Recombinantly-modified adeno-associated virus helper vectors and their use to improve packaging efficiency of recombinantly-modified adeno-associated virus

Abstract

To provide recombinantly-modified adeno-associated virus (AAV) helper vectors that are capable of increasing the packaging efficiency of recombinantly-modified adeno-associated virus (rAAV) and their use to improve the packaging efficiency of such rAAV.SOLUTION: The present invention is directed to recombinantly-modified adeno-associated virus (AAV) helper vectors that have been further modified to replace (or augment) P5 and / or P40 promoter sequences that are natively associated with Rep proteins encoded by rAAV with AAV P5 and / or P40 promoters that are associated with the Rep proteins of an rAAV of different serotype.SELECTED DRAWING: Figure 1

Description

[Technical field]

[0001] The present invention relates to recombinant adeno-associated virus (AAV) helper vectors that can increase the packaging efficiency of recombinant adeno-associated virus (rAAV), and their use to improve the packaging efficiency of such rAAV.The present invention particularly relates to recombinant modified adeno-associated virus (AAV) helper vectors that are further modified to replace (or enhance) the P5 and / or P40 promoter sequences that naturally associate with the Rep protein encoded by such rAAV with the AAV P5 and / or P40 promoters that associate with the Rep protein of a different serotype of rAAV.The use of such alternative or additional promoter sequences causes increased production of recombinant modified adeno-associated virus. Sequence Listing Reference

[0002] This application contains one or more sequence listings in accordance with 37 C.FR 1.821 et seq., which are disclosed in a computer readable medium (filename: 2650-0004US_ST25.txt (created on July 15, 2019, size 84,101 bytes)), which are incorporated by reference in their entirety herein. [Background technology]

[0003] I. Adeno-associated Virus (AAV)

[0004] Adeno-associated viruses (AAVs) are small, naturally occurring, non-pathogenic viruses belonging to the Dependovirus genus of the Parvoviridae family (Balakrishnan, B. et al. (2014) “Basic Biology of Adeno-Associated Virus (AAV) Vectors Used in Gene Therapy,” Curr. Gene Ther. 14(2):86-100; Zinn, E. et al. (2014) “Adeno-Associated Virus: Fit To Serve,” Curr. Opin. Virol. 0:90-97). Although they do not cause disease, AAV is known to infect humans and other primates and to become endemic in human populations (Johnson, FB et al. (1972) “Immunological Reactivity of Antisera Prepared Against the Sodium Dodecyl Sulfate-Treated Structural Polypeptides of Adenovirus-Associated Virus,” J. Virol. 9(6):1017-1026). AAV infects a wide range of different cell types (e.g., cells of the central nervous system, heart, kidney, liver, lung, pancreas, retinal pigment epithelium, or photoreceptor cells, or skeletal muscle cells). Twelve serotypes of the virus (e.g., AAV2, AAV5, AAV6, etc.) that exhibit different tissue infectivity ("tropism") have been identified (Colella, P. et al. (2018) "Emerging Issues in AAV-Mediated In Vivo Gene Therapy," Molec. Ther. Meth. Clin. Develop. 8:87-104; Hocquemiller, M. et al. (2016) "Adeno-Associated Virus-Based Gene Therapy for CNS Diseases," Hum. Gene Ther. 27(7):478-496; Lisowski, L. et al. (2015) "Adeno-Associated Virus Serotypes For Gene Therapeutics," 24:59-67).

[0005] AAV is a single-stranded DNA virus consisting of approximately 4,800 nucleotides. The viral genome can be described as having a 5' half and a 3' half that together contain the genes encoding the viral proteins (Figure 1). The 5' half of the AAV genome contains the AAV rep gene, which, with multiple reading frames, staggered initiation promoters (P5, P19, and P40), and alternative splicing, encodes four nonstructural Rep proteins (Rep40, Rep52, Rep68, and Rep78) required for viral transcriptional control and replication, and packaging of the viral genome into the viral capsule (Lackner, DF et al. (2002) "Studies of the Mechanism of Transactivation of the Adeno-Associated Virus p19 Promoter by Rep Protein," J. Virol. 76(16):8225-8235). In the presence of viral proteins (such as Ad proteins), the P5 promoter is activated and mediates the transcription of Rep68 and Rep78 proteins, which are involved in transcriptional regulation, latency, rescue, and viral DNA replication, and thus function as key regulators of the AAV life cycle (Murphy, M. et al. (2007) “Adeno-Associated Virus Type 2 p5 Promoter: a Rep-Regulated DNA Switch Element Functioning in Transcription, Replication, and Site-Specific Integration,” J. Virol. 81(8):3721-3730).Expression of Rep68 and Rep78 proteins activates the P19 promoter, which is involved in the transcription of Rep40 and Rep52 proteins (Lackner, DF et al. (2002) "Studies of the Mechanism of Transactivation of the Adeno-Associated Virus p19 Promoter by Rep Protein, J. Virol. 76(16):8225-8235; Ogasawara, Y. et al. (1998) "The Use of Heterologous Promoters for Adeno-Associated Virus (AAV) Protein Expression in AAV Vector Production," Microbiol. Immunol. 42(3):177-185). The 3' half of the AAV genome contains the AAV capsid gene (cap), which encodes the three capsid proteins (VPs): VP1, VP2, and VP3. The three capsid proteins are translated from a single mRNA transcript controlled by a single promoter (P40 for AAV2). The 3' half of the AAV genome also contains the AAP gene, which encodes the AAV assembly activating protein (AAP). Sixty VP monomers (including approximately 5 copies of VP1, 5 copies of VP2, and 50 copies of VP3) self-assemble around the AAV genome to form the icosahedral protein shell (capsid) of the mature virus particle (Buning, H. et al. (2019) “Capsid Modifications for Targeting and Improving the Efficacy of AAV Vectors,” Mol. Ther. Meth. Clin. Devel. 12: P248-P265; Van Vliet KM et al. (2008) The Role of the Adeno-Associated Virus Capsid in Gene Transfer. In: Drug Delivery Systems, Jain, KK (ed.), Meth. Molec. Biol. 437: 51-91). The AAV AAP proteins are thought to be required for stabilizing and transporting newly produced VP proteins from the cytoplasm to the cell nucleus.The 3' half of the AAV genome also contains the AAV X gene, which is thought to encode proteins that support genome replication (Colella, P. et al. (2018) "Emerging Issues in AAV-Mediated In Vivo Gene Therapy," Molec. Ther. Meth. Clin. Develop. 8:87-104; Buning, H. et al. (2019) "Capsid Modifications for Targeting and Improving the Efficacy of AAV Vectors," Mol. Ther. Meth. Clin. Devel. 12:P248-P265; Cao, M. et al. (2014) "The X Gene Of Adeno-Associated Virus2 (AAV2) Is Involved In Viral DNA Replication," PLoS ONE 9,e104596:1-10).

[0006] The AAV gene coding sequence is flanked by two AAV-specific palindromic inverted terminal repeats (ITRs) of 145 nucleotides (Balakrishnan, B. et al. (2014) “Basic Biology of Adeno-Associated Virus (AAV) Vectors Used in Gene Therapy,” Curr. Gene Ther. 14(2):86-100; Colella, P. et al. (2018) “Emerging Issues in AAV-Mediated In Vivo Gene Therapy,” Molec. Ther. Meth. Clin. Develop. 8:87-104).

[0007] AAV is an essentially defective virus that lacks the ability to perform at least two important functions: the ability to initiate synthesis of virus-specific products and the ability to assemble such products to form the icosahedral protein shell (capsid) of mature infectious virus particles. It therefore requires a co-infecting "helper" virus, such as adenovirus (Ad), herpes simplex virus (HSV), cytomegalovirus (CMV), vaccinia virus or human papillomavirus, to provide viral-associated (VA) RNAs that are not encoded by genes in the AAV genome. Such VA RNAs are not translated, but play a role in regulating the translation of other viral genes. Similarly, the AAV genome does not contain genes encoding the viral proteins E1a, E1b, E2a, and E4; therefore, these proteins must also be supplied by a co-infecting "helper" virus. The E1a protein greatly stimulates viral gene transcription during productive infection. The E1b protein prevents apoptosis of adenovirus-infected cells, allowing productive infection to proceed. The E2a protein plays a role in the elongation step of viral strand displacement replication by unwinding the template and promoting transcription initiation.The E4 protein has been shown to affect transgene persistence, vector toxicity, and immunogenicity (Grieger, JC et al. (2012) "Adeno-Associated Virus Vectorology, Manufacturing, and Clinical Applications," Meth. Enzymol. 507:229-254; Dyson, N. et al. (1992) "Adenovirus E1A Targets Key Regulators Of Cell Proliferation," Canc. Surv. 12:161-195; Jones NC (1990) "Transformation By The Human Adenoviruses," Semin. Cancer Biol. 1(6):425-435; Ben-Israel, H. et al. (2002) "Adenovirus and Cell Cycle Control," Front. Biosci. 7:d1369-d1395; Hoeben, RC et al. (2013) "Adenovirus DNA Replication," Cold Spring Harb. Perspect. Biol. 5:a013003 (pp. 1-11); Berk, AJ (2013) "Adenoviridae: The Viruses And Their Replication, In: FIELDS VIROLOGY, 6th Edition (eds. Knipe, DM et al.), Vol. 2., Lippincott Williams & Wilkins, Philadelphia, pp. 1704-1731; Weitzman, MD (2005) "Functions Of The Adenovirus E4 Proteins And Their Impact On Viral Vectors," Front. Biosci. 10:1106-1117).

[0008] AAV virus infects both dividing and non-dividing cells and persists as a circular episomal molecule or integrates into the host cell DNA at specific chromosomal loci (adeno-associated virus integration sites or AAVS). (Duan, D. (2016) “Systemic Delivery Of Adeno-Associated Viral Vectors,” Curr. Opin. Virol. 21:16-25; Grieger, JC et al. (2012) “Adeno-Associated Virus Vectorology, Manufacturing, and Clinical Applications,” Meth. Enzymol. 507:229-254). AAV remains latent within the infected cell unless a helper virus is present to perform the functions required for AAV replication and maturation. II. rAAV and its Applications in Gene Therapy

[0009] In light of the properties of AAV, recombinantly modified versions of AAV (rAAV) have found substantial utility as vectors for gene therapy (Naso, MF et al. (2017) “Adeno-Associated Virus (AAV) as a Vector for Gene Therapy,” BioDrugs 31: 317-334; Berns, KI et al. (2017) “AAV: An Overview of Unanswered Questions,” Human Gene Ther. 28(4): 308-313; Berry, GE et al. (2016) “Cellular Transduction Mechanisms Of Adeno-Associated Viral Vectors,” Curr. Opin. Virol. 21: 54-60; Blessing, D. et al. (2016) “Adeno-Associated Virus And Lentivirus Vectors: A Refined Toolkit For The Central Nervous System.” System,”21:61-66;Santiago-Ortiz,JL(2016)“Adeno-Associated Virus(AAV) Vectors in Cancer Gene Therapy,”J.Control Release240:287-301;Salganik,M. et al.(2015)“Adeno-Associated Virus As A Mammalian DNA Vector,”Microbiol.Spectr.3(4):1-32;Hocquemiller, M. et al. (2016)“Adeno-Associated Virus-Based Gene Therapy for CNS Diseases,”Hum.Gene Ther.27(7):478-496;Lykken,EA et al.(2018)“Recent Progress And Considerations For AAV Gene Therapies Targeting The Central Nervous System,”J.Neurodevelop.Dis.10:16:1-10;Buning,H.(2019) “Capsid Modifications for Targeting and Improving the Efficacy of AAV Vectors,” Mol.Ther.Meth.Clin.Devel.12:P248-P265;During, MJ et al. (1998) “In Vivo Expression Of Therapeutic Human Genes For Dopamine Production In The Caudates Of MPTP-Treated Monkeys Using An AAV Vector,”Gene Ther.5:820-827; Grieger, JC et al. (2012) “Adeno-Associated Virus Vectorology, Manufacturing, and Clinical Applications,” Meth. Enzymol.507:229-254; Kotterman, MA et al. (2014) “Engineering Adeno-Associated Viruses For Clinical Gene Therapy,”Nat.Rev.Genet.15(7):445-451;Kwon, I. et al. (2007)“Designer Gene Delivery Vectors:Molecular Engineering and Evolution of Adeno-Associated Viral Vectors for Enhanced Gene Transfer,” Pharm. Res. 25(3):489-499; U.S. Patent Nos. 10,266,845; 10,081,659; U.S. Patent No. 9,890,396; U.S. Patent No. 9,840,719; U.S. Patent No. 9,839,696; U.S. Patent No. 9,834,789; U.S. Patent No. 9,803,218; U.S. Patent No. 9,783,825; U.S. Patent No. 9,777,291; U.S. Patent No. 9,540,659; U.S. Patent No. 9,527,904; U.S. Patent No. 8,236,557; U.S. Patent No. 7,972,593, and U.S. Patent No. 7,943,374).

[0010] rAAV is typically produced using a circular plasmid ("rAAV plasmid vector"). The AAV rep and cap genes are typically deleted from such constructs and replaced with a promoter, a beta-globin intron, a cloning site into which a selected therapeutic gene (transgene) is inserted, and a polyadenylation ("polyA") site. However, the inverted terminal repeats (ITRs) of rAAV are retained, such that the transgene expression cassette of the rAAV plasmid vector is flanked by AAV ITR sequences (Colella, P. et al. (2018) "Emerging Issues in AAV-Mediated In Vivo Gene Therapy," Molec. Ther. Meth. Clin. Develop. 8:87-104; Buning, H. et al. (2019) "Capsid Modifications for Targeting and Improving the Efficacy of AAV Vectors," Mol. Ther. Meth. Clin. Devel. 12:P248-P265). Thus, from 5' to 3', a rAAV comprises the 5' ITR, the rAAV transgene expression cassette, and the 3' ITR.

[0011] rAAVs have been used to deliver transgenes to patients suffering from any of a number of genetic diseases (e.g., hereditary lipoprotein lipase deficiency (LPLD), Leber congenital amaurosis (LCA), aromatic L-amino acid decarboxylase deficiency (AADC), choroideremia, hemophilia) and are useful in new clinical methods such as interfering RNA (RNAi) therapy and gene modification strategies such as Crispr / Cas9 (U.S. Patent No. 8,697,359, U.S. Patent No. 10,000,772, U.S. Patent No. 10,113,167, U.S. Patent No. 10,227,611; Lino, CA et al. (2018) “Delivering CRISPR: A Review Of The Challenges And Approaches,” Drug Deliv. 25(1):1234-1237; Ferreira, V. et al. (2014) “Immune Responses To AAV-Vectors, The Glybera Example From Bench To Bedside”Front.Immunol.5(82):1-15), Buning, H. et al. (2019) “Capsid Modifications for Targeting and Improving the Efficacy of AAV Vectors,” Mol.Ther.Meth.Clin.Devel.12:P248-P265; Rastall, DPW (2017) “Current and Future Treatments for Lysosomal Storage Disorders,”Curr.Treat Options Neurol.19(12):45;Kay, M. et al. (2017)“Future Of rAAV Gene Therapy:Platform For RNAi,Gene Editing And Beyond,”Human Gene Ther.28:361-372);Berns, KI et al. (2017)“AAV:An Overview of Unanswered Questions,”Human Gene Ther.28(4):308-313).More than 150 clinical trials involving rAAV have been initiated (Buning, H. et al. (2019) “Capsid Modifications for Targeting and Improving the Efficacy of AAV Vectors,” Mol. Ther. Meth. Clin. Devel. 12: P248-P265; Clement, N. et al. (2016) “Manufacturing Of Recombinant Adeno-Associated Viral Vectors For Clinical Trials,” Meth. Clin. Develop. 3: 16002: 1-7). The most commonly used AAV serotype for such recombinantly modified AAVs is AAV2, which can infect cells of the central nervous system, kidney, retinal pigment epithelium and photoreceptor cells. The AAV serotype AAV9, which infects muscle cells and is also widely used (Duan, D. (2016) “Systemic Delivery Of Adeno-Associated Viral Vectors,” Curr. Opin. Virol. 21: 16-25). AAV serotypes are described in: U.S. Patent No. 10,301,650; U.S. Patent No. 10,266,846; U.S. Patent No. 10,265,417; U.S. Patent No. 10,214,785; U.S. Patent No. 10,214,566; U.S. Patent No. 10,202,657; U.S. Patent No. 10,046,016; U.S. Patent No. 9,884,071; U.S. Patent No. 9,856,539; U.S. Patent No. 9,737,618; U.S. Patent No. 9,677,089; U.S. Patent No. No. 9,458,517; U.S. Patent No. 9,457,103; U.S. Patent No. 9,441,244; U.S. Patent No. 9,193,956; U.S. Patent No. 8,846,389; U.S. Patent No. 8,507,267; U.S. Patent No. 7,906,111; U.S. Patent No. 7,479,554; U.S. Patent No. 7,186,552; U.S. Patent No. 7,105,345; U.S. Patent No. 6,984,517; U.S. Patent No. 6,962,815; and U.S. Patent No. 733,757. III. Methods of rAAV Production

[0012] rAAV containing the desired transgene expression cassette is typically produced by human cells (such as HEK293) grown in suspension. As mentioned above, rAAV is a defective virus, so additional functions must be provided in order for the rAAV to replicate and be packaged.

[0013] rAAV can be produced by transiently transfecting cells with a rAAV plasmid vector and a second plasmid vector, the second plasmid vector comprising an AAV helper function-providing polynucleotide that provides the Rep52 and Rep78 genes (but not Rep40 and Rep68 or for the production of rAAV) required for vector transcriptional control and replication and for packaging of the viral genome into a viral capsule, as well as the cap gene, which is deleted from AAV to produce rAAV. The second plasmid vector can further comprise non-AAV helper function-providing polynucleotides encoding viral transcription and translation factors (E1a, E1b, E2a, VA and E4) required for AAV propagation, thereby comprising a double plasmid transfection system in concert with the rAAV (Grimm, D. et al. (1998) "Novel Tools For Production And Purification Of Recombinant Adeno-Associated Virus Vectors," Hum. Gene Ther. 9:2745-2760; Penaud-Budloo, M. et al. (2018) "Pharmacology of Recombinant Adeno-associated Virus Production," Molec. Ther. Meth. Clin. Develop. 8:166-180).

[0014] However, it is becoming increasingly common to clone AAV helper function-providing polynucleotides (providing the required rep and cap genes) into an "AAV helper plasmid" and non-AAV helper function-providing polynucleotides (providing genes encoding viral transcription and translation factors) onto a different plasmid (i.e., an "Ad helper plasmid"), such plasmids working in conjunction with an rAAV plasmid vector comprise a triple plasmid transfection system (Figure 2). Use of a triple plasmid transfection system has the advantage that one cap gene can be easily switched for another cap gene, thereby facilitating serotype changes of rAAV. By using a helper plasmid rather than a helper virus, rAAV can be produced without further production of helper virus particles (Francois, A. et al. (2018) “Accurate Titration of Infectious AAV Particles Requires Measurement of Biologically Active Vector Genomes and Suitable Controls,” Molec. Ther. Meth. Clin. Develop. 10:223-236; Matsushita, T. et al. (1998) “Adeno-Associated Virus Vectors Can Be Efficiently Produced Without Helper Virus,” Gene Ther. 5:938-945).

[0015] Transient transfection of plasmid DNA, including rAAV plasmid vectors, plasmid vectors providing the AAV helper functions rep and cap genes, and plasmid vectors providing non-AAV helper functions, into HEK293 cells by calcium phosphate co-precipitation has become the standard method for producing rAAV in the laboratory (Grimm, D. et al. (1998) “Novel Tools For Production And Purification Of Recombinant Adeno-Associated Virus Vectors,” Hum. Gene Ther. 9:2745-2760). However, the use of such calcium phosphate-mediated transfection processes with suspension-cultured transfected mammalian cells requires medium exchange and thus may not be ideal for the large-scale rAAV production required to produce therapeutic doses of rAAV (Lock, M. et al. (2010) “Rapid, Simple, and Versatile Manufacturing of Recombinant Adeno-Associated Viral Vectors at Scale,” Hum. Gene Ther. 21:1259-1271). For this reason, polyethyleneimine (PEI) has been used as a transfection reagent and has been found to provide virus yields similar to those obtained using calcium phosphate-mediated transfection (Durocher, Y. et al. (2007) "Scalable Serum-Free Production Of Recombinant Adeno-Associated Virus Type 2 By Transfection Of 293 Suspension Cells," J. Virol. Meth. 144:32-40).

[0016] Alternatively, rAAV can be produced in insect cells (e.g., sf9 cells) or HSV-infected baby hamster kidney (BHK) cells (e.g., BHK21) using baculovirus vectors (see, e.g., U.S. Pat. No. 9,879,282; U.S. Pat. No. 9,879,279; U.S. Pat. No. 8,945,918; U.S. Pat. No. 8,163,543; U.S. Pat. No. 7,271,002; U.S. Pat. No. 6,723,551) (Francois, A. et al. (2018) "Accurate Titration of Infectious AAV Particles Requires Measurement of Biologically Active Vector Genomes and Suitable Controls," Molec. Ther. Meth. Clin. Develop. 10:223-236). Methods for production of rAAV are reviewed in Grieger, JC et al. (2012) “Adeno-Associated Virus Vectorology, Manufacturing, and Clinical Applications,” Meth. Enzymol. 507:229-254, and in Penaud-Budloo, M. et al. (2018) “Pharmacology of Recombinant Adeno-associated Virus Production,” Molec. Ther. Meth. Clin. Develop. 8:166-180. IV. rAAV Purification and Recovery Methods

[0017] After production, rAAV is typically harvested and purified one or more times by overnight CsCl gradient centrifugation (Zolotukhin, S. et al. (1999) "Recombinant Adeno-Associated Virus Purification Using Novel Methods Improves Infectious Titer and Yield," Gene Ther. 6:973-985), followed by desalting to form a purified rAAV production stock. 12 ~10 13Titers of infectious rAAV capsids / mL are obtained.

[0018] To measure the infectious titer of rAAV preparations, plaque assays cannot be used because rAAV infection does not cause cytopathic effects. Therefore, infectious titers are typically measured as tissue culture median infectious doses (TCID50). In this method, HeLa-derived AAV2 rep- and cap-expressing cell lines are grown in 96-well plates and infected with replicate 10-fold serial dilutions of rAAV preparations in the presence of serotype 5 adenovirus. After infection, vector genome replication is determined by quantitative PCR (qPCR) (Zen, Z. et al. (2004) “Infectious Titer Assay For Adeno-Associated Virus Vectors With Sensitivity Sufficient To Detect Single Infectious Events,” Hum. Gene Ther. 15:709-715). Alternatively, the infectious titer of prepared rAAV can be measured using an infectious center assay (ICA). This assay uses HeLa rep-cap cells and Ad, but involves transferring the cells to a membrane after incubation. Infectious centers (representing individual infected cells) are detected via hybridization using a labeled probe complementary to a portion of the transgene used. Although more widely used, the TCID 50 assay has been reported to lead to a higher background than ICA and to overestimate vector infectivity compared to ICA (Francois, A. et al. (2018) “Accurate Titration of Infectious AAV Particles Requires Measurement of Biologically Active Vector Genomes and Suitable Controls,” Molec. Ther. Meth. Clin. Develop. 10:223-236).Methods for producing and purifying rAAV are described, inter alia, in U.S. Patent Nos. 10,294,452; 10,161,011; 10,017,746; 9,598,703; 7,625,570; 7,439,065; 7,419,817; 7,208,315; 6,995,006; 6,989,264; 6,846,665; and 6,841,357.

[0019] However, despite all these previous successes, there remains a need to develop methods that can address the issues that currently limit the applicability of rAAV for gene therapy (Grieger, JC et al. (2012) “Adeno-Associated Virus Vectorology, Manufacturing, and Clinical Applications,” Meth. Enzymol. 507:229-254; Kotterman, MA et al. (2014) “Engineering Adeno-Associated Viruses For Clinical Gene Therapy,” Nat. Rev. Genet. 15(7):445-451; Kwon, I. et al. (2007) “Designer Gene Delivery Vectors: Molecular Engineering and Evolution of Adeno-Associated Viral Vectors for Enhanced Gene Transfer,” Pharm. Res. 25(3):489-499; Naso, MF et al. (2017) “Adeno-Associated Virus (AAV) as a Vector for Gene Therapy,” BioDrugs 31:317-334).

[0020] The present invention relates to improved methods for increasing the efficiency of AAV and rAAV packaging through modulation of the expression of the AAV rep and cap genes. Summary of the Invention

[0021] The present invention relates to recombinant adeno-associated virus (AAV) helper vectors that can increase the packaging efficiency of recombinant adeno-associated virus (rAAV), and their use to improve the packaging efficiency of such rAAV.The present invention particularly relates to recombinant modified adeno-associated virus (AAV) helper vectors that are further modified to replace (or enhance) the P5 and / or P40 promoter sequence that naturally associates with the Rep protein encoded by such rAAV with the AAV P5 and / or P40 promoter that associates with the Rep protein of a different serotype of rAAV.The use of such alternative or additional promoter sequences causes increased production of recombinant modified adeno-associated virus.

[0022] In particular, the present invention provides recombinant modified adeno-associated virus (AAV) helper vectors comprising an AAV helper function-providing polynucleotide, in particular an AAV helper function-providing polynucleotide that is a plasmid vector, wherein the polynucleotide comprises a non-native AAV serotype P5 or P40 promoter sequence.

[0023] The present invention specifically includes embodiments of such recombinant modified adeno-associated virus (AAV) helper vectors, wherein said AAV helper function-providing polynucleotide vector comprises a non-native AAV serotype P5 promoter sequence and / or a non-native AAV serotype P40 promoter sequence.

[0024] The present invention also specifically includes embodiments of such recombinant modified adeno-associated virus (AAV) helper vectors in which a non-native AAV serotype P5 or P40 promoter sequence replaces the native AAV serotype promoter sequence.

[0025] The present invention also specifically includes the embodiment of such recombinant modified adeno-associated virus (AAV) helper vectors, which further comprise non-AAV helper function-providing polynucleotides.

[0026] The present invention further provides a method for increasing the production titer of a recombinant modified adeno-associated virus (rAAV) comprising a transgene cassette, the method comprising culturing cells transfected with: (1) rAAV; (2) a recombinant modified adeno-associated virus (AAV) helper vector as described above, further comprising a non-AAV helper function-providing polynucleotide; Culturing is performed in a medium under conditions sufficient to allow production of rAAV, and the presence of the non-native AAV serotype P5 or P40 promoter sequence causes the cells to produce said rAAV at increased production titers compared to that achieved when the AAV helper function-providing polynucleotide contains the native serotype P5 and P40 promoters.

[0027] The present invention further provides a method for increasing the production titer of a recombinant modified adeno-associated virus (rAAV) comprising a transgene cassette, the method comprising culturing cells transfected with: (1) rAAV; (2) any of the recombinant modified adeno-associated virus (AAV) helper vectors described above; and (3) additional vectors, particularly plasmid vectors, including non-AAV helper function-providing polynucleotides; Culturing is performed in a medium under conditions sufficient to allow production of rAAV, and the presence of the non-native AAV serotype P5 or P40 promoter sequence causes the cells to produce said rAAV at increased production titers compared to that achieved when the AAV helper function-providing polynucleotide contains the native serotype P5 and P40 promoters.

[0028] The present invention specifically includes embodiments of such methods, wherein the transgene cassette comprises a nucleic acid that encodes a protein or is transcribed that is therapeutic for a genetic or inherited disease or condition.

[0029] The present invention also includes, inter alia, the embodiment of such a method, (A) the AAV helper function-providing polynucleotide of the vector encodes an AAV1 Cap protein and the non-native AAV serotype promoter sequence is a promoter sequence of an AAV of serotype AAV3, AAV4, AAV5, AAV6, AAV7 or AAV8, or a hybrid of one or more of the said serotypes; (B) the AAV helper function-providing polynucleotide of the vector encodes an AAV2 Cap protein and the non-native AAV serotype promoter sequence is a promoter sequence of AAV of serotype AAV1, AAV3, AAV4, AAV5, AAV6, AAV7, or AAV8, or a hybrid of one or more of the said serotypes; (C) the AAV helper function-providing polynucleotide of the vector encodes an AAV3 Cap protein and the non-native AAV serotype promoter sequence is a promoter sequence of AAV of serotype AAV1, AAV4, AAV5, AAV6, AAV7, or AAV8, or a hybrid of one or more of the said serotypes; (D) the AAV helper function-providing polynucleotide of the vector encodes an AAV4 Cap protein and the non-native AAV serotype promoter sequence is a promoter sequence of AAV of serotype AAV1, AAV3, AAV5, AAV6, AAV7, or AAV8, or a hybrid of one or more of the said serotypes; (E) the AAV helper function-providing polynucleotide of the vector encodes an AAV5 Cap protein and the non-native AAV serotype promoter sequence is a promoter sequence of AAV of serotype AAV1, AAV3, AAV4, AAV6, AAV7, or AAV8, or a hybrid of one or more of the said serotypes; (F) the AAV helper function-providing polynucleotide of the vector encodes an AAV6 Cap protein and the non-native AAV serotype promoter sequence is a promoter sequence of AAV of serotype AAV1, AAV3, AAV4, AAV5, AAV7, or AAV8, or a hybrid of one or more of the said serotypes; (G) the AAV helper function-providing polynucleotide of the vector encodes an AAV7 Cap protein and the non-native AAV serotype promoter sequence is a promoter sequence of an AAV of serotype AAV1, AAV3, AAV4, AAV5, AAV6 or AAV8, or a hybrid of one or more of the said serotypes; or (H) the AAV helper function-providing polynucleotide of the vector encodes an AAV8 Cap protein, and the non-native AAV serotype promoter sequence is an AAV promoter sequence of serotype AAV1, AAV3, AAV4, AAV5, AAV6 or AAV7, or a hybrid of one or more of the said serotypes.

[0030] The invention also specifically includes the embodiment of such methods, wherein the cell is a human embryonic kidney cell, a baby hamster kidney cell or an sf9 insect cell.

[0031] The present invention further provides a pharmaceutical composition comprising a recombinant modified adeno-associated virus (rAAV) produced by any of the methods described above and a pharma- ceutically acceptable carrier. [Brief description of the drawings]

[0032] [Figure 1] FIG. 1 provides a schematic genetic map of the wild-type (Wt) AAV genome. [Diagram 2]FIG. 2 provides a schematic diagram of the structural domains of the wild-type AAV2 genome (1), recombinant AAV (rAAV) (2), the complementary "AAV helper plasmid" (3), and the adenovirus helper plasmid ("Ad helper plasmid") (4). Wild-type (Wt) AAV2 (1) consists of AAV-specific palindromic inverted terminal repeats (ITRs), a 5' half containing the gene encoding the Rep protein, and a 3' half containing the gene encoding the Cap protein. rAAV (2) is formed by replacing the Rep and Cap-encoding genes of wild-type (Wt) AAV2 (1) with a transgene cassette containing a promoter (Pro), an exogenous transgene of interest, and a polyadenylation site (pA). To produce rAAV (2), a complementary "AAV helper" plasmid vector (3) and an adenovirus helper plasmid vector (Ad helper plasmid) (4) are provided. The complementary AAV helper plasmid (3) provides the Rep and Cap proteins. The Ad helper plasmid (4) provides the adenoviral proteins E1a, E1b, E2a, VA and E4. [Diagram 3] FIG. 3 shows the genetic map of the AAV helper plasmid vector pAAV-RC1 (SEQ ID NO:1). [Figure 4] FIG. 4 shows the genetic map of the AAV helper plasmid vector pAAV-RC2 (SEQ ID NO:2). [Diagram 5] FIG. 5 shows the genetic map of the AAV helper plasmid vector pAAV-RC5 (SEQ ID NO:3). [Figure 6] FIG. 6 shows the genetic map of the AAV helper plasmid vector pAAV-RC6 (SEQ ID NO:4). [Figure 7] FIG. 7 shows the genetic map of the AAV helper plasmid vector pAAV-RC7 (SEQ ID NO:5). [Figure 8] FIG. 8 shows the genetic map of the AAV helper plasmid vector pHelper-Kan (SEQ ID NO:6). [Figure 9]FIG. 9 shows the genetic map of the AAV helper plasmid vector pAV-CMV-EGFP (SEQ ID NO:7). [Figure 10] FIG. 10 shows the genetic map of the AAV helper plasmid vector pAV-TBG-EGFP (SEQ ID NO:8). [Figure 11]11 shows the overall structure and approach followed for the development of the exemplary AAV helper constructs described herein. The parent construct (pAAV-RC2; Parent-RC) contains the AAV2 serotype promoter sequences of the P5 and P19 promoters (black boxed) that direct the expression of the native AAV2 rep gene (white boxed gene) encoding the Rep protein, and the AAV2 serotype promoter sequence of the P40 promoter (black boxed) that directs the expression of the native AAV2 cap gene (grey boxed gene) encoding the Cap protein. The P5-RC construct is a derivative of the parent plasmid AAV RC that has been modified to direct expression of the AAV rep gene using a non-native P5 promoter (i.e., the AAV P5 promoter not naturally present within the AAV rep gene of the vector (downward striped box)) in place of the native AAV serotype P5 promoter (black filled box); the P5-RC construct uses the native AAV serotype P19 and P40 promoter sequences (black filled box) of the parent vector to direct expression of the AAV rep and cap genes. The P40-RC construct is a derivative of the parental plasmid AAV RC that has been modified to direct expression of the AAV cap gene using the vector's non-native P40 promoter (i.e., the AAV P40 promoter not natively present in the AAV rep gene (upward striped box)) instead of the native AAV serotype P40 promoter (black box); the P40-RC construct uses the parental vector's native AAV serotype P5 and P19 promoter sequences (black box) to direct expression of the AAV rep gene. The P5 / P40-RC construct is a derivative of the parental plasmid AAV RC that has been modified to direct expression of the AAV rep gene using the non-native P5 promoter (i.e., the AAV P5 promoter not natively present in the vector's AAV rep gene (downward striped box)) instead of the native AAV serotype P5 promoter (black box).The P5 / P40-RC construct was further modified to direct expression of the AAV cap gene using the vector's non-native P40 promoter (i.e., the AAV P40 promoter not naturally present in the AAV rep gene (upward striped box)) in place of the native AAV serotype P40 promoter (black box). The P40-RC construct uses the parent vector's native AAV serotype P19 promoter sequence (black box) to direct expression of the AAV rep gene. The sequence of the promoter region is shown in Table 1. [Figure 12A] Figure 12A shows rAAV production titers obtained by modifying the parent RC2 vector to contain the non-native P5 promoter sequence (Figure 11; Figure 12A; downward striped rectangle) in place of the AAV2 P5 promoter naturally associated with the rep gene of such vectors. The P19 and P40 promoters are both native AAV2 serotype promoter sequences (black filled rectangle). [Figure 12B] Figure 12B shows rAAV production titers obtained by modifying the parent RC2 vector to contain a non-native P5 promoter sequence (Figure 11; Figure 12A; downward striped rectangle) in place of the AAV2 P5 promoter naturally associated with the rep gene of such vectors. The P19 and P40 promoters are both native AAV2 serotype promoter sequences (black filled rectangles). Figure 12B shows rAAV production titers obtained using such AAV helper plasmid vectors. The following constructs were used: Parent-RC2, P5(2)-RC2, P5(1)-RC2, P5(3)-RC2, P5(4)-RC2, P5(5)-RC2, P5(7)-RC2, and P5(8)-RC2. The sequences of the promoter regions are shown in Table 1. rAAV production titers were obtained using a triple plasmid transfection system with rAAV and an Ad helper plasmid providing the necessary adenoviral functions. [Figure 13A]Figure 13A shows rAAV production titers obtained by modifying the parental RC2 vector to contain the non-native P40 promoter sequence (Figure 11; Figure 13A; up-striped rectangle) in place of the AAV2 serotype P40 promoter of the parental vector. The P5 and P19 promoters are both native AAV2 serotype promoter sequences (black filled rectangle). [Figure 13B] Figure 13B shows the rAAV production titers obtained by modifying the parent RC2 vector to include a non-native P40 promoter sequence (Figure 11; Figure 13A; upward striped rectangle) in place of the AAV2 serotype P40 promoter of the parent vector. The P5 and P19 promoters are both native AAV2 serotype promoter sequences (black filled rectangles). Figure 13B shows the rAAV production titers obtained using such AAV helper plasmid vectors. The following constructs were used: Parent-RC2, P40(1)-RC2, P40(3)-RC2, P40(4)-RC2, P40(5)-RC2, P40(6)-RC2, P40(7)-RC2, and P40(8)-RC2. The sequences of the promoter regions are shown in Table 1. The rAAV production titers were obtained using a triple plasmid transfection system with rAAV and an Ad helper plasmid providing the necessary adenoviral functions. [Figure 14A] Figure 14A shows the rAAV production titers obtained by modifying the parent RC2 vector to include the non-native P5 and / or P40 promoter sequences (Figure 11; Figure 14A; P5, downward striped rectangle; P40, upward striped rectangle) in place of the AAV2 serotype P5 and P40 promoters of the parent vector. The P19 promoter is the native AAV2 serotype promoter sequence (black filled rectangle). The following constructs were used: Parent-RC2, P5(2)-RC2, P5(3)-RC2, P5(5)-RC2, P40(1)-RC2, P5(2) / P40(1)-RC2, P5(3) / P40(1)-RC2, and P5(5) / P40(1)-RC2. The sequences of the promoter regions are shown in Table 1. [Figure 14B]FIG. 14B shows rAAV production titers obtained by modifying the parent RC2 vector to include non-native P5 and / or P40 promoter sequences (FIG. 11; FIG. 14A; P5, downward striped rectangle; P40, upward striped rectangle) in place of the AAV2 serotype P5 and P40 promoters of the parent vector. The P19 promoter is the native AAV2 serotype promoter sequence (black filled rectangle). The following constructs were used: Parent-RC2, P5(2)-RC2, P5(3)-RC2, P5(5)-RC2, P40(1)-RC2, P5(2) / P40(1)-RC2, P5(3) / P40(1)-RC2, and P5(5) / P40(1)-RC2. The sequences of the promoter regions are shown in Table 1. FIG. 14B shows rAAV production titers obtained using such AAV helper plasmid vectors. Production titers of rAAV were obtained using a triple plasmid transfection system with rAAV and an Ad helper plasmid that provides the necessary adenoviral functions. [Figure 15A] Figure 15A shows rAAV production titers obtained by modifying the parent RC6 vector to contain the non-native P5 promoter sequence (Figure 11; Figure 15A; downward striped rectangle) in place of the AAV2 serotype P5 promoter naturally associated with the rep gene of such vectors. The P19 and P40 promoters are both native AAV2 serotype promoter sequences (black filled rectangles). The following constructs were used: Parent-RC6, P5(1)-RC6, P5(2)-RC6, P5(3)-RC6, P5(7)-RC6 and P5(8)-RC6. The sequences of the promoter regions are shown in Table 1. rAAV production titers were obtained using a triple plasmid transfection system with rAAV and an Ad helper plasmid providing the necessary adenoviral functions (Figures 15B and 15C). [Figure 15B]Figure 15B shows rAAV production titers obtained by modifying the parent RC6 vector to contain the non-native P5 promoter sequence (Figure 11; Figure 15A; downward striped rectangle) in place of the AAV2 serotype P5 promoter naturally associated with the rep gene of such vectors. The P19 and P40 promoters are both native AAV2 serotype promoter sequences (black filled rectangles). The following constructs were used: Parent-RC6, P5(1)-RC6, P5(2)-RC6, P5(3)-RC6, P5(7)-RC6 and P5(8)-RC6. The sequences of the promoter regions are shown in Table 1. rAAV production titers were obtained using a triple plasmid transfection system with rAAV and an Ad helper plasmid providing the necessary adenoviral functions (Figures 15B and 15C). [Figure 15C] Figure 15C shows rAAV production titers obtained by modifying the parent RC6 vector to contain the non-native P5 promoter sequence (Figure 11; Figure 15A; downward striped rectangle) in place of the AAV2 serotype P5 promoter naturally associated with the rep gene of such vectors. The P19 and P40 promoters are both native AAV2 serotype promoter sequences (black filled rectangles). The following constructs were used: Parent-RC6, P5(1)-RC6, P5(2)-RC6, P5(3)-RC6, P5(7)-RC6 and P5(8)-RC6. The sequences of the promoter regions are shown in Table 1. rAAV production titers were obtained using a triple plasmid transfection system with rAAV and an Ad helper plasmid providing the necessary adenoviral functions (Figures 15B and 15C). [Figure 16A]Figure 16A shows rAAV production titers obtained by modifying the parent RC1, RC5, or RC7 vectors to contain the non-native P5 promoter sequence (Figure 11; Figure 16A; downward striped rectangle) in place of the AAV2 serotype P5 promoter naturally associated with the rep gene of such vectors. The P19 and P40 promoters are both native AAV2 serotype promoter sequences (black filled rectangles). The following constructs were used: Parent-RC1, Parent-RC5, Parent-RC7, P5(2)-RC1, P5(7)-RC1, P5(8)-RC1, P5(7)-RC5, P5(2)-RC7, P5(7)-RC7, and P5(8)-RC7. The sequences of the promoter regions are shown in Table 1. rAAV production titers were obtained using a triple plasmid transfection system with rAAV and an Ad helper plasmid providing the necessary adenoviral functions (Figure 16B). [Figure 16B] Figure 16B shows rAAV production titers obtained by modifying the parent RC1, RC5, or RC7 vectors to contain the non-native P5 promoter sequence (Figure 11; Figure 16A; downward striped rectangle) in place of the AAV2 serotype P5 promoter naturally associated with the rep gene of such vectors. The P19 and P40 promoters are both native AAV2 serotype promoter sequences (black filled rectangles). The following constructs were used: Parent-RC1, Parent-RC5, Parent-RC7, P5(2)-RC1, P5(7)-RC1, P5(8)-RC1, P5(7)-RC5, P5(2)-RC7, P5(7)-RC7, and P5(8)-RC7. The sequences of the promoter regions are shown in Table 1. rAAV production titers were obtained using a triple plasmid transfection system with rAAV and an Ad helper plasmid providing the necessary adenoviral functions (Figure 16B). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0033] I. Methods of the Invention The present invention relates to recombinant adeno-associated virus (AAV) helper vectors that can increase the packaging efficiency of recombinant adeno-associated virus (rAAV), and their use to improve the packaging efficiency of such rAAV.The present invention particularly relates to recombinant modified adeno-associated virus (AAV) helper vectors that are further modified to replace (or enhance) the P5 and / or P40 promoter sequence that naturally associates with the Rep protein encoded by such rAAV with the AAV P5 and / or P40 promoter that associates with the Rep protein of a different serotype of rAAV.The use of such alternative or additional promoter sequences causes increased production of recombinant modified adeno-associated virus.

[0034] The present invention is based in part on the recognition that high levels of Rep and Cap proteins increase the amount of rAAV genome particles produced, thereby increasing the efficiency of rAAV packaging, resulting in high production titers of rAAV stocks.It has been unexpectedly found that the desired high levels of rAAV can be achieved by replacing the AAV P5 and / or P40 promoters that direct protein expression with different AAV P5 and / or P40 promoters, or by adding such different AAV P5 and / or P40 promoters in addition to the promoters that are initially present.Cap AAV Rep proteins are described in US Patent No. 10,214,730; US Patent No. 7,122,348; US Patent No. 6,821,511; US ​​Patent No. 6,753,419; US Patent No. 9,441,206; and US Patent No. 7,115,391.

[0035] As mentioned above, AAV and rAAV are characterized based on the serotype determined by the capsid protein (Colella, P. et al. (2018) “Emerging Issues in AAV-Mediated In Vivo Gene Therapy,” Molec. Ther. Meth. Clin. Develop. 8:87-104; Hocquemiller, M. et al. (2016) “Adeno-Associated Virus-Based Gene Therapy for CNS Diseases,” Hum. Gene Ther. 27(7):478-496; Lisowski, L. et al. (2015) “Adeno-Associated Virus Serotypes For Gene Therapeutics," 24:59-67; U.S. Patent No. 10,301,650; U.S. Patent No. 10,266,846; U.S. Patent No. 10,265,417; U.S. Patent No. 10,214,785; U.S. Patent No. 10,214,566; U.S. Patent No. 10,202,657; U.S. Patent No. 10,046,016; U.S. Patent No. 9,884,071; U.S. Patent No. 9,856,539; U.S. Patent No. 9,737,618; U.S. Patent No. 9,677,089; U.S. Patent No. (U.S. Pat. Nos. 9,458,517; 9,457,103; 9,441,244; 9,193,956; 8,846,389; 8,507,267; 7,906,111; 7,479,554; 7,186,552; 7,105,345; 6,984,517; 6,962,815; and 6,733,757). AAV and rAAV having "hybrid" serotypes can be produced by forming AAV and rAAV in the presence of AAV helper function-providing polynucleotides encoding two or more capsid proteins of different serotypes. Such AAV and rAAV exhibit the trophism of the combination of AAV and rAAV having each of such capsid proteins.

[0036] The Rep proteins of different AAV serotypes differ, but because such proteins are not structural proteins, this difference does not contribute to the observed serotypes of AAV.

[0037] As used herein, the term "AAV" is intended to refer to the adeno-associated virus and may be used to refer to the virus itself or its derivatives. This term includes all subtypes and both naturally occurring and recombinant forms. As used herein, the term "rAAV" is intended to refer to recombinant modified forms of AAV, including polynucleotide sequences that are not of AAV origin (i.e., polynucleotides that are heterologous to AAV). rAAV may be single-stranded or double-stranded and may be composed of deoxyribonucleotides or ribonucleotides. As discussed above, rAAV typically lacks certain AAV genes, and thus is produced using a double plasmid transfection system, or more preferably, a triple plasmid transfection system, including a plasmid vector containing an AAV helper function-providing polynucleotide, a plasmid vector containing a non-AAV helper function-providing polynucleotide, and a rAAV plasmid vector (Figure 2). In one embodiment, the AAV helper function-providing polynucleotides in such double or triple transfection systems may include more than one rep and / or cap gene, such that rAAVs having hybrid serotypes can be formed. In another embodiment, a second or additional AAV helper function-providing polynucleotide may be provided (e.g., on a second or additional plasmid vector) to allow for the formation of rAAVs having hybrid serotypes. A. Exemplary AAV Helper Function-Providing Polynucleotides

[0038] As used herein, "AAV helper functions" refers to AAV proteins (e.g., Rep and Cap) and / or AAV polynucleotides required for rAAV replication and packaging. Such AAV helper functions are provided by "AAV helper function-providing polynucleotides", which as used herein refers to polynucleotides integrated into viruses, plasmid vectors, non-plasmid vectors, or cell chromosomes that provide AAV helper functions. AAV helper plasmids that can be used according to the present invention to provide AAV helper functions include pAAV-RC (Agilent; Addgene; Cell Biolabs), pAAV-RC1, pAAV-RC2, pAAV-RC5, pAAV-RC6, and pAAV-RC7. 1. Plasmid pAAV-RC1

[0039] Plasmid pAAV-RC1 (SEQ ID NO:1; FIG. 3) is an AAV helper plasmid that expresses AAV1 serotype capsid proteins that can be used according to the invention to provide AAV helper functions. The P5 and P40 promoters of pAAV-RC1 are AAV2 serotype promoters (SEQ ID NO:10 and SEQ ID NO:18, respectively). The coding strand of plasmid pAAV-RC1 (SEQ ID NO:1): catggttttg ggacgtttcc tgagtcagat tcgcgaaaaaa ctgattcaga gaatttaccg cgggatcgag ccgactttgc caaactggtt cgcggtcaca aagaccagaa atggcgccgg aggcggggaac aaggtggtgg atgagtgcta catccccacctcctcc cagtgggcgt ggactaatat ggaacagtat ttaagcgcct gtttgaatct cacggagcgt aaacggttgg tggcgcagca tctgacgcac gtgtcgcaga cgcaggagca gaacaaagag aatcagaatc ccaattctga tgcgccggtg atcagattcag caggtcagc ggtggctcgt ggacaagggg attacctcgg agaagcagtg gatccaggag gaccaggcct catacatctc cttcaatgcg gcctccaact cgcggtccca aatcaaggct gccttggaca atgcgggaaa gattatgagc ctgactaaaaa ccgccccgag ctaccgcggcgc catttccagc aatcggattt ataaaatttt ggaactaaac gggtacgatc cccaatatgc ggcttccgtc tttctgggat gggccacgaa aaagttcggc aagaggaaca ccatctggct gtttgggcct gcaactaccg ggaagaccaa catcgcggag gccatagcccccgcgc ggaccaatga gaactttccc ttcaacgact gtgtcgacaa gatggtgatc tggtgggagg aggggaagat gaccgccaag gtcgtggagt cggccaaagc cattctcgga ggaagcaagg tgcgcgtgga ccagaaatgcaagtcctcgg cccagataga cccgactccc gtgatcgtca cctccaacac caacatgtgc gccgtgattg acgggaactc aacgaccttc gaacaccagc agccgttgca agaccggatg ttcaaatttg aactcacccg ccgtctggat catgactttg ggaaggtcac caagcaggaa gtcaaagact ttttccggtg ggcaaaggat cacgtggttg aggtggagca tgaattctac gtcaaaaagg gtggagccaa gaaaagaccc gcccccagtg acgcagatat aagtgagccc aaacgggtgc gcgagtcagt tgcgcagcca tcgacgtcag acgcggaagc ttcgatcaac tacgcagaca ggtaccaaaa caaatgttct cgtcacgtgg gcatgaatct gatgctgttt ccctgcagac aatgcgagag aatgaatcag aattcaaata tctgcttcac tcacggacag aaagactgtt tagagtgctt tcccgtgtca gaatctcaac ccgtttctgt cgtcaaaaag gcgtatcaga aactgtgcta cattcatcat atcatgggaa aggtgccaga cgcttgcact gcctgcgatc tggtcaatgt ggatttggat gactgcatct ttgaacaata aatgatttaa atcaggtatg gctgccgatg gttatcttcc agattggctc gaggacaacc tctctgaggg cattcgcgag tggtgggact tgaaacctgg agccccgaag cccaaagcca accagcaaaa gcaggacgac ggccggggtc tggtgcttcc tggctacaag tacctcggac ccttcaacgg actcgacaag ggggagcccg tcaacgcggc ggacgcagcg gccctcgagc acgacaaggc ctacgaccagcagctcaaag cgggtgacaa tccgtacctg cggtataacc acgccgacgc cgagtttcag gagcgtctgc aagaagatac gtctttttggg ggcaacctcg ggcgagcagt cttccaggcc aagaagcggg ttctcgaacc tctcggtg gttgagctcgc aagaaacgtc cggtagagca gtcgccacaa gagccagact cctcctcggg catcggcaag acaggccagc agcccgctaa aaagagactc aattttggtc agactggcga ctcagagtca gtccccgatc cacaacctct cggagaacct ccagcaaccc ccgccct gcggct cagggct cgcaccaatg gcagacaata acgaaggcgc cgacggagtg ggtaatgcct caggaaattg gcattgcgat tccacatggc tgggcgacag agtcatcacc accagcaccc gcacctgggc cttgcccacc tacaataacc acctctacaa gcaaatctcc agtgctcgcgcactcacgacggc gctacagcac cccctggggg tattttgatt tcaacagatt ccactgccac ttttcaccac gtgactggca gcgactcatc aacaacaatt ggggattccg gcccaagaga ctcaacttca aactcttcaa catccaagtc aaggaggtca cgacgaatga tggcagtca accatc cagcacggtt caagtcttct cggactcgga gtaccagctt ccgtacgtc tcggctctgc gcaccagggc tgcctccctc cgtcccggc ggacgtgttc atgattccgc aatacggcta cctgacgctc aacaatggcagccaagccgt gggacgttca tcctttact gcctggaata tttcccttct cagatgctga gaacggcaa caactttacc ttcagctaca cctttgagga agtgcctttc cacagcagct acgcgcacag ccagagcctg gaccggctga tgaatcctct catcgaccaa tacctgtatt acctgaacag aactcaaaat cagtccggaa gtgcccaaaa caaggacttg ctgtttagcc gtgggtctcc agctggcatg tctgttcagc ccaaaaaactg gctacctgga ccctgttatc ggcagcagcg cgtttctaaa acaaaaacag acaacaacaa cagcaattt acctggactg gtgcttcaaa atataacctc aatgggcgtg aatccatcat caaccctggc actgctatgg cctcacacaa agacgacgaa gacaagttct ttcccatgag cggtgtcatg attttggaa aagagagcgc cggagcttca aacactgcat tggacaatgt catgattaca gacgaagagg aaattaaagc cactaaccct gtggccaccg aaagatttgg gaccgtggca gtcaatttcc agagcagcag cacagaccct gcgaccggag atgtgcatgc tatgggagca ttacctggca tggtgtggca agatagagac gtgtacctgc agggtcccat ttgggccaaa attcctcaca cagatggaca ctttcacccg tctcctctta tgggcggctt tggactcaag aacccgctc ctcagatcct catcaaaaac acgcctgttc ctgcgaatcc tccggcggag ttttcagcta caaagtttgc ttcattcatc acccaatact ccacaggaca agtgagtgtg gaaattgaat gggagctgcagaaagaaaac agcaagcgct ggaatcccga agtgcagtac acatccaatt atgcaaaatc tgccaacgtt gattttactg tggacaacaa tggactttat actgagcctc gccccacattgg cacccgttac cttaccgtc ccctgtaagg cgcgccaccg gttgcttgtt aatcaataaa ccgtttaatt cgtttcagtt gaactttggt ctctgcgtat ttctttctta tctagtttcc atgctctagg atccactagt aacggccgcc agtgtgctgg aattcggctt tgtagttaat gattaacccg ccatgctact tatctacgta gccatgctct agaggtcctg tattagaggt cacgtgagtg tttgcgaca tttgcgaca ccatgtggtc acgctgggta tttaagcccg agtgagcacg cagggtctcc attttgaagc gggaggttttg aacgcgcagc cgccaagccg aattctgcag atatccaaac actggcggcc gctcgactag agcggccgcc accgcggtgg agctccagct tttgttccct ttagtgaggg ttaattgcgc gcttggcgta atcatggtca tagctgtttc ctgtgtgaaa ttgttatccg ctcacaattc cacacaacat acgagccgga agcataaagt gtaaagcctg gggtgcctaa tgagtgagct aactcacatt aattgcgttg cgctcactgc ccgctttcca gtcgggaaac ctgtcgtgcc agctgcatta atgaatcggc caacgcgcgg ggagaggcgg tttgcgtatt gggcgctctt ccgcttctc gctcactgac tcgctgcgct cggtcgttcg gctgcggcga gcggtatcag ctcactcaaa ggcggtaata cggttatccacagaatcagg ggataacgca ggaaagaaca tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa ggccgcgttg ctggcgttt tccataggct ccgcccccct gacgagcatc acaaaaatcg acgctcaagt cagaggtggc gaaacccgac aggactataa agataccagg cgtttcccc tggaagctcc ctcctgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc ctttctccct tcgggaagcg tggcgctttc tcatagctca cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc actggcagca gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga gttcttgaag tggtggccta actacggcta cactagaaga acagtatttg gtatctgcgc tctgctgaag ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac caccgctggt agcggtggtt ttttgttg caagcagcag attacgcgca gaaaaaaaagg atctcaagaa gatcctttga tctttctac ggggtctgac gctcagtgga acgaaaaactc acgttaaggg attttggtca tgagattatc aaaaaggatc ttcacctaga tccttttaaa ttaaaaatga agttttaaat caatctaaag tatatatgag taaacttggt ctgacagtta ccaatgctta atcagtgagg cacctatctc agcgatctgt ctatttcgt catccatagttgcctgactc cccgtcgtgt agataactac gatacgggag ggcttaccat ctggccccag tgctgcaatg ataccgcgag acccacgctc accggctcca gatttatcag caataaacca gccagccgga aggccgagc gcagaagtgg tcctgcaact ttatccgcct ccatccagtc tattaattgt tgccgggaag ctagagtaag tagttcgcca gttaatagtt tgcgcaacgt tgttgccatt gctacaggca tcgtggtgtc acgctcgtcg tttggtatgg cttcattcag ctccggttcc caacgatcaa ggcgagttac atgatccccc atgttgtgca aaaaagcggt tagctccttc ggtcctccga tcgttgtcag aagtaagttg gccgcagtgt tatcactcat ggttatggca gcactgcata attctcttac tgtcatgcca tccgtaagat gctttctgt gactggtgag tactcaacca agtcattctg agaatagtgt atgcggcgac cgagttgctc ttgcccggcg tcaatacggg samaaccgc gccacatagc agaactttaa aagtgctcat cattggaaaa cgttcttcgg ggcgaaaact ctcaaggatc ttaccgctgt tgagatccag ttcgatgtaa cccactcgtg cacccaactg atcttcagca tcttttactt tcaccagcgt tctgggtga gcaaaaacag gaaggcaaa tgccaaaa aagggaataa gggcgacacg gaaatgttga atactcatac tcttccttt tcaatattat tgaagcattt atcagggtta ttgtctcatg agcggataca tatttgaatg tatttagaaa aataaacaaa taggggttcc gcgcacatttccccgaaaag tgccacctaa attgtaagcg ttaatattt gttaaaattc gcgttaaatt tttgttaaat cagctcattt tttaaccaat aggccgaaat cggcaaaatc ccttataaat caaaagaata gaccgagata gggttgagtg ttgttccagt ttggaacaag agtccactat taaagaacgt ggactccaac gtcaaaggc gaaaaaccgt ctatcagggc gatggcccac tacgtgaacc atcaccctaa tcaagtttt tggggtcgag gtgccgtaaa ggaaccctaa agggagcc cgatttagag cttgacgggg aaagccggcg aacgtggcga gaaaggaagg ggaaagcg aaaggagcgg gcgctagggc gctggcaagt gtagcggtca cgctgcgcgt aaccaccaca cccgccgcgc ttaatgcgcc gctacagggc gcgtcccatt cgccattcag gctgcgcaac tgttgggaag ggcgatcggt gcgggcctct tcgctattac gccagctggc gaaagggga tgtgctgcaa ggcgattaag ttgggtaacg ccagggtttt cccagtcacg acgttgtaaa acgacggcca gtgagcgcgc gtaatacgac tcactatagg gcgaattggg taccgggccc cccctcgagg tcgacggtat cggggagct cgcagggtct ccattttgaa gcgggaggtt tgaacgcgca gccgccatgc cggggtttta cgagattgtg attaaggtcc ccagcgacct tgacgagcat ctgcccggca tttctgacag ctttgtgaac tgggtggccg agaaggaatg ggagttgccg ccagattctg acatggatct gaatctgatt gagcaggcacccctgaccgt ggccgagaag ctgcagcgcg actttctgac ggaatggcgc cgtgtgagta aggccccgga ggctcttttc tttgtgcaat ttgagaaggg agagagctac ttccacatgc acgtgctcgt ggaaaccacc ggggtgaaat c

[0040] In SEQ ID NO:1, residues 1-1561 of pAAV-RC1 encode the Rep protein, Rep78 (residues 95-221 correspond to the AAV2 P19 promoter, and residues 1075-1254 correspond to the AAV2 P40 promoter (SEQ ID NO:18)); residues 1578-3788 encode the AAV1 VP1 capsid protein; residues 7127-7431 encode the Rep68 protein; residues 3984-4114 correspond to the AAV2 P5 promoter sequence (SEQ ID NO:10); residues 4237-4253 are the M13 Rev sequence; residues 4261-4277 are the Lac operator sequence; residues 4285-4315 are the Lac promoter sequence; and residues 4578-5302 are the pMB corresponds to the ori sequence; residues 5398-6258 encode the ampicillin resistance determinant; and residues 6259-6357 are the bla promoter sequence (Figure 3). 2. Plasmid pAAV-RC2

[0041] Plasmid pAAV-RC2 (SEQ ID NO:2; FIG. 4) is an AAV helper plasmid that expresses AAV2 serotype capsid proteins that can be used according to the invention to provide AAV helper functions. The P5 and P40 promoters of pAAV-RC2 are AAV2 serotype promoters (SEQ ID NO:10 and SEQ ID NO:18, respectively). The coding strand of plasmid pAAV-RC2 (SEQ ID NO:2): ccgggccccc cctcgaggtc gacggtatcg ggggagctcg cagggtctcc attttgaagc gggaggtttg aacgcgcagc cgccatgccg gggttttacg agattgtgat taaggtcccc agcgaccttg acgagcatct gcccggcatt tctgacagct ggtgaccg ggggagg agttgccgcc agattctgac atggatctga atctgattga gcaggcaccc ctgaccgtgg ccgagaagct gcagcgcgac tttctgacgg aatggcgccg tgtgagtaag gccccggagg ctcttttctt tgtgcaattt gagaagggag agagctactt g ccacatgcactc atggttttgg gacgtttcct gagtcagatt cgcgaaaaac tgattcagag aatttaccgc gggatcgagc cgactttgcc aaactggttc gcggtcacaa agaccagaaa tggcgccgga ggcgggaaca aggtggtgga tgagtgctac actt atccccactcctc caccac agtgggcgtg gactaattg gaacagtatt taagcgcctg tttgaatctc acggagcgta aacggttggt ggcgcagcat ctgacgcacg tgtcgcagac gcaggagcag aaaagaga atcagaatcc caattctgat gcgccggtga tcagattcag aggtacgg aggtacgg gtggctcgtg gacaagggga ttacctcgga gaagcagtgg atccaggagg accaggcctc atacatctcc ttcaatgcgg cctccaactc gcggtcccaa atcaaggctg ccttggacaa tgcgggaaag attatgagcctgactaaaac cgcccccgac tacctggtgg gccagcagcc cgtggaggac atttccagca atcggattta taaaattttg gaactaaacg ggtacgatcc ccaatatgcg gcttccgtct ttctgggatg ggccacgaaa aagttcggca agaggaacac catctggctg tttgggcctg caactaccgg gaagaccaac atcgcggagg ccatagccca cactgtgccc ttctacgggt gcgtaaactg gaccaatgag aactttccct tcaacgactg tgtcgacaag atggtgatct ggtgggagga ggggaagatg accgccaagg tcgtggagtc ggccaaagcc attctcggag gaagcaaggt gcgcgtggac cagaaatgca agtcctcggc ccagatagac ccgactcccg tgatcgtcac ctccaacacc aacatgtgcg ccgtgattga cgggaactca acgaccttcg aacaccagca gccgttgcaa gaccggatgt tcaaatttga actcacccgc cgtctggatc atgactttgg gaaggtcacc aagcaggaag tcaaagactt tttccggtgg gcaaaggatc acgtggttga ggtggagcat gaattctacg tcaaaaaggg tggagccaag aaaagacccg cccccagtga cgcagatata agtgagccca aacgggtgcg cgagtcagtt gcgcagccat cgacgtcaga cgcggaagct tcgatcaact acgcagacag gtaccaaaac aaatgttctc gtcacgtggg catgaatctg atgctgtttc cctgcagaca atgcgagaga atgaatcaga attcaaatat ctgcttcact cacggacaga aagactgttt agagtgcttt cccgtgtcag aatctcaacccgtttctgtc gtcaaaaagg cgtatcagaa actgtgctac attcatcata tcatgggaaa ggtgccagac gcttgcactg cctgcgatct ggtcaatgtg gatttggatg actgcatctt tgaacaataa atgatttaaa tcaggtatgg ctgccgatgg ttatcttcca gattggctcg aggacactct ctctgaagga ataagacagt ggtggaagct caaacctggc ccaccaccac caaagcccgc agagcggcat aaggacgaca gcaggggtct tgtgcttcct gggtacaagt acctcggacc cttcaacgga ctcgacaagg gagagccggt caacgaggca gacgccgcgg ccctcgagca cgacaaagcc tacgaccggc agctcgacag cggagacaac ccgtacctca agtacaacca cgccgacgcg gagtttcagg agcgccttaa agaagatacg tcttttgggg gcaacctcgg acgagcagtc ttccaggcga aaaagagggt tcttgaacct ctgggcctgg ttgaggaacc tgttaagacg gctccgggaa aaaagaggcc ggtagagcac tctcctgtgg agccagactc ctcctcggga accggaaagg cgggccagca gcctgcaaga aaaagattga attttggtca gactggagac gcagactcag tacctgaccc ccagcctctc ggacagccac cagcagcccc ctctggtctg ggaactaata cgatggctac aggcagtggc gcaccaatgg cagacaataa cgagggcgcc gacggagtgg gtaattcctc gggaaattgg cattgcgatt ccacatggat gggcgacaga gtcatcacca ccagcacccg aacctgggcc ctgcccacct acaacaaccacctctacaaa caaatttcca gccaatcagg agcctcgaac gacaatcact actttggcta cagcacccct tgggggtatt ttgacttcaa cagattccac tgccaacttt caccacgtga ctggcaaaga ctcatcaaca acaactgggg attccgacc aagagactca acttcaagct ctttaacatt caagtcaaag aggtcacgca gaatgacggt acgacgacga ttgccaataa ccttaccagc acggttcagg tgtttaactga ctcggagtac cagctcccgt acgtcctcgg ctcggcgcat caaggatgcc tcccgccgtt cccagcagac gtcttcatgg tgccacagta tggatacctc accctgaaca acgggagtca ggcagtagga cgctcttcat tttactgcct ggagtacttt ccttctcaga tgctgcgtac cggaaacaac tttaccttca gctacacttt tgaggacgtt cctttccacag gctctggacc gtctcatgaa tcctctcatc gaccagtacc tgtattactt gagcaagaa aacactccaa gtggaaccac cacgcagtca aggcttcagt tttctcaggc cggagcgagt gacattcggg accagtctag gaactggctt cctggaccct gttaccgcca gcagcgagta tcaaagacat ctgcggataa caacaagt gaatactcgt ggactggagc taccaagtac cacctcaatg gcagagactc tctggtgaat ccgggcccgg ccatggcaag ccacaaggac gatgaagaaa agttttttcc tcagagcggg gttctcatct ttgggaagca aggctcagag aaaacaaatg tggacattga aaaggtcatgattacagacg aagaggaaat caggacaacc aatcccgtgg ctacggagca gtatggttct gtatctacca acctccagag aggcaacaga caagcagcta ccgcagatgt caacacacaa ggcgttcttc caggcatggt ctggcaggac agagatgtgt accttcaggg gcccatctgg gcaaagattc cacacacgga cggacatttt cacccctctc ccctcatggg tggattcgga cttaaacacc ctcctccaca gattctcatc aagaacaccc cggtacctgc gaatccttcg accaccttca gtgcggcaaa gtttgcttcc ttcatcacac agtactccac gggacaggtc agcgtggaga tcgagtggga gctgcagaag gaaaacagca aacgctggaa tcccgaaatt cagtacactt ccaactacaa caagtctgtt aatgtggact ttactgtgga cactaatggc gtgtattcag agcctcgccc cattggcacc agatacctga ctcgtaatct gtaattgctt gttaatcaat aaaccgttta attcgtttca gttgaacttt ggtctctgcg tatttctttc ttatctagtt tccatgctct aggatccact agtaacggcc gccagtgtgc tggaattcgg ctttgtagtt aatgattaac ccgccatgct acttatctac gtagccatgc tctagaggtc ctgtattaga ggtcacgtga gtgttttgcg acattttgcg acaccatgtg gtcacgctgg gtatttaagc ccgagtgagc acgcagggtc tccattttga agcgggaggt ttgaacgcgc agccgccaag ccgaattctg cagatatcca aacactggcg gccgctcgac tagagcggcc gccaccgcggtggagctcca gcttttgttc cctttagtga gggttaattg cgcgcttggc gtaatcatgg tcatagctgt ttcctgtgtg aaattgttat ccgctcacaa ttccacacaa catacgagcc ggaagcataa agtgtaaagc ctggggtgcc taatgagtga gctaactcac attaattgcg ttgcgctcac tgcccgcttt ccagtcggga aacctgtcgt gccagctgca ttaatgaatc ggccaacgcg cggggagagg cggtttgcgt attgggcgct cttccgcttc ctcgctcact gactcgctgc gctcggtcgt tcggctgcgg cgagcggtat cagctcactc aaaggcggta atacggttat ccacagaatc aggggataac gcaggaaaga acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag gctccgcccc cctgacgagc atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc gacaggacta taaagatacc aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc ttatccggta actatcgtct tgagtccaac ccggtaagac acgacttatc gccactggca gcagccactg gtaacaggat tagcagagcg aggtatgtag gcggtgctac agagttcttg aagtggtggc ctaactacgg ctacactaga agaacagtatttggtatctg cgctctgctg aagccagtta ccttcggaaa aagagttggt agctcttgat ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg tcatgagatt atcaaaaagg atcttcacct agatcctttt aaattaaaaa tgaagtttta aatcaatcta aagtatatat gagtaaactt ggtctgacag ttaccaatgc ttaatcagtg aggcacctat ctcagcgatc tgtctatttc gttcatccat agttgcctga ctccccgtcg tgtagataac tacgatacgg gagggcttac catctggccc cagtgctgca atgataccgc gagacccacg ctcaccggct ccagatttat cagcaataaa ccagccagcc ggaagggccg agcgcagaag tggtcctgca actttatccg cctccatcca gtctattaat tgttgccggg aagctagagt aagtagttcg ccagttaata gtttgcgcaa cgttgttgcc attgctacag gcatcgtggt gtcacgctcg tcgtttggta tggcttcatt cagctccggt tcccaacgat caaggcgagt tacatgatcc cccatgttgt gcaaaaaagc ggttagctcc ttcggtcctc cgatcgttgt cagaagtaag ttggccgcag tgttatcact catggttatg gcagcactgc ataattctct tactgtcatg ccatccgtaa gatgcttttc tgtgactggt gagtactcaa ccaagtcatt ctgagaatag tgtatgcggc gaccgagttgctcttgcccg gcgtcaatac gggataatac cgcgccacat agcagaactt taaaagtgct catcattgga aaacgttctt cggggcgaaa actctcaagg atcttaccgc tgttgagatc cagttcgatg taacccactc gtgcacccaa ctgatcttca gcatctttta ctttcaccag cgtttctggg tgagcaaaaa cagggaaggca aaatgccgca aaaaagggaa taagggcgac acggaaatgt tgaatactca tactcttcct ttttcaatat tattgaagca tttatcaggg ttatgtctc atgagcggat acatatttga atgtatttag aaaaataaac aaataggggt tccgcgcaca tttccccgaa aagtgccacc taaattgtaa gcgttaatat tttgttaaaa ttcgcgttaa attttgtta aatctca ttttttaacc aataggccga aatcggcaaa atcccttata aatcaaaaga atagaccgag atagggttga gtgttgttcc agtttggaac aagagtccac tattaaagaa cgtggactcc aacgtcaaag ggcgaaaaac cgtctatcag ggcgatggcc cactacgtga accatcaccc taatcaagtt ttttggggtc gaggtgccgt aaagcactaa atcggaaccc taaagggagc ccccgattta gagcttgacg gggaaagccg gcgaacgtgg cgagaaagga agggaagaaa gcgaaaggag cgggcgctag ggcgctggca agtgtagcgg tcacgctgcg cgtaaccacc acacccgccg cgcttaatgc gccgctacag ggcgcgtccc attcgcatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctattacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt tttcccagtc acgacgttgt aaaacgacgg ccagtgagcg cgcgtaatac gactcactat agggcgaatt gggta

[0042] In SEQ ID NO:2, residues 85-1950 of pAAV-RC2 encode the Rep protein, Rep78 (residues 484-663 correspond to the AAV2 P19 promoter, residues 1464-1643 correspond to the AAV2 P40 promoter (SEQ ID NO:18), and residues 1668-1676 are the donor site); residues 1967-4174 encode the AAV2 VP1 capsid protein; residues 1992-2016 encode a portion of the Rep68 protein; residues 4175-4256 encode a polyA sequence; residues 4357-4487 correspond to the AAV2 P5 promoter sequence of SEQ ID NO:10; and residues 4610-4626 encode the M13 the Rev sequence; residues 4634-4650 are the Lac operator sequence; 4658-4688 are the Lac promoter sequence; residues 4951-5675 correspond to the pMB ori sequence, residues 5771-6631 encode the ampicillin resistance determinant; and residues 6632-6730 are the bla promoter sequence (FIG. 4). 3. Plasmid pAAV-RC5

[0043] Plasmid pAAV-RC5 (SEQ ID NO:3; FIG. 5) is an AAV helper plasmid that expresses AAV5 serotype capsid proteins that can be used according to the invention to provide AAV helper functions. The P5 and P40 promoters of pAAV-RC5 are AAV2 serotype promoters (SEQ ID NO:10 and SEQ ID NO:18, respectively). The coding strand of plasmid pAAV-RC5 (SEQ ID NO:3): catggttttg ggacgtttcc tgagtcagat tcgcgaaaaaa ctgattcaga gaatttaccg cgggatcgag ccgactttgc caaactggtt cgcggtcaca aagaccagaa atggcgccgg aggcggggaac aaggtggtgg atgagtgcta catccccacctcctcc cagtgggcgt ggactaatat ggaacagtat ttaagcgcct gtttgaatct cacggagcgt aaacggttgg tggcgcagca tctgacgcac gtgtcgcaga cgcaggagca gaacaaagag aatcagaatc ccaattctga tgcgccggtg atcagattcag caggtcagc ggtggctcgt ggacaagggg attacctcgg agaagcagtg gatccaggag gaccaggcct catacatctc cttcaatgcg gcctccaact cgcggtccca aatcaaggct gccttggaca atgcgggaaa gattatgagc ctgactaaaaa ccgccccgag ctaccgcggcgc catttccagc aatcggattt ataaaatttt ggaactaaac gggtacgatc cccaatatgc ggcttccgtc tttctgggat gggccacgaa aaagttcggc aagaggaaca ccatctggct gtttgggcct gcaactaccg ggaagaccaa catcgcggag gccatagcccccgcgc ggaccaatga gaactttccc ttcaacgact gtgtcgacaa gatggtgatc tggtgggagg aggggaagat gaccgccaag gtcgtggagt cggccaaagc cattctcgga ggaagcaagg tgcgcgtgga ccagaaatgcaagtcctcgg cccagataga cccgactccc gtgatcgtca cctccaacac caacatgtgc gccgtgattg acgggaactc aacgaccttc gaacaccagc agccgttgca agaccggatg ttcaaatttg aactcacccg ccgtctggat catgactttg ggaaggtcac cagcaggaa gtcaaagact ttttccggtg ggcaaaggat cacgtggttg aggtggagca tgaattctac gtcaaaaagg gtggagccaa gaaagaccc gcccccagtg acgcagatat aagtgagccc aaacgggtgc gcgagtcagt tgcgcagcca tcgacgtcag acgcggaagc ttcgatcaac tacgcagaca ggtaccaaaa caaatgttct cgtcacgtgg gcatgaatct gatgctgttt ccctgcagac aatgcgagag aatgaatcag aattcaaata tctgcttcac tcaggcag aaagactgtt tagagtgctt tcccgtgtca gaatctcaac ccgtttctgt cgtcaaaaag gcgtatcaga aactgtgcta cattcatcat atcatgggaa aggtgccaga cgcttgcact gcctgcgatc tggtcaatgt ggatttggat gactgcatct ttgaacaata aatgatttaa atcaggtatg tctttgttg atcaccctcc agattggttg gaagaagttg gtgaaggtct tcgcgagttt ttgggccttg aagcgggccc accgaaacca aaacccaatc agcagcatca agatcaagcc cgtggtctt tgctgcctgg ttataactat ctcggacccg gaaacggtct cgatcgagga gagcctgtca acagggcaga cgaggtcgcg cgagagcacg acatctcgta caacgagcagcagcttgaggcgg gagacaaccc ctacctcaag tacaaccacg cggacgccga gtttcaggag aagctcgccg acgacacatc cttcggggga aacctcggaa aggcagtctt tcaggccaag aaaagggttc tcgaaccttt tggcctggtt gaagagggtg ctaagacggc ccctaccgga aagcggatag acgaccactt tccaaaaaga aagaaggctc ggaccgaaga ggactccaag ccttccacct cgtcagacgc cgaagctgga cccagcggat cccagcagct gcaaatccca gcccaaccag cctcaagttt gggagctgat acaatgtctg cgggaggtgg cggcccattg ggcgacaata accaaggtgc cgatggagtg ggcaatgcct cgggagattg gcattgcgat tccacgtgga tgggggacag agtcgtcacc aagtccaccc gaacctgggt gctgcccagc tacaacaacc accagtaccg agagatcaaa agcggctccg tcgacggaag caacgccaac gcctactttg gatacagcac cccctggggg tactttgact ttaaccgctt ccacagccac tggagccccc gagactggca aagactcatc aacaactact ggggcttcag accccggtcc ctcagagtca aaatcttcaa cattcaagtc aaagaggtca cggtgcagga ctccaccacc accatcgcca acaacctcac ctccaccgtc caagtgttta cggacgacga ctaccagctg ccctacgtcg tcggcaacgg gaccgaggga tgcctgccgg ccttccctcc gcaggtcttt acgctgccgc agtacggtta cgcgacgctg aaccgcgaca acacagaaaa tcccaccgag aggagcagcttcttctgcct agagtacttt cccagcaaga tgctgagaac gggcaacaac tttgagttta cctacaactt tgaggaggtg cccttccact ccagcttcgc tcccagtcag aacctgttca agctggccaa cccgctggtg gaccagtact tgtaccgctt cgtgagcaca aataacactg gcggagtcca gttcaacaag aacctggccg ggagatacgc caacacctac aaaaactggt tcccggggcc catgggccga acccagggct ggaacctggg ctccggggtc aaccgcgcca gtgtcagcgc cttcgccacg accaatagga tggagctcga gggcgcgagt taccaggtgc ccccgcagcc gaacggcatg accaacaacc tccagggcag caacacctat gccctggaga acactatgat cttcaacagc cagccggcga acccgggcac caccgccacg tacctcgagg gcaacatgct catcaccagc gagagcgaga cgcagccggt gaaccgcgtg gcgtacaacg tcggcgggca gatggccacc aacaaccaga gctccaccac tgcccccgcg accggcacgt acaacctcca ggaaatcgtg cccggcagcg tgtggatgga gagggacgtg tacctccaag gacccatctg ggccaagatc ccagagacgg gggcgcactt tcacccctct ccggccatgg gcggattcgg actcaaacac ccaccgccca tgatgctcat caagaacacg cctgtgcccg gaaatatcac cagcttctcg gacgtgcccg tcagcagctt catcacccag tacagcaccg ggcaggtcac cgtggagatg gagtgggagc tcaagaagga aaactccaag aggtggaacc cagagatccagtacacaaac aactacaacg accccccagtt tgtggacttt gccccggaca gcaccggga atacagaacc accagaccta tcggaacccg ataccttacc cgaccccttt aaggcgcgcc accggttgct tgttaatcaa taaaccgttt aattcgtttc agttgaactt tggtctctgc gtattcttt cttatctagt ttccatgctc taggatccac tagtaacggc cgccagtgtg ctggaattcg gctttgtagt taatgattaa cccgccatgc tacttatcta cgtagccatg ctctagaggt cctgtattag aggtcacgtg agtgttttgc gacattttgc gacaccatgt ggtcacgctg ggtatttaag cccgagtgag cacgcagggt ctccattttg aagcgggagg tttgaacgc cagccgccaa gccgaattct gcagatatcc aaacactggc ggccgctcga ctagagcggc cgccaccgcg gtggagct agcttttgtt ccctttagtg agggttaatt gcgcgcttgg cgtaatcatg gtcatagctg tttcctgtgt gaaattgtta tccgctcaca attccacaca acatacgagc cggaagcata aagtgtaaag cctggggtgc ctaatgagtg agctaactca cattaattgc gttgcgctca ctgcccgctt tccagtcggg aaacctgtcg tgccagctgc attaatgaat cggccaacgc gcggggagag gcggtttgcg tattgggcgc tcttccgctt cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg gcgagcggta tcagctcact caaggcggt aatacggtta tccacagaat cagggggataa cgcaggaaag aacatgtgagcaaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg tttttccata ggctccgccc ccctgacgag catcacaaaa atcgacgctc aagtcagagg tggcgaaacc cgacaggact ataaagatac caggcgtttc cccctggaag ctccctcgtg cgctctcctg ttccgaccct gccgcttacc ggatacctgt ccgcctttct cccttcggga agcgtggcgc tttctcatag ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc gttcagcccg accgctgcgc cttatccggt aactatcgtc ttgagtccaa cccggtaaga cacgacttat cgccactggc agcagccact ggtaacagga ttagcagagc gaggtatgta ggcggtgcta cagagttctt gaagtggtgg cctaactacg gctacactag aagaacagta tttggtatct gcgctctgct gaagccagtt accttcggaa aaagagttgg tagctcttga tccggcaaac aaaccaccgc tggtagcggt ggtttttttg tttgcaagca gcagattacg cgcagaaaaa aaggatctca agaagatcct ttgatctttt ctacggggtc tgacgctcag tggaacgaaa actcacgtta agggattttg gtcatgagat tatcaaaaag gatcttcacc tagatccttt taaattaaaa atgaagtttt aaatcaatct aaagtatata tgagtaaact tggtctgaca gttaccaatg cttaatcagt gaggcaccta tctcagcgat ctgtctattt cgttcatcca tagttgcctg actccccgtc gtgtagataa ctacgatacgggagggcttta ccatctggcc ccagtgctgc aatgataccg cgagacccac gctcaccggc tccagattta tcagcataa accagccagc cggaagggcc gagcgcagaa gtgtcctgc aactttatcc gcctccatcc agtctattaa ttgtgttgagccg gagccg agtttgcgca acgttgttgc cattgctaca ggcatcgtgg tgtcacgctc gtcgttgt atggctcat tcagctccgg tcccaacga tcaggcgag ttacatgatc gcccatgttg tgccaaaag cggttagcagctctt cttcggctc gtgttatcac tcatggttat ggcagcactg cataattctc ttactgtcat gccatccgta agatgcttt ctgtgactgg tgagtactca accagtcat tctgagaata gtgtatgcgg cgaccgagtt gctctgccc ggcgagcatacata cgggactcata cgggactcata ttaaaagtgc tcatcattgg aaaacgttct tcggggcga aactctcaag gatcttaccg ctgttgagat ccagttcgat gtaacccact cgtgcacca actgatc actgattt acttcacca gcgtttctg gtgagcaaa aaaagggaggaccag aaaagggaccgag cacggaaatg ttgaatactc atactctcc ttttcaata ttattgaagc atttatcagg gttattgtct catgagcgga cacatatttg aatgtattta gaaaaataa caatagggg ttccgcgcac atttccccga aaagtgccac ctaaattgta agcgttaatattttgttaaa attcgcgtta aatttttgtt aaatcagctc attttttaac caataggccg aaatcggcaa aatcccttat aaatcaaaag aatagaccga gatagggttg agtgttgttc cagtttggaa caagagtcca ctattaaaga acgtggactc caacgtcaaa gggcgaaaaa ccgtctatca gggcgatggc ccaactacgtg aaccatcacc ctaatcaagt ttttggggt cgaggtgccg taaagcacta aatcggaacc ctaaaagggag cccccgattt agagcttgac ggggaaagcc ggcgaacgtg gcgagaaagg aagggagaa agcgaaagga gcgggcgcta gggcgctggc aagtgtagcg gtcacgctgc gcgtaaccac cacacccgcc gcgcttaatg cgccgctaca gggcgcgtcc cattcgccat tcaggctgc caactgttgg gaagggcgat cggtgcgggc ctcttcgcta ttacgccagc tggcgaaagg gggatgtgct gcaaggcgat taagttgggt aacgccaggg ttttcccagt cacgacgttg taaaacgacg gccagtgagc gcgcgtaata cgactcacta tagggcgaat tgggtaccgg gccccccctc gaggtcgacg gtatcgggg agctcgcagg gtctccattt tgaagcggga ggtttgaacg cgcagccgcc atgccggggt tttacgagat tgtgattaag gtccccagcg accttgacga gcatctgccc ggcatttctg acagctttgt gaactgggtg gccgagaagg aatgggagtt gccgccagat tctgacatgg atctgaatct gattgagcag gcacccctga ccgtggccga gaagctgcag cgcgactttctgacggaatg gcgccgtgtg agtaaggccc cggaggctct tttctttgtg caatttgaga agggagagag ctacttccac atgcacgtgc tcgtggaaac caccggggtg aaatc

[0044] In SEQ ID NO:3, residues 1-1561 of pAAV-RC5 encode the Rep protein, Rep78 (residues 91-221 correspond to the AAV2 P19 promoter, and residues 1075-1254 correspond to the P40 promoter (SEQ ID NO:18)); residues 1578-3749 encode the AAV5 VP1 capsid protein; residues 7091-7395 encode a portion of the Rep68 protein; residues 3948-4078 correspond to the AAV2 P5 promoter sequence of SEQ ID NO:10; residues 4201-4217 are the M13 Rev sequence; residues 4225-4241 are the Lac operator sequence; residues 4249-4279 are the Lac promoter sequence; and residues 4542-5266 are the pMB It corresponds to the ori sequence; residues 5362-6222 encode the ampicillin resistance determinant; residues 6223-6321 are the bla promoter sequence (Figure 5). 4. Plasmid pAAV-RC6

[0045] Plasmid pAAV-RC6 (SEQ ID NO: 4; FIG. 6) is an AAV helper plasmid that expresses AAV6 serotype capsid proteins that can be used according to the invention to provide AAV helper functions. The P5 and P40 promoters of pAAV-RC6 are AAV2 serotype promoters (SEQ ID NO: 10 and SEQ ID NO: 18, respectively). Coding strand of plasmid pAAV-RC6 (SEQ ID NO:4): catggttttg ggacgtttcc tgagtcagat tcgcgaaaaaa ctgattcaga gaatttaccg cgggatcgag ccgactttgc caaactggtt cgcggtcaca aagaccagaa atggcgccgg aggcggggaac aaggtggtgg atgagtgcta catccccacctcctcc cagtgggcgt ggactaatat ggaacagtat ttaagcgcct gtttgaatct cacggagcgt aaacggttgg tggcgcagca tctgacgcac gtgtcgcaga cgcaggagca gaacaaagag aatcagaatc ccaattctga tgcgccggtg atcagattcag caggtcagc ggtggctcgt ggacaagggg attacctcgg agaagcagtg gatccaggag gaccaggcct catacatctc cttcaatgcg gcctccaact cgcggtccca aatcaaggct gccttggaca atgcgggaaa gattatgagc ctgactaaaaa ccgccccgag ctaccgcggcgc catttccagc aatcggattt ataaaatttt ggaactaaac gggtacgatc cccaatatgc ggcttccgtc tttctgggat gggccacgaa aaagttcggc aagaggaaca ccatctggct gtttgggcct gcaactaccg ggaagaccaa catcgcggag gccatagcccccgcgc ggaccaatga gaactttccc ttcaacgact gtgtcgacaa gatggtgatc tggtgggagg aggggaagat gaccgccaag gtcgtggagt cggccaaagc cattctcgga ggaagcaagg tgcgcgtgga ccagaaatgcaagtcctcgg cccagataga cccgactccc gtgatcgtca cctccaacac caacatgtgc gccgtgattg acgggaactc aacgaccttc gaacaccagc agccgttgca agaccggatg ttcaaatttg aactcacccg ccgtctggat catgactttg ggaaggtcac caagcaggaa gtcaaagact ttttccggtg ggcaaaggat cacgtggttg aggtggagca tgaattctac gtcaaaaagg gtggagccaa gaaaagaccc gcccccagtg acgcagatat aagtgagccc aaacgggtgc gcgagtcagt tgcgcagcca tcgacgtcag acgcggaagc ttcgatcaac tacgcagaca ggtaccaaaa caaatgttct cgtcacgtgg gcatgaatct gatgctgttt ccctgcagac aatgcgagag aatgaatcag aattcaaata tctgcttcac tcacggacag aaagactgtt tagagtgctt tcccgtgtca gaatctcaac ccgtttctgt cgtcaaaaag gcgtatcaga aactgtgcta cattcatcat atcatgggaa aggtgccaga cgcttgcact gcctgcgatc tggtcaatgt ggatttggat gactgcatct ttgaacaata aatgatttaa atcaggtatg gctgccgatg gttatcttcc agattggctc gaggacaacc tctctgaggg cattcgcgag tggtgggact tgaaacctgg agccccgaaa cccaaagcca accagcaaaa gcaggacgac ggccggggtc tggtgcttcc tggctacaag tacctcggac ccttcaacgg actcgacaag ggggagcccg tcaacgcggc ggatgcagcg gccctcgagc acgacaaggc ctacgaccagcagctcaaag cgggtgacaa tccgtacctg cggtataacc acgccgacgc cgagtttcag gagcgtctgc aagaagatac gtcttttggg ggcaacctcg ggcgagcagt cttccaggcc aagaagaggg ttctcgaacc ttttggtctg gttgaggac cggtagagca gtcgccacaa gagccagact cctcctcggg cattggcaag acaggccagc agcccgctaa aaagagactc aattttggtc agactggcga ctcagagtca gtccccgacc cacaacctct cggagaacct ccagcaaccc ccgctgctgt gggacct acaggatc gcagacaata acgaaggcgc cgacggagtg ggtaatgcct caggaaattg gcattgcgat tccacatggc tgggcgacag agtcatcacc accagcaccc gaacatgggc cttgcccacc tataacaacc acctctacaa gcaaatctcc agtgcttcaa cggggcagcagcagcac cccctggggg tattttgatt tcaacagatt ccactgccat ttctcaccac gtgactggca gcgactcatc aacaacaatt ggggattccg gcccaagaga ctcaacttca agctcttcaa catccaagtc aaggaggtca cgacgaatga tgcgtcacg accatcgcta caagctcgctc cggactcgga gtaccagttg ccgtacgtcc tcggctctgc gcaccagggc tgcctccctc cgttcccggc ggacgtgttc atgattccgc agtacggcta cctaacgctc aacaatggcagccaggcagt gggacggtca tccttttact gcctggaata ttcccatcg cagatgctga gaacgggcaa taactttacc ttcagctaca ccttcgagga cgtgccttc cacagcagct acgcgcacag ccagagcctg gaccggctga tgaatcgaccattc tacctcact aactcagaat cagtccggaa gtgcccaaaa caggacttg ctgtttagcc gggggtcc agctgcatg tctgttcagc ccaaaactg gctactgga cgctgttacc ggcagcagcg cgtttctaa acaaaaacag acaatcagcaa gcaatcaat accaacc cagctctaa aatgggcgtg aatctataat siaccctggc actgctatgg cctcacacaa agacgacaaa gatagttct ttcccatgag cggtgtcatg attttggaa aggagcgc cggagcttca aacactgcag tggacaatgt catgatcaca gacgagaggt aaggcaatccaacccaag gactgtggca gtcaatctcc agagcagcag cacagaccct gcgaccggag atgtgcatgt tatgggagcc ttacctggaa tggtgtgt agacagac gtacctgc agggtcctat tgggccagctcttcacca cggatggaca tggtgcttacccg cacccgcctc ctcagatcct catcaaaac acgcctgttc ctgcgaatcc tccggcagag tttcggcta caaagtttgc ttcattcatc acccagtatt ccacaggaca agtgagcgtg gagattgaat gggagctgcagaaagaaaac agcaaacgct ggaatcccga agtgcagtat acatctaact atgcaaaatc tgccaacgtt gatttcactg tggacaacaa tggactttat actgagcctc gccccacattgg cacccgttac ctcaccgtc ccctgtaagg cgcgccaccg gttgcttgtt aatcaataaa ccgtttaatt cgtttcagtt gaactttggt ctctgcgtat ttctttctta tctagtttcc atgctctagg atccactagt aacggccgcc agtgtgctgg aattcggctt tgtagttaat gattaacccg ccatgctact tatctacgta gccatgctct agaggtcctg tattagaggt cacgtgagtg tttgcgaca tttgcgaca ccatgtggtc acgctgggta tttaagcccg agtgagcacg cagggtctcc attttgaagc gggaggttttg aacgcgcagc cgccaagccg aattctgcag atatccaaac actggcggcc gctcgactag agcggccgcc accgcggtgg agctccagct tttgttccct ttagtgaggg ttaattgcgc gcttggcgta atcatggtca tagctgtttc ctgtgtgaaa ttgttatccg ctcacaattc cacacaacat acgagccgga agcataaagt gtaaagcctg gggtgcctaa tgagtgagct aactcacatt aattgcgttg cgctcactgc ccgctttcca gtcgggaaac ctgtcgtgcc agctgcatta atgaatcggc caacgcgcgg ggagaggcgg tttgcgtatt gggcgctctt ccgcttcctc gctcactgac tcgctgcgct cggtcgttcg gctgcggcga gcggtatcag ctcactcaaa ggcggtaata cggttatccacagaatcagg ggataacgca ggaaagaaca tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa ggccgcgttg ctggcgttt tccataggct ccgcccccct gacgagcatc acaaaatcg acgctcaagt cagaggtggc gaaacccgac aggactataa agataccagg cgtttcccc tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc ctttctccct tcgggaagcg tggcgctttc tcatagctca cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc actggcagca gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga gttcttgaag tggtggccta actacggcta cactagaaga acagtatttg gtatctgcgc tctgctgaag ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac caccgctggt agcggtggtt ttttgttg caagcagcag attacgcgca gaaaaaaaagg atctcaagaa gatcctttga tctttctac ggggtctgac gctcagtgga acgaaaaactc acgttaaggg attttggtca tgagattatc aaaaaggatc ttcacctaga tccttttaaa ttaaaaatga agttttaaat caatctaaag tatatatgag taaacttggt ctgacagtta ccaatgctta atcagtgagg cacctatctc agcgatctgt ctatttcgt catccatagttgcctgactc cccgtcgtgt agataactac gatacgggag ggcttaccat ctggccccag tgctgcaatg ataccgcgag acccacgctc accggctcca gatttatcag caataaacca gccagccgga aggccgagc gcagaagtgg tcctgcaact ttatccgcct ccatccagtc tattaattgt tgccgggaag ctagagtaag tagttcgcca gttaatagtt tgcgcaacgt tgttgccatt gctacaggca tcgtggtgtc acgctcgtcg tttggtatgg cttcattcag ctccggttcc caacgatcaa ggcgagttac atgatccccc atgttgtgca aaaaagcggt tagctccttc ggtcctccga tcgttgtcag aagtaagttg gccgcagtgt tatcactcat ggttatggca gcactgcata attctcttac tgtcatgcca tccgtaagat gctttctgt gactggtgag tactcaacca agtcattctg agaatagtgt atgcggcgac cgagttgctc ttgcccggcg tcaatacggg samaaccgc gccacatagc agaactttaa aagtgctcat cattggaaaa cgttcttcgg ggcgaaaact ctcaaggatc ttaccgctgt tgagatccag ttcgatgtaa cccactcgtg cacccaactg atcttcagca tcttttactt tcaccagcgt tctgggtga gcaaaaacag gaaggcaaa tgccaaaa aagggaataa gggcgacacg gaaatgttga atactcatac tcttccttt tcaatattat tgaagcattt atcagggtta ttgtctcatg agcggataca tatttgaatg tatttagaaa aataaacaaa taggggttcc gcgcacatttccccgaaaag tgccacctaa attgtaagcg ttaatattt gttaaaattc gcgttaaatt tttgttaaat cagctcattt tttaaccaat aggccgaaat cggcaaaatc ccttataaat caaaagaata gaccgagata gggttgagtg ttgttccagt ttggaacaag agtccactat taaagaacgt ggactccaac gtcaaaggc gaaaaaccgt ctatcagggc gatggcccac tacgtgaacc atcaccctaa tcaagtttt tggggtcgag gtgccgtaaa ggaaccctaa agggagcc cgatttagag cttgacgggg aaagccggcg aacgtggcga gaaaggaagg ggaaagcg aaaggagcgg gcgctagggc gctggcaagt gtagcggtca cgctgcgcgt aaccaccaca cccgccgcgc ttaatgcgcc gctacagggc gcgtcccatt cgccattcag gctgcgcaac tgttgggaag ggcgatcggt gcgggcctct tcgctattac gccagctggc gaaagggga tgtgctgcaa ggcgattaag ttgggtaacg ccagggtttt cccagtcacg acgttgtaaa acgacggcca gtgagcgcgc gtaatacgac tcactatagg gcgaattggg taccgggccc cccctcgagg tcgacggtat cggggagct cgcagggtct ccattttgaa gcgggaggtt tgaacgcgca gccgccatgc cggggtttta cgagattgtg attaaggtcc ccagcgacct tgacgagcat ctgcccggca tttctgacag ctttgtgaac tgggtggccg agaaggaatg ggagttgccg ccagattctg acatggatct gaatctgatt gagcaggcacccctgaccgt ggccgagaag ctgcagcgcg actttctgac ggaatggcgc cgtgtgagta aggccccgga ggctcttttc tttgtgcaat ttgagaaggg agagagctac ttccacatgc acgtgctcgt ggaaaccacc ggggtgaaat c

[0046] In SEQ ID NO:4, residues 1-1561 of pAAV-RC6 encode the Rep protein, Rep78 (residues 91-221 correspond to the AAV2 P19 promoter and residues 1075-1254 correspond to the P40 promoter (SEQ ID NO:18)); residues 1578-3788 encode the AAV6 VP1 capsid protein; residues 736-1281 encode a portion of the Rep68 protein; residues 3984-4114 correspond to the AAV2 P5 promoter sequence (SEQ ID NO:10); residues 4237-4253 are the M13 Rev sequence; residues 4261-4277 are the Lac operator sequence; residues 4285-4315 are the Lac promoter sequence; and residues 4578-5302 are the pMB It corresponds to the ori sequence; residues 5398-6258 encode the ampicillin resistance determinant; residues 6259-6357 are the bla promoter sequence (Figure 6). 5. pAAV-RC7 Plasmid

[0047] Plasmid pAAV-RC7 (SEQ ID NO:5; FIG. 7) is an AAV helper plasmid that expresses AAV6 serotype capsid proteins that can be used according to the invention to provide AAV helper functions. The P5 and P40 promoters of pAAV-RC7 are AAV2 serotype promoters (SEQ ID NO:10 and SEQ ID NO:18, respectively). Coding strand of plasmid pAAV-RC7 (SEQ ID NO:5): catggttttg ggacgtttcc tgagtcagat tcgcgaaaaaa ctgattcaga gaatttaccg cgggatcgag ccgactttgc caaactggtt cgcggtcaca aagaccagaa atggcgccgg aggcggggaac aaggtggtgg atgagtgcta catccccacctcctcc cagtgggcgt ggactaatat ggaacagtat ttaagcgcct gtttgaatct cacggagcgt aaacggttgg tggcgcagca tctgacgcac gtgtcgcaga cgcaggagca gaacaaagag aatcagaatc ccaattctga tgcgccggtg atcagattcag caggtcagc ggtggctcgt ggacaagggg attacctcgg agaagcagtg gatccaggag gaccaggcct catacatctc cttcaatgcg gcctccaact cgcggtccca aatcaaggct gccttggaca atgcgggaaa gattatgagc ctgactaaaaa ccgccccgag ctaccgcggcgc catttccagc aatcggattt ataaaatttt ggaactaaac gggtacgatc cccaatatgc ggcttccgtc tttctgggat gggccacgaa aaagttcggc aagaggaaca ccatctggct gtttgggcct gcaactaccg ggaagaccaa catcgcggag gccatagcccccgcgc ggaccaatga gaactttccc ttcaacgact gtgtcgacaa gatggtgatc tggtgggagg aggggaagat gaccgccaag gtcgtggagt cggccaaagc cattctcgga ggaagcaagg tgcgcgtgga ccagaaatgcaagtcctcgg cccagataga cccgactccc gtgatcgtca cctccaacac caacatgtgc gccgtgattg acgggaactc aacgaccttc gaacaccagc agccgttgca agaccggatg ttcaaatttg aactcacccg ccgtctggat catgactttg ggaaggtcac caagcaggaa gtcaaagact ttttccggtg ggcaaaggat cacgtggttg aggtggagca tgaattctac gtcaaaaagg gtggagccaa gaaaagaccc gcccccagtg acgcagatat aagtgagccc aaacgggtgc gcgagtcagt tgcgcagcca tcgacgtcag acgcggaagc ttcgatcaac tacgcagaca ggtaccaaaa caaatgttct cgtcacgtgg gcatgaatct gatgctgttt ccctgcagac aatgcgagag aatgaatcag aattcaaata tctgcttcac tcacggacag aaagactgtt tagagtgctt tcccgtgtca gaatctcaac ccgtttctgt cgtcaaaaag gcgtatcaga aactgtgcta cattcatcat atcatgggaa aggtgccaga cgcttgcact gcctgcgatc tggtcaatgt ggatttggat gactgcatct ttgaacaata aatgatttaa atcaggtatg gctgccgatg gttatcttcc agattggctc gaggacaacc tctctgaggg cattcgcgag tggtgggacc tgaaacctgg agccccgaaa cccaaagcca accagcaaaa gcaggacaac ggccggggtc tggtgcttcc tggctacaag tacctcggac ccttcaacgg actcgacaag ggggagcccg tcaacgcggc ggacgcagcg gccctcgagc acgacaaggc ctacgaccagcagctcaaag cgggtgacaa tccgtacctg cggtataacc acgccgacgc cgagtttcag gagcgtctgc aagaagatac gtcatttggg ggcaacctcg ggcgagcagt cttccaggcc aagaagcggg ttctcgaacc tctcggtctg gttgaggaag gcgctaagac ggctcctgca aagaagagac cggtagagcc gtcacctcag cgttcccccg actcctccac gggcatcggc aagaaaggcc agcagcccgc cagaaagaga ctcaatttcg gtcagactgg cgactcagag tcagtccccg accctcaacc tctcggagaa cctccagcag cgccctctag tgtgggatct ggtacagtgg ctgcaggcgg tggcgcacca atggcagaca ataacgaagg tgccgacgga gtgggtaatg cctcaggaaa ttggcattgc gattccacat ggctgggcga cagagtcatt accaccagca cccgaacctg ggccctgccc acctacaaca accacctcta caagcaaatc tccagtgaaa ctgcaggtag taccaacgac aacacctact tcggctacag caccccctgg gggtattttg actttaacag attccactgc cacttctcac cacgtgactg gcagcgactc atcaacaaca actggggatt ccggcccaag aagctgcggt tcaagctctt caacatccag gtcaaggagg tcacgacgaa tgacggcgtt acgaccatcg ctaataacct taccagcacg attcaggtat tctcggactc ggaataccag ctgccgtacg tcctcggctc tgcgcaccag ggctgcctgc ctccgttccc ggcggacgtc ttcatgattc ctcagtacgg ctacctgact ctcaacaatggcagtcagtc tgtgggacgt tcctccttct actgcctgga gtacttcccc tctcagatgc tgagaacggg caacaacttt gagttcagct acagcttcga ggacgtgcct ttccacagca gctacgcaca cagccagagc ctggaccggc tgatgaatcc cctcatcgac cagtacttgt actacctggc cagaacacag agtaacccag gaggcacagc tggcaatcgg gaactgcagt tttaccaggg cgggccttca actatggccg aacaagccaa gaattggtta cctggacctt gcttccggca acaaagagtc tccaaaacgc tggatcaaaa caacaacagc aactttgctt ggactggtgc caccaaatat cacctgaacg gcagaaactc gttggttaat cccggcgtcg ccatggcaac tcacaaggac gacgaggacc gctttttccc atccagcgga gtcctgattt ttggaaaaac tggagcaact aacaaaacta cattggaaaa tgtgttaatg acaaatgaag aagaaattcg tcctactaat cctgtagcca cggaagaata cgggatagtc agcagcaact tacaagcggc taatactgca gcccagacac aagttgtcaa caaccaggga gccttacctg gcatggtctg gcagaaccgg gacgtgtacc tgcagggtcc catctgggcc aagattcctc acacggatgg caactttcac ccgtctcctt tgatgggcgg ctttggactt aaacatccgc ctcctcagat cctgatcaag aacactcccg ttcccgctaa tcctccggag gtgtttactc ctgccaagtt tgcttcgttc atcacacagt acagcaccgg acaagtcagc gtggaaatcg agtgggagctgcagaaggaa aacagcaagc gctggaaccc ggagattcag tacacctcca actttgaaaaa gcagactggt gtggactttg ccgttgacag ccagggtgtt tactctgagc ctcgccctat tggcactcgt tacctcaccc gtaatctgta aggcgcgccact gcccatc attcgtttca gttgaacttt ggtctctgcg tatttctttc ttatctagtt tccatgctct aggatccact agtaacggcc gccagtgtgc tggaattcgg cttttgtagtt aatgattaac ccgccatgct acttatctac gtagccatgc tctagaggtc ctgtattaga ggtcattgcggt acattgcg acaccatgtg gtcacgctgg gtatttaagc ccgagtgagc acgcagggtc tccattttga agcgggaggt ttgaacgcgc agccgccaag ccgaattctg cagatatcca aacactggcg gccgctcgac tagagcggcc gccaccgcgg tggagcttcca gctttttc cctttaggg cgcgcttggc gtaatcatgg tcatagctgt ttcctgtgtg aaattgttat ccgctcacaa ttccacacaa catacgagcc ggaagcataa agtgtaaagc ctggggtgcc taatgagtga gctaactcac attaattgcg ttgcgctcac tgcccgct gccactgcgc ttaatgaatc ggccaacgcg cggggagagg cggtttgcgt attgggcgct cttccgcttc ctcgctcact gactcgctgc gctcggtcgt tcggctgcgg cgagcggtat cagctcactc aaaggcggta atacggttatccacagaatc aggggataac gcaggaaaga acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag gctccgcccc cctgacgagc atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc gacaggacta taaagatacc aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc ttatccggta actatcgtct tgagtccaac ccggtaagac acgacttatc gccactggca gcagccactg gtaacaggat tagcagagcg aggtatgtag gcggtgctac agagttcttg aagtggtggc ctaactacgg ctacactaga agaacagtat ttggtatctg cgctctgctg aagccagtta ccttcggaaa aagagttggt agctcttgat ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg tcatgagatt atcaaaaagg atcttcacct agatcctttt aaattaaaaa tgaagtttta aatcaatcta aagtatatat gagtaaactt ggtctgacag ttaccaatgc ttaatcagtg aggcacctat ctcagcgatc tgtctatttc gttcatccatagttgcctga ctccccgtcg tgtagataac tacgatacgg gagggcttac catctggccc cagtgctgca atgataccgc gagacccacg ctcaccggct ccagatttat cagcaataaa ccagccagcc ggaagggccg agcgcagaag tggtcctgca actttatccg cctccatcca gtctattaat tgttgccggg aagctagagt aagtagttcg ccagttaata gtttgcgcaa cgttgttgcc attgctacag gcatcgtggt gtcacgctcg tcgtttggta tggcttcatt cagctccggt tcccaacgat caaggcgagt tacatgatcc cccatgttgt gcaaaaaagc ggttagctcc ttcggtcctc cgatcgttgt cagaagtaag ttggccgcag tgttatcact catggttatg gcagcactgc ataattctct tactgtcatg ccatccgtaa gatgcttttc tgtgactggt gagtactcaa ccaagtcatt ctgagaatag tgtatgcggc gaccgagttg ctcttgcccg gcgtcaatac gggataatac cgcgccacat agcagaactt taaaagtgct catcattgga aaacgttctt cggggcgaaa actctcaagg atcttaccgc tgttgagatc cagttcgatg taacccactc gtgcacccaa ctgatcttca gcatctttta ctttcaccag cgtttctggg tgagcaaaaa caggaaggca aaatgccgca aaaaagggaa taagggcgac acggaaatgt tgaatactca tactcttcct ttttcaatat tattgaagca tttatcaggg ttattgtctc atgagcggat acatatttga atgtatttag aaaaataaac aaataggggt tccgcgcacatttccccgaa aagtgccacc taaattgtaa gcgttaatat tttgttaaaa ttcgcgttaa atttttgtta aatcagctca ttttttaacc aataggccga aatcggcaaa atcccttata aatcaaaaga atagaccgag atagggttga gtgttgttcc agtttggaac aagagtccac tattaaagaa cgtggactcc aacgtcaaag ggcgaaaaac cgtctatcag ggcgatggcc cactacgtga accatcaccc taatcaagtt ttttggggtc gaggtgccgt aaagcactaa atcggaaccc taaagggagc ccccgattta gagcttgacg gggaaagccg gcgaacgtgg cgagaaagga agggaagaaa gcgaaaggag cgggcgctag ggcgctggca agtgtagcgg tcacgctgcg cgtaaccacc acacccgccg cgcttaatgc gccgctacag ggcgcgtccc attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt tttcccagtc acgacgttgt aaaacgacgg ccagtgagcg cgcgtaatac gactcactat agggcgaatt gggtaccggg ccccccctcg aggtcgacgg tatcggggga gctcgcaggg tctccatttt gaagcgggag gtttgaacgc gcagccgcca tgccggggtt ttacgagatt gtgattaagg tccccagcga ccttgacgag catctgcccg gcatttctga cagctttgtg aactgggtgg ccgagaagga atgggagttg ccgccagatt ctgacatgga tctgaatctg attgagcaggcacccctgac cgtggccgag aagctgcagc gcgactttct gacggaatgg cgccgtgtga gtaaggcccc ggaggctctt ttctttgtgc aatttgagaa gggagagagc tacttccaca tgcacgtgct cgtggaaacc accggggtga aatc

[0048] In SEQ ID NO:5, residues 1-1561 of pAAV-RC7 encode the Rep protein, Rep78 (residues 91-221 correspond to the AAV2 P19 promoter; residues 1075-1254 correspond to the P40 promoter (SEQ ID NO:18); residues 1578-3791 encode the AAV7 VP1 capsid protein; residues 736-1281 encode a portion of the Rep68 protein; residues 3987-4117 correspond to the AAV2 P5 promoter sequence of SEQ ID NO:10); residues 4240-4256 are the M13Rev sequence; residues 4264-4280 are the Lac operator sequence; residues 4288-4318 are the Lac promoter sequence; and residues 4581-5305 are the pMB It corresponds to the ori sequence; residues 5401-6261 encode the ampicillin resistance determinant; residues 6262-6360 are the bla promoter sequence (Figure 7). B. Exemplary Non-AAV Helper Function-Providing Polynucleotides

[0049] As used herein, the term "non-AAV helper functions" refers to proteins of Ad, CMV, HSV or other non-AAD viruses (e.g., E1a, E1b, E2a, VA and E4) and / or polynucleotides of Ad, CMV, HSV or other non-AAD viruses that are necessary for replication and packaging of rAVV. Such non-AAV helper functions are provided by "non-AAV helper function-providing polynucleotides," which as that term is used herein is a polynucleotide integrated into a virus, a plasmid vector, a non-plasmid vector, or a cellular chromosome that provides the non-AAV helper function. The vectors, pHelper and their derivatives (such as those commercially available from Cell Biolabs, Inc., Invitrogen, Stratagene and others) are suitable non-AAV helper function-providing polynucleotides (see, e.g., Matsushita, T. et al. (1998) "Adeno-Associated Virus Vectors Can Be Efficiently Produced Without Helper Virus," Gene Ther. 5:938-945; Sharma, A. et al. (2010) "Transduction Efficiency Of AAV2 / 6,2 / 8 And 2 / 9 Vectors For Delivering Genes In Human Corneal Fibroblasts," Brain Res. Bull. 81(2-3):273-278).

[0050] The pHelper-Kan plasmid (SEQ ID NO:6; FIG. 8) is a non-AAV helper function-providing polynucleotide that can be used in accordance with the invention to provide non-AAV helper functions. Coding strand of plasmid pHelper-Kan (SEQ ID NO:6) [ka] [ka] [ka] [ka]

[0051] In sequence number 6, residues 1-5343 of pHelper-Kan comprise a polynucleotide (residues 258-1847) derived from an adenovirus and encoding an E2A protein; residues 5344-8535 comprise a polynucleotide (residues 258-1847) derived from an adenovirus and encoding an E4orf6 protein; residues 9423-10011 correspond to the ori sequence; residues 10182-10976 encode a kanamycin resistance determinant (residues 10977-11081) expressed by the bla promoter sequence; and residues 11107-11561 correspond to the f1 ori sequence (Figure 4). C. Exemplary rAAV Plasmid Vectors

[0052] As discussed above, AAV helper function-providing polynucleotides and non-AAV helper function-providing polynucleotides are typically used in conjunction with rAAV plasmid vectors, comprising a triple transfection system. Several commercially available rAAV plasmid vectors, such as pAV-CMV-EGFP, pGOI, etc. (Cell Biolabs, Inc., Invitrogen and Stratagene), can be used in accordance with the present invention.An exemplary rAAV plasmid vector that may be used in accordance with the present invention comprises a 5′ ITR, a U6 promoter, a CMV enhancer and promoter sequence, a polynucleotide encoding enhanced green fluorescent protein (EGFP) (Gambotto, A. et al. (2000) “Immunogenicity Of Enhanced Green Fluorescent Protein (EGFP) In BALB / C Mice: Identification Of An H2-Kd-Restricted CTL Epitope,” Gene Ther. 7(23):2036-2040; Tsien, RY (1998) “The Green Fluorescent Protein,” Annu. Rev. Biochem. 67:509-544; Cinelli, RA et al. (2000) “The Enhanced Green Fluorescent Protein As A Tool For The Analysis Of Protein Dynamics And Localization: Local Fluorescence Study At The Single-Molecule Level,” Photochem. Photobiol. 71(6):771-776; Chopra et al. (2000) “The Enhanced Green Fluorescent Protein As A Tool For The Analysis Of Protein Dynamics And Localization: Local Fluorescence Study At The Single-Molecule Level,” Photochem. Photobiol. 71(6):771-776; A. (2008) “Recombinant Adenovirus With Enhanced Green Fluorescent Protein,” In: MOLECULAR IMAGING AND CONTRAST AGENT DATABASE (MICAD), National Center for Biotechnology Information, Bethesda MD), and pAV-CMV-EGFP (SEQ ID NO: 7; Figure 9) which contains a FLAG tag and 6xHis tag site, an SV40 poly(A) site and a 3'ITR to facilitate recovery and localization of the expressed protein. Coding strand of plasmid pAV-CMV-EGFP (SEQ ID NO:7): cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccggcgtcg ggcgaccttt gtcgcccgg ccctccagtg agcgagcgcg cagagaggga gtggccactactag gggttcctgc taggtagcagc cgaattcgtg ttactcataa ctagtaggt cgggcaggaa gagggcctat ttcccatgat tccttcatat tgcatatac gatacaggc tgttagagag atattagaa ttaatttgac tgtaacaca agattag gttatag tttatatact ggacatcat atgcttaccg taacttgaaa gtatttcgat ttcttggtt tatatctt gtggaagga cgcgggatcc actggaccag gcagcagcgt cagaagactt tttggaaa gctgactag taatactgta atagtaatca attacggttagt accacctagttagttca aatggcccgc ctggctgacc gcccaacgac ccccgcccat tgacgtcaat atgacgtat gttcccatag taacgccaat agggacttc cattgacgtc aatgggtgga gtattacgg taaactgccc acttggcagt acatcaagcg cacctactactagcg gtaaatggcc cgcctggcat tatgcccagt acatgacctt atgggactt cctacttggc agtacatcta cgtattagtc atcgctatta ccatggtgat gcggttttgg cagtacatca atgggcgtgg atagcggtttgactcacggg gatttccaag tctccacccc attgacgtca atgggagttt gttttgcacc aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcgtgt acggtgggag gtctatataa gcagagctgg tttagtgaac cgtcagatcc gctagagatc cggtaccgag gagatctgcc gccgcgatcg ccggcgcgcc agatctcacg cttaactagc tagcggaccg acgcgtacgc ggccgctcga gatggtgagc aagggcgagg agctgttcac cggggtggtg cccatcctgg tcgagctgga cggcgacgta aacggccaca agttcagcgt gtccggcgag ggcgagggcg atgccaccta cggcaagctg accctgaagt tcatctgcac caccggcaag ctgcccgtgc cctggcccac cctcgtgacc accctgacct acggcgtgca gtgcttcagc cgctaccccg accacatgaa gcagcacgac ttcttcaagt ccgccatgcc cgaaggctac gtccaggagc gcaccatctt cttcaaggac gacggcaact acaagacccg cgccgaggtg aagttcgagg gcgacaccct ggtgaaccgc atcgagctga agggcatcga cttcaaggag gacggcaaca tcctggggca caagctggag tacaactaca acagccacaa cgtctatatc atggccgaca agcagaagaa cggcatcaag gtgaacttca agatccgcca caacatcgag gacggcagcg tgcagctcgc cgaccactac cagcagaaca cccccatcgg cgacggcccc gtgctgctgc ccgacaacca ctacctgagc acccagtccg ccctgagcaaagaccccaac gagaagcgcg atcacatggt cctgctggag ttcgtgaccg ccgccgggat cactctcggc atggacgagc tgtacaagt agtcgaggat tataaggatg acgacgataa attcgtcgag caccaccacc accaccacta ataaggttta tccgatccac cggatctaga taagatatcc gatccaccgg atctagataa ctgatcataa tcagccatac cacatttgta gaggttttac ttgctttaaa aaacctccca cacctccccc tgaacctgaa acataaaatg aatgcaattg ttgttgttaa cttgtttaatt gcagcttata atggttacaa ataaagcaat agcatcacaa atttcacaaa taaagcatt tttcactgc attctagttg tggtttgtcc aaactcatca atgtatctta acgcggtaac cacgtgcgga ccgagcggcc gcaggaaccc ctagtgatgg agttggccac tccctctctg cgcgctcgctc cgctcactga ggccgggcga ccaaaggtcg cccgacgccc gggctttgcc cgggcggcct cagtgagcga gcgagcgcgc agctgcctgc aggggcgcct gatgcggtat tttctcctta cgcatctgtg cggtatttca caccgcatac gtcaaagcaa ccatagtacg cgccctgtag cggcgcatta agcgcggcgg gtgtggtggt tacgcgcag gtgaccgcta cacctgccag cgccttagcg cccgctcctt tcgctttctt cccttcctt ctcgccacgt tcgccggctt tccccgtcaa gctctaaatc gggggctccc tttagggttc cgatttagtg ctttacggca cctcgacccc aaaaaacttg atttgggtgatggttcacgt agtgggccat cgccctgata gacggttttt cgccctttga cgttggagtc cacgttcttt aatagtggac tcttgttcca aactggaaca acactcaacc ctatctcggg ctattctttt gatttataag ggattttgcc gatttcggcc tattggttaa aaaatgagct gatttaacaa aaatttaacg cgaattttaa caaaatatta acgtttacaa ttttatggtg cactctcagt acaatctgct ctgatgccgc atagttaagc cagccccgac acccgccaac acccgctgac gcgccctgac gggcttgtct gctcccggca tccgcttaca gacaagctgt gaccgtctcc gggagctgca tgtgtcagag gttttcaccg tcatcaccga aacgcgcgag acgaaagggc ctcgtgatac gcctattttt ataggttaat gtcatgataa taatggtttc ttagacgtca ggtggcactt ttcggggaaa tgtgcgcgga acccctattt gtttattttt ctaaatacat tcaaatatgt atccgctcat gagacaataa ccctgataaa tgcttcaata atattgaaaa aggaagagta tgagtattca acatttccgt gtcgccctta ttcccttttt tgcggcattt tgccttcctg tttttgctca cccagaaacg ctggtgaaag taaaagatgc tgaagatcag ttgggtgcac gagtgggtta catcgaactg gatctcaaca gcggtaagat ccttgagagt tttcgccccg aagaacgttt tccaatgatg agcactttta aagttctgct atgtggcgcg gtattatccc gtattgacgc cgggcaagag caactcggtc gccgcataca ctattctcagaatgacttgg ttgagtactc accagtcaca gaaaagcatc ttacggatgg catgacagta agagaattat gcagtgctgc cataaccatg agtgataaca ctgcggccaa cttacttctg acaacgatcg gaggaccgaa ggagctaacc gcttttttgc acaacatggg ggatcatgta actcgccttg atcgttggga accggagctg aatgaagcca taccaaacga cgagcgtgac accacgatgc ctgtagcaat ggcaacaacg ttgcgcaaac tattaactgg cgaactactt actctagctt cccggcaaca attaatagac tggatggagg cggataaagt tgcaggacca cttctgcgct cggcccttcc ggctggctgg tttattgctg ataaatctgg agccggtgag cgtgggtctc gcggtatcat tgcagcactg gggccagatg gtaagccctc ccgtatcgta gttatctaca cgacggggag tcaggcaact atggatgaac gaaatagaca gatcgctgag ataggtgcct cactgattaa gcattggtaa ctgtcagacc aagtttactc atatatactt tagattgatt taaaacttca tttttaattt aaaaggatct aggtgaagat cctttttgat aatctcatga ccaaaatccc ttaacgtgag ttttcgttcc actgagcgtc agaccccgta gaaaagatca aaggatcttc ttgagatcct ttttttctgc gcgtaatctg ctgcttgcaa acaaaaaaac caccgctacc agcggtggtt tgtttgccgg atcaagagct accaactctt tttccgaagg taactggctt cagcagagcg cagataccaa atactgtcct tctagtgtag ccgtagttaggccaccactt caagaactct gtagcaccgc ctacatacct cgctctgcta atcctgttac cagtggctgc tgccagtggc gataagtcgt gtcttaccgg gttggactca agacgatagt taccggataa ggcgcagcgg tcgggctgaa cggggggttc gtgcacacag cccagcttgg agcgaacgac ctacaccgaa ctgagatacc tacagcgtga gctatgagaa agcgccacgc ttcccgaagg gagaaaggcg gacaggtatc cggtaagcgg cagggtcgga acaggagagc gcacgagga gcttccaggg ggaaacgcct ggtatcttta tagtcctgtc gggtttcgcc acctctgact tgagcgtcga tttttgtgat gctcgtcagg ggggcggagc ctatggaaaa acgccagcaa cgcggccttt ttacggttcc tggccttttg ctggcctttt gctcacatgt

[0053] In SEQ ID NO:7, residues 1-128 of pAV-CMV-EGFP correspond to the 5'ITR; residues 201-441 are a U6 promoter sequence, residues 562-865 are a human cytomegalovirus (CMV) immediate early enhancer sequence, residues 866-1068 comprise a CMV immediate early promoter sequence; residues 1192-1911 comprise a mammalian codon-optimized polynucleotide encoding EGFP; residues 1918-1941 encode a FLAG tag; residues 1951-1968 encode a 6xHis tag, residues 2139-2260 encode an SV40 poly(A) sequence, residues 2293-2433 correspond to the 3'ITR; residues 2508-22963 encode a F1 residues 3350-4210 encode the ampicillin resistance determinant and its signal sequence (residues 3350-3418) expressed by the bla promoter sequence (residues 3245-3349); residues 4381-4969 correspond to the ori sequence (Figure 9).

[0054] A second exemplary plasmid vector that can be used in accordance with the present invention is pAV-TBG-EGFP (SEQ ID NO:8; FIG. 10), which contains a 5′ ITR, a thyroid hormone binding globulin (TBG) promoter, a polynucleotide encoding enhanced green fluorescent protein (EGFP), a FLAG tag and a 6×His tag site to facilitate recovery and localization of the expressed protein, an SV40 poly(A) site, and a 3′ ITR. Coding strand of pAV-TBG-EGFP plasmid (SEQ ID NO:8): cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcgtcg ggcgaccttt ggtcgcccgg cctcagtgag cgagcgagcg cgcagagagg gagtggccaa ctccatcact aggggttcct gcggccggtc gcgtctagta ctagtaggtt aatttttaaa aagcagtcaa aagtccaagt ggcccttggc agcatttact ctctctgttt gctctggtta ataatctcag gagcacaaac attccagatc caggttaatt tttaaaaagc agtcaaaagt ccaagtggcc cttggcagca tttactctct ctgtttgctc tggttaataa tctcaggagc acaaacattc cagatccggc gcgccagggc tggaagctac ctttgacatc atttcctctg cgaatgcatg tataatttct acagaaccta ttagaaagga tcacccagcc tctgcttttg tacaactttc ccttaaaaaa ctgccaattc cactgctgtt tggcccaata gtgagaactt tttcctgctg cctcttggtg cttttgccta tggcccctat tctgcctgct gaagacactc ttgccagcat ggacttaaac ccctccagct ctgacaatcc tctttctctt ttgttttaca tgaagggtct ggcagccaaa gcaatcactc aaagttcaaa ccttatcatt ttttgctttg ttcctcttgg ccttggtttt gtacatcagc tttgaaaata ccatcccagg gttaatgctg gggttaattt ataactaaga gtgctctagt tttgcaatac aggacatgct ataaaaatgg aaagatgttg ctttctgaga gacaggtacc gaggagatct gccgccgcga tcgccaccat ggtgagcaag ggcgaggagctgttcaccgg ggtggtgccc atcctggtcg agctggacgg cgacgtaaac ggccacaagt tcagcgtgtc cggcgagggc gagggcgatg ccacttacgg caagctgacc ctgaagttca tctgcaccac cggcaagctg cccgtgccct ggcccac gcgtgcagtg cttcagccgc taccccgacc acatgaagca gcacgacttc ttcaagtccg ccatgcccga aggctacgtc caggagcgca ccatcttctt caaggacgac ggcaactaca agacccgcgc cgaggtgaag ttcgagggcg acaccctcgcgcgcgacgacgc caaggaggac ggcaacatcc tggggcacaa gctggagtac aactacaaca gccacaacgt ctatatcatg gccgacaagc agaagaacgg catcaaggtg aacttcaaga tccgccacaa catcgaggac ggcagcgtgc agctcgccga ccactaccag cagaacaccc cggccgcggcgc acaaccacta cctgagcacc cagtccgccc tgagcaaaga ccccaacgag aagcgcgatc acatggtcct gctggagttc gtgaccgccg ccgggatcac tctcggcatg gacgagctgt acaagtagac gcgtacgcgg ccgctcgagg attataagga tgaatc tataaggtt tatccgatcc accggatcta gataagatat ccgatccacc ggatctagat aactgatcat aatcagccat accacatttg tagaggtttt acttgcttta aaaaacctcc cacacctccc cctgaacctgaaacataaaa tgaatgcaat tgttgttgtt aacttgttta ttgcagctta taatggttac aaataaagca atagcatcac aaatttcaca aataaagcat tttttcact gcattctagt tgtggtttgt caaactcat caatgtatct taacgcggta accacgtgc ggagttggcc actccctctc tgcgcgctcg ctcgctcact gaggccgggc gaccaaaggt cgcccgacgc ccgggctttg cccgggcggc ctcagtgagc gagcgagcgc gcagctgcct gcaggggcgc ctgatgcggt tctctctgt tcgctgt cacaccgcat acgtcaaagc aaccatagta cgcgccctgt agcggcacat taagcgcggc gggtgtggtg gttacgcgca gcgtgaccgc tacacctgcc agcgccttag cgcccgctcc ttcgctttc ttcccttcct ttcgccc g tcgggggctc cctttagggt tccgatttag tgctttacgg cacctcgacc ccaaaaaact tgatttgggt gatggttcac gtagtgggcc atcgccctga tagacggtttt ttcgcccttt gacgttggag tccacgttct ttaatagtgg actcttgttc caaacttc ggctattctt ttgatttata agggattttg ccgatttcgg tctattggtt aaaaaattgag ctgatttaac aaaaatttaa cgcgaatttt aacaaaatat taacgtttac aattttatgg tgcactctca gtacaatctg ctctgatgcc gcatagttaa gccagccccgacacccgcca acacccgctg acgcgccctg acgggcttgt ctgctcccgg catccgctta cagacaagct gtgaccgtct ccgggagctg catgtgtcag aggttttcac cgtcatcacc gaaacgcgcg agacgaaagg gcctcgtgat acgcctat attatcat ttataggttacgattgtgt caggtggcac tttcgggga aatgtgcgcg gaacccctat ttgtttatttt ttctaaatac attcaaatat gtatccgctc atgagacaat aaccctgata aatgcttcaa tatattgaa aaaggaagag tatgagtatt caacatttcc gtgtcgccct tattccct tttgccctt tcccggctt tccttgattc cgctggtgaa agtaaaagat gctgaagatc agttgggtgc acgagtgggt tacatcgaac tggatctcaa cagcggtaag atccttgaga gttttcgccc cgaagaacgt tttccaatga tgagcacttt taaagttctg ctatgtggcg cggtattatc ccgtattgagg g cactattctc agaatgactt ggttgagtac tcaccagtca cagaaaagca tcttacggat ggcatgacag taagagaatt atgcagtgct gccataacca tgagtgataa cactgcggcc aacttacttc tgacaacgat cggaggaccg aaggagctaa ccgcttt gcacatgcacatgc tgatcgttgg gaaccggagc tgaatgaagc cataccaaac gacgagcgtg acaccacgat gcctgtagca atggcaacaa cgtgcgcaa actattaactggcgaactac ttactctagc ttcccggcaa caattaatag actggatgga ggcggataaa gttgcaggac cacttctgcg ctcggccctt ccggctggct ggtttattgc tgataaatct ggagccggtg agcgtgggtc tcgcggtatc attgcagcac tggggccaga tggtaagccc tcccgtatcg tagttatcta cacgacgggg agtcaggcaa ctatggatga acgaaataga cagatcgctg agataggtgc ctcactgatt aagcattggt aactgtcaga ccaagtttac tcatatatac tttagattga tttaaaactt catttttaat ttaaaaggat ctaggtgaag atcctttttg ataatctcat gaccaaaatc ccttaacgtg agttttcgtt ccactgagcg tcagaccccg tagaaaagat caaaggatct tcttgagatc ctttttttct gcgcgtaatc tgctgcttgc aaacaaaaaa accaccgcta ccagcggtgg tttgtttgcc ggatcaagag ctaccaactc tttttccgaa ggtaactggc ttcagcagag cgcagatacc aaatactgtt cttctagtgt agccgtagtt aggccaccac ttcaagaact ctgtagcacc gcctacatac ctcgctctgc taatcctgtt accagtggct gctgccagtg gcgataagtc gtgtcttacc gggttggact caagacgata gttaccggat aaggcgcagc ggtcgggctg aacggggggt tcgtgcacac agcccagctt ggagcgaacg acctacaccg aactgagata cctacagcgt gagctatgag aaagcgccac gcttcccgaa gggagaaagg cggacaggta tccggtaagc ggcagggtcggaacaggaga gcgcacgagg gagcttccag ggggaaacgc ctggtatctt tatagtcctg tcgggtttcg ccacctctga cttgagcgtc gatttttgtg atgctcgtca ggggggcgga gcctatggaa aaacgccagc aacgcggcct ttttacggtt cctggccttt tgctggcctt ttgctcacat gt

[0055] In SEQ ID NO:8, residues 1-130 of pAV-TBG-EGFP correspond to the 5'ITR; residues 150-854 are the TBG promoter sequence together with residues 415-824 containing TBG; residues 886-1608 encode EGFP; residues 1630-1653 encode a FLAG tag; residues 1663-1680 encode a 6xHis tag; residues 1851-1972 encode a poly(A) sequence; residues 2005-2145 correspond to the 3'ITR; residues 2220-2675 correspond to the F1 ori sequence; residues 3062-3922 encode the ampicillin resistance determinant and its signal sequence (residues 3062-3130) expressed by the bla promoter sequence (residues 2957-3061); and residues 4093-4681 correspond to the ori sequence (Figure 10).

[0056] As used herein, the term "native AAV serotype promoter sequence" is intended to mean a promoter sequence that naturally controls transcription of the AAV rep gene or that is naturally present within such a rep gene. For example: The AAV1 P5 promoter sequence naturally controls the transcription of the AAV1 rep gene, and the AAV1 P40 promoter sequence is naturally found in the AAV1 rep gene. Thus, the AAV1 P5 promoter sequence and the AAV1 P40 promoter sequence are the native AAV serotype promoter sequences of the AAV1 rep gene; The AAV2 P5 promoter sequence naturally controls the transcription of the AAV2 rep gene, and the AAV2 P40 promoter sequence is naturally found in the AAV2 rep gene. Thus, the AAV2 P5 promoter sequence and the AAV2 P40 promoter sequence are the native AAV serotype promoter sequences of the AAV2 rep gene; The AAV5 P5 promoter sequence naturally controls the AAV5 rep gene, and the AAV5 P40 promoter sequence is naturally found in the AAV5 rep gene. Thus, the AAV5 P5 promoter sequence and the AAV5 P40 promoter sequence are the native AAV serotype promoter sequences of the AAV5 rep gene; The AAV6 P5 promoter sequence naturally controls the AAV6 rep gene, and the AAV6 P40 promoter sequence is naturally found in the AAV6 rep gene. Thus, the AAV6 P5 promoter sequence and the AAV6 P40 promoter sequence are native AAV serotype promoter sequences of the AAV6 gene; and The AAV7 P5 promoter sequence naturally controls the AAV rep gene, and the AAV7 P40 sequence is naturally found in the AAV7 rep gene. Thus, the AAV7 P5 promoter sequence and the AAV7 P40 promoter sequence are native AAV serotype promoter sequences of AAV7.

[0057] The native AAV P5 and P40 promoter sequences for AAV serotypes 1 through 8 are shown in Table 1. Any such sequence, or subsequence thereof, capable of mediating transcription can be used in accordance with the methods of the invention. [Table 1-1] [Table 1-2] [Table 1-3]

[0058] In contrast, the term "non-native AAV serotype promoter sequence" is intended to mean a promoter sequence that does not naturally control the rep gene of AAV and is not naturally found within such a rep gene. Exemplary, non-limiting examples of non-native AAV serotype promoter sequences are: the AAV1 P5 promoter when used to direct expression of the AAV2, AAV5, AAV6, or AAV7 rep gene; the AAV2 P5 promoter when used to direct expression of the AAV1, AAV5, AAV6, or AAV7 rep gene; the AAV5 P5 promoter when used to direct expression of the AAV1, AAV2, AAV6, or AAV7 rep gene; the AAV6 P5 promoter when used to direct expression of the AAV1, AAV2, AAV5, or AAV7 rep gene; the AAV7 P5 promoter when used to direct expression of the AAV1, AAV2, AAV5, or AAV6 rep gene; the AAV1 P40 promoter when used to direct expression of the AAV2, AAV5, AAV6, or AAV7 rep gene; P40 promoter; the AAV5 P40 promoter when used to direct expression of the AAV1, AAV2, AAV6, or AAV7 rep gene; the AAV6 P40 promoter when used to direct expression of the AAV1, AAV2, AAV5, or AAV7 rep gene; the AAV7 P40 promoter when used to direct expression of the AAV1, AAV2, AAV5, or AAV6 rep gene, and the like.

[0059] In one embodiment, one or more of such AAV serotype promoter sequences can be genetically engineered into a recombinant AAV helper plasmid designed to provide Rep and Cap proteins that replace or augment the existing P5 or P40 promoters of such plasmids. Such modification is preferably accomplished using well-known methods of recombinant DNA technology.

[0060] The serotype identity of a promoter sequence is indicated herein by indicating the promoter involved (e.g., P5, P40, etc.), the serotype of the rep gene with which it is naturally associated, and the name of the vector, i.e., for example, a pAAV-RC2 plasmid containing the P5 promoter sequence naturally associated with AAV2 is indicated as P5(2)-RC2; a pAAV-RC2 plasmid containing the P5 promoter sequence naturally associated with AAV3 is indicated as P5(3)-RC2; a pAAV-RC5 plasmid containing the P40 promoter sequence naturally associated with AAV7 is indicated as P40(7)-RC5; a pAAV-RC2 plasmid containing the P5 promoter naturally associated with AAV3 and the P40 promoter sequence naturally associated with AAV8 is indicated as P5(3) / P40(8)-RC2, etc.

[0061] In one embodiment, the introduced AAV serotype promoter sequence replaces the originally existing AAV serotype promoter sequence. In another embodiment, the introduced AAV serotype promoter sequence is in addition to such originally existing AAV serotype promoter sequence and is located 5' or 3' to such originally existing AAV serotype promoter sequence. The introduced nucleotide sequence can be located adjacent to or distant from such originally existing AAV serotype promoter sequence.

[0062] The substitution or addition of one or more of such AAV serotype promoter sequences of the present invention increases the rAAV production titer. As used herein, the term "production titer" is intended to indicate the amount of concentration of infectious rAAV in a preparation. Such amount or concentration is preferably determined by titering the AAV or rAAV in such a preparation. The production titer of the rAAV preparation of the present invention is preferably titered after freezing / thawing the producer cells (e.g., HEK293 transformed with rAAV plasmid vector, AAV helper vector providing Rep and Cap proteins, and Ad helper vector providing necessary adenoviral transcription and translation factors) three times, followed by sonication to release the rAAV particles. The preparation is then centrifuged. The AAV vector used is localized in the supernatant. An aliquot of the preparation is treated with proteinase K and the number of AAV genomes is determined. An aliquot of the preparation is used to infect HeLa-32C2 cells (expressing AAV2 Rep and Cap) and the infectious titer is measured using an infectious center assay (ICA) (Francois, A. et al. (2018) “Accurate Titration of Infectious AAV Particles Requires Measurement of Biologically Active Vector Genomes and Suitable Controls,” Molec. Ther. Meth. Clin. Develop. 10:223-236) or, more preferably, as a tissue culture median infectious dose (TCID50) (Zen, Z. et al. (2004) “Infectious Titer Assay For Adeno-Associated Virus Vectors With Sensitivity Sufficient To Detect Single Infectious Events,” Hum. Gene Ther. 15:709-715).

[0063] As used herein, an rAAV production titer is said to be "increased" by a method of the invention if the production titer resulting from use of a method of the invention is at least 10% greater, more preferably at least 20% greater, even more preferably at least 30% greater, more preferably at least 40% greater, more preferably at least 50% greater, more preferably at least 60% greater, more preferably at least 70% greater, more preferably at least 80% greater, more preferably at least 90% greater, more preferably at least 2-fold greater, more preferably at least 110% greater, more preferably at least 120% greater, more preferably at least 130% greater, more preferably at least 140% greater, more preferably at least 2.5-fold greater, more preferably at least 160% greater, more preferably at least 170% greater, more preferably at least 180% greater, more preferably at least 190% greater, more preferably at least 3-fold greater than the titer resulting from a similarly performed production in which no additionally provided ions were provided.

[0064] The rAAV that can be used to increase production titers using the methods of the present invention can include any transgene cassette that allows the rAAV to be packaged into a rAAV plasmid vector that can be encapsulated into an AAV capsid particle. Without being limited thereto, such transgene cassettes can be of human, primate (including chimpanzee, gibbon, gorilla, orangutan, etc.), cercopithecine (including baboon, cynomolgus monkey, vervet monkey, etc.), canine, glirine (including rat, mouse, hamster, guinea pig, etc.), feline, ovine, caprine, or equine origin.

[0065] In preferred embodiments, such rAAV or rAAV plasmid vectors contain transcribed nucleic acids encoding proteins (e.g., enzymes, hormones, antibodies, receptors, ligands, etc.) or associated with a genetic or genetic disease or condition, and thus can be used in gene therapy to treat such disease or condition.

[0066] The methods of the invention can further be used to increase production titers of rAAV and rAAV plasmid vectors in cells transfected with (1) AAD helper vectors that have non-native AAV serotype promoter sequences and are capable of expressing proteins or RNA molecules not naturally provided by such rAAV or rAAV plasmid vectors, but necessary for their production. As discussed above, such proteins or RNA molecules include genes encoding the ReP52 and Rep78 proteins required for vector transcriptional control and replication, and packaging of the viral genome into the viral coat, and the cap gene encoding the VP capsid protein required for formation of infectious particles; and (2) Ad helper vectors that can provide non-AAV helper proteins (e.g., E1a, E1b, E2a, VA, E4) or RNAs not provided by such rAAV or rAAV plasmid vectors but necessary for their production.

[0067] In one embodiment for producing a rAAV of the invention, all of such genes and RNA molecules are provided on the same helper virus (or more preferably, helper vector) such that in conjunction with the rAAV they comprise a double plasmid transfection system. More preferably, however, for producing a rAAV of the invention, the AAV helper function-providing polynucleotides providing the necessary rep and cap genes, as well as such non-native AAV serotype promoter sequences, are provided on a vector separate from the vector comprising the non-AAV helper function-providing polynucleotides, such vector or plasmid in conjunction with the rAAV they comprise a triple plasmid transfection system.

[0068] Thus, the present invention stems, in part, from the recognition that rAAV production can be increased by inducing expression of the Rep and Cap proteins with a promoter sequence that is not the native promoter sequence. Thus, by modifying a particular rAAV to replace its native P5 and / or P40 AAV serotype promoter sequence with a non-native P5 and / or P40 AAV serotype promoter sequence (or by incorporating a non-native P5 or / and P40 AAV serotype promoter sequence), the methods of the present invention are used to increase the production titer of rAAV belonging to any serotype, including AAV1, AAV2, AAV5, AAV6, AAV7, AAV8, AAV9 and AAV10 serotypes, including hybrid serotypes (e.g., AAV2 / 5 and rAAV2 / 5, a hybrid of AAV serotypes 2 and 5 and having the trophic properties of both such serotypes).

[0069] The methods of the invention can be used to increase the production titer of rAAV produced using "helper" RNA or proteins provided by adenovirus, herpes simplex virus, cytomegalovirus, vaccinia virus, or papilloma virus.

[0070] The method of the present invention can be used to increase the production titer of rAAV produced by cells in adherent monolayer or suspension culture, and can be used with any method capable of producing rAAV. However, rAAV is preferably produced by transfecting baby hamster kidney (BHK) cells, or more preferably human embryonic kidney (HEK) cells, grown in tissue culture with the above-mentioned plasmid vector. The BHK cell line BHK-21 (ATCC CCL-10), which lacks endogenous retrovirus, is the preferred BHK cell line. The HEK cell line HEK293 (ATCC CRL-1573) and its derivatives, such as HEK293T (ATCC CRL-3216: a highly transfectable derivative of the HEK293 cell line in which a temperature-sensitive gene for SV40 T antigen has been inserted) or HEK293T / 17 (ATCC™ CRL-11268, selected for ease of transfection), are particularly preferred. The HEK293T / 17SF cell line (ATCC ACS-4500) is a derivative of the 293T / 17 cell line (ATCC CRL-11268) that is adapted to serum-free medium and suspension and can be used if desired.

[0071] The preferred basal medium of the present invention for culturing such cells is Eagle's Minimum Essential Medium (ATCC Catalog No. 30-2003) or Dulbecco's Modified Eagle's Medium (DMEM; Mediatech, Manassas, VA). Fetal bovine serum (e.g., FBS; HyClone Laboratories, South Logan, UT) is added to a final concentration of 10% to make a complete growth medium. Eagle's Minimum Essential Medium and Dulbecco's Modified Eagle's Medium are complex media that contain various inorganic salts, as well as amino acids, vitamins, and, optionally, glucose. The medium differs in that Dulbecco's Modified Eagle's Medium contains approximately four times as many vitamins and amino acids as the original Eagle's Minimum Essential Medium, and two to four times as much glucose. Additionally, it contains iron in the form of ferric sulfate and phenol red for pH indication (Yao, T et al. (2017) "Animal-Cell Culture Media: History, Characteristics, And Current Issues," Reproduc. Med. Biol. 16(2):99-117).

[0072] The cells used for such transfections are preferably passaged twice a week to maintain them in the exponential growth phase. For small-scale transfections, e.g., 1 x 10 cells per well on a multi-well plate. 6 HEK293 or BHK cells, or 1.5 × 10 per 15 cm dish 7 An aliquot of HEK293 cells can be used. For large-scale production, HEK293 or BHK cells can be harvested from multiple confluent 15 cm plates and split into two 10-layer cell stacks (Corning, Corning, NY) containing 1 liter of complete culture medium. In one embodiment, such cells are grown in such medium for 4 days prior to transfection. The day before transfection, two cell stacks are trypsinized and cells (e.g., approximately 6×10 8The cells) may be resuspended in 200 ml of medium. Preferably, the cells are allowed to attach for 24 hours prior to transfection. The confluency of the cell stacks can be monitored using a Diaphot inverted microscope (Nikon, Melville, NY) with the phase contrast hardware removed to accommodate the cell stacks on the microscope stage.

[0073] In particular, the present invention further provides a method for increasing the production titer of a recombinant modified adeno-associated virus (rAAV) containing a transgene cassette, the method comprising culturing a cell transfected with: (1) rAAV; (2) a recombinant modified adeno-associated virus (rAAV) helper vector comprising a polynucleotide that provides AAV helper function, such polynucleotide comprising a non-native AAV serotype P5 or P40 promoter sequence in place of or in addition to a native AAV serotype promoter sequence; and (3) additional vectors, particularly plasmid vectors, including non-AAV helper function-providing polynucleotides; Culturing is performed in a medium under conditions sufficient to allow production of rAAV, and the presence of the non-native AAV serotype P5 or P40 promoter sequence causes the cells to produce said rAAV at increased production titers compared to that achieved when the AAV helper function-providing polynucleotide contains the native serotype P5 and P40 promoters.

[0074] The present invention further provides a method for increasing the production titer of a recombinant modified adeno-associated virus (rAAV) comprising a transgene cassette, the method comprising culturing cells transfected with: (1) rAAV; and (2) a recombinant modified adeno-associated virus (rAAV) helper vector comprising: (a) an AAV helper function-providing polynucleotide, such polynucleotide comprising a non-native AAV serotype P5 or P40 promoter sequence in place of, or in addition to, a native AAV serotype promoter sequence; and (b) a non-AAV helper function-providing polynucleotide; Culturing is performed in a medium under conditions sufficient to allow production of rAAV, and the presence of the non-native AAV serotype P5 or P40 promoter sequence causes the cells to produce said rAAV at increased production titers compared to that achieved when the AAV helper function-providing polynucleotide contains the native serotype P5 and P40 promoters.

[0075] In preferred embodiments, the transgene cassette of such a rAAV contains a nucleic acid that encodes a protein or is transcribed that is therapeutic for a genetic or inherited disease or condition. II. Pharmaceutical Compositions of the Invention

[0076] The invention further includes pharmaceutical compositions comprising a pharma- ceutically acceptable preparation of the rAAV produced according to the methods of the invention and a pharma- ceutically acceptable carrier. The rAAV of such pharmaceutical compositions comprises a transgene cassette or comprises a transcribed nucleic acid encoding a protein that is therapeutic for a genetic or inherited disease or condition and is present in such pharmaceutical compositions in an effective amount ("effective amount").

[0077] The term "pharmaceutical acceptable" means approved for use in animals, particularly humans, by a regulatory agency of a federal or state government or a regulatory agency listed in the US Pharmacopeia or other generally recognized pharmacopeia. The term "carrier" refers to a diluent, adjuvant (e.g., Freund's complete and incomplete adjuvants), excipient, or vehicle with which the therapeutic is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline and aqueous dextrose and glycerol solutions can also be used as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk powder, glycerol, propylene, glycol, water, ethanol, and the like. The compositions can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents, if desired. These compositions can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents, if desired. These compositions can take the form of solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained-release formulations, and the like. Suitable pharmaceutical excipients are described in U.S. Pat. No. 8,852,607; U.S. Pat. No. 8,192,975; U.S. Pat. No. 6,764,845; U.S. Pat. No. 6,759,050, and U.S. Pat. No. 7,598,070.

[0078] In general, the components of the composition of the present invention are supplied separately or mixed together in unit dosage form, for example as dry lyophilized powder or water-free concentrate, or as an aqueous solution in a sealed container such as a vial, ampoule or sachet indicating the amount of active agent.When the composition is administered by injection, it can be administered using an injection bottle containing sterile pharmaceutical grade water or saline.When the composition is administered by injection, an ampoule of sterile water for injection or saline or other diluent can be provided to mix the components before administration.

[0079] The invention also provides pharmaceutical packs or kits comprising one or more containers of such pharmaceutical compositions, which may, where appropriate, have associated therewith a notice in a format prescribed by a governmental agency regulating the manufacture, use or sale of drugs or biological products, which notice reflects approval by that agency of the manufacture, use or sale for human administration.

[0080] The rAAV of such pharmaceutical compositions is preferably packaged in a sealed container, such as a vial, ampoule or sachette, indicating the quantity of the molecule and optionally including instructions for use. In one embodiment, the rAAV of such kits is supplied as a dry sterile lyophilized powder or water-free concentrate in a sealed container, which can be reconstituted, for example, with water, saline or other diluent, to the appropriate concentration for administration to a subject. The lyophilized material is stored at 2-8°C in the original container and administered within 12 hours after reconstitution, preferably within 6 hours, 5 hours, 3 hours, or within 1 hour after dissolution. In another embodiment, the rAAV of such kits is supplied as an aqueous solution in a sealed container, which can be diluted, for example, with water, saline, or other diluent, to the appropriate concentration for administration to a subject. The kits can further include, in one or more containers, one or more other prophylactic and / or therapeutic agents useful in the treatment of a disease or condition; and / or the kits can further include one or more cytotoxic antibodies that bind to one or more cancer antigens associated with the cancer. In some embodiments, the other prophylactic or therapeutic agent is a chemotherapeutic agent. In other embodiments, the prophylactic or therapeutic agent is a biological or hormonal therapy. III. Uses of the Invention

[0081] The methods of the invention can be used to facilitate the production of rAAV, and in particular, can be used to facilitate the production of rAAV that contain a transgene cassette encoding a protein (e.g., an enzyme, hormone, antibody, receptor, ligand, etc.) or that contains a transcribed nucleic acid that treats a genetic or inherited disease or condition, and can be used in gene therapy to treat such disease or condition. Examples of such diseases and conditions include color blindness (ACHM); alpha 1 antitrypsin (AAT) deficiency; Alzheimer's disease; aromatic L-amino acid decarboxylase (AADC) deficiency; choroideremia (CHM); cancer; Duchenne muscular dystrophy; dysferlin deficiency; follistatin gene deficiency (BMDSIBM); hemophilia A; hemophilia B; hepatitis A; hepatitis B; hepatitis C; Huntington's disease; idiopathic Parkinson's disease; late infantile neuronal ceroid lipofuscinosis (LINCL, infantile form of Batten disease); Leber's congenital amaurosis (LCA); Leber's hereditary optic neuropathy (LHON); limb-girdle muscular dystrophy 1B (LGMD1B); limb-girdle muscular dystrophy 1 C (LGMD1C); limb-girdle muscular dystrophy 2A (LGMD2A); limb-girdle muscular dystrophy 2B (LGMD2B); limb-girdle muscular dystrophy 2I (LGMD2I); limb-girdle muscular dystrophy 2L (LGMD2L); lipoprotein lipase (LPL) deficiency; metachromatic leukodystrophy; neurological disorders; neuromotor disorders; neuroskeletal disorders; Parkinson's disease; rheumatoid arthritis; Sanfilippo A syndrome; spinal muscular atrophy (SMA); X-linked retinoschisis (XLRS); alpha-sarcoglycan deficiency (LGMD2D); beta-sarcoglycan deficiency (LGMD2E); gamma-sarcoglycan deficiency (LGMD2C) and delta-sarcoglycan deficiency (LGMD2F). IV. EMBODIMENTS OF THE PRESENT ART

[0082] The present invention relates to recombinant modified adeno-associated virus (AAV) helper vectors comprising AAV helper function-providing polynucleotides, uses and compositions thereof, and in particular to the following embodiments E1 to E16: E1. A recombinant modified adeno-associated virus (AAV) helper vector comprising an AAV helper function-providing polynucleotide, wherein the polynucleotide comprises a non-native AAV serotype P5 or P40 promoter sequence. A recombinant modified adeno-associated virus (AAV) helper vector of E1, wherein the AAV helper function-providing polynucleotide vector comprises a non-native AAV serotype P5 promoter sequence. E3. A recombinant modified adeno-associated virus (AAV) helper vector, either E1 or E2, in which the AAV helper function-providing polynucleotide vector comprises a non-native AAV serotype P40 promoter sequence. E4. A recombinant modified adeno-associated virus (AAV) helper vector of any of E1 to E3, wherein the vector is a plasmid vector. E5. A recombinant modified adeno-associated virus (AAV) helper vector of E1, in which a non-native AAV serotype P5 or P40 promoter sequence replaces the native AAV serotype promoter sequence. E6. A recombinant modified adeno-associated virus (AAV) helper vector of any of E1 to E6, wherein the vector further comprises a non-AAV helper function-providing polynucleotide. E7. A method of increasing the production titer of a recombinant modified adeno-associated virus (rAAV) containing a transgene cassette, the method comprising culturing cells transfected with: (1) rAAV; and (2) a recombinant modified adeno-associated virus (AAV) helper vector of E6; The method, wherein culturing is performed in a medium under conditions sufficient to allow production of rAAV, and the presence of a non-native AAV serotype P5 or P40 promoter sequence causes the cells to produce rAAV at an increased production titer compared to that achieved when the AAV helper function-providing polynucleotide contains the native serotype P5 and P40 promoters. E8. A method for increasing the production titer of a recombinant modified adeno-associated virus (rAAV) containing a transgene cassette, the method comprising culturing cells transfected with: (1) rAAV; (2) any of E1 to E6 recombinant modified adeno-associated virus (AAV) helper vectors; and (3) Additional vectors, particularly plasmid vectors, containing non-AAV helper function-providing polynucleotides; The method, wherein culturing is performed in a medium under conditions sufficient to allow production of rAAV, and the presence of a non-native AAV serotype P5 or P40 promoter sequence causes the cells to produce rAAV at an increased production titer compared to that achieved when the AAV helper function-providing polynucleotide contains the native serotype P5 and P40 promoters. E9. The method of E7 or E8, comprising: (A) the AAV helper function-providing polynucleotide of the vector encodes an AAV1 Cap protein and the non-native AAV serotype promoter sequence is a promoter sequence of an AAV of serotype AAV3, AAV4, AAV5, AAV6, AAV7 or AAV8, or a hybrid of one or more of the said serotypes; (B) the AAV helper function-providing polynucleotide of the vector encodes an AAV2 Cap protein and the non-native AAV serotype promoter sequence is a promoter sequence of AAV of serotype AAV1, AAV3, AAV4, AAV5, AAV6, AAV7, or AAV8, or a hybrid of one or more of the said serotypes; (C) the AAV helper function-providing polynucleotide of the vector encodes an AAV3 Cap protein and the non-native AAV serotype promoter sequence is a promoter sequence of AAV of serotype AAV1, AAV4, AAV5, AAV6, AAV7, or AAV8, or a hybrid of one or more of the said serotypes; (D) the AAV helper function-providing polynucleotide of the vector encodes an AAV4 Cap protein and the non-native AAV serotype promoter sequence is a promoter sequence of AAV of serotype AAV1, AAV3, AAV5, AAV6, AAV7, or AAV8, or a hybrid of one or more of the said serotypes; (E) the AAV helper function-providing polynucleotide of the vector encodes an AAV5 Cap protein and the non-native AAV serotype promoter sequence is a promoter sequence of AAV of serotype AAV1, AAV3, AAV4, AAV6, AAV7, or AAV8, or a hybrid of one or more of the said serotypes; (F) the AAV helper function-providing polynucleotide of the vector encodes an AAV6 Cap protein and the non-native AAV serotype promoter sequence is a promoter sequence of AAV of serotype AAV1, AAV3, AAV4, AAV5, AAV7, or AAV8, or a hybrid of one or more of the said serotypes; (G) the AAV helper function-providing polynucleotide of the vector encodes an AAV7 Cap protein and the non-native AAV serotype promoter sequence is a promoter sequence of an AAV of serotype AAV1, AAV3, AAV4, AAV5, AAV6 or AAV8, or a hybrid of one or more of the said serotypes; or (H) the AAV helper function-providing polynucleotide of the vector encodes an AAV8 Cap protein, and the non-native AAV serotype promoter sequence is an AAV promoter sequence of serotype AAV1, AAV3, AAV4, AAV5, AAV6, or AAV7, or a hybrid of one or more of the said serotypes. method. E10. Methods from E7 to E9, in which the cells are human embryonic kidney cells, baby hamster kidney cells or sf9 insect cells. E11. Method of E10 where the cells are HEK293 human embryonic kidney cells. E12. Method of E11 where the cells are BHK21 baby hamster kidney cells. E13. Any of the methods E7 to E12, wherein the transgene cassette encodes a protein or comprises a transcribed nucleic acid which is therapeutic for a genetic or inherited disease or condition. Preparation of recombinant modified adeno-associated virus (rAAV) produced by the method of E14.E13. A pharmaceutical composition comprising a recombinant modified adeno-associated virus (rAAV) produced by the method of E15.E13 and a pharma- ceutically acceptable carrier. E16. A recombinant modified adeno-associated virus (rAAV) preparation of E14 or a pharmaceutical composition of E15 for use in treating a genetic disease or condition. EXAMPLES

[0083] Having generally described the invention, the same will be more readily understood by reference to the following examples, which are provided by way of illustration and are not intended to limit the invention unless specified. Example 1 Comparison of rAAV production titers by cells transfected with AAV RC2 helper plasmid vectors carrying non-native AAV serotype P5 promoter sequences

[0084] To demonstrate the ability of a non-native AAV serotype promoter sequence to affect rAAV production titers, a derivative of the AAV helper plasmid AAV RC2 (containing the AAV2 rep gene and the cap gene encoding the Cap protein of the AAV2 serotype) was constructed (Figure 11) that contained a non-native AAV serotype promoter sequence in place of the native AAV2 serotype P5 promoter of such a plasmid (Figure 12A; downward striped rectangle). The P19 and P40 promoters of the construct were unchanged and thus both were native AAV2 serotype promoter sequences (Figure 12A; black filled rectangle).

[0085] The following constructs were used; the sequences of the promoter regions are shown in Table 1: (1)Parent-RC2 pAAV-RC2 (SEQ ID NO:2), which contains the AAV2 rep gene and a portion of the complete AAV2 serotype P5 promoter sequence (SEQ ID NO:10), and the AAV2 cap gene, the expression of which is controlled by the native AAV2 P40 promoter sequence (SEQ ID NO:18); (2)P5(1)-RC2 A derivative of the plasmid vector pAAV-RC2 in which the native AAV serotype P5 promoter sequence was replaced with the P5 promoter sequence of AAV serotype 1 (SEQ ID NO:9); (3)P5(2)-RC2 A derivative of the plasmid vector pAAV-RC2 in which the partial AAV2 serotype P5 promoter sequence of Parent-RC2 was replaced with the full-length P5 promoter of AAV serotype 2 (SEQ ID NO: 10); (4)P5(3)-RC2 A derivative of the plasmid vector pAAV-RC2 in which the native AAV2 serotype P5 promoter sequence is replaced with the P5 promoter sequence of AAV serotype 3 (SEQ ID NO:11); (5)P5(4)-RC2 A derivative of the plasmid vector pAAV-RC2 in which the native AAV2 serotype P5 promoter sequence is replaced with the P5 promoter sequence of AAV serotype 4 (SEQ ID NO: 12); (6)P5(5)-RC2 A derivative of the plasmid vector pAAV-RC in which the native AAV2 serotype P5 promoter sequence is replaced with the P5 promoter sequence of AAV serotype 5 (SEQ ID NO: 13); (7)P5(6)-RC2 A derivative of the plasmid vector pAAV-RC in which the native AAV2 serotype P5 promoter sequence is replaced with the P5 promoter sequence of AAV serotype 6 (SEQ ID NO: 14); (8)P5(7)-RC2 A derivative of the plasmid vector pAAV-RC in which the native AAV2 serotype P5 promoter sequence is replaced with the P5 promoter sequence of AAV serotype 7 (SEQ ID NO: 15); and (9)P5(8)-RC2 A derivative of the plasmid vector pAAV-RC in which the native AAV2 serotype P5 promoter sequence is replaced with the P5 promoter sequence of AAV serotype 8 (SEQ ID NO: 16).

[0086] Figure 12B shows the rAAV production titers obtained using such AAV helper plasmid vectors. rAAV production titers were obtained using a triple plasmid transfection system with rAAV (pGOI; BBa_K404119) and an Ad helper plasmid (pHelper) that provides the necessary adenoviral functions. Plasmid pGOI is an rAAV plasmid vector that contains, from 5' to 3', the 5'ITR, a CMV promoter, a β-globin intron, a polynucleotide encoding the yellow fluorescent protein mVenus (Nagai, T. et al. (2002) "A Variant Of Yellow Fluorescent Protein With Fast And Efficient Maturation For Cell-Biological Applications," Nat. Biotechnol. 20(1):87-90), a polyA domain of human growth hormone, and the 3'ITR. Figure 12B reveals that the serotype of the P5 promoter affects rAAV production titers, showing that replacing the native AAV2 P5 promoter of plasmid vector pAAV-RC2 with the AAV5 serotype P5 promoter significantly reduced the rAAV production titer, whereas replacing the native AAV2 P5 promoter of plasmid vector pAAV-RC2 with the P5 promoter of AAV serotypes 1, 3, 5, 7, or 8 significantly increased the rAAV production titer. Example 2 Comparison of rAAV production titers by cells transfected with AAV RC2 helper plasmid vectors carrying non-native AAV serotype P40 promoter sequences

[0087] To further demonstrate the ability of non-native AAV serotype promoter sequences to affect rAAV production titers, a derivative of the AAV helper plasmid AAV RC2 (containing the AAV2 rep gene and the cap gene encoding the Cap protein of the AAV2 serotype) was constructed (Figure 11) that contained a non-native AAV serotype promoter sequence in place of the native AAV2 serotype P40 promoter of such a plasmid (Figure 13A; up-striped rectangle). The P5 and P19 promoters of the construct were unchanged and thus both were native AAV2 serotype promoter sequences (Figure 13A; black filled rectangle).

[0088] The following constructs were used; the sequences of the promoter regions are shown in Table 1: (1)Parent-RC2 pAAV-RC2 (SEQ ID NO:2), which contains the AAV2 rep gene and a portion of the complete AAV2 serotype P5 promoter sequence (SEQ ID NO:10), and the AAV2 cap gene, the expression of which is controlled by the native AAV2 P40 promoter sequence (SEQ ID NO:18); (2)P40(1)-RC2 A derivative of the plasmid vector pAAV-RC2 in which the native AAV2 serotype P40 promoter sequence is replaced with the P40 promoter sequence of AAV serotype 1 (SEQ ID NO: 17); (3) P40(2)-RC2 A derivative of the plasmid vector pAAV-RC2 in which the AAV2 serotype P40 promoter sequence of Parent-RC2 was replaced with the AAV serotype 2 P40 promoter sequence (SEQ ID NO: 18); (4) P40(3)-RC2 A derivative of the plasmid vector pAAV-RC2 in which the native AAV2 serotype P40 promoter sequence is replaced with the P40 promoter sequence of AAV serotype 3 (SEQ ID NO: 19); (5)P40(4)-RC2 A derivative of the plasmid vector pAAV-RC2 in which the native AAV2 serotype P40 promoter sequence is replaced with the P40 promoter sequence of AAV serotype 4 (SEQ ID NO:20); (6)P40(5)-RC2 A derivative of the plasmid vector pAAV-RC2 in which the native AAV2 serotype P40 promoter sequence is replaced with the P40 promoter sequence of AAV serotype 5 (SEQ ID NO:21); (7)P40(6)-RC2 A derivative of the plasmid vector pAAV-RC2 in which the native AAV2 serotype P40 promoter sequence is replaced with the P40 promoter sequence of AAV serotype 6 (SEQ ID NO:22); (8)P40(7)-RC2 A derivative of the plasmid vector pAAV-RC2 in which the native AAV2 serotype P40 promoter sequence is replaced with the P40 promoter sequence of AAV serotype 7 (SEQ ID NO: 23); and (9)P40(8)-RC2 A derivative of the plasmid vector pAAV-RC2 in which the native AAV2 serotype P40 promoter sequence is replaced with the P40 promoter sequence of AAV serotype 8 (SEQ ID NO:24).

[0089] Figure 13B shows rAAV production titers obtained using such AAV helper plasmid vectors. rAAV production titers were obtained essentially as described in Example 1. The results of the study revealed that the serotype of the P40 promoter also affected rAAV production titers, showing that replacement of the native AAV2 P40 promoter in plasmid vector pAAV-RC2 with the AAV5 serotype P40 promoter significantly reduced rAAV production titers, whereas replacement of the native AAV2 P40 promoter in plasmid vector pAAV RC2 with the AAV1 serotype P40 promoter or the AAV8 serotype P40 promoter significantly increased rAAV production titers. Example 3 Comparison of rAAV production titers by cells transfected with AAV RC2 helper plasmid vectors carrying non-native AAV serotype P5 and P40 promoter sequences

[0090] To further demonstrate the ability of non-native AAV serotype promoter sequences to affect rAAV production titers, derivatives of the AAV helper plasmid AAVRC2 (containing the AAV2 rep gene and the cap gene encoding the Cap protein of the AAV2 serotype) were constructed that contained non-native AAV serotype promoter sequences in place of the native AAV2 serotype P5 (FIG. 14A; downward striped rectangle) and p40 (FIG. 14A; upward striped rectangle) promoters of such plasmids (FIG. 11). The AAV2 P5 and P19 promoters of the constructs were unchanged and thus were native AAV2 serotype promoter sequences (FIG. 14A; black filled rectangle).

[0091] The following constructs were used; the sequences of the promoter regions are shown in Table 1: (1)Parent-RC2 pAAV-RC2 (SEQ ID NO:2), which contains the AAV2 rep gene and a portion of the complete AAV2 serotype P5 promoter sequence (SEQ ID NO:10), and the AAV2 cap gene, the expression of which is controlled by the native AAV2 P40 promoter sequence (SEQ ID NO:18); (2)P5(2)-RC2 a derivative of the plasmid vector pAAV-RC2 in which a portion of the AAV2 serotype P5 promoter sequence has been replaced with the P5 promoter sequence of AAV serotype 2 (SEQ ID NO: 10); (3)P5(3)-RC2 A derivative of the plasmid vector pAAV-RC2 in which the native AAV2 serotype P5 promoter sequence is replaced with the P5 promoter sequence of AAV serotype 3 (SEQ ID NO:11); (4)P5(5)-RC2 A derivative of the plasmid vector pAAV-RC2 in which the native AAV2 serotype P5 promoter sequence is replaced with the P5 promoter sequence of the AAV5 serotype (SEQ ID NO: 13); (5)P40(1)-RC2 A derivative of the plasmid vector pAAV-RC2 in which the native AAV2 serotype P40 promoter sequence is replaced with the AAV1 serotype P40 promoter sequence (SEQ ID NO: 17); (6) P5(2) / P40(1)-RC2 A derivative of the plasmid vector pAAV-RC2 in which the native AAV2 serotype P5 promoter sequence has been replaced with the P5 promoter sequence of AAV2 (SEQ ID NO:10) and the native P40 promoter sequence has been replaced with the P40 promoter sequence of AAV1 (SEQ ID NO:17); (7) P5(3) / P40(1)-RC2 A derivative of the plasmid vector pAAV-RC2 in which the native AAV2 serotype P5 promoter sequence is replaced with the P5 promoter sequence of AAV3 (SEQ ID NO:11) and the native P40 promoter sequence is replaced with the P40 promoter sequence of AAV1 (SEQ ID NO:17); and (8) P5(5) / P40(1)-RC2 A derivative of the plasmid vector pAAV-RC2 in which the native AAV2 serotype P5 promoter sequence is replaced with the P5 promoter sequence of AAV5 (SEQ ID NO: 13) and the native P40 promoter sequence is replaced with the P40 promoter sequence of AAV1 (SEQ ID NO: 17).

[0092] rAAV production titers were obtained essentially as described in Example 1. Figure 14B shows the rAAV production titers obtained using such AAV helper plasmid vectors. As shown in Figure 14B, replacement of the native P5 and P40 promoters of pAAV-RC2 with the p5 promoter sequence and P40 promoter sequence of AA1 of AAV3 or AAV5 synergistically increased rAAV production titers. Example 4 Comparison of rAAV production titers by cells transfected with AAV RC6 helper plasmid vectors carrying non-native AAV serotype P5 and P40 promoter sequences

[0093] To further demonstrate the ability of non-native AAV serotype promoter sequences to affect rAAV production titers, a derivative of the AAV helper plasmid AAV RC6 (containing the AAV2 rep gene and the cap gene encoding the Cap protein of the AAV6 serotype) was constructed that contained a non-native AAV serotype promoter sequence in place of the native AAV2 serotype P5 (Figure 15A; downward striped rectangle) and p40 (Figure 15A; downward striped rectangle) promoters of such a plasmid (Figure 11). The AAV2 P5 promoter in the construct was unchanged and thus the native AAV2 serotype promoter sequence (Figure 15A; black filled rectangle).

[0094] The following constructs were used; the sequences of the promoter regions are shown in Table 1: (1)Parent-RC6 pAAV-RC6 (SEQ ID NO: 4), which contains the AAV2 rep gene and its native AAV2 serotype P5 promoter sequence (SEQ ID NO: 10) and the AAV6 cap gene, the expression of which is controlled by the native AAV2 P40 promoter sequence (SEQ ID NO: 18); (2)P5(1)-RC6 A derivative of the plasmid vector pAAV-RC6 in which the native AAV2 serotype P5 promoter sequence is replaced with the AAV1 serotype P5 promoter sequence (SEQ ID NO:9); (3)P5(2)-RC6 A derivative of the plasmid vector pAAV-RC6 in which the native AAV2 serotype P5 promoter sequence is replaced with the AAV2 serotype P5 promoter sequence (SEQ ID NO: 10); (4)P5(3)-RC6 A derivative of the plasmid vector pAAV-RC6 in which the native AAV2 serotype P5 promoter sequence is replaced with the AAV3 serotype P5 promoter sequence (SEQ ID NO:11); (5)P5(7)-RC6 A derivative of the plasmid vector pAAV-RC6 in which the native AAV2 serotype P5 promoter sequence is replaced with the AAV7 serotype P5 promoter sequence (SEQ ID NO: 15); and (6)P5(8)-RC6 A derivative of the plasmid vector pAAV-RC6 in which the native AAV2 serotype P5 promoter sequence is replaced with the AAV8 serotype P5 promoter sequence (SEQ ID NO: 16).

[0095] Figure 15B shows the rAAV production titers obtained using such AAV helper plasmid vectors. rAAV production titers were obtained essentially as described in Example 1.

[0096] The results of the study are shown in Figures 15B and 15C and demonstrate the production titers obtained using such AAV helper plasmid vectors. As shown in such figures, replacement of the native P5 and P40 promoters of pAAV-RC6 with the p5 promoter sequences of AAV serotypes 1, 2, 3, 7, or 8 increased rAAV production titers. Example 5 Comparison of rAAV production titers by cells transfected with AAV RC1, AAV RC5 or AAV RC7 helper plasmid vectors carrying non-native AAV serotype P5 and P40 promoter sequences

[0097] To further demonstrate the ability of non-native AAV serotype promoter sequences to affect rAAV production titers, derivatives of the AAV helper plasmid AAV RC1 (containing the AAV2 rep gene and a cap gene encoding the Cap protein of the AAV1 serotype), derivatives of the AAV helper plasmid AAV RC5 (containing the AAV2 rep gene and a cap gene encoding the Cap protein of the AAV5 serotype), and derivatives of the AAV helper plasmid AAV RC7 (containing the AAV2 rep gene and a cap gene encoding the Cap protein of the AAV7 serotype) were constructed to contain non-native AAV serotype promoter sequences in place of the native AAV2 serotype P5 (Figure 16A; downward striped rectangle) and / or p40 (Figure 16A; upward striped rectangle) promoters of such plasmids (Figure 11).

[0098] The following constructs were used; the sequences of the promoter regions are shown in Table 1: (1)Parent-RC1 pAAV-RC1 (SEQ ID NO:1), which contains the AAV2 rep gene and its native AAV2 serotype P5 promoter sequence (SEQ ID NO:10), and the AAV1 cap gene, the expression of which is controlled by the native AAV2 P40 promoter sequence (SEQ ID NO:18); (2)Parent-RC5 pAAV-RC5 (SEQ ID NO:3), which contains the AAV2 rep gene and its native AAV2 serotype P5 promoter sequence (SEQ ID NO:10), and the AAV5 cap gene, the expression of which is controlled by the native AAV2 P40 promoter sequence (SEQ ID NO:18); (3)Parent-RC7 pAAV-RC7 (SEQ ID NO:5), which contains the AAV2 rep gene and its native AAV2 serotype P5 promoter sequence (SEQ ID NO:10), and the AAV7 cap gene, the expression of which is controlled by the native AAV2 P40 promoter sequence (SEQ ID NO:18); (4)P5(2)-RC1 A derivative of the plasmid vector pAAV-RC1 in which the native AAV1 serotype P5 promoter sequence is replaced with the P5 promoter sequence of AAV2 (SEQ ID NO: 10); (5)P5(7)-RC1 A derivative of the plasmid vector pAAV-RC1 in which the native AAV1 serotype P5 promoter sequence is replaced with the P5 promoter sequence of AAV7 (SEQ ID NO: 15); (6)P5(8)-RC1 A derivative of the plasmid vector pAAV-RC1 in which the native AAV1 serotype P5 promoter sequence is replaced with the P5 promoter sequence of AAV8 (SEQ ID NO: 16); (7)P5(7)-RC5 A derivative of the plasmid vector pAAV-RC5 in which the native AAV5 serotype P5 promoter sequence is replaced with the P5 promoter sequence of AAV7 (SEQ ID NO: 15); (8)P5(2)-RC7 A derivative of the plasmid vector pAAV-RC7 in which the native AAV7 serotype P5 promoter sequence is replaced with the P5 promoter sequence of AAV2 (SEQ ID NO: 10); (9)P5(7)-RC7 A derivative of the plasmid vector pAAV-RC7 in which the native AAV7 serotype P5 promoter sequence is replaced with the P5 promoter sequence of AAV7 (SEQ ID NO: 15); and (10)P5(8)-RC7 A derivative of the plasmid vector pAAV-RC7 in which the native AAV7 serotype P5 promoter sequence is replaced with the P5 promoter sequence of AAV8 (SEQ ID NO: 16).

[0099] AAV production titers were obtained essentially as described in Example 1. The results of the study are shown in Figure 16B and demonstrate that replacement of the native P5 promoter sequence of pAAV-RC1, pAAV-RC5, and pAAV-RC7 with the P5 promoter sequence of AAV serotypes 2, 7, or 8 increased rAAV production titers.

[0100] All publications and patents mentioned in this specification are incorporated by reference herein to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference in its entirety. While the invention has been described in connection with particular embodiments thereof, it will be understood that the invention is capable of further modifications, and this application is generally intended to cover any variations, uses, or adaptations of the invention including departures from the present disclosure which come within known or customary practice in the art to which this invention pertains, in accordance with the principles of the invention.

Claims

1. A recombinant modified adeno-associated virus (AAV) helper vector comprising an AAV helper function-providing polynucleotide, said polynucleotide comprising an AAV rep gene and an AAV P5 and / or P40 promoter sequence; A recombinant modified adeno-associated virus (AAV) helper vector, wherein the serotype of AAV from which the AAV P5 and / or p40 promoter sequences are derived is different from the serotype of AAV from which the AAV rep genes are derived.

2. 2. The recombinant modified adeno-associated virus (AAV) helper vector of claim 1, wherein the AAV helper function-providing polynucleotide vector comprises the AAV P5 promoter sequence.

3. 2. The recombinant modified adeno-associated virus (AAV) helper vector of claim 1, wherein the AAV helper function-providing polynucleotide vector comprises the AAV P40 promoter sequence.

4. The recombinant modified adeno-associated virus (AAV) helper vector of claim 1, wherein the vector is a plasmid vector.

5. 2. The recombinant modified adeno-associated virus (AAV) helper vector of claim 1, wherein the AAV P5 and / or P40 promoter sequences replace native AAV serotype promoter sequences.

6. 2. The recombinant modified adeno-associated virus (AAV) helper vector of claim 1 , comprising: (A) the AAV rep gene is AAV serotype 1 and the AAV P5 and / or P40 promoter sequence is an AAV P5 promoter sequence derived from AAV serotype 2, 7, or 8; (B) the AAV rep gene is AAV serotype 2 and the AAV P5 and / or P40 promoter sequence is an AAV P5 promoter sequence derived from AAV serotype 1, 3, 5, 7, or 8; (C) the AAV rep gene is AAV serotype 2 and the AAV P5 and / or P40 promoter sequence is an AAV P40 promoter sequence derived from AAV serotype 1 or 8; (D) the AAV rep gene is AAV serotype 2 and the AAV P5 and / or P40 promoter sequence is an AAV P5 promoter sequence derived from AAV serotype 3 or 5 and an AAV P40 promoter sequence derived from AAV serotype 1; (E) the AAV rep gene is AAV serotype 5 and the AAV P5 and / or P40 promoter sequence is an AAV P5 promoter sequence derived from AAV serotype 7; (F) the AAV rep gene is AAV serotype 6 and the AAV P5 and / or P40 promoter sequence is an AAV P5 promoter sequence derived from AAV serotype 1, 2, 3, 7, or 8; or (G) the AAV rep gene is AAV serotype 7 and the AAV P5 and / or P40 promoter sequence is an AAV P5 promoter sequence derived from AAV serotype 2, 7, or 8. Recombinant modified adeno-associated virus (AAV) helper vectors.

7. 2. The recombinant modified adeno-associated virus (AAV) helper vector of claim 1, wherein the vector further comprises a non-AAV helper function-providing polynucleotide.

8. 1. A method for increasing the production titer of a recombinant modified adeno-associated virus (rAAV) containing a transgene cassette, the method comprising culturing a cell transfected with: (1) the rAAV; and (2) The recombinant modified adeno-associated virus (AAV) helper vector according to claim 7, wherein the culturing is in a medium under conditions sufficient to allow production of the rAAV, and the presence of the AAV P5 and / or P40 promoter sequences causes the cells to produce the rAAV at an increased production titer compared to that achieved when the AAV helper function-providing polynucleotide contains a P5 and P40 promoter derived from an AAV of the same serotype as the AAV serotype from which the AAV rep gene is derived.

9. The method of claim 8, wherein the transgene cassette is one that can be used in gene therapy.

10. The method of claim 8 , wherein the transgene cassette comprises a promoter, a polyadenylation site, or a combination thereof.

11. 9. The method of claim 8, wherein the transgene cassette encodes a protein or the transcribed nucleic acid comprises a transcribed nucleic acid, and the protein or the transcribed nucleic acid is therapeutic for a genetic or inherited disease or condition.

12. 9. The method of claim 8, comprising: (A) the AAV helper function-providing polynucleotide of the vector encodes AAV1 Cap proteins and the AAV P5 and / or P40 promoter sequence is a promoter sequence of AAV of serotype AAV3, AAV4, AAV5, AAV6, AAV7 or AAV8, or a hybrid of one or more of the said serotypes; (B) the AAV helper function-providing polynucleotide of the vector encodes AAV2 Cap proteins and the AAV P5 and / or P40 promoter sequence is a promoter sequence of AAV of serotype AAV1, AAV3, AAV4, AAV5, AAV6, AAV7, or AAV8, or a hybrid of one or more of the said serotypes; (C) the AAV helper function-providing polynucleotide of the vector encodes AAV3 Cap proteins and the AAV P5 and / or P40 promoter sequence is a promoter sequence of AAV of serotype AAV1, AAV4, AAV5, AAV6, AAV7, or AAV8, or a hybrid of one or more of the said serotypes; (D) the AAV helper function-providing polynucleotide of the vector encodes AAV4 Cap proteins and the AAV P5 and / or P40 promoter sequence is a promoter sequence of AAV of serotype AAV1, AAV3, AAV5, AAV6, AAV7, or AAV8, or a hybrid of one or more of the said serotypes; (E) the AAV helper function-providing polynucleotide of the vector encodes AAV5 Cap proteins and the AAV P5 and / or P40 promoter sequence is a promoter sequence of AAV of serotype AAV1, AAV3, AAV4, AAV6, AAV7, or AAV8, or a hybrid of one or more of the said serotypes; (F) the AAV helper function-providing polynucleotide of the vector encodes AAV6 Cap proteins and the AAV P5 and / or P40 promoter sequence is a promoter sequence of AAV of serotype AAV1, AAV3, AAV4, AAV5, AAV7, or AAV8, or a hybrid of one or more of the said serotypes; (G) the AAV helper function-providing polynucleotide of the vector encodes AAV7 Cap proteins and the AAV P5 and / or P40 promoter sequence is a promoter sequence of AAV of serotype AAV1, AAV3, AAV4, AAV5, AAV6 or AAV8, or a hybrid of one or more of the said serotypes; or (H) the AAV helper function-providing polynucleotide of the vector encodes AAV8 Cap protein and the AAV P5 and / or P40 promoter sequence is a promoter sequence of an AAV that is of serotype AAV1, AAV3, AAV4, AAV5, AAV6 or AAV7, or a hybrid of one or more of the said serotypes. method.

13. 9. The method of claim 8, comprising: (A) the AAV helper function-providing polynucleotide of the vector encodes an AAV1 Cap protein and the AAV P5 and / or P40 promoter sequence is an AAV P5 promoter sequence derived from AAV serotype 2, 7, or 8; (B) the AAV helper function-providing polynucleotide of the vector encodes an AAV2 Cap protein and the AAV P5 and / or P40 promoter sequence is an AAV P5 promoter sequence derived from AAV serotype 1, 3, 5, 7, or 8; (C) the AAV helper function-providing polynucleotide of the vector encodes an AAV2 Cap protein and the AAV P5 and / or P40 promoter sequence is an AAV P40 promoter sequence derived from AAV serotype 1 or 8; (D) the AAV helper function-providing polynucleotide of the vector encodes an AAV2 Cap protein, and the AAV P5 and / or P40 promoter sequence is an AAV P5 promoter sequence derived from AAV serotype 3 or 5 and an AAV P40 promoter sequence derived from AAV serotype 1; (E) the AAV helper function-providing polynucleotide of the vector encodes an AAV5 Cap protein and the AAV P5 and / or P40 promoter sequence is an AAV P5 promoter sequence derived from AAV serotype 7; (F) the AAV helper function-providing polynucleotide of the vector encodes AAV6 Cap protein and the AAV P5 and / or P40 promoter sequence is an AAV P5 promoter sequence derived from AAV serotype 1, 2, 3, 7, or 8; or (G) the AAV helper function-providing polynucleotide of the vector encodes an AAV7 Cap protein, and the AAV P5 and / or P40 promoter sequence is an AAV P5 promoter sequence derived from AAV serotype 2, 7, or 8. method.

14. 9. The method of claim 8, wherein the cell is a human embryonic kidney cell, a baby hamster kidney cell or an sf9 insect cell.

15. 15. The method of claim 14, wherein the cells are HEK293 human embryonic kidney cells.

16. The method of claim 14, wherein the cells are BHK21 baby hamster kidney cells.

17. 1. A method for increasing the production titer of a recombinant modified adeno-associated virus (rAAV) containing a transgene cassette, the method comprising culturing a cell transfected with: (1) the rAAV; (2) the recombinant modified adeno-associated virus (AAV) helper vector of claim 1; and (3) an additional vector comprising a non-AAV helper function-providing polynucleotide; wherein the culturing is in a medium under conditions sufficient to allow production of the rAAV, and the presence of the AAV P5 or P40 promoter sequences causes the cells to produce the rAAV at an increased production titer compared to that achieved when the AAV helper function-providing polynucleotide contains a P5 and P40 promoter derived from an AAV of the same serotype as the AAV serotype from which the AAV rep gene is derived.

18. The method of claim 17, wherein the transgene cassette is one that can be used in gene therapy.

19. 18. The method of claim 17, wherein the transgene cassette comprises a promoter, a polyadenylation site, or a combination thereof.

20. 18. The method of claim 17, wherein the transgene cassette encodes a protein or the transcribed nucleic acid comprises a transcribed nucleic acid, and the protein or the transcribed nucleic acid is therapeutic for a genetic or inherited disease or condition.

21. 20. The method of claim 17, (A) the AAV helper function-providing polynucleotide of the vector encodes AAV1 Cap proteins and the AAV P5 and / or P40 promoter sequence is a promoter sequence of AAV of serotype AAV3, AAV4, AAV5, AAV6, AAV7 or AAV8, or a hybrid of one or more of the said serotypes; (B) the AAV helper function-providing polynucleotide of the vector encodes AAV2 Cap proteins and the AAV P5 and / or P40 promoter sequence is a promoter sequence of AAV of serotype AAV1, AAV3, AAV4, AAV5, AAV6, AAV7, or AAV8, or a hybrid of one or more of the said serotypes; (C) the AAV helper function-providing polynucleotide of the vector encodes AAV3 Cap proteins and the AAV P5 and / or P40 promoter sequence is a promoter sequence of AAV of serotype AAV1, AAV4, AAV5, AAV6, AAV7, or AAV8, or a hybrid of one or more of the said serotypes; (D) the AAV helper function-providing polynucleotide of the vector encodes AAV4 Cap proteins and the AAV P5 and / or P40 promoter sequence is a promoter sequence of AAV of serotype AAV1, AAV3, AAV5, AAV6, AAV7, or AAV8, or a hybrid of one or more of the said serotypes; (E) the AAV helper function-providing polynucleotide of the vector encodes AAV5 Cap proteins and the AAV P5 and / or P40 promoter sequence is a promoter sequence of AAV of serotype AAV1, AAV3, AAV4, AAV6, AAV7, or AAV8, or a hybrid of one or more of the said serotypes; (F) the AAV helper function-providing polynucleotide of the vector encodes AAV6 Cap proteins and the AAV P5 and / or P40 promoter sequence is a promoter sequence of AAV of serotype AAV1, AAV3, AAV4, AAV5, AAV7, or AAV8, or a hybrid of one or more of the said serotypes; (G) the AAV helper function-providing polynucleotide of the vector encodes AAV7 Cap proteins and the AAV P5 and / or P40 promoter sequence is a promoter sequence of AAV of serotype AAV1, AAV3, AAV4, AAV5, AAV6 or AAV8, or a hybrid of one or more of the said serotypes; or (H) the AAV helper function-providing polynucleotide of the vector encodes AAV8 Cap proteins and the AAV P5 and / or P40 promoter sequence is a promoter sequence of AAV of serotype AAV1, AAV3, AAV4, AAV5, AAV6 or AAV7, or a hybrid of one or more of the said serotypes; method.

22. 20. The method of claim 17, comprising: (A) the AAV helper function-providing polynucleotide of the vector encodes an AAV1 Cap protein and the AAV P5 and / or P40 promoter sequence is an AAV P5 promoter sequence derived from AAV serotype 2, 7, or 8; (B) the AAV helper function-providing polynucleotide of the vector encodes an AAV2 Cap protein and the AAV P5 and / or P40 promoter sequence is an AAV P5 promoter sequence derived from AAV serotype 1, 3, 5, 7, or 8; (C) the AAV helper function-providing polynucleotide of the vector encodes an AAV2 Cap protein and the AAV P5 and / or P40 promoter sequence is an AAV P40 promoter sequence derived from AAV serotype 1 or 8; (D) the AAV helper function-providing polynucleotide of the vector encodes an AAV2 Cap protein, and the AAV P5 and / or P40 promoter sequence is an AAV P5 promoter sequence derived from AAV serotype 3 or 5 and an AAV P40 promoter sequence derived from AAV serotype 1; (E) the AAV helper function-providing polynucleotide of the vector encodes an AAV5 Cap protein and the AAV P5 and / or P40 promoter sequence is an AAV P5 promoter sequence derived from AAV serotype 7; (F) the AAV helper function-providing polynucleotide of the vector encodes AAV6 Cap protein and the AAV P5 and / or P40 promoter sequence is an AAV P5 promoter sequence derived from AAV serotype 1, 2, 3, 7, or 8; or (G) the AAV helper function-providing polynucleotide of the vector encodes an AAV7 Cap protein, and the AAV P5 and / or P40 promoter sequence is an AAV P5 promoter sequence derived from AAV serotype 2, 7, or 8. method.

23. 18. The method of claim 17, wherein the cell is a human embryonic kidney cell, a baby hamster kidney cell or an sf9 insect cell.

24. 24. The method of claim 23, wherein the cells are HEK293 human embryonic kidney cells.

25. The method of claim 23, wherein the cells are BHK21 baby hamster kidney cells.

26. 10. A pharmaceutical composition comprising a recombinant modified adeno-associated virus (rAAV) produced by the method of claim 8 and a pharma- ceutically acceptable carrier.

27. 20. A pharmaceutical composition comprising a recombinant modified adeno-associated virus (rAAV) produced by the method of claim 17 and a pharma- ceutically acceptable carrier.

Images