DUX4 RNA silencing using RNA-targeting crispr-CAS13b

Abstract

To provide DUX4 RNA silencing using RNA-targeting CRISPR-CAS13B.SOLUTION: RNA interference-based products and methods for inhibiting the expression of the double homeobox 4 (DUX4) gene on human chromosome 4q35 are disclosed. The disclosure includes the Cas13 protein silencing of an RNA, where Cas13 is specifically targeted to a DUX4 region of interest using a sequence-specific guide RNA (gRNA). Recombinant adeno-associated viruses of the disclosure deliver DNAs encoding inhibitory gRNAs that are constructed with Cas13 direct repeats to knock down the expression of DUX4. The methods have application to the treatment of muscular dystrophies including, but not limited to, facioscapulohumeral muscular dystrophy (FSHD), and other disorders associated with elevated DUX4 expression, including cancer.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present disclosure relates to CRISPR / Cas13 products and methods for silencing or inhibiting the expression of the double homeobox 4 (DUX4) gene on human chromosome 4q35. The present disclosure provides a recombinant gene editing complex comprising a recombinant gene editing protein, i.e., Cas13, and a nucleic acid encoding a guide RNA (gRNA) that specifically hybridizes to a target nucleic acid sequence encoding a region of the DUX4 gene, where the complex binds to the target nucleic acid sequence, thereby inhibiting DUX4 gene expression. The recombinant adeno-associated virus of the present disclosure delivers DNA encoding a gRNA that knocks down the expression of DUX4. The method is applied to the treatment of muscular dystrophies, including but not limited to facioscapulohumeral muscular dystrophy (FSHD), and other disorders for which DUX4 inhibition is indicated, such as cancer.

[0002] Incorporation by reference of sequence listing This application contains, as a separate part of the disclosure, a sequence listing in computer readable form (Filename: 53307A_Seqlisting.txt, 34,420 bytes, ASCII text file, created on December 30, 2019), which is incorporated by reference in its entirety. [Background technology]

[0003] Muscular dystrophies (MD) are a group of genetic disorders characterized by progressive weakening and degeneration of the skeletal muscles that control movement. Some forms of MD have an onset in infancy or childhood, whereas others may not appear until middle age or later. The disorders differ in the distribution and degree of muscle weakness (some forms of MD also affect the heart muscle), age at onset, rate of progression, and mode of inheritance.

[0004] Facioscapulohumeral muscular dystrophy (FSHD) is an inherited degenerative muscle disease characterized by slowly progressive weakness, with the facial, scapular, and upper arm muscles most affected. Initially named Landouzy-Dejerine, FSHD is a genetic muscular dystrophy (MD) that is usually autosomal dominant and initially affects the skeletal muscles of the face (facio), scapula (scapula or shoulder blade), and upper arm (humerus). FSHD is the third most common genetic disorder of skeletal muscles, present in approximately 4–12 per 100,000 of the population. Historically, FSHD was classified as the third most common MD, affecting 1 in 20,000 people worldwide. However, recent data indicate that FSHD is the most common MD in Europe, suggesting that its global incidence may be underestimated.

[0005] Symptoms may develop during early childhood and usually become noticeable in the teenage years, with 95% of affected individuals having disease by age 20. Progressive skeletal muscle weakness usually affects other areas of the body as well and is often asymmetric. Life expectancy may be threatened by respiratory failure, and up to 20% of affected individuals become severely disabled, requiring the use of a wheelchair or powered cart. Currently, there are no curative treatments available for this severe disability, leaving patients with only symptom management options.

[0006] There are two clinically indistinguishable forms of FSHD, termed FSHD1 and FSHD2. The majority of cases (approximately 95%) are classified as FSHD1, while the remainder are classified as FSHD2 or show typical FSHD symptoms but have not yet been genetically characterized. Briefly, both FSHD forms are caused by derepression of the toxic DUX4 gene. The DUX4 open reading frame is encoded within D4Z4 repeats located in the human chromosome 4q subtelomere. Humans may have different copy numbers of D4Z4 repeats on both 4q alleles. D4Z4 arrays with a number greater than 10 are typically embedded in heterochromatin, resulting in repression of the DUX4 gene located in each repeat.

[0007] FSHD1 is caused by a congenital reduction in the number of D4Z4 repeats (1–10 D4Z4 copies) in one allele, which disrupts the epigenetic silencing of this region. FSHD2 results from mutations in chromatin-modifying genes (SMCHD1, DNMT3B), which also lead to epigenetic derepression of the D4Z4 repeats. In both cases, the DUX4 gene can be transcribed into DUX4 mRNA. However, reduced epigenetic silencing of DUX4 is not sufficient to cause FSHD, as individual repeats lack a polyA signal to stabilize the DUX4 transcript. To cause FSHD, inheritance of a specific chromosomal background called 4qA, which contains a pLAM region located adjacent to the last repeat, is required. The pLAM region contributes a polyA signal to the last DUX4 copy. Therefore, when DUX4 transcription occurs in 4qA haplotype, the full-length DUX4 transcript located closest to telomere is stabilized and translated into DUX4 protein that is toxic to muscle.There remains a need in the art for such muscular dystrophies, including FSHD, and for the products and methods of treatment.Similarly, since DUX4 is involved in various cancers, there remains a need in the art for the treatment of cancers associated with the expression of DUX4, whereby the inhibition of DUX4 is therapeutic. Summary of the Invention

[0008] Provided herein are products and methods for treating muscular dystrophies adversely affected by expression or overexpression of double homeobox 4 (DUX4). In some embodiments, the muscular dystrophies are FSHD.

[0009] The present disclosure provides nucleic acids, compositions, and viral vectors, including nucleic acids designed to inhibit expression of DUX4 with the assistance of Cas13, methods for using these products to inhibit and / or interfere with expression of the DUX4 gene in cells, methods for treating subjects suffering from muscular dystrophy, as well as recombinant gene editing complexes comprising at least one nucleic acid comprising a nucleotide sequence encoding Cas13 or a Cas13 ortholog or variant; and at least one nucleic acid comprising a nucleotide sequence encoding a guide RNA (gRNA) that specifically hybridizes to a target nucleic acid sequence encoding DUX4 and Cas13b directed repeats, wherein binding of the complex to the target nucleic acid sequence inhibits DUX4 gene expression.

[0010] In some aspects, the present disclosure provides a nucleic acid encoding a DUX4-encoding gRNA comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 3-13 and 51-54.

[0011] In some aspects, the disclosure provides a nucleic acid encoding a DUX4-encoding guide RNA (gRNA) that specifically hybridizes to a target nucleic acid encoding DUX4 comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 14-24 and 55-58.

[0012] In some embodiments, the nucleic acid further comprises a Cas13b directional repeat sequence. In some embodiments, the Cas13b directional repeat sequence is located downstream or at the 3' end of the nucleic acid encoding the DUX4-encoded gRNA. In some embodiments, the Cas13b directional repeat sequence comprises the nucleotide sequence set forth in SEQ ID NO:37, or a variant thereof having at least about 90% identity with the nucleotide sequence set forth in SEQ ID NO:37.

[0013] In some aspects, the disclosure provides a nucleic acid comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 25-35 and 59-62, or a variant thereof having at least about 90% identity to the nucleotide sequence set forth in any one of SEQ ID NOs: 25-35 and 59-62.

[0014] In some embodiments, the nucleic acid of the present disclosure further comprises a promoter sequence. In some embodiments, the promoter is any of U6, U7, tRNA, H1, minimal CMV, T7, EF1-alpha, minimal EF1-alpha, or skeletal muscle specific promoter. In some embodiments, the muscle specific promoter is unc45b, tMCK, minimal MCK, CK6, CK7, MHCK7, or CK1.

[0015] In some aspects, the disclosure provides a nucleic acid comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 38-48 and 63-66, or a variant thereof having at least about 90% identity to the nucleotide sequence set forth in any one of SEQ ID NOs: 38-48 and 63-66.

[0016] In some embodiments, the present disclosure provides an adeno-associated virus (AAV) that comprises any one or more nucleic acids provided in the present disclosure. In some embodiments, the AAV comprises multiple copies of the same nucleic acid. For example, in some embodiments, the AAV comprises multiple copies of the same gRNA. In some embodiments, the AAV comprises multiple copies of different nucleic acids. For example, in some embodiments, the AAV comprises multiple copies of a combination of gRNAs. In some embodiments, the virus comprises rep and cap genes. In some embodiments, the virus is deficient in rep and cap genes. In some embodiments, the adeno-associated virus is a recombinant AAV (rAAV). In some embodiments, the adeno-associated virus is a self-complementary recombinant AAV (scAAV). In some embodiments, the AAV is AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV-anc80, or AAV rh.74. In some embodiments, the AAV is AAV-9.

[0017] The present disclosure also provides any one or more of the nucleic acids of the present disclosure and any one or more of the AAVs of the present disclosure in a composition.In some embodiments, the composition also comprises a diluent, excipient, and / or acceptable carrier.In some embodiments, the carrier is a pharmaceutically acceptable carrier or a physiologically acceptable carrier.

[0018] In some embodiments, the present disclosure provides a method of inhibiting and / or disrupting expression of a DUX4 gene in a cell, comprising contacting the cell with a composition comprising an adeno-associated virus or an adeno-associated virus comprising any of a nucleic acid comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 3-13 and 51-54, 25-35 and 59-62, and 38-48 and 63-66, and / or a nucleic acid encoding a DUX4-encoding gRNA that specifically hybridizes to a target nucleic acid encoding DUX4 comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 14-24 and 55-58, and a nucleic acid encoding a Cas13 protein or a Cas13 ortholog or variant thereof. In some embodiments, the Cas13 protein is Cas13b or a Cas13b ortholog or variant thereof. In some embodiments, the Cas13b protein is encoded by a nucleotide sequence set forth in SEQ ID NO: 36, or a variant thereof having at least about 80% identity to the sequence set forth in SEQ ID NO: 36. In some embodiments, the method further comprises contacting the cell with an adeno-associated virus comprising a nucleic acid encoding a DUX4 inhibitory RNA. In some embodiments, the expression of the nucleic acid encoding a DUX4 inhibitory RNA is under the control of a U6 promoter, a U7 promoter, a T7 promoter, a tRNA promoter, an H1 promoter, a minimal EF1-alpha promoter, a miniCMV promoter, a CMV promoter, a muscle creatine kinase (MCK) promoter, an alpha-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), or a desmin promoter.

[0019] In some embodiments, the present disclosure provides a method of treating a subject suffering from muscular dystrophy, comprising administering to the subject an effective amount of an adeno-associated virus or a composition comprising an adeno-associated virus comprising any of a nucleic acid comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 3-13 and 51-54, 25-35 and 59-62, and 38-48 and 63-66, and / or a nucleic acid encoding a DUX4-encoding gRNA that specifically hybridizes to a target nucleic acid encoding DUX4 comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 14-24 and 55-58, and a nucleic acid encoding a Cas13 protein or a Cas13 ortholog or variant thereof. In some embodiments, the Cas13 protein is Cas13b or a Cas13b ortholog or variant thereof. In some embodiments, the Cas13b protein is encoded by a nucleotide sequence set forth in SEQ ID NO: 36, or a variant thereof having at least about 80% identity to the sequence set forth in SEQ ID NO: 36. In some embodiments, the method further comprises contacting the cell with an adeno-associated virus comprising a nucleic acid encoding DUX4 inhibitory RNA.In some embodiments, the expression of the nucleic acid encoding DUX4 inhibitory RNA is under the control of U6 promoter, U7 promoter, T7 promoter, tRNA promoter, H1 promoter, minimal EF1-alpha promoter, miniCMV promoter, CMV promoter, muscle creatine kinase (MCK) promoter, alpha-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7) or desmin promoter.In various embodiments, the muscular dystrophy is FSHD.

[0020] In some aspects, the disclosure provides a method of treating muscular dystrophy in a subject in need of treatment, comprising administering to the subject an effective amount of an adeno-associated virus, wherein the genome of the adeno-associated virus encodes at least one nucleic acid encoding a double homeobox 4 (DUX4)-encoding guide RNA (gRNA) comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 3-13 and 51-54, and (b) a DUX4-encoding guide RNA (gRNA) that specifically hybridizes to a target nucleic acid encoding DUX4 comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 14-24 and 55-58. (d) at least one nucleic acid comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 25-35 and 59-62, or a variant thereof having at least about 90% identity to the nucleotide sequence set forth in any one of SEQ ID NOs: 25-35 and 59-62, (e) at least one nucleic acid comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 38-48 and 63-66, or a variant thereof having at least about 90% identity to the nucleotide sequence set forth in any one of SEQ ID NOs: 38-48 and 63-66, or (f) any combination of (a)-(d) thereof. In some embodiments, the method further comprises administering to the subject an effective amount of an adeno-associated virus comprising a nucleic acid encoding a Cas13 protein, or a Cas13 ortholog or variant. In some embodiments, the Cas13 protein is Cas13b or a Cas13b ortholog or variant thereof. In some embodiments, the Cas13b protein is encoded by a nucleotide sequence set forth in SEQ ID NO: 36, or a variant thereof having at least about 80% identity to the sequence set forth in SEQ ID NO: 36. In some embodiments, the method further comprises contacting the cell with an adeno-associated virus comprising a nucleic acid encoding a DUX4 inhibitory RNA.In some embodiments, expression of the nucleic acid encoding the DUX4 inhibitory RNA is under the control of a U6 promoter, a U7 promoter, a T7 promoter, a tRNA promoter, an H1 promoter, a minimal EF1-alpha promoter, a miniCMV promoter, a CMV promoter, a muscle creatine kinase (MCK) promoter, an alpha-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), or a desmin promoter. In various embodiments, the muscular dystrophy is FSHD.

[0021] In some embodiments, the present disclosure provides a method of treating a subject suffering from a cancer associated with expression of DUX4 or elevated expression levels of DUX4, comprising administering to the subject an effective amount of an adeno-associated virus or a composition comprising an adeno-associated virus comprising any of a nucleic acid comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 3-13 and 51-54, 25-35 and 59-62, and 38-48 and 63-66, and / or a nucleic acid encoding a DUX4-encoding gRNA that specifically hybridizes to a target nucleic acid encoding DUX4 comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 14-24 and 55-58, and a nucleic acid encoding a Cas13 protein or a Cas13 ortholog or variant thereof. In some embodiments, the Cas13 protein is Cas13b or a Cas13b ortholog or variant thereof. In some embodiments, the Cas13b protein is encoded by a nucleotide sequence set forth in SEQ ID NO: 36, or a variant thereof having at least about 80% identity to the sequence set forth in SEQ ID NO: 36. In some embodiments, the method further comprises contacting the cell with an adeno-associated virus comprising the nucleic acid encoding DUX4 inhibitory RNA.In some embodiments, the expression of the nucleic acid encoding DUX4 inhibitory RNA is under the control of U6 promoter, U7 promoter, T7 promoter, tRNA promoter, H1 promoter, minimal EF1-alpha promoter, miniCMV promoter, CMV promoter, muscle creatine kinase (MCK) promoter, alpha-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7) or desmin promoter.In some embodiments, the cancer is DUX4+ cancer.In various embodiments, the cancer is bladder cancer, breast cancer, cervical cancer, endometrial cancer, esophageal cancer, lung cancer, kidney cancer, ovarian cancer, rhabdoid cancer (or rhabdoid sarcoma), sarcoma, gastric cancer, testicular cancer, thymoma, melanoma or metastatic melanoma.

[0022] In some aspects, the disclosure provides a method of treating a cancer associated with expression of DUX4 or elevated expression levels of DUX4 in a subject in need of such treatment, comprising administering to the subject an effective amount of an adeno-associated virus, the genome of the adeno-associated virus comprising at least one nucleic acid encoding a double homeobox 4 (DUX4)-encoded guide RNA (gRNA) comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 3-13 and 51-54, (b) a DUX4-encoded guide RNA (gRNA) that specifically hybridizes to a target nucleic acid encoding DUX4 comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 14-24 and 55-58. The method further comprises administering to the subject an effective amount of an adeno-associated virus comprising a nucleic acid encoding a Cas13 protein, or a Cas13 ortholog or variant thereof. In some embodiments, the Cas13 protein is Cas13b or a Cas13b ortholog or variant thereof. In some embodiments, the Cas13 protein is Cas13b or a Cas13b ortholog or variant thereof. In some embodiments, the Cas13b protein is encoded by a nucleotide sequence set forth in SEQ ID NO: 36, or a variant thereof having at least about 80% identity to the sequence set forth in SEQ ID NO: 36. In some embodiments, the method further comprises contacting the cell with an adeno-associated virus comprising a nucleic acid encoding a DUX4 inhibitory RNA.In some embodiments, the expression of the nucleic acid encoding DUX4 inhibitory RNA is under the control of U6 promoter, U7 promoter, T7 promoter, tRNA promoter, H1 promoter, minimal EF1-alpha promoter, miniCMV promoter, CMV promoter, muscle creatine kinase (MCK) promoter, alpha-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7) or desmin promoter.In some embodiments, cancer is DUX4+ cancer.In various embodiments, cancer is bladder cancer, breast cancer, cervical cancer, endometrial cancer, esophageal cancer, lung cancer, kidney cancer, ovarian cancer, rhabdoid cancer (or rhabdoid sarcoma), sarcoma, gastric cancer, testicular cancer, thymoma, melanoma or metastatic melanoma.

[0023] In some embodiments, the disclosure provides a recombinant gene editing complex comprising at least one nucleic acid comprising a nucleotide sequence encoding Cas13 or a Cas13 ortholog or variant, and at least one nucleic acid comprising a nucleotide sequence encoding a gRNA that specifically hybridizes to a target nucleic acid sequence encoding DUX4 and Cas13b directed repeats, wherein binding of the complex to the target nucleic acid sequence inhibits DUX4 gene expression. In some embodiments, the nucleic acid comprises at least one nucleic acid encoding a double homeobox 4 DUX4-encoded gRNA comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 3-13 and 51-54, (b) at least one nucleic acid encoding a DUX4-encoded gRNA that specifically hybridizes to a target nucleic acid encoding DUX4 comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 14-24 and 55-58, (c) a nucleotide sequence set forth in any one of SEQ ID NOs: 25-35 and 59-62, or a nucleotide sequence set forth in any one of SEQ ID NOs: 25-35 and 59-62. and 59-62, or a variant thereof having at least about 90% identity to the nucleotide sequence set forth in any one of SEQ ID NOs: 38-48 and 63-66, or a variant thereof having at least about 90% identity to the nucleotide sequence set forth in any one of SEQ ID NOs: 38-48 and 63-66, or (e) a nucleotide sequence encoding a gRNA and a Cas13b directed repeat, comprising any combination of (a)-(d) thereof. In some embodiments, the recombinant gene editing complex further comprises an adeno-associated virus comprising a nucleic acid encoding a Cas13 protein, or a Cas13 ortholog or variant. In some embodiments, the Cas13 protein is Cas13b or a Cas13b ortholog or variant thereof. In some embodiments, the Cas13b protein is encoded by a nucleotide sequence set forth in SEQ ID NO: 36, or a variant thereof having at least about 80% identity to the sequence set forth in SEQ ID NO: 36.In some embodiments, the recombinant gene editing complex further comprises an adeno-associated virus comprising a nucleic acid encoding a DUX4 inhibitory RNA. In some embodiments, the expression of the nucleic acid encoding a DUX4 inhibitory RNA is under the control of a U6 promoter, a U7 promoter, a T7 promoter, a tRNA promoter, an H1 promoter, a minimal EF1-alpha promoter, a miniCMV promoter, a CMV promoter, a muscle creatine kinase (MCK) promoter, an alpha-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), or a desmin promoter. In various embodiments, the recombinant gene editing complex is used in the treatment of muscular dystrophy or in the manufacture of a medicament for the treatment of muscular dystrophy. In some embodiments, the recombinant gene editing complex is used in the treatment of FSHD or in the manufacture of a medicament for the treatment of FSHD.

[0024] In some embodiments, the present disclosure provides the use of the nucleic acid and recombinant gene editing complex described herein for reducing DUX4 expression and / or DUX4 overexpression in cells and / or for the manufacture of a medicament for the treatment of muscular dystrophy. In some embodiments, the muscular dystrophy is FSHD.

[0025] Other features and advantages of the present disclosure will become apparent from the following detailed description. It should be understood, however, that the detailed description and specific examples, while indicating preferred embodiments of the present disclosure, are given by way of illustration only, since various changes and modifications within the spirit and scope of the disclosure will become apparent to those skilled in the art from this detailed description. In certain embodiments, for example, the following are provided: (Item 1) A nucleic acid encoding a double homeobox 4 (DUX4)-encoding guide RNA (gRNA) comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 3 to 13 and 51 to 54. (Item 2) A nucleic acid encoding a double homeobox 4 (DUX4)-encoding guide RNA (gRNA) that specifically hybridizes to a target nucleic acid encoding DUX4 comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 14 to 24 and 55 to 58. (Item 3) 3. The nucleic acid of item 1 or 2, further comprising a Cas13b direct repeat sequence. (Item 4) 4. The nucleic acid of item 3, wherein the Cas13b direct repeat is located downstream or at the 3' end of the nucleic acid encoding the DUX4-encoding gRNA. (Item 5) 5. The nucleic acid of item 3 or 4, wherein the Cas13b direct repeat sequence comprises a nucleotide sequence set forth in SEQ ID NO: 37, or a variant thereof having at least about 90% identity to the nucleotide sequence set forth in SEQ ID NO: 37. (Item 6) 6. The nucleic acid according to item 5, comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 25 to 35 and 59 to 62, or a variant thereof having at least about 90% identity to the nucleotide sequence set forth in any one of SEQ ID NOs: 25 to 35 and 59 to 62. (Item 7) 7. The nucleic acid according to any one of items 1 to 6, further comprising a promoter sequence. (Item 8) 8. The nucleic acid of item 7, wherein the promoter is any of a U6, U7, tRNA, H1, minimal CMV, T7, EF1-alpha, minimal EF1-alpha, or skeletal muscle specific promoter. (Item 9) 9. The nucleic acid of item 8, wherein the muscle-specific promoter is unc45b, tMCK, minimal MCK, CK6, CK7, MHCK7, or CK1. (Item 10) 9. The nucleic acid according to item 8, comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 38 to 48 and 63 to 66, or a variant thereof having at least about 90% identity to the nucleotide sequence set forth in any one of SEQ ID NOs: 38 to 48 and 63 to 66. (Item 11) 11. An adeno-associated virus comprising the nucleic acid according to any one of items 1 to 10. (Item 12) 12. The adeno-associated virus of item 11, wherein the virus is defective in the rep and cap genes. (Item 13) 13. The adeno-associated virus of item 11 or 12, wherein the virus is a recombinant AAV (rAAV) or a self-complementary recombinant AAV (scAAV). (Item 14) 14. The adeno-associated virus of any one of items 11 to 13, wherein the virus is AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV-anc80, or AAV rh.74. (Item 15) 15. The adeno-associated virus according to any one of items 11 to 14, wherein the virus is AAV-9. (Item 16) A composition comprising the adeno-associated virus according to any one of items 11 to 15 and a pharma- ceutically acceptable carrier. (Item 17) 1. A method for inhibiting and / or disrupting expression of the double homeobox 4 (DUX4) gene in a cell, comprising: (a) the adeno-associated virus according to any one of items 11 to 15 or the composition according to item 16, and (b) contacting the adeno-associated virus with a nucleic acid encoding a Cas13 protein, or a Cas13 ortholog or variant thereof. (Item 18) 19. The method of claim 18, wherein the Cas13 protein is Cas13b or a Cas13b ortholog or variant thereof. (Item 19) 20. The method of claim 19, wherein the Cas13b protein is encoded by a nucleotide sequence set forth in SEQ ID NO: 36, or a variant having at least about 80% identity to the sequence set forth in SEQ ID NO: 36. (Item 20) 20. The method of any one of items 17 to 19, further comprising contacting the cell with an adeno-associated virus comprising a nucleic acid encoding a DUX4 inhibitory RNA. (Item 21) 21. The method of claim 20, wherein the expression of the nucleic acid encoding the DUX4 inhibitory RNA is under the control of a U6 promoter, a U7 promoter, a T7 promoter, a tRNA promoter, an H1 promoter, a minimal EF1-alpha promoter, a miniCMV promoter, a CMV promoter, a muscle creatine kinase (MCK) promoter, an alpha-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), or a desmin promoter. (Item 22) A method of treating a subject suffering from muscular dystrophy, comprising administering to the subject an effective amount of (a) the adeno-associated virus according to any one of items 11 to 15 or the composition according to item 16, and (b) administering an adeno-associated virus comprising a nucleic acid encoding a Cas13 protein, or a Cas13 ortholog or variant. (Item 23) 23. The method of claim 22, wherein the Cas13 protein is Cas13b or a Cas13b ortholog or variant thereof. (Item 24) 24. The method of claim 23, wherein the Cas13b protein is encoded by a nucleotide sequence set forth in SEQ ID NO: 36 or a variant having at least about 80% identity to the sequence set forth in SEQ ID NO: 36. (Item 25) 25. The method of any one of items 22 to 24, further comprising contacting the cell with an adeno-associated virus comprising a nucleic acid encoding a DUX4 inhibitory RNA. (Item 26) 26. The method of claim 25, wherein the expression of the nucleic acid encoding the DUX4 inhibitory RNA is under the control of a U6 promoter, a U7 promoter, a T7 promoter, a tRNA promoter, an H1 promoter, a minimal EF1-alpha promoter, a miniCMV promoter, a CMV promoter, a muscle creatine kinase (MCK) promoter, an alpha-myosin heavy chain enhancer- / MCK enhancer-promoter (MHCK7), or a desmin promoter. (Item 27) 1. A method of treating muscular dystrophy in a subject in need thereof, comprising administering to the subject an effective amount of an adeno-associated virus, the genome of which comprises: (a) at least one nucleic acid encoding a double homeobox 4 (DUX4)-encoding guide RNA (gRNA) comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 3-13 and 51-54; (b) at least one nucleic acid encoding a DUX4-encoding guide RNA (gRNA) that specifically hybridizes to a target nucleic acid encoding DUX4 comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 14-24 and 55-58; (c) at least one nucleic acid comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 25 to 35 and 59 to 62, or a variant thereof having at least about 90% identity to the nucleotide sequence set forth in any one of SEQ ID NOs: 25 to 35 and 59 to 62; (d) at least one nucleic acid comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 38-48 and 63-66, or a variant thereof having at least about 90% identity to the nucleotide sequence set forth in any one of SEQ ID NOs: 38-48 and 63-66; or (e) A method comprising any combination of (a) to (d). (Item 28) 28. The method of claim 27, further comprising administering to the subject an effective amount of an adeno-associated virus comprising a nucleic acid encoding a Cas13 protein or a Cas13 ortholog or variant. (Item 29) 29. The method of claim 28, wherein the Cas13 protein is Cas13b or a Cas13b ortholog or variant thereof. (Item 30) 30. The method of claim 28 or 29, wherein the Cas13b protein is encoded by a nucleotide sequence set forth in SEQ ID NO: 36, or a variant having at least about 80% identity to the sequence set forth in SEQ ID NO: 36. (Item 31) 31. The method according to any one of items 27 to 30, further comprising administering to the subject an effective amount of an adeno-associated virus comprising a nucleic acid encoding a DUX4 inhibitory RNA. (Item 32) 32. The method according to any one of items 22 to 31, wherein the muscular dystrophy is facioscapulohumeral muscular dystrophy (FSHD). (Item 33) A recombinant gene editing complex, comprising: (a) at least one nucleic acid comprising a nucleotide sequence encoding Cas13 or a Cas13 ortholog or variant; and (b) at least one nucleic acid comprising a target nucleic acid sequence encoding double homeobox 4 (DUX4) and a nucleotide sequence encoding a guide RNA (gRNA) that specifically hybridizes to a Cas13b direct repeat sequence; A recombinant gene editing complex, wherein the complex binds to the target nucleic acid sequence, thereby inhibiting DUX4 gene expression. (Item 34) the nucleic acid comprising the nucleotide sequence encoding the gRNA and the Cas13b direct repeat sequence, (a) at least one nucleic acid encoding a double homeobox 4 (DUX4)-encoding guide RNA (gRNA) comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 3-13 and 51-54; (b) at least one nucleic acid encoding a DUX4-encoding guide RNA (gRNA) that specifically hybridizes to a target nucleic acid encoding DUX4 comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 14-24 and 55-58; (c) at least one nucleic acid comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 25 to 35 and 59 to 62, or a variant thereof having at least about 90% identity to the nucleotide sequence set forth in any one of SEQ ID NOs: 25 to 35 and 59 to 62; (d) at least one nucleic acid comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 38-48 and 63-66, or a variant thereof having at least about 90% identity to the nucleotide sequence set forth in any one of SEQ ID NOs: 38-48 and 63-66; or (e) any combination of (a) to (d) thereof. The recombinant gene editing complex of Item 33. (Item 35) 35. The recombinant gene editing complex of claim 33 or 34, wherein the Cas13 protein is Cas13b or a Cas13b ortholog or variant thereof. (Item 36) 36. The recombinant gene editing complex of claim 35, wherein the Cas13b protein is encoded by a nucleotide sequence set forth in SEQ ID NO: 36, or a variant having at least about 80% identity to the sequence set forth in SEQ ID NO: 36. (Item 37) 37. The recombinant gene editing complex of any one of items 33 to 36, further comprising a nucleic acid encoding a DUX4 inhibitory RNA. (Item 38) 1. A method of treating cancer in a subject in need thereof, comprising administering to the subject an effective amount of an adeno-associated virus, the genome of which comprises: (a) at least one nucleic acid encoding a double homeobox 4 (DUX4)-encoding guide RNA (gRNA) comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 3-13 and 51-54; (b) at least one nucleic acid encoding a DUX4-encoding guide RNA (gRNA) that specifically hybridizes to a target nucleic acid encoding DUX4 comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 14-24 and 55-58; (c) at least one nucleic acid comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 25 to 35 and 59 to 62, or a variant thereof having at least about 90% identity to the nucleotide sequence set forth in any one of SEQ ID NOs: 25 to 35 and 59 to 62; (d) at least one nucleic acid comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 38-48 and 63-66, or a variant thereof having at least about 90% identity to the nucleotide sequence set forth in any one of SEQ ID NOs: 38-48 and 63-66; or (e) A method comprising any combination of (a) to (d). (Item 39) 39. The method of claim 38, further comprising administering to the subject an effective amount of an adeno-associated virus comprising a nucleic acid encoding a Cas13 protein or a Cas13 ortholog or variant. (Item 40) 40. The method of claim 39, wherein the Cas13 protein is Cas13b or a Cas13b ortholog or variant thereof. (Item 41) 41. The method of claim 39 or 40, wherein the Cas13b protein is encoded by a nucleotide sequence set forth in SEQ ID NO: 36 or a variant having at least about 80% identity to the sequence set forth in SEQ ID NO: 36. (Item 42) 42. The method of any one of items 38 to 41, further comprising administering to the subject an effective amount of an adeno-associated virus comprising a nucleic acid encoding a DUX4 inhibitory RNA. (Item 43) 43. The method according to any one of items 38 to 42, wherein the cancer is bladder cancer, breast cancer, cervical cancer, endometrial cancer, esophageal cancer, lung cancer, kidney cancer, ovarian cancer, rhabdoid cancer (or rhabdoid sarcoma), sarcoma, gastric cancer, testicular cancer, thymoma, melanoma, or metastatic melanoma. [Brief description of the drawings]

[0026] [Figure 1A] Figure 1A-B show the targeting site of each Cas13b gRNA on DUX4 mRNA. Grey boxes indicate DUX4 exon 1, exon 2, and exon 3. Intron 1, exon 2, intron 2, and exon 3 serve as the 3'UTR of DUX4. DUX4-targeting miRNA reads are indicated by arrows. gRNAs with matching miRNA positions are indicated by lines. Guide RNAs 1-11 are shown in Figure 1A. Guide RNAs 1-11 and 13-16 are shown in Figure 1B. [Figure 1B] Figure 1A-B show the targeting site of each Cas13b gRNA on DUX4 mRNA. Grey boxes indicate DUX4 exon 1, exon 2, and exon 3. Intron 1, exon 2, intron 2, and exon 3 serve as the 3'UTR of DUX4. DUX4-targeting miRNA reads are indicated by arrows. gRNAs with matching miRNA positions are indicated by lines. Guide RNAs 1-11 are shown in Figure 1A. Guide RNAs 1-11 and 13-16 are shown in Figure 1B. [Figure 2A]Figure 2A-D show the results of screening CRISPR-Cas13b gRNA sequences designed to silence the DUX4 gene in HEK293 cells. Figure 2A shows the results of a Western blot test of the ability of each gRNA (gRNA1-12 described herein) to efficiently silence the DUX4 gene at the protein level. Alpha-tubulin served as a loading control. Figure 2B shows a caspase-3 / 7 cell death assay 48 hours after transfection. DUX4 triggered cell death, and cells expressing only DUX4 had elevated caspase-3 / 7 activity, indicating that the cells were undergoing apoptosis. In contrast, all DUX4-transfected cells that received Cas13b together with an effective guide RNA (gRNA1-12) were protected from cell death as indicated by baseline levels of caspase-3 / 7 activity. Figure 2C shows the results of a cell viability assay, confirming the data in Figure 2B. There were significantly more viable cells in DUX4-transfected samples treated with Cas13b and gRNA compared to samples that received DUX4 alone. Figure 2D shows the results of a control experiment using Western blot, demonstrating that Cas13b itself does not reduce DUX4 protein expression without guide RNA. [Figure 2B]Figure 2A-D show the results of screening CRISPR-Cas13b gRNA sequences designed to silence the DUX4 gene in HEK293 cells. Figure 2A shows the results of a Western blot test of the ability of each gRNA (gRNA1-12 described herein) to efficiently silence the DUX4 gene at the protein level. Alpha-tubulin served as a loading control. Figure 2B shows a caspase-3 / 7 cell death assay 48 hours after transfection. DUX4 triggered cell death, and cells expressing only DUX4 had elevated caspase-3 / 7 activity, indicating that the cells were undergoing apoptosis. In contrast, all DUX4-transfected cells that received Cas13b together with an effective guide RNA (gRNA1-12) were protected from cell death as indicated by baseline levels of caspase-3 / 7 activity. Figure 2C shows the results of a cell viability assay, confirming the data in Figure 2B. There were significantly more viable cells in DUX4-transfected samples treated with Cas13b and gRNA compared to samples that received DUX4 alone. Figure 2D shows the results of a control experiment using Western blot, demonstrating that Cas13b itself does not reduce DUX4 protein expression without guide RNA. [Figure 2C]Figure 2A-D show the results of screening CRISPR-Cas13b gRNA sequences designed to silence the DUX4 gene in HEK293 cells. Figure 2A shows the results of a Western blot test of the ability of each gRNA (gRNA1-12 described herein) to efficiently silence the DUX4 gene at the protein level. Alpha-tubulin served as a loading control. Figure 2B shows a caspase-3 / 7 cell death assay 48 hours after transfection. DUX4 triggered cell death, and cells expressing only DUX4 had elevated caspase-3 / 7 activity, indicating that the cells were undergoing apoptosis. In contrast, all DUX4-transfected cells that received Cas13b together with an effective guide RNA (gRNA1-12) were protected from cell death as indicated by baseline levels of caspase-3 / 7 activity. Figure 2C shows the results of a cell viability assay, confirming the data in Figure 2B. There were significantly more viable cells in DUX4-transfected samples treated with Cas13b and gRNA compared to samples that received DUX4 alone. Figure 2D shows the results of a control experiment using Western blot, demonstrating that Cas13b itself does not reduce DUX4 protein expression without guide RNA. [Figure 2D]Figure 2A-D show the results of screening CRISPR-Cas13b gRNA sequences designed to silence the DUX4 gene in HEK293 cells. Figure 2A shows the results of a Western blot test of the ability of each gRNA (gRNA1-12 described herein) to efficiently silence the DUX4 gene at the protein level. Alpha-tubulin served as a loading control. Figure 2B shows a caspase-3 / 7 cell death assay 48 hours after transfection. DUX4 triggered cell death, and cells expressing only DUX4 had elevated caspase-3 / 7 activity, indicating that the cells were undergoing apoptosis. In contrast, all DUX4-transfected cells that received Cas13b together with an effective guide RNA (gRNA1-12) were protected from cell death as indicated by baseline levels of caspase-3 / 7 activity. Figure 2C shows the results of a cell viability assay, confirming the data in Figure 2B. There were significantly more viable cells in DUX4-transfected samples treated with Cas13b and gRNA compared to samples that received DUX4 alone. Figure 2D shows the results of a control experiment using Western blot, demonstrating that Cas13b itself does not reduce DUX4 protein expression without guide RNA. [Figure 3A] Figures 3A-E show RNAscope images of treated and untreated myotubes. Figure 3A shows untreated FSHD myotubes. Figure 3B shows untreated healthy myotubes. Figure 3C shows Cas13b transfected FSHD myotubes. Figure 3D shows FSHD myotubes treated with Cas13b+gRNA3. Figure 3E shows FSHD myotubes treated with Cas13b+gRNA9. DUX4 mRNA foci are detected as dark punctate spots indicated by arrows. DUX4 RNA foci were reduced in CRISPR-Cas13b gRNA treated samples (Figures 3D and 3E). [Figure 3B]Figures 3A-E show RNAscope images of treated and untreated myotubes. Figure 3A shows untreated FSHD myotubes. Figure 3B shows untreated healthy myotubes. Figure 3C shows Cas13b transfected FSHD myotubes. Figure 3D shows FSHD myotubes treated with Cas13b+gRNA3. Figure 3E shows FSHD myotubes treated with Cas13b+gRNA9. DUX4 mRNA foci are detected as dark punctate spots indicated by arrows. DUX4 RNA foci were reduced in CRISPR-Cas13b gRNA treated samples (Figures 3D and 3E). [Figure 3C] Figures 3A-E show RNAscope images of treated and untreated myotubes. Figure 3A shows untreated FSHD myotubes. Figure 3B shows untreated healthy myotubes. Figure 3C shows Cas13b transfected FSHD myotubes. Figure 3D shows FSHD myotubes treated with Cas13b+gRNA3. Figure 3E shows FSHD myotubes treated with Cas13b+gRNA9. DUX4 mRNA foci are detected as dark punctate spots indicated by arrows. DUX4 RNA foci were reduced in CRISPR-Cas13b gRNA treated samples (Figures 3D and 3E). [Figure 3D] Figures 3A-E show RNAscope images of treated and untreated myotubes. Figure 3A shows untreated FSHD myotubes. Figure 3B shows untreated healthy myotubes. Figure 3C shows Cas13b transfected FSHD myotubes. Figure 3D shows FSHD myotubes treated with Cas13b+gRNA3. Figure 3E shows FSHD myotubes treated with Cas13b+gRNA9. DUX4 mRNA foci are detected as dark punctate spots indicated by arrows. DUX4 RNA foci were reduced in CRISPR-Cas13b gRNA treated samples (Figures 3D and 3E). [Figure 3E]Figures 3A-E show RNAscope images of treated and untreated myotubes. Figure 3A shows untreated FSHD myotubes. Figure 3B shows untreated healthy myotubes. Figure 3C shows Cas13b transfected FSHD myotubes. Figure 3D shows FSHD myotubes treated with Cas13b+gRNA3. Figure 3E shows FSHD myotubes treated with Cas13b+gRNA9. DUX4 mRNA foci are detected as dark punctate spots indicated by arrows. DUX4 RNA foci were reduced in CRISPR-Cas13b gRNA treated samples (Figures 3D and 3E). [Figure 4] Figure 4 shows the expression of the DUX4-associated biomarker PRAME family member 12 (PRAMEF12) in FSHD myotubes treated with Cas13b+gRNA or control. DUX4 is a transcription factor known to activate several downstream genes, including PRAMEF12. FSHD myotubes treated with CRISPR-Cas13b gRNA1, gRNA2, gRNA3, and gRNA9 had significantly reduced expression of PRAMEF12 compared to cells treated with Cas13b alone, or Cas13b+gRNA12. These results indicate that reduced expression of DUX4 is associated with reduced DUX4 activation biomarkers. Each individual assay was performed in duplicate in each condition. [Figure 5-1] FIG. 5 shows the DUX4 targeting sequences of gRNA1-11 and 13-16 (SEQ ID NOs: 14-24 and 55-58) and gRNA1-11 and 13-16 expression cassettes (SEQ ID NOs: 38-48 and 63-66), which comprise the human U6 promoter, gRNA (as set forth in SEQ ID NOs: 3-13 and 51-54), and Cas13b directed repeats (SEQ ID NO: 37), as disclosed in various embodiments of the present disclosure. [Figure 5-2]FIG. 5 shows the DUX4 targeting sequences of gRNA1-11 and 13-16 (SEQ ID NOs: 14-24 and 55-58) and gRNA1-11 and 13-16 expression cassettes (SEQ ID NOs: 38-48 and 63-66), which comprise the human U6 promoter, gRNA (as set forth in SEQ ID NOs: 3-13 and 51-54), and Cas13b directed repeats (SEQ ID NO: 37), as disclosed in various embodiments of the present disclosure. [Figure 5-3] FIG. 5 shows the DUX4 targeting sequences of gRNA1-11 and 13-16 (SEQ ID NOs: 14-24 and 55-58) and gRNA1-11 and 13-16 expression cassettes (SEQ ID NOs: 38-48 and 63-66), which comprise the human U6 promoter, gRNA (as set forth in SEQ ID NOs: 3-13 and 51-54), and Cas13b directed repeats (SEQ ID NO: 37), as disclosed in various embodiments of the present disclosure. [Figure 5-4] FIG. 5 shows the DUX4 targeting sequences of gRNA1-11 and 13-16 (SEQ ID NOs: 14-24 and 55-58) and gRNA1-11 and 13-16 expression cassettes (SEQ ID NOs: 38-48 and 63-66), which comprise the human U6 promoter, gRNA (as set forth in SEQ ID NOs: 3-13 and 51-54), and Cas13b directed repeats (SEQ ID NO: 37), as disclosed in various embodiments of the present disclosure. [Figure 6A] Figure 6A-C show qRT-PCR results of inhibition of DUX4 activity as indicated by the decrease in the relative expression levels of various DUX 4 targets (biomarkers), namely TRIM43 (Figure 6A), MBD3L2 (Figure 6B), and PRAMEF12 (Figure 6C), relative to DUX4 activity after transfection with Cas13b and various gRNA plasmids. Human RPL13A was used as a reference gene. The expression levels of these biomarkers were normalized to myotubes transfected with only Cas13b as a negative control. The expression levels of each of the three biomarkers were decreased after transfection with Cas13b and gRNA compared to only Cas13b-transfected cells. [Figure 6B]Figure 6A-C show qRT-PCR results of inhibition of DUX4 activity as indicated by the decrease in the relative expression levels of various DUX 4 targets (biomarkers), namely TRIM43 (Figure 6A), MBD3L2 (Figure 6B), and PRAMEF12 (Figure 6C), relative to DUX4 activity after transfection with Cas13b and various gRNA plasmids. Human RPL13A was used as a reference gene. The expression levels of these biomarkers were normalized to myotubes transfected with only Cas13b as a negative control. The expression levels of each of the three biomarkers were decreased after transfection with Cas13b and gRNA compared to only Cas13b-transfected cells. [Figure 6C] Figure 6A-C show qRT-PCR results of inhibition of DUX4 activity as indicated by the decrease in the relative expression levels of various DUX 4 targets (biomarkers), namely TRIM43 (Figure 6A), MBD3L2 (Figure 6B), and PRAMEF12 (Figure 6C), relative to DUX4 activity after transfection with Cas13b and various gRNA plasmids. Human RPL13A was used as a reference gene. The expression levels of these biomarkers were normalized to myotubes transfected with only Cas13b as a negative control. The expression levels of each of the three biomarkers were decreased after transfection with Cas13b and gRNA compared to only Cas13b-transfected cells. [Figure 7] Figure 7 shows the results of an in vitro gene silencing assay. All gRNAs targeted DUX4 and were able to reduce Renilla luciferase expression. The most significant silencing seen in this particular assay was achieved by gRNAs 1, 2, and 15. [Figure 8] Figure 8 shows the results of an in vitro fluorescence assay performed to measure the reduction in DUX4 expression using mCherry expression as a marker. Compared to cells transfected with non-targeting gRNA (gRNA12) or Cas13b alone, mCherry expression was significantly reduced in cells treated with gRNA1 and 2. [Figure 9A] Figure 9A-C show the results of in vivo experiments using the TIC-DUX4 mouse model. Figure 9A shows that TIC-DUX4 mice can be induced to develop mild and progressive muscle pathology, as shown by the relative expression of WAP 4 disulfide core domain protein 3 (WFDC3) in the muscles (tibialis anterior (TA), gastrocnemius (GAS), and triceps (TRI)) of mice over time with tamoxifen treatment alone. Figure 9B shows the increase in DUX4 expression and tissue damage in TA and GAS muscles of TIC-DUX4 mice after administration of 1 mg / kg tamoxifen three times a week over time (without administration of gRNA targeting DUX4). [Figure 9B] Figure 9A-C show the results of in vivo experiments using the TIC-DUX4 mouse model. Figure 9A shows that TIC-DUX4 mice can be induced to develop mild and progressive muscle pathology, as shown by the relative expression of WAP 4 disulfide core domain protein 3 (WFDC3) in the muscles (tibialis anterior (TA), gastrocnemius (GAS), and triceps (TRI)) of mice over time with tamoxifen treatment alone. Figure 9B shows the increase in DUX4 expression and tissue damage in TA and GAS muscles of TIC-DUX4 mice after administration of 1 mg / kg tamoxifen three times a week over time (without administration of gRNA targeting DUX4). [Figure 9C]Figures 9A-C show the results of in vivo experiments using the TIC-DUX4 mouse model. Figure 9A shows that TIC-DUX4 mice show a significant increase in WAP in the muscles of mice (tibialis anterior (TA), gastrocnemius (GAS), and triceps (TRI)) over time with tamoxifen treatment alone. Figure 9B shows that TIC-DUX4 mice can be induced to develop mild and progressive muscle pathology as indicated by the relative expression of WFDC3. Figure 9B shows increased DUX4 expression and tissue damage in TA and GAS muscles of TIC-DUX4 mice after administration of 1 mg / kg tamoxifen three times a week over time (without administration of gRNA targeting DUX4). Figure 9C-E show the results of neonatal intramuscular injection of AAV-CRISPR-Cas13 (containing gRNA1) in TIC-DUX4 mice. Neonatal TIC-DUX4 mice (1-2 days old) were unilaterally co-injected with 5e10 AAV.Cas13 and AAV.gRNA1 on days 1-2. Four weeks later, mice began the tamoxifen protocol (1 mg / kg, three times a week for 4 weeks). Expression of WFDC3 was reduced in mice treated with gRNA1 and Cas13b. [Figure 9D] Figure 9C-E show the results of neonatal intramuscular injection of AAV-CRISPR-Cas13 (containing gRNA1) in TIC-DUX4 mice. Neonatal TIC-DUX4 mice (1-2 days old) were unilaterally co-injected with 5e10 AAV.Cas13 and AAV.gRNA1 on day 1-2. Four weeks later, mice started a tamoxifen protocol (1 mg / kg, 3 times a week for 4 weeks). Expression of WFDC3 was reduced in mice treated with gRNA1 and Cas13b. [Figure 9E] Figure 9C-E show the results of neonatal intramuscular injection of AAV-CRISPR-Cas13 (containing gRNA1) in TIC-DUX4 mice. Neonatal TIC-DUX4 mice (1-2 days old) were unilaterally co-injected with 5e10 AAV.Cas13 and AAV.gRNA1 on day 1-2. Four weeks later, mice started a tamoxifen protocol (1 mg / kg, 3 times a week for 4 weeks). Expression of WFDC3 was reduced in mice treated with gRNA1 and Cas13b. [Figure 10] Figure 10 shows that gRNAs 1-11 and 13-16 reduced the toxicity of DUX4 and protected cells from apoptosis in a caspase 3 / 7 assay. [Figure 11] FIG. 11 shows the reduction in DUX4 mRNA and protein (as shown by relative expression of WFDC3) 3 weeks after co-injection of sAAV6-Cas13b and scAAV6-gRNA1 (5e10) into mouse TA followed by injection of DUX4 (1e9). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0027] The present disclosure provides a novel strategy to achieve double homeobox protein 4 (DUX4) gene silencing at the mRNA level using CRISPR / Cas13, since expression of DUX4 in muscle is known to cause muscular dystrophies, including but not limited to facioscapulohumeral muscular dystrophy (FSHD). Thus, in some embodiments, the products and methods described herein are used to treat FSHD.

[0028] The emergence of DUX4 as an important future therapeutic target for FSHD has lowered the barrier to pursuing translational research in FSHD. Using guide RNAs targeting DUX4 mRNA with the Cas13b system to reduce expression of DUX4 can provide treatment for this disease. This disclosure provides evidence that DUX4 gene silencing caused by engineered artificial guide RNAs with the utilization of the Cas13 system downregulates the expression of DUX4, providing protection from cell death and a promising therapeutic approach for treating muscular dystrophies such as FSHD.

[0029] The DUX4 gene encodes a protein of approximately 45 kDA. See UniProtKB-Q9UBX2(DUX4_HUMAN). Derepression of the DUX4 gene is involved in the pathogenesis of FSHD. Derepression can occur by two known mechanisms: D4Z4 repeat contraction or mutations in the chromatin modifying genes SMCHD1 or DNMT3B. In the former case, in unaffected subjects, the D4Z4 array is composed of 11-100 repeats, whereas in FSHD1 patients, the array is reduced to 1-10 repeats (PubMed:19320656). Both conditions may cause DNA hypomethylation at chromosome 4q35, thereby creating a chromosomal environment permissive for expression of DUX4.

[0030] DUX4 maps to the D4Z4 macrosatellite, which is epigenetically repressed in somatic tissues. D4Z4 chromatin relaxation of FSHD1 leads to inefficient epigenetic repression of DUX4 and a variegated pattern of DUX4 protein expression in a subset of skeletal muscle nuclei. Ectopic expression of DUX4 in skeletal muscle activates expression of stem cell and germline genes, and when overexpressed in somatic cells, DUX4 can ultimately lead to cell death.

[0031] Each D4Z4 repeat unit contains an open reading frame (named DUX4) encoding two homeoboxes, and the repeat array and ORFs are conserved in other mammals. The encoded protein has been reported to function as a transcriptional activator of numerous genes, including several genes considered biomarkers for FSHD disease, including ZSCAN4, PRAMEF12, TRIM43, and MBD3L2 (PMID:24861551). Contraction of macrosatellite repeats causes autosomal dominant FSHD. Alternative splicing results in multiple transcript variants.

[0032] In some embodiments, the nucleic acid encoding human DUX4 is described in the nucleotide sequence set forth in SEQ ID NO:1. In some embodiments, the amino acids of human DUX4 are described in the amino acid sequence set forth in SEQ ID NO:2. In various embodiments, the method of the present disclosure also targets isoforms and variants of the nucleotide sequence set forth in SEQ ID NO:1. In some embodiments, the variants have 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, and 70% identity with the nucleotide sequence set forth in SEQ ID NO:1. In some embodiments, the method of the present disclosure targets isoforms and variants of the nucleic acid comprising a nucleotide sequence encoding the amino acid sequence set forth in SEQ ID NO:2. In some embodiments, variants have 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, and 70% identity to the nucleotide sequence encoding the amino acid sequence set forth in SEQ ID NO:2.

[0033] Currently, there is no cure for FSHD, and little translational research has been published targeting FSHD, despite its relative abundance among muscular dystrophies. Although several FSHD candidate genes have been identified, many recent studies support that the primary culprit in the pathogenesis of FSHD is the proapoptotic DUX4 gene, which encodes a transcription factor. Thus, in simple terms, overexpression of DUX4 is the primary pathogenic insult underlying FSHD.

[0034] The present disclosure includes the use of CRISPR / Cas13 to silence or downregulate the expression of DUX4 to ameliorate and / or treat subjects with muscular dystrophies, including but not limited to FSHD or other disorders caused by a mutated DUX4 gene and the resulting altered version of mRNA. The CRISPR-Cas adaptive immune system defends microbes against foreign nucleic acids via RNA-guided endonucleases. The Cas13 enzyme is rapidly becoming a major player in the CRISPR field for precise RNA editing (Cox et al., RNA editing with CRISPR-Cas13, Science 358(6366):1019-27, 2017). CRISPR / Cas13 is a gene regulation mechanism in eukaryotic cells that has been considered to treat various diseases.

[0035] The present disclosure includes the use of CRISPR / Cas13 to silence or downregulate expression of DUX4 to ameliorate and / or treat subjects with DUX4-expressing cancer. It has been reported that DUX4, an early embryonic transcription factor that is typically silenced in normal tissues, is re-expressed in many solid tumors of the bladder, breast, lung, kidney, stomach, and other organ sites (Chew et al., Developmental Cell 50(5):658-71.e7(2019). DUX4 has also been implicated in melanoma and metastatic melanoma. Id. DUX4 is normally expressed as the embryo forms and develops, but is subsequently epigenetically repressed and silenced in somatic tissues. It has also been reported that DUX4 plays a role in tumorigenesis and metastasis in sarcomas (Okimoto et al., J Clin Invest.2019;129(8):3401-3406). Overall, DUX4 has been implicated in bladder cancer, breast cancer, cervical cancer, endometrial cancer, esophageal cancer, lung cancer, kidney cancer, ovarian cancer, rhabdoid carcinoma (or rhabdoid sarcoma), sarcoma, gastric cancer, testicular cancer, thymoma, melanoma, or metastatic melanoma. Advances in cancer immunotherapy have made it important to identify genes that regulate antigen presentation and tumor-immune interactions. Expression of DUX4 has been shown to block interferon-γ-mediated induction of MHC class I, suggesting suppression of antigen presentation in DUX4-mediated immune evasion. Clinical data in metastatic melanoma confirmed that expression of DUX4 is associated with significantly reduced progression-free survival and overall survival in response to anti-CTLA-4. Thus, as described herein, methods of inhibiting expression of DUX4 or overexpression of DUX4 are therapeutic in the treatment and prevention of DUX4-associated tumors or cancers.

[0036] Nucleic acid editing can be used to treat genetic diseases, particularly at the RNA level, where disease-associated sequences can be rescued to result in functional protein products. Type VI CRISPR-Cas systems contain the programmable single-effector RNA-guided ribonuclease Cas13. Type VI systems have been profiled to engineer Cas13 orthologs capable of robust knockdown and have demonstrated RNA editing in mammalian cells by directing adenosine-to-inosine deaminase activity by ADAR2 (adenosine deaminase acting on RNA type 2) to transcripts. This system, termed Programmable RNA Editing for A to I Replacements (REPAIR), can be used to edit full-length transcripts containing pathogenic mutations (Cox et al., supra).

[0037] In some embodiments, the present disclosure includes a programmable single-effector RNA-guided ribonuclease Cas13 that uses a type VI CRISPR-Cas system.In some embodiments, the present disclosure uses Cas13b (Smargon et al., Molecular Cell 65:618-30,2017), which is a CRISPR-associated RNA-guided RNase with two crRNA variants.Cas13b processes its own CRISPR array with short and long directed repeats, cleaves target RNA, and exhibits concomitant RNase activity.

[0038] The present disclosure includes various nucleic acids that comprise, consist essentially of, or consist of various nucleotide sequences described herein. In some aspects, the nucleic acid comprises a nucleotide sequence. In some aspects, the nucleic acid consists essentially of a nucleotide sequence. In some aspects, the nucleic acid consists of a nucleotide sequence.

[0039] The present disclosure includes Cas13, Cas13 orthologs, and Cas13 variants, and methods of using the Cas13, Cas13 orthologs, and Cas13 variants.Thus, in some embodiments, Cas13 is Cas13a, Cas13b, or Cas13c.In some embodiments, Cas13a, Cas13b, or Cas13c is mammalian codon optimized.In some embodiments, Cas13b is PspCas13b (catalog number pC0046, https: / / www.addgene.org / 103862 / , see also Cox et al., Science 24:358(6366):1019-1027,2017). In exemplary embodiments, Cas13 is Cas13b comprising the nucleotide sequence set forth in SEQ ID NO:36, or a variant thereof having at least about 70%, about 75%, about 80%, about 85%, about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the sequence set forth in SEQ ID NO:36. In some embodiments, Cas13 is inserted into a mammalian expression vector, including a viral vector, for expression in cells. In some embodiments, a mammalian gRNA for Cas13a, Cas13b, or Cas13c ortholog is cloned into a mammalian expression vector, including a viral vector, for expression in cells. In some embodiments, the DNA encoding the guide RNA and / or Cas13 is under the expression of a promoter. In some embodiments, the promoter is a U6 promoter.

[0040] In some embodiments, Cas13 DUX4 RNA silencing is superior to DNA-directed editing strategies due to the fact that the DUX4 gene is embedded within the same D4Z4 DNA repeats, and even single-site DNA editing strategies result in the excision of the entire end of chromosome 4, or the production of a shorter array of D4Z4 repeats that may alter the epigenetic state of chromosome 4 and result in derepression of DUX4. Importantly, the present disclosure provides Cas13-specific guide RNAs that significantly reduce expression of DUX4.

[0041] In some embodiments, the present disclosure provides a DUX4 RNA-targeting guide RNA (gRNA). More specifically, the present disclosure provides a nucleic acid encoding a DUX4-encoded gRNA comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 3-13 and 51-54. These sequences include the antisense "guide" strand sequences of the present disclosure of various sizes. The antisense guide strand is the strand of the mature miRNA duplex that ultimately becomes the RNA component of the RNA-induced silencing complex responsible for sequence-specific gene silencing. See Chapter 7, Section 7.3 of Duan (Ed.), Muscle Gene Therapy, Springer Science+Business Media, LLC (2010).

[0042] For example, the first antisense guide strand, i.e., gRNA of SEQ ID NO: 3, corresponds to (is the reverse complement of and therefore binds to) the DUX4 sequence set forth in SEQ ID NO: 14. See FIG. 5 and Table 1, which show the gRNA sequence and the DUX4 target sequence to which it binds. The second antisense guide strand, i.e., gRNA of SEQ ID NO: 4, binds to the DUX4 sequence set forth in SEQ ID NO: 14, and so on.

[0043] Thus, the present disclosure includes a nucleic acid encoding a DUX4-encoded gRNA comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 3-13 and 51-54. In various embodiments, the present disclosure provides these gRNAs as gRNAs 1-11 and 13-16, respectively. In some embodiments, the present disclosure provides gRNA 12, which is used as a control. gRNA 12 is a Cas13b non-targeting gRNA (Cox et al., Science 24:358(6366):1019-27, 2017).

[0044] In various embodiments, the disclosure includes a nucleic acid encoding a DUX4-encoded guide RNA that specifically hybridizes to a target nucleic acid encoding DUX4 that includes a nucleotide sequence set forth in any one of SEQ ID NOs: 14-24 and 55-58. The disclosure also includes a nucleic acid that further includes a nucleotide sequence encoding a Cas13b directed repeat sequence (e.g., SEQ ID NO: 37, or a variant thereof having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the sequence set forth in SEQ ID NO: 37). In some embodiments, the Cas13b directed repeat is located downstream or at the 3' end of the gRNA. Thus, in some embodiments, the nucleic acid comprises, consists essentially of, or consists of a nucleotide sequence set forth in any one of SEQ ID NOs: 25-35 and 59-62. In some embodiments, the nucleic acid includes a variant having at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% identity to a nucleotide sequence set forth in any one of SEQ ID NOs: 25-35 and 59-62. In some embodiments, the disclosure includes a nucleic acid comprising a promoter, a gRNA, and a Cas13 directed repeat comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 38-48 and 63-66. In some embodiments, the nucleic acid comprises a variant having at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to a nucleotide sequence set forth in any one of SEQ ID NOs: 38-48 and 63-66. As described herein, such functional gRNAs and constructs comprising gRNAs are designed to target DUX4 RNA.

[0045] The disclosure includes compositions comprising any of the nucleic acids described herein in combination with a diluent, excipient, or buffer. In some aspects, the disclosure includes vectors comprising any of the nucleic acids described herein.

[0046] Delivery of these gRNAs, including gRNAs with Cas13b directed repeats, together with vectors expressing Cas13 enzymes (e.g., Cas13b), causes degradation of DUX4 mRNA, resulting in a decrease in DUX4 protein. In some embodiments, the nucleic acid encoding the Cas13b enzyme comprises the nucleotide sequence set forth in SEQ ID NO: 36, or a variant thereof having at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the nucleotide sequence set forth in SEQ ID NO: 36, or a biologically active fragment thereof. In some embodiments, the Cas13b gene sequence is pC0046-EF1a-PspCas13b-NES-HIV plasmid (Addgene).

[0047] In some embodiments, one or more Cas13 constructs are co-transfected with one or more gRNA constructs into the cell of interest for targeting DUX4 gene.In additional embodiments, one or more Cas13 constructs are co-transfected with one or more gRNA constructs and one or more microRNAs (miRNAs) designed to inhibit DUX4 gene expression in the cell of interest.

[0048] In some aspects, the disclosure includes the use of RNA interference to downregulate or inhibit the expression of DUX4. RNA interference (RNAi) is a gene regulation mechanism in eukaryotic cells that has been explored to treat various diseases. RNAi refers to the post-transcriptional control of gene expression mediated by miRNAs. miRNAs are small (21-25 nucleotides), non-coding RNAs that share sequence homology and base-pair with the 3' untranslated region of their cognate messenger RNA (mRNA). The interaction between miRNA and mRNA instructs the cell's gene silencing machinery to prevent translation of the mRNA.

[0049] In exemplary embodiments, the present disclosure includes the use of gRNAs to disrupt the expression of DUX4. In additional embodiments, the present disclosure includes the use of other inhibitory RNAs used in combination with the gRNAs described herein to further reduce or block the expression of DUX4.

[0050] As understanding of the natural RNAi pathway has progressed, researchers have designed artificial shRNAs and snRNAs for use in regulating the expression of target genes to treat disease. Several classes of small RNAs are known to trigger the RNAi process in mammalian cells, including small (or small) interfering RNAs (siRNAs), as well as small (or small) hairpin RNAs (shRNAs) and microRNAs (miRNAs), which constitute a similar class of vector expression triggers [Davidson et al., Nat. Rev. Genet. 12: 329-40, 2011; Harper, Arch. Neurol. 66: 933-8, 2009]. shRNAs and miRNAs are expressed in vivo from plasmid or virus-based vectors, so long as the vector is present in the target cell nucleus and the driving promoter is active, a single administration can achieve long-term gene silencing (Davidson et al., Methods Enzymol. 392: 145-73, 2005). Importantly, this vector expression approach builds on decades of progress already made in the muscle gene therapy field. However, instead of expressing a protein encoding gene, the vector cargo in the RNAi therapeutic strategy is an artificial shRNA or miRNA cassette that targets the disease gene of interest. This strategy is used to express a natural miRNA. Each shRNA / miRNA is based on the hsa-miR-30a sequence and structure. The natural mir-30a mature sequence is replaced by unique sense and antisense sequences derived from the target gene.

[0051] As mentioned above, the present disclosure includes the use of other inhibitory RNAs used in combination with the gRNAs described herein to further reduce or block the expression of DUX4. Thus, in some embodiments, the products and methods of the present disclosure also include short hairpin RNAs or small hairpin RNAs (shRNAs) to affect (e.g., knock down or inhibit) the expression of DUX4. Short hairpin RNAs (shRNAs / hairpin vectors) are artificial RNA molecules with tight hairpin turns that can be used to silence the expression of target genes via RNA interference (RNAi). shRNAs are beneficial mediators of RNAi in that they have a relatively low rate of degradation and turnover, but this requires the use of an expression vector. Once the vector transduces the host genome, the shRNA is then transcribed in the nucleus by polymerase II or polymerase III depending on the promoter selection. The product mimics primary microRNA (pri-miRNA) and is processed by Drosha. The resulting pre-shRNA is exported from the nucleus by exportin 5. This product is then processed by Dicer and loaded into the RNA-induced silencing complex (RISC). The sense (passenger) strand is degraded. The antisense (guide) strand directs RISC to the mRNA with a complementary sequence. In case of perfect complementarity, RISC cleaves the mRNA. In case of imperfect complementarity, RISC blocks the translation of the mRNA. In both of these cases, the shRNA causes the silencing of the target gene. In some embodiments, the present disclosure includes the production and administration of AAV vectors that express DUX4 antisense sequences via shRNA. The expression of shRNA is regulated by the use of various promoters. Promoter selection is essential to obtain robust shRNA expression. In various embodiments, polymerase II promoters such as U6 and H1, and polymerase III promoters are used. In some embodiments, U6 shRNA is used.

[0052] Thus, in some embodiments, the present disclosure uses U6shRNA molecules to further inhibit, knock down or disrupt DUX4 gene expression. Conventional small / short hairpin RNA (shRNA) sequences are usually transcribed into cell nuclei from vectors that contain polIII promoters such as U6. Endogenous U6 promoters usually control the expression of U6 RNA, a small nuclear RNA (snRNA) involved in splicing, and have been well characterized [Kunkel et al., Nature.322(6074):73-7(1986); Kunkel et al., Genes Dev.2(2):196-204(1988); Paule et al., Nucleic Acids Res.28(6):1283-98(2000)]. In some embodiments, the U6 promoter is used to control vector-based expression of shRNA molecules in mammalian cells because (1) the promoter is recognized by RNA polymerase III (polyIII) and controls high-level constitutive expression of shRNA, and (2) the promoter is active in most mammalian cell types [Paddison et al., Proc. Natl. Acad. Sci. USA 99(3):1443-8(2002); Paul et al., Nat. Biotechnol. 20(5):505-8(2002)]. In some embodiments, the promoter is a type III polIII promoter in that all the factors required to control expression of the shRNA are located upstream of the transcription start site (Paule et al., Nucleic Acids Res. 28(6):1283-98(2000)). The present disclosure includes both mouse and human U6 promoters. The shRNA, which contains sense and antisense sequences from the target gene connected by a loop, is transported from the nucleus to the inside of the cytoplasm where Dicer processes it into small / small interfering RNAs (siRNAs).

[0053] In some embodiments, the products and methods of the disclosure include small nuclear ribonucleic acid (snRNA), also commonly referred to as U-RNA, to knock down or even inhibit DUX4 gene expression. snRNA is a class of small RNA molecules found in the splicing speckles and bodies of Cajal in the cell nuclei of eukaryotic cells. Small nuclear RNAs are associated with a set of specific proteins, the complexes being called small nuclear ribonucleoproteins (snRNPs, often pronounced "snur-puss"). Each snRNP particle consists of an snRNA component and multiple snRNP-specific proteins, including Sm proteins, a family of nuclear proteins. snRNAs form ribonucleoprotein complexes (snRNPs) with their associated proteins and bind to specific sequences on pre-mRNA substrates. They are transcribed by either RNA polymerase II or RNA polymerase III. snRNAs are often divided into two classes based on both common sequence features and associated protein factors, such as the RNA-binding LSm protein. The first class, known as Sm-class snRNA, consists of U1, U2, U4, U4atac, U5, U7, U11 and U12. Sm-class snRNA is transcribed by RNA polymerase II. The second class, known as Lsm-class snRNA, consists of U6 and U6atac. Lsm-class snRNA is transcribed by RNA polymerase III and does not leave the nucleus compared to Sm-class snRNA. In some embodiments, the present disclosure includes the production and administration of AAV vectors containing U7 snRNA to deliver DUX4 antisense sequences.

[0054] In some embodiments, the present disclosure uses U7snRNA molecules to further inhibit, knock down, or disrupt DUX4 gene expression. U7snRNA is normally involved in histone pre-mRNA 3' end processing, but in some embodiments, it is converted into a versatile tool for splicing regulation or as an antisense RNA that is continuously expressed in cells [Goyenvalle et al., Science 306(5702):1796-9(2004)]. By replacing the wild-type U7Sm binding site with a consensus sequence derived from spliceosomal snRNA, the resulting RNA associates with the seven Sm proteins found in spliceosomal snRNA (Figure 7). As a result, this U7 SmOPT RNA accumulates more efficiently in the nucleocytoplasm and does not mediate further histone pre-mRNA cleavage. However, this U7 SmOPT RNA can still bind to histone pre-mRNA and function as a competitive inhibitor for wild-type U7snRNP. By further replacing the sequence that binds to histone downstream factors with a sequence that is complementary to a specific target in the splicing substrate, U7 snRNA can be generated that can regulate specific splicing events. The advantage of using U7 derivatives is that the antisense sequence is embedded into small nuclear ribonucleoprotein (snRNP) complexes. Furthermore, when embedded in gene therapy vectors, these small RNAs can be persistently expressed in target cells after a single injection [Levy et al., Eur. J. Hum. Genet. 18(9): 969-70 (2010); Wein et al., Hum. Mutat. 31(2): 136-42, (2010); Wein et al., Nat. Med. 20(9): 992-1000 (2014)]. The potential of the U7 snRNA system in neuromuscular disorders has been investigated in vivo using an AAV approach (AAV.U7) [Levy et al., Eur. J. Hum. Genet. 18(9):969-70(2010); Wein et al., Hum. Mutat. 31(2):136-42(2010); Wein et al., Nat. Med. 20(9):992-1000(2014)].A single injection of this AAV9.U7 targeted the defective RNA in a mouse model of Duchenne muscular dystrophy, resulting in long-term correction of the disease in all muscles, including the heart and diaphragm. The ability to target the heart is of paramount importance since DM1 patients display cardiac abnormalities.

[0055] U7snRNA is usually involved in histone pre-mRNA 3' end processing, but it is also used as a flexible tool for splicing regulation, or as antisense RNA that is continuously expressed in cells.One advantage of using U7 derivatives is that antisense sequences are embedded into small nuclear ribonucleoprotein (snRNP) complexes.Furthermore, when embedded in gene therapy vectors, these small RNAs can be continuously expressed in target cells after a single injection.

[0056] Embodiments of the present disclosure utilize vectors (e.g., viral vectors such as adeno-associated virus (AAV), adenovirus, retrovirus, lentivirus, equine-associated virus, alphavirus, poxvirus, herpesvirus, poliovirus, sindbis virus, and vaccinia virus) to deliver polynucleotides encoding the DUX4 inhibitory RNA and DUX4 gRNA disclosed herein. In some aspects, each gRNA and each Cas13b is individually cloned into the vector. Thus, in some aspects, the present disclosure includes a vector comprising one or more of the nucleotide sequences as described above in this disclosure. In some aspects, the vector is an AAV vector. In some aspects, the vector is a single-stranded AAV vector. In some aspects, the AAV is a recombinant AAV (rAAV). In some aspects, the rAAV lacks the rep and cap genes. In some embodiments, the rAAV is a self-complementary (sc) AAV.

[0057] In some embodiments, the present disclosure utilizes adeno-associated virus (AAV) to deliver a nucleic acid encoding an inhibitory RNA, including gRNA, that targets DUX4 mRNA to knock down or inhibit DUX4 expression. In some embodiments, AAV is used to deliver a nucleic acid encoding Cas13 or a Cas13 ortholog or variant. AAV is a replication-deficient parvovirus, whose single-stranded DNA genome is about 4.7 kb long, including an inverted terminal repeat (ITR) of 145 nucleotides. There are multiple serotypes of AAV. The nucleotide sequences of the genomes of the AAV serotypes are known. For example, the complete genome of AAV-1 is provided in GenBank Accession No. NC_002077, and the complete genome of AAV-2 is provided in GenBank Accession No. NC_001401 and Srivastava et al. al., J. Virol., 45:555-564 {1983), the complete genome of AAV-3 is provided under GenBank Accession No. NC_1829, the complete genome of AAV-4 is provided under GenBank Accession No. NC_001829, the AAV-5 genome is provided under GenBank Accession No. AF085716, the complete genome of AAV-6 is presented under GenBank Accession No. NC_001862, at least portions of the genomes of AAV-7 and AAV-8 are provided under GenBank Accession Nos. AX753246 and AX753249, respectively (see also U.S. Pat. Nos. 7,282,199 and 7,790,449 regarding AAV-8), and the AAV-9 genome is described in Gao et al. al., J. Virol., 78:6381-6388 (2004), the AAV-10 genome is provided in Mol. Ther., 13(1):67-76 (2006), and the AAV-11 genome is provided in Virology, 330(2):375-383 (2004). Cis acting sequences that direct viral DNA replication (rep), encapsidation / packaging, and introduction into host cell chromosomes are contained within the AAV ITRs.Three AAV promoters (designated p5, p19, and p40 for their relative map positions) drive the expression of two AAV internal open reading frames encoding the rep and cap genes. The two rep promoters (p5 and p19), coupled with differential splicing of a single AAV intron (at nucleotides 2107 and 2227), result in the production of four rep proteins (rep78, rep68, rep52, and rep40) from the rep gene. The rep proteins have multiple enzymatic properties that are ultimately involved in the replication of the viral genome. The cap gene is expressed from the p40 promoter and encodes the three capsid proteins VP1, VP2, and VP3. Alternative splicing and non-consensus translation initiation sites are responsible for the production of the three associated capsid proteins. A single consensus polyadenylation site is located at map position 95 of the AAV genome. The life cycle and genetics of AAV are reviewed in Muzyczka, Current Topics in Microbiology and Immunology, 158:97-129 (1992).

[0058] AAV has unique characteristics that make it attractive as a vector for delivering foreign DNA to cells, for example in gene therapy. AAV infection of cells in culture is non-cytopathic, and natural infection of humans and other animals is silent and asymptomatic. Moreover, AAV can infect many mammalian cells, allowing the possibility of targeting many different tissues in vivo. Furthermore, AAV can transduce slowly dividing and non-dividing cells and essentially persist for the life of those cells as transcriptionally active nuclear episomes (extrachromosomal elements). The AAV proviral genome is infectious as cloned DNA in a plasmid making the construction of recombinant genomes feasible. Furthermore, signals directing AAV replication, genome encapsidation and transduction are contained within the ITRs of the AAV genome, so that part or all of the internal approximately 4.3 kb genome (encoding replication and structural capsid proteins, rep-cap) may be replaced with foreign DNA. The rep and cap proteins can be provided in trans. Another important feature of AAV is that it is an extremely stable and robust virus. This easily withstands the conditions used to inactivate adenovirus (56°C-65°C for several hours), making low-temperature storage of AAV less important. AAV can be lyophilized, and AAV-infected cells are not resistant to superinfection. In some embodiments, AAV is used to deliver inhibitory RNA, including gRNA, under the control of the U6 promoter. In some embodiments, AAV is used to deliver inhibitory RNA under the control of the U7 promoter. In some embodiments, AAV is used to deliver both gRNA and other inhibitory RNA under the control of the U7 and U6 promoters. In some embodiments, AAV is used to deliver gRNA, inhibitory RNA, and Cas13 (or Cas13 orthologs or variants) under the control of the U6 promoter.

[0059] The recombinant AAV genome of the present disclosure comprises one or more AAV ITRs flanking at least one DUX4 targeting polynucleotide construct. In some embodiments, the polynucleotide is a gRNA. In some aspects, the gRNA is administered together with other polynucleotide constructs targeting DUX4. In various aspects, the gRNA is expressed under various promoters, including but not limited to promoters such as U6, U7, tRNA, H1, minimal CMV (e.g., miniCMV), T7, EF1-alpha, minimal EF1-alpha, skeletal muscle specific promoters, etc. In some aspects, such muscle specific promoters include but are not limited to unc45b, tMCK, minimal MCK, CK6, CK7, MHCK7, CK1. Specifically, this strategy is used in various aspects to achieve more efficient expression of the same gRNA in multiple copies in a single scaffold. The AAV DNA in the rAAV genome can be from any AAV serotype from which a recombinant virus can be derived, including, but not limited to, AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV-anc80, and AAV-rh.74. As described in the background section above, the nucleotide sequences of the genomes of various AAV serotypes are known in the art.

[0060] The DNA plasmid of the present disclosure comprises the rAAV genome of the present disclosure. The DNA plasmid is introduced into a cell that is permissive for infection by AAV's helper virus (e.g., adenovirus, E1-deleted adenovirus or herpesvirus) for the incorporation of the rAAV genome into infectious viral particles. The technology of producing rAAV particles is standard in the art, in which the packaged AAV genome, rep and cap genes, and helper virus functions are provided to the cell. The production of rAAV requires that the following components are present in a single cell (referred to herein as a packaging cell): the rAAV genome, the AAV rep and cap genes separated from the rAAV genome (i.e., not present in the rAAV genome), and the helper virus functions. The AAV rep gene may be from any AAV serotype from which a recombinant virus may be derived, or may be from an AAV serotype different from the rAAV genome ITRs, including, but not limited to, AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV-anc80, and AAV rh.74. In some embodiments, the AAV DNA in the rAAV genome is derived from any AAV serotype from which recombinant virus can be derived, including but not limited to AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV-anc80 and AAV-rh.74. Other types of rAAV variants, such as rAAVs with capsid mutations, are also included in the present disclosure. See, for example, Marsic et al., Molecular Therapy, 22(11):1900-1909(2014). As described above, the nucleotide sequences of the genomes of various AAV serotypes are known in the art. The use of cognate components is particularly contemplated. The production of pseudotyped rAAV is disclosed, for example, in WO 01 / 83692, which is incorporated herein by reference in its entirety.

[0061] The recombinant AAV genome of the present disclosure includes, for example, one or more AAV ITRs flanking a polynucleotide encoding one or more DUX4 inhibitory RNAs. Commercial suppliers such as Ambion Inc. (Austin, TX), Darmacon Inc. (Lafayette, CO), InvivoGen (San Diego, CA), and Molecular Research Laboratories, LLC (Herndon, VA) generate custom inhibitory RNA molecules. In addition, commercially available kits such as the SILENCER™ siRNA Construction Kit (Ambion Inc., Austin, TX) or psiRNA System (InvivoGen, San Diego, CA) are available for producing custom siRNA molecules. Embodiments include a rAAV genome that includes a nucleic acid comprising a nucleotide sequence set forth in any of SEQ ID NOs: 25-36 and 59-62.

[0062] The method to generate packaging cells is to create a cell line that stably expresses all the components required for the production of AAV particles. For example, a plasmid (or multiple plasmids) containing a rAAV genome lacking the AAV rep and cap genes, the AAV rep and cap genes separated from the rAAV genome, and a selectable marker such as a neomycin resistance gene is integrated into the genome of the cell. The AAV genome has been introduced into a bacterial plasmid by procedures such as GC tailing (Samulski et al., 1982, Proc. Natl. Acad. S6. USA, 79:2077-2081), adding a synthetic linker containing a restriction endonuclease cleavage site (Laughlin et al., 1983, Gene, 23:65-73), or direct blunt-end ligation (Senapathy & Carter, 1984, J. Biol. Chem., 259:4661-4666). The packaging cell line is then infected with a helper virus such as adenovirus. The advantage of this method is that the cells are selectable and suitable for large-scale production of rAAV. Other examples of suitable methods use adenovirus or baculovirus rather than plasmids to introduce the rAAV genome and / or the rep and cap genes into packaging cells.

[0063] General principles of rAAV production are reviewed in, for example, Carter, 1992, Current Opinions in Biotechnology, 1533-539; and Muzyczka, 1992, Curr. Topics in Microbial. and Immunol., 158:97-129). Various approaches are described by Ratschin et al., Mol. Cell. Biol. 4:2072 (1984), Hermonat et al., Proc. Natl. Acad. Sci. USA, 81: 6466 (1984), Tratschin et al., Mo 1. Cell. Biol. al., J.Virol.,62:1963(1988), and Lebkowski et al.,1988 Mol.Cell.Biol.,7:349(1988), Samulski et al. al. (1989, J. Virol., 63:3822-3828), U.S. Pat. No. 5,173,414, WO95 / 13365 and corresponding U.S. Pat. No. 5,658,776, WO95 / 13392, WO96 / 17947, PCT / US98 / 18600, WO97 / 09441 (PCT / US96 / 14423), WO97 / 08298 (PCT / US96 / 13872), WO97 / 21825 (PCT / US96 / 20777), WO97 / 06243 (PCT / FR96 / 01064), WO99 / 11764, Perrin et al. (1995) Vaccine 13:1244-1250, Paul et al. (1993) Human Gene Therapy 4:609-615, Clark et al. (1996) Gene Therapy 3:1124-1132, U.S. Patent No. 5,786,211, U.S. Patent No. 5,871,982, and U.S. Patent No. 6,258,595. The foregoing documents are incorporated herein by reference in their entireties, with particular emphasis on the portions of the documents relating to rAAV production.

[0064] Thus, the present disclosure provides a packaging cell that produces infectious rAAV.In one embodiment, the packaging cell can be a stably transformed cancer cell, such as HeLa cell, 293 cell, and PerC.6 cell (similar 293 line).In another embodiment, the packaging cell is a cell that is not a transformed cancer cell, such as low-passage 293 cell (human fetal kidney cell transformed with adenovirus E1), MRC-5 cell (human fetal fibroblast), WI-38 cell (human fetal fibroblast), Vero cell (monkey kidney cell), and FRhL-2 cell (rhesus fetal lung cell).

[0065] In some embodiments, the rAAV is purified by methods standard in the art, such as by column chromatography or cesium chloride gradients. Methods for purifying rAAV vectors from helper viruses are known in the art, including, for example, those disclosed in Clark et al., Hum. Gene Ther., 10(6): 1031-1039 (1999), Schenpp and Clark, Methods Mol. Med., 69: 427-443 (2002), U.S. Patent No. 6,566,118, and WO98 / 09657.

[0066] In another embodiment, the present disclosure includes a composition comprising a rAAV comprising any of the constructs described herein. In some aspects, the present disclosure includes a composition comprising a rAAV for delivering a gRNA described herein. In some aspects, the present disclosure includes a composition comprising one or more of the gRNAs described herein together with one or more DUX4 inhibitory RNAs. In some aspects, the present disclosure includes a composition comprising a rAAV for delivering a gRNA and Cas13 described herein. In some aspects, the present disclosure includes a composition comprising a rAAV for delivering a gRNA and Cas13 described herein and one or more DUX4 inhibitory RNAs. The composition of the present disclosure includes a rAAV and one or more pharma- ceutical or physiologically acceptable carriers, excipients, or diluents. Acceptable carriers and diluents are nontoxic to recipients and preferably inert at the dosages and concentrations employed and include buffers such as phosphate, citrate, or other organic acid salts; antioxidants such as ascorbic acid; low molecular weight polypeptides; proteins such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and / or nonionic surfactants such as Tween, Pluronic®, or polyethylene glycol (PEG).

[0067] Sterile injectable solution is prepared by incorporating the required amount of rAAV into a suitable solvent, together with various other components as listed above as necessary, and then sterilizing by filtration.Generally, dispersion is prepared by mixing sterilized active ingredient into a sterile vehicle that contains basic dispersion medium and other required components from those listed above.In the case of sterile powder for preparing sterile injectable solution, the preferred method of preparation is vacuum drying and freeze-drying technology, which produces powder of active ingredient plus any additional desired components from their solution that has been previously sterilized and filtered.

[0068] The titer of the rAAV administered in the methods of the present disclosure will vary depending, for example, on the particular rAAV, the mode of administration, the therapeutic goal, the targeted individual, and the cell type, and can be determined by standard methods in the art. The titer of the rAAV is approximately 1 x 10 per mL. 6 , about 1×10 7 , about 1×10 8 , about 1×10 9 , about 1×10 10 , about 1×10 11 , about 1×10 12 , about 1×10 13 ~Approx. 1×10 14 Dosages can range from units of viral genome (vg) (e.g., 1×10 7 vg, 1×10 8 vg, 1×10 9 vg, 1×10 10 vg, 1×10 11 vg, 1×10 12 vg, 1×10 13 vg and 1×10 14 vg).

[0069] In some aspects, the disclosure provides a method of delivering any one or more nucleic acids encoding a DUX4-encoded gRNA that specifically hybridizes to a target nucleic acid encoding DUX4 comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 3-13 and 51-54, 25-35 and 59-62, or 38-48 and 63-66, or comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 14-24 and 55-58, to a subject in need thereof, comprising administering to the subject an AAV encoding a DUX4-encoded gRNA as described herein.

[0070] In some aspects, the present disclosure provides AAV transduced cells for delivering DUX4 gRNA. The present disclosure includes a method of transducing target cells with rAAV in vivo or in vitro. The method includes administering an effective amount or a plurality of effective amounts of a composition comprising the rAAV of the present disclosure to a subject, including an animal (e.g., a human) in need thereof. When the dose is administered before the onset of muscular dystrophy, the administration is preventive. When the dose is administered after the onset of muscular dystrophy, the administration is therapeutic. In an embodiment of the present disclosure, the effective amount is a dose that alleviates (eliminates or reduces) at least one symptom associated with the muscular dystrophy being treated, slows or prevents the progression of muscular dystrophy, slows or prevents the progression of muscular dystrophy, reduces the extent of disease, reduces the extent of disease, causes remission (partial or complete) of muscular dystrophy, and / or prolongs survival. In some aspects, the muscular dystrophy is FSHD.

[0071] The administration of the effective dose of the composition can be by a standard route in the art, including but not limited to intramuscular, parenteral, intravascular, intravenous, oral, oral, nasal, pulmonary, intracranial, intraventricular, intrathecal, intraosseous, intraocular, rectal, or intravaginal.The administration route and serotype of the AAV components (particularly AAV ITR and capsid protein) of the rAAV of the present disclosure can be selected and / or adapted by those skilled in the art, taking into account the infectious disease and / or disease state to be treated, and the target cell / tissue, such as the cell expressing DUX4.In some embodiments, the administration route is intramuscular administration.In some embodiments, the administration route is intravenous administration.

[0072] In particular, the actual administration of the rAAV of the present disclosure can be accomplished by using any physical method that delivers the rAAV recombinant vector to the target tissue of an animal. Administration according to the present disclosure includes, but is not limited to, injection into muscle, bloodstream, central nervous system, and / or directly into the brain or other organs. Resuspending rAAV in phosphate buffered saline has been demonstrated to be sufficient to provide a vehicle useful for expression in muscle tissue, and there are no known limitations on carriers or other components that can be co-administered with rAAV (compositions that degrade DNA should be avoided in the usual manner involving rAAV). The capsid protein of rAAV may be modified to target the rAAV to a specific target tissue of interest, such as muscle. See, for example, WO 02 / 053703, the disclosure of which is incorporated herein by reference. The pharmaceutical composition can be prepared as an injectable formulation or as a local formulation that is delivered to muscle by transdermal delivery. Numerous formulations for both intramuscular injection and transdermal delivery have been developed in advance and can be used in carrying out the present disclosure. The rAAV can be used with any pharma- ceutically acceptable carrier for ease of administration and handling.

[0073] For intramuscular injection, solutions in adjuvants such as sesame or peanut oil, or aqueous propylene glycol solutions, and sterile aqueous solutions can be used. Such aqueous solutions can be buffered if necessary, and the liquid diluent is first rendered isotonic with saline or glucose. Solutions of rAAV as a free acid (DNA contains acidic phosphate groups) or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions of rAAV can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof, as well as in oils. Under ordinary storage and use conditions, these preparations contain a preservative to prevent the growth of microorganisms. In this connection, the sterile aqueous media employed are all readily available by standard techniques well known to those skilled in the art.

[0074] Pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the form must be sterile and fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be, for example, a solvent or dispersion medium containing water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. In some embodiments, the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. Prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include an isotonic agent, for example, sugar or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use of agents delaying absorption, for example, aluminum monostearate and gelatin.

[0075] Sterile injectable solution is prepared by incorporating the required amount of rAAV into a suitable solvent, together with various other components as listed above as necessary, and then sterilizing by filtration.Generally, dispersion is prepared by mixing sterilized active ingredient into a sterile vehicle that contains basic dispersion medium and other required components from those listed above.In the case of sterile powder for preparing sterile injectable solution, the preferred method of preparation is vacuum drying and freeze-drying technology, which produces powder of active ingredient plus any additional desired components from their solution that has been previously sterilized and filtered.

[0076] The term "transduction" is used to refer to the administration / delivery of one or more DUX4 inhibitory RNAs (including, but not limited to, gRNA and one or more Cas13-encoding nucleotides) to a recipient cell, either in vivo or in vitro, via a replication-deficient rAAV of the present disclosure, resulting in expression of the DUX4 inhibitory RNA by the recipient cell.

[0077] In one aspect, transduction with rAAV is carried out in vitro.In one embodiment, the desired target cells are removed from the subject, transduced with rAAV, and reintroduced into the subject.Alternatively, syngeneic or xenogeneic cells can be used if syngeneic or xenogeneic cells do not generate an inappropriate immune response in the subject.

[0078] Suitable methods for transduction and reintroduction of transduced cells into a subject are known in the art. In one embodiment, cells can be transduced in vitro, for example by combining rAAV with cells in a suitable medium and screening for cells carrying the DNA of interest using conventional techniques such as Southern blot and / or PCR, or by using a selectable marker. The transduced cells can then be formulated into a pharmaceutical composition, and the composition can be introduced into a subject by a variety of techniques, such as by intramuscular, intravenous, subcutaneous, and intraperitoneal injection, or by injection into smooth and cardiac muscles, for example, using a catheter.

[0079] The present disclosure provides a method of administering to a subject in need thereof an effective amount (or doses administered essentially simultaneously or doses given at intervals) of an rAAV comprising DNA encoding a gRNA targeted to disrupt DUX4 expression, and DNA encoding Cas13b directed repeats and Cas13.

[0080] The transduction of cells by the rAAV of the present disclosure results in the sustained expression of the guide RNA that targets DUX4 expression and Cas13b directed repeat.Therefore, the present disclosure provides a method for administering / delivering the rAAV that expresses inhibitory RNA to a subject.The subject is an animal subject, and in some embodiments, the subject is a human.

[0081] Such methods include transducing the vasculature, central nervous system and tissues (including but not limited to myocytes and neurons, tissues such as muscle, including skeletal muscle, organs such as the heart, brain, skin, eye, and the endocrine system and glands such as endocrine and oral glands) with one or more rAAVs of the present disclosure. In some embodiments, transduction is performed with a gene cassette that contains tissue-specific regulatory elements. For example, one embodiment of the present disclosure utilizes regulatory elements derived from actin and myosin gene families, such as the myoD gene family [see Weintraub et al., Science, 251:761-766 (1991)], muscle cell specific enhancer binding factor MEF-2 [Cserjesi and Olson, Mol Cell Biol 11:4854-4862 (1991)], the human skeletal actin gene [Muscat et al., Mol Cell Biol, 7:4089-4099 (1987)], the cardiac actin gene, muscle creatine kinase sequence elements [see Johnson et al., Mol Cell Biol, 9:3393-3399 (1989)], and the mouse creatine kinase enhancer (mCK) element, the fast twitch skeletal troponin C gene, the slow twitch cardiac troponin C gene, and the slow twitch cardiac troponin I gene: hypoxia-inducible nuclear factor [Semenza et al., Mol Cell Biol, 1999]. et al., Proc. Natl. Acad. Sci. USA, 88:5680-5684 (1991)], steroid-inducible elements and promoters including glucocorticoid response elements (GREs) [see Mader and White, Proc. Natl. Acad. Sci. USA, 90:5603-5607 (1993)], tMCK promoter [see Wang et al., Gene Therapy, 15:1489-1499 (2008)], CK6 promoter [see Wang et al., supra], and other control elements.

[0082] Since AAV targets all diseased organs that express DUX4, the present disclosure includes delivery of DNA encoding inhibitory RNA to all cells, tissues, and organs of a subject. In some embodiments, the vascular system, central nervous system, muscle tissue, heart, and brain are attractive targets for DNA delivery in vivo. The present disclosure includes sustained expression of DUX4 inhibitory gRNA from transduced cells to affect DUX4 expression (e.g., knockdown or inhibit expression). In some embodiments, the present disclosure includes sustained expression of DUX4 inhibitory gRNA from transduced muscle fibers. By "muscle cell" or "muscle tissue" is meant a cell or group of cells derived from any type of muscle (e.g., skeletal and smooth muscles derived from the digestive tract, bladder, blood vessels, or heart tissue). In some embodiments, such muscle cells may or may not be differentiated into myoblasts, myocytes, myotubes, cardiomyocytes, and cardiomyogenic cells.

[0083] In yet another aspect, the disclosure provides a method of preventing or inhibiting expression of a DUX4 gene in a cell, comprising contacting the cell with an rAAV encoding a DUX4 inhibitory gRNA, wherein the gRNA is encoded by a nucleotide sequence set forth in any one of SEQ ID NOs: 3-13 and 51-54. In some aspects, the gRNA is encoded by a nucleotide sequence having about 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent identity to a sequence set forth in any one of SEQ ID NOs: 3-13 and 51-54. In some embodiments, expression of DUX4 is inhibited by at least about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 96, about 97, about 98, about 99, or about 100 percent.

[0084] In yet another aspect, the disclosure provides a method of preventing or inhibiting expression of a DUX4 gene in a cell, comprising contacting the cell with an rAAV encoding a DUX4 inhibitory gRNA, wherein the gRNA specifically hybridizes to a target nucleic acid encoding DUX4 comprising a nucleotide sequence set forth in any one of SEQ ID NOs: 14-24 and 55-58. In some aspects, expression of DUX4 is inhibited by at least about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 96, about 97, about 98, about 99, or about 100 percent.

[0085] In yet another aspect, the disclosure provides a method of preventing or inhibiting expression of the DUX4 gene in a cell, comprising contacting the cell with a vector, e.g., an rAAV vector, encoding a DUX4 inhibitory gRNA and a Cas13b directed repeat, wherein the gRNA and Cas13b repeat are encoded by a nucleotide sequence set forth in SEQ ID NOs: 25-35 and 59-62, or a variant thereof. In another aspect, the disclosure provides a method of preventing or inhibiting expression of the DUX4 gene in a cell, comprising contacting the cell with a vector comprising a nucleotide sequence encoding a promoter, a DUX4 inhibitory gRNA, and a Cas13b directed repeat comprising a nucleotide sequence set forth in SEQ ID NOs: 38-48 and 63-66, or a variant thereof. In some embodiments, the variant has at least about 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent identity to any one of SEQ ID NOs: 25-35 and 59-62 or 38-48 and 63-66. In some embodiments, expression of DUX4 is inhibited by at least about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 96, about 97, about 98, about 99, or about 100 percent.

[0086] In yet another aspect, the disclosure provides a method of preventing or treating muscular dystrophy (including but not limited to FSHD), comprising administering to a subject a vector encoding a polynucleotide sequence comprising a U6 promoter sequence, a gRNA sequence targeting DUX4, and a Cas13b directed repeat sequence, wherein the polynucleotide sequence comprises any one of the nucleotide sequences of SEQ ID NOs: 3-13 and 51-54, 25-35 and 59-62, or 38-48 and 63-66. In some embodiments, the Cas13b directed repeat sequence comprises the nucleotide sequence set forth in SEQ ID NO: 37. In some embodiments, the vector is AAV. In some embodiments, the AAV is recombinant AAV (rAAV). In some embodiments, the rAAV lacks the rep and cap genes. In some embodiments, the rAAV is self-complementary (sc) AAV. In some embodiments, the AAV is used with Cas13 protein to edit RNA. In some embodiments, Cas13 is specifically directed to a transcript of interest using a sequence-specific gRNA.

[0087] In some embodiments, the present disclosure provides a recombinant gene editing complex comprising a nucleic acid comprising various gRNA nucleotide sequences described herein bound to Cas13b directed repeat sequences, which is delivered in combination with Cas13 (e.g., Cas13b) to edit the DUX4 gene. Such gene editing complexes are used to manipulate the expression of DUX4, particularly at the RNA level, when disease-related sequences such as DUX4 are abnormally expressed, and to treat genetic diseases associated with abnormal DUX4 expression, such as muscular dystrophy. Type VI CRISPR-Cas systems include the programmable single effector RNA-guided RNases Cas13. The Cas13 enzyme is capable of robust knockdown and exhibits RNA editing by using catalytically inactive Cas13 on mammalian cell transcripts (Cox et al., RNA Editing with CRISPR-Cas13, Science. 24; 358(6366): 1019-1027, 2017).

[0088] CRISPR-Cas13 does not rely on endogenous enzymes to achieve targeted gene silencing, because Cas13 is derived from prokaryotes and is delivered to target cells using more traditional gene replacement strategies.The CRISPR-Cas13 system disclosed herein for targeting DUX4 can be used alone or in combination with inhibitory RNA (RNAi) to improve silencing.Although RNAi achieves DUX4 silencing efficiently, RNAi-mediated silencing rarely induces 100% silencing of the target DUX4 gene.Thus, in some embodiments, the present disclosure provides the use of both the recombinant gene editing system described herein and the method for targeting DUX4 gene in combination with other RNAi products.

[0089] "Treatment" includes ameliorating or inhibiting one or more symptoms of muscular dystrophy, including, but not limited to, muscle wasting, muscle weakness, muscle tonia, skeletal muscle problems, retinal abnormalities, hip weakness, facial weakness, abdominal muscle weakness, joint and spinal abnormalities, leg weakness, shoulder weakness, hearing loss, muscle inflammation, and asymmetric muscle weakness.

[0090] Molecular, biochemical, histological and functional endpoints show the therapeutic effect of the product based on RNA interference, comprising the Cas13 protein editing of RNA and the method disclosed herein for inhibiting the expression of DUX4 gene on human chromosome 4q35.The endpoints contemplated by the present disclosure include one or more of the following: reduction or elimination of DUX4 protein expression, which is applied to the treatment of muscular dystrophy, including but not limited to FSHD and other disorders associated with elevated DUX4 expression.

[0091] The present disclosure also provides a kit for use in treating the disorders described herein.Such a kit comprises at least a first sterile composition comprising any of the nucleic acids described above or any of the viral vectors described above in a pharma-ceutically acceptable carrier.Another component is optionally a second therapeutic agent for treating the disorder, together with a suitable container and vehicle for administering the therapeutic composition.The kit optionally comprises a solution or buffer for suspending, diluting, or carrying out the delivery of the first and second compositions.

[0092] In one embodiment, such a kit includes the nucleic acid or vector in a diluent packaged in a container, such as a sealed bottle or vessel, with a label attached to the container or included in the package that describes the use of the nucleic acid or vector. In one embodiment, the diluent is in the container such that the amount of head space in the container (e.g., the amount of air between the liquid formulation and the top of the container) is very small. Preferably, the amount of head space is negligible (i.e., almost nonexistent).

[0093] In some embodiments, the formulation comprises a stabilizer. The term "stabilizer" refers to a substance or excipient that protects the formulation from adverse conditions, such as those that occur during heating or freezing, and / or extends the stability or shelf life of the formulation in a stable state. Examples of stabilizers include, but are not limited to, sugars such as sucrose, lactose, and mannose, sugar alcohols such as mannitol, amino acids such as glycine or glutamic acid, and proteins such as human serum albumin or gelatin.

[0094] In some embodiments, the formulation comprises an antimicrobial preservative. The term "antimicrobial preservative" refers to any substance added to the composition that inhibits the growth of microorganisms that may be introduced when the vial or container used is repeatedly punctured. Examples of antimicrobial preservatives include, but are not limited to, substances such as thimerosal, 2-phenoxyethanol, benzethonium chloride, and phenol.

[0095] In some embodiments, the kits include labels and / or instructions that describe the use of the reagents provided in the kit. The kits also optionally include a catheter, syringe, or other delivery device for delivering one or more of the compositions used in the methods described herein.

[0096] This entire document is intended to be related as a unified disclosure, and it is understood that all combinations of features described herein are contemplated, even if the combinations of features are not found together in the same sentence, or paragraph, or section of this document. The disclosure also includes all embodiments of the invention that are narrower in scope than the variations specifically mentioned above, for example. With respect to aspects of the disclosure described as genus, all individual species are considered separate aspects of the disclosure. With respect to aspects of the disclosure described or claimed as "a" or "an", these terms are understood to mean "one or more", unless the context clearly demands a more limited meaning. When an aspect of the disclosure is described as "comprising" a feature, it is also contemplated that the embodiment "consists of" or "consists essentially of" that feature.

[0097] All publications, patents, and patent applications cited in this specification are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference in its entirety, to the extent that it is not inconsistent with this disclosure.

[0098] It is understood that the examples and embodiments described herein are for illustrative purposes only, and that various modifications or changes in light thereof will be suggested to those skilled in the art and are to be included within the spirit and scope of this application and the scope of the appended claims. EXAMPLES

[0099] Aspects and embodiments of the present disclosure are illustrated by the following examples, which are not intended to limit the scope of the invention in any way.

[0100] Example 1 Design and testing of DUX4-targeting Cas13b-gRNA Design of DUX4-targeting Cas13b-gRNA DUX4-targeting Cas13b-gRNA was designed. Cas13b enzyme and associated gRNA from Prevotella sp. P5-125 (PspCas13b) were used in this study. To design DUX4-specific gRNA, the targeting sequence was selected to match the position of the lead microRNA (miRNA) miDUX4 construct, such as mi405, mi406, and mi1155. See U.S. Patent No. 9,469,851. The structure of PspCas13b gRNA and their target sites are shown in Figure 1. The gRNA sequence containing the human U6 promoter was synthesized by Integrated DNA Technologies (IDT) (Skokie, IL). The plasmid expressing human codon-optimized PspCas13b (pc0046) was purchased from Addgene (Cambridge, MA).

[0101] Western blot assay HEK293 cells (250,000 cells / well) were seeded in 24-well plates 16 h prior to transfection. The next morning, 900 ng of PspCas13b and 1800 ng of gRNA plasmids were co-transfected into the cells using Lipofectamine 2000 (Thermofisher, US). 8–10 h after transfection, the medium was changed and 180 ng of DUX4 plasmid was re-transfected into the cells. 20 h after transfection, the cells were lysed in RIPA buffer (50 mM Tris, 150 mM NaCl, 0.1% SDS, 0.5% sodium deoxycholate, 1% TritonX100) supplemented with a cocktail containing protease inhibitors. Protein concentration was determined by DC Protein Assay Kit (Bio-Rad Laboratories). 20 μg of each total protein sample was run on a 12% SDS-polyacrylamide gel. The molecular weight of protein bands was determined using a GE Healthcare Rainbow Molecular Weight Marker (Fisherscientific, USA). Proteins were transferred from SDS-PAGE gels to PVDF membranes by semi-dry transfer method. Membranes were blocked with 5% nonfat milk and then incubated overnight at 4°C with primary monoclonal mouse anti-DUX4 (1:500; P4H2, Novus Biologicals) or rabbit polyclonal anti-α-tubulin antibody (1:1,000; ab15246, Abcam, Cambridge, MA). The next day after washing, blots were probed with horseradish peroxidase-conjugated goat anti-mouse or goat anti-rabbit secondary antibodies (1:100,000; Jackson ImmunoResearch, West Grove, PA) for 1 h at room temperature. After a brief incubation with Immobilon Chemiluminescent HRP Substrate (Millipore, Billerica, MA), relative protein bands developed on X-ray film.

[0102] Cell death assay HEK293 cells (50,000 cells / well) were co-transfected with DUX4, Cas13b, and gRNA expression plasmids using lipofectamine 2000 and plated in 96-well plates. Cell death was measured using the Apo-ONE Homogeneous caspase-3 / 7 Assay (Promega, Madison, WI) 48 hours after transfection using a fluorescent plate reader (Spectra max M2, Molecular Devices, Sunnyvale, CA). Individual assays were performed in triplicate (n=3) and data reported as the average caspase activity relative to the DUX4-only transfected control. Results are shown in Figure 2B.

[0103] Viability assay HEK293 cells (250,000 cells / well) were co-transfected with DUX4, Cas13b, and gRNA expression plasmids using lipofectamine 2000 and plated in 24-well plates. After 48 h of incubation at 37°C with 5% CO2, cells were trypsinized and harvested in 1 ml of growth medium. Automated cell counting was performed using Countess® Cell Counting Chamber Slides (Thermofisher, US). Results were then confirmed by conventional cell counting using a hemocytometer and trypan blue staining. Data were reported as the average total cell number per experiment. Error bars indicate SD. Results are shown in Figure 2C.

[0104] RNAscope assay Cas13b and gRNA plasmids (3 and 6 μg, respectively) were co-transfected into FSHD myoblasts [15A cells (Jones et al., Human Molecular Genetics 21(20):4419-30, 2012); 500,000 cells / reaction] using the Lonza Nucleofector Kit (Lonza, VVPD-1001). FSHD myoblasts were then cultured on glass coverslips in two wells of a 24-well plate containing myoblast growth medium. After 24 hours, the growth medium was replaced with differentiation medium, and the cells were allowed to differentiate into myotubes for 7 days. Myotubes were fixed in 4% PFA (Fisher Scientific, USA) for 30 minutes at room temperature. They were then dehydrated in 50%, 70%, and 100% ethyl alcohol gradients for 5 minutes each at room temperature. Cells were stained with the designed DUX4 probe using RNAscope 2.5 HD Assay Brown (Advanced Cell Diagnostics) according to the manufacturer's protocol. Images were taken with an Olympus DP71 microscope.

[0105] Quantitative real-time PCR analysis of DUX4 biomarker Cas13b and gRNA plasmids (3 and 6 μg, respectively) were co-transfected into FSHD myoblasts (15A, 500,000 cells / reaction) using the Lonza Nucleofector Kit (Lonza, VVPD-1001) and then cultured in 12-well plates. After 24 h, the growth medium was discarded and fresh differentiation medium was added to the cells intended to differentiate myoblasts into myotubes. The cells were allowed to differentiate for 7–9 days. Total RNA was extracted using Trizol (Fisher, Waltham, MA) according to the manufacturer's protocol. The quality and quantity of the isolated RNA was checked with NanoDrop™ (ThermoFisher Scientific). The isolated RNA was then DNase treated (DNA-Free, Ambion, TX) and used for RT-PCR using random hexamers (Applied Biosystems cDNA Archive Kit; Applied Biosystems, Foster City, CA). The subsequent cDNA samples were then used as templates for Taqman Assays using pre-designed PRAMEF12 (a biomarker of DUX4 activity) and human RPL13A control primer / probe sets (Applied Biosystems). Each sample was run in duplicate. All data was normalized to the Cas13b-expressing sample.

[0106] Example 2 DUX4-mRNA targeting gRNA The CRISPR-Cas system, a bacterial immune system, has been used for genome or RNA editing in mammalian cells. The goal of this study was to develop a prospective treatment for muscular dystrophies such as FSHD using a DUX4 gene silenced RNA targeting CRISPR-Cas13 approach. To do this, 11 different Cas13b gRNAs (Figure 1) targeting human DUX4 mRNA were engineered. Each gRNA sequence was cloned into a U6 promoter-driven expression cassette, and an in vitro screening assay was performed to identify lead DUX4-targeting gRNAs.

[0107] According to Cox et al. (supra), the Cas13b enzyme from Prevotella sp. P5-125 (PspCas13b) used in this study is a highly efficient Cas13 enzyme for mammalian RNA editing. Cas13b gRNA does not have any specific protospacer adjacent sequence (PFS) constraints that interfere with mammalian cells, but G bases at the 5' end or dual 3' and 5' ends may slightly increase the efficiency of the PspCas13b enzyme (Cox et al., supra). Because there is no strong PFS preference, any part of the desired mRNA can be selected as the target sequence, and the associated reverse complement sequence can be used with the Cas13b gRNA. Previously, researchers used gRNAs that matched the position of the shRNA to facilitate a better comparison of the efficiency of each method (Omar et al., Nature 550(7675):280-4, 2017).

[0108] In this experiment, the targeting sequences were selected to match in position with several miDUX4 RNA sequences, such as mi405, mi406, and mi1155 (see U.S. Patent No. 9,469,851). Because these miRNAs showed a significant reduction in the amount of DUX4 mRNA, it was theorized that the target mRNA sequences have good accessibility (open or partially open structure) for the targeting miRNA followed by the gRNA with matching position. The target sites of PspCas13b gRNA are shown in Figure 1A-B. The sequences of each gRNA are listed in SEQ ID NOs: 3-13 and 51-54. The DUX4 DNA target sequences of each gRNA are listed in SEQ ID NOs: 14-24 and 55-58.

[0109] Example 3 Selection of DUX4-mRNA-targeting gRNA The dUX4-mRNA targeting gRNA sequences disclosed herein were selected for their ability to reduce the DUX4 protein and its toxicity.

[0110] Each gRNA plasmid was transfected into HEK293 cells along with the Cas13b and DUX4 plasmids. The ability of each gRNA to silence DUX4 at the protein level was investigated (Figure 2A). Each gRNA tested was found to reduce DUX4 protein expression in vitro.

[0111] Each gRNA was then tested for its ability to reduce DUX4-induced apoptosis in transfected cells via a caspase 3 / 7 assay. Each gRNA reduced caspase 3 / 7 activity compared to cells transfected with DUX4 (control) alone (Figure 2B). A cell viability assay was performed showing that each gRNA increased the viability of treated cells, i.e., reduced DUX4-induced apoptosis (Figure 2C).

[0112] We co-transfected HEK293 cells with different ratios of DUX4:Cas13b expression plasmids to determine whether different ratios were more effective, and performed Western blot assays to examine the effect on DUX protein expression. All ratios tested showed a decrease in DUX4 protein amounts (Figure 2D).

[0113] Example 4 RNAscope in situ hybridization showed a significant decrease in DUX4 mRNA abundance in treated FSHD myotubes. To investigate DUX4 silencing at the RNA level, we performed treated FSHD myoblasts differentiated into myotubes and RNAscope in situ hybridization using a specifically designed DUX4-targeting probe.

[0114] While untreated FSHD myotubes showed high levels of DUX4 mRNA (Figure 3A), all samples treated with gRNA targeting DUX4 with Cas13b showed a significant reduction in the amount of DUX4 mRNA, as evident from the brown staining (Figure 3D and Figure 3E). Indeed, samples treated with gRNA targeting DUX4 with Cas13b showed DUX4 mRNA levels similar to those observed in healthy myotubes (Figure 3B (control)). Treatment with Cas13b alone (control) resulted in some reduction in DUX4 mRNA levels (Figure 3C), but DUX4 mRNA levels were still higher than those of healthy controls (Figure 3B), with significant differences between the Cas13b control (Figure 3C) and samples treated with DUX4-targeting gRNA-Cas13b (Figures 3D and 3E).

[0115] Example 5 Decreased PRAMEF12 biomarker expression levels in treated cells indicate reduced DUX4 activity To determine the reduction in gene expression of DUX4 targets resulting from the introduction of gRNA targeting DUX4 with Cas13b, quantitative RT-PCR was performed using PRAMEF12-specific probes and primers to measure PRAMEF12 expression (i.e., a biomarker indicative of DUX4 activity) in FSHD myotubes treated with DUX4-mRNA-targeting gRNA-Cas13b sequences. FSHD-affected human myoblasts (15A) were co-transfected with plasmids expressing Cas13b and gRNA and then differentiated into supermyotubes for 7 days. Total RNA was isolated by Trizol (Ambion) according to the manufacturer's protocol. Complementary DNA (cDNA) was generated using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) after elimination of genomic DNA. Quantitative PCR (qPCR) reactions were performed using the TaqMan Gene Expression Master Mix protocol (Thermo-Fisher Scientific). The following program was used for qPCR analysis: 1 cycle of denaturation at 95°C for 10 min, 39 cycles of 95°C for 15 s at 60°C for 1 min, followed by 1 cycle of cooling at 40°C. Human Ribosomal Protein L13A (RPL13A) was used as a reference gene. Data were analyzed using Delta-Delta-CT (2 -ΔΔCT ) algorithm. PRAMEF12 expression was normalized to only Cas13b-transfected myotubes as a negative control.

[0116] FSHD myotubes treated with CRISPR-Cas13b gRNA1, gRNA2, gRNA3, and gRNA9 significantly reduced PRAMEF12 expression (up to 80% in gRNA3-treated cells) compared to cells transfected with Cas13b alone or Cas13b+gRNA12 (see Figure 4).

[0117] Example 6 Determining Effective Dosage Dose escalation experiments of Cas13b and gRNA are performed to define the effective dose range of DUX4 knockdown. To increase the efficiency of DUX4 gene silencing using the CRISPR-Cas13 method described herein, each lead gRNA combination is cloned into the same plasmid backbone and tested for their ability to inhibit DUX4 expression in FSHD patient myoblast cell lines by examining the expression of DUX4 and various DUX4 biomarkers such as ZSCAN4, PRAMEF12, PRAMEF2, MBD3L2, KHDC1L, TRIM43, LEUTX, etc. Such FSHD myoblast cell lines include, but are not limited to, Wellstone17A, 12A, 18A, etc. (Jones et al., Human Mol. Genetics 21(20):4419-30, 2012). DUX4 expression and DUX4 biomarker expression levels are analyzed by qRT-PCR and / or RNAscope in situ hybridization.

[0118] Example 7 Packaging of Cas13b and gRNA Cas13b and various gRNAs described herein are packaged into AAV vectors to test the efficacy of DUX4 silencing in vivo. In some embodiments, Cas13b and gRNAs are packaged into two different AAV vectors. The PspCas13b gene is a 3270 nucleotide sequence, also called Prevotella sp. P5-125 (PspCas13b) (Cox et al., RNA Editing with CRISPR-Cas13, Science. 24; 358 (6366): 1019-1027, 2017). A plasmid containing this sequence was purchased from Addgene (catalog number: 103862, plasmid name: pC0046-EF1a-PspCas13b-NES-HIV) and is of sufficient size to be packaged into a single-stranded (ss) AAV vector. In various embodiments, Cas13b gene expression cassettes are constructed using short and weak promoters such as mini-CMV promoters, or skeletal muscle specific promoters such as compact unc45b, and minimal MCK promoters such as CK6 or tMCK. In some embodiments, regulatory sequences such as the Kozak sequence present at the beginning of the Cas13b sequence described herein, Woodchuck Hepatitis Virus (WHP) post-transcriptional regulatory element (WPRE), HIV nuclear export signal (NES), and SV40 polyA signal are added to the cassette to increase the efficiency of translation and the stability of mRNA. For example, the Kozak, WPRE, and HIV NES sequences are present in the Cas13b plasmid (Addgene (PC0046), see SEQ ID NO: 36).

[0119] In various embodiments, gRNAs are expressed under different promoters, such as U6, U7, tRNA, H1, miniCMV, T7, or minimal EF1-alpha. Specifically, this strategy is intended to provide more efficient expression of the same gRNA in multiple copies in a single backbone. AAV proviral plasmids containing multiple copies of each gRNA or combinations of two or more gRNAs are generated and used to generate AAV particles. Each gRNA is cloned with its own promoter, targeting sequence, Cas13b gRNA direct repeat, and terminal signal. These constructs are small enough to be packaged into self-complementary AAV (scAAV) vectors. Different serotypes of AAV vectors are generated and tested, including but not limited to AAV6, AAV9, and AAV2. As mentioned above, the present disclosure is not limited to these AAV vectors, as all types of vectors are included for use with the products and methods of the present disclosure. AAV particles carrying Cas13b or gRNA expression cassettes are generated by transient triple transfection of HEK293 cells as described by Rashnonejad et al. (Mol. Biotechnol. 58(1):30-6, 2016) and Gao et al. (Introducing genes into mammalian cells: Viral vectors. In: Green MR, Sambrook J, editors. Molecular cloning: A laboratory manual. Vol. 2. New York: Cold Spring Harbor Laboratory Press; 2012. pp. 1209-1313).

[0120] Example 8 Testing in the DUX4 mouse model Cas13b and various gRNAs packaged in AAV vectors will be tested for efficacy in silencing DUX4 expression in vivo in various mouse models, for example, the recently published TIC-DUX4 mouse model (Giesige et al., JCI Insight, 3(22):e123538, 2018) and / or the previously published iDUX4pA mouse model (Bosnakovski et al., Nature Commun. 8(1):550, 2017). Intramuscular (IM) or intravascular injections will be used to deliver AAV vectors to mice. Expression of DUX4 will be activated by tamoxifen (TIC-DUX4) or doxycycline (iDUX4pA) administration via oral gavage. Muscle histology, molecular analysis, physical activity, and physiological analysis of treated mice will be performed as described (Giesige et al., supra).

[0121] Example 9 Testing in the DUX4 mouse model To determine the safety, toxicology, and efficacy of Cas13b and gRNA vectors, dose escalation studies of AAV vectors expressing gRNA, Cas13 enzyme, and combinations thereof will be performed.

[0122] For safety studies, various doses of AAV vectors carrying gRNA, Cas13 enzyme, and their combinations are administered to adult mice (7-8 weeks old) by intramuscular (IM, 40ul=TA, 100ul=GAS) or tail vein injection in wild type C57BL / 6J mice. For IV administration, the volume depends on the mouse's weight / blood volume and should not exceed 10% of the animal's total body weight. The dose of AAV ranges, in some embodiments, from 1E8 DNAse resistant particles (DRP) to 1E13 DRP or more, and those shown to be non-toxic in wild type mice are tested for protective properties in FSHD animals.

[0123] Phenotype, histopathology, muscle degeneration, muscle regeneration, and molecular analysis are measured at different time points. In various embodiments, mice injected with phosphate-buffered saline (PBS) are used as controls. Mice are given high doses of ketamine / xylazine and then euthanized at different time points. Various muscles and organs are extracted and isolated for histology, molecular analysis, and pathological analysis.

[0124] DUX4 expression in TIC-DUX4 or / and iDux4pA mice is induced. Some of the highest doses of gRNA and Cas13 shown to be safe and not cause toxicity in dose escalation studies in wild-type mice are tested. AAV delivery of gRNA and CRISPR-Cas components such as Cas13b is performed in neonatal or young adult mice. Neonatal injections are performed on postnatal days 1 to 3. A volume of 10 microliters is used for neonatal injections, either intramuscularly or via temporal vein injection. Adult injections are performed by either intramuscularly or via tail vein injection. At various time points following Cas13 / gRNA gene delivery, the animals' blood, organs, and limb muscles are tested (including measurements of strength and activity parameters) and / or collected for various molecular, histological, functional, and physiological analyses to determine therapeutic efficacy.

[0125] Example 10 DUX4 activity in FSHD myotubes was decreased after transfection of Cas13b and gRNA plasmids To determine whether the DUX4-mRNA targeting gRNA sequence disclosed herein can reduce DUX4 protein activity, 500,000 FSHD myoblasts (15A) were electroporated with 3 μg of Cas13b and 6 μg of gRNA plasmid. The cells were then differentiated into myotubes for 7 days after adding differentiation medium. Total RNA was isolated using the TRIZOL® method according to the manufacturer's protocol, and qRT-PCR was performed for three DUX4 activity biomarkers, namely, TRIM43, MBD3L2, and PRAMEF12.

[0126] Quantitative real-time PCR analysis of DUX4 biomarker Cas13b and gRNA plasmids (3 and 6 μg, respectively) were co-transfected into FSHD myoblasts (15A, 500,000 cells / reaction) using the Lonza Nucleofector Kit (Lonza, VVPD-1001) and then cultured in 12-well plates. After 24 h, the growth medium was discarded and fresh differentiation medium was added to the cells intended to differentiate myoblasts into myotubes. The cells were allowed to differentiate for 7–9 days. Total RNA was extracted using Trizol (Fisher, Waltham, MA) according to the manufacturer's protocol. The quality and quantity of the isolated RNA was checked by Nanodrop, then DNase treated (DNA-Free, Ambion, TX) and used for RT-PCR using random hexamers (Applied Biosystems cDNA Archive Kit; Applied Biosystems, Foster City, CA). The subsequent cDNA samples were then used as templates for Taqman Assays using pre-designed TRIM43, MBD3L2, and PRAMEF12 (biomarkers of DUX4 activity) and human RPL13A control primer / probe sets (Applied Biosystems). Each sample was performed in triplicate, and the experiment was repeated three times. All data was normalized to Cas13b-expressing samples.

[0127] Figure 6A-C show qRT-PCR results of inhibition of DUX4 activity as indicated by the decrease in the relative expression levels of various DUX 4 targets (biomarkers), namely TRIM43 (Figure 6A), MBD3L2 (Figure 6B), and PRAMEF12 (Figure 6C), relative to DUX4 activity after transfection with Cas13b and various gRNA plasmids. Human RPL13A was used as a reference gene. The expression levels of these biomarkers were normalized to myotubes transfected with only Cas13b as a negative control. The expression levels of each of the three biomarkers were decreased after transfection with Cas13b and gRNA compared to only Cas13b-transfected cells.

[0128] Compared to Cas13b-transfected cells (control), all gRNAs tested were able to reduce the expression levels of all three biomarkers (Figure 6A-C).

[0129] These experiments show that the gRNA sequence disclosed herein successfully reduces DUX4 activity, as shown by the reduction in the expression of DUX4 biomarker.These experiments also show that multiple copies of the gRNA sequence in one AAV vector plasmid are effective in reducing the expression of DUX4 biomarker.

[0130] Example 11 Selection of additional DUX4-mRNA-targeting gRNAs Additional DUX4-mRNA-targeting gRNA sequences (i.e., gRNAs 13-16) were designed and selected for their ability to target the DUX4 protein and reduce its toxicity.

[0131] Guide RNAs 13 and 14 encode the DUX4 polyA signal (PLAM),

[0132] gRNA 13 targeting site: TGTGCCCTTGTTCTCCGTGAAATTCTGGC (SEQ ID NO: 55), and

[0133] gRNA14 targeting site: Designed to target GTGCGCACCCCGGCTGACGTGCAAGGGAGC (SEQ ID NO:56).

[0134] Guide RNAs 15 and 16 target DUX4 exon 1,

[0135] gRNA15 targeting site: TCCCGGAGTCCAGGATTCAGATCTGGTTTC (SEQ ID NO: 57), and

[0136] gRNA16 targeting site: Designed to target CTGGTTTCAGAATCGAAGGGCCAGGCACCC (SEQ ID NO:58).

[0137] These additional gRNAs were also tested in the experiments described herein and were shown to be effective in reducing DUX4 expression.

[0138] Example 12 Expression of DUX4-mRNA silenced by Cas13b and gRNA The ability of each gRNA to silence DUX4 was investigated using luciferase and in vitro fluorescence assays.

[0139] Luciferase assay The dual luciferase reporter plasmid was modified from Psicheck2 (Promega) with a firefly luciferase cassette serving as a transfection control, and the human DUX4 gene (3'UTR including coding region and intron) cloned downstream of the Renilla luciferase stop codon serving as the 3'UTR (Wallace et al., 2018, Pre-clinical Safety and Off-Target Studies to Support Translation of AAV-Mediated RNAi Therapy for FSHD, Mol Ther Methods Clin Dev.). HEK293 cells were co-transfected (Lipofectamine 2000; Invitrogen) with the luciferase DUX4 reporter, Cas13b, and individual U6.gRNA expression plasmids at a molar ratio of 1:6:28. DUX4 gene silencing was determined as previously described (Wallace et al., RNA interference inhibits DUX4-induced muscle toxicity in vivo: implications for a targeted FSHD therapy. Mol. Ther. 2012;20:1417-1423.) Triplicate data were averaged per experiment, and individual experiments were performed three times. Results are reported as the mean ratio of Renilla to firefly luciferase activity ± SD for all combination experiments.

[0140] All gRNAs were able to target DUX4 and reduce Renilla luciferase expression, with the most significant silencing seen in this particular assay being achieved by gRNAs 1, 2, and 15 (Figure 7).

[0141] In vitro fluorescence assay HEK293 cells were co-transfected with a plasmid containing the human DUX4 gene (with the 3'UTR containing the coding region and an intron) cloned downstream of an mCherry stop codon as the 3'UTR, and Cas13b and gRNA expression plasmids (gRNA1 and gRNA2). Cells were photographed 48 hours after transfection.

[0142] Expression of mCherry (as an indicator of DUX4 expression) was significantly reduced in cells treated with gRNAs 1 and 2 compared to a non-targeting gRNA (gRNA12) or compared to cells transfected with Cas13b alone (Figure 8).

[0143] Each of the gRNAs tested was found to reduce DUX4 expression in vitro.

[0144] Example 13 Testing in the neonatal TIC-DUX4 mouse model TIC-DUX4 mice can be induced by tamoxifen to develop mild and progressive muscle pathology.Therefore, TIC-DUX4 mice receive 1mg / kg tamoxifen three times a week to develop muscle pathology and measure the effect of administration of Cas13 and gRNA of the present disclosure on muscle pathology.Mice are treated and sacrificed at different times after treatment with Cas13 and gRNA1.

[0145] WAP 4 disulfide core domain protein 3 (WFDC3) expression levels increased in mouse muscles (tibialis anterior (TA), gastrocnemius (GAS), and triceps (TRI)) over time (Figure 9A) with tamoxifen treatment alone as an indicator of progressive muscle pathology. DUX4-mediated muscle damage increased in mouse muscles (TA and GAS) over time (30, 37, and 44 days) (Figure 9B).

[0146] One- to two-day-old TIC-DUX4 pups received unilateral co-injections of 5e10 AAV.Cas13 and AAV.gRNA1. Four weeks later, mice began receiving 1 mg / kg tamoxifen three times a week for four weeks. Expression of WFDC3 in treated muscles was normalized to untreated muscles of the same mice. Expression levels of WFDC3 (as measured by quantitative RT-PCR) in muscles of neonatal mice (TA (Figure 9C), Quad (Figure 9D), and Gas (Figure 9E)) were decreased after treatment with Cas13 and gRNA1, showing a significant reduction (*P<0.02) (Figure 9D).

[0147] This study demonstrates the efficacy of the CRISPR-Cas13-DUX4 system in vivo and provides evidence of CRISPR-Cas13-mediated inhibition of DUX4 expression in vivo.

[0148] Example 14 Reducing DUX4 toxicity and protecting cells from apoptosis Each gRNA was then tested for its ability to reduce DUX4-induced apoptosis in transfected cells via a caspase 3 / 7 assay.

[0149] Cell death assay To investigate the ability of gRNAs to reduce DUX4 toxicity and protect cells from apoptosis, caspase 3 / 7 assays were performed. HEK293 cells (50,000 cells / well) were co-transfected with 30 ng of DUX4 plasmid, 80 ng of Cas13b plasmid, and 350 ng of each gRNA expression plasmid using lipofectamine 2000 and plated in 96-well plates. Cell death was measured using the Apo-ONE Homogeneous caspase-3 / 7 Assay (Promega, Madison, WI) 48 hours after transfection using a fluorescent plate reader (Spectra max M2, Molecular Devices, Sunnyvale, CA). Three individual assays were performed in triplicate (n=3), and data were reported as the average caspase activity relative to the control transfected with DUX4 alone.

[0150] Each gRNA reduced caspase 3 / 7 activity compared to cells transfected with DUX4 only (control) (Figure 10), indicating that gRNAs 1-11 and 13-16 reduced the toxicity of DUX4 and protected cells from apoptosis. Cell viability assays performed showed that each gRNA increased the viability of treated cells, i.e., reduced DUX4-induced apoptosis.

[0151] Example 15 Inhibition of DUX4 expression in mouse muscle in vivo To investigate the ability of AAV.CRISPR-Cas13 therapy to target DUX4 in muscle, adult mice were co-injected with DUX4 (1E9), ssAAV6-Cas13b (2.5 E10), and scAAV6-gRNA1 (5E10), or DUX4 alone (1E9) into the TA muscle.

[0152] Three weeks after injection, the mice were sacrificed and the TA muscles were extracted and frozen for histology and molecular analysis. As described herein, DUX4 protein can function as a transcriptional activator of other genes in human and mouse cells. Therefore, any changes in the expression levels of DUX4 target genes are widely used as an indicator of DUX4 activity in humans and mice.

[0153] The DUX4 activation biomarkers in mice are WFDC3 and TRIM36. In this experiment, QRT-PCR was performed on RNA / cDNA taken from treated and untreated muscles using WFDC3 probe and primers. Figure 11 shows the reduction in the expression levels of DUX4 activation biomarkers (indicated by the relative expression of WFDC3) 3 weeks after co-injection of sAAV6-Cas13b and scAAV6-gRNA1 (5e10) into mouse TA followed by injection of DUX4 (1e9). As shown in Figure 11, a greater than 80% reduction in the expression levels of WFDC3 was detected in treated muscles compared to untreated muscles.

[0154] While the present disclosure has been described in terms of specific embodiments, those skilled in the art will recognize that variations and modifications thereof occur, and therefore only such limitations as appear in the claims should be placed on the present disclosure.

[0155] All documents referenced in this application are incorporated herein by reference in their entirety.

[0156] The nucleotide and amino acid sequences disclosed herein are set forth in Table 1, set forth below. [Table 1-1] [Table 1-2] [Table 1-3]

Table 1-4

Table 1-5

Table 1-6

Table 1-7

Claims

[Claim 1] The invention described in the specification.

Images