat. Acad. Sci. USA, 85:5879-5883 (1988)). H and V L The scFvs can be expressed from nucleic acids containing sequences encoding the scFvs. See also U.S. Pat. Nos. 5,091,513, 5,132,405, and 4,956,778, and U.S. Patent Application Publication Nos. 20050196754 and 20050196754. Antagonistic scFvs with inhibitory activity have been described (e.g., Zhao et al., Hybridoma (Larchmt) 27(6):455-51 (2008); Peter et al., J Cachexia Sarcopenia Muscle (2012); Shieh et al., J. Imunol, 183(4):2277-85 (2009); Giomarelli et al., Thromb Haemost, 1999, 141:111-112). 97(6):955-63 (2007); Fife et al., J Clin Invest 116(8):2252-61 (2006); Brocks et al., Immunotechnology 3(3):173-84 (1997); Moosmayer et al., Ther Immunol 2(10):31-40 (1995). Agonistic scFvs with stimulatory activity have been described (see, e.g., Peter et al., J Biol Chem 25278(38):36740-7 (2003); Xie et al., Nat Biotech 15(8):768-71 (1997); Ledbetter et al., Crit Rev Immunol 17(5-6):427-55 (1997); Ho et al., Bio Chim Biophys Acta 1638(3):257-66 (2003)).

[0175] As used herein, "F(ab)" refers to a fragment of an antibody structure that binds to an antigen but is monovalent and does not have an Fc portion; for example, digestion of an antibody with the enzyme papain produces two F(ab) fragments and an Fc fragment (e.g., heavy (H) chain constant region; the Fc region that does not bind to antigen).

[0176] As used herein, "F(ab')2" refers to an antibody fragment produced by pepsin digestion of a whole IgG antibody, which fragment has two antigen-binding (ab') (bivalent) regions, each of which has a distinct antigen-binding domain. 1 The "F(ab')2" region contains two separate amino acid chains, i.e., a portion of the H chain and a light (L) chain linked by an S-S bond to bind the antigen, where the remaining portions of the H chain are linked together. The "F(ab')2" fragment can be split into two individual Fab' fragments.

[0177] As used herein, "CDR" is defined as the complementarity determining region amino acid sequences of an antibody that are the hypervariable regions of the immunoglobulin heavy and light chains. See, e.g., Kabat et al., Sequences of Proteins of Immunological Interest, 4th USDepartment of Health and See, for example, National Institutes of Health, US Department of Health and Human Services (1987). Generally, an antibody contains three heavy chain and three light chain CDRs or CDR regions in the variable region. The CDRs provide the majority of contact residues for the binding of the antibody to the antigen or epitope. In certain embodiments, the CDR regions are represented using the Kabat system (Kabat, EA et al., Sequences of Proteins of Immunological Interest, Fifth Edition, USDepartment of Health and Human Services, NIH Publication No. 91-3242 (1991)).

[0178] As used herein, the term "affinity" refers to a measure of binding strength. Without being bound by theory, affinity is determined by the affinity of the antibody binding site. ) and the antigenic determinant, the size of the contact area between them, and the distribution of charged and hydrophobic groups. Affinity also includes the term "avidity," which refers to the strength of antigen-antibody binding after the formation of a reversible complex (e.g., either monovalent or multivalent). Methods for calculating the affinity of an antibody to an antigen are known in the art and include the use of binding experiments to calculate affinity. Antibody activity in functional assays (e.g., flow cytometry assays) also reflects antibody affinity. Antibodies and affinities can be phenotypically characterized and compared using functional assays (e.g., flow cytometry assays). Nucleic acid molecules useful in the subject matter of the present disclosure include any nucleic acid molecule that encodes a polypeptide or a fragment thereof. In certain embodiments, nucleic acid molecules useful in the subject matter of the present disclosure include nucleic acid molecules that encode an antibody or an antigen-binding portion thereof. Such nucleic acid molecules need not be 100% identical to an endogenous nucleic acid sequence, but typically exhibit substantial identity. A polynucleotide having "substantial homology" or "substantial identity" with an endogenous sequence can typically hybridize with at least one strand of a double-stranded nucleic acid molecule. "Hybridize" refers to a pair that forms a double-stranded molecule between complementary polynucleotide sequences (e.g., genes described herein) or portions thereof under various stringency conditions. (See, for example, Wahl, GM and SL Berger, Methods Enzymol. 152:399 (1987); Kimmel, AR Methods Enzymol. 152:507 (1987)).

[0179] The term "substantially homologous" or "substantially identical" refers to a polypeptide or nucleic acid molecule that exhibits at least 50% or more homology or identity to a reference amino acid sequence (e.g., any one of the amino acid sequences described herein) or nucleic acid sequence (e.g., any one of the nucleic acid sequences described herein). For example, such a sequence is at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 96%, or about 97%, or about 98%, or about 99% homologous or identical at the amino acid level or nucleic acid to the sequence (e.g., a wild-type or naturally occurring sequence) used for comparison. In some embodiments, a substantially homologous or substantially identical polypeptide contains one or more amino acid amino acid substitutions, insertions, or deletions compared to the sequence used for comparison. In some embodiments, substantially homologous or substantially identical polypeptides contain one or more unnatural amino acids or amino acid analogs, including D-amino acids and retroinverso amino acids, to replace the homologous sequences.

[0180] Sequence homology or sequence identity is typically measured using sequence analysis software (e.g., the Sequence Analysis Software Package, BLAST, BESTFIT, GAP or PILEUP / PRETTYBOX programs of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705). Such software matches identical or similar sequences by assigning degrees of homology to various substitutions, deletions and / or other modifications. In an exemplary approach to determining the degree of identity, the BLAST program can be used, e.g. -3 and e-100 A probability score between indicates closely related sequences.

[0181] As used herein, the term "analog" refers to a structurally related polypeptide or nucleic acid molecule that has the function of a reference polypeptide or nucleic acid molecule.

[0182] As used herein, the term "conservative sequence modification" refers to an amino acid modification that does not significantly affect or change the binding properties of an engineered receptor of the present disclosure (e.g., an extracellular antigen-binding domain of an engineered receptor) that contains that amino acid sequence. Conservative modifications can include amino acid substitutions, additions, and deletions. Modifications can be introduced into the human scFv of an engineered receptor of the present disclosure by standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. Amino acids can be classified into groups by physicochemical properties such as charge and polarity. Conservative amino acid substitutions are those in which an amino acid residue is replaced with an amino acid within the same group. For example, amino acids can be classified by charge: positively charged amino acids include lysine, arginine, histidine, negatively charged amino acids include aspartic acid, glutamic acid, and neutrally charged amino acids include alanine, asparagine, cysteine, glutamine, glycine, isoleucine, leucine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. Furthermore, amino acids can be classified by polarity: polar amino acids include arginine (basic polar), asparagine, aspartic acid (acidic polar), glutamic acid (acidic polar), glutamine, histidine (basic polar), lysine (basic polar), serine, threonine and tyrosine, and non-polar amino acids include alanine, cysteine, glycine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan and valine. Thus, one or more amino acid residues in the CDR region can be replaced with other amino acid residues from the same group, and the altered antibody can be tested for retained function (i.e., the function described in (c)-(1) above) using the functional assays described herein. In certain embodiments, no more than 1, no more than 2, no more than 3, no more than 4, no more than 5 residues in a specified sequence or CDR region are altered.

[0183] As used herein, the term "ligand" refers to a molecule that binds to a receptor. In particular, a ligand binds a receptor on another cell, allowing intercellular recognition and / or interaction.

[0184] As used herein, the term "costimulatory signaling domain" or "costimulatory domain" refers to a portion of an engineered receptor that includes the intracellular domain of a costimulatory molecule. A costimulatory molecule is a cell surface molecule other than an antigen receptor or an Fc receptor that, upon binding to an antigen, provides a second signal required for efficient activation and function of T lymphocytes. Examples of such costimulatory molecules include CD27, CD28, 4-1BB (CD137), OX40 (CD134), CD30, CD40, PD-1, ICOS (CD278), LFA-1, CD2, CD7, LIGHT, NKD2C, B7-H2, and ligands that specifically bind CD83. Thus, although the present disclosure provides exemplary costimulatory domains derived from CD28 and 4-1BB, other costimulatory domains are contemplated for use with the engineered receptors described herein. The inclusion of one or more costimulatory signaling domains can enhance the efficacy and expansion of T cells expressing the engineered receptor. The intracellular signaling domain and the costimulatory signaling domain can be linked in tandem in any order to the carboxyl terminus of the transmembrane domain.

[0185] As used herein, the term "chimeric costimulatory receptor" or "CCR" refers to a chimeric receptor that binds to an antigen and provides a costimulatory signal, but does not provide a T cell activation signal.

[0186] The term "bispecific antibody" or "trispecific antibody" refers to an antibody having two different antigen-binding regions (bispecific antibodies) or three different antigen-binding regions (trispecific antibodies). In some embodiments, a bispecific antibody comprises an antibody format (or antibody structure) as disclosed in FIG. 2 of Brinkmann et al., "The making of bispecific antibodies," MABS 9(2): 182-212 (2017) or FIG. 2 of Labrijn et al., "Bispecific antibodies: a mechanistic review of the pipeline," Nature Reviews 18: 585-608 (2019).

[0187] In some embodiments, at least one of the antigen-binding regions of the bispecific or trispecific antibody binds to an activation antigen on immune effector cells. This can be understood as different target binding, but also includes binding to different epitopes in one target. Non-limiting examples of activation antigens include, but are not limited to, CD3, CD2, CD4, CD8, CD19, LFA1, CD45, NKG2D, NKp44, NKp46, NKp30, DNAM, B7-H3 (CD276), CD20, CD22, or combinations thereof. Non-limiting examples of bispecific antibodies include, but are not limited to, CD3xCD19, CD3xGD2, CD3xEphA2, and NKG2DxGD2 antibodies.

[0188] In one embodiment, the dimer comprises a bispecific antibody. Optionally, the dimer comprises a bispecific T cell engager ("BiTE") antibody, a bispecific killer cell engager ("BiKE") antibody, or other bispecific antibodies described herein, such as those associated with different immune cells. In another embodiment, the dimer comprises a trispecific antibody. Optionally, the dimer comprises a trispecific T cell engager ("TriTE") antibody or a trispecific killer cell engager ("TriKE") antibody, or other trispecific antibodies described herein, such as those associated with different immune cells.

[0189] As used herein, the term "bispecific T cell engager" or "BiTE" refers to a bispecific monoclonal antibody that comprises a first antigen-binding fragment that binds to a T cell receptor and a second antigen-binding fragment that binds to a tumor cell via a tumor-specific molecule. As used herein, the term "trispecific T cell engager" ("TiTE" or "TriTE") refers to a trispecific monoclonal antibody that comprises a first antigen-binding fragment that binds to a T cell engager, a second antigen-binding fragment that binds to a tumor cell via a tumor-specific molecule, and a third antigen-binding fragment that binds to a T cell engager or a cytokine T cell activation domain. In one embodiment, the tumor-specific molecule comprises a tumor antigen selected from ephrin type-A receptor 2 (EphA2), interleukin (IL)-13r alpha 2, EGFR VIII, PSMA, EpCAM, GD2 or GD3, fucosyl GM1, PSCA, PLAC1, sarcoma breakpoint, Wilms' tumor 1, alpha fetoprotein (AFP), carcinoembryonic antigen (CEA), CA-125, MUC-1, epithelial tumor antigen (ETA), tyrosinase, melanoma associated antigen (MAGE), blood differentiation antigen, surface glycoprotein, ganglioside (GM2), growth factor receptor, stromal antigen, vascular antigen, receptor tyrosine kinase-like orphan receptor 1 (ROR1), mesothelin, CD38, CD123, human epidermal growth factor receptor 2 (HER2), B-cell maturation antigen (BCMA), fibroblast activation protein (FAP) alpha, or a combination thereof. Examples of BiTEs include, but are not limited to, blinatumomab (MT103) and solitomab (MT110).

[0190] The term "bispecific killer engager" or "BiKE" as used herein refers to a bispecific monoclonal antibody that includes a first antigen-binding fragment that binds to a natural killer (NK) cell engager domain and a second antigen-binding fragment that binds to tumor cells via a tumor-specific molecule. The term "trispecific NK cell engager" ("TiKE" or "TriKE") as used herein refers to a trispecific monoclonal antibody that includes a first antigen-binding fragment that binds to a NK cell engager, a second antigen-binding fragment that binds to tumor cells via a tumor-specific molecule, and a third antigen-binding fragment that binds to a NK cell engager or cytokine NK cell activation domain. The NKG2DxIL21RxGD2 antibody is one exemplary TriKE antibody. Examples of NK cell engager domains include CD16, CD16 + CD2, CD16 + DNAM and CD16 + Examples of cytokine NK activation domains include, but are not limited to, IL-15, IL-12, IL-18, IL-21, or other NK cell enhancing cytokines, chemokines and / or activation molecules. NK engaging domains can include any moiety that binds and / or activates NK cells and / or any moiety that blocks inhibition of NK cells. In some embodiments, NK engaging domains can include antibodies that selectively bind to components on the surface of NK cells. In other embodiments, NK engaging domains can include ligands or small molecules that selectively bind to components on the surface of NK cells.

[0191] In some embodiments, the NK engaging domain can selectively bind to a receptor located at least partially on the surface of an NK cell. In certain embodiments, the NK engaging domain can function to bind an NK cell and thereby bring the NK in spatial proximity to a target to which the targeting domain selectively binds. However, in certain embodiments, the NK engaging domain can selectively bind to a receptor that activates the NK cell, and thus also has an activation function. As described above, activation of the CD16 receptor can induce antibody-dependent cell-mediated cytotoxicity. Thus, in certain embodiments, the NK engaging domain can comprise at least a portion of an anti-CD16 receptor antibody effective to selectively bind to the CD16 receptor. In other embodiments, the NK engager cell domain can interfere with mechanisms that inhibit NK cells. In such embodiments, the NK engager domain can comprise, for example, anti-PDl / PDLl, anti-NKG2A, anti-TIGIT, anti-killer immunoglobulin receptor (KIR), and / or any other inhibitory blocking domain.

[0192] In certain embodiments, cells are genetically modified (including immune cells) with engager molecules that contain at least an antigen recognition domain and an activation domain, and optionally contain domains for inhibition of cytokines, costimulatory domains and / or negative regulatory molecules of T cell activation. The antigen recognition domain of the engager molecule binds to one or more molecules present in and / or on the target cell or secreted by the target cell. In certain embodiments, the target cell is a cancer cell, including at least a solid tumor cell. When the engager molecule binds the target molecule, the engager molecule can activate cells that express the molecule recognized by the activation domain. The engager molecule can activate cells that have been genetically modified with the engager molecule, or can activate cells that have not been modified.

[0193] Depending on the desired effect, activation can result in positive or negative signals.Examples of positive signals include signals that induce cell proliferation, cytokine secretion or cytolytic activity.Examples of negative signals include signals that inhibit T cell proliferation, inhibit secretion of immunosuppressive factors or induce cell death.

[0194] In certain embodiments, immune cells that secrete engager molecules can redirect resident (naturally present in a particular individual) immune cells towards cancer cells.

[0195] Embodiments of the present disclosure provide for the delivery of engineered immune cells that secrete engager molecules to an individual (known to have or suspected to have cancer, including certain cancers) in need of such delivery, as opposed to delivering engager molecules only to the individual themselves (in the absence of production by the engineered immune cells). In the present disclosure, the individual receives engineered immune cells that enable the production of engager molecules. In certain embodiments, the cells produce immune stimulatory cytokines, proliferate in an antigen-specific manner, kill appropriate target cells, redirect bystander immune cells (including at least T cells or NK cells) to cancer cells, secrete engager molecules upon activation, and / or are effective locoregionally or systemically against cancer. Figure 3 shows examples of engineered T cells or NK cells that secrete engager molecules. Certain T cells or NK cells may produce engagers that can target the same cancer cell-specific antigens, but the activation domains for the T cells or NK cells must be different because NK cells do not express CD3. Examples of activation domains for NK cells include, for example, at least CD16, NKG2D, or NKp30.

[0196] Gene delivery vehicles also include DNA / liposome complexes, micelles, and targeted viral protein-DNA complexes. Liposomes that also contain targeting antibodies or fragments thereof can be used in the methods disclosed herein. In addition to the delivery of polynucleotides to cells or cell populations, the proteins described herein can be directly introduced into cells or cell populations by non-limiting techniques of protein transfection, or culture conditions that can enhance the expression and / or increase the activity of the proteins disclosed herein are other non-limiting techniques.

[0197] As used herein, the term "signal peptide" or "signal polypeptide" refers to an amino acid sequence that is usually present at the N-terminal end of newly synthesized secretory or membrane polypeptides or proteins. "Signal peptide" or "signal polypeptide" acts to guide a polypeptide to a specific cellular location, for example, across the cell membrane, into the cell membrane, or into the nucleus. In some embodiments, the signal peptide is removed after localization. Examples of signal peptides are well known in the art. Non-limiting examples are those described in U.S. Patent Nos. 8,853,381, 5,958,736, and 8,795,965.

[0198] As used herein, the term "viral capsid" or "capsid" refers to the proteinaceous shell or coat of a viral particle. The capsid functions to encapsidate, protect, transport, and release the viral genome into the host cell. Capsids are generally composed of oligomeric structural subunits of proteins ("capsid proteins"). As used herein, the term "encapsidated" means enclosed within a viral capsid.

[0199] As used herein, the term "helper" with respect to a virus or plasmid refers to a virus or plasmid that is used to provide additional components required for the replication and packaging of a viral particle or recombinant viral particle, such as the modified AAV disclosed herein. The components encoded by the helper virus may include any genes required for virion assembly, encapsidation, genome replication and / or packaging. For example, the helper virus may encode an enzyme required for the replication of the viral genome. Non-limiting examples of helper viruses and plasmids suitable for use with AAV constructs include pHELP (plasmid), adenovirus (virus) or herpesvirus (virus).

[0200] As used herein, the term "AAV" is the standard abbreviation for adeno-associated virus. Adeno-associated virus is a single-stranded DNA parvovirus that grows only in cells that are provided with specific functions by a co-infecting helper virus. General information and reviews of AAV can be found, for example, in Carter, 1989, Handbook of Parvoviruses, Vol.1, pp.169-228 and Berns, 1990, Virology, pp.1743-1764, Raven Press, (New York). It is well known that various serotypes are very closely related, both structurally and functionally, even at the genetic level, so it is fully expected that the same principles described in these reviews can be applied to additional AAV serotypes that have been characterized after the publication date of these reviews. (See, e.g., Blacklowe, 1988, pp. 165-174 of Parvoviruses and Human Disease, J.R. Puttison, ed.; and Rose, Comprehensive Virology 3:1-61 (1974).) For example, all AAV serotypes apparently exhibit very similar replication properties mediated by homologous rep genes, and all possess three related capsid proteins, such as those expressed in AAV2. The degree of relatedness is further suggested by heteroduplex analysis revealing extensive cross-hybridization between serotypes along the length of the genome, and the presence at the ends of similar self-annealing segments that correspond to "inverted terminal repeats" (ITRs). Similar infectivity patterns also suggest that the replication functions in each serotype are under similar regulatory control.

[0201] As used herein, "AAV vector" refers to a vector that contains one or more polynucleotides of interest (or transgenes) flanked by AAV terminal repeats (ITRs). Such AAV vectors can be replicated and packaged into infectious viral particles when present in a host cell transfected with a vector that encodes and expresses the rep and cap gene products.

[0202] "AAV virion" or "AAV virus particle" or "AAV vector particle" refers to a virus particle that is composed of at least one AAV capsid protein and a polynucleotide AAV vector enclosed in the capsid.When the particle contains a heterologous polynucleotide (i.e., a polynucleotide other than the wild-type AAV genome, such as a transgene to be delivered to mammalian cells), it is usually referred to as "AAV vector particle" or simply "AAV vector".Therefore, since such vector is contained within the AAV vector particle, the production of the AAV vector particle necessarily includes the production of the AAV vector.

[0203] In some embodiments, AAV is a replication-deficient parvovirus, whose single-stranded DNA genome is about 4.7 kb long, including two 145-nucleotide inverted terminal repeats (ITRs). There are multiple serotypes of AAV. The nucleotide sequences of the genomes of AAV serotypes are known. For example, the complete genome of AAV-1 is provided under GenBank Accession No. NC_002077. The complete genome of AAV-2 is provided under GenBank Accession No. NC_001401 and Srivastava et al., J. Virol., 45:555-564 (1983). The complete genome of AAV-3 is provided under GenBank Accession No. NC_1829. The complete genome of AAV-4 is provided under GenBank Accession No. NC_001829. The AAV-5 genome is provided under GenBank Accession No. AF085716. The complete genome of AAV-6 is provided under GenBank Accession No. NC_00 1862. At least a portion of the AAV-7 and AAV-8 genomes are provided under GenBank accession numbers AX753246 and AX753249, respectively. The AAV-9 genome is provided in Gao et al., J. Virol., 78:6381-6388 (2004). The AAV-10 genome is provided in Mol. Ther., 13(1):67-76 (2006). The AAV-11 genome is provided in Virology, 330(2):375-383 (2004). The sequence of the AAV rh.74 genome is provided in U.S. Patent No. 9,434,928, which is incorporated herein by reference. U.S. Patent No. 9,434,928 also provides the sequences of capsid proteins and self-complementary genomes. In one embodiment, the genome is a self-complementary genome. Cis-acting sequences that direct viral DNA replication (rep), encapsidation / packaging, and host cell chromosomal integration are contained within the AAV ITRs. Three AAV promoters (designated p5, p19, and p40 for their relative map positions) drive expression of two AAV internal open reading frames encoding the rep and cap genes.Two rep promoters (p5 and pi9), coupled with alternative splicing of a single AAV intron (at nucleotides 2107 and 2227), result in the production of four rep proteins (rep78, rep68, rep52 and rep40) from the rep gene. The Rep proteins have multiple enzymatic properties that are ultimately involved in the replication of the viral genome. The cap gene is expressed from the p40 promoter and encodes the three capsid proteins VP1, VP2 and VP3. Alternative splicing and non-consensus translation initiation sites are responsible for the production of the three related capsid proteins. A single consensus polyadenylation site is located at map position 95 of the AAV genome. The life cycle and genetics of AAV are reviewed in Muzyczka, Current Topics in Microbiology and Immunology, 158:97-129 (1992).

[0204] AAV possesses unique features that make it attractive as a vector for delivering foreign DNA to cells, for example in gene therapy. AAV infection of cells in culture is noncytotoxic, and natural infection of humans and other animals is asymptomatic and symptomless. In addition, AAV can infect many mammalian cells and target many different tissues in vivo. Furthermore, AAV can transduce slowly dividing and non-dividing cells and persist as transcriptionally active nuclear episomes (extrachromosomal elements) for essentially the lifetime of these cells. The AAV proviral genome is inserted as cloned DNA in a plasmid, making the construction of recombinant genomes feasible. Furthermore, because signals directing AAV replication and genome encapsidation are contained within the ITRs of the AAV genome, some or all of the internal approximately 4.3 kb of the genome (encoding the replication and structural capsid protein, rep-cap) can be replaced with foreign DNA. To generate AAV vectors, the rep and cap proteins can be provided in trans. Another important feature of AAV is that it is a highly stable and robust virus. AAV readily survives the conditions used to inactivate adenovirus (56°-65°C for several hours), making cryopreservation of AAV less important. AAV can even be lyophilized. Finally, cells infected with AAV are not resistant to superinfection.

[0205] Several studies have demonstrated long-term (>1.5 years) recombinant AAV-mediated protein expression in muscle. See Clark et al., Hum Gene Ther, 8:659-669 (1997); Kessler et al., Proc Nat. Acad Sc. USA, 93:14082-14087 (1996); and Xiao et al., J Virol, 70:8098-8108 (1996). See also Chao et al., Mol Ther, 2:619-623 (2000) and Chao et al., Mol Ther, 4:217-222 (2001). Furthermore, because muscle is highly vascularized, recombinant AAV transduction resulted in the appearance of the transgene product in the systemic circulation after intramuscular injection, as described by Herzog et al., Proc Natl Acad Sci USA, 94:5804-5809 (1997) and Murphy et al., Proc Natl Acad Sci USA, 94:13921-13926 (1997). Furthermore, Lewis et al., J Virol, 76:8769-8775 (2002) demonstrated that skeletal muscle fibers possess the cellular factors necessary for correct antibody glycosylation, folding and secretion, indicating that muscle is capable of stable expression of secreted protein therapeutics. The AAV DNA in the rAAV genome can be derived from any AAV serotype from which recombinant virus can be derived, including but not limited to AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV PHP.B, AAVrh74 and AAV-DJ. The production of pseudotyped rAAV is disclosed, for example, in WO 01 / 83692. Other types of rAAV variants are also contemplated, such as rAAV with capsid mutations. See, for example, Marsic et al., Molecular Therapy, 22(11):1900-1909 (2014). The nucleotide sequences of the genomes of various AAV serotypes are known in the art.

[0206] As used herein, the term "external" with respect to a viral capsid protein refers to a surface, domain, region or end of the capsid protein that faces outward in an assembled viral capsid. The term "internal" with respect to a viral capsid protein refers to a surface, domain, region or end (amino or carboxyl) of the capsid protein that faces inward in an assembled viral capsid. When used with respect to an assembled viral capsid, the term "internal" refers to the capsid-enclosed space inside the viral capsid and the capsid's inward-facing surface that is exposed to the enclosed space. The internal space is enclosed in the capsid by the viral capsid protein and may contain nucleic acid such as the viral genome, viral proteins, host or packaging cell proteins, and any other components or factors that are packaged or encapsidated during replication, virion assembly, encapsidation and / or packaging.

[0207] As used herein, the term "label" refers to a directly or indirectly detectable compound or composition that is directly or indirectly conjugated to a composition to be detected, e.g., a protein such as a polynucleotide or an antibody, to generate a "labeled" composition. The term also includes sequences conjugated to a polynucleotide that provide a signal upon expression of the inserted sequence, such as green fluorescent protein (GFP). The label may be detectable alone (e.g., radioisotope labels or fluorescent labels) or, in the case of an enzymatic label, may catalyze a chemical change in a substrate compound or composition that is detectable. The label may be suitable for small-scale detection or may be more suitable for high-throughput screening. Thus, suitable labels include, but are not limited to, radioisotopes, fluorescent dyes, chemiluminescent compounds, dyes, and proteins, including enzymes. The label may be simply detected or quantified. A response that is simply detected generally includes a response whose presence is merely confirmed, whereas a response that is quantified generally includes a response that has a quantifiable (e.g., numerically reportable) value, such as intensity, polarization, and / or other property. In luminescent or fluorescent assays, the detectable response can be generated directly, using a luminophore or fluorophore associated with the assay component actually responsible for binding, or indirectly, using a luminophore or fluorophore associated with another (e.g., reporter or indicator) component.

[0208] Examples of luminescent labels that generate signals include, but are not limited to, bioluminescence and chemiluminescence. Detectable luminescent responses generally include the change or generation of a luminescent signal. Suitable methods and luminophores for luminescent labeling of assay components are known in the art and are described, for example, in Haugland, Richard P. (1996) Handbook of Fluorescent Probes and Research Chemicals (6th ed.). Examples of luminescent probes include, but are not limited to, aequorin and luciferase.

[0209] Examples of suitable fluorescent labels include, but are not limited to, fluorescein, rhodamine, tetramethylrhodamine, eosin, erythrosine, coumarin, methylcoumarin, pyrene, Malachite Green, stilbene, Lucifer Yellow, Cascade Blue™, and Texas Red. Other suitable optical dyes are described in Haugland, Richard P. (1996) Handbook of Fluorescent Probes and Research Chemicals (6th ed.).

[0210] In another embodiment, the fluorescent label is functionalized to facilitate covalent binding to cellular components present in or on the surface of cells or tissues, such as cell surface markers.Suitable functional groups include, but are not limited to, isothiocyanate groups, amino groups, haloacetyl groups, maleimides, succinimidyl esters, and sulfonyl halides, all of which can be used to attach the fluorescent label to a second molecule.The choice of functional group of the fluorescent label depends on the site of attachment to either linker, drug, marker, or second labeling agent.

[0211] Fluorescent labels can be attached directly to the cellular component or compound or via a linker. Binding pairs suitable for use in indirectly linking fluorescent labels to intermediates include, but are not limited to, antigen / antibody, e.g., rhodamine / anti-rhodamine, biotin / avidin and biotin / streptavidin.

[0212] The term "solid support" refers to a non-aqueous surface such as a "culture plate", "gene chip" or "microarray". Such gene chips or microarrays can be used for diagnostic and therapeutic purposes by many techniques known to those skilled in the art. In one technique, oligonucleotides are attached and arranged on the gene chip to determine DNA sequences by hybridization approaches, such as those outlined in U.S. Pat. Nos. 6,025,136 and 6,018,041. The polynucleotides of the invention can be modified into probes, which can then be used to detect gene sequences. Such techniques are described, for example, in U.S. Pat. Nos. 5,968,740 and 5,858,659. Probes can also be attached or affixed to electrode surfaces for electrochemical detection of nucleic acid sequences, as described by Kayem et al., U.S. Pat. No. 5,952,172 and Kelley et al., (1999) Nucleic Acids Res. 27:4830-4837.

[0213] A "composition" is intended to mean a combination of an active polypeptide, polynucleotide or antibody with another compound or composition, inert (e.g., a detectable label) or active (e.g., a gene delivery vehicle).

[0214] A "pharmaceutical composition" is intended to include a combination of an active polynucleotide, polynucleotide or antibody with an inert or active carrier, such as a solid support, making the composition suitable for in vitro, in vivo or ex vivo diagnostic or therapeutic use.

[0215] As used herein, the term "pharmaceutical acceptable carrier" includes any of the standard pharmaceutical carriers, such as phosphate buffered saline solution, water, and emulsions, such as oil / water or water / oil emulsions, as well as various types of wetting agents. The composition may also include stabilizers and preservatives. For examples of carriers, stabilizers and adjuvants, see Martin (1975) Remington's Pharm.Sci., 15th Ed. (Mack Publ.Co., Easton).

[0216] As used herein, the term "cancer" includes solid tumors and hematological malignancies. Exemplary solid tumors include, but are not limited to, bladder cancer, bone cancer, brain cancer (e.g., glioblastoma), breast cancer, colorectal cancer, esophageal cancer, eye cancer, head and neck cancer, kidney cancer, lung cancer, melanoma, mesothelioma, ovarian cancer, pancreatic cancer, prostate cancer, or gastric cancer. Exemplary hematological malignancies include acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), follicular lymphoma (FL), diffuse large B-cell lymphoma (DLBCL), mantle cell lymphoma (MCL), Waldenstrom's macroglobulinemia, multiple myeloma, extranodal marginal zone B-cell lymphoma, nodal marginal zone B-cell lymphoma, Burkitt's lymphoma, non-Burkitt's high lymphoma, and leukemia. The cancer includes, but is not limited to, aggressive B-cell lymphoma, primary mediastinal B-cell lymphoma (PMBL), immunoblastic large cell lymphoma, precursor B-lymphoblastic lymphoma, B-cell prolymphocytic leukemia, lymphoplasmacytic lymphoma, splenic marginal zone lymphoma, plasma cell myeloma, plasmacytoma, mediastinal (thymic) large B-cell lymphoma, intravascular large B-cell lymphoma, primary effusion lymphoma, or lymphomatoid granulomatosis. In some cases, the cancer is a metastatic cancer (e.g., a metastatic solid tumor or a metastatic hematological malignancy). In some cases, the cancer is a recurrent or refractory cancer (e.g., a recurrent or refractory solid tumor or a recurrent or refractory hematological malignancy).

[0217] In some embodiments, the cancer is characterized by upregulated expression of fibroblast activation protein (FAP) (the amino acid sequence of human FAP is disclosed in GenPept Accession No. I38593, accessed February 10, 2020). FAP, also known as FAP-alpha and prolyl endopeptidase FAP, is a membrane-bound glycoprotein and part of the dipeptidyl peptidase (DPP) family. FAP has both post-proline exopeptidase and gelatinase activity. In some cases, cancers characterized by upregulated expression of FAP (FAP-positive cancers) include, but are not limited to, bone cancer, brain cancer, breast cancer, colorectal cancer, esophageal cancer, gastric cancer, liver cancer, lung cancer, oral cancer, ovarian cancer, pancreatic cancer, parathyroid cancer, and kidney cancer. In some cases, FAP-positive cancers include high levels of fibrosis. In some cases, this level is compared to a comparable cancer in which FAP is not upregulated. In a further example, the level is compared to the level of fibrosis in a normal subject.

[0218] In some cases, the dimer described herein binds to the extracellular portion of FAP-alpha. In some cases, the dimer binds to human FAP-alpha (e.g., to the extracellular portion of FAP-alpha having GenPept accession number I38593 or its equivalent). In some cases, the dimer binds to FAP-alpha and to an immune cell target, for example, a cell surface polypeptide expressed on T cells or NK cells. In some cases, the dimer binds to FAP-alpha and optionally to an immune cell target (e.g., a cell surface polypeptide expressed on T cells or NK cells) for the treatment of FAP-positive cancer, optionally pancreatic cancer, and optionally FAP-positive cancer characterized by high levels of fibrosis.

[0219] In some embodiments, the cancer is characterized by expression and / or upregulation of B-cell maturation antigen (BCMA) (also known as tumor necrosis factor receptor superfamily member 17, TNFRSF17 and BCM), a cell surface receptor of the TNF receptor superfamily. In some cases, the amino acid sequence of human BCMA is disclosed in GenPept Accession No. BAB60895.1 (accessed February 10, 2020). In some cases, the cancer characterized by expression and / or upregulation of BCMA is myeloma (or multiple myeloma).

[0220] In some cases, the dimer described herein binds to the extracellular portion of BCMA. In some cases, the dimer binds to human BCMA (e.g., the extracellular portion of BCMA having GenPept accession number BAB60895.1 or its equivalent). In some cases, the dimer binds to BCMA and an immune cell target, such as a cell surface polypeptide expressed on T cells or NK cells. In some cases, the dimer binds to BCMA and optionally to an immune cell target (e.g., a cell surface polypeptide expressed on T cells or NK cells) for the treatment of myeloma.

[0221] In some embodiments, the cancer is characterized by expression or upregulation of epidermal growth factor receptor (EGFR) variants, such as EGFR variant III (EGFRvIII). EGFRvIII refers to a mutation in EGFR that includes a deletion of exons 2-7 of the EGFR gene. In some cases, cancers characterized by expression or upregulation of EGFRvIII (EGFRvIII-positive cancers) include, but are not limited to, glioblastoma, bladder cancer, breast cancer, colorectal cancer, esophageal cancer, head and neck squamous cell carcinoma (HNSCC), lung cancer, melanoma, ovarian cancer, peripheral nerve sheath tumor (PNST), prostate cancer, sarcoma, and thyroid cancer.

[0222] In some cases, the dimer described herein binds to the extracellular portion of EGFRvIII. In some cases, the dimer binds to the extracellular portion of human EGFRvIII. In some cases, the dimer binds to EGFRvIII and immune cell target, for example, cell surface polypeptide expressed on T cells or NK cells. In some cases, the dimer binds to EGFRvIII and optionally binds to immune cell target (for example, cell surface polypeptide expressed on T cells or NK cells) for treating EGFRvIII-positive cancer, optionally glioblastoma.

[0223] In some embodiments, the cancer is characterized by upregulation of human epidermal growth factor receptor 2 (HER2), also known as HER2 / neu, receptor tyrosine-protein kinase erbB-2, CD340, and ERBB2. In some cases, the amino acid sequence of human HER2 is disclosed in GenPept Accession No. NP-004439.2 (accessed February 10, 2020). In some cases, HER2-positive cancers include, but are not limited to, breast cancer, ovarian cancer, gastric cancer, colorectal cancer, pancreatic cancer, and endometrial cancer.

[0224] In some cases, the dimer described herein binds to the extracellular portion of HER2. In some cases, the dimer binds to the extracellular portion of human HER2 (e.g., comprising the amino acid sequence shown in GenPept Accession No. NP-004439.2 or its equivalent). In some cases, the dimer binds to HER2 and an immune cell target, for example, a cell surface polypeptide expressed on T cells or NK cells. In some cases, the dimer binds to HER2 and optionally binds to an immune cell target (e.g., a cell surface polypeptide expressed on T cells or NK cells) for the treatment of HER2-positive cancer, optionally breast cancer.

[0225] In some embodiments, the cancer is characterized by upregulation of CD123, also known as interleukin-3 receptor or IL-3RA. In some cases, the amino acid sequence of human CD123 is disclosed in GenPept Accession No. NP_002174.1 (accessed February 10, 2020). In some cases, CD123-positive cancers include, but are not limited to, acute myeloid leukemia (AML), acute lymphocytic leukemia (ALL), blastic plasmocytoid dendritic cell neoplasm, and hairy cell leukemia.

[0226] In some cases, the dimer described herein binds to the extracellular portion of CD123. In some cases, the dimer binds to the extracellular portion of human CD123 (e.g., comprising the amino acid sequence shown in GenPept Accession No. NP-002174.1 or its equivalent). In some cases, the dimer binds to CD123 and to an immune cell target, for example, a cell surface polypeptide expressed on T cells or NK cells. In some cases, the dimer binds to CD123 and optionally to an immune cell target (e.g., a cell surface polypeptide expressed on T cells or NK cells) for the treatment of CD123-positive cancer, optionally AML.

[0227] In some embodiments, the cancer is characterized by upregulation of CD38, also known as ADP-ribosyl cyclase 1 or ADPRC1. In some cases, the amino acid sequence of human CD38 is disclosed in GenPept Accession No. BAA18966.1 (accessed February 10, 2020). In some cases, CD38-positive cancers include, but are not limited to, multiple myeloma, acute myeloid leukemia, prostate cancer, and lung cancer.

[0228] In some cases, the dimer described herein binds to the extracellular portion of CD38. In some cases, the dimer binds to the extracellular portion of human CD38 (e.g., comprising the amino acid sequence shown in GenPept Accession No. BAA18966.1 or its equivalent). In some cases, the dimer binds to CD38 and an immune cell target, for example, a cell surface polypeptide expressed on T cells or NK cells. In some cases, the dimer binds to CD38 and optionally binds to an immune cell target (e.g., a cell surface polypeptide expressed on T cells or NK cells) for the treatment of CD38-positive cancer, optionally AML.

[0229] In some embodiments, the cancer is characterized by upregulation of mesothelin (also known as MSLN). In some cases, the amino acid sequence of human mesothelin is disclosed in GenPept Accession No. AAV87530.1 (accessed February 10, 2020). In some cases, mesothelin-positive cancers include, but are not limited to, mesothelioma, pancreatic cancer, ovarian cancer, endometrial cancer, bile duct cancer, gastric cancer, lung adenocarcinoma, and childhood acute myeloid leukemia.

[0230] In some cases, the dimer described herein binds to the extracellular portion of mesothelin. In some cases, the dimer binds to the extracellular portion of human mesothelin (e.g., comprising the amino acid sequence shown in GenPept Accession No. AAV87530.1 or an equivalent thereof). In some cases, the dimer binds to mesothelin and an immune cell target, such as a cell surface polypeptide expressed on a T cell or NK cell. In some cases, the dimer binds to mesothelin and optionally binds to an immune cell target (e.g., a cell surface polypeptide expressed on a T cell or NK cell) for the treatment of mesothelin-positive cancer, optionally mesothelioma.

[0231] In some embodiments, the cancer is characterized by upregulation of interleukin-13 receptor alpha (IL13Ralpha). In some cases, IL13Ralpha includes IL13Ralpha1 (IL13Rα1) and IL13Ralpha2 (IL13Rα2). In some cases, the amino acid sequence of human IL13Rα1 is disclosed in GenPept Accession No. P78552.1 (accessed February 10, 2020). In some cases, the amino acid sequence of human IL13Rα2 is disclosed in GenPept Accession No. Q14627.1 (accessed February 10, 2020). In some cases, IL13Ralpha positive cancers include, but are not limited to, brain cancers (e.g., glioblastoma) and renal cell carcinoma (RCC).

[0232] In some cases, the dimer described herein binds to the extracellular portion of IL13R alpha. In some cases, the dimer binds to the extracellular portion of human IL13R alpha (e.g., comprising the amino acid sequence shown in GenPept Accession Nos. P78552.1, Q14627.1 or equivalents). In some cases, the dimer binds to IL13R alpha and an immune cell target, e.g., a cell surface polypeptide expressed on T cells or NK cells. In some cases, the dimer binds to IL13R alpha and optionally binds to an immune cell target (e.g., a cell surface polypeptide expressed on T cells or NK cells) for the treatment of IL13R alpha positive cancer, optionally brain cancer.

[0233] In some embodiments, the cancer is characterized by upregulation of B7-H3, also known as CD276, an immune checkpoint member. In some cases, the amino acid sequence of human B7-H3 is disclosed in GenPept Accession No. CAE47548.1 (accessed February 10, 2020). In some cases, B7-H3 positive cancers include, but are not limited to, lung cancer (e.g., non-small cell lung cancer), breast cancer, prostate cancer, renal cell carcinoma, brain cancer, pancreatic cancer, kidney cancer, gastric cancer, ovarian cancer, melanoma, and thyroid cancer.

[0234] In some cases, the dimer described herein binds to the extracellular portion of B7-H3. In some cases, the dimer binds to the extracellular portion of human B7-H3 (e.g., comprising the amino acid sequence shown in GenPept Accession No. CAE47548.1 or an equivalent thereof). In some cases, the dimer binds to B7-H3 and a T cell or NK cell target, e.g., a cell surface polypeptide expressed on a T cell or NK cell. In some cases, the dimer binds to B7-H3 and optionally binds to a T cell or NK cell target (e.g., a cell surface polypeptide expressed on a T cell or NK cell) for the treatment of B7-H3 positive cancer, optionally lung cancer (e.g., non-small cell lung cancer), breast cancer, prostate cancer, renal cell carcinoma, brain cancer, pancreatic cancer, kidney cancer, gastric cancer, ovarian cancer, melanoma or thyroid cancer.

[0235] In some embodiments, the cancer is characterized by upregulation of receptor tyrosine kinase-like orphan receptor 1 (ROR1), also known as neurotrophic tyrosine kinase, receptor-related 1 or NTRKR1. In some cases, the amino acid sequence of human ROR1 is disclosed in GenPept Accession No. NP_005003 (accessed February 10, 2020). In some cases, ROR1-positive cancers include, but are not limited to, breast cancer, lung cancer, gastric cancer, ovarian cancer, chronic lymphocytic leukemia (CLL) and acute lymphocytic leukemia (ALL).

[0236] In some cases, the dimer described herein binds to an extracellular portion of ROR1. In some cases, the dimer binds to an extracellular portion of human ROR1 (e.g., comprising the amino acid sequence shown in GenPept Accession No. NP_005003 or an equivalent thereof). In some cases, the dimer binds to ROR1 and an immune cell target, e.g., a cell surface polypeptide expressed on T cells or NK cells. In some cases, the dimer binds to ROR1 and optionally binds to an immune cell target (e.g., a cell surface polypeptide expressed on T cells or NK cells) for the treatment of ROR1-positive cancer, optionally breast cancer, lung cancer, gastric cancer, ovarian cancer, CLL or ALL.

[0237] In some embodiments, the cancer is characterized by upregulation of ephrin type A receptor 2 (EphA2), also known as EPH receptor A2, tyrosine-protein kinase receptor ECK, or epithelial cell receptor protein tyrosine kinase. In some cases, the amino acid sequence of human EphA2 is disclosed in GenPept Accession No. NP_004422.2 (accessed February 10, 2020). In some cases, EphA2-positive cancers include, but are not limited to, breast cancer, bladder cancer, prostate cancer, skin cancer, lung cancer, ovarian cancer, brain cancer, mesothelioma, thyroid cancer, colorectal cancer, gastric cancer, esophageal cancer, endometrial cancer, cervical cancer, pancreatic cancer, melanoma, renal cell carcinoma, and liver cancer.

[0238] In some cases, the dimer described herein binds to the extracellular portion of EphA2. In some cases, the dimer binds to the extracellular portion of human EphA2 (e.g., comprising the amino acid sequence shown in GenPept Accession No. NP_004422.2 or its equivalent). In some cases, the dimer binds to EphA2 and to an immune cell target, for example, a cell surface polypeptide expressed on T cells or NK cells. In some cases, the dimer binds to EphA2 and optionally to an immune cell target (e.g., a cell surface polypeptide expressed on T cells or NK cells) for treating EphA2-positive cancer, optionally breast cancer, bladder cancer, prostate cancer, skin cancer, lung cancer, ovarian cancer, brain cancer, mesothelioma, thyroid cancer, colorectal cancer, gastric cancer, esophageal cancer, endometrial cancer, cervical cancer, pancreatic cancer, melanoma, renal cell cancer or liver cancer.

[0239] In some embodiments, the cancer is B-cell leukemia or B-cell lymphoma. Exemplary B-cell leukemias include B-cell chronic lymphocytic leukemia (or B-cell small lymphocytic lymphoma); acute lymphoblastic leukemia, mature B-cell type; B-cell prolymphocytic leukemia; precursor B-lymphoblastic leukemia; and hairy cell leukemia. In some cases, B-cell leukemia, B-cell lymphoma, or a combination thereof, is characterized by elevated expression of CD20 and / or CD22 on B cells. In some cases, the dimer described herein binds to CD20 or CD22. In some cases, the dimer binds to CD20 expressed on B cells. In some cases, the dimer binds to CD22 expressed on B cells. In some cases, the dimer further binds to another cellular target, such as a cell surface polypeptide expressed on a cancer cell or a cell surface polypeptide expressed on a T cell or NK cell. In some cases, the dimer binds to CD20 or CD22 and optionally to another cellular target (e.g., a cell surface polypeptide expressed on a cancer cell or a cell surface polypeptide expressed on a T cell or NK cell) for the treatment of B cell leukemia or B cell lymphoma.

[0240] As used herein, "first line treatment" includes primary treatment for a subject, optionally a subject with cancer. In some cases, in the context of cancer, the cancer is a primary cancer. In other cases, the cancer is a metastatic or recurrent cancer. In some cases, the first line treatment includes chemotherapy. In other cases, the first line treatment includes radiation therapy. Those skilled in the art will readily appreciate that different first line treatments may be applicable to different types of cancer.

[0241] As used herein, second line therapy includes treatment utilized after cessation of primary or first line treatment. Third line, fourth line or fifth line therapy includes subsequent treatment. As indicated by naming convention, third line therapy includes the course of treatment when primary and second line therapy are discontinued.

[0242] The "subject" of diagnosis or treatment is a cell or an animal, such as a mammal, or a human. The subject is not limited to a particular species, and includes non-human animals that are the subject of diagnosis or treatment, those that are subject to infection, or animal models, such as monkeys, rats, mice, murines such as chinchillas, canines such as dogs, lagomorphs such as rabbits, farm animals, sport animals, and pets. Human patients are also included in this term.

[0243] The term "tissue" is used herein to refer to tissue of a living or dead organism, or any tissue derived from or designed to mimic a living or dead organism. Tissues may be healthy, diseased, and / or have genetic mutations. Biological tissues may include any single tissue (e.g., a collection of cells that may be interconnected), or a group of tissues that make up an organ or part or region of an organism's body. Tissues may include homogenous cellular material, or tissues may be composite structures such as those found in regions of the body including the chest, which may include, for example, lung tissue, skeletal tissue, and / or muscle tissue. Exemplary tissues include, but are not limited to, tissues derived from the liver, lung, thyroid, skin, pancreas, blood vessels, bladder, kidney, brain, bile duct, duodenum, abdominal aorta, iliac vein, heart, and intestine (including any combination thereof).

[0244] As used herein, the terms "specifically binds" or "specifically binds" or "specifically targets" refer to a polypeptide or fragment thereof that recognizes and binds to a biological molecule of interest (e.g., a polypeptide) but does not substantially recognize or bind to other molecules in a sample, e.g., a biological sample, that contains or expresses a tumor antigen.

[0245] As used herein, "treating" a disease in a subject or "treatment" of a disease in a subject refers to (1) preventing a symptom or disease from occurring in a subject who is predisposed to or has not yet shown symptoms of the disease, (2) arresting or halting the development of the disease, or (3) alleviating a disease or a symptom of the disease or causing a regression of the disease or a symptom of the disease. As understood in the art, "treatment" is an approach to obtain a beneficial or desired result, including a clinical result. In the present technology, a beneficial or desired result can include, but is not limited to, one or more of the following: alleviation or reduction of one or more symptoms, reduction in the severity of a condition (including a disease), a stabilized (i.e., non-worsening) status of a condition (including a disease), a delay or slowdown of a condition (including a disease), progression, reduction or remission, status and remission (whether partial or complete) of a condition (including a disease), whether detectable or undetectable. In one embodiment, the term "treatment" excludes prevention.

[0246] As used herein, the term "effective amount" is intended to mean an amount sufficient to achieve a desired effect. In the context of therapeutic or prophylactic applications, the effective amount depends on the type and severity of the condition in question, as well as the characteristics of the individual subject, such as general health, age, sex, weight, and tolerance to pharmaceutical compositions. In the context of gene therapy, in some embodiments, the effective amount is an amount sufficient to cause partial or complete restoration of function of a gene that is missing in a subject. In other embodiments, an effective amount of a recombinant polynucleotide, vector, or AAV viral particle is an amount sufficient to cause expression of a gene in a subject. In some embodiments, the effective amount is the amount required to increase galactose metabolism in a subject in need of increased galactose metabolism. Those skilled in the art can determine the appropriate amount depending on these and other factors.

[0247] In some embodiments, the effective amount depends on the size and nature of the application in question.The effective amount also depends on the nature and sensitivity of the target subject and the method used.Those skilled in the art can determine the effective amount based on these and other considerations.The effective amount may include one or more administrations of the composition depending on the embodiment.

[0248] As used herein, the term "administer" or "administration" is intended to mean the delivery of a substance to a subject, such as an animal or human. Administration can be performed in one dose, continuously or intermittently throughout the course of treatment. Methods for determining the most effective means and dosage of administration are known to those skilled in the art and vary with the composition used for treatment, the purpose of the treatment, and the age, health, or sex of the subject being treated. Single or multiple administrations can be performed, with the dose level and pattern being selected by the treating physician or, in the case of pets and animals, by the treating veterinarian. Appropriate dosage formulations and methods for administering drugs are known in the art. Routes of administration can also be determined, and methods for determining the most effective route of administration are known to those skilled in the art and vary with the composition used for treatment, the purpose of the treatment, the health or disease stage of the subject being treated, and the target cell or tissue. Non-limiting examples of routes of administration include intravenous, intraarterial, intramuscular, intracardiac, intrathecal, subventricular, epidural, intracerebral, intraventricular, subretinal, intravitreal, intraarticular, intraocular, intraperitoneal, intrauterine, intradermal, subcutaneous, transdermal, transmucosal and inhalation.

[0249] MODES FOR CARRYING OUT THE DISCLOSURE Cancer is the second leading cause of death worldwide, with an estimated 9.6 million deaths in 2018. There are many different types of cancer treatments in clinical development and commercially available, such as immunotherapy, hormonal therapy, targeted drug therapy, adoptive cell therapy, and chemotherapy. While progress has been made in many therapeutic areas, challenges remain regarding factors such as half-life and toxicity that affect therapeutic efficacy. For example, oncolytic virus-based therapies provide targeted delivery of payloads to the tumor microenvironment of interest. However, these tumors are still difficult to treat. Oncolytic viruses express their payload in tumor cells and induce a cell-killing effect, thereby limiting the expression of the payload to a few days, often a few hours, at most. Therefore, to obtain a sustained and long-term therapeutic effect, multiple administrations are required, which increases toxicity and leads to harmful immune responses. Adoptive cell therapy, such as chimeric antigen receptor (CAR)-T cell therapy, offers subjects suffering from cancer an individualized treatment option. However, some of the most common side effects of CAR-T cell therapy include cytokine release syndrome; neurological events such as encephalopathy, aphasia, seizures and balance disorders; neutropenia; and anemia. In addition, the preparation of CAR-T cells involves several weeks of culture and growth before administration, and this time can be crucial, especially for patients in advanced stages of cancer.

[0250] In certain embodiments, methods are disclosed herein for delivering a therapeutic transgene (e.g., a dimer as disclosed herein) using a gene therapy vector. In some embodiments, the gene therapy vector provides stable, persistent expression of the therapeutic transgene (e.g., a dimer). In further embodiments, the gene therapy vector provides constitutive expression. In further embodiments, the gene therapy vector provides regulated expression. In some cases, the gene therapy vector is transduced into normal cells (e.g., into organ cells such as liver cells or into muscle cells). In some cases, a single administration of the gene therapy vector is sufficient to induce stable, persistent expression of the therapeutic transgene (e.g., a dimer). In further cases, the gene therapy vector provides continuous, long-term expression of the therapeutic transgene (e.g., a dimer) that provides long-term pressure on the cancer cells.

[0251] In certain embodiments, methods are disclosed herein for using TransJoin to deliver a therapeutic transgene (e.g., a dimer as disclosed herein). In some cases, TransJoin provides constitutive expression of a therapeutic transgene (e.g., a dimer). In some cases, TransJoin provides sustained, stable, long-term expression of a therapeutic transgene (e.g., a dimer). In some cases, long-term expression includes about 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 8 months, 10 months, 1 year or longer. In some cases, TransJoin is transduced into normal cells (e.g., into organ cells such as liver cells or into muscle cells). In some cases, a single administration of TransJoin is sufficient to induce stable, sustained expression of a therapeutic transgene (e.g., a dimer). In further cases, TransJoin provides continuous, long-term expression of a therapeutic transgene (e.g., a dimer) that exerts long-term pressure on cancer cells.

[0252] In certain embodiments, novel methods are disclosed herein for activating transgene expression (e.g., dimers disclosed herein) that can be used as a gene therapy platform for regulated expression, e.g., short-term gene expression (e.g., for weeks to months, and even 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 8 months or longer, as needed). In some cases, the methods utilize TransSkip. In one aspect, transgene expression is placed under the control of a drug or external agent (e.g., OncoSkip) such that administration of the drug or agent modulates (activates or inactivates) gene expression. On the other hand, lack or cessation of administration of the drug or agent reverts to the original state of gene expression prior to administration. For example, if a drug or agent can activate gene expression, cessation of administration can inactivate gene expression, thereby minimizing side effects, if any, present. In some cases, TransSkip is transduced into normal cells (e.g., into organ cells such as liver cells or into muscle cells). In some cases, a single dose of TransSkip is sufficient to induce the stable and continuous expression of therapeutic transgenes (e.g., dimers). In further cases, TransSkip provides regulated but continuous expression of therapeutic transgenes (e.g., dimers) that exert long-term pressure on cancer cells.

[0253] Exon skipping is a technique used to treat certain genetic diseases in which a short region of a gene is defective. DNA mutations result in damaged proteins, either because incorrect amino acids appear in the protein, or because the DNA mutation creates a stop mutation resulting in a truncated protein, or because the DNA mutation changes the reading frame resulting in both. Since mammalian genes are typically coded in exons, i.e., divided into multiple gene segments (exons) that are spliced ​​together during processing of the mRNA, the DNA mutations (base pair changes or deletions) that underlie many diseases are contained within a single exon. If that exon is skipped and may not be included in the final spliced ​​mRNA, the mutated region will not be included in the final protein. Although the protein will be shorter and may be missing some parts, the protein will still be "in frame" and may retain some of its function.

[0254] For example, Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) are the most common childhood forms of muscular dystrophy and are caused by genetic defects in the DMD gene that encode dystrophin, a muscle protein required for the interaction between the cytoskeleton and the extracellular matrix to maintain the stability of muscle fibers during contraction. DMD mutations in the dystrophin gene are characterized by frameshift insertions or deletions or nonsense point mutations, resulting in the lack of functional dystrophin. BMD mutations generally keep the reading frame intact and allow the synthesis of partially functional dystrophin. Exon skipping-based therapy has converted out-of-frame mutations present in DMD patients into in-frame mutations that encode partially functional dystrophin. In 2016, the FDA approved eteplirsen™ (Sarepta Therapeutics), the first exon skipping drug for Duchenne muscular dystrophy with mutations in exon 51 of the dystrophin gene. When the drug (which is a short stretch of modified DNA, also called an oligo), is administered, exon 51 is "skipped," restoring a nearly full-length, more functional protein. Similar techniques are being developed to skip other dystrophin exons, as well as exons in other disease-causing genes.

[0255] In contrast to exon skipping, the present disclosure utilizes transgene activation in gene therapy applications. Most, if not all, gene therapy approaches currently use the complementary (cDNA) sequence of a gene. That is, the gene sequence of the transgene is only the coding sequence (exons only) and does not contain any intervening (intron) sequence. Therefore, the gene does not undergo RNA splicing.

[0256] The present disclosure and technology utilize intervening sequences containing splice donor and acceptor sites and RNA spliceosome binding sites to allow the transgene to undergo normal exon splicing. Thus, a "reverse engineered" (artificial) exon-intron-exon gene structure is provided in the transgene, which undergoes splicing when expressed in a target cell. However, splicing is regulated based on the principle of exon skipping. In one aspect, an intentionally inserted exon containing a stop codon in the middle of the gene regulates gene expression, i.e., only when that exon is skipped will the artificial structure express a normal functional transgene. In one embodiment, the functional transgene encodes an antibody. In another embodiment, the antibody is a bispecific or trispecific antibody (e.g., a dimer). In another embodiment, the antibody (e.g., a dimer) is a bispecific T cell engager (BiTE), a bispecific NK cell engager (BiKE), a trispecific T cell engager (TriTE) or a trispecific NK cell engager (TriKE).

[0257] In further embodiments, the extent and type of splicing is modified by cell type, since many genes usually undergo alternative splicing, which sometimes varies by cell type.In addition, splicing sometimes varies in certain cancer cells (some exons of a certain gene may be included or excluded in normal cells versus cancer cells).This technology can exploit these characteristics to achieve different transgene regulation in normal cells versus cancer cells.Also, antibodies, such as bispecific or trispecific antibodies, encoded by functional transgenes can be used to treat cancer.Thus, in one embodiment, the modulation of transgene splicing in the present disclosure provides a method for treating cancer.

[0258] Construct embodiments In certain embodiments, provided herein is a polynucleotide or vector comprising, or alternatively consisting essentially of, or consisting of (a)-(d): (a) a first polynucleotide sequence comprising a first portion of an open reading frame encoding a first polypeptide; (b) a second polynucleotide sequence comprising a second portion of the open reading frame encoding the first polypeptide; (c) a third polynucleotide sequence encoding a second polypeptide; and (d) a gene regulatory polynucleotide sequence located between the first polynucleotide and the second polynucleotide. In some cases, the first polypeptide binds to a surface polypeptide (e.g., a surface receptor) of a first target cell, and the second polypeptide binds to a surface polypeptide (e.g., a surface receptor) of a second target cell. In some cases, the first target cell and the second target cell are different. For example, the first target cell can be a tumor cell and the second target cell can be an immune cell. In a second example, the first target cell can be an immune cell and the second target cell can be a tumor cell. In a third example, the first target cell can be a first immune cell and the second target cell can be a second immune cell, where the first immune cell is a different cell type than the second immune cell. In a fourth example, the first target cell is a first cancer cell and the second target cell is a second cancer cell, where the first cancer cell and the second cancer cell are from the same type of cancer, e.g., associated with the same genetic defect or alternatively are of the same tissue type.

[0259] In some embodiments, the first polypeptide is a first antibody or a binding fragment thereof, and the second polypeptide is a second antibody or a binding fragment thereof. Optionally, provided herein is a polynucleotide or vector that comprises, or alternatively consists essentially of, or consists of (a)-(d): (a) a first polynucleotide sequence comprising a first portion of an open reading frame encoding the first antibody or an antigen-binding fragment thereof; (b) a second polynucleotide sequence comprising a second portion of an open reading frame encoding the first antibody or an antigen-binding fragment thereof; (c) a third polynucleotide sequence encoding the second antibody or an antigen-binding fragment thereof; and (d) a gene regulatory polynucleotide sequence located between the first polynucleotide and the second polynucleotide. Complements of the polynucleotides are also provided. In one aspect, the polynucleotides, their complements, and / or the vectors are detectably labeled. Optionally, the first antibody binds to a first target and the second antibody binds to a second target. In some cases, the first target is a surface polypeptide (e.g., a surface receptor) on a first cell, and the second target is a surface polypeptide (e.g., a surface receptor) on a second cell. In some cases, the first target cell and the second target cell are different. For example, the first target cell can be a tumor cell and the second target cell can be an immune cell. In a second example, the first target cell can be an immune cell and the second target cell can be a tumor cell. In a third example, the first target cell can be a first immune cell and the second target cell can be a second immune cell, where the first immune cell is a different cell type than the second immune cell. In a fourth example, the first target cell is a first cancer cell and the second target cell is a second cancer cell, where the first cancer cell and the second cancer cell are derived from the same type of cancer, e.g., associated with the same genetic defect or alternatively of the same tissue type. In some cases, the first target is a first epitope and the second target is a second epitope, both epitopes being present on the same antigen. In some cases, the first and second antibodies have different amino acid sequences.In one embodiment, the polynucleotide is contained within a gene expression vector, non-limiting examples of which include a plasmid, a DNA viral vector or a gene delivery vehicle.

[0260] Also disclosed herein in some embodiments is a vector for use in gene therapy, comprising a first polynucleotide sequence encoding a first antibody or an antigen-binding fragment thereof and a second polynucleotide sequence encoding a second antibody or an antigen-binding fragment thereof. Complements of the polynucleotides are also provided. In one aspect, the polynucleotides, their complements and / or the vector are detectably labeled. In some cases, the first antibody binds to a first target and the second antibody binds to a second target. In some cases, the first target is a surface polypeptide (e.g., a surface receptor) on a first cell and the second target is a surface polypeptide (e.g., a surface receptor) on a second cell. In some cases, the first target cell and the second target cell are different. For example, the first target cell can be a tumor cell and the second target cell can be an immune cell. In a second example, the first target cell can be an immune cell and the second target cell can be a tumor cell. In a third example, the first target cell can be a first immune cell, and the second target cell can be a second immune cell, where the first immune cell is a different cell type from the second immune cell.In a fourth example, the first target cell is a first cancer cell, and the second target cell is a second cancer cell, where the first cancer cell and the second cancer cell are from the same type of cancer, e.g., associated with the same genetic defect, or alternatively of the same tissue type.In some cases, the first target is a first epitope, and the second target is a second epitope, where both epitopes are present on the same antigen.In some cases, the first and second antibodies have different amino acid sequences.

[0261] In further embodiments, the gene regulatory polynucleotide sequence comprises a splice donor site, an upstream intron, an exon containing a stop codon sequence in all three reading frames, a downstream intron, and a splice acceptor site. In further embodiments, the gene regulatory polynucleotide sequence comprises one or more binding sequences for an antisense oligonucleotide. In further embodiments, the antisense oligonucleotide is a morpholino. In further embodiments, the binding sequence for the morpholino oligonucleotide comprises a polynucleotide sequence at least 95% identical to SEQ ID NO: 24 (AATATGATCCAACAATAGAGGTAAATCTTG) or SEQ ID NO: 25 (GATCCAACAATAGAGGTAAATCTTGTTTTA), or alternatively at least 96%, or alternatively at least 97%, or alternatively at least 98%, or alternatively at least 99% identical thereto. In one embodiment, the morpholino oligonucleotide comprises a polynucleotide sequence at least 95% identical to SEQ ID NO: 27 (CAAGATTTACCTCTATTGTTGGATCATATT) or SEQ ID NO: 28 (TAAAACAAGATTTACCTCTATTGTTGGATC), or alternatively at least 96%, or alternatively at least 97%, or alternatively at least 98%, or alternatively at least 99% identical to each of these. Splice donor sites and splice acceptor sites are well known in the art. Those skilled in the art are aware of the sequences, e.g., consensus sequences, of splice donor sites and splice acceptor sites. An exemplary splice site consensus sequence for the U2 intron is the 5' splice site MAG- GT The 3' splice site for the U2 intron can include RAGT, where M is A or C, R is A or G, the underlined nucleotides indicate that "GT" is invariant, and the dash "-" indicates the splice site. AG -G, where the underlined nucleotide indicates an invariant "AG", and the dash "-" indicates the splice site. Further examples of consensus splice site sequences include, but are not limited to, the following:

[0262] p53 exon 10 5' splice site (donor): CAG-gtgagt, where the dash "-" indicates the splice site;

[0263] Brd2 exon 3 5′ss: AAG-gtgagt, where dashes “-” indicate splice sites;

[0264] BRCA1 exon 22 5' splice site: CAG-gtaagt, where the dash "-" indicates the splice site;

[0265] SMN1 exon 1 5′ss: CAG-gtgagg, where dashes “-” indicate splice sites;

[0266] BRD2 3' splice site acceptor intron 1 (lowercase) / exon 2 (uppercase): cccatctttacag-GCTCCC, where the dash "-" indicates the splice site;

[0267] BCL-X 3' splice acceptor intron 2 (lowercase) / exon 3 (uppercase): tctctccctgcag-GATACT, where dashes "-" indicate splice sites;

[0268] Fibronectin 3' splice acceptor intron 28 (lowercase) / exon 29 (uppercase): ctttttcatacag-GAGGAA, where dashes "-" indicate splice sites;

[0269] Survivin 3' splice acceptor intron 2 (lowercase) / exon 3 (uppercase): tctttatttccagGCAAAG, where dashes "-" indicate splice sites.

[0270] In some embodiments, splice site consensus sequences are obtained from http: / / science.umd.edu / labs / mount / RNAinfo / matrices.html.

[0271] In some embodiments, the stop codon comprises an oligonucleotide of the group TAA, TAG, or TGA. In further embodiments, the stop codon sequence comprises a polynucleotide sequence of TAAxTAGxTGAxTAGxTAAxTGAx (SEQ ID NO: 1), where x is any nucleotide, or alternatively, the stop codon sequence comprises a polynucleotide sequence of TAATTAGTTGATTAGTTAATTGAT (SEQ ID NO: 2). In still further embodiments, the gene regulatory polynucleotide comprises a polynucleotide sequence at least 95% identical to SEQ ID NO: 2, or alternatively at least 96%, or alternatively at least 97%, or alternatively at least 98%, or alternatively at least 99% identical to SEQ ID NO: 2.

[0272] In a further embodiment, the first antibody or antigen-binding fragment thereof specifically binds to an activation antigen on an immune effector cell, and the second antibody or antigen-binding fragment thereof binds to a tumor antigen. In another embodiment, the first antibody or antigen-binding fragment thereof specifically binds to a tumor antigen, and the second antibody or antigen-binding fragment thereof binds to an activation antigen on an immune effector cell. In a further embodiment, the vector also comprises a fourth polynucleotide sequence encoding a third antibody or antigen-binding fragment thereof, the third antibody or antigen-binding fragment thereof binds to an activation antigen or a tumor antigen on an immune effector cell. In one embodiment, the immune effector cell comprises a dendritic cell, a natural killer ("NK") cell, a macrophage, a T cell, a B cell, or a combination thereof. Non-limiting examples of immune effector cells include T cells or NK cells.

[0273] Non-limiting examples of activation antigens on immune effector cells include CD3, CD2, CD4, CD8, CD19, LFA1, CD45, NKG2D, NKp44, NKp46, NKp30, DNAM, or combinations thereof.

[0274] Non-limiting examples of target antigens on antigen presenting cells include, but are not limited to, B7-H3 (CD276).

[0275] Non-limiting examples of target antigens on B cells include, but are not limited to, CD20 and CD22.

[0276] Non-limiting examples of tumor antigens include one or more of ephrin type A receptor 2 (EphA2), interleukin (IL)-13r alpha 2, EGFR VIII, PSMA, EpCAM, GD3, fucosyl GM1, PSCA, PLAC1, sarcoma breakpoint, Wilms tumor 1, alpha fetoprotein (AFP), carcinoembryonic antigen (CEA), CA-125, MUC-1, epithelial tumor antigen (ETA), tyrosinase, melanoma associated antigen (MAGE), blood differentiation antigen, surface glycoprotein, ganglioside (GM2), growth factor receptor, stromal antigen, vascular antigen, receptor tyrosine kinase-like orphan receptor 1 (ROR1), mesothelin, CD38, CD123, human epidermal growth factor receptor 2 (HER2), B-cell maturation antigen (BCMA), fibroblast activation protein (FAP) alpha, or a combination thereof. Further examples can be found in the art, and are incorporated herein by reference, for example. In another embodiment, the recombinant vector expresses a pre-mRNA encoding a dimer as described herein. In some cases, when the pre-mRNA is contacted with a morpholino oligonucleotide, the dimer is a bispecific antibody or a trispecific antibody. Non-limiting examples of dimers are from the following groups: bispecific T cell engager (BiTE) or bispecific NK cell engager (BiKE); trispecific antibodies include trispecific T cell engager (TriTE) or trispecific NK cell engager (TriKE). In one embodiment, a trispecific antibody includes a first antibody or an antigen-binding fragment thereof and a second antibody or an antigen-binding fragment thereof.

[0277] In one aspect, the dimer (e.g., bispecific or trispecific cell engager) comprises a polypeptide sequence with at least 95% sequence identity to SEQ ID NO: 11, optionally at least 96%, at least 97%, at least 98% or at least 99% sequence identity to SEQ ID NO: 11. In another embodiment, the polypeptide sequence encodes an antigen-binding fragment for CD3; CD2; CD4; CD8; CD19; lymphocyte function-associated antigen 1 (LFAl); CD45; interleukin 21 receptor (IL21R); natural killer group 2 member D (NKG2D); natural cytotoxicity receptor (NCR), such as NKp44, NKp46 or NKp30; or DNAX accessory molecule-1 (also called DNAM or DNAM-1; CD226 or platelet and T-cell activation antigen 1 (PTA1)). In another embodiment, the polypeptide sequence encodes an antigen-binding fragment for CD3, CD19, GD2 or NKG2D. In another embodiment, the polypeptide encodes a first antigen-binding fragment and a second antigen-binding fragment. In another embodiment, the first antigen-binding fragment binds to CD3 and the second antigen-binding fragment binds to CD19. In another embodiment, the first antigen-binding fragment binds to CD3 and the second antigen-binding fragment binds to GD2. In another embodiment, the first antigen-binding fragment binds to NKG2D and the second antigen-binding fragment binds to GD2.

[0278] In one embodiment, the trispecific engager or antibody comprises a first antigen-binding fragment, a second antigen-binding fragment and a third antigen-binding fragment. In another embodiment, the trispecific engager or antibody comprises three antigen-binding fragments that individually bind to NKG2D, IL21R and GD2. In a further aspect, the trispecific engager or antibody comprises a polypeptide sequence having at least at least 95% sequence identity to SEQ ID NO:11, or alternatively at least 96%, or alternatively at least 97%, or alternatively 98%, or alternatively at least 99% sequence identity to SEQ ID NO:11.

[0279] In one embodiment, the antigen-binding fragment that binds to IL-21R is IL-21. The amino acid sequence and cDNA sequence of IL-12 are shown in SEQ ID NO:3 and SEQ ID NO:4, respectively. In one embodiment, the antigen-binding fragment that binds to NKG2D includes MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, ULBP6, Rae-1α, Rae-1β, Rae-1γ, Rae-1δ, Rae-1ε, H60a, H60b, H60c, MULT1, or fragments thereof. In one embodiment, the antigen-binding fragment that binds to NKG2D is MICA (SEQ ID NO:5) or a fragment thereof, or an equivalent thereof.

[0280] The MICA sequence, in one embodiment, comprises a wide-type variant. In one embodiment, the MICA variant is a sequence variant of wild-type MICA (e.g., the wild-type MICA sequence shown in SEQ ID NO:5). In another embodiment, the MICA variant is a sequence variant of MUC-30 (SEQ ID NO:7), which comprises a methionine mutation instead of an alanine at position 129 of the wide-type MICA sequence (MICA-129Met). The equivalent of the MICA variant (MICA-129Met) retains the methionine mutation at position 129 of wild-type MICA. In another embodiment, the bispecific or trispecific engager or antigen-binding fragment of the antibody is separated by a linker sequence. One embodiment of the linker sequence comprises, consists essentially of, or consists of GGGSGGGGSGGGGS (SEQ ID NO:9) or an equivalent thereof. The linker sequence is encoded by a polynucleotide sequence of GGCGGCGGCAGCGGCGGCGGCGGCGGCAGCGGCGGCGGCGGCAGC (SEQ ID NO: 10) or an equivalent thereof. In one embodiment, the two antigen-binding fragments separated by the linker sequence are IL21 and MICA (e.g., wild-type MICA or a MICA mutant such as MUC-30 or MICA-129Met), or a fragment thereof, or an equivalent of each of them. In one embodiment, the two antigen-binding fragments separated by the linker sequence are GD2 and MICA (e.g., wild-type MICA or a MICA mutant such as MUC-30 or MICA-129Met), or a fragment thereof, or an equivalent of each of them. In one embodiment, the two antigen-binding fragments separated by the linker sequence are IL21 and GD2, or a fragment thereof, or an equivalent of each of them. In another embodiment, the linker is inserted between the antigen-binding fragments of any of the following trispecific engagers: IL21-MICA129-GD2 MICA129-IL21-GD2 GD2-IL21-MICA129 GD2-MICA129-IL21 IL21-MICA / V129M-GD2-HDD MICA / V12M-IL21-GD2-HDD GD2-IL21-MICA129-HDD GD2-MICA129-IL21-HDD

[0281] In another embodiment, the dimer (e.g., bispecific or trispecific engager) comprises a secretion consensus sequence (also referred to herein as sec0A). In some cases, the secretion consensus sequence (sec0A) comprises at least 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to, or consists of, SEQ ID NO:51, MWWRLWWLLLLLLLLWPMVWA (SEQ ID NO:51). In some cases, sec0A is encoded by a polynucleotide comprising ATGTGGTGGAGACTGTGGTGGCTGCTGCTGCTGCTGCTGCTGCTGTGGCCCATGGTGTGGGCC (SEQ ID NO:52), or an equivalent thereof.

[0282] In some cases, the secretion consensus sequence further comprises 1, 2, 3, 4 or more residues at the C-terminus of the sequence. In some cases, the 1, 2, 3, 4 or more residues are residues having an aliphatic side chain (e.g., Ala, Met, Ile, Val or Leu). In some cases, the 1, 2, 3, 4 or more residues are Ala, Gly, Val, Ile residues or combinations thereof. In some cases, the 1, 2, 3, 4 or more residues are Ala, Gly, Val residues or combinations thereof. In some cases, the 1, 2, 3, 4 or more residues are Ala, Gly or combinations thereof. In some cases, the secretion consensus sequence further comprises 1, 2, 3, 4 or more Ala residues at the C-terminus of the sequence. In some cases, the secretion consensus sequence further comprises 1, 2, 3, 4 or more Gly residues at the C-terminus of the sequence. In some cases, the secretion consensus sequence further comprises one, two, three, four or more Val residues at the C-terminus of the sequence. In some cases, the secretion consensus sequence further comprises one, two, three, four or more Ile residues at the C-terminus of the sequence.

[0283] In some cases, the secretion consensus sequence further comprises one, two or three residues having an aliphatic side chain (e.g., Ala, Met, Ile, Val or Leu). In some cases, the one, two or three residues are Ala, Gly, Val, Ile residues or a combination thereof. In some cases, the one, two or three residues are Ala, Gly, Val, or a combination thereof. In some cases, the one, two or three residues are Ala, Gly, or a combination thereof. In some cases, the secretion consensus sequence further comprises one, two or three Ala residues at the C-terminus of the sequence. In some cases, the secretion consensus sequence further comprises one, two or three Gly residues at the C-terminus of the sequence. In some cases, the secretion consensus sequence further comprises one, two or three Val residues at the C-terminus of the sequence. In some cases, the secretion consensus sequence further comprises one, two or three Ile residues at the C-terminus of the sequence.

[0284] In some cases, the secretion consensus sequence further comprises one or two residues having an aliphatic side chain (e.g., Ala, Met, Ile, Val, or Leu). In some cases, the one or two residues are Ala, Gly, Val, Ile, or a combination thereof. In some cases, the one or two residues are Ala, Gly, Val, or a combination thereof. In some cases, the one or two residues are Ala, Gly, or a combination thereof. In some cases, the secretion consensus sequence further comprises one or two Ala residues at the C-terminus of the sequence. In some cases, the secretion consensus sequence further comprises one or two Gly residues at the C-terminus of the sequence. In some cases, the secretion consensus sequence further comprises one or two Val residues at the C-terminus of the sequence. In some cases, the secretion consensus sequence further comprises one or two Ile residues at the C-terminus of the sequence.

[0285] In some cases, the secretion consensus sequence further comprises a residue having an aliphatic side chain (e.g., Ala, Met, Ile, Val, or Leu). In some cases, the single residue is Ala, Gly, Val, or Ile. In some cases, the secretion consensus sequence further comprises an Ala at the C-terminus of the sequence. In some cases, the secretion consensus sequence further comprises a Gly at the C-terminus of the sequence. In some cases, the secretion consensus sequence further comprises a Val at the C-terminus of the sequence. In some cases, the secretion consensus sequence further comprises an Ile at the C-terminus of the sequence.

[0286] In some cases, the secretion consensus sequence further comprises one or two Ala residues at the C-terminus of the consensus sequence, such sequences being referred to as secretecon 1A (or sec1A) with one Ala at the C-terminus and secretecon 2A (or sec2A) with two Ala residues at the C-terminus. In some cases, sec1A comprises at least 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to MWWRLWWLLLLLLLLWPMVWAA (SEQ ID NO:53). In some cases, sec1A is encoded by a polynucleotide comprising ATGTGGTGGAGACTGTGGTGGCTGCTGCTGCTGCTGCTGCTGCTGTGGCCCATGGTGTGGGCCGCC (SEQ ID NO:54) or an equivalent thereof. In some cases, sec2A comprises at least 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to MWWRLWWLLLLLLLLWPMVWAAA (SEQ ID NO:55). In some cases, sec2A is encoded by a polynucleotide that comprises ATGTGGTGGAGACTGTGGTGGCTGCTGCTGCTGCTGCTGCTGCTGTGGCCCATGGTGTGGGCCGCCGCC (SEQ ID NO:56), or an equivalent thereof.

[0287] In some embodiments, the secretion consensus sequence modulates the expression and / or secretion of the dimer. In some cases, the secretion consensus sequence (e.g., sec1A or sec2A) enhances the expression and / or secretion of the dimer. In some cases, the secretion consensus sequence (e.g., sec1A or sec2A) modulates (e.g., enhances) the expression of the dimer by about 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 20-fold, 50-fold or more. In some cases, the secretion consensus sequence (e.g., sec1A or sec2A) modulates (e.g., enhances) the secretion of the dimer by about 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 20-fold, 50-fold or more.

[0288] In some embodiments, the dimers (e.g., trispecific engagers) described herein include a secretion consensus sequence (e.g., sec0A, sec1A, or sec2A), an IL21 sequence (e.g., SEQ ID NO: 3), a MICA sequence (e.g., wild-type sequence, MUC-30, or MICA-129Met), an anti-GD2 peptide sequence, or one or more equivalents thereof. In some cases, the dimers (e.g., trispecific engagers) include a secretcon 1A sequence, an IL21 sequence, a MICA129 sequence, an anti-GD2 peptide sequence, or one or more equivalents thereof. In one embodiment, the dimers (e.g., trispecific engagers) include a secretcon 1A-linker-IL21-linker-MICA129-linker-anti-GD2 peptide, or one or more equivalents thereof. In one embodiment, the dimers (e.g., trispecific engagers) include a polypeptide sequence of SEQ ID NO: 11.

[0289] SEQ ID NO:11 [ka] Or its equivalent.

[0290] In one embodiment, the dimer (eg, trispecific engager) is encoded by the sequence of SEQ ID NO:12. SEQ ID NO:12 [ka] [ka] Or its equivalent.

[0291] In one embodiment, the dimer (e.g., bispecific engager) comprises a secreton 1A sequence (sec1A), a CD3 sequence, and an anti-GD2 peptide sequence, or one or more equivalents thereof. In one embodiment, the bispecific engager comprises the polypeptide sequence of SEQ ID NO: 13 arranged as follows: sec1A-anti-CD3-linker-anti-GD2-HDD. The sec1A portion is underlined. The anti-CD3 portion is in bold. The anti-GD2 portion is underlined and in italics. The grey shaded area indicates the HDD portion, which includes the HDD peptide in bold, the hinge region in lowercase upstream of the HDD peptide, and the spacer region in lowercase downstream of the HDD peptide. SEQ ID NO:13 [ka] Or its equivalent.

[0292] In another embodiment, the dimer (e.g., bispecific engager) comprises a sec1A sequence, an anti-CD3 sequence and an anti-GD2 peptide sequence, or one or more equivalents thereof, and in one aspect is encoded by the sequence of SEQ ID NO:14. SEQ ID NO:14 [ka] [ka] Or its equivalent.

[0293] In another embodiment, the dimer (e.g., bispecific engager) comprises a secreton 1A sequence, an anti-CD19 sequence, and an anti-CD3 sequence arranged as follows: sec1A-anti-CD19-linker-anti-CD3. The bispecific engager comprises the polypeptide sequence of SEQ ID NO: 15. The sec1A portion is underlined. SEQ ID NO:15 [ka] Or its equivalent.

[0294] In another embodiment, the dimer (e.g., bispecific engager) comprises a secreton 1A sequence, an anti-CD19 sequence and an anti-CD3 sequence arranged as follows: sec1A-anti-CD19-linker-anti-CD3, or one or more equivalents thereof. In one embodiment, it is encoded by the polynucleotide sequence of SEQ ID NO: 16. SEQ ID NO:16 [ka] Or its equivalent.

[0295] In some embodiments, the dimer comprises a secretion signal called secreton AA (sec2A). In some cases, the dimer comprises secreton AA linked in tandem with an amino acid sequence from blinatumomab (which targets CD3 and CD19). In some cases, secreton AA-blinatumomab (or sec2A-CD19xCD3) comprises the polypeptide sequence of SEQ ID NO: 29, with the secreton AA portion underlined. SEQ ID NO:29 [ka] Or its equivalent.

[0296] In some embodiments, the dimer comprising sec2A-CD19xCD3 is encoded by the polynucleotide sequence of SEQ ID NO:30. SEQ ID NO:30 [ka] [ka] Or its equivalent.

[0297] In some embodiments, the dimer comprises a secretome A (sec1A) sequence, CD19 and CD3 arranged in the sequence sec1A-CD19xCD3, or one or more equivalents thereof. In one embodiment, it is encoded by the polynucleotide sequence of SEQ ID NO:31. SEQ ID NO:31 [ka] [ka] Or its equivalent.

[0298] In some embodiments, the dimer comprises a secreton (sec0A) sequence, CD19 and CD3, or one or more equivalents thereof, and in one aspect is arranged as sec0A-CD19xCD3 and is encoded by the polynucleotide sequence of SEQ ID NO:32. SEQ ID NO:32 [ka] [ka] Or its equivalent.

[0299] In some embodiments, the dimer comprises CD19 and CD3 sequences without the secreton sequence, arranged as CD19xCD3, or equivalents of one or both of these, and in one aspect is encoded by the polynucleotide sequence of SEQ ID NO:33. SEQ ID NO:33 [ka] [ka] Or its equivalent.

[0300] In one aspect, the bispecific T cell engager comprises a polypeptide sequence at least 95% identical, or alternatively at least 96%, or alternatively at least 97%, or alternatively at least 98%, or alternatively at least 99% identical to any one of SEQ ID NOs: 12 and 13. In one embodiment, the trispecific antibody comprises a first antibody or antigen-binding fragment thereof, a second antibody or antigen-binding fragment thereof, and a third antibody or antigen-binding fragment thereof. In a further aspect, the trispecific antibody comprises a polypeptide sequence at least at least 95% sequence identity to SEQ ID NO: 11, or alternatively at least 96%, or alternatively at least 97%, or alternatively at least 98%, or alternatively at least 99% sequence identity to SEQ ID NO: 11.

[0301] In a further embodiment, the recombinant polynucleotide expresses a pre-mRNA encoding the trispecific antibody when the pre-mRNA is contacted with a morpholino oligonucleotide.

[0302] In one embodiment, the antigen binding domain is a single chain variable fragment of an antibody.

[0303] In further embodiments, the recombinant polynucleotide or vector further comprises a polynucleotide sequence encoding a secretory peptide. In another embodiment, the vector further comprises a polynucleotide sequence encoding a dimerization domain. In another embodiment, the vector comprises a 5' inverted repeat (ITR) and a 3' ITR. In another embodiment, the vector comprises a sequence of SEQ ID NO: 4, 6, 8, 12, 15, 16, 30-33 or equivalents thereof, or a polynucleotide, or alternatively at least 95%, or alternatively at least 96%, or alternatively at least 97%, or alternatively at least 98%, or alternatively at least 99% identity. Non-limiting examples of vectors include recombinant viral vectors comprising a backbone vector selected from the group of retroviral vectors, lentiviral vectors, murine leukemia virus ("MLV") vectors, Epstein-Barr virus ("EBV") vectors, adenoviral vectors, herpes virus ("HSV") vectors, adeno-associated virus ("AAV") vectors, AAV vectors, or optionally self-complementary AAV vectors. These are optionally detectably labeled. Complements of the optionally detectably labeled polynucleotides are also provided.

[0304] Recombinant polynucleotide vectors can be contained in host cells, such as prokaryotic or eukaryotic cells. The cells can be used to recombinantly express or replicate polynucleotides by culturing the cells containing the polynucleotides under conditions that allow for replication of the polynucleotides and, if necessary, expression of the polynucleotides. The polynucleotides and / or expression products are optionally isolated from the cell culture.

[0305] The present invention also provides a virus packaging system, comprising the vector as described above, whose backbone is derived from a plasmid virus, a packaging plasmid, and an envelope plasmid. The packaging plasmid contains nucleosides, capsid and matrix proteins. Examples of packaging plasmids are also described in patent literature, such as U.S. Patent Nos. 7,262,049; 6,995,258; 7,252,991 and 5,710,037. This system also contains a plasmid that codes for the envelope protein provided by the envelope plasmid.

[0306] The present disclosure also provides suitable packaging cell line.In one embodiment, packaging cell line is HEK-293 cell line.Other suitable cell lines are known in the art and described in, for example, U.S. Patent Nos. 7,070,994; 6,995,919; 6,475,786; 6,372,502; 6,365,150 and 5,591,624.

[0307] The present invention further provides a method for making AAV particles, comprising, or alternatively, essentially consisting of, or even consisting of transducing a packaging cell line with a viral system as described above under suitable conditions for packaging viral vector.Such conditions are known in the art and are briefly described herein.Viral particles can be isolated from cell supernatant using methods known to those skilled in the art, such as centrifugation.Such isolated particles are further provided by the present invention.

[0308] The invention further provides an isolated AAV viral particle produced by this method, the viral particle comprising, or alternatively consisting essentially of, or consisting of a polynucleotide described herein.

[0309] host cell Further provided is an isolated cell or population of cells comprising, or alternatively consisting essentially of, or consisting of the isolated polynucleotides, viral particles, vectors and packaging systems described above and incorporated herein by reference. In one embodiment, the isolated cell is a packaging cell line.

[0310] Also provided are isolated cells or populations of cells comprising, or alternatively consisting essentially of, or consisting of the polynucleotide sequences described herein.

[0311] The isolated cells described herein may be any of the cells of species from the following groups: mouse, rat, rabbit, monkey, cow, sheep, pig, dog, cat, farm animal, sports animal, pet, horse and primate, and may in particular be human cells.

[0312] The vector and cell can be contained in a composition that contains the vector and / or host cell and a carrier, such as a pharmaceutically acceptable carrier.The vector and cell can be formulated for various modes of administration and can contain an effective amount of the vector and / or host cell that is effective for the patient, disorder or disease, vector and mode of administration.In one embodiment, the mode of administration is systemic or intravenous.In another embodiment, administration is local administration by direct injection.In one embodiment, the morpholino oligonucleotide is contacted with the vector at the same time or subsequently to the vector.Alternatively, the morpholino oligonucleotide is contacted before the vector.

[0313] How to use The polynucleotides and vectors are useful for treating various diseases or disorders. In one embodiment, a method for delivering a transgene is provided. The method includes administering an effective amount of a polynucleotide or vector containing a transgene to a cell, tissue or patient to be treated. In one embodiment, an effective amount of an antisense oligonucleotide (e.g., a morpholino oligonucleotide) is administered to a cell, tissue or patient to be treated. Non-limiting examples of transgenes are provided and are selected based on the purpose of the method. The cell or tissue can be mammalian, e.g., human. In one embodiment, the antisense oligonucleotide (e.g., a morpholino oligonucleotide) is contacted simultaneously with the vector or subsequent to the vector. Alternatively, the morpholino oligonucleotide is contacted prior to the vector. In another embodiment, the vector is introduced into the cell by transfection, infection, transformation, electroporation, injection, microinjection, or a combination thereof.

[0314] Also provided herein is a method for treating cancer in a subject in need of such treatment. The method comprises, or alternatively consists essentially of, or consists of administering to the subject an effective amount of a recombinant viral vector or cell described herein. In a further embodiment, the method further comprises administering to the subject an effective amount of an antisense oligonucleotide (e.g., a morpholino oligonucleotide). In one embodiment, an effective amount of an anti-cancer agent is administered to the subject. Non-limiting examples of anti-cancer agents include anti-cancer peptides, polypeptides, nucleic acid molecules, small molecules, viral particles, or combinations thereof. In another embodiment, the vector is introduced into the cell by transfection, infection, transformation, electroporation, injection, microinjection, or combinations thereof. The treatment can be administered as a first line treatment, a second line treatment, a third line treatment, a fourth line treatment, or a fifth line treatment. The treatment can be an adjunct treatment or can be combined with other cancer therapies.

[0315] In one embodiment of the disclosed method, the viral particle is an oncolytic HSV particle.

[0316] Administration Administration of the recombinant polynucleotide and / or vector (e.g., AAV), viral particle or composition of the present disclosure can be performed in one dose, continuously or intermittently throughout the duration of treatment. Administration can be through any suitable mode of administration, including, but not limited to, intravenous, intraarterial, intramuscular, intracardiac, intrathecal, subventricular, epidural, intracerebral, intraventricular, subretinal, intravitreal, intraarticular, intraocular, intraperitoneal, intrauterine, intradermal, subcutaneous, transdermal, transmucosal, and inhalation. In some cases, the mode of administration includes parenteral administration. In one embodiment, the recombinant polynucleotide or vector or composition is administered by intramuscular or intravenous injection. In another embodiment, the recombinant polynucleotide or vector or composition is administered systemically. In another embodiment, the recombinant polynucleotide or vector or composition is administered parentally by injection, infusion, or implantation.

[0317] The method of determining the most effective means and dosage of administration is known to those skilled in the art and varies according to the composition used for treatment, the purpose of treatment and the subject being treated. Single or multiple administrations can be carried out with the dosage level and pattern selected by the treating physician. It should be noted that the dosage can be influenced by the route of administration. Appropriate dosage formulations and methods of administering drugs are known in the art. Non-limiting examples of such suitable dosages can be a minimum of 1E+9 vector genomes to a maximum of 1E+17 vector genomes per administration.

[0318] In some embodiments of the methods described herein, the number of viral particles (e.g., AAV) administered to a subject is about 10 9 ~about 10 17 In certain embodiments, the range is about 10 10 ~about 10 16 pieces, about 10 10 ~about 10 15 pieces, about 10 10 ~about 10 12 pieces, about 1011 ~about 10 13 pieces, about 10 11 ~about 10 12 pieces, about 10 11 ~about 10 14 pieces, about 10 11 ~about 10 15 pieces, about 10 11 ~about 10 16 pieces, about 5×10 11 ~Approx. 5×10 12 Pieces or about 10 12 ~about 10 13 In some cases, about 10 viral particles are administered to the subject. 11 ~about 10 12 In some cases, about 10 viral particles are administered to the subject. 13 ~about 10 15 In some cases, about 10 viral particles are administered to the subject. 9 ~about 10 12 In some cases, about 10 viral particles are administered to the subject. 9 ~about 10 11 In some cases, the amount of viral particles administered is based on the weight of the subject. One skilled in the art may find that the total amount delivered to a subject is about 10 9 ~about 10 17 10 viral particles, if necessary, approximately 10 10 ~about 10 16 pieces, about 10 10 ~about 10 15 pieces, about 10 10 ~about 10 12 pieces, about 10 11 ~about 10 13 pieces, about 10 11 ~about 10 12 pieces, about 10 11 ~about 10 14 pieces, about 10 11 ~about 10 15 pieces, about 10 11 ~about 10 16 pieces, about 5×10 11 ~Approx. 5×10 12 Pieces or about 10 12 ~about 10 13In some cases, the subject is a pediatric subject (e.g., a subject under 18 years of age). In some cases, the subject is about 10 9 ~about 10 12 pieces, about 10 10 ~about 10 12 pieces, about 10 11 ~about 10 12 Pieces or about 10 9 ~about 10 10 10 viral particles are administered to a pediatric subject.

[0319] In further embodiments, the viral particles and compositions of the present disclosure can be administered in combination with other treatments, e.g., approved treatments appropriate for cancer and its related disorders or conditions.

[0320] Successful treatment and / or repair is determined when one or more of the following is detected: alleviation or improvement of one or more symptoms of the disease, disorder or condition of the treated subject, reduction in the severity of the disease, disorder or condition of the subject, stable (i.e., not worsening) state of the disease, disorder or condition, delay or slowing of the progression of the disease, disorder or condition, and improvement or alleviation of the disease, disorder or condition. In some embodiments, successful treatment is determined by detecting the presence of the repaired target polynucleotide in one or more cells, tissues or organs isolated from the subject. In some embodiments, successful treatment is determined by detecting the presence of the polypeptide encoded by the repaired target polynucleotide in one or more cells, tissues or organs isolated from the subject.

[0321] kit In some embodiments, the agents, vectors or compositions described herein can be assembled into pharmaceutical or diagnostic or research kits to facilitate their use in therapeutic, diagnostic or research applications. In some embodiments, the kits of the present disclosure include one or more of the modified viral capsid proteins, isolated polynucleotides, vectors, host cells, recombinant viral particles, recombinant expression systems, modified AAVs, modified cells, isolated tissues, compositions or pharmaceutical compositions described herein.

[0322] In some embodiments, the kit further includes instructions for use. Specifically, such kits may include one or more agents described herein, together with instructions that describe the intended use and proper use of these agents. As an example, in one embodiment, the kit may include instructions for mixing one or more components of the kit, and / or for isolating and mixing samples and applying to a subject. In certain embodiments, the agents in the kit are pharmaceutical formulations and dosages that are suitable for a particular use and method of administering the agents. Kits for research purposes may contain components in appropriate concentrations or amounts to carry out various experiments.

[0323] The kits can be designed to facilitate the use of the methods described herein and can take many forms. Each composition of the kit can be provided in liquid form (e.g., in solution) or solid form (e.g., dry powder), as applicable. In certain cases, some of the compositions can be configurable or otherwise processable (e.g., into an active form), for example, by the addition of a suitable solvent or other species (e.g., water or cell culture medium), which may or may not be provided with the kit. In some embodiments, the compositions can be provided in a preservation solution (e.g., a cryopreservation solution). Non-limiting examples of preservation solutions include DMSO, paraformaldehyde, and CryoStor® (Stem Cell Technologies, Vancouver, Canada). In some embodiments, the preservation solution contains an amount of a metalloprotease inhibitor.

[0324] As used herein, "instructions" can define instruction and / or promotional elements, and typically include written instructions on or accompanying packaging of the claimed methods, recombinant vectors, or compositions. Instructions can also include any oral or electronic instructions provided in any format that clearly identifies to a user that the instructions are to be associated with the kit, such as audiovisual (e.g., videotape, DVD, etc.), internet and / or web-based communication means, etc. In some embodiments, the written instructions are in a format prescribed by a government agency regulating the manufacture, use, or sale of pharmaceutical or biological products, and the instructions can also reflect approval by the agency of manufacture, use, or sale for animal administration.

[0325] In some embodiments, the kit contains any one or more of the components described herein in one or more containers. Thus, in some embodiments, the kit may include a container housing the agent described herein. The agent may be in liquid, gel, or solid (powder) form. The agent may be aseptically prepared, packaged in a syringe, and shipped refrigerated. Alternatively, it may be contained in a vial or other container for storage. A second container may have another agent prepared aseptically. Alternatively, the kit may contain an active agent premixed and shipped in a syringe, vial, tube, or other container. The kit may have one or more or all of the components required to administer the agent to a subject, such as a syringe, topical application device, or IV needle tube and bag.

[0326] The treatments described herein can be combined with appropriate diagnostic techniques to identify and select patients for such treatment.

[0327] Method of production In a further method provided by the present disclosure, a method for producing a bispecific or trispecific antibody in a cell comprises contacting a cell comprising a vector described herein with an effective amount of a morpholino oligonucleotide. In one embodiment, the morpholino oligonucleotide comprises a polynucleotide sequence at least 95% identical to SEQ ID NO: 27 (CAAGATTTACCTCTATTGTTGGATCATATT) or SEQ ID NO: 28 (TAAAACAAGATTTACCTCTATTGTTGGATC) or their respective equivalents. In one aspect, the morpholino oligonucleotide is contacted simultaneously with the vector or subsequently to the vector. Alternatively, the morpholino oligonucleotide is contacted prior to the vector. Non-limiting examples of bispecific antibodies include a polypeptide sequence at least 95% identical to any one of SEQ ID NOs: 13 and 15, or alternatively at least 96%, or at least 97%, or at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 13 and 15. In another embodiment, the trispecific antibody comprises a polypeptide sequence at least 95% identical to SEQ ID NO:11, or alternatively at least 96%, or at least 97%, or at least 98%, or at least 99% sequence identity to SEQ ID NO:11.

[0328] In another embodiment, the vector is introduced into the cell by transfection, infection, transformation, electroporation, injection, microinjection, or a combination thereof. Non-limiting examples of cells include fibroblasts, skeletal cells, epithelial cells, muscle cells, neuronal cells, endocrine cells, melanocytes, blood cells, or a combination thereof.

[0329] Additionally, kits are provided which contain one or more of the vectors, cells or compositions described herein, optionally with instructional or written materials.

[0330] Specific Embodiments There are several methods for modulating gene expression through the principle of exon skipping.

[0331] In one embodiment, at least three exons are required to be able to skip exons in this strategy. In a three-exon structure, there are two splice donors and two splice acceptor sites, as shown in Figure 1. The first donor site is spliced ​​to the first acceptor site ("a" in Figure 1) or alternatively to the second acceptor site ("c" in Figure 1). The second donor site can only be spliced ​​to the second acceptor site ("b" in Figure 1). Thus, there are five possible RNA structures that can result from such a three-exon / two-intron structure, depending on whether no splicing occurs, only one splice event occurs (a, b or c), or two splices occur (a+b).

[0332] Sequence-specific oligonucleotides ("oligos") are constructed that specifically interfere with each of the splicing events, typically at the site of the splice donor or acceptor site or at the binding site for one of the spliceosome components (sometimes in the middle of the intron). In this embodiment, as shown in Figure 1, each oligo is classified as 1-donor (1D), 2-acceptor (1A), 2-donor (2D) or 3-acceptor (3D) based on whether it interferes with the donor or acceptor.

[0333] For example, exon 2 of a gene is skipped in cancer cells but remains in normal cells due to alternative splicing or interference by oligos. In this embodiment, the normal gene containing the skipped exon is not expressed in cancer cells but expresses the protein in normal cells. The sequence of the intron flanking exon 2 in this construct can be used to reproduce the same splicing pattern in the transgene. As a result, a construct containing a transgene in a typical intron-exon-intron structure that is spliced ​​in both normal and tumor cells maintains relatively efficient splicing, resulting in a high level of fully spliced ​​transcripts (exons 1+2+3, utilizing splices a+b). Furthermore, if an oligo blocks splicing of intron a or intron b (or both), exon 2 is skipped to generate a transcript that fuses exon 1 to exon 3. Thus, the relative expected abundance of the "theoretical possible" transcripts shown in Figure 1 has been modified in Figure 2 to show transcripts that may be abundant.

[0334] In one embodiment, based on the splicing concept described above, oligonucleotides and "exon skipping" techniques are used to switch the transgene from a transcript containing exon 1, exon 2 and exon 6 to a transcript containing exon 1 and exon 3. Thus, the construct or vector creates a functional polypeptide encoded by a transcript with exon 1 fused to exon 3. In one embodiment, a stop codon is engineered to be operably linked to exon 2, such that transcription stops at the stop codon before translation of exon 3, without interference by an oligonucleotide to skip exon 2. A premature stop codon results in a non-functional transcript containing exon 1, exon 2 and exon 3. In one embodiment, the stop codons are placed in all three reading frames to ensure complete termination. Since the ribosome stops translating the transcript after the stop codon, which includes exon 3, the baseline of a non-functional transcript (exons 1+2+3) then switches to a functional transcript (exons 1+2), as illustrated in Figure 3.

[0335] The construction of such transgenes is then fairly straightforward, but an intron-exon STOP-intron structure is selected that will be properly "spliced ​​in" under normal circumstances. The intron-exon STOP-intron can be engineered using sequences flanking a normally spliced ​​exon and cloned into a specific site in the transgene resulting in splice donor and acceptor consensus sequences in the flanking bases. The exon should be carefully selected, since the exon in the normal gene from which the sequence was taken will also be skipped. For example, the intron-exon-intron can be derived from a spliced ​​DNA viral gene, in which case normal cellular genes are expected to be unaffected. Alternatively, if the gene therapy application is for cancer, one may consider utilizing an intron-exon-intron boundary from an oncogene that may result in an incomplete oncogene. Such a strategy exploits off-target skipping of cellular genes as a potential "bonus" therapeutic effect.

[0336] Some exons are differentially regulated in cancer cells compared to normal cells. For example, a splice 2 type exon is "spliced ​​in" in normal cells but excluded from the same gene in certain cancer cells. In that case, using the intron-exon-intron boundary of the splice 2 type exon in the construct (see Figure 4), the baseline and skipped expression of the transgene differs between normal and cancer cells as shown in Figure 5. Since the engineered exon STOP is not normally present in cancer cells, the transgene is activated in cancer cells but not in normal cells (Figure 5). Such exons can be used to selectively express a transgene in cancer cells and not in normal cells even in the absence of any exon skipping. Such a scenario may be desirable, for example, for a toxin gene or a prodrug enzyme. Skipping exon 2 using an oligo can activate the transgene in normal cells and increase expression in cancer cells if baseline skipping in cancer cells is less than 100%.

[0337] Conversely, splice 3 exons are excluded in normal cells but "spliced ​​in" in certain cancer cells, thus exploiting regulated splicing of such exons to achieve the opposite result to splice 2, as shown in Figure 6.

[0338] In summary, strategies are disclosed for controlling transgene expression in gene therapy to achieve the following:

[0339] Strategy #1: Activation of transgene expression relies on administration of exon-skipping oligonucleotides. This effect is seen in both normal and cancer cells.

[0340] Strategy #2: In the absence of drugs or exogenously added agents, activation of transgene expression is usually high in certain cancer cells (and only in certain cancers) and low in normal cells. This application can be used for cancer-selective expression for cancers with properly regulated splicing. Administration of exon-skipping oligonucleotides activates expression in normal cells in addition to certain cancer cells.

[0341] Strategy #3: Activation of transgene expression is high in normal cells but low in certain cancer cells. Administration of exon-skipping oligonucleotides activates expression in those cancer cells.

[0342] Although the principles of controllable gene expression can be applied to any gene therapy application, gene therapy for the treatment of cancer is a particular application. In this embodiment, a therapeutic agent expressed in and secreted from normal cells can be activated when needed through administration of an appropriate exon-skipping oligonucleotide.

[0343] For these purposes, applicants designed an intron-exon STOP-intron cassette from exon 1 of the KRAS gene as an example of a construct of Strategy #1 for insertion into a transgene of interest to achieve controllable gene expression. Oligos that induce exon skipping are selected for therapeutic use.

[0344] In one embodiment, applicants utilize the structure of the KRAS gene, one of the most commonly mutated genes in cancer. KRAS is not an enzyme and does not have any obvious drug-binding pockets on its surface, so it could not be targeted by drugs. Thus, to the applicants' knowledge, the present skipping technology is the first method for targeting KRAS in cancer. For these purposes, applicants' constructs utilize the first exon of KRAS in the 5' untranslated region, with the ATG start codon for protein translation inside the second exon. (Thus, the second exon is often called exon 1, and the first exon is exon 0.) Since the ATG start codon is missing, oligos that induce exon skipping of the ATG-containing exon result in a transcript that is not translated normally.

[0345] KRAS-based intron-exon STOP-intron From the Genbank sequence (NCBI reference sequence: NG_007524.1, last accessed on 20 February 2019), the exons of KRAS are located at: 4990..5170, 10526..10647, 28509..28687, 30148..30307, ​​46010..51132, and the cDNA binds: 10537..10647, 28509..28687, 30148..30307, ​​46010..46126.

[0346] The first ATG of the normal KRAS gene is at position 10537.

[0347] The exons to be skipped are between 10526 and 10647 (122 bp).

[0348] The construct contains a pseudoversion with a stop codon in each reading frame.

[0349] In one embodiment, in the case of the KRAS1 exon, the shaded and underlined nucleotides (including the ATG of KRAS) are replaced with a stop codon. [ka]

[0350] Exemplary stop codons are TAA, TAG and TGA. In one embodiment, all three reading frames are: TAAxTAGxTGA (where x is any nucleotide).

[0351] A stop codon can be inserted to engineer all three stop codons twice in a row. Additionally, the 11 base pair repeat can be avoided by using the sequence: TAAxTAGxTGAxTAGxTAAxTGAx (24bp) (SEQ ID NO: 1), where x is any nucleotide. A specific embodiment is: TAATTAGCTGAGTAGATAAGTGAT (SEQ ID NO: 2). As a result, one embodiment containing the exon Kras1STOP (stop codon is underlined) is: [ka] .

[0352] The canonical upstream intron is 5171 to 10525 (5,355 bp) of the NCBI reference sequence NG_007524.1: "gtacg...ataag", with the remainder of the upstream intron indicated as "...".

[0353] The normal downstream intron is from 10648 to 28508 (17,861 bp) of the NCBI reference sequence NG_007524.1: "gtaaa...ctcag", with the remainder of the downstream intron indicated as "...".

[0354] In one embodiment, the upstream and downstream ends of both introns include approximately 75 base pairs ("bps"). In one embodiment, the upstream intron sequence is as follows: [ka] .

[0355] In one embodiment, the downstream intron sequence is as follows: [ka] .

[0356] Thus, in one embodiment, the sequence below is the intron-exon Kras1STOP-intron sequence (the unhighlighted sequence is the upstream intron, the grey sequence is the intron containing the STOP sequence, and the underlined sequence is the downstream intron): [ka] [ka]

[0357] In one embodiment, a series of oligos can be added that span the exon-downstream intron boundary junction so that exon skipping can be induced. Exon skipping oligos tend to be 20-30 base pairs that are antisense to the DNA.

[0358] In one embodiment, the morpholino binding site is an intron-exon STOP-intron morpholino site from Kras1 (SEQ ID NO: 26). The sequence of the K1ExonStopIntron3' junction sequence is listed below (exons are shown in grey and introns are underlined): [ka] .

[0359] Applicants have generated and tested two morpholino binding sites, designated KTS1 (SEQ ID NO:24) and KTS2 (SEQ ID NO:25). The KTS1 morpholino sequence comprises the sequence of SEQ ID NO:27. The KTS2 morpholino sequence comprises the sequence of SEQ ID NO:28. Applicants used the KTS2 morpholino reverse sequence (SEQ ID NO:29) as a negative control. [ka]

[0360] In some cases, the splice donor site is A / C AG *** GT A / G AGT (SEQ ID NO: 34), *** " indicates the exon-intron boundary and also indicates the insertion site of the intron-exon STOP-intron sequence.

[0361] In some cases, the splice acceptor is (Py)XCAG *** GG / T (SEQ ID NO: 35) *** " indicates intron-exon boundaries.

[0362] In some cases, exemplary splice donor sites for inserting an intron-exon STOP-intron sequence include AAG-GG (SEQ ID NO:36), CAG-GG (SEQ ID NO:37), AAG-GT (SEQ ID NO:38) or CAG-GT (SEQ ID NO:39), where "-" indicates the insertion site.

[0363] CATAAVERT CONSTRUCTION cancer( C ancer) targeting ( Ta rgeted) AAV Expression ( e xpressed,)adjustment( r egulated) T To create a (CATAAVERT) linker (also called "TransSkip"), an intron-exon Kras1STOP-intron sequence is inserted into the coding region at the site generating a consensus splice donor and acceptor site. In one embodiment, a vector containing a regulated CATAAVERT expresses CD3 and GD2.

[0364] In another embodiment, the vector comprises a sequence encoding the secreton-AA-CD3xGD2-HDD dimate. For this construct, the sequence of the secreton-AA-CD3xGD2-HDD dimate includes all of the potential sites (highlighted in grey) for inserting an intron-exon Kras1 stop-intron to generate a consensus splice donor / acceptor (insert sequence after one or more 5 bp thirds of the potential sites), and is provided below. [ka] [ka]

[0365] In one embodiment, an insertion is made at the most upstream site to minimize the length of the CD3xGD2 dimer translated before the stop codon (the underlined sequence is the splice junction that is retained in the mRNA when the intron is spliced, the double underlined sequence is the splice donor site at the beginning of the upstream intron sequence, the sequence shown in grey is the exon containing the STOP sequence, and the sequence shown in bold is the downstream intron). In some cases, this sequence is referred to as CD3xGD2K1 dimer: [ka] [ka] [ka] .

[0366] In some cases, the upstream splicing factor binding site is modified (the modified region is shown in italics and bold). The underlined sequence is the splice junction that is retained in the mRNA when the intron is spliced ​​out, the double underlined sequence is the splice donor site at the beginning of the upstream intron sequence, the grey sequence is the exon containing the STOP sequence, and the bold sequence is the downstream intron. In some cases, this sequence is referred to as the CD3xGD2K2 dimer: [ka] [ka] .

[0367] In some cases, the CD3xGD2 dimer construct comprises one or more further modifications in the polynucleotide sequence. In some cases, the CD3xGD2 dimer construct is sec2A-CD3xGD2-HDD-K3, the sequence of which is shown as SEQ ID NO: 41. The underlined sequence is the splice junction that is retained in the mRNA when the intron is spliced ​​out, the double underlined sequence is the splice donor site at the beginning of the upstream intron sequence, the grey sequence is the exon containing the STOP sequence, and the bold sequence is the downstream intron. SEQ ID NO:41 [ka] [ka] [ka]

[0368] In some cases, the CD3xGD2 dimer construct is sec2A-CD3xGD2-HDD-K4, the sequence of which is shown as SEQ ID NO: 42. The underlined sequence is the splice junction that is retained in the mRNA when the intron is spliced ​​out, the double underlined sequence is the splice donor site at the start of the upstream intron sequence, the grey sequence is the exon containing the STOP sequence, and the bold sequence is the downstream intron. SEQ ID NO:42 [ka] [ka]

[0369] In some cases, the CD3xGD2 dimer construct is sec2A-CD3xGD2-HDD-K5, the sequence of which is shown as SEQ ID NO: 43. The underlined sequence is the splice junction that is retained in the mRNA when the intron is spliced ​​out, the double underlined sequence is the splice donor site at the start of the upstream intron sequence, the grey sequence is the exon containing the STOP sequence, and the bold sequence is the downstream intron. SEQ ID NO:43 [ka] [ka] [ka]

[0370] In some embodiments, the dimers described herein include a CD3 sequence, a CD19 sequence, and optionally a secreton sequence. In some cases, the dimers include the CD3xCD19 construct shown in SEQ ID NO: 44, which highlights all of the potential sites for inserting an intron-exon-Kras1 stop-intron sequence to generate a consensus splice donor / acceptor site. Each potential insertion site is highlighted in gray. SEQ ID NO:44 [ka] [ka]

[0371] In some cases, the insertion is made at the most upstream site. In some cases, the dimer further comprises a secreton sequence. In some cases, the CD3xCD19 construct is sec1A-CD3xCD19-K1, the sequence of which is shown as SEQ ID NO: 45. As shown below, the underlined sequences are the splice junctions that are retained in the mRNA when the intron is spliced, the italicized and bolded sequences are the upstream intron sequences, the grey sequences are the exons containing the STOP sequence, and the bolded sequences are the downstream introns. SEQ ID NO:45 [ka] [ka]

[0372] In some cases, the CD3xCD19 construct is sec1A-CD3xCD19-K3, the sequence of which is shown as SEQ ID NO: 46. As shown below, the underlined sequences are the splice junctions that are retained in the mRNA when the intron is spliced ​​out, the italicized and bolded regions are the modified regions of the upstream splicing factor binding sites, the grey sequences are the exons containing the STOP sequences, and the bolded sequences are the downstream introns. SEQ ID NO:46 [ka] [ka] EXAMPLES

[0373] These examples are provided for illustrative purposes only and are not intended to limit the scope of the claims provided herein. [Example 1] Generation of CD3xGD2-HDD Dimates Utilizing Exemplary CD3xGD2-HDD TransJoins

[0374] Map of an exemplary AAV construct for testing CD3xGD2-HDD expression.

[0375] As a proof of principle, we expressed a previously described bispecific molecule targeting human CD3 on T cells and disialoganglioside GD2 on neuroblastoma and other types of cancer cells. As reported in Ahmed et al., OncoImmunology, 4:4, e989776, DOI:10.4161 / 2162402X.2014.989776, this bispecific protein has the amino acid sequences of the heavy and light variable regions for human CD3 from clone OKT3 fused by a short linker (L) to an scFv construct against GD2 from clone 5F11, linked as a dimer by the HNF1a dimerization domain (HDD) (using the format for single chain variable fragments, scFvs). To reverse engineer the optimal human DNA coding sequence for CD3xGD2-HDD, we used the vectorbuilder.com codon optimization tool (http: / / en.vectorbuilder.com / tool / codon-optimization.html). The resulting DNA sequence beginning with an ATG start codon was synthesized and cloned downstream of the chicken-actin-b-globin promoter (CAGp) in an adenovirus-associated virus expression cassette with an inverted terminal sequence from AAV2. Based on the finding that alanine enhances secretion depending on the protein, three other versions were generated that contain a consensus secretion signal domain ("secrecon", based on Barash et al., Biochem Biophys Res Commun. 2002;294:835-842) downstream of the ATG start site and end with 0, 1 or 2 alanines (Gueler-Gane et al., PLoS ONE 11(5):e0155340.doi:10.1371 / journal.pone.0155340). The proteins derived from these constructs were called heterodimeric scFvs or dimers. Figure 7 shows four exemplary CD3xGD2-HDD dimer constructs.

[0376] Assays for determining dimer structure and function.

[0377] 293T cells were transduced with AAV expression vector (or control), and the supernatant was collected and stored. The supernatant was tested for the presence of the correct size protein on electrophoresis (SDS-PAGE), for binding to CD3 by binding competition assay using flow cytometry, for T cell activation by flow cytometry, and for tumor cell killing when co-incubated with T cells. See Figure 8, which shows a diagrammatic representation of the assay for determining the structure and function of the dimers disclosed herein.

[0378] The three constructs containing the secretory peptide show less CD3xGD2-HDD dimate retained intracellularly.

[0379] Whole cell lysates of 293T cells transfected with different AAV CD3xGD2-HDD expression plasmids were collected 48 hours after transfection. Polyacrylamide electrophoresis (PAGE) was performed using 50ug total protein per lane, and the gels were stained with Ponceau S. The results showed more protein using construct #1104 lacking the secretory sequence, but all three constructs with secretory sequences showed less protein. Controls included cells alone or cells transfected with a control plasmid (pcDNA3-GFP). KDa, kilodaltons; Sec, secretory domain; GFP, green fluorescent protein; MW, molecular weight. See Figure 9.

[0380] Only supernatants from cells transfected with the AAV CD3xGD2-HDD construct containing the secretory sequence bind and activate T cells.

[0381] Supernatants were tested for binding to and activation of human T cells. Binding was determined by competition with fluorescently labeled anti-CD3 antibodies prebound to T (Jurkat) cells. Stained cells showed 77.6%, 79.24% and 78.7% (Q2+Q3) CD3 positivity in the control groups (DMEM, Ctrl, GFP), respectively, and 77.7% from AAV vector #1104 lacking the secretory peptide. In contrast, binding of fluorescently labeled anti-CD3 antibodies was reduced to 2.15%, 3.67% and 3.99% (Q2+Q3) by supernatants from cells transfected with each vector containing the secretory peptide. Additionally, cells were co-stained with anti-CD69 as a marker of T cell activation. The control group and AAV vector #1104 all showed less than 13.4% CD69 positivity (Q1+Q2), whereas the three different secretion-containing AAV vectors showed 58.87-68.5% CD69 positivity. See Figure 10.

[0382] Method details: Jurkat2e5 cells / well in 400ul RPMI+10%FBS were seeded in 24-well plates, then 100ul of supernatant from 293 T transfected cells (20% of total culture) was added to each well. After 48 hours of incubation, Jurkat cells were spun down, washed once with PBS, and then stained with PE-anti-hCD69 (1:100) and PerCP-anti-hCD3e (1:300#OKT3) for 30 minutes on ice. After washing with FACS buffer, each sample was fixed in 1% PFA and analyzed by flow cytometry. DMEM is only medium added to Jurkat, Ctrl is added supernatant from untransfected 293T cells, and GFP is added supernatant from 293T cells transfected with an AAV plasmid expressing GFP.

[0383] Only supernatants from cells transfected with AAV vectors containing the secreted peptide activate human T cells.

[0384] Human T (Jurkat) cells were incubated with supernatants from 293T cells transfected with various AAV vectors, stained for CD69 with PE-labeled antibodies, and examined under fluorescence microscopy. See FIG. 11, where the left panel is phase contrast and the right panel is fluorescence. Neither the EGFP vector control nor the vector lacking the secretory peptide #1104 showed positive staining, while the other three vectors showed high levels of staining (red). Method details: Jurkat2e5 cells / well in 400ul of RPMI+10%FBS were seeded in 24-well plates, then 100ul of supernatant from 293 T transfected cells (20% of the total culture) was added to each well. After 48 hours of incubation, Jurkat cells were spun down, washed once with PBS, and then stained with phycoerythrin (PE)-anti-hCD69 (1:100) for 30 minutes on ice. After washing with FACS buffer, each sample was fixed in 1% PFA for 5 min. Scale bar: 100 um.

[0385] Binding of CD3xGD2-HDD to T cells is dose-dependent.

[0386] Various amounts of supernatant from 293T cells transfected with AAV plasmids containing different secretory peptides were incubated and tested for competition with peridinin chlorophyll protein complex (PerCP)-conjugated anti-hCD3 on JurkatT cells. See FIG. 12A, in which the left panel shows FACS plots and the right panel shows median staining levels. The gray shading in the left panel shows no staining, and the dark gray line in each panel shows maximum staining cells without added supernatant. FIG. 12B shows a bar graph of median staining levels normalized to unstained control.

[0387] Method details: Jurkat2e5 cells / well in 400ul RPMI+10%FBS were seeded in 24-well plates, then 10ul, 25ul, 50ul or 100ul of supernatant from 293T transfected cells (2-20% of total culture) was added to each well. After 24 hours of incubation, Jurkat cells were spun down, washed once with PBS, then stained with PerCP-anti-hCD3e (1:300#OKT3) for 30 minutes on ice. After washing with FACS buffer, each sample was fixed in 1% PFA for 5 minutes before being analyzed by flow cytometry. Sec=secreted peptide, A=alanine.

[0388] Binding assay of the CD3xGD2-HDD dimer to the anti-GD2 arm and confirmation that both GD2 and CD3 binding are present on a single molecule.

[0389] Binding of CD3xGD2-HDD to GD2 was indirectly measured by first incubating supernatant from 293T transfected cells with either GD2-positive or GD2-negative cells and then repeating the CD3 T cell binding competition assay. Proteins that bind GD2 should be taken up by GD2-positive cells but not by GD2-negative cells, resulting in a loss of competition for T cell binding. This assay was so designed to confirm that the GD2 binding was co-linked to the CD3 binding, in other words, that the single molecule is bispecific. See Figure 13 for an illustrated representation of the binding assay.

[0390] CD3xGD2-HDD binds both CD3 and GD2.

[0391] As shown in Figure 13, the supernatant from 293T cells transfected with #1101 CD3xGD2-HDD AAV vector was collected and pre-incubated with GD2-positive SK-N-Be(2) or GD2-negative Raji cells. After centrifugation and washing, binding competition assays were performed against CD3 T (Jurkat) cells.

[0392] FIG. 14 shows an exemplary CD3xGD2-HDD dimer that binds both CD3 and GD2. The grey shading in the top panel with black outlines are unstained Jurkat T cells, and the dark grey line is Jurkat T cells fully stained for CD3 without added supernatant. Sample Jurkat_cd3e showed fully competitive CD3 binding when using supernatant without preincubation, nearly overlapping with supernatant preincubated with GD2-negative Raji cells. In contrast, sample Jurkat_cd3e sknbe2 showed loss of competition when supernatant was preincubated with GD2-positive SK-N-Be(2) neuroblastoma cells, confirming that the same molecule binds both CD3 and GD2.

[0393] Assay to determine whether CD3xGD2-HDD induces GD2+ target cell killing by T cells.

[0394] Figure 15 shows the flow chart of the assay to determine whether CD3xGD2-HDD induces GD2+ target cell killing by T cells. As shown in Figure 15, GD2+ neuroblastoma (SK-N-Be(2)) cells are seeded into wells, followed by primary human T cells (purchased from StemExpress) and supernatants from 293T cells transfected with AAV vectors. Cell viability is assessed using CellTiter-Glo from Promega (Madison, WI).

[0395] Secreted CD3xGD2-HDD induces T cell killing of neuroblastoma cells.

[0396] Using the assay shown in Figure 15, the cytotoxicity of human T cells + supernatants (from 293T cells transfected with various AAV vector plasmids) was tested against GD2 + SK-N-Be(2) neuroblastoma cells. A T cell to target cell ratio of 10:1 was used. After 48 hours in co-culture, cells were assayed for viability. Compared to supernatants from untransfected cells ("no dimer"), there was no discernible cytotoxicity using supernatants from cells transfected with constructs expressing an irrelevant dimer (CD19xCD3) or a vector lacking the secreted peptide (#1104) (Figure 16). In contrast, supernatants from cells transfected with each of the vectors containing the secreted peptide induced statistically significant cytotoxicity (p<0.001), killing 25-30% of the cells (Figure 16).

[0397] T cell-mediated cytotoxicity by CD3xGD2-HDD dimers is associated with GD2 expression.

[0398] A panel of neuroblastoma cell lines was tested for their susceptibility to killing by human T cells in combination with supernatant from AAV vector #1101 (Figure 17, top panel) and their GD2 expression was measured by flow cytometry (Figure 17, bottom graph, shaded curve is isotype control). CHP-134 cells showed the highest cytotoxicity and the highest GD2 expression. [Example 2] Generation of CD19xCD3 Dimates Utilizing Exemplary CD19xCD3TransJoins

[0399] Map of an exemplary AAV construct for testing CD19xCD3 dimer expression.

[0400] An FDA-approved protein therapeutic known as blinatumomab, a so-called bispecific T cell engager (BiTE), was generated to target human CD19 on B / B cell malignancies and human CD3 on T cells. Using the publicly available amino acid sequence of blinatumomab (http: / / www.drugbank.ca / drugs / DB09052), we further used the vectorbuilder.com codon optimization tool (http: / / en.vectorbuilder.com / tool / codon-optimization.html) to reverse engineer an optimal human DNA coding sequence for CD19xCD3. The resulting DNA sequence, beginning with an ATG start codon, was synthesized and cloned downstream of the chicken-actin-b-globin promoter (CAGp) in an adenovirus-associated virus expression cassette with an AAV2-derived terminal inverted sequence. Based on the finding that alanine enhances secretion depending on the protein, three other versions were generated that contain a consensus secretion signal domain ("secrecon", based on Barash et al., Biochem Biophys Res Commun. 2002;294:835-842) downstream of the ATG start site and end with 0, 1 or 2 alanines (Gueler-Gane et al., PLoS ONE 11(5):e0155340.doi:10.1371 / journal.pone.0155340). Proteins derived from these constructs were called heterodimeric scFvs or dimers. Figures 18A and 18B show five exemplary CD19xCD3 constructs.

[0401] FIG. 18C shows a pictorial representation of CD19 dimers interacting with cancer cells and T cells. CD19 dimers are produced by cells containing CD19TransJoin. When administered to a subject, for example, intravenously, AAV TransJoin (e.g., AAV CD19 TransJoin as shown in this figure) enters normal cells such as liver or muscle and expresses the polypeptide that AAV TransJoin encodes. The secretory signal peptide is cleaved during secretion, leaving behind an active dimer that binds cancer cells (Ca) on one end and T immune cells on the other end.

[0402] Only supernatants from cells transfected with the AAV CD19xCD2 construct containing the secretory sequence bind and activate T cells.

[0403] Supernatants were tested for binding to and activation of human T cells. Binding was determined by competition with fluorescently labeled anti-CD3 antibodies prebound to human T (Jurkat) cells. Stained cells showed 77.6%, 79.24% and 78.7% (Q2+Q3) CD3 positivity in the control groups (DMEM, Ctrl, GFP), respectively, and 79.4% from vector #1323 lacking the secretory peptide. In contrast, binding of fluorescently labeled anti-CD3 antibodies was reduced to 23.88%, 18.59% and 30.76% (Q2+Q3) by supernatants from cells transfected with each vector containing the secretory peptide. Additionally, cells were co-stained with anti-CD69 as a marker of T cell activation. The control group and #1323 all showed less than 13.38% CD69 positivity (Q1+Q2), while the three different secretion-containing vectors showed 63.9%, 67.3% and 66.6% CD69 positivity (Figure 19).

[0404] Method details: Jurkat2e5 cells / well in 400ul RPMI+10%FBS were seeded in 24-well plates, then 100ul of supernatant from 293 T transfected cells (20% of total culture) was added to each well. After 48 hours of incubation, Jurkat cells were spun down, washed once with PBS, and then stained with PE-anti-hCD69 (1:100) and PerCP-anti-hCD3e (1:300#OKT3) for 30 minutes on ice. After washing with FACS buffer, each sample was fixed in 1% PFA and analyzed by flow cytometry. DMEM is only medium added to Jurkat, Ctrl is added supernatant from untransfected 293T cells, and GFP is added supernatant from 293T cells transfected with an AAV plasmid expressing GFP.

[0405] Only supernatants from cells transfected with AAV vectors containing the secreted peptide activate human T cells.

[0406] Human T (Jurkat) cells were incubated with supernatants from 293T cells transfected with various AAV vectors, stained with PE-labeled antibodies against CD69, and examined under fluorescent microscopy. See Figure 20, left panel is phase contrast, right panel is fluorescence. Neither the EGFP vector control nor the AAV vector #1323 lacking the secretory peptide showed positive staining, while the other three vectors showed high levels of staining (red).

[0407] Method details: Jurkat2e5 cells / well in 400ul RPMI+10%FBS were seeded in 24-well plates, then 100ul of supernatant from 293 T transfected cells (20% of total culture) was added to each well. After 48 hours of incubation, Jurkat cells were spun down, washed once with PBS, and then stained with phycoerythrin (PE)-anti-hCD69 (1:100) for 30 minutes on ice. After washing with FACS buffer, each sample was fixed in 1% PFA for 5 minutes. Scale bar: 100um.

[0408] AAV-secreted CD19xCD3 specifically binds CD19, but not CD45.

[0409] Using a binding competition assay, we determined whether supernatants from AAV vector-transfected 293T cells interfered with the staining of Epstein-Barr virus (EBV)-transformed human B cells by two different antibodies, one that stains the B cell marker CD19 and the other that stains the pan-leukocyte marker CD45.

[0410] Cells in the three control groups (DMEM, Ctrl, GFP) showed 93%, 93.1% and 93.2% positive staining (Q1+Q2) for CD19, respectively, and supernatants from cells transfected with AAV vector #1323 lacking the secretory peptide did not compete the staining and showed 93.2% positivity for CD19, see FIG. 21. In contrast, each of the AAV vectors containing the secretory peptide competed the CD19 signal down to 33.33%, 31.07% and 35.88%. Note that the cutoff was set so that unstained cells showed 14.58% positivity for CD19, suggesting that the supernatants from cells transfected with these three AAV vectors competed down to 2-fold background. In contrast, none of the vectors competed for CD45 staining, which was 78.89%, 79.14% and 78.32% positive in the three controls (Q2+Q3), 82.9% positive in the vector lacking the secretory peptide, and 80.5%, 78.5% and 79.4% positive using supernatants from cells transfected with the other three vectors.

[0411] Method details: B cells transformed by EBV (Gene Ther. 2013 July;20(7):761-9. doi:10.1038 / gt.2012.93), called NB122R, were seeded in 24-well plates at 2e5 cells / well in 400ul of RPMI+10%FBS, then 100ul of supernatant from 293T transfected cells (2-20% of total culture) was added to each well. After 24 hours of incubation, cells were spun down, washed once with PBS, and then stained with PEcy7-anti-hCD45 (1:100) and APC-anti-hCD19 (1:300) for 30 minutes on ice. After washing with FACS buffer, each sample was fixed in 1% PFA for 5 minutes before flow cytometry analysis. DMEM is media only added to Jurkat, Ctrl is added supernatant from untransfected 293T cells, and GFP is added supernatant from 293T cells transfected with an AAV plasmid expressing GFP.

[0412] Binding of CD19xCD3 to T cells is dose-dependent, and vectors containing a single alanine downstream of the secretory peptide consensus sequence are superior compared to other vectors tested.

[0413] Various amounts of supernatant from 293T cells transfected with AAV plasmids containing different secretory peptides were incubated and tested for competition with peridinin chlorophyll protein complex (PerCP)-conjugated anti-hCD3 on JurkatT cells. See FIG. 22A, where the left panel shows FACS plots and the right panel shows median staining levels. The grey shading in each of the left panels is unstained cells, and the dark grey line in each of the left panels is maximally stained cells without added supernatant. FIG. 22B shows a bar graph of median staining levels normalized to the unstained control. The vector #1325, which has a single alanine downstream of the secretory peptide consensus sequence, showed the greatest competition compared to the other tested vectors and was selected for further experiments.

[0414] Method details: Jurkat2e5 cells / well in 400ul RPMI+10%FBS were seeded in 24-well plates, then 10ul, 25ul, 50ul or 100ul of supernatant from 293T transfected cells (2-20% of total culture) was added to each well. After 24 hours of incubation, Jurkat cells were spun down, washed once with PBS, then stained with PerCP-anti-hCD3e (1:300#OKT3) for 30 minutes on ice. After washing with FACS buffer, each sample was fixed in 1% PFA for 5 minutes before being analyzed by flow cytometry. MFI=mean fluorescence intensity, Sec=secreted peptide, A=alanine.

[0415] Binding of CD19xCD3 to B cells is dose-dependent, and vectors containing a single alanine downstream of the secretory peptide consensus sequence are superior compared to other vectors tested.

[0416] Various amounts of supernatant from 293T cells transfected with AAV plasmids containing different secretory peptides were incubated and tested for competition with allophycocyanin (APC)-conjugated anti-hCD19 on human B cells. See FIG. 23A, where the left panel shows FACS plots and the right panel shows median staining levels. The grey shading in each of the left panels is unstained, and the dark grey line in each of the left panels is the maximally stained cells without added supernatant. FIG. 23B shows a bar graph of median staining levels normalized to the unstained control. The vector with a single alanine at the end of the secretory peptide, #1325, showed the greatest competition, consistent with the results for T cell binding shown in FIG. 22A and FIG. 22B, and was selected for further experiments.

[0417] Method details: NB122R human B cells at 2e5 cells / well in 400ul RPMI+10%FBS were seeded in 24-well plates, then 10ul, 25ul, 50ul or 100ul of supernatant from 293T transfected cells (2-20% of total culture) was added to each well. After 24 hours of incubation, cells were spun down, washed once with PBS, then stained with APC-anti-hCD19 (1:300) for 30 minutes on ice. After washing with FACS buffer, each sample was fixed in 1% PFA for 5 minutes before being analyzed by flow cytometry. MFI=mean fluorescence intensity, Sec=secreted peptide, A=alanine.

[0418] CD3 dimates activate T cells through anti-CD28 costimulation better than anti-CD3 antibodies.

[0419] Human T (Jurkat) cells were co-incubated with anti-CD28 antibody and supernatants from AAV vector-transfected 293T cells (left panel of FIG. 24) or increasing concentrations of anti-CD3 antibody (right panel of FIG. 24). Cellular mRNA was harvested and quantitative reverse transcriptase polymerase chain reaction (RT-PCR) was performed on IL-2 (top panel of FIG. 24) and IL-8 (bottom panel of FIG. 24) mRNAs and expression was calculated relative to the housekeeping mRNA GAPDH. Only supernatants from cells transfected with AAV vector constructs containing secretory domains showed stimulation of any gene over controls (gfp, 293t) and over vector constructs lacking the secretory domain (#1104 for CD3xGD2-HDD and #1323 for CD19xCD3).

[0420] 293T cells provide the highest transduction efficiency for AAV8.

[0421] Four different cell lines were infected with two different concentrations of AAV8 expressing green fluorescent protein (GFP) at a multiplicity of infection (MOI) of 1e4 or 1e5 genome copies (gc) using 2% fetal bovine serum-containing medium. 48 hours after virus infection, GFP signals were evaluated by fluorescence microscopy. See Figure 25. AML-12: mouse normal hepatocytes; 293T: human embryonic kidney cells transformed with SV40-T antigen; H441-CRM: human lung cancer cells with KRAS mutation; SK-N-Be(2): human neuroblastoma cells with NMYC amplification.

[0422] The dimate concentration in the supernatant of AAV8-infected cells is dependent on the AAV dose and transduction efficiency.

[0423] T (Jurkat) binding assays were performed on supernatants from 293T and H441 cells transfected with TransJoin vector or AAV-GFP control. The grey shading in the panels are unstained control cells, and the dark grey line in each panel is T cells fully stained with anti-CD3 antibody, see FIG. 26. CD19xCD3 dimates appeared to be much more effective than CD3xGD2-HDD dimates in competing for binding, but the effect was dose-dependent (the higher the MOI, the more the curve shifted to the left) and was not seen in a cell line with low AAV8 transduction efficiency (H441 cells). MOI, efficiency of infection.

[0424] A single intravenous injection of CD19xCD3 TransJoin selectively depletes B cells in humanized mice.

[0425] We purchased immunodeficient mice (NSG-SGM3, Jackson Labs) that were irradiated and injected intravenously with human CD34+ hematopoietic stem cells. By 12 weeks, the mice showed engraftment of human blood cells by flow cytometry of peripheral blood, including T and B lymphocytes. As shown in Figure 27, mice were given a single injection of CD19xCD3 TransJoin (AAV8-Sec1A-CAG-193, vector #1325 packaged in an AAV8 capsid) at various doses, and blood was analyzed by flow cytometry for human lymphocytes harvested at various time points. Low doses (5e9 and 5e10 vector genomes (vg) / kilogram (kg) body weight) were ineffective, but higher doses (5e11 and 5e12 vg / kg) were sufficient to eliminate circulating B cells without affecting CD4+ or CD8+ T cells.

[0426] A single intravenous injection of CD19xCD3 TransJoin results in long-term B cell depletion in humanized mice.

[0427] Humanized mice were treated with a single dose of CD19xCD3 AAV8 TransJoin and subsequently blood lymphocyte subsets were measured. As shown in Figure 28 for a single mouse, long-term selective B cell depletion was observed in all mice analyzed as long as these mice remained viable.

[0428] 1 shows that a single intravenous injection of CD19xCD3 TransJoin eliminates CD19+ lymphomas in humanized mice.

[0429] Human CD19+ Raji cells (derived from a patient with Burkitt's lymphoma) were implanted into the flanks of two humanized mice and grown to 250 mm 3The tumors were then waited until they reached a size exceeding 100 μg / kg. One animal was then injected into the tail vein with a control AAV virus, AAVGFP, and the second animal was injected into the tail vein with CD19xCD3 AAV8 TransJoin. The tumors in the control mice eventually grew rapidly and the animals had to be euthanized. The tumors in the TransJoin-treated mice grew slowly and then eventually shrank almost completely. See FIG. 29. Although the animals had to be sacrificed due to symptoms of graft-versus-host disease, a known consequence in humanized mice, this experiment demonstrates the proof of principle that a single TransJoin injection can treat cancer. [Example 3] Use of OncoSkip and TransSkip to simultaneously target oncogene expression and activate therapeutic transgene expression

[0430] Overview of OncoSkip and TransSkip described herein.

[0431] OncoSkip is an antisense morpholino that induces exon skipping of oncogenes. In some embodiments, OncoSkip is designed as an antisense morpholino that induces exon skipping of critical exons in oncogenes (left side of FIG. 30). For proof of principle, KRAS (exons 1, 2, 3 represented by black-gold-gray on the left side of FIG. 30) was used to test a morpholino containing an ATG start site (shown as a small light gray bar above the oncogene in FIG. 30) designed to skip KRAS exon 2 so that normal expression of the oncogene is reduced. A derivative of the same exon to be skipped is then made, but mutated to contain multiple stop codons in each reading frame, along with flanking intron sequences. A new intron-exon (stop)-intron is then inserted into the transgene coding sequence at the site that reforms the donor and acceptor splice sites so that it is spliced ​​into the transgene mRNA and interrupts the normal coding sequence. In the presence of an antisense morpholino (small light grey bar above the oncogene), the newly inserted exon is skipped and the coding sequence is religated to generate a functional product. The class of AAV vectors that contain genes interrupted by intron-exon-intron sequences are called TransSkip viruses, and the class of morpholinos designed to downregulate oncogenes are called OncoSkips.

[0432] KRAS OncoSkip antisense morpholino induces exon skipping of endogenous KRAS in lung cancer cells.

[0433] Lung cancer cell lines A549 and H441 (not shown) were incubated with KTS1 and KTS2 OncoSkip antisense morpholinos, as well as a reverse control morpholino against KTS2. Both KTS1 and KTS2 were designed to bind to the 3-prime end of the exon-intron junction of KRAS exon 2 and induce skipping of exon 2 since exon 2 contains the ATG start site. Endogenous KRAS mRNA was then analyzed by reverse transcriptase RT-PCR for the presence of exon 2 by PCR with primers present in exon 1 (forward) and exon 2 (reverse). As a control for total KRAS mRNA, primers in exon 4 were used. A dose-dependent reduction of transcripts containing exon 2 ("exon 1+2") was observed with both OncoSkip morpholinos. See FIG. 31.

[0434] AAV vector map of CD3xGD2-HDD TransSkip showing the reverse engineered introns flanking the exons inserted into the CD3xGD2-HDD dimer coding sequence.

[0435] We synthesized a 3-prime sequence of the human intron (Ki1) upstream of KRAS exon 2, a derivative of KRAS exon 2 mutated to multiple stop codons in all three reading frames (STOP), and a 5-prime sequence of the human intron (Ki) downstream of KRAS exon 2, and cloned the cassette into the gene sequence encoding the GD2 dimer in a specific sequence that reproduces the consensus splice donor and acceptor sites. See Figure 32. When the new STOP exon is spliced ​​into the transcript, no functional dimer is produced. When cells are exposed to an antisense morpholino that binds the 3-prime exon-intron junction, the STOP exon is skipped and the full-length dimer mRNA is expressed. The KRAS sequence was chosen such that antisense morpholinos designed to cause exon 2 skipping would concomitantly alter mRNA splicing of the TransSkip transgene, resulting in expression of the full-length dimer in transduced cells, and because exon 2 contains the KRAS ATG start codon, reduce or eliminate native KRAS expression in cancer cells.

[0436] Exemplary strategies for testing OncoSkip and TransSkip activity.

[0437] As shown in Figure 33, cell pellets and supernatants were collected from 293T cells transduced with AAV dimer vectors. mRNA was isolated from the cell pellets and subjected to reverse transcriptase RT-PCR to determine the extent to which the artificial exons in the transgene were spliced ​​into the mRNA. Supernatants were analyzed for dimer expression by T cell binding and killing assays.

[0438] Antisense morpholinos induce exon skipping of the CD3xGD2-HDD TransSkip transgene.

[0439] 293T cells were transfected with CD3xGD2-HDD dimer plasmid #1042. Cells were harvested 48 hours post-transfection for total RNA isolation. Approximately 1ug of RNA was used for RT-PCR. Lane #9 shows full-length transgene RNA between the primers without splicing using DNA plasmid as template, see FIG. 34. Lanes 7 and 8 as well as the control lane are without antisense morpholino and show that the majority of transcripts contain internal exons (stripped rectangles). There are some transcripts with exons excluded (smallest bands), suggesting that this construct has some "leakage" of activated transcripts. Inclusion of either morpholino (KTS1, KTS2) dose-dependently reduces the percentage of inactivated exon-containing transcripts (219bp) and increases activated transcripts that exclude exons (97bp).

[0440] KRAS OncoSkip induces secreted expression of CD3xGD2-HDD dimers in cells transfected with the CD3xGD2-HDD TransSkip AAV vector.

[0441] Supernatants were collected from transfected 293T cells and tested for T cell binding (interference by fluorescently labeled anti-CD3 antibody). As shown in Figure 35, the grey line in the top panel is unstained T (Jurkat) cells, and the dark grey line in the top panel is T cells completely stained by anti-CD3 antibody. As a positive control, supernatants from cells transfected with constitutively expressed CD3xGD2-HDD TransJoin#1011 almost completely competed with anti-CD3 staining. Supernatants from cells transfected with CD3xGD2-HDD TransSkip#1042 showed intermediate competition consistent with some "leakage" of exon-skipped dimer mRNA, further induced with either OncoSkip morpholino (KTS1, KTS2).

[0442] Exon skipping of CD3xGD2-HDD TransSkip by KRAS OncoSkip is an on-target effect.

[0443] Exon skipping induced by the targeted antisense morpholino KTS2 was compared to a morpholino containing the same bases but with the reversed sequence (Figure 36). KTS2 induced exon skipping in nearly 100% of the transcripts (97bp), while the reversed sequence control morpholino had no effect compared to the Endoporter only (carrier for the morpholino) control.

[0444] Induction of CD3xGD2-HDD dimer expression determined by T cell engagement is an on-target effect.

[0445] Supernatants from 293T cells transfected with CD3xGD2-HDD TransJoin (positive control) and CD3xGD2-HDD TransSkip, incubated without or with various antisense morpholinos, were collected and human T (Jurkat) cell binding assays were performed by flow cytometry (competition for fluorescently labeled anti-CD3 antibody binding). See Figure 37, where the grey lines in the top panel are unstained T cells and the dark grey lines in the top panel are fully stained T cells. The line showing #1101 CD3xGD2-HDD TransJoin is the almost completely competed signal obtained from constitutively expressed GD3 TransJoin. As previously mentioned, supernatants from CD3xGD2-HDD TransSkip transfected cells showed little competition at baseline (#1042 CD3xGD2-HDD TransSkip, no morpholino), which was not altered by the control morpholino (CD3xGD2-HDD TransSkip+“KTS2-Invert ctl”), but were induced to compete with more signal by the on-target “OncoSkip” morpholino, KTS2 (CD3xGD2-HDD TransSkip+KTS2).

[0446] AAV genomic map of exemplary TransSkip splice variants that were generated and tested to reduce baseline TransSkip "leakiness" but maintain inducible exon skipping.

[0447] A splicing variant of TransSkip was engineered to reduce the baseline exon skipping observed with CD3xGD2-HDD TransSkip. To increase transgene expression, the Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE) downstream of the coding sequence was used. Due to AAV packaging size constraints, the inclusion of the WPRE sequence required the use of a shorter promoter, so a new set of vectors was created using a promoter derived from a short form of the human eukaryotic translation elongation factor 1 alpha 1 promoter (EFSp). The variants were created by changing specific base pairs in the U2 auxiliary factor (U2AF) binding site located in the polypyrimidine track at the 3-prime end of the first intron (Ki1-5). See Figure 38.

[0448] CD3xGD2-HDD TransSkip splice variant K3 eliminates baseline but maintains inducible exon skipping.

[0449] We transfected 293T cells with a new panel of five different CD3xGD2-HDD TransSkip constructs without and with the KTS2 antisense "OncoSkip" morpholino and compared them to the "Endo only" control with the morpholino carrier but no morpholino. We analyzed the mRNA transcripts by reverse transcriptase RT-PCR and found different phenotypes. As shown in Figure 39, variant K4 had similar (or slightly more) levels of baseline exon skipping than K1, and the inducibility of skipping exceeded that of K1. Variants K2, K3 and K5 did not effectively show baseline skipping. Of these three, variant K3 was the most inducible to skip exons.

[0450] The CD3xGD2-HDD TransSkip variant K3 shows no baseline dimate production but is most inducible by KRAS OncoSkip.

[0451] Using a T (Jurkat) cell binding assay, a panel of CD3xGD2-HDD TransJoin splice variants was tested for the production of secreted CD3xGD2-HDD dimate expression without or with KRAS KTS2 OncoSkip antisense morpholino (far right). As shown in Figure 40, the grey lines in each of the right panels are unstained T cells, dark grey are fully stained T cells, blue are constitutively expressed CD3xGD2-HDD TransJoin, and green are the respective CD3xGD2-HDD TransSkip without OncoSkip ("Endo only"). The sequences show the polypyrimidine U2AF binding sites with engineered grey base pair variants (underlined and italicized) compared to the wild-type KRAS intron sequence (K1). The upper band in the RT-PCR gel is the transcript containing the exon, and the lower band is the transcript with the skipped exon. Variants K1 and K4 show some detectable baseline exon skipping by RT-PCR and significant baseline dimer expression (green, far right), whereas variants K2, K3, and K5 all show no baseline exon skipping by RT-PCR and no dimer expression by binding competition (green, far right). All three of these variants show a small amount of inducible exon skipping by RT-PCR expression in the presence of KRAS antisense morpholino OncoSkip KTS2, and various degrees of dose-dependent dimer expression in the presence of KRAS OncoSkip (light and dark purple represent low and high concentrations, respectively). The K3 variant appeared to be the most inducible, and therefore K3 was selected as the lead construct for further studies.

[0452] OncoSkip-mediated induction of dimer expression from CD3xGD2-HDD TransSkip variants K3 and K5 is an on-target effect.

[0453] RT-PCR and T(Jurkat) binding assays were repeated using CD3xGD2-HDD TransSkip variants K2, K3 and K5, and included the "inverted KTS2" antisense morpholino as a control. See Figure 41. Inverted KTS2 contains the same nucleotide bases as KTS2, except in the reversed order. Inverted KTS2 was unable to induce exon skipping in both K3 and K5 (lower band on gel), whereas the correct KTS2 sequence induced exon skipping in both K3 and K5 (none of the K2 variants induced exon skipping). In the T cell binding assay for dimer expression (rightmost panel), grey is unstained T cells, dark grey is fully stained T cells, blue is constitutively expressed CD3xGD2-HDD TransJoin, purple is KRAS OncoSkip with KTS2 (lighter is lower amount, darker is higher amount), and yellow is reverse KTS2 control. The dimer protein assay is consistent with RT-PCR; none of the morpholinos induced dimer expression from the K2 variant, and only KTS2 OncoSkip induced dimer expression from the K3 and K5 variants, but not the reverse control.

[0454] Secreted dimers derived by OncoSkip from the AAV CD3xGD2-HDD TransSkip vector are functional in mediating T cell killing of neuroblastoma cells.

[0455] Human T cells plus supernatant from 293T cells transfected with various AAV CD3xGD2-HDD TransSkip variants, without and with KRAS OncoSkip KTS2, were tested for cytotoxicity against GDS2+SK-N-Be(2) neuroblastoma cells (Figure 42). A T cell to target cell ratio of 10:1 was used. After 48 hours in co-culture, cells were assayed for viability. Results were normalized to supernatant from non-transfected cells. CD3xGD2-HDD TransSkip variants K1 and K4 showed cytotoxicity in the absence of KRAS OncoSkip KTS2, consistent with baseline exon skipping, and further showed inducible cytotoxicity with K4. CD3xGD2-HDD TransSkip variant K2 showed neither baseline nor inducible cytotoxicity, consistent with its known efficient splicing and exon introduction. In contrast, CD3xGD2-HDD TransSkip variants K3 and K5 showed no baseline but induced cytotoxicity, which was dose-dependent for the K3 variant.

[0456] Transgene exon skipping in cells infected with AAV CD3xGD2-HDD TransSkip variant K3 is inducible and on-target by KRAS OncoSkip.

[0457] Exon skipping in the context of AAV virus infection was examined to determine whether it mirrored what was seen in other studies with AAV plasmid transfection. CD3xGD2-HDD TransSkip variants K1 and K3 were packaged into AAV8 and analyzed for exon introduction ("inactivation") and exclusion ("activation") by RT-PCR 48 hours after AAV infection of 293T cells. Cells were incubated without ("Endo only") or with antisense morpholino KRAS OncoSkip KTS2 or reverse control ("InvtKTS2 Ctl"). As shown in Figure 43, with the vector plasmid, the AAV GD2 K1 variant showed exon skipping at baseline, which was further induced by KRAS OncoSkip KTS2 but not by the control. In contrast, no exon skipping was observed at baseline for the K3 variant, but was observed to be induced by OncoSkip KTS2 (both alone and in complex with the carrier "Vivo-KTS2"). In contrast, no exon skipping was induced at baseline by the control morpholino.

[0458] AAV genomic map of the CD19xCD3 TransSkip splice variant.

[0459] Based on findings from the CD3xGD2-HDD TransSkip study, where variant K3 showed lower baseline but still inducible dimate expression compared to K1, we generated K1 and K3 intron variants inserted into the CD19xCD3 dimate transgene. As with the GD2 series, a WPRE downstream of the coding sequence was used to increase transgene expression, necessitating the use of the shorter promoter EFSp. Ki, sequence derived from part of the KRAS intron. STOP, exon 2 from KRAS mutated to contain a stop codon in all three reading frames. CD19xCD3 For diagrammatic examples of TransSkip constructs, see Figures 44A and 44B.

[0460] FIG. 44C shows a pictorial representation of CD19 dimers interacting with cancer cells and T cells. CD19 dimers are produced by cells containing CD19 TransSkip. When administered to a subject, for example, intravenously, AAV TransSkip (e.g., AAV CD19 TransSkip as shown in this figure) enters normal cells such as liver or muscle, but does not express a polypeptide because an exon containing an intron and a stop codon has been inserted into the normal coding sequence of the transgene. In the presence of an antisense polynucleotide (e.g., a morpholino antisense oligonucleotide) that induces exon skipping, the mRNA transcript processed by the antisense oligonucleotide contains the complete transgene uninterrupted by the STOP exon. Under these circumstances, the polypeptide is synthesized and secreted, and the secretory signal peptide is cleaved during secretion, leaving an active dimer that binds cancer cells (Ca) on one end and T immune cells on the other end.

[0461] OncoSkip morpholinos KTS1 and KTS2 induce on-target exon skipping of CD19xCD3 TransSkip K1.

[0462] As shown in Figure 45, 293T cells were transfected with AAV vectors containing CD19xCD3 TransJoin (positive control, #1325) and CD19xCD3 TransSkip K1 (#1098) without (lane #4) or with co-incubation with a control morpholino (lane #3) or two different KRAS OncoSkip morpholinos (lanes 1 and 2). CD19xCD3 TransSkip K1 showed some baseline exon skipping (presence of a lower "activation" band in lanes 3 and 4), consistent with our findings with the corresponding construct for CD3xGD2-HDD TransSkip. These results indicate that the engineered TransSkip design works similarly with multiple different transgenes.

[0463] KRAS OncoSkip induces secreted expression of CD19xCD3 dimers in cells transfected with the CD19xCD3 TransSkip K1 AAV vector.

[0464] Supernatants were collected from transfected 293T cells and tested for T cell binding (interference by fluorescently labeled anti-CD3 antibody). As shown in Figure 46, the grey lines in the top panel are unstained T (Jurkat) cells, and the dark grey lines in the top panel are T cells completely stained by anti-CD3 antibody. As a positive control, supernatants from cells transfected with constitutively expressed CD19xCD3 TransJoin#1325 were competed for anti-CD3 staining (#1325). Supernatants from cells transfected with CD19xCD3 TransSkip#1098 in the presence of morpholino control showed some baseline competition (KTS2 reverse Ctl) consistent with "leakage" of exon-skipped dimer mRNA, which was further induced by either OncoSkip morpholino (KTS1; KTS2) to the level achieved by constitutive CD19xCD3 TransJoin.

[0465] CD19xCD3 TransSkip splice variant K3 eliminates baseline but maintains inducible exon skipping.

[0466] As shown in FIG. 47, 293T cells were transfected with K1 and K3 CD19xCD3 TransSkip constructs without and with KTS2 antisense "OncoSkip" morpholino or control morpholino ("InvtKTS2 Ctl") and compared to "Endo only" control with morpholino carrier but no morpholino. mRNA transcripts were analyzed by reverse transcriptase RT-PCR. Consistent with the corresponding CD3xGD2-HDD TransJoin construct, variant K1 showed baseline exon skipping. In contrast, variant K3 showed no skipping with baseline skipping ("Endo only") or morpholino control. Skipping was observed with KTS2 OncoSkip with K3 (#1168) variant and was confirmed by analyzing protein expression via T cell binding assay.

[0467] Induction of CD19xCD3 dimer expression from CD19xCD3 TransSkip K3 as determined by T cell binding is an on-target effect.

[0468] Supernatants were collected from 293T cells transfected with CD3xGD2-HDD TransJoin (positive control) and CD19xCD3 TransSkip, incubated without or with various antisense morpholinos, and human T (Jurkat) cell binding assays were performed by flow cytometry (competition for fluorescently labeled anti-CD3 antibody binding). As shown in Figure 48, in each of the upper panels, grey is unstained T cells, dark grey is fully stained T cells, pink is fully stained T cells in the presence of supernatant from untransfected 293T cells, and blue is the signal competed by supernatant from cells transfected with constitutively expressed CD19xCD3 TransJoin#1073. All supernatants from CD19xCD3 TransSkip K1#11166 showed high expression comparable to the positive control CD19xCD3 TransJoin at baseline and with control morpholino, demonstrating that this construct is not suitable for controlling gene expression. In contrast, consistent with our experience with CD3xGD2-HDD TransSkip, CD19xCD3 TransSkip variant K3#1168 showed no baseline expression (green) or expression induced by control morpholino (light and dark orange, "IntCtl"), but dose-dependent expression by KRAS OncoSkip morpholino KTS2 (light and dark purple).

[0469] Induction of CD19xCD3 dimer expression from CD19xCD3 TransSkip K3 is repeatable.

[0470] Exon skipping and T cell binding assays were repeated to confirm the absence of leakage and the presence of inducibility with K3 CD19xCD3 TransSkip compared to K1 CD19xCD3 TransSkip (Figure 49). See also Figure 48.

[0471] Embodiment

[0472] Embodiment 1: A vector for use in gene therapy, comprising a first polynucleotide sequence encoding a first antibody or antigen-binding fragment thereof, and a second polynucleotide sequence encoding a second antibody or antigen-binding fragment thereof.

[0473] Embodiment 2: The vector of embodiment 1, wherein the vector is a recombinant vector.

[0474] Embodiment 3: The vector of embodiment 1 or 2, wherein the vector is a viral vector.

[0475] Embodiment 4: The vector according to any one of embodiments 1 to 3, wherein the viral vector is a retroviral vector.

[0476] Embodiment 5: The vector of any one of embodiments 1 to 4, wherein the viral vector is an adenoviral vector, an adeno-associated viral (AAV) vector, a lentiviral vector, a murine leukemia virus ("MLV") vector, an Epstein-Barr virus ("EBV") vector, or a herpes virus ("HSV") vector.

[0477] Embodiment 6: The vector of any one of embodiments 1 to 5, wherein the AAV vector is an AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV PHP.B, AAVrh74 or AAV-DJ vector.

[0478] Embodiment 7: The vector of embodiment 6, wherein the AAV vector is AAVrh74 (GenBank Accession No. LP899424.1).

[0479] Embodiment 8: The vector of any one of embodiments 1 to 7, wherein the first antibody or antigen-binding fragment thereof specifically binds to an activation antigen on an immune effector cell and the second antibody or antigen-binding fragment thereof binds to a tumor antigen.

[0480] Embodiment 9: The vector of any one of embodiments 1 to 7, wherein the first antibody or antigen-binding fragment thereof specifically binds to a tumor antigen and the second antibody or antigen-binding fragment thereof binds to an activation antigen on an immune effector cell.

[0481] Embodiment 10: The vector of any one of embodiments 1 to 9, further comprising a third polynucleotide sequence encoding a third antibody or antigen-binding fragment thereof, wherein the third antibody or antigen-binding fragment thereof binds to an activation antigen or a tumor antigen on an immune effector cell.

[0482] Embodiment 11: The vector of any one of embodiments 8 to 10, wherein the immune effector cell comprises a dendritic cell, a natural killer ("NK") cell, a macrophage, a T cell or a B cell.

[0483] Embodiment 12: The vector according to any one of embodiments 8 to 11, wherein the immune effector cell is a T cell or a NK cell.

[0484] Embodiment 13: The vector of any one of embodiments 8 to 12, wherein the activation antigen on the immune effector cell comprises CD3, CD2, CD4, CD8, CD19, LFA1, CD45, NKG2D, NKp44, NKp46, NKp30, DNAM, B7-H3, CD20, CD22, or a combination thereof.

[0485] Embodiment 14: The vector of any one of embodiments 8 to 13, wherein the tumor antigen comprises one or more of ephrin type A receptor 2 (EphA2), interleukin (IL)-13r alpha 2, EGFR VIII, PSMA, EpCAM, GD3, fucosyl GM1, PSCA, PLAC1, sarcoma breakpoint, Wilms' tumor 1, alpha fetoprotein (AFP), carcinoembryonic antigen (CEA), CA-125, MUC-1, epithelial tumor antigen (ETA), tyrosinase, melanoma associated antigen (MAGE), blood differentiation antigen, surface glycoprotein, ganglioside (GM2), growth factor receptor, stromal antigen, vascular antigen, receptor tyrosine kinase-like orphan receptor 1 (ROR1), mesothelin, CD38, CD123, human epidermal growth factor receptor 2 (HER2), B-cell maturation antigen (BCMA), fibroblast activation protein (FAP) alpha, or a combination thereof.

[0486] Embodiment 15: The vector according to any one of embodiments 1 to 14, wherein the first antibody or antigen-binding fragment thereof and the second antibody or antigen-binding fragment thereof form a dimer.

[0487] Embodiment 16: The vector of embodiment 15, wherein the dimer is a bispecific antibody.

[0488] Embodiment 17: The vector of embodiment 15, wherein the dimer is a trispecific antibody.

[0489] Embodiment 18: The vector of embodiment 15 or 16, wherein the bispecific antibody comprises a polypeptide sequence at least 95% identical to any one of SEQ ID NOs: 13 or 15.

[0490] Embodiment 19: The vector of embodiment 15 or 17, wherein the trispecific antibody comprises a polypeptide sequence at least 95% identical to SEQ ID NO:11.

[0491] Embodiment 20: The vector according to any one of embodiments 1 to 19, wherein the vector further comprises a polynucleotide sequence encoding a secretory peptide.

[0492] Embodiment 21: The vector of embodiment 20, wherein the secretory peptide comprises a secretory consensus sequence.

[0493] Embodiment 22: The vector of embodiment 20 or 21, wherein the secretion consensus sequence comprises at least 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO:51.

[0494] Embodiment 23: The vector of embodiment 20 or 21, wherein the secretion consensus sequence consists of SEQ ID NO:51.

[0495] Embodiment 24: A vector according to any one of embodiments 20 to 23, wherein the secretion consensus sequence is encoded by a polynucleotide comprising SEQ ID NO: 52 or an equivalent thereof.

[0496] Embodiment 25: A vector according to any one of embodiments 20 to 24, wherein the secretion consensus sequence further comprises 1, 2, 3, 4 or more residues at the C-terminus of the sequence.

[0497] Embodiment 26: A vector according to any one of embodiments 20 to 25, wherein the secretion consensus sequence further comprises one, two, three, four or more Ala residues at the C-terminus of the sequence.

[0498] Embodiment 27: A vector according to any one of embodiments 20 to 26, wherein the secretion consensus sequence further comprises one, two or three Ala residues at the C-terminus of the sequence.

[0499] Embodiment 28: A vector according to any one of embodiments 20 to 27, wherein the secretion consensus sequence further comprises two Ala residues at the C-terminus of the sequence.

[0500] Embodiment 29: The vector of embodiment 28, wherein the secretion consensus sequence comprises at least 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO:55, or consists of SEQ ID NO:55.

[0501] Embodiment 30: The vector of embodiment 28 or 29, wherein the secretion consensus sequence is encoded by a polynucleotide comprising SEQ ID NO: 56 or an equivalent thereof.

[0502] Embodiment 31: A vector according to any one of embodiments 20 to 30, wherein the secretion consensus sequence further comprises one Ala residue at the C-terminus of the sequence.

[0503] Embodiment 32: The vector of embodiment 31, wherein the secretion consensus sequence comprises at least 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to, or consists of, SEQ ID NO:53.

[0504] Embodiment 33: The vector of embodiment 31 or 32, wherein the secretion consensus sequence is encoded by a polynucleotide comprising SEQ ID NO: 54 or an equivalent thereof.

[0505] Embodiment 34: A vector according to any one of embodiments 1 to 33, wherein the secretion consensus sequence modulates the expression and / or secretion of the dimer.

[0506] Embodiment 35: A vector according to any one of embodiments 1 to 34, wherein the secretion consensus sequence enhances expression and / or secretion of the dimer.

[0507] Embodiment 36: A vector according to any one of embodiments 1 to 35, wherein the vector further comprises a polynucleotide sequence encoding a dimerization domain.

[0508] Embodiment 37: The vector of embodiment 36, wherein the dimerization domain comprises the dimerization domain of human hepatocyte nuclear factor 1 alpha (HNF1α).

[0509] Embodiment 38: The vector of embodiment 37, wherein the dimerization domain of HNF1α comprises a polypeptide sequence comprising at least 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO:47.

[0510] Embodiment 39: A vector according to any one of embodiments 1 to 38, wherein the vector further comprises a promoter.

[0511] Embodiment 40: The vector of embodiment 39, wherein the promoter is a constitutive promoter.

[0512] Embodiment 41: The vector of embodiment 39 or 40, wherein the promoter is a tissue-specific promoter.

[0513] Embodiment 42: The vector according to any one of embodiments 39 to 41, wherein the promoter comprises a Rous sarcoma virus (RSV) LTR promoter, a cytomegalovirus (CMV) promoter, an SV40 promoter, a dihydrofolate reductase promoter, a beta-actin promoter, a phosphoglycerol kinase (PGK) promoter, a U6 promoter, an EF1 alpha truncated (EFS) promoter, a phosphoglycerate kinase (PGK) promoter, a ubiquitin C (UbiC) promoter, an alpha-1-antitrypsin, a spleen focus forming virus (SFFV) promoter or a chicken beta-actin (CBA) promoter.

[0514] Embodiment 43: A vector according to any one of embodiments 39 to 42, wherein the promoter is an EFS optionally comprising SEQ ID NO: 49 or an equivalent thereof.

[0515] Embodiment 44: A vector described in any one of embodiments 1 to 43, wherein the vector further comprises an enhancer.

[0516] Embodiment 45: The vector of embodiment 44, wherein the enhancer is a RSV enhancer, a CMV enhancer and an alpha-fetoprotein MERII enhancer.

[0517] Embodiment 46: The vector according to any one of embodiments 1 to 45, wherein the vector further comprises one or more additional regulatory elements.

[0518] Embodiment 47: A vector according to any one of embodiments 1 to 46, comprising a Woodchuck Hepatitis Virus (WHP) post-transcriptional regulatory element (WPRE), optionally a regulatory element comprising SEQ ID NO: 50 or an equivalent thereof.

[0519] Embodiment 48: The vector according to any one of embodiments 1 to 47, wherein the vector comprises a 5' inverted terminal repeat (ITR) and a 3' ITR.

[0520] Embodiment 49: A vector according to any one of embodiments 1 to 48, wherein the vector comprises a sequence as set forth in SEQ ID NO: 4, 6, 8, 12, 14, 16 to 23, 30 to 33 or 40 to 46.

[0521] Embodiment 50: A composition comprises a vector according to any one of embodiments 1 to 49 and a carrier, optionally a pharma- ceutically acceptable carrier.

[0522] Embodiment 51: The composition of embodiment 50, wherein the composition is formulated for systemic administration.

[0523] Embodiment 52: The composition of embodiment 50, wherein the composition is formulated for topical administration.

[0524] Embodiment 53: The composition of any one of embodiments 50 to 52, wherein the composition is formulated for parenteral administration.

[0525] Embodiment 54: A method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of a vector according to any one of embodiments 1 to 49 or a pharmaceutical composition according to any one of embodiments 50 to 53, wherein the vector expresses a therapeutic anti-cancer antibody or an antigen-binding fragment thereof.

[0526] Embodiment 55: The method of embodiment 54, further comprising administering to the subject an anti-cancer agent.

[0527] Embodiment 56: The method of embodiment 55, wherein the anticancer agent comprises an agent selected from a peptide, a polypeptide, a nucleic acid molecule, a small molecule, a viral particle, or a combination thereof.

[0528] Embodiment 57: The method of embodiment 56, wherein the viral particle is an oncolytic HSV particle.

[0529] Embodiment 58: The method of any one of embodiments 54 to 57, wherein the subject is a mammal.

[0530] Embodiment 59: The method of any one of embodiments 54 to 58, wherein the subject is a human.

[0531] Embodiment 60: A method for producing a bispecific or trispecific antibody in a cell, comprising contacting the cell with a vector according to any one of embodiments 1 to 49.

[0532] Embodiment 61: The method of embodiment 60, wherein the contacting comprises transfection, infection, transformation, electroporation, injection, microinjection, or a combination thereof.

[0533] Embodiment 62: The method of embodiment 60 or 61, wherein the cells comprise fibroblasts, skeletal cells, epithelial cells, muscle cells, neuronal cells, endocrine cells, melanocytes, blood cells, or a combination thereof.

[0534] Embodiment 63: The method according to any one of embodiments 60 to 62, wherein the bispecific antibody comprises a polypeptide sequence at least 95% identical to SEQ ID NO: 13 or 15.

[0535] Embodiment 64: The method of any one of embodiments 60 to 62, wherein the trispecific antibody comprises a polypeptide sequence that is at least 95% identical to SEQ ID NO:11.

[0536] Embodiment 65: The method according to any one of embodiments 60 to 62, wherein the bispecific antibody is encoded by a polynucleotide sequence that is at least 95% identical to SEQ ID NO: 14, 16, 22, 23, 30 to 33 or 40 to 46.

[0537] Embodiment 66: The method of any one of embodiments 60 to 62, wherein the trispecific antibody is encoded by a polynucleotide sequence that is at least 95% identical to SEQ ID NO: 12.

[0538] Embodiment 67: A kit comprising a vector according to any one of embodiments 1 to 49 or a pharmaceutical composition according to any one of embodiments 50 to 53.

[0539] Embodiment 68: The kit of embodiment 67, further comprising an instructional material. Equivalent

[0540] While the present disclosure has been described in conjunction with the above embodiments, it should be understood that the foregoing description and examples are intended to illustrate, but not to limit, the scope of the present disclosure. Other aspects, advantages, and modifications within the scope of the present disclosure will be apparent to those skilled in the art.

[0541] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. All nucleotide sequences provided herein are written in the 5' to 3' direction.

[0542] The embodiments illustratively described herein may suitably be practiced in the absence of any element or elements, or limitation or limitations, not specifically disclosed herein. Thus, for example, terms such as "comprising," "including," "containing," and the like, should be read expansively and without limitation. Moreover, the terms and expressions used herein are used as terms of description, not terms of limitation, and in the use of such terms and expressions, there is no intention to exclude any equivalents of the features shown and described or portions thereof, and it is recognized that various modifications are possible within the scope of the present disclosure.

[0543] Thus, while the present disclosure has been specifically disclosed by certain embodiments and features that may be present as needed, it should be understood that modifications, improvements, and variations of the embodiments disclosed herein may be employed by those skilled in the art, and that such modifications, improvements, and variations are considered to be within the scope of the present disclosure. The materials, methods, and examples provided herein are representative of specific embodiments and are illustrative and are not intended as limitations on the scope of the disclosure.

[0544] The scope of the disclosure is described broadly and generically herein. Each of the narrower species and subgeneric groupings falling within the generic disclosure also form part of the disclosure. This includes the generic description of the disclosure with a provisos or negative limitation removing any subject matter from the genus, regardless of whether the deleted material is specifically recited herein.

[0545] Furthermore, where features or aspects of the disclosure are described in terms of a Markush group, those skilled in the art will recognize that embodiments of the disclosure may also be described in terms of any individual member or subgroup of members of the Markush group. In certain embodiments, for example, the following items are provided: (Item 1) A polynucleotide or vector comprising: (a) a first polynucleotide sequence comprising a first portion of an open reading frame encoding a first polypeptide; (b) a second polynucleotide sequence comprising a second portion of said open reading frame encoding said first polypeptide; and (c) a third polynucleotide sequence encoding a second polypeptide; and (d) a gene regulatory polynucleotide sequence located between the first polynucleotide and the second polynucleotide; A polynucleotide or vector comprising: (Item 2) 2. The polynucleotide or vector according to item 1, wherein the gene regulatory polynucleotide sequence comprises a splice donor site, an upstream intron, an exon containing more than one stop codon sequence in each reading frame, a downstream intron, and a splice acceptor site. (Item 3) 3. The polynucleotide or vector according to item 1 or 2, wherein the gene regulatory polynucleotide sequence comprises one or more of a binding sequence for an antisense oligonucleotide, a binding sequence for doxycycline or a polynucleotide sequence encoding a riboswitch. (Item 4) 4. The polynucleotide or vector according to any one of items 1 to 3, wherein the antisense oligonucleotide is a morpholino oligonucleotide. (Item 5) 5. The polynucleotide or vector according to item 4, wherein the binding sequence for the morpholino oligonucleotide comprises a polynucleotide sequence that is at least 95% identical to SEQ ID NO: 24 or 25. (Item 6) 5. The polynucleotide or vector according to item 4, wherein the morpholino oligonucleotide comprises a polynucleotide sequence that is at least 95% identical to SEQ ID NO: 27 or 28. (Item 7) The stop codon is Oligonucleotides of the group TAA, TAG or TGA; A polynucleotide sequence of TAAxTAGxTGAxTAGxTAAxTGAx (SEQ ID NO: 1), where x is any nucleotide; or A polynucleotide sequence of TAATTAGTTGATTAGTTAATTGAT (SEQ ID NO:2) or its equivalent; 3. The polynucleotide or vector according to item 2, comprising: (Item 8) 8. The polynucleotide or vector according to any one of items 1 to 7, wherein the gene regulatory polynucleotide comprises a polynucleotide sequence that is at least 95% identical to SEQ ID NO: 21. (Item 9) 9. The polynucleotide or vector according to any one of items 1 to 8, wherein the first polypeptide is a first antibody or an antigen-binding fragment thereof, and the second polypeptide is a second antibody or an antigen-binding fragment thereof. (Item 10) 10. The polynucleotide or vector according to any one of items 1 to 9, wherein the first antibody or antigen-binding fragment thereof specifically binds to an activation antigen on an immune effector cell, and the second antibody or antigen-binding fragment thereof binds to a tumor antigen. (Item 11) 10. The polynucleotide or vector according to any one of items 1 to 9, wherein the first antibody or antigen-binding fragment thereof specifically binds to a tumor antigen, and the second antibody or antigen-binding fragment thereof binds to an activation antigen on an immune effector cell. (Item 12) 12. The polynucleotide or vector according to any one of items 1 to 11, further comprising a fourth polynucleotide sequence encoding a third antibody or an antigen-binding fragment thereof, wherein the third antibody or the antigen-binding fragment thereof binds to an activation antigen or a tumor antigen on an immune effector cell. (Item 13) 13. The polynucleotide or vector of any one of items 10 to 12, wherein the immune effector cells comprise dendritic cells, natural killer ("NK") cells, macrophages, T cells, B cells, or a combination thereof. (Item 14) 13. The polynucleotide or vector according to any one of items 10 to 12, wherein the immune effector cell is a T cell or a NK cell. (Item 15) 13. The polynucleotide or vector according to any one of items 10 to 12, wherein the activation antigen on the immune effector cell comprises CD3, CD2, CD4, CD8, CD19, LFA1, CD45, NKG2D, NKp44, NKp46, NKp30, DNAM, B7-H3, CD20, CD22 or a combination thereof. (Item 16) The tumor antigen is selected from the group consisting of ephrin type A receptor 2 (EphA2), interleukin (IL)-13r alpha 2, EGFR VIII, PSMA, EpCAM, GD3, fucosyl GM1, PSCA, PLAC1, sarcoma breakpoint, Wilms' tumor 1, alpha fetoprotein (AFP), carcinoembryonic antigen (CEA), CA-125, MUC-1, epithelial tumor antigen (ETA), tyrosinase, melanoma associated antigen (MAGE), hematologic differentiation antigen, surface glycoprotein, ganglioside (GM2), growth factor receptor, stromal antigen, vascular antigen, receptor tyrosine kinase-like orphan receptor 1 (ROR1), mesothelin, CD38, CD123, human epidermal growth factor receptor 2 (HER2), B cell maturation antigen (BCMA), fibroblast Item 17. The polynucleotide or vector according to any one of items 10 to 12, comprising one or more of a facilitation activating protein (FAP) alpha or a combination thereof. 17. The polynucleotide or vector according to any one of items 1 to 16, wherein the vector is a recombinant vector, optionally a viral vector, and is capable of expressing a pre-mRNA encoding the dimer when the pre-mRNA is contacted with an antisense oligonucleotide, optionally a morpholino oligonucleotide. (Item 18) 18. The polynucleotide or vector according to item 17, wherein the dimer is a bispecific antibody. (Item 19) 18. The polynucleotide or vector according to item 17, wherein the dimer is a trispecific antibody. (Item 20) 20. The polynucleotide or vector of item 18 or 19, wherein the bispecific or trispecific antibody comprises the first antibody or an antigen-binding fragment thereof and the second antibody or an antigen-binding fragment thereof. (Item 21) 19. The polynucleotide or vector of item 18, wherein the bispecific antibody comprises a polypeptide sequence that is at least 95% identical to any one of SEQ ID NOs: 13 or 15. (Item 22) 22. The polynucleotide or vector according to any one of items 1 to 21, wherein the vector expresses a pre-mRNA encoding a trispecific antibody when said pre-mRNA is contacted with an antisense oligonucleotide, optionally a morpholino oligonucleotide. (Item 23) 23. The polynucleotide or vector of item 22, wherein the trispecific antibody comprises the first antibody or its antigen-binding fragment, the second antibody its antigen-binding fragment, and the third antibody or its antigen-binding fragment. (Item 24) The trispecific antibody is a compound having a sequence identical to that of SEQ ID NO: 11 and at least 23. The polynucleotide or vector according to item 22, comprising a polypeptide sequence that is at least 95% identical to the polypeptide sequence of item 22. (Item 25) 25. The polynucleotide or vector according to any one of items 1 to 24, wherein the first antibody and the second antibody are each independently a single-chain variable fragment. (Item 26) 26. The polynucleotide or vector according to any one of items 1 to 25, further comprising a polynucleotide sequence encoding a secretory peptide, optionally a secretory consensus sequence. (Item 27) 27. The polynucleotide or vector according to any one of items 1 to 26, further comprising a polynucleotide sequence encoding a dimerization domain. (Item 28) 28. The polynucleotide or vector according to any one of items 1 to 27, further comprising a 5' inverted terminal repeat (ITR) and a 3' ITR. (Item 29) 29. The polynucleotide or vector according to any one of items 1 to 28, wherein the vector comprises a sequence according to SEQ ID NO: 4, 6, 8, 12, 14, 16 to 23, 30 to 33 or 40 to 46. (Item 30) 30. The polynucleotide or vector of any one of items 1 to 29, wherein the vector is a recombinant viral vector comprising a backbone vector selected from the group of a retroviral vector, a lentiviral vector, a murine leukemia virus ("MLV") vector, an Epstein-Barr virus ("EBV") vector, an adenoviral vector, a herpes virus ("HSV") vector or an adeno-associated virus ("AAV") vector. (Item 31) 31. The polynucleotide or vector according to any one of items 1 to 30, wherein the vector is an AAV vector, optionally a self-complementary AAV vector, further optionally an AAVrh74 vector. (Item 32) The composition comprises the polynucleotide or vector according to any one of items 1 to 31 and a carrier, optionally a pharma- ceutically acceptable carrier. (Item 33) 32. A method for treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of a recombinant polynucleotide or vector according to any one of items 1 to 31 or the pharmaceutical composition according to item 32, wherein the polynucleotide or vector expresses a therapeutic anti-cancer antibody or an antigen-binding fragment thereof. (Item 34) 34. The method of claim 33, further comprising administering to the subject an effective amount of an antisense oligonucleotide, optionally a morpholino oligonucleotide. (Item 35) 35. The method of claim 33 or 34, further comprising administering an anticancer agent to the subject. (Item 36) 36. The method of claim 35, wherein the anticancer agent comprises an agent selected from a peptide, a polypeptide, a nucleic acid molecule, a small molecule, a viral particle, or a combination thereof. (Item 37) 37. The method of claim 36, wherein the viral particle is an oncolytic HSV particle. (Item 38) 38. The method according to any one of items 33 to 37, wherein the subject is a mammal. (Item 39) 39. The method according to any one of items 33 to 38, wherein the subject is a human. (Item 40) 32. A method for producing a bispecific or trispecific antibody in a cell, the method comprising contacting a cell containing the vector according to any one of items 1 to 31 with an effective amount of an antisense oligonucleotide, optionally a morpholino oligonucleotide. (Item 41) 41. The method of claim 40, wherein the morpholino oligonucleotide comprises a sequence that is at least 95% identical to the stereochemically pure polynucleotide. (Item 42) 41. The method of claim 40, wherein the vector is introduced into the cells by transfection, infection, transformation, electroporation, injection, microinjection, or a combination thereof. (Item 43) 43. The method according to any one of items 40 to 42, wherein said cells comprise fibroblasts, skeletal cells, epithelial cells, muscle cells, neuronal cells, endocrine cells, melanocytes, blood cells or a combination thereof. (Item 44) 44. The method according to any one of items 40 to 43, wherein the bispecific antibody comprises a polypeptide sequence that is at least 95% identical to SEQ ID NO: 13 or 15. (Item 45) 45. The method according to any one of items 40 to 44, wherein the trispecific antibody comprises a polypeptide sequence that is at least 95% identical to SEQ ID NO:11. (Item 46) 44. The method according to any one of items 40 to 43, wherein the bispecific antibody is encoded by a polynucleotide sequence that is at least 95% identical to SEQ ID NO: 14, 16, 22, 23, 30 to 33 or 40 to 46. (Item 47) 45. The method according to any one of items 40 to 44, wherein the trispecific antibody is encoded by a polynucleotide sequence that is at least 95% identical to SEQ ID NO:12. (Item 48) A kit comprising the polynucleotide or vector according to any one of items 1 to 31 or the pharmaceutical composition according to item 32. (Item 49) 50. The kit of item 48, further comprising an instruction material.

Claims

[Claim 1] The invention described in this specification.

Images