Manipulation of eif3 to modulate repeat associated non-ATG (RAN) translation
Patent Information
- Application Number
- JP2024190590
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2016-04-04
- Filing Date
- 2024-10-30
- Publication Date
- 2025-11-11
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
Current understanding of repeat-associated non-ATG (RAN) translation mechanisms is limited, and there is a need for effective methods to modulate RAN protein translation, which is associated with various diseases.
The use of eukaryotic initiation factor 3 (eIF3) modulators, such as proteins, nucleic acids, or small molecules, to contact cells expressing RAN protein, thereby modulating its translation.
This approach effectively reduces RAN protein translation, potentially treating diseases associated with RAN protein accumulation by targeting specific eIF3 subunits and their regulatory functions.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[Technical field]
[0001] Related Applications This application claims the benefit under 35 U.S.C. 119(e) of U.S. Provisional Application No. 62 / 318,200, filed April 4, 2016, entitled "Manipulation of EIF3 to Regulate Repeat-Associated Non-ATG (RAN) Translation," the entire contents of which are incorporated herein by reference.
[0002] Federally Sponsored Research This invention was made with Government support under R37NS040389 awarded by the NIH. The Government has certain rights in this invention. [Background technology]
[0003] background Since the initial discovery of repeat-associated non-ATG (RAN) translation, an increasing number of disease-associated repeats have been found to undergo RAN translation. Although RAN protein toxicity has been shown in transfected cells and model systems, suggesting the relevance of RAN translation to disease pathogenesis, the understanding of the mechanism of RAN translation has not improved since the initial discovery of RAN translation. Hairpin-forming CAG, but not non-hairpin-forming CAA expansions have been observed to undergo RAN translation in transfected cells. Furthermore, it has been observed that all other repeat expansions reported to undergo RAN translation can also form complex RNA structures such as intrastrand hairpins and G-quadruplexes. These data suggest that RAN translation occurs in an RNA structure-dependent manner. Furthermore, larger repeat expansions are generally associated with higher levels of RAN protein accumulation in transfected cells, suggesting that an increased number of repeats favors RAN translation. Further cis- and trans-factors involved in RAN translation remain to be elucidated. Summary of the Invention
[0004] Summary of the Invention In some embodiments, aspects of the disclosure provide methods of modulating repeat-associated non-ATG protein (RAN protein) translation by contacting a cell expressing the repeat-associated non-ATG protein (RAN protein) with an effective amount of a eukaryotic initiation factor 3 (eIF3) modulating agent.
[0005] In some embodiments, the RAN protein is poly-alanine, poly-leucine, poly-serine, poly-cysteine, poly-Leu-Pro-Ala-Cys (SEQ ID NO:6) (e.g., associated with DM2), poly-Gln-Ala-Gly-Arg (SEQ ID NO:5) (e.g., associated with DM2), poly-Gly-Pro, poly-Gly-Arg, poly-Gly-Ala (e.g., sense C9orf72 ALS / FTD), or poly-Pro-Ala, poly-Pro-Arg, poly-Gly-Pro (e.g., antisense C9orf72 ALS / FTD). In some embodiments, the RAN protein is not poly-glutamine. In some embodiments, the RAN protein comprises about 10 to about 100 poly-amino acid repeats. In some embodiments, the RAN protein comprises about 20 to about 75 poly-amino acid repeats. In some embodiments, the RAN protein comprises about 30 to about 200 poly-amino acid repeats. In some embodiments, the RAN protein comprises at least 35 poly-amino acid repeats. In some embodiments, the RAN protein comprises at least 100 poly-amino acid repeats. In some embodiments, the RAN protein comprises at least 200 poly-amino acid repeats (e.g., at least 500, 1000, 2000, 2500, 5000, 10000, etc. poly-amino acid repeats).
[0006] In some embodiments, the RAN protein is associated with Huntington's disease (HD, HDL2), Fragile X syndrome (FRAXA), Spinal-bulbar muscular atrophy (SBMA), Dentatorubral-Pallidoluysian atrophy (DRPLA), Spinocerebellar ataxia 1 (SCA1), Spinocerebellar ataxia 2 (SCA2), Spinocerebellar ataxia 3 (SCA3), Spinocerebellar ataxia 6 (SCA6), Spinocerebellar ataxia 7 (SCA7), Spinocerebellar ataxia 8 (SCA8), Spinocerebellar ataxia 9 (SCA10), Spinocerebellar ataxia 11 (SCA11), Spinocerebellar ataxia 12 (SCA12), Spinocerebellar ataxia 13 (SCA13), Spinocerebellar ataxia 14 (SCA14), Spinocerebellar ataxia 15 (SCA15), Spinocerebellar ataxia 16 (SCA16), Spinocerebellar ataxia 17 (SCA17), Spinocerebellar ataxia 18 (SCA18), Spinocerebellar ataxia 19 (SCA19), Spinocerebellar ataxia 20 (SCA20), Spinocerebellar ataxia 21 (SCA21), Spinocerebellar ataxia 22 (SCA22), Spinocerebellar ataxia 23 (SCA23), Spinocerebellar ataxia 24 (SCA24), Spinocerebellar ataxia 25 (SCA25), Spinocerebellar ataxia 26 (SCA26), Spinocerebellar ataxia 27 (SCA27), Spinocerebellar ataxia 28 (SCA28), Spinocere The gene is encoded by a gene associated with amyotrophic lateral sclerosis (ALS), spinocerebellar ataxia type 36 (SCA36), spinocerebellar ataxia type 29 (SCA29), spinocerebellar ataxia type 10 (SCA10), myotonic dystrophy type 1 (DM1), myotonic dystrophy type 2 (DM2), or Fuchs' corneal dystrophy (e.g., CTG181).
[0007] In some embodiments, the eIF3 regulator is a protein, such as an antibody, a nucleic acid, or a small molecule. In some embodiments, the eIF3 regulator is an inhibitory nucleic acid. In some embodiments, the inhibitory nucleic acid is an interfering RNA selected from the group consisting of dsRNA, siRNA, shRNA, mi-RNA, and artificial miRNA (ami-RNA). In some embodiments, the inhibitory nucleic acid is an antisense nucleic acid, such as an antisense oligonucleotide (ASO), or a nucleic acid aptamer, such as an RNA aptamer. In some embodiments, the interfering RNA is an siRNA. In some embodiments, the interfering RNA specifically binds (e.g., hybridizes) to the nucleic acid encoding eIF3 (e.g., the nucleic acid encoding eIF3 subunit).
[0008] It should be understood that an eIF3 modulating agent can reduce the expression of a nucleic acid encoding an eIF3 subunit (e.g., an eIF3F nucleic acid) or the expression of an eIF3 protein (e.g., an eIF3f subunit). In some embodiments, the eIF3 modulating agent reduces the expression of an eIF3 subunit selected from the group consisting of eIF3a, eIF3b, eIF3c, eIF3d, eIF3e, eIF3f, eIF3g, eIF3h, eIF3i, eIF3j, eIF3k, eIF3l, and eIF3m. In some embodiments, the eIF3 inhibitor reduces the expression of eIF3f or eIF3m. In some embodiments, the eIF3 modulating agent reduces expression of a nucleic acid encoding an eIF3 subunit selected from the group consisting of eIF3A, eIF3B, eIF3C, eIF3D, eIF3E, eIF3F, eIF3G, eIF3H, eIF3I, eIF3J, eIF3K, eIF3L, and eIF3M. In some embodiments, the eIF3 inhibitor reduces expression of eIF3f or eIF3m. In some embodiments, the eIF3 inhibitor reduces expression of eIF3F or eIF3M.
[0009] In some embodiments, the eIF3 modulating agent increases the expression of an eIF3 subunit selected from the group consisting of eIF3a, eIF3b, eIF3c, eIF3d, eIF3e, eIF3f, eIF3g, eIF3h, eIF3i, eIF3j, eIF3k, eIF3l, and eIF3m. In some embodiments, the eIF3 inhibitor increases the expression of eIF3h. In some embodiments, the eIF3 modulating agent increases the expression of a nucleic acid encoding an eIF3 subunit selected from the group consisting of eIF3A, eIF3B, eIF3C, eIF3D, eIF3E, eIF3F, eIF3G, eIF3H, eIF3I, eIF3J, eIF3K, eIF3L, and eIF3M. In some embodiments, the eIF3 inhibitor increases the expression of eIF3f or eIF3m. In some embodiments, the eIF3 inhibitor increases the expression of eIF3F or eIF3M.
[0010] In some embodiments, the cells are located in a subject. In some embodiments, the cells are located in the subject's brain, optionally in the white matter of the brain. In some embodiments, the subject is an animal. In some embodiments, the subject is a mammal. In some embodiments, the subject is a human.
[0011] In some embodiments, aspects of the disclosure provide methods of treating a disease associated with repeat-associated non-ATG protein (RAN protein) translation by administering an effective amount of a eukaryotic initiation factor 3 (eIF3) modulating agent to a subject expressing the repeat-associated non-ATG protein (RAN protein).
[0012] In some embodiments, the RAN protein is not poly-glutamine. In some embodiments, the RAN protein is poly-alanine, poly-leucine, poly-serine, poly-cysteine, poly-glutamine, poly-Leu-Pro-Ala-Cys (SEQ ID NO:6) (e.g., associated with DM2), poly-Gln-Ala-Gly-Arg (SEQ ID NO:5) (e.g., associated with DM2), poly-Gly-Pro, poly-Gly-Arg, poly-Gly-Ala (e.g., sense C9orf72 ALS / FTD), or poly-Pro-Ala, poly-Pro-Arg, poly-Gly-Pro (e.g., antisense C9orf72 ALS / FTD). In some embodiments, the RAN protein comprises at least 35 poly-amino acid repeats. In some embodiments, the RAN protein comprises about 10 to about 100 poly-amino acid repeats. In some embodiments, the RAN protein comprises about 20 to about 75 poly-amino acid repeats. In some embodiments, the RAN protein comprises about 30 to about 200 poly-amino acid repeats. In some embodiments, the RAN protein comprises at least 100 poly-amino acid repeats. In some embodiments, the RAN protein comprises at least 200 poly-amino acid repeats (e.g., at least 500, 1000, 2000, 2500, 5000, 10000, etc. poly-amino acid repeats).
[0013] In some embodiments, the disease associated with repetitive non-ATG protein (RAN protein) translation is Huntington's disease (HD, HDL2), Fragile X syndrome (FRAXA), Spinal-bulbar muscular atrophy (SBMA), Dentatorubral-Pallidoluysian atrophy (DRPLA), Spinocerebellar ataxia 1 (SCA1), Spinocerebellar ataxia 2 (SCA2), Spinocerebellar ataxia 3 (SCA3), Spinocerebellar ataxia 6 (SCA6), Spinocerebellar ataxia 7 (SCA7), Spinocerebellar ataxia 8 (SCA9), Spinocerebellar ataxia 9 (SCA10), Spinocerebellar ataxia 10 (SCA11), Spinocerebellar ataxia 11 (SCA12), Spinocerebellar ataxia 12 (SCA13), Spinocerebellar ataxia 13 (SCA14), Spinocerebellar ataxia 14 (SCA15), Spinocerebellar ataxia 15 (SCA16), Spinocerebellar ataxia 16 (SCA17), Spinocerebellar ataxia 17 (SCA18), Spinocerebellar ataxia 18 (SCA19), Spinocerebellar ataxia 19 ... The patient may have spinocerebellar ataxia 8 (SCA8), spinocerebellar ataxia 12 (SCA12), or spinocerebellar ataxia 17 (SCA17), amyotrophic lateral sclerosis (ALS), spinocerebellar ataxia type 36 (SCA36), spinocerebellar ataxia type 29 (SCA29), spinocerebellar ataxia type 10 (SCA10), myotonic dystrophy type 1 (DM1), myotonic dystrophy type 2 (DM2), or Fuchs' corneal dystrophy (e.g., CTG181).
[0014] In some embodiments, the eIF3 regulator is a protein, such as an antibody, a nucleic acid, or a small molecule.In some embodiments, the eIF3 regulator is an inhibitory nucleic acid.In some embodiments, the inhibitory nucleic acid is an interfering RNA selected from the group consisting of dsRNA, siRNA, shRNA, mi-RNA, and ami-RNA.In some embodiments, the inhibitory nucleic acid is an antisense nucleic acid, such as an antisense oligonucleotide (ASO), or a nucleic acid aptamer, such as an RNA aptamer.In some embodiments, the interfering RNA is an siRNA.
[0015] In some embodiments, the eIF3 regulating agent reduces the expression of eIF3f. In some embodiments, the eIF3 regulating agent reduces the expression of eIF3m. In some embodiments, the eIF3 regulating agent reduces the expression of eIF3F. In some embodiments, the eIF3 regulating agent reduces the expression of eIF3M. In some embodiments, both an eIF3 regulating agent that reduces the expression of eIF3f and an eIF3 regulating agent that reduces the expression of eIF3m are administered to the subject.
[0016] In some embodiments, the method further comprises administering an additional therapeutic agent for a disease associated with repetitive non-ATG protein (RAN protein) translation. In some embodiments, the additional therapeutic agent is an antibody (e.g., an antibody that specifically binds to the RAN repeat expansion or an antibody that specifically binds to a unique region of the RAN protein that is the C-terminus of the repeat expansion) or an additional inhibitory nucleic acid. In some embodiments, the antibody specifically binds to the poly-Ser RAN repeat expansion. In some embodiments, the antibody binds to the C-terminal region of the protein that contains the poly-Ser RAN repeat expansion.
[0017] In some embodiments, the eIF3 modulating agent increases expression of eIF3h.
[0018] In some embodiments, the subject is an animal. In some embodiments, the subject is a mammal. In some embodiments, the subject is a human.
[0019] In some embodiments, the compositions comprise one or more (eg, 2, 3, 4, 5, or more) agents that modulate the expression and / or activity of eIF3 (eg, of one or more subunits of eIF3).
[0020] In some aspects, the disclosure provides methods for treating a disease associated with repetitive non-ATG protein (RAN protein) translation comprising administering to a subject expressing a RAN protein an effective amount of an antibody that specifically binds to the RAN repeat expansion, or an antibody that specifically binds to a unique region of the RAN protein that is C-terminal to the repeat expansion.
[0021] In some embodiments, the antibody binds to a poly-serine (poly-Ser) repeat expansion. In some embodiments, the antibody binds to a unique region of the RAN protein that is C-terminal to the repeat expansion. In some embodiments, the unique region of the RAN protein that is C-terminal to the repeat expansion is or comprises the sequence shown in SEQ ID NO:9.
[0022] In some embodiments, the antibodies described by the present disclosure (e.g., antibodies that specifically bind to the RAN repeat expansion or antibodies that specifically bind to a unique region of the RAN protein that is C-terminal to the repeat expansion) target (e.g., immunospecifically bind to) RAN protein aggregates in a subject. In some embodiments, the anti-RAN protein antibodies bind to intracellular RAN protein (e.g., bind to RAN protein in the cytoplasm or nucleus of a cell). In some embodiments, the anti-RAN protein antibodies bind to extracellular RAN protein (e.g., bind to RAN protein on the outside of the extracellular membrane of a cell).
[0023] These and other aspects of the present application are described in more detail herein and illustrated by the following non-limiting drawings. [Brief description of the drawings]
[0024] [Figure 1] Figures 1A-1C show that eIF3F knockdown causes a reduction in polyAla RAN. Figure 1A shows a schematic showing the plasmids used. ATG in polyGln frame. Sequence corresponds to SEQ ID NO: 18. Figures 1B-1C show Western blots showing a reduction in polyAla but not polyGlu in the presence of eIF3F knockdown (KD).
[0025] [Diagram 2] Figures 2A-2D show that eIF3F and eIF3M knockdown, but not eIF3H knockdown, reduces RAN in the polyAla frame. Figure 2A shows a schematic of the eIF3 complex organization. Figure 2B shows the RAN expression construct. The ATG is in the polyAla frame. The sequence corresponds to SEQ ID NO: 18. Figures 2C-2D show that polyAla levels are reduced by eIF3M siRNA treatment but increased by eIF3H siRNA treatment.
[0026] [Diagram 3] Figures 3A-3C show that eIF3F controls RAN translation in all three frames across the CAG expansion. Figure 3A shows a RAN expression construct that does not have a nearby cognate start site. The sequence corresponds to SEQ ID NO: 19. Figure 3B shows a Western blot demonstrating that RAN reduces three frames. PolySer shows both soluble (top) and insoluble (bottom) fractions. Figure 3C shows a Western blot demonstrating efficient knockdown of eIF3F protein.
[0027] [Figure 4] Figures 4A-4B show the effect of eIF3F knockdown in the context of ATXN8. Figure 4A shows the ATXN8 gene and the protein expressed across the CAG repeat. The amino acid and nucleic acid sequences (top to bottom) are represented by SEQ ID NOs: 11-13. Figure 4B shows that expression of the polySer frame in ATXN8 is eIF3F-knockdown sensitive due to AUG and close cognates in polyGln and polyAla frames.
[0028] [Diagram 5] Figure 5A-5B show the effect of eIF3F in C9orf72 (ALS) and DM2 situations. Figure 5A shows C9orf72 minigene (top) and protein blot (bottom) showing that eIF3F siRNA reduces GP RAN protein. Figure 5B shows DM2 minigene (top) and protein blot (bottom) showing that eIF3F siRNA reduces QAGR RAN protein.
[0029] [Figure 6-1]Figures 6A-6E show that polySer protein accumulates in white matter regions of the brain. Figure 6A shows the amino acid sequence of polySer RAN protein with a unique C-terminus (SEQ ID NO: 14). The peptide sequences used to generate rabbit polyclonal antibodies are underlined (SSSKARFSNMKDPG, SEQ ID NO: 15) and RVNLSVEAGSQKRQSE, SEQ ID NO: 16). Figure 6B shows a schematic diagram of the Flag-Ser-CT construct expressing an ATG-initiated N-terminal Flag epitope tagged polySer extension protein followed by an endogenous C-terminal sequence. The sequence corresponds to SEQ ID NO: 20. Co-localization of immunofluorescence (IF) staining with α-Flag and α-SerCT1 in HEK293T cells transfected with Flag-Ser-CT but not pre-immune serum. Figure 6C shows colocalization of immunofluorescence (IF) staining with α-Flag and α-SerCT2 in HEK293T cells transfected with Flag-Ser-CT but not pcDNA3.1. Figure 6D shows immunoblots showing detection of recombinant polySer protein with α-Flag (left) and α-SerCT2 (right) in lysates of HEK293T cells transfected with Flag-Ser-CT (second lane) but not pcDNA3.1 (first lane). Figure 6E shows immunohistochemistry (IHC) of SCA8 BAC mouse cerebellum, showing that polyGln but not polySer accumulates in Purkinje cells. In contrast, polySer is seen in the molecular layer and cerebellar white matter. (Insert: higher magnification of molecular layer and white matter. [Figure 6-2] Same as above. [Figure 6-3] Same as above.
[0030] [Figure 7] Figure 7 shows that polySer accumulation increases with age and disease severity. Representative images of the vestibular nuclei, cuneate nucleus, and motor cortex layers II / III of SCA8 BAC mice (n=3) at February (left panel), June (middle panel), and end stages stained with α-SerCT are shown. Typical aggregates are indicated by arrows.
[0031] [Figure 8-1] Figures 8A-8D show that SCA8 BAC mice exhibit white matter abnormalities at sites of polySer accumulation. Figure 8A shows the observed sites of polySer accumulation as shown by SerCT in deep cerebellar white matter as shown in cerebellum and brainstem SCA8 BAC mice but not NT mice, with vacuolization as shown by H&E, associated demyelination as shown by luxol fast blue staining (LFB), and axonal degeneration as shown by α-SMI-32. Figure 8B shows the observed sites of demyelination as shown by LFB, and axonal degeneration as shown by α-SMI-32, and polySer accumulation as detected by SerCT antibody in SCA8 human autopsy tissue. Figure 8C shows that immunohistochemistry (IHC) with CC1 (α-APC) antibody shows significantly reduced numbers of mature oligodendrocytes in SCA8 BAC mice compared to NT mice (NT n=5, SCA8 BAC n=5; **** p<0.0001; mean ± SEM; unpaired t-test). Figure 8D shows that immunofluorescence with α-GFAP antibody shows significantly increased astrogliosis in SCA8 BAC mice compared to NT mice (NT n=3, SCA8 BAC n=3, ** p<0.01; mean ± SEM; unpaired t-test). [Figure 8-2] Same as above. [Figure 8-3] Same as above.
[0032] [Figure 9-1]Figures 9A-9F show that mammalian translation factor eIF3F is upregulated in symptomatic SCA8 BAC mice and can control RAN translation. Figure 9A shows a bar graph showing relative Eif3f expression levels in SCA8 BAC mice compared to littermates. p<0.0001; mean±SEM; unpaired t-test). Figure 9B shows a schematic showing constructs used for eiF3F knockdown experiments. All constructs have tags in each of the three reading frames. M indicates methionine-initiated reading frame. All sequences correspond to SEQ ID NO: 18. Figure 9C shows dot blot detection of polySer expression using α-FLAG antibody showing a reduction in RAN poly-Ser but not ATG polySer when cells are co-transfected with eIF3F siRNA. Figure 9D shows quantification of polySer detection. *p<0.05; ns not significant; mean±SEM; unpaired t-test. Figure 9E shows detection of polyAla expression using α-HA antibody showing a decrease in RAN poly-Ala but not ATG polyAla when cells are co-transfected with eIF3F siRNA. Figure 9F shows quantification of polyAla detection. *p<0.05; ns not significant; mean±SEM; unpaired t-test. [Figure 9-2] Same as above. [Figure 9-3] Same as above. [Figure 9-4] Same as above.
[0033] [Figure 10-1]Figures 10A-10C show that the mammalian translation factor eIF3F can be regulated across GGGGCC, CAGG and CCTG repeats. Figure 10A shows protein blotting of RAN protein expression detected with α-FLAG antibody showing reduced RAN protein accumulation in cells co-transfected with GGGGCC or CAGG constructs and eIF3F siRNA and increased RAN protein accumulation in cells co-transfected with CCTG and eIF3F siRNA. Figure 10B shows quantification of protein blots. *p<0.05; ns not significant; mean±SEM; unpaired t-test. Figure 10C shows that eIF3F knockdown reduces the levels of GP and QAGR RAN proteins expressed from constructs lacking the ATG start codon and increases the levels of LPAC tetrapeptide protein expressed across CCUG-extended RNA. [Figure 10-2] Same as above.
[0034] [Figure 11-1] Figures 11A-11E show the development of anti-Ser antibodies that bind to poly-Ser repeats. Figure 11A shows a schematic of the predicted proteins translated from the sense and antisense transcripts resulting from the CAG repeats. Figure 11B shows the peptide sequence (SEQ ID NO: 17) used to generate the anti-Ser antibody (top) and the poly-Ser expression construct with a C-terminal FLAG tag (bottom). Figure 11C shows poly-Ser detected in cells by immunoblotting with anti-Ser antibody. Figure 11D shows immunofluorescence detection of poly-Ser with a C-terminal FLAG-tag with anti-FLAG and anti-Ser antibodies. Figure 11E shows immunohistochemistry (IHC) staining of human SCA8 and control autopsy tissues with anti-Ser antibody. [Figure 11-2] Same as above. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0035] In eukaryotes, the protein translation machinery, including ribosome, initiation factor (eIF) and specific steps of translation initiation and elongation, is well conserved.However, it has been reported that the components of the translation machinery, including ribosomal protein, ribosomal RNA, tRNA and eIF3 subunit, vary between cell types and developmental stages.According to an aspect of the present disclosure, the cell or tissue-specific heterogeneity of one or more of these factors (for example, one or more eIF3 subunits) constitutes the variability of RAN protein accumulation in brain in some embodiments.
[0036] Eukaryotic initiation factor 3 (eIF3) is a multiprotein complex involved in the initiation step of eukaryotic protein translation. Generally, in humans, eIF3 contains 13 non-identical subunits (e.g., eIF3a-m). Mammalian eIF3, the largest and most complex initiation factor, contains up to 13 non-identical subunits. Generally, eIF3f is involved in many steps of translation initiation, including stabilizing the ternary complex, mediating the binding of mRNA to the 40S subunit, and promoting the dissociation of the 40S and 60S ribosomal subunits. In some embodiments, other non-conserved mammalian eIF3 subunits can play a regulatory role in eIF3 function, affecting RNA translation (e.g., eIF3m). In some embodiments, eIF3 complexes have been observed to interact with viral and cellular IRES in an RNA structure-dependent manner, indicating that this is a role in non-canonical translation events. In some embodiments, eIF3f plays an important role in RAN translation, and manipulation of eIF3F / eIF3f or other eIF3 subunits (eg, eIF3M / eIF3m) can be useful to regulate RAN protein expression.
[0037] RAN protein translation An aspect of the present disclosure relates to the discovery that one or more eIF3 subunits are regulators of repeat-associated non-ATG (RAN) protein translation. A "RAN protein (repeat-associated non-ATG translation protein)" is a polypeptide translated from a bidirectionally transcribed sense or antisense RNA sequence that has a nucleotide expansion in the absence of an AUG start codon. Generally, RAN proteins contain an expanded repeat of amino acids called a polyamino acid repeat. For example, "AAAAAAAAAAAAAAAAAA" (poly-alanine) (SEQ ID NO: 1), "LLLLLLLLLLLLLLLLLL" (poly-leucine) (SEQ ID NO: 2), "SSSSSSSSSSSSSSSSSSSS" (poly-serine) (SEQ ID NO: 3), or "CCCCCCCCCCCCCCCCCC" (poly-cysteine) (SEQ ID NO: 4) are polyamino acid repeats that are each 20 amino acid residues in length. The RAN protein can have a polyamino acid repeat that is at least 25, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, or at least 200 amino acid residues in length. In some embodiments, the RAN protein has a polyamino acid repeat that is 200 or more amino acid residues in length.
[0038] Generally, RAN protein is translated from abnormal repeat expansion (e.g., CAG repeat) of DNA. Without wishing to be bound by any particular theory, RAN protein accumulation (e.g., in the nucleus or cytoplasm of cell) disrupts cell function and induces cytotoxicity. Thus, in some embodiments, RAN protein translation and accumulation are associated with disease or disorder, such as neurodegenerative disease or disorder. Examples of disorders and diseases associated with RAN protein translation and accumulation include, but are not limited to, spinocerebellar ataxia type 8 (SCA8), myotonic dystrophy type 1 (DM1), fragile X tremor ataxia syndrome (FXTAS) and C9ORF72 amyotrophic lateral sclerosis / frontotemporal dementia (ALS / FTD).
[0039] Methods of Treating Diseases and Disorders Associated with Ran Protein Translation or Accumulation - Patent application In some embodiments, the compositions and methods described by this disclosure are useful for reducing or inhibiting RAN protein translation or accumulation in a cell or a subject (e.g., a subject having a disorder or disease associated with RAN translation). In some embodiments, the cell is in vitro. In some embodiments, the subject is a mammalian subject. In some embodiments, the subject is a human subject.
[0040] In some aspects, the present disclosure provides a method of treating a disease associated with repeat non-ATG protein (RAN protein) translation by administering an effective amount of a eukaryotic initiation factor 3 (eIF3) modulating agent to a subject expressing the repeat non-ATG protein (RAN protein).
[0041] In some aspects, the present disclosure provides a method of treating a disease associated with repetitive non-ATG protein (RAN protein) translation by administering an antibody (e.g., an antibody that specifically binds to a RAN repeat expansion or an antibody that specifically binds to a unique region of a RAN protein that is C-terminal to the repeat expansion) to a subject expressing the repetitive non-ATG protein (RAN protein). In some embodiments, the antibody specifically binds to a poly-Ser RAN repeat expansion. In some embodiments, the antibody binds to the C-terminal region of a protein that contains a poly-Ser RAN repeat expansion.
[0042] In some embodiments, the disease associated with repetitive non-ATG protein (RAN protein) translation is Huntington's disease (HD, HDL2), Fragile X syndrome (FRAXA), Spinal-bulbar muscular atrophy (SBMA), Dentatorubral-Pallidoluysian atrophy (DRPLA), Spinocerebellar ataxia 1 (SCA1), Spinocerebellar ataxia 2 (SCA2), Spinocerebellar ataxia 3 (SCA3), Spinocerebellar ataxia 6 (SCA6), Spinocerebellar ataxia 7 (SCA7), Spinocerebellar ataxia 8 (SCA9), Spinocerebellar ataxia 9 (SCA10), Spinocerebellar ataxia 10 (SCA11), Spinocerebellar ataxia 11 (SCA12), Spinocerebellar ataxia 12 (SCA13), Spinocerebellar ataxia 13 (SCA14), Spinocerebellar ataxia 14 (SCA15), Spinocerebellar ataxia 15 (SCA16), Spinocerebellar ataxia 16 (SCA17), Spinocerebellar ataxia 17 (SCA18), Spinocerebellar ataxia 18 (SCA19), Spinocerebellar ataxia 19 ... The patient may have spinocerebellar ataxia 8 (SCA8), spinocerebellar ataxia 12 (SCA12) or spinocerebellar ataxia 17 (SCA17), amyotrophic lateral sclerosis (ALS), spinocerebellar ataxia type 36 (SCA36), spinocerebellar ataxia type 29 (SCA29), spinocerebellar ataxia type 10 (SCA10), myotonic dystrophy type 1 (DM1), myotonic dystrophy type 2 (DM2), or Fuchs' corneal dystrophy (e.g., CTG181).
[0043] As used herein, an "effective amount" is a dose of a therapeutic agent sufficient to provide a medically desirable result, such as treatment or amelioration of one or more signs or symptoms caused by a disease or disorder associated with RAN protein translation or accumulation (e.g., a neurodegenerative disease). The effective amount will vary depending on the age and health of the subject being treated, the severity of the disease or disorder in the subject (e.g., the amount of RAN protein accumulation, or the cytotoxicity caused by such accumulation), the duration of treatment, the nature of any concomitant therapy, the particular route of administration, and similar factors within the knowledge and expertise of the health practitioner.
[0044] In some embodiments, the method for treating the disease associated with repetitive non-ATG protein (RAN protein) translation described by the present disclosure further comprises administering one or more additional therapeutic agents to the subject.The identification and selection of suitable additional therapeutic agents are within the capabilities of those skilled in the art, and vary according to the disease that the subject suffers from.For example, in some embodiments, one or more therapeutic agents for Huntington's disease (e.g., tetrabenazine, amantadine, chlorpromazine, etc.), fragile X syndrome (e.g., selective serotonin reuptake inhibitors, carbamazepine, methylphenidate, trazodone, etc.), spinocerebellar ataxia (e.g., baclofen, riluzole, amantadine, varenicline, etc.), or amyotrophic lateral sclerosis (ALS) (e.g., riluzole, etc.), myotonic dystrophy type 1 (tideglobus, mexiletine, etc.) are administered to the subject.
[0045] Administration of the treatment may be accomplished by any method known in the art (see, e.g., Harrison's Principle of Internal Medicine, McGraw Hill Inc.). Administration may be local or systemic. Administration may be parenteral (e.g., intravenous, subcutaneous, or intradermal) or oral. Compositions for different routes of administration are well known in the art (see, e.g., Remington's Pharmaceutical Sciences by EW Martin). Dosage depends on the subject and the route of administration. Dosage can be determined by one skilled in the art.
[0046] Routes of administration include, but are not limited to, oral, parenteral, intravenous, intramuscular, intraperitoneal, intranasal, sublingual, intratracheal, inhalation, subcutaneous, ocular, vaginal, and rectal. Systemic routes include oral and parenteral. For administration by inhalation, several types of devices are regularly used. These types of devices include metered dose inhalers (MDIs), breath-actuated MDIs, dry powder inhalers (DPIs), spacer / holding chambers combined with MDIs, and nebulizers.
[0047] In some embodiments, the treatment of the disease associated with RAN protein expression is administered to the central nervous system (CNS) of a subject in need thereof.As used herein, "central nervous system (CNS)" refers to all cells and tissues of the brain and spinal cord of a subject, including but not limited to neurons, glial cells, astrocytes, cerebrospinal fluid, etc.The mode of administration of the therapeutic agent to the CNS of a subject includes direct injection into the brain (e.g., intracerebral injection, intraventricular injection, intraparenchymal injection, etc.), direct injection into the spinal cord of a subject (e.g., intrathecal injection, lumbar injection, etc.), or any combination thereof.
[0048] In some embodiments, the treatment described by the present disclosure is administered systemically to the subject, for example by intravenous injection. In some embodiments, the therapeutic molecule (e.g., eIF3 regulator or anti-RAN protein antibody) that is administered systemically can be modified to improve the delivery of the molecule to the CNS of the subject. Examples of modifications that improve the CNS delivery of therapeutic molecules include, but are not limited to, co-administration or conjugation with blood-brain barrier targeting agents (e.g., transferrin, melanotransferrin, low-density lipoprotein (LDL), angioleiomyomatosis, RVG peptide, etc., as disclosed in Georgiva et al., Pharmaceuticals 6(4):557-583 (2014)), co-administration with BBB disrupting agents (e.g., bradykinin), and physical disruption of the BBB before administration (e.g., MRI-Guided Focused Ultrasound), etc.
[0049] The eIF3 regulator or anti-RAN protein antibody (e.g., antibody that binds to RAN protein) may be delivered by any suitable manner known in the art. In some embodiments, the eIF3 regulator (e.g., eiF3 interfering RNA or antibody that binds to RAN protein) is delivered to the subject by a vector such as a viral vector (e.g., adenoviral vector, recombinant adeno-associated viral vector (rAAV vector), lentiviral vector, etc.) or a plasmid-based vector.
[0050] Aspects of the present disclosure relate to the surprising discovery that robust SCA8 polySer RAN accumulation is detected in deep cerebellar white matter in SCA8 mice and SCA8 human autopsy tissue.Therefore, in some embodiments of the method described by the present disclosure, an effective amount of eIF3 modulator is delivered to the white matter of the brain of a subject.
[0051] eIF3 Modulators In some embodiments, one or more subunits of eIF3 control RAN translation.In some embodiments, one or more agents that regulate (e.g., increase or decrease expression) the expression of eIF3 subunits (e.g., eIF3f, eIF3m, eIF3h, or other eIF3 subunits) can be used to regulate RAN translation in cells or subjects (e.g., subjects with diseases or conditions associated with RAN translation).In some aspects, the present disclosure is based on the discovery that in some embodiments, the isoform of the F subunit of eIF3 complex (eIF3f) controls RAN translation in certain brain regions, such as white matter regions of human brain.
[0052] In an aspect, the present disclosure relates to the discovery that administration of one or more modulators of eIF3 (e.g., one or more activators, or one or more inhibitors) to a subject (e.g., a cell of a subject) can be used to control repeat-associated non-ATG (RAN) translation in one or more proteins. As used herein, "modulator of eIF3" refers to an agent that directly or indirectly affects the expression level or activity of the eIF3 protein complex or eIF3 complex subunits (e.g., eIF3f, eIF3m, etc.). The modulator can be an activator of eIF3 or eIF3 subunits (e.g., increases expression or activity of eIF3 or eIF3 subunits) or an inhibitor of eIF3 or eIF3 subunits (e.g., decreases expression or activity of eIF3 or eIF3 subunits).
[0053] Generally, a direct modulator functions by interacting with (e.g., interacting or binding to) eIF3 (or eIF3 subunits), or eIF3 protein complexes, or genes encoding eIF3 subunits. Generally, an indirect modulator functions by interacting with genes or proteins that control the expression or activity of eIF3 or eIF3 subunits (e.g., do not directly interact with genes or proteins encoding eIF3 or eIF3 subunits). In some embodiments, the modulator of eIF3 is a selective modulator. "Selective modulator" refers to a modulator of eIF3 that preferentially regulates the activity or expression of one type of eIF3 subunit compared to another type of eIF3 subunit. In some embodiments, the modulator of eIF3 is a selective modulator of eIF3f.
[0054] The eIF3 inhibitor can be a protein (e.g., an antibody), a nucleic acid, or a small molecule. Examples of proteins that inhibit eiF3 (e.g., an eIF3 subunit) include, but are not limited to, polyclonal anti-eIF3 antibodies, monoclonal anti-eIF3 antibodies, measles virus N protein, viral stress-inducible protein p56, and the like. Examples of nucleic acid molecules that inhibit eiF3 (e.g., an eIF3 subunit) include, but are not limited to, dsRNA, siRNA, miRNA, and the like that target genes encoding eIF3 subunits. Examples of small molecule inhibitors of eIF3 include, but are not limited to, mTOR inhibitors (e.g., rapamycin, PP242), S6 kinase (S6K) inhibitors, and the like.
[0055] In some embodiments, the eIF3 regulator is an inhibitory nucleic acid. In some embodiments, the inhibitory nucleic acid is an interfering RNA selected from the group consisting of dsRNA, siRNA, shRNA, mi-RNA and ami-RNA. In some embodiments, the inhibitory nucleic acid is an antisense nucleic acid (e.g., antisense oligonucleotide (ASO)) or a nucleic acid aptamer (e.g., an RNA aptamer). In general, the inhibitory RNA molecule can be unmodified or modified. In some embodiments, the inhibitory RNA molecule comprises one or more modified oligonucleotides, such as phosphorothioate, 2'-O-methyl, and the like, and such modifications have been recognized in the art as improving the stability of oligonucleotides in vivo.
[0056] In some embodiments, the interfering RNA comprises a sequence complementary to between 5 and 50 contiguous nucleotides (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, about 30, about 35, about 40, or about 50 contiguous nucleotides) of a nucleic acid sequence (such as an RNA sequence) encoding an eIF3 subunit. Examples of nucleic acid sequences encoding eIF3 subunits are listed under GenBank Accession No. NM_003750.2 (eIF3a), GenBank Accession No. NM_003751.3 (eIF3b), GenBank Accession No. NM_003752.4 (eIF3c), GenBank Accession No. NM_003753.3 (eIF3d), GenBank Accession No. NM_001568.2 (eIF3e), GenBank Accession No. NM_003754.2 (eIF3f), GenBank Accession No. NM_003755.2 (eIF3g), GenBank Accession No. NM_003756.2 (eIF3h), GenBank Accession No. NM_003757.2 (eIF3i), GenBank Accession No. NM_003758.2 (eIF3j), GenBank Accession No. NM_003759.2 (eIF3k), GenBank Accession No. NM_003750.2 (eIF3i), GenBank Accession No. NM_003751.3 (eIF3b), GenBank Accession No. NM_003752.4 (eIF3c), GenBank Accession No. NM_003753.3 (eIF3d), GenBank Accession No. NM_001568.2 (eIF3e), GenBank Accession No. NM_003754.2 (eIF3f), GenBank Accession No. NM_003755.2 (eIF3i), GenBank Accession No. NM_003755.2 (eIF3k), GenBank Accession No. NM_003756.2 (eIF3i), GenBank Accession No. NM_003757.2 (eIF3k), GenBank Accession No. NM_0037 GenBank Accession No. NM_003755.4 (eIF3g), GenBank Accession No. NM_003756.2 (eIF3h), GenBank Accession No. NM_003757.3 (eIF3i), GenBank Accession No. NM_003758.3 (eIF3j), GenBank Accession No. NM_013234.3 (eIF3k), GenBank Accession No. NM_016091.3 (eIF3l), GenBank Accession No. NM_006360.5 (eiF3m), etc. In some embodiments, the interfering RNA is an siRNA. In some embodiments, an eIF3f siRNA is administered (e.g., Dharmacon Cat #J-019535-08). In some embodiments, an eIF3m siRNA is administered (e.g., Dharmacon Cat #J-016219-12). In some embodiments, eIF3h siRNA is administered (eg, Dharmacon Cat #J-003883-07).
[0057] In some embodiments, eIF3f is a negative regulator of RAN translation, and a decrease in the level of human eIF3f is associated with a decrease in the accumulation of RAN protein in cells.In some embodiments, RAN translation (e.g., in cells expressing RAN protein) is different from close cognate translation or AUG translation and is sensitive to eIF3f knockdown.In some embodiments, the translation machinery used for RAN translation is different from the AUG and nearby AUG translation machinery in cells.
[0058] In some embodiments, increasing eIF3f levels or activity (e.g., via ectopic expression of eIF3f) can increase RAN translation. In some embodiments, this can be useful for increasing RAN translation efficiency or for inducing RAN translation in cells (e.g., for creating cellular or animal models of RAN translation). In some embodiments, eIF3f can be added to an in vitro cell-free translation system to support or promote RAN translation.
[0059] In some embodiments, one or more modulators (e.g., one or more activators or one or more inhibitors) of one or more subunits of eIF3 are administered to a subject to treat a disease associated with nucleic acid repeat expansion (e.g., associated with repeat-associated non-ATG translation).For example, in some embodiments, a modulator of 2, 3, 4, 5, 6, 7, 8, 9, or 10 of one or more subunits of eIF3 is administered to a subject.
[0060] In certain microsatellite expansion disorders, such as C9-ALS / FTD, RAN protein from GGGGCC repeat expansion has been shown to accumulate in gray matter regions. Two of the three antisense reading frames have in-frame AUG start codons. According to aspects of the present disclosure, in-frame AUG and nearby AUG codons can explain the more widespread RAN protein accumulation in this disease (e.g., C9-ALS / FTD) than in white matter regions. In some embodiments, RAN translation occurs in the presence of an upstream AUG start codon, and regulation of eIF3f / F affects protein accumulation in those reading frames (e.g., PR and GP made from antisense GGCCCC expansion transcripts of C9orf72 ALS / FTD).
[0061] In some embodiments, eIF3f controls RAN translation for reading frames without any nearby cognate start codons.In some embodiments, RAN translation for reading frames without any nearby cognate start codons contributes to white matter specific accumulation of RAN protein from these frames.Thus, in some embodiments, RAN protein accumulation in white matter of a subject can be regulated by regulating eIF3 as described herein.In some embodiments, eIF3f regulation can regulate RAN protein accumulation in other non-white matter tissues.
[0062] In some embodiments, eIF3f in white matter regions may induce peptides from repeat-containing transcripts (more than 60% of the human genome is composed of repeat elements) under non-pathological conditions. Interestingly, the human MBP gene, which encodes one of the most abundant white matter-specific proteins, myelin basic protein, contains highly polymorphic but non-pathogenic (TGGA)n repeats within the first exon (Boylan et al., 1990). In some embodiments, MPB and / or other white matter-specific genes containing repeat expansions can be translated via RAN translation to give rise to peptides in human white matter. According to aspects of the present disclosure, the translation of such peptides can be controlled via eIF3 as described herein.
[0063] Anti-RAN protein antibody In some aspects, the present disclosure relates to an antibody that specifically binds to a RAN repeat expansion or specifically binds to a unique region of a RAN protein that is the C-terminus of the repeat expansion. In some embodiments, the antibody specifically binds to a poly-Ser RAN repeat expansion. In some embodiments, the antibody binds to the C-terminal region of a protein that contains a poly-Ser RAN repeat expansion. In some embodiments, the anti-RAN antibody binds to an intracellular RAN protein. In some embodiments, the anti-RAN antibody binds to an extracellular RAN protein.
[0064] Anti-RAN antibodies can be polyclonal or monoclonal. Typically, polyclonal antibodies are produced by inoculation of a suitable mammal, such as a mouse, rabbit, or goat. Larger mammals are often preferred because of the greater amount of serum that can be recovered. Typically, an antigen (e.g., an antigen containing a poly-Ser repeat region) is injected into the mammal. This induces B lymphocytes to produce IgG immunoglobulins specific for the antigen. The polyclonal IgG is purified from the serum of the mammal. Monoclonal antibodies are generally produced by a single cell line (e.g., a hybridoma cell line). In some embodiments, anti-RAN antibodies are purified (e.g., isolated from serum).
[0065] Many methods may be used to obtain anti-RAN antibodies. For example, antibodies may be produced using recombinant DNA methods. Monoclonal antibodies may also be produced by the generation of hybridomas (see, e.g., Kohler and Milstein (1975) Nature, 256:495-499) according to known methods. Hybridomas formed in this manner are then screened using standard methods, such as enzyme-linked immunosorbent assay (ELISA) and surface plasmon resonance (e.g., OCTET or BIACORE) analysis, to identify one or more hybridomas that produce an antibody that specifically binds to a particular antigen. Any form of a particular antigen (e.g., RAN protein) may be used as an immunogen, for example, recombinant antigen, naturally occurring form, any variant or fragment thereof. One typical method of making antibodies involves screening a protein expression library, such as a phage or ribosome display library, that expresses the antibody or a fragment thereof (e.g., scFv). Phage display is described, for example, in Ladner et al. U.S. Pat. No. 5,223,409; Smith (1985) Science 228:1315-1317; Clackson et al. (1991) Nature, 352:624-628; Marks et al. (1991) J. Mol. Biol., 222:581-597, WO 92 / 18619; WO 91 / 17271; WO 92 / 20791; WO 92 / 15679; WO 93 / 01288; WO 92 / 01047; WO 92 / 09690; and WO 90 / 02809.
[0066] In addition to using display libraries, a specific antigen (e.g., one or more RAN proteins such as poly-Ser) can be used to immunize a non-human animal, such as a rodent, e.g., a mouse, a hamster, or a rat. In one embodiment, the non-human animal is a mouse.
[0067] In other embodiments, monoclonal antibodies are obtained from non-human animals and then modified, e.g., chimerized, using recombinant DNA techniques known in the art.Various approaches to making chimeric antibodies have been described.See, for example, Morrison et al., Proc. Natl. Acad. Sci. USA 81:6851,1985; Takeda et al., Nature 314:452,1985; Cabilly et al., U.S. Patent No. 4,816,567; Boss et al., U.S. Patent No. 4,816,397; Tanaguchi et al., European Patent Publication EP 171496; European Patent Publication No. 0173494, British Patent No. 2177096B.
[0068] Antibodies can also be humanized by methods known in the art. For example, monoclonal antibodies with desired binding specificity can be commercially humanized (Scotgene, Scotland; and Oxford Molecular, Palo Alto, Calif). Fully humanized antibodies, such as those expressed in transgenic animals, are within the scope of the present invention (see, for example, Green et al. (1994) Nature Genetics 7,13; and U.S. Patent Nos. 5,545,806 and 5,569,825).
[0069] For additional antibody production techniques, see Antibodies: A Laboratory Manual, 2nd Edition, edited by Edward A. Greenfield, Dana-Farber Cancer Institute, © 2014. The present disclosure is not necessarily limited to a particular source, method of production, or other special characteristics of the antibodies.
[0070] These and other aspects of the present application are illustrated by the following non-limiting examples. EXAMPLES
[0071] Example 1 More than 40 diseases are caused by microsatellite expansion mutations. The mechanisms by which repeat expansion mutations make proteins vary. Expansion mutations can code for aggregates prone to expanded proteins when expressed as part of an ATG-initiated open reading frame. The expansion can result in a protein in the presence of a close cognate AUG-like start codon (typically one that is changed from AUG by one nucleotide). In these cases, the canonical protein translation machinery is typically used. In addition, hairpin-forming expansion mutations can also express expanded proteins in all three reading frames without an AUG start codon. This process is termed repeat-associated non-ATG (RAN) translation and has been reported in an increasing number of neurological diseases, including spinocerebellar ataxia type 8, myotonic dystrophy, amyotrophic lateral sclerosis, and frontotemporal dementia.
[0072] This example describes that the regulation of eIF3 complex (e.g., via inhibitors such as RNAi molecules) affects RAN translation. This example describes that siRNA knockdown of eIF3F and eIF3M RNA, which encodes the eIF3f and eIF3m protein subunits of eIF3 complex, reduces the steady-state level of RAN protein expressed across CAG, CAGG, CCUG and G4C2 expansion mutations. Conversely, overexpression of eIF3f and eIF3m increases RAN translation in some embodiments. This finding has potential therapeutic relevance for a broad category of diseases caused by microsatellite expansion mutations.
[0073] Decreased levels of eIF3F result in downregulation of RAN translation in the absence of AUG or a close cognate AUG-like initiation codon To investigate the role of eIF3F in RAN translation, siRNA was used to knock down eIF3F expression in HEK293T cells. Co-transfection experiments were performed with the repeat-containing plasmid, ATG-(CAG)exp and control siRNA, eIF3F siRNA, or, as a negative control, MRI1 siRNA (eIF2B subunit-like protein). The plasmid ATG-(CAG)n contains an ATG start codon in a polyGln frame. Because the poly-Ser expansion protein expressed from this construct has solubility issues, polyAla was used as a readout for RAN translation. A dramatic reduction in polyAla expression was observed in cells transfected with the ATG-(CAG)n plasmid together with eIF3F-specific siRNA, compared to both control and MRI1-specific siRNA transfections. In contrast, ATG-initiated polyGln expression did not seem to be affected by eIF3F knockdown, indicating that canonical translation is not as sensitive as RAN translation to eIF3F levels (Figure 1A-1C).
[0074] We examined the effects of eIF3m and eIF3h, two other eIF3 subunits that directly interact with eIF3F. The eIF3-m, -a, -c, -e, -l, and -k subunits have been shown to assemble via interactions of their polymerization domains. The -f and -h subunits bind to each other and to the rest of the complex via interactions between -f and -m. Downregulation of eIF3m shows a similar decrease in the levels of polyAla RAN protein. This is consistent with the decrease seen with eIF3f reduction, as eIF3f is loaded to the rest of the complex via eIF3m.
[0075] The second binding partner, eIF3h, shows the opposite effect of increasing the level of polyAla RAN protein with eIF3H siRNA knockdown, indicating that eIF3h subunit normally prevents RAN translation (Figure 2A-D). The eIF3h subunit has been reported to mediate translation from an upstream open reading frame (uORF) at AUG or a close cognate start codon, indicating that this factor favors initiation at AUG or a close cognate AUG-like codon and can negatively regulate RAN translation. Thus, mutants of the eiF3 complex affect the efficiency of canonical and RAN translation in some embodiments. Specifically, when eIF3h is absent from the core complex, eIF3f can still bind to the core eIF3 complex, favoring RAN translation and downregulating canonical translation.
[0076] To examine whether the regulatory effect of eIF3f is polyAla specific, a second plasmid (HDL2-mut) containing an expanded CAG repeat with modified HDL2 in the 5' flanking sequence upstream of the repeat was examined. This construct does not contain an AUG or close AUG start codon between the stop codon and the repeat region in any of the reading frames. eIF3f downregulation results in reduced RAN protein accumulation in all three frames (Figures 3A-3B). As polySer RAN protein does not run well in polyacrylamide gels, it is shown in both insoluble and soluble fractions. An efficient knockdown of eIF3f protein levels is also shown (Figure 3C).
[0077] The effect of eIF3f knockdown on RAN translation in the context of ATXN8 was examined (Figure 4A-4B). A construct (KMQ-3T) with the 5' flanking region from the ATXN8 locus was used. An ATG start codon is present in frame with polyGln. This double transfection experiment with KMQ-3T plasmid and eIF3f-targeting siRNA revealed that only protein translation from the polySer frame was sensitive to eIF3f levels, whereas polyGln and polyAla were not affected by eIF3f knockdown. This result on polyGln translation indicates that the in-frame AUG start codon drives expression of polyGln via canonical translation. In addition, a close cognate AUA is present in frame with polyAla. The AUA codon has been shown to be used with approximately 60% efficiency to initiate canonical translation in rabbit reticulocytes and can also drive canonical translation in the polyAla frame in this context. Thus, the regulatory effect of eIF3f is present only for polySer frames that do not contain any of the reported nearby cognate start sites.
[0078] The effect of eIF3f knockdown on RAN translation was examined in the ALS and DM2 contexts. Figures 5A-5B show the effect of eIF3F in the C9orf72 (ALS) and DM2 contexts. Figure 5A shows the C9orf72 minigene (top) and protein blot (bottom) showing that eIF3F siRNA reduces GP RAN protein. Figure 5B shows the DM2 minigene (top) and protein blot (bottom) showing that eIF3F siRNA reduces QAGR RAN protein.
[0079] Taken together, these experiments in transfected cells indicate that RAN translation, which initiates without close cognate codon usage and met-tRNA association, employs a specific translational machinery that associates with the eIF3f and eIF3m subunits.
[0080] Example 2 PolySer proteins accumulate in white matter regions of the brain To test whether PolySer RAN protein accumulates in SCA8, we generated rabbit polyclonal antibodies directed to two non-overlapping peptide sequences within the unique C-terminal region of the predicted SCA8 PolySer protein (Figure 6A). We demonstrated the specificity of these antibodies using cells transfected with a plasmid expressing an epitope-tagged PolySer protein with the predicted C-terminal region (Figure 6B-6D). Immunohistochemistry (IHC) was performed to detect SCA8 PolySer RAN protein in vivo. The IHC distribution of PolySer RAN was compared to that of the SCA8 polyGln expansion protein in SCA8 mice. Although both proteins are expressed from the ATXN8 sense transcript, their distribution patterns are strikingly different. IHC performed on consecutive cerebellar sections shows that polyGln but not polySer aggregates accumulate in Purkinje cells. In contrast, polySer, but not polyGln aggregates, are found in the molecular layer and deep cerebellar white matter (Figure 6E). PolyGln staining in these regions is primarily nuclear. In contrast, polySer aggregates show perinuclear or intraneuronal localization in these regions. Similar to mouse, SCA8 polySer and polyGln proteins accumulate in distinct regions of human autopsy tissue, with polySer found primarily in the deep cerebellar white matter and polyGln in Purkinje cell nuclei.
[0081] In summary, the SCA8 polySer and polyGln proteins, which are co-expressed from the ATXN8 transcript, display strikingly distinct accumulation patterns. SCA8 RAN polySer aggregates are found primarily in white matter and neuropil regions throughout the brain. In contrast, polyGln aggregates are found in cerebellar Purkinje cells and other neurons throughout the brain. These data indicate that differences in cell-specific expression, localization or turnover of these proteins result in their distinct cellular accumulation patterns, and that polySer RAN protein may contribute to disease by affecting white matter regions.
[0082] SCA8 polySer aggregates increase with age and disease progression To examine whether polySer RAN protein aggregate burden changes with time and disease progression, IHC at different ages was performed at 2 months of age (when animals showed no obvious abnormalities), 6 months of age (when a prominent phenotype was evident and would be lethal without further care), and 10 months of age (when animals showed advanced end-stage disease). At 2 months of age, IHC revealed very small, pin-like polySer aggregates that were found infrequently in the brainstem (Figure 7), but were undetectable in the frontal cortex. At 6 months of age, the size and number of polySer RAN aggregates had increased substantially in the brainstem, and small aggregates were now evident throughout the frontal cortex. At approximately 10 months of age (end-stage with symptomatic disease), polySer aggregates had increased in size and were more abundant in both the brainstem and frontal cortex (Figure 7).
[0083] In summary, polySer RAN protein burden increases with age and disease progression in SCA8 mice. Early polySer RAN protein accumulation within the neuropil of the brainstem is consistent with the early motor abnormalities seen in 2-month-old animals. Furthermore, detection of polySer RAN aggregates throughout the frontal cortex at later stages of the disease is consistent with multiple reports of cortical involvement in SCA8 patients.
[0084] RAN polySer-positive white matter regions display a degenerative phenotype H&E staining of severely damaged SCA8 mice shows widespread vacuolization of subcortical and deep white matter in the cerebellum, including the dentate nucleus (Figure 8A). Vacuolization was also observed in subcortical white matter regions of the cerebral cortex and in white matter tracts throughout the brainstem (Figure 8A). Serial sections of the cerebellum and brainstem were examined to observe whether demyelination and axonal degeneration were noted in polySer-positive regions. Luxol Fast Blue (LFB) staining shows demyelination in both the cerebellum and brainstem from SCA8 mice compared to controls. Consistently, IHC using an antibody against the dephosphorylated form of neurofilament H showed evidence of axonal degeneration (Figure 8A). Similar changes were observed in human autopsy tissue with demyelination and axonal degeneration observed in sites with polySer accumulation (Figure 8B).
[0085] To further characterize oligodendrocyte abnormalities in polySer-positive white matter regions, IHC with a cytoplasmic marker of mature oligodendrocytes (CC1) was performed in mice. Consistent with the demyelination data, these data show a decrease in the number of mature oligodendrocytes in the deep cerebellar white matter regions of SCA8 animals compared to controls (Figure 8C). Furthermore, GFAP staining of the deep cerebellar white matter shows evidence of reactive astrogliosis in SCA8 compared to NT animals, which have a 50% increase in relative GFAP staining (Figure 8D).
[0086] Taken together, these data indicate that polySer-positive white matter regions in SCA8 mice exhibit oligodendrocyte loss, astrogliosis, demyelination and axonal degeneration.
[0087] RAN translation is regulated by eIF3F, a translation factor with increased white matter expression Accumulation of SCA8 polySer RAN protein in white matter regions indicates that RAN translation may be more efficient in certain cell types or brain regions. Transcriptomics data was analyzed and it was observed that eIF3F, a eukaryotic translation factor, is elevated in white matter. RNAseq data showed a 2.13-fold increase in eIF3F RNA levels during the later stages of the disease, which correlated with increased RAN protein aggregation, compared to control mice (Figure 9A). These data indicate that eIF3F may increase RAN translation at later stages of the disease and also explain the preferential accumulation of RAN polySer protein in white matter.
[0088] A series of cell culture experiments were performed in which the effect of eIF3F knockdown was examined on extended proteins expressed from constructs with and without an ATG start codon. The effect of eIF3F knockdown on polySer RAN protein expression using minigenes with and without an ATG start codon in the polySer frame was examined (Figure 9B). siRNA knockdown of eIF3F reduces steady-state levels of polySer protein expressed using A8 and CAG constructs that do not contain an ATG start codon to 47% (p<0.05) and 34% (p<0.01) compared to control siRNA (Figure 9C). In contrast, eIF3F knockdown reduces the steady-state levels of polySer protein expressed using DM1(M) constructs that contain an ATG start codon in the polySer frame. s) did not affect polySer levels in cells transfected with the DM1-3T construct (Figure 9D). Similarly, steady-state levels of polyAla RAN protein expressed from constructs (A8 and DM1) that do not contain an ATG start codon in the polyAla reading frame are reduced by eIF3F knockdown to 53% (p<0.05) and 28% (p<0.05), respectively (Figure 9E and Figure 9F). Similar to the polySer results, eIF3F knockdown in the presence of an ATG start codon (CAG-3T) did not reduce polyAla accumulation. In summary, these data indicate that RAN translation of polyAla and polySer proteins across expanded CAG repeats uses an alternative protein translation machinery that engages eIF3F. In contrast, the presence of an in-frame ATG codon allows recruitment of a canonical preinitiation complex that is not sensitive to eIF3F levels.
[0089] Constructs expressing G4C2, CAGG and CCUG-expanded RNAs associated with repeat expansion motifs found in other diseases (e.g., C9ORF72, ALS / FTD and DM2) were also tested (Figure 10A). Protein levels of GlyPro(G4C2), GlnAlaGlyArg(SEQ ID NO:5)(CAGG), LeuProAlaCys(SEQ ID NO:6)(CCUG) were measured by protein blotting. Similar to the CAG expansion results, eIF3F knockdown reduced the levels of GP (0.57 p<0.05) and QAGR (0.12 p<0.05) RAN proteins expressed from constructs lacking the ATG start codon. In contrast, eIF3F knockdown increased the levels of LPAC tetrapeptide protein expressed across the CCUG-expanded RNA (2.8, p<0.05) (Figures 10B-10C).
[0090] Taken together, these data indicate that RAN translation can be reduced in multiple reading frames and across multiple repeat motifs, including CAG, G4C2 and CAGG repeats.
[0091] material and method DNA constructs and siRNA The Flag-polySer-CT construct was made by subcloning the ATNX8 genomic sequence containing the 82 repeat CAG expansion with 188 bp downstream sequence into the p3XFlag-myc-CMV-24 vector (Sigma, E 6151) in the CAG orientation. The genomic DNA used to generate this clone was amplified by PCR using genomic DNA from a SCA8 BAC-expanded mouse (2878) and using a 5' primer (5'AGCTGAAGCTTGTTAAAAGAAGATAATATATTTAAAAAATGCAG3'; SEQ ID NO:7) containing an added HindIII restriction enzyme site and a 3' primer (5'AGTCTGAATTCCCTAGTTCTTGGCTCCAGACTAAC3'; SEQ ID NO:8) containing an added EcoRI restriction enzyme site. The 5' primer also contains a T / G base substitution to avoid the insertion of a stop codon in the AGC reading frame between the N-terminal flag and the repeat region. The PCR product was cut with HindIII / EcoRI and cloned into p3XFlag-myc-CMV-24 cut with the same enzymes. The presence of the N-terminal Flag epitope tag in polySer(AGC) frame, the 82 CAG repeats and the 3' flanking region spanning the first stop codon in the polySer frame were confirmed by Sanger sequencing. ATG(CAG103)-3T, A8(KMQ)-3T, DM1-Ser(M), GGGGCC-3T were generated previously. siRNA targeting human eIF3F and control non-targeting siRNA were ordered from commercial sources.
[0092] Cell culture and transfection HEK293T cells were cultured in DMEM supplemented with 10% fetal bovine serum (FBS) at 37 °C and 5% CO 2The cells were incubated in a humid atmosphere containing 0.1% CO. Plasmid and siRNA transfections were performed with Lipofectamine 2000 (Invitrogen). Cells were harvested 48 hours after transfection for later analysis. For KD experiments, HEK293T cells were cleaved with 30 nM siRNA using Lipofectamine 2000. Repeat-containing plasmids and 30 nM siRNA were co-transfected 24 hours after transfection. Cells were harvested 48 hours after the first second round of transfection.
[0093] Rabbit polyclonal antibody production Polyclonal rabbit antibodies against polySer RAN protein were produced by New England Peptide. Rabbit antisera were produced against synthetic peptides Ac-CSSSKARFSNMKD-amide (SEQ ID NO: 9) and Ac-CRVNLSVEAGSQKRQSE-amide (SEQ ID NO: 10) for α-polySer1 and α-polySer2, respectively.
[0094] Mouse samples In this example, an SCA8 BAC transgenic line (Bac exp2,2878) on an FVB background was used. Haploid mice carrying the SCA8 BAC transgene were confirmed by genotyping PCR. Due to the severe motor dysfunction that appears after 5 months of age in SCA8 BAC-expanded mice, additional food (GelDiet, Clear H) was added. 2 O) was provided on the bottom of the animal's cage for >5 months. For histological analysis, animals were anesthetized with 100 mg ketamine and 20 mg xylazine per kg body weight and perfused via the ascending aorta with 15 ml isotonic saline followed by 10 ml 10% buffered formalin.
[0095] Histology and immunohistochemistry For detection of polySer RAN protein, brains were harvested and frozen in liquid nitrogen-cooled 2-methylbutane. Seven-micrometer sagittal sections were cut using a cryostat and fixed in 10% buffered formalin for 15 min. Endogenous peroxidase block was performed in 3% H 2 O 2 in methanol for 5 min. To block nonspecific binding, non-serum block (Biocare Medical, BS966M) was applied for 15 min. Primary antisera were applied in non-serum block 1:10 overnight at 4°C at the following dilutions: α-polySer1 (1:10000), α-polySer2 (1:5000) or corresponding pre-immune serum at the same dilution. Sections were washed 3 times with 1X PBS and biotin-labeled rabbit secondary antibody (Biolegend, sig-32002) was applied for 30 min at room temperature. Horseradish peroxidase-conjugated coupling reagent (Biolegend, 93028) was applied for 30 min at room temperature and detection was performed by exposure to Vector Nova Red Substrate Kit (Vector Laboratories, Inc., SK4800). For counterstaining, hematoxylin solution (Vector Laboratories, Inc., H3404) was applied for 20 s. Slides were dehydrated in graded ethanol and xylene solutions and mounted with Cytoseal 60 (Electron Microscopy Sciences, 18006).
[0096] For detection of polySer RAN protein in fixed brain tissue, animals were perfused transcardially with 1x PBS and 10% buffered formalin. Brains were harvested and stored in 10% formalin for 24 hours, then removed to 70% ethanol. After histological processing and paraffin embedding, 7-micrometer sagittal sections were cut using a microtome. Sections were deparaffinized in xylene (15 min) and rehydrated in an alcohol gradient (10 min). Sections were then subjected to the following antigen retrieval steps: First, 1 mM CaCl 21. Treatment with 1ug / mL proteinase K in 50mM Tris buffer (pH=7.6) at 37℃ for 30 minutes. 2. Pressure in 10mM EDTA (pH=6.5) for 15 minutes using microwave as heat source. 3. Treatment with 95% formic acid for 5 minutes. Endogenous peroxidase was inhibited by 3% H 2 O 2 Sections were blocked for 10 min in methanol. To block non-specific binding, non-serum block (Biocare Medical, BS966M) was applied for 15 min. Primary antisera were applied at the same concentration of α-polySer1 (1:5000), α-polySer2 (1:10000) or corresponding pre-immune serum in non-serum block at 1:10 overnight at 4°C. Sections were washed 3 times with 1X PBS and biotin-labeled rabbit secondary antibody (Biolegend, SIG32002) was applied for 30 min at room temperature. Horseradish peroxidase-conjugated coupling reagent was applied for 30 min at room temperature and detection was performed by exposure to Vector Red Substrate Kit (Vector Laboratories, Inc., SK4800). Hematoxylin solution was applied for 20 s (Vector Laboratories, Inc., H3404).
[0097] Immunostaining experiments using CC1 (1:1000, Calbiochem), SMI-32 (1:3000, Covance) and α-Flag (1:1000, Sigma) antibodies were performed in a similar manner as above, except that mild heat-induced antigen retrieval was performed in 10 mM citrate buffer (pH=6.0) using a steamer instead of a pressurizer. For hematoxylin and eosin staining, 7-micron mouse and human brain sections were deparaffinized in xylene and dehydrated in gradient ethanol. Slides were then immersed in hematoxylin (modified Harris, Sigma Aldrich) for 1 min and washed in distilled water for 10 min. Slides were then immersed in Eosin Y (Sigma Aldrich, 71311) for 30 s and washed in distilled water for 10 min. Slides were rehydrated and coverslipped prior to visualization.
[0098] For Luxol Fast Blue (LFB) staining, 7 micron mouse and human brain sections were deparaffinized in xylene and hydrated in 95% ethyl alcohol. Sections were left in LFB solution (0.1% Luxol Fast Blue in 95% ethyl alcohol) overnight at 56°C. The following day, slides were rinsed with 95% ethyl alcohol and distilled water. Slides were then differentiated in lithium carbonate solution and 70% ethyl alcohol (30 s each) and washed with distilled water. Slides were counterstained with cresyl violet solution (0.1% cresyl violet in distilled water) for 40 s and rinsed with distilled water. Slides were rehydrated and coverslipped before visualization. Images were captured with an Olympus BX51 light microscope.
[0099] statistical analysis Statistical significance was assessed by unpaired Student's t-test. Statistics were performed using the software package Prism 5 (GraphPad Software).
[0100] Western blotting Cells were lysed in RIPA (150 mM NaCl, 1% sodium deoxycholate, 1% Triton X-100, 50 mM Tris-HCl) (pH=7.5) buffer containing proteinase inhibitors (Roche) by shaking for 30 min at 4°C. Genomic DNA was sheared through a 21-gauge needle and the lysate was centrifuged at 15000g for 15 min at 4°C. The supernatant was taken as the soluble fraction and quantified by Bradford assay (Biorad). Lysates were run on 4%-12% Bis-Tris gels (Biorad) and transferred to nitrocellulose membranes. The membrane was blotted with the antibodies: anti-myc (1:2000, Sigma, F9291), anti-Flag-HRP (1:3000, Sigma, A8592), anti-HA (1:2000, Sigma, H6533), anti-GAPDH (1:10000, Millipore, MAB374) α-polySer1 (1:10000) in 1% milk in phosphate buffered saline with Tween 20 (PBST) overnight at 4°C with shaking. The membrane was washed three times for 5 min in PBST and incubated in a secondary antibody solution conjugated to horseradish peroxidase (1:2500, GE Healthcare, NA931V) for 45 min at room temperature. The membrane was washed again in PBST and developed with application of substrate for enhanced chemiluminescence (ECL) for 1 min (PerkinElmer, NEL10400).
[0101] The pellet was resuspended in 2% SDS and incubated at 65°C. The resulting SDS-soluble fraction was immobilized on a nitrocellulose membrane using a Bio-Dot 96-well microfiltration system (Bio-Rad) under vacuum. The membrane was washed with PBST and blotted using the same protocol as for Western blotting.
[0102] Example 3 We have produced an anti-Ser antibody that binds to poly-serine (polySer) RAN protein (Figures 11A-11C). Poly-Ser is produced by translation of the second reading frame of the CAG repeat in the sense orientation (Figure 11A). A peptide sequence containing 10 serine residues (SEQ ID NO: 17) was used to produce a polyclonal antibody (anti-Ser) in rabbits. An expression construct encoding a poly-Ser protein with a C-terminal FLAG tag was also produced. Immunoblot analysis shows specific binding of anti-Ser to the poly-Ser protein (Figure 11C).
[0103] HEK293T cells were transfected with an expression construct encoding polySer and immunofluorescence assay was performed. The data show that poly-Ser protein was detected by both anti-FLAG and anti-Ser antibodies (Figure 11D). Anti-Ser antibody also stained poly-Ser protein in SCA8 human autopsy tissues but not in control human autopsy tissues (Figure 11E).
[0104] It was observed that RAN polySer showed a distinct accumulation pattern mainly in white matter regions and colocalized with white matter abnormalities. It was observed that early white matter changes play a pathogenic role in SCA8, indicating that modulation of the translation machinery is a viable therapeutic option to reduce RAN translation. The accumulation of polySer RAN protein in human SCA8 brains also indicates that polySer RAN protein is a suitable target for immunotherapy.
[0105] Many neurodegenerative diseases involve the abnormal accumulation of misfolded proteins in insoluble intracellular or extracellular aggregates. In some embodiments, the toxicity of misfolded protein aggregates is the presence of insoluble aggregates. In some embodiments, the toxicity of misfolded protein aggregates is the presence of their soluble oligomers. Thus, in some embodiments, anti-RAN protein antibodies (e.g., anti-Ser) target (e.g., immunospecifically bind) and clear RAN protein aggregates and oligomers in a subject. In some embodiments, anti-RAN protein antibodies bind to intracellular RAN protein (e.g., bind to RAN protein in the cytoplasm or nucleus of a cell). In some embodiments, RAN proteins (e.g., polyGA, poly-GP, poly-PA, etc.) are transferred between cells. In some embodiments, anti-RAN protein antibodies bind to extracellular RAN protein (e.g., bind to RAN protein on the outside of the extracellular membrane of a cell).
[0106] In some embodiments, anti-RAN protein antibodies mediate antibody-induced phagocytosis of pathological protein deposits, direct antibody-mediated destruction of aggregates, neutralization of toxic soluble proteins, neutralization of aggregated proteins, or prevention of cell-to-cell transmission of misfolded proteins.
[0107] Other Aspects All of the features disclosed herein may be combined in any combination. Each feature disclosed herein may be replaced by alternative features serving the same, equivalent, or similar purpose. Thus, unless specifically stated otherwise, each feature disclosed is only one example of a generic series of equivalent or similar features.
[0108] From the above description, those skilled in the art can easily ascertain the essential characteristics of the present disclosure, and can make various changes and modifications to the present disclosure to adapt the present disclosure to various applications and conditions without departing from the spirit and scope of the present disclosure. Accordingly, other embodiments are within the scope of the claims of the present disclosure.
[0109] Equal While several inventive embodiments have been described and illustrated herein, those of ordinary skill in the art will readily envision various other means and / or structures for performing the functions and / or obtaining the results and / or one or more of the advantages described herein, and each such variation and / or modification is deemed to be within the scope of the inventive embodiments described herein. More generally, those of ordinary skill in the art will readily recognize that all parameters, dimensions, materials, and configurations described herein are intended to be exemplary, and that the actual parameters, dimensions, materials, and / or configurations will depend on the particular application in which the teachings of the present invention are used. Those of ordinary skill in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific inventive embodiments described herein. Thus, the foregoing embodiments are presented by way of example only, and it should be understood that within the scope of the appended claims and equivalents thereto, the inventive embodiments may be practiced other than as specifically described and claimed. The inventive aspects of the present disclosure are directed to each individual feature, system, article, material, kit, and / or method described herein. In addition, any combination of two or more of such features, systems, articles, kits, and / or methods is within the inventive scope of the present disclosure, if such features, systems, articles, kits, and / or methods are not mutually inconsistent.
[0110] All definitions defined and used herein should be understood to be controlling in accordance with dictionary definitions, definitions in documents incorporated by reference, and / or ordinary meanings of the defined terms.
[0111] All publications, patents, and patent applications disclosed herein are hereby incorporated by reference with respect to the subject matter for which each is cited, and in some cases may include the entire document.
[0112] The indefinite articles "a" and "an," as used in the specification and claims, unless clearly indicated to the contrary, should be understood to mean "at least one."
[0113] As used herein and in the claims, the term "and / or" should be understood to mean "one or both" of the elements so conjoined, i.e., elements that are optionally conjunctively present and optionally disjunctively present. Multiple elements listed with "and / or" should be construed in the same manner, i.e., "one or more" of the elements so conjoined. Other elements than the elements specifically identified by the "and / or" clause may optionally be present, whether or not associated with those elements specifically identified. Thus, as a non-limiting example, when used in conjunction with open-ended language such as "comprising," a reference to "A and / or B" can mean, in one embodiment, only A (optionally including elements other than B); in another embodiment, only B (optionally including elements other than A); in yet another embodiment, both A and B (optionally including other elements); and so forth.
[0114] "Or" as used herein and in the claims should be understood to have the same meaning as "and / or" as defined above. For example, when separating items in a list, "or" or "and / or" should be interpreted as being inclusive, i.e., the inclusion of at least one of more than one of a number or list of elements, and optionally including additional unlisted items. Only terms expressly indicated to the contrary, such as "only one" or "exactly one" or "consisting of" as used in the claims, refer to the inclusion of exactly one element of a number or list of elements. In general, the term "or" as used herein will only be understood as indicating an exclusive selection (i.e., "one or the other but not both") when preceded by an exclusive term such as "any," "one," "only one," or "exactly one." "Consisting essentially of" as used in the claims has its ordinary meaning as used in the field of patent law.
[0115] The phrase "at least one" as used herein and in the claims with reference to a list of one or more elements should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed in the list of elements, and not excluding any combination of elements in the list of elements. This definition also allows for elements to be optionally present other than those specifically identified in the list of elements referred to by the phrase "at least one," whether or not associated with those elements specifically identified. Thus, as a non-limiting example, "at least one of A and B" (or, equivalently, "at least one of A or B" or, equivalently, "at least one of A and / or B") can mean, in one embodiment, at least one, optionally one or more A, in the absence of B (and optionally including elements other than B); in another embodiment, it can mean at least one, optionally more than one B, in the absence of A (and optionally including elements other than A); in yet another embodiment, it can mean at least one, optionally more than one A, and at least one, optionally more than one B (and optionally including other elements), etc.
[0116] Unless expressly stated to the contrary, in any method claimed herein that includes multiple steps or actions, it is to be understood that the order of the steps or actions of the method is not necessarily limited to the order in which the steps or actions are recited.
[0117] In the present specification and claims, all transitional phrases such as "comprising," "including," "carrying," "having," "containing," "involving," "holding," "composed of," and the like, should be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases "consisting of" and "consisting essentially of" are closed or semi-closed transitional phrases, respectively, as set forth in U.S. Patent Office Manual of Patent Examination Section 2111.03. In alternative embodiments, it should be understood that embodiments described herein using an open-ended transitional phrase (e.g., "comprising") are also contemplated as "consisting of" and "consisting essentially of" the feature described by the open-ended transitional phrase. For example, if the disclosure describes "a composition comprising A and B," the disclosure also contemplates the alternative embodiments "a composition consisting of A and B" and "a composition consisting essentially of A and B."
Claims
1. An antibody that specifically binds to a poly-serine repeat expansion in repeat-associated non-ATG translated (RAN) protein.
2. The antibody described in claim 1, wherein the poly-serine repeat expansion contains 10 serines.
3. An antibody described in claim 1 or 2, wherein the RAN protein is encoded by a Huntington's disease (HD, HDL2)-related gene.
4. An antibody that specifically binds to the C-terminal region of poly-serine repeat-associated non-ATG translated (RAN) protein.
5. The antibody described in claim 4, wherein the C-terminal region of the poly-serine RAN protein comprises the amino acid sequence of SEQ ID NO: 9 or SEQ ID NO:
10.
6. A method for producing an antibody, comprising administering a poly-serine amino acid repeat peptide to a non-human subject.
7. A method for producing an antibody, comprising introducing a poly-serine amino acid repeat peptide into a cell, optionally wherein the cell is a mammalian cell.
8. The method described in claim 6 or 7, wherein the poly-serine amino acid repeat peptide contains 10 serines.
9. A method described in any one of claims 6 to 8, wherein the poly-serine amino acid repeat peptide comprises the amino acid sequence of SEQ ID NO:
17.
10. A method for producing an antibody, comprising administering to a non-human subject a peptide comprising the C-terminal region of a poly-serine repeat-associated non-ATG translated (RAN) protein.
11. A method for producing an antibody, comprising introducing into a cell a peptide comprising the C-terminal region of a poly-serine repeat-associated non-ATG translated (RAN) protein.
12. The method described in claim 10 or 11, wherein the peptide comprises the amino acid sequence of SEQ ID NO: 9 or SEQ ID NO:
10.
13. An antibody produced by the method described in any one of claims 6 to 12.
14. An antibody described in any one of claims 1 to 5 or 13, which is a polyclonal antibody.
15. An antibody described in any one of claims 1 to 5 or 13, which is a monoclonal antibody.
16. An antibody described in any one of claims 1 to 5 or 13 to 15, which is a humanized antibody.
17. An antibody described in any one of claims 1 to 5 or 13 to 16, which is a chimeric antibody.
18. A composition for treating a disease or disorder associated with a RAN protein in a subject, the composition comprising an antibody described in any one of claims 1 to 5 or 13 to 17.
19. The composition described in claim 18, wherein the subject is a human.
20. (i) contacting the antibody of any one of claims 1 to 5 or 13 to 17 with a poly-serine RAN protein; and (ii) detecting a complex comprising said antibody and said poly-serine RNA protein. A method comprising: