Angelman syndrome antisense treatment

Abstract

To provide antisense oligonucleotides for use in the treatment of Angelman syndrome, capable of inducing expression of ubiquitin-protein ligase E3A (UBE3A) from the paternal allele in animal or human neurons.SOLUTION: The present invention provides a modified oligonucleotide comprising a contiguous nucleotide sequence of at least 18 ribonucleotides having nucleic acid complementarity to a contiguous portion of a specific nucleotide sequence, wherein the modified oligonucleotide is capable of targeting the 5'-end of a UBE3A-AS transcript.SELECTED DRAWING: Figure 1A

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application is a continuation of U.S. Provisional Application No. 62 / 593,431, filed December 1, 2017. and priority to application serial no. 62 / 676,034 filed on May 24, 2018 which are incorporated herein by reference in their entireties.

[0002] Sequence Listing This application is filed on November 30, 2018 under the title "922001-2020 Sequential Application." ence Listing_ST25" as an ASCII.txt file The contents of the sequence listing, including any sequence listing submitted in electronic form, are incorporated herein in their entirety. can be. [Background technology]

[0003] Angelman syndrome (AS) is a condition characterized by severe intellectual and motor disabilities, epilepsy, and sleep disorders. AS is a neurodevelopmental disorder associated with cognitive impairment, cognitive impairment, and an abnormally "happy" temperament. Individuals with the condition are often diagnosed at age 2-3 years and have a normal lifespan. Currently, there are no treatment options for individuals with AS. There are few treatment options, most of which are antiepileptic drugs to treat seizures. Includes.

[0004] Angelman syndrome is a maternally inherited ubiquitin-protein ligase E3A (UBE3A) gene expression or function. Unlike genes, UBE3A is genomic imprinted. Printing is the process of turning off one allele of a gene while leaving the other allele on. This is a naturally occurring, rare phenomenon in neurons of the central nervous system (CNS). In mice, the paternal UBE3A allele is turned off, but the UB Both alleles of E3A are on. Therefore, AS is always maternally inherited. It is caused by mutations affecting the UBE3A allele.

[0005] The paternal UBE3A allele harbors several protein-coding and non-coding transgenes. The UBE3A antisense transcript (UBE UBE3A-AS is switched off by the paternal allele and CN It is expressed only in neurons of S, which turns off the expression of the paternal UBE3A allele. Why UBE3A is imprinted in neurons It is unclear whether this is the case, but it is possible that an inactive but functional copy of UBE3A exists on the paternal chromosome. Because of the presence of a copy of the gene that causes AS, it creates a unique opportunity to treat individuals with AS. Research to date has shown that turning on the paternal UBE3A allele can treat AS. These results indicate that this is a viable treatment for Summary of the Invention [Problem to be solved by the invention]

[0006] Here, we show that the 5'-end of the UBE3A-AS transcript is important for its stability. Based on these findings, antisense oligonucleotides ( ASO) terminates transcription of UBE3A-AS and reactivates expression of the paternal UBE3A allele The 5'-end of UBE3A-AS was designed to target this region. These targeted ASOs terminate the transcription of UBE3A-AS and inhibit the paternal UBE3A The SNHG14 is compatible with several They are polycistronic transcripts that code for different RNAs. [Means for solving the problem]

[0007] Therefore, herein, the 5′-antisense transcript of UBE3A (UBE3A-AS) The 3'-end of SNORD115 and SNORD109B are thought to represent the '-end. At least 98% (i.e., 98%, 99%) of the target exon between the 5'-end of 10-30 nucleotides long (i.e., 1 0, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 , 24, 25, 26, 27, 28, 29, or 30 consecutive nucleotides In particular, the target exon is located in human chromosome 15, human genome assembly UBE3, which corresponds to positions 25,511,577 to 25,516,681 on Buri hg19 In some embodiments, the target nucleic acid may be in the 5'-end of UBE3A. -AS is one of five exons located in the 5'-end of 25,5 11,577-25,511,761 (exon 1), 25,512,059-25,5 12,191 (exon 2), 25,513,476-25,513,600 (exon 3), 25,514,752–25,514,880 (exon 4), and 25,51 It may correspond to positions 6,565 to 25,516,681 (exon 5). The nucleic acid is a contiguous nucleic acid of 10 to 30 nucleotides within SEQ ID NO: 1, 2, 3, 4, or 5. It may be an acid sequence.

[0008] In some embodiments, the target sequence is UBE3A-AS exons 1-5, UBE3A - AS exon 5 and SNORD109B exon 1, and / or SNORD10 9B is the exon boundary including exons 1 and 2.

[0009] Methods and strategies for designing ASOs are known in the art. In some embodiments, the ASO is designed to target a sequence that is conserved among human subjects. In some embodiments, the ASO comprises a sequence that is conserved among primate subjects. Designed to target.

[0010] The oligonucleotides can be, for example, antisense oligonucleotides having a gapmer design. a nucleic acid sequence that is an amplicon (i.e., an amplicon that is ... The disclosed oligonucleotides can be used to target the UBE3A-AS transcript. Degradation, reduction, or elimination of the substance induces paternal UBE3A expression in neurons It is possible to express the UBE3A gene upstream of the SNORD109B snoRNA. This is done by targeting the 5'-end of the -AS. Examples of ASOs designed in this way are provided in Tables 1, 2, 3, 4, or 5. For example, in some embodiments, the ASO comprises the nucleic acid sequence SEQ ID NO: 6, 7, 8, 9, 10, or 11 inclusive.

[0011] The disclosed ASOs also have properties such as stability, solubility, activity, cellular distribution, and / or cellular uptake. For example, the disclosed ASOs can have one or more modifications to improve their binding. , one or more sugar-modified nucleosides and / or modified internucleoside linkages For example, in some embodiments, the oligonucleotide may contain For example, the phosphodiester bond has been modified to one that is more resistant to nuclease attack. In some embodiments, the ASO comprises one or more internucleoside linkages that are modified with One or more bases that are different from naturally occurring nucleobases but are functional during nucleic acid hybridization. The nucleic acid comprises the above modified nucleobase.

[0012] In some embodiments, the ASO is a DNA oligonucleotide. In embodiments, the ASO is an RNA oligonucleotide. ASOs contain both deoxynucleotides and ribonucleotides. The SO may be a gapmer, headmer, or tailmer oligonucleotide. In some embodiments, the center block of a gapmer protects the internal block from nuclease degradation. It is flanked by blocks of modified ribonucleotides that protect the lock. For example, ASO The 3'- and 5'-ends of the 3, 4, or 5'-terminus are used for protection against exonucleases. or five modified ribonucleotide monomers, followed by RNase H cleavage of the target RNA To activate the nucleotide sequence, a sequence of 7, 8, 9, 10 or more natural DNA monomers is required. In some cases, the modified ribonucleotide may contain a stretch. , 2'-O-methyl (OMe) RNA nucleotides, 2'-O-methoxyethyl (MOE )-modified nucleotides, or 2'-locked nucleic acids (LNAs). Gapmer ASOs Examples of such methods are provided in Tables 7, 11, and 17. Thus, some implementations In one embodiment, the disclosed ASO has a nucleic acid sequence selected from SEQ ID NOs: 362-392. do.

[0013] One or more ASOs disclosed herein, and a pharma- ceutically acceptable diluent, carrier, Pharmaceutical compositions including the salts and / or adjuvants (excipients) are also disclosed.

[0014] In vivo or in vivo upregulation of UBE3A expression in target cells in which paternal UBE3A expression is suppressed or in vitro induction, comprising one or more of the disclosed ASOs or Also disclosed is a method of administering to said cells an effective amount of the composition disclosed in.

[0015] The present invention relates to a method for treating or preventing a disease, disorder, or dysfunction associated with the in vivo activity of UBE3A. The method comprises administering a therapeutically or prophylactically effective amount of one or more of the disclosed ASOs to a patient comprising administering to the patient a therapeutically or prophylactically effective amount of one or more of the disclosed ASOs to a patient. Have or suspect that you have a disease, disorder, or dysfunction, such as Angelman syndrome Also disclosed are methods comprising administering to a subject

[0016] The details of one or more embodiments of the invention are set forth in the accompanying drawings and the detailed description below. Other features, objects, and advantages of the invention will become apparent from the description and drawings, and from the claims. For example, a person skilled in the art can understand that the present disclosure is a UBE Demonstrating the utility of certain sequences as described herein for affecting expression of 3A and are or target (e.g., are complementary to) such sequences. ) oligonucleotide formats. Those of skill in the art will recognize that the present disclosure is not limited to any particular mechanism of action and will appreciate the advantages of the provided options. Ligands can be used to block the RNase H activity of oligonucleotides, which act via an antisense mechanism involving, for example, RNase H activity. It may be useful to have such sequences or to have them act as a Other therapeutic formats of targeted oligonucleotides (e.g., siRNA, shR Also provided are nucleic acid sequences for nucleic acid sequences (e.g., nuclease gRNA, nuclease gRNA, etc.). By defining useful sequences as described above, the present invention also provides methods for determining the sequence of interest for such sequences. The various formats in which they are expressed (e.g., in vivo, in vitro, (or both) as part of a nucleic acid vector, such as a vector. Thus, those of skill in the art will recognize that, upon reading this disclosure, The references are exemplary and are not intended to be limiting unless a suitable nucleic acid (e.g., oligonucleotide) is used, regardless of mechanism of action. Those skilled in the art will recognize that the method may be utilized via any of a variety of mechanisms. The appropriate format and structure (e.g., Recognizes extensive literature on siRNAs, shRNAs, nuclease-gRNAs, etc. In some embodiments, the nucleic acids provided are useful in one or more mechanistic contexts. The present invention is directed to a method for the preparation of a composition having a format and / or structure known in the art to be useful. Features (including, for example, nucleic acid-directed nucleases such as RNase H, RISC, Cas, etc.) Incorporate. [Brief description of the drawings]

[0017] [Figure 1A-1D]Figure 1A shows the Prader-Willi / Angelman syndrome (PWS / AS) imprinted region in human and mouse. Figure 1A shows the reference sequence annotation of the human PWS / AS imprinted region. Figure 1B shows the reference sequence annotation of the PWS / AS imprinted orthologous region in mouse. Figure 1C shows the 3'-end of UBE3A-AS and UBE3A. Figure 1D shows a strand alignment showing the orthologous region between human, macaque (Macaca fascicularis), pig, elephant, mouse, and rat. The targeted region is conserved among non-human primates but not among rodents. Figure 1D also shows a genomic evolutionary rate profiling (GERP) plot of the region. Positive values ​​represent evolutionary constraint at a particular DNA base. [Figures 2A-2E]Analysis of ASOs targeting mouse Ube3a-AS. Figure 2A is a diagram of the approximate location of mouse Ube3a-AS transcripts and mouse-specific ASOs. Boxes and lines represent exons and introns, respectively. Arrows represent the direction of transcription. Figure 2B is a diagram of the Ube3aYFP reporter allele used to measure paternal Ube3a protein levels. The Ube3aYFP mouse model was generated by targeting yellow fluorescent protein (YFP) to the 3'-end of the endogenous Ube3a locus. Expression of Ube3a-AS inhibits transcription of the paternal Ube3aYFP allele, and loss of Ube3a-AS reactivates paternal Ube3aYFP expression, which can be detected by immunofluorescence imaging using an anti-YFP antibody. Figure 2C is a diagram of the experimental timeline for examining ASOs in mouse primary hippocampal neurons. Mouse primary hippocampal neurons were generated from newborn mice (0DIV) carrying a paternally inherited Ube3aYFP allele and treated after 7 days in vitro (7DIV). After 3 days of treatment (10DIV), Ube3aYFP protein levels were measured in individual cells. Figure 2D contains immunofluorescence images showing paternal Ube3aYFP protein in primary neurons treated with vehicle (veh), negative control ASO (ASO-C), topotecan (topo), ASO-B, and ASO1.1. Figure 2E shows paternal Ube3a YFP average intensity levels in individual neuronal cells treated with vehicle (veh, 1% DMSO; n = 3), control ASO (ASO-C, 15 µM; n = 3), topotecan (topo, 0.3 µM; n = 3), ASO-B (1, 5, 15 µM; n = 3), ASO-1.1 (1, 5, 15 µM), ASO-1.2 (1, 5, 15 µM), and ASO3.1 (1, 5, 15 µM). Abbreviations: YFP, yellow fluorescent protein; Tx, treatment; DIV, days in vitro; ns, not significant. Error bars represent standard error of the mean. [Figure 3A-3D]Analysis of ASOs targeting human UBE3A-AS. Figure 3A shows the approximate location of human UBE3A-AS and human-specific ASOs (ASO1-6). ASO-7 is located in an intron of UBE3A-AS. Boxes and lines represent exons and introns, respectively. Figure 3B shows an experimental timeline for investigating ASOs in human GABAergic induced pluripotent stem cell (iPSC)-derived neurons from a karyotype-normal individual. Human iPSC-derived neurons were treated after 14 DIV and then processed for RNA isolation at 20 DIV. Figures 3C and 3D show the relative steady-state RNA levels (normalized to ASO-C) of UBE3A-AS (Figure 3C) and UBE3A (Figure 3D) in iPSC-derived neurons treated with control ASO (ASO-C, 10 μM), and ASO1-7 (10 μM), and topotecan (Topo, 1 μM). Abbreviations: Tx, treatment; DIV, days in vitro. Error bars represent standard error of the mean. [Figure 4A-4I] Analysis of human ASO-4 and topotecan in GABAergic iPSC-derived neurons. Figure 4A-4F show the relative expression (normalized to 1 nM) of UBE3A-AS (Figure 4A), SNORD116 (Figure 4B), IPW (Figure 4C), SNORD115 (Figure 4D), SNORD109A / B (Figure 4E), and UBE3A (Figure 4F) steady-state RNA levels in iPSC-derived neurons treated with a 10-point 1 / 2 log dose curve of ASO-4 and topotecan (1 nM, 3 nM, 10 nM, 30 nM, 100 nM, 300 nM, 1 µM, 3 µM, 10 µM, and 30 µM). Figure 4G is a diagram of the experimental timeline to examine ASO-4 in GABAergic iPSC-derived neurons treated at 59 DIV. Figures 4H-4I show the relative expression (normalized to ASO-C) of UBE3A-AS (Figure 4H) and UBE3A (Figure 4I) steady-state RNA levels in iPSC-derived neurons treated with ASO-C (10 µM) and ASO-4 (1, 5, and 10 µM). Abbreviations: Tx, treatment. Error bars represent standard error of the mean. [Figure 5A-5F]Analysis of optimized ASOs in human GABAergic and glutamatergic iPSC-derived neurons. Figure 5A is a diagram of the experimental timeline for investigating optimized ASOs in GABAergic iPSC-derived neurons. Figure 5B shows the relative expression (normalized to water control) of UBE3A-AS steady-state RNA levels in iPSC-derived neurons treated with a 5-point 1 / 2 log dose curve (30 nM, 100 nM, 300 nM, 1 μM, 3 μM; n=6) of ASO-3.1, ASO-3.2, ASO-4.1, ASO-4.2, ASO-4.3, ASO-4.4, ASO-6.1, ASO-4.I, and ASO-4.S. ASO-4.I and ASO-4.S represent ASO-4 produced by two companies (ASO-4.I, Integrated DNA Technologies; ASO-4.S, Sigma-Aldrich). Figure 5C is a diagram of the experimental timeline for investigating ASO-4 and ASO-6.1 in GABAergic iPSC-derived neurons. Figure 5D shows the relative expression (normalized to 1 nM) of UBE3A-AS and UBE3A steady-state RNA levels in iPSC-derived neurons treated with ASO-4 (ASO-4.I and ASO-4.S) and a 10-point 1 / 2 log dose curve of ASO-6.1 (1 nM, 3 nM, 10 nM, 30 nM, 100 nM, 300 nM, 1 μM, 3 μM, 10 μM, and 30 μM; n=3). Figure 5E is a diagram of the experimental timeline for investigating ASO-4 and ASO-6.1 in glutamatergic iPSC-derived neurons. Figure 5F shows the relative expression (normalized to water control) of UBE3A-AS and UBE3A steady-state RNA levels in iPSC-derived neurons treated with ASO-4 (ASO-4.I and ASO-4.S) and a 10-point 1 / 2 log dose curve of ASO-6.1 (1 nM, 3 nM, 10 nM, 30 nM, 100 nM, 300 nM, 1 μM, 3 μM, 10 μM, and 30 uM; n=3). Error bars represent standard error of the mean. [Figures 6A-6D]Figure 6 shows the identification of ASO target regions in mouse PWS / AS imprinted regions. Figure 6A shows the annotation of reference sequences of orthologous PWS / AS imprinted regions on mouse chromosome 7C. Figure 6B shows transcript assemblies produced from RNA-sequencing (RNA-seq) data from mouse brain. Figure 6C shows ASO target regions showing Snord115 snoRNAs retained in exons at the 5'-end of Snord115 host gene transcript / Ube3a-AS. Aligned RNA-seq reads are shown below the assembly transcript. Exons and introns are indicated by boxes and lines, respectively. FIG. 6D is a sequence alignment of snoRNAs in the retained exons Snord115_ENSMUST00000101836 (SEQ ID NO: 490), Snord115_ENSMUST00000101936 (SEQ ID NO: 491), Snord115_ENSMUST00000104493 (SEQ ID NO: 492), Snord115_ENSMUST00000082443 (SEQ ID NO: 493), and Snord115_ENSMUST00000104427 (SEQ ID NO: 494), showing that the retained snoRNAs have the degenerate boxes required for functional snoRNA formation. [Figure 7A-7G]Identification of ASO target regions in human PWS / AS imprinted regions. Figure 7A shows reference sequence annotation of the Prader-Willi / Angelman syndrome (PWS / AS) imprinted region. Figure 7B shows RNA-seq assembly of human PWS polycistronic transcripts. Figure 7C shows SNORD115-45, which is retained in an exon at the 3'-end of the SNORD115 host gene transcript / 5'-end of UBE3A-AS. Aligned RNA-seq reads produced from adult human brain show that the L1 line is transcribed. Figure 7D shows reference sequence annotation of the 3'-end of the SNORD115 cluster (SNORD115-39-48 and SNORD109B). Figure 7E shows the location of the L1 line element between SNORD115-44 and SNORD115-45. Figure 7F shows a chain alignment of placental species, representing the major clades showing conservation in the SNORD115-45-48 region, albeit attenuated in rodents. Figure 7G shows a sequence alignment of snoRNAs in the target region to SNORD115-44 (functional snoRNA) (SEQ ID NO: 495), SNORD115-48 (SEQ ID NO: 496), SNORD115-45 (SEQ ID NO: 497), SNORD115-46 (SEQ ID NO: 498) and SNORD115-47 (SEQ ID NO: 499), showing that SNORD115-45 (retained), SNORD115-46 (partially retained) and SNORD116-47 have the degenerate box required for functional snoRNA formation. [Figure 8A-8C]Pharmacodynamic analysis of candidate ASOs. Figure 8A shows fitted dose-response curves of normalized UBE3A-AS steady-state RNA levels in GABAergic iPSC-derived neurons treated with 10-point 1 / 2 log dose curves (1 nM, 3 nM, 10 nM, 30 nM, 100 nM, 300 nM, 1 μM, 3 μM, 10 μM, and 30 μM; n=2) of ASO-4 and ASO-6.1 with different backbone and RNA modification designs. The dose-response curves are fitted using a 4-parameter logistic regression model (Hill). The graphs represent the fitted model and standard error. The Y-axis represents the relative UBE3A-AS RNA levels, and the X-axis represents the log molar (M) concentration of the ASO. Figures 8B and 8C are dendritic and star plots of hierarchical clustering of fitted dose-response curves, showing the relationship between the candidate ASOs and grouping them into three clusters. [Figure 9] Pharmacodynamic analysis of ASO-6.1.PO-1.O and ASO-4.4.PS.L in Angelman syndrome iPSC-derived neurons. Four-parameter logistic regression model (Hill) of normalized UBE3A-AS steady-state RNA levels in Angelman syndrome iPSC-derived neurons treated with a 10-point ½ log dose curve (1 nM, 3 nM, 10 nM, 30 nM, 100 nM, 300 nM, 1 μM, 3 μM, 10 μM, and 30 μM; n=3) of ASO-6.1.PO-1.O and ASO-4.4.PS.L. [Figure 10]Figure 1 shows expression analysis of RNAs encoded by PWS polycistronic transcripts in Angelman syndrome iPSC neurons treated with ASO-6.1-PO-1.O and ASO-4.4.PS.L. Normalized steady-state RNA levels of SNURF, SNRPN, SNHG116, SNORD116 snoRNA, IPW, SNHG115, SNORD115 snoRNA, UBE3A-AS, and UBE3A in AS iPSC-derived neurons treated with vehicle (1% HO; n=3), ASO-6.1.PO-1.O (30 μM; n=3), and ASO-4.4.PS.L (30 μM; n=3) are shown. Data represent the mean percentage of RNA relative to vehicle. Error bars represent standard error of the mean. An asterisk (*) indicates a statistically significant difference (p<0.05) versus vehicle using one-way ANOVA with Dunnett's multiple comparison test. [Figure 11] Pharmacodynamic analysis of ASO-6.1.PO-1.O and ASO-4.4.PS.L in cynomolgus macaques. Steady-state RNA levels of UBE3A-AS in macaque CNS regions treated with vehicle (0.9% saline; n=5), ASO-6.1.PO-1.O (10 mg; n=3), and ASO-4.4.PS.L (10 mg; n=3) are shown. Data represent the mean percentage of UBE3A-AS RNA relative to vehicle. Error bars represent standard error of the mean. Asterisks (*) indicate statistically significant differences (p < 0.05) relative to vehicle using one-way ANOVA with Dunnett's multiple comparison test. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0018] Also known as ubiquitin-protein ligase E3A antisense transcript and UBE3A-A UBE3A-AS / Ube3a-AS transcription, also known as S / Ube3a-AS The product is the UBE3A-AS transcript, which is located on the antisense DNA strand to the UBE3A gene. The name of the transcript produced by transcription of the gene. indicates a human gene (e.g., UBE3A), and gene names with only the first letter in capital letters are Note that mouse genes (e.g., Ube3a) are shown. UBE3A-AS Transcription The product is a large polycistronic transcription unit encoding SNURF-SNRPN, Orf Clusters of small nucleolar C / D box RNAs (SNORDs), as well as several Transcribed as part of an uncharacterized long non-coding RNA. In humans, the UBE3A / Ube3a gene is printed in neurons of the central nervous system. It is expressed only from the maternal allele. The e3a-AS transcript silences transcription of the paternal UBE3A / Ube3a allele UBE3A-AS / Ube3a-AS inhibition is essential and sufficient for the paternal UBE3 A / Ube3a allele. Mutations affecting the function or expression of the gene cause Angelman syndrome (AS). In AS patients, the paternal allele is functional but epigenetically silenced. When silencing is abolished by silencing the paternal UBE3A allele, functional UBE3A expression in neurons is suppressed. Potential source of E3A.

[0019] A polycistronic transcription unit encoding UBE3A-AS (hereinafter referred to as PT The transcription factor PTU (termed SNURF) is approximately 450,000 base pairs in length. -Starting in the upstream exon (U-exon) of the SNRPN locus and the 5'-end of UBE3A The PTU is organized as follows (5'-3'): SNURF- SNRPN, SNORD107, SNORD64, SNORD109A, SNORD11 6 (29 copies), IPW, SNORD115 (48 copies), SNORD109B, and and UBE3A, which are oriented in the opposite direction to the upstream transcript. , alternatively spliced ​​and subject to alternative 3'-processing. SNURF-S NRPN encodes two polypeptides. SNORD encodes host gene transcripts (SN HG14) intron, and is a spliced ​​intron exonuclease UBE3A-AS is a transcript that overlaps with the UBE3A gene. Most C / D box snoRNAs play important roles in ribosome biogenesis. They act as 2'-O-methylators of ribosomal RNA (rRNA) However, snoRNAs located in the PWS / AS region are complementary to known rRNAs. However, the SNORD115 snoRNA does not express any sequence that is related to serotonin. It was found to alter alternative splicing of the receptor 2C pre-mRNA.

[0020] Herein, the 5'-end of the UBE3A-AS transcript is important for its stability. As disclosed herein, the 5'-terminus of UBE3A-AS ASOs targeting UBE3A-AS likely terminate transcription of UBE3A-AS and inhibit paternal UBE3A By turning on the allele, UBE3A-AS levels can be reduced.

[0021] The term "oligonucleotide" as used herein means what is commonly known by those skilled in the art As understood, it is defined as a molecule that contains two or more covalently linked nucleosides. Such covalently linked nucleosides are also referred to as nucleic acid molecules or oligomers. Oligonucleotides can be commonly produced in laboratories by solid phase chemical synthesis followed by purification. When referring to the sequence of an oligonucleotide, the reference is to the covalently linked nucleotides. The sequence or order of the nucleic acid base moieties of the nucleotides or nucleosides, or modifications thereof The oligonucleotides disclosed herein are not limited to those that are artificial, e.g. The oligonucleotides disclosed herein may also be chemically synthesized. It may also include modified nucleosides or nucleotides as above.

[0022] As used herein, the term "antisense oligonucleotide" refers to an oligonucleotide that specifically targets a target nucleic acid. , which modulates expression of a target gene by hybridizing to a contiguous sequence on the target nucleic acid. In some embodiments, the present invention is defined as an oligonucleotide that can The antisense oligonucleotides disclosed herein are single-stranded.

[0023] The term "contiguous nucleotide sequence" refers to a sequence of an oligonucleotide that is complementary to a target nucleic acid. This term is used herein in conjunction with the terms "contiguous nucleobase sequence" and "oncogene region." In some embodiments, the oligonucleotide motif sequence is used interchangeably with the term "oligonucleotide motif sequence." All nucleotides of a polynucleotide are present in a contiguous nucleotide sequence. In some embodiments, the oligonucleotide comprises a contiguous nucleotide sequence, in some cases can be used to attach functional groups to a contiguous nucleotide sequence by Additional nucleotide(s) may be included, for example a nucleotide linker region. The nucleotide linker region may or may not be complementary to the target nucleic acid.

[0024] Nucleotides are the building blocks of oligonucleotides and polynucleotides and are It can include both naturally occurring and non-naturally occurring nucleotides. Nucleotides, such as NA and RNA nucleotides, consist of a ribose sugar moiety, a nucleobase moiety, and one or more phosphate groups (which are absent in nucleosides). And nucleotides may also be referred to interchangeably as "units" or "monomers." good.

[0025] As used herein, the term "modified nucleoside" or "nucleoside modification" refers to , by introducing one or more modifications in the sugar moiety or the (nucleo)base moiety, an equivalent DNA or RNA nucleosides that are modified as compared to RNA nucleosides. In one embodiment, the modified nucleoside comprises a modified sugar moiety. The term is also used herein in conjunction with the term "nucleoside analog" or modified "nucleoside analog." The term "monomer" may be used interchangeably with "unit" or modified "monomer."

[0026] The term "modified internucleoside linkage" refers to a linker that covalently links two nucleosides together. A phosphate bond, commonly referred to by those skilled in the art as a phosphodiester (PO) bond or a bond other than a natural phosphate bond, Defined as understood. Nucleotides with modified internucleoside linkages In some embodiments, a modified nucleotide is Internucleotide linkages are the major structural units of oligonucleotides compared to phosphodiester linkages. For naturally occurring oligonucleotides, the internucleoside linkages are , which contains a phosphate group that creates a phosphodiester bond between adjacent nucleosides. The enhanced internucleoside linkages are useful in stabilizing oligonucleotides for in vivo use. Particularly useful, for example, within the gap region of a gapmer oligonucleotide, as well as D of the oligonucleotides disclosed herein, such as in the region of modified nucleosides It acts to protect against nuclease cleavage in regions of NA or RNA nucleosides. This can be done.

[0027] In some embodiments, the oligonucleotide is modified from natural phosphodiester, e.g. For example, one or more nucleosides have been modified to a linkage that is more resistant to nuclease attack. Nuclease resistance was determined by incubating oligonucleotides in serum. or by nuclease resistance assays [e.g., snake venom phosphodiesterase (SVPD)], both of which are well known in the art. Nuclease resistance of oligonucleotides can be enhanced by using a nuclease inhibitor. The internucleoside linkages are referred to as nuclease-resistant internucleoside linkages.

[0028] In some embodiments, the oligonucleotide or its contiguous nucleotide sequence At least 50% of the internucleoside linkages in the string are modified, and the oligonucleotide or the internucleoside linkages in the consecutive nucleotide sequences thereof, e.g., at least 60%, e.g., at least 70%, e.g., at least 80%, or e.g., at least In some embodiments, the oligonucleotide or oligonucleotides thereof are 90% modified. All internucleoside linkages of the consecutive nucleotide sequence are modified.

[0029] In some embodiments, the oligonucleotide may be a non-nucleotidic oligonucleotide, such as a conjugate. It is recognized that the internucleoside linkage attached to the nucleotide functionality can be a phosphodiester. In some embodiments, the oligonucleotide is linked to a non-nucleotidic functional group. The internucleoside linkages to be joined are modified.

[0030] In some embodiments, the oligonucleotide or its contiguous nucleotide sequence All internucleoside linkages in the string are nuclease-resistant internucleoside linkages.

[0031] Modified internucleoside linkages include, for example, phosphorothioates, diphosphorothioates, In some embodiments, the modified phosphate may be selected from the group consisting of phosphates, boranophosphates, and boranophosphates. The modified internucleoside linkages enhance the RNase activity of the oligonucleotides disclosed herein. H recruitment, e.g., phosphorothioates, diphosphorothioates, oate, or boranophosphate.

[0032] In some embodiments, the internucleoside linkage contains sulfur (S), e.g., phospho It is a thioate internucleoside linkage.

[0033] Phosphorothioate internucleoside linkages provide nuclease resistance, favorable pharmacokinetics, and These are particularly useful due to their ease of use and ease of manufacture. At least 50% of the internucleoside bonds in the nucleotide sequence or in the contiguous nucleotide sequence is phosphorothioate, and the oligonucleotide or its successive nucleotides For example, at least 60%, for example, at least 70%, of the internucleoside linkages in the sequence , e.g., at least 80%, or, e.g., at least 90% phosphorothioate. In some embodiments, the oligonucleotide or its consecutive nucleotides All internucleoside linkages in the sequence are phosphorothioate.

[0034] In some embodiments, the oligonucleotide contains one or more neutral internucleoside bonds. In particular, phosphotriesters, methylphosphonates, MMI, amide-3, formaldehyde, etc. The internucleoside linkage is selected from acetal or thioformacetal. The internucleoside linkages are as described in WO2009 / 124238, which is incorporated herein by reference. In one embodiment, the internucleoside linkage is as disclosed in WO2007 / 031 091 (hereby incorporated by reference) .

[0035] Nuclease-resistant linkages, such as phosphorothioate linkages, are used to separate regions of gapmers. G, or the unmodified nucleoside regions of the headmer and tailmer. An oligonucleoside that can recruit nucleases when it forms a duplex with an acid. However, phosphorothioate linkages can also be used in gap markers. Regions F and F' for the sequence, or modified nucleotides of the headmer and tailmer Non-nuclease recruitment and / or affinity enhancing regions, such as osidic regions It may also be useful in

[0036] However, each of the design regions is designed to prevent nuclease degradation by modified nucleosides such as LNAs. Phosphorothioate, such as phosphodiester bonds, are particularly preferred in regions that protect against The nucleoside linkages may include internucleoside linkages other than phosphate. The phosiester bond is preferably linked to a modified nucleoside unit (typically a non-nucleoside unit). The oligonucleotide can be included between or adjacent to the target nucleic acid (e.g., in the recruitment region). The bioavailability and / or biodistribution of phosphodiesterases can be modified. WO2008 / 113832 for teaching oligonucleotides with ester bonds is incorporated herein by reference.

[0037] In some embodiments, all of the internucleoside linkages in the oligonucleotide are In some embodiments, the linkages are phosphorothioate and / or boranophosphate. In this study, all internucleoside linkages in the oligonucleotide were phosphorothioate linkages. be.

[0038] The term nucleobase refers to the base that forms hydrogen bonds in nucleic acid hybridization. Purines, present in nucleotides and nucleotides (e.g., adenine and guanine) ) and pyrimidine (e.g., uracil, thymine, and cytosine) moieties. The term base may be different from naturally occurring nucleic acid bases, but is used in nucleic acid hybridization. In this context, the term "nucleobase" also encompasses modified nucleobases that are functional during synthesis. are naturally occurring nucleobases, e.g., adenine, guanine, cytosine, thymidine, uracil, Refers to both xanthine, xanthine, and hypoxanthine, as well as non-naturally occurring variants. vinegar.

[0039] In some embodiments, the nucleobase moiety converts a purine or pyrimidine to a modified Change to phosphorus or pyrimidine, e.g., substituted purine or substituted pyrimidine. For example, isocytosine, pseudoisocytosine, 5-methyl 5-Propynyl-cytosine, 5-Thiozolo-cytosine, 5-Propynyl-cytosine, 5-Propynyl- Uracil, 5-bromouracil, 5-thiazolo-uracil, 2-thio-uracil, 2'thio -Thymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6- The nucleobase is selected from diaminopurine, and 2-chloro-6-aminopurine.

[0040] The nucleobase portion may be a letter code for each corresponding nucleobase, e.g., A, T, G, C. or U, where each letter is optionally a modification of an equivalent function. For example, in the exemplified oligonucleotide, the nucleic acid The base moiety is selected from A, T, G, C, and 5-methylcytosine (5mC). Combinations of these modifications may also be used. For example, a 5mC LNA nucleoside may be used. Similarly, 2'-hydroxymethyl (2'-OMe)5mC can be used.

[0041] The term "complementarity" refers to Watson-Crick base pairing of nucleosides / nucleotides. The Watson-Crick base pair is guanine (G)-cytosine (C) and adenine (A)-thymine (T) / uracil (U). The oligonucleotides are Modified nucleobases, e.g., 5-methylcytosine, which is often used instead of cytosine Thus, the term complementary can include nucleosides with unmodified It is understood that this encompasses Watson-Crick base pairing between nucleobases and modified nucleobases. Let it be understood.

[0042] As used herein, the term "% complementarity" refers to the specific complementarity of another nucleic acid molecule (e.g., a target nucleic acid). nucleotide sequence at a specific position (i.e., Watson forming click-click base pairs), consecutive bases in a nucleic acid molecule (e.g., an oligonucleotide) The percentage refers to the number of nucleotides in a nucleotide sequence that is The number of aligned bases that form pairs between the sequences of the oligonucleotides is counted, and the number of nucleotides in the oligonucleotides is counted. The average number of leucocytes in a given sample is calculated by dividing by the total number of leucocytes in a given sample and multiplying by 100. Unaligned nucleobases / nucleotides (which form base pairs) are called mismatches. Be found out.

[0043] As used herein, the term "hybridizing" or "hybridize" forms hydrogen bonds with base pairs on opposite strands, thus forming a duplex is understood as two nucleic acid strands (e.g., an oligonucleotide and a target nucleic acid). The affinity of the binding between two nucleic acid strands is the strength of hybridization. is often defined as the temperature at which half of the oligonucleotide forms a duplex with the target nucleic acid. It is described in terms of a defined melting temperature (Tm). Under physiological conditions, the Tm is strictly the affinity not proportional to sex (Mergny and Lacroix, 2003; Oligonuc leotides 13:515-537). The Gibbs free energy of the standard state, ΔG ° is a more accurate indication of binding affinity and is related to the dissociation constant (Kd) of the reaction, ΔG°=-RT are related by the equation ln(Kd), where R is the gas constant and T is the absolute temperature. Therefore, the very low ΔG° of the reaction between the oligonucleotide and the target nucleic acid This reflects the strong hybridization between the oligonucleotide and the target nucleic acid. ° is the energy associated with the reaction, where the aqueous concentration is 1M and the pH is 7 and the temperature is 37° C. Hybridization of the oligonucleotide to the target nucleic acid The reaction is spontaneous, and for spontaneous reactions, ΔG° is less than zero. ΔG ° can be measured experimentally, see, for example, Hansen et al., 1965, Chem. omm.36-38 and Holdgate et al., 2005, Drug Discov T It can be measured by isothermal titration calorimetry (ITC) as described in Those skilled in the art will be aware that commercially available equipment is available for measuring ΔG°. Sugimoto et al., 1995, Biochemistry 34:11211-11 216 and McTigue et al., 2004, Biochemistry 43:5388 Using appropriately derived thermodynamic parameters as described in -5405, ntaLucia, 1998, Proc Natl Acad Sci USA.95: By using the nearest neighbor model as described by 1460-1465, Δ G° can also be estimated numerically. To have the potential to modulate acid targets, the oligonucleotides disclosed herein are Less than 10 kcal for oligonucleotides between 10 and 30 nucleotides long It hybridizes to the target nucleic acid with a predicted ΔG° value. In some embodiments , the degree or strength of hybridization is determined by the standard Gibbs free energy Δ The oligonucleotides are measured by the G°. - Less than 15 kcal, e.g., less than 20 kcal, e.g., 8 to 30 nucleosides Estimated ΔG° values ​​of less than -25 kcal for oligonucleotides of length In some embodiments, the oligonucleotide can hybridize to the target nucleic acid. The nucleotides are -10 to -60 kcal, e.g., -12 to -40, e.g., -15 -30kcal or -16~-27kcal, e.g. -18~-25kcal It hybridizes to the target nucleic acid with a predetermined ΔG° value.

[0044] In some embodiments, the disclosed oligonucleotides are capable of binding to a target nucleic acid molecule. A nucleic acid sequence of at least 8 nucleotides that is complementary to or hybridizes to a target sequence. A contiguous nucleotide sequence (and therefore The target sequence is at least 8 consecutive nucleotides, e.g., 9, 10, 11, 12 , 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 consecutive nucleotides, e.g., 12 to 25 It is composed of, for example, 14 to 18 consecutive nucleotides.

[0045] In some embodiments, the disclosed oligonucleotides inhibit, alter, or inhibit a target nucleic acid sequence. The functional nucleic acid to be modified or deleted, e.g., siRNA, shRNA, or nuclease gRNA.

[0046] As used herein, the term "modulation of expression" refers to the modulation of expression of UBE3 prior to administration of the oligonucleotide. Oligonucleotides that change the amount of UBE3A RNA / protein when compared to the amount of A Alternatively, the expression of Adjustments are determined by reference to control experiments in which the disclosed oligonucleotides are not administered. The modulation affected by the oligonucleotides can be determined as follows: 5-45 By targeting the 5'-end of UBE3A-AS downstream of snoRNA relieve, eliminate, prevent, attenuate or decrease the repression of paternal UBE3A-AS transcripts The regulation relates to its ability to initiate or terminate a disease, for example, affected by UBE3A-AS. Removal or blocking of the inhibitory mechanisms that affect paternal UBE3A expression was restored. The effect can also be visualized as the ability of an oligonucleotide to enhance or increase the activity of a given polypeptide.

[0047] The disclosed oligonucleotides include modified sugar moieties, i.e., DNA and RNA one or more nucleotides having a modification of the sugar moiety as compared to the ribose sugar moiety found in Nucleosides with modifications of the ribose sugar moiety include, primarily, To improve certain properties of oligonucleotides, such as affinity and / or nuclease resistance Such modifications can be made, for example, to the hexose ring (HNA) or bicyclic The ribose ring structure is modified by substitution at C2 and Typically has a biradical bond at the C4 carbocyclic ring or between the C2 and C3 carbons Contains an unlinked ribose ring (e.g., UNA) that typically lacks a bond. The sugar-modified nucleosides are, for example, bicyclohexose nucleosides (WO201 1 / 017521) or tricyclic nucleosides (WO2013 / 154798). Modified nucleosides can also be used, for example, in peptide nucleic acids (PNAs) or morpholino nucleic acids. As used herein, the term "nucleoside" includes nucleosides in which the sugar moiety is replaced with a non-sugar moiety, such as in

[0048] Sugar modifications also replace the substituents on the ribose ring that are naturally found in DNA and RNA nucleosides. This also includes modifications made by changing the hydrogen or 2'-OH group to a group other than the one provided. Substitutions may be introduced, for example, at the 2', 3', 4' or 5' position. Nucleosides having the formula (I) also include 2'-modified nucleosides, such as 2'-substituted nucleosides. Indeed, much interest has been focused on the development of 2'-substituted nucleosides. A number of 2'-substituted nucleosides have been shown to increase the binding affinity of oligonucleotides when incorporated into them. These compounds have been found to have beneficial properties such as enhanced nucleoside tolerance and enhanced affinity. It was done.

[0049] A 2' sugar-modified nucleoside is a nucleoside that has a substituent other than H or -OH at the 2' position. nucleosides (2'-substituted nucleosides) or 2'-linked biradicals It contains 2'-substituted nucleosides and LNA (2'-4' biradical linked) nucleosides. For example, 2' modified sugars have been used to enhance the These may provide increased binding affinity and / or increased nuclease resistance. Examples of modified nucleosides include 2'-O-alkyl-RNA, 2'-O-methyl-RNA, -RNA(O-Me), 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA, and 2'-fluoro- For further examples, see Freier & Altman n;Nucl.Acid Res., 1997, 25, 4429-4443 and Uhl mann;Curr.Opinion in Drug Development, 20 00, 3(2), 293-213; and Deleavey and Damha, Che See Mistry and Biology 2012, 19, 937.

[0050] Locked nucleic acid (LNA) nucleosides are nucleotides that have a C2' and C4' bond at the ribose sugar ring of the nucleotide. A modified nucleoside that contains a linker group (called a biradical or bond) between These nucleosides are referred to in the literature as bridged nucleic acids or bicyclic nucleic acids (BNAs). ) is also called.

[0051] Nuclease-mediated degradation occurs when complementary nucleotides form duplexes with such sequences. It refers to an oligonucleotide that can mediate degradation of a DNA sequence.

[0052] In some embodiments, the oligonucleotide inhibits nuclease-mediated degradation of the target nucleic acid. In some embodiments, the disclosed oligonucleotides may function through a nuclease, particularly a nuclease-specific cleavage site. , an endonuclease, preferably an endoribonuclease (RNase), e.g. It can recruit RNase H. It acts via a nuclease-mediated mechanism. Examples of oligonucleotide designs typically include regions of at least 5-6 DNA nucleosides. and flanked on one or both sides by affinity enhancing nucleosides; For example, gapmers, headmers, and tailmers.

[0053] As used herein, the term "gapmer" refers to a nucleic acid sequence comprising one or more affinity-enhancing modified nucleosides. RNase H recruits oligonucleotides flanked at the 5' and 3' ends. It refers to an antisense oligonucleotide that contains a region (gap) of an octade. The headmer and tailmer designs are described herein. In this case, one of the flanks is missing. That is, only one end of the oligonucleotide has an affinity-enhancing modified nucleoside. For the headmer, the 3' flank is deleted (i.e., the 5' flank is The 5' flank contains an affinity-enhancing modified nucleoside, and the tailmer lacks a 5' flank. missing (i.e., the 3' flank contains an affinity-enhancing modified nucleoside).

[0054] Conjugation of the disclosed oligonucleotides to one or more non-nucleotide moieties The chemistry may, for example, affect the activity, cellular distribution, cellular uptake, or stability of the oligonucleotide. By affecting the pharmacology of oligonucleotides, several In some embodiments, the conjugate moiety is capable of determining the cellular distribution, bioavailability, and / or bioavailability of the oligonucleotide. by improving irritability, metabolism, excretion, permeation, and / or cellular uptake. In particular, the conjugates modify or enhance the pharmacokinetic properties of oligonucleotides. Oligonucleotides may be targeted to specific organs, tissues, or cell types, thereby The effect of the oligonucleotide in that organ, tissue, or cell type can be enhanced. At the same time, the conjugates can inhibit the expression of oligonucleotides in non-target cell types, tissues, or organs. Activity of the leutidine, e.g., off-target activity in non-target cell types, tissues, or organs or may play a role in reducing activity. No. 02013 / 033230 provides suitable conjugate moieties, which are hereby incorporated by reference. The present application is incorporated herein by reference. WO2012 / 143379 discloses a method for the treatment of inflammatory bowel disorders, including inflammatory bowel disorders, Conjugation to antibody fragments with affinity for the A method of delivering an object is provided, which is incorporated herein by reference.

[0055] In some embodiments, the non-nucleotide moiety (conjugate moiety) is a carbohydrate, Cell surface receptor ligands, drug substances, hormones, lipophilic substances, polymers, proteins, peptides Peptides, toxins (e.g., bacterial toxins), vitamins, viral proteins (e.g., capsids), In some embodiments, the compound is selected from the group consisting of: The non-nucleotide moiety can facilitate delivery of the antibody or antibody fragment, e.g., across the blood-brain barrier. and antibodies or antibody fragments that target the transferrin receptor, in particular antibodies or antibody fragments that target the transferrin receptor. Piece.

[0056] The term "subject" refers to any individual that is the target of administration or treatment. A subject may be a vertebrate, For example, the subject may be a mammal. Thus, the subject may be a human or an animal patient. " refers to a subject receiving treatment from a clinician, e.g., a physician.

[0057] The term "therapeutically effective" means a compound that is sufficient to ameliorate one or more of the causes or symptoms of a disease or disorder. Such improvements refer to the amount of a composition used that is sufficient to reduce or alter the and exclusion is not necessarily required.

[0058] The term "pharmaceutical acceptable" means a substance that is within the scope of sound medical judgment and has reasonable benefit / risk. Depending on the risk ratio, excessive toxicity, inflammation, allergic reactions, or other problems or complications may occur. Compounds, materials suitable for use in contact with human and animal tissues without , compositions, and / or dosage forms.

[0059] The term "treatment" refers to the cure, amelioration, stabilization, or treatment of a disease, pathological condition, or disorder. This term refers to the medical management of a patient with the intent to prevent or treat a disease. i.e., specifically directed treatment aimed at ameliorating a disease, pathological condition, or disorder. and for symptomatic treatment, i.e., removal of the cause of the disease, pathological condition, or disorder. In addition, the term includes palliative care, i.e., care that is tailored to the specific needs of a disease, pathology, or Treatment designed to alleviate symptoms rather than cure a biological condition or disorder; preventative treatment Treatment, i.e., minimizing the onset of an associated disease, pathological condition, or disorder; or controlled treatment, i.e., partial or complete inhibition; and supportive treatment, i.e., Another specific treatment directed toward ameliorating the associated disease, pathological condition, or disorder. This includes treatments used to supplement

[0060] The term "inhibit" can be evaluated at a particular point in time, as one of skill in the art will recognize. "A decrease in the level of a physiological parameter, activity, response, condition, disease, or other physiological parameter" refers to such a decrease in the level of a physiological parameter, activity, response, condition, disease, or other physiological parameter. As such, in some embodiments, inhibition is a delayed onset or a reduced frequency. In some embodiments, inhibition can be or can include an activity, response, condition, or This can include, but is not limited to, the complete elimination of a condition or disease. e.g., a decrease in an activity, response, condition, or disease when compared to a natural or control level. Thus, a decrease can include a 10% decrease in the amount of a protein that is increased when compared to the native or control level. 10, 20, 30, 40, 50, 60, 70, 80, 90, 100% or any amount It may be a decrease.

[0061] Antisense oligonucleotides (ASOs) target the SNORD115 host gene transcript ( AF400500), which was designed to target an exon at the 5'-end of S NORD115-46, SNORD115-47, SNORD115-48, and SN The ORD109B snoRNA was harbored by the UBE3A antisense transcript (UBE3A- In particular, the target nucleic acid is believed to represent the 5'-end of human chromosome 15, human genome U, corresponding to positions 25,511,577 to 25,516,681 on assembly hg19 In some embodiments, the target nucleic acid may be the 5'-end of the UBE3A-AS. It is one of five exons located in the 5'-end of 3A-AS, which is ,511,577~25,511,761 (exon 1), 25,512,059~25 ,512,191 (exon 2), 25,513,476-25,513,600 (exon exon 3), 25,514,752–25,514,880 (exon 4), and 25, It may correspond to positions 516,565 to 25,516,681 (exon 5).

[0062] Thus, in some embodiments, the target nucleic acid is AGAAAAGCACTCTTTGGCCTGTTGTGACTGGGACAGTTGA CAGCACCCAGGTGTCCTTTAATGAAAATGCTCTTGACACC AATGCATCCTAGCATCACAGCTTCAGGAAGCCTTCTCAAG TGTGCATGGGGAGTACTATGTCTTTCATCAATAATGAAAT CTTCTGATTTG (exon 1, sequence number 1).

[0063] In some embodiments, the target nucleic acid is TGTGCCATTCTATTATAAAAGATCAGTAGCTTCCTTTACC GACGTGTATATTCTATTCTAGAACATTGAGCTATGGAAGAC TCCCACCTAAGGGAATTAGTTTTACACCTTCAG (exon 2, Sequence number 2).

[0064] In some embodiments, the target nucleic acid is: ATAAAGACTGCTGAGAAGAG CACCCTCTGGTGTTGTCACAGAGGCAAGTGCTACCGCACA GGCATGCTGCAGTGAATTTAACTGATCCTCTGTCCCTGCA ACCGTTGTTTAAGGATGCTATTCTG (exon 3, SEQ ID NO: 3) do.

[0065] In some embodiments, the target nucleic acid is AAAAGACTGTGGAGGAAGAAA ACCCTTTACCCTGTTGTTCAGGGAGAAACTGACACCACTC AACTGCCTGGCACTGAAAATGTGGCATCCAGTCCACTTTA CCATCAGTGTTTAAGGAAACCATCTCTG (Exon 4, SEQ ID NO: 4 ).

[0066] In some embodiments, the target nucleic acid is ATAAGGATGACTGAGGAAGA GTACTCTTTGGCTTGTTGACACCAGCACAGCTGACACACC CAGATATCTGTTTGGTCTCCTGTGAACTTTCAACCAGGAT TTAAGGATGCCACTCTG (exon 5, sequence number 5).

[0067] In some embodiments, the disclosed ASO comprises the nucleic acid sequence TAGAGGTGAAGGC CAGGCAC (ASO-1, SEQ ID NO: 6).

[0068] In some embodiments, the ASO comprises the nucleic acid sequence GTACTCTTCCTCAGTCAT CC (ASO-2, SEQ ID NO:7).

[0069] In some embodiments, the disclosed ASO comprises the nucleic acid sequence TGTCAGTTTCTCC CTGAACA (ASO-3, SEQ ID NO:8).

[0070] In some embodiments, the disclosed ASO comprises the nucleic acid sequence TAGAATGGCACAT CTCTTGG (ASO-4, SEQ ID NO:9).

[0071] In some embodiments, the disclosed ASO comprises the nucleic acid sequence GTTTTCTTCCTCC. ACAGTCT (ASO-6, SEQ ID NO: 10).

[0072] In some embodiments, the disclosed ASO comprises the nucleic acid sequence CTGGTGTCAACAA GCCAAAG (ASO-7, SEQ ID NO:11).

[0073] Further ASOs that can target exon 1 at the 3'-end of the SNORD115 region include Table 1 below provides examples of exon 2 that may be targeted at the 3' end of SNORD115. Examples of ASOs are provided in Table 2 below. Target exons at the 3' end of SNORD115 Exemplary ASOs that may be used are provided below in Table 3. Exemplary ASOs that can target exon 4 are provided below in Table 4. SNORD Exemplary ASOs that can target exon 5 at the 3'-end of 115 are provided in Table 5 below. can be. [Table 1] [Table 2] JPEG2025041632000004.jpg233127 [Table 3] [Table 4] JPEG2025041632000007.jpg233143JPEG2025041632000008.jpg23674 [Table 5] JPEG2025041632000010.jpg23362

[0074] The disclosed oligonucleotides suppress the expression of paternal UBE3A, particularly in neuronal cells. The regulation of induction or upregulation of paternally expressed UBE3A in the mouse model can be achieved by This is accomplished by hybridizing to the 5'-end of UBE3A-AS. In embodiments, the oligonucleotides disclosed herein have a ΔG °, e.g., -10 to -60 kcal, e.g., -12 to -40, e.g., -15 to -3 0kcal or -16~-27kcal, e.g., -18~-25kcal ΔG° Accordingly, it hybridizes to a subsequence of the target nucleic acid of SEQ ID NO:1.

[0075] In some embodiments, the disclosed oligonucleotides are administered in saline or non-targeted form. Compared with the expression levels of UBE3A in neuronal cells treated with nucleotides At least 20% of the subjects were treated with saline or non-targeting oligonucleotides. At least 30% compared with the expression level of UBE3A in cultured neuronal cells, 5%, 40%, 45%, 50%, 55%, 60%, 80%, 100%, 120%, 150 %, 160%, 170%, 180%, 190%, 200%, 210%, 220%, 230 %, 240% or 250%. In embodiments, the disclosed oligonucleotides are prepared by dissolving in saline or non-targeting oligonucleotides. SNHG1 downstream of SNORD1 in neuronal cells treated with tide 4 by at least 20% compared to the levels of the transcripts, more preferably by saline or non-standard Expression of SNORD1115-45 in neuronal cells treated with targeted oligonucleotides at least 30%, 40%, 50%, or 60% higher than the level of the downstream SNHG14 transcript %, 70%, 80%, 90%, or 95% downstream of SNORD115-45 The level of HG14 transcript can be reduced.

[0076] Targeting by the disclosed oligonucleotides is achieved by sequential nucleotide division of the oligonucleotide. It is driven by hybridization between the nucleic acid sequence and the target nucleic acid. In one embodiment, the disclosed oligonucleotide comprises a nucleic acid sequence that is linked to the oligonucleotide and the target nucleic acid. The hybridization sequence to the target nucleic acid is not affected despite the mismatch. The above-mentioned modifications may still be sufficient to show the desired modulation of UBE3A expression. The reduced binding affinity is advantageously due to the presence of LNAs in the oligonucleotide sequence. The present invention can increase the binding affinity for targeting 2'-modified nucleosides, including The increased number of nucleotides and / or the increased number of modifications in the oligonucleotide can be used to This is compensated for by the decorated nucleoside.

[0077] The disclosed antisense oligonucleotides include those disclosed herein that are At least 90% homology to one of the five exons located in the 5'-end of S Complementarity, e.g., at least 91%, e.g., at least 92%, e.g., at least 93% %, for example at least 94%, for example at least 95%, for example at least 96% For example, at least 97%, for example at least 98%, or 100% complementary. It can have a continuous nucleotide sequence of 10 to 30 nucleotides. .

[0078] Oligonucleotide design involves determining the pattern of nucleoside sugar modifications in the oligonucleotide sequence. The disclosed antisense oligonucleotides contain sugar-modified nucleosides. It may contain DNA, RNA, or arabinonucleic acid (ANA) nucleosides. In some embodiments, the oligonucleotide comprises a sugar-modified nucleoside and a DNA In some embodiments, the oligonucleotide comprises a sugar-modified nucleoside. In some embodiments, oligonucleosides include nucleosides and RNA nucleosides. The nucleotides include sugar-modified nucleosides and ANA nucleosides.

[0079] In some embodiments, the oligonucleotide comprises at least one modified nucleotide. osids, e.g., at least 2, at least 3, at least 4, at least 5, At least 6, at least 7, at least 8, at least 9, at least 10 , at least 11, at least 12, at least 13, at least 14, at least In one embodiment, each of the nucleotides contains at least 15, or at least 16, modified nucleosides. In one embodiment, the oligonucleotide may comprise 1 to 10 modified nucleosides, e.g., 2 to 9 modified nucleosides. Modified nucleosides, e.g., 3 to 8 modified nucleosides, e.g., 4 to 7 modified nucleosides modified nucleosides, for example, 6 or 7 modified nucleosides.

[0080] In some embodiments, the oligonucleotide comprises at least one modified nucleotide. In some embodiments, the nucleoside bond in the contiguous nucleotide sequence The internucleoside linkages are phosphorothioate or boranophosphate internucleoside linkages. .

[0081] In some embodiments, the disclosed antisense oligonucleotides comprise one or more Sugar-modified nucleosides, such as 2' sugar-modified nucleosides, are preferred. The disclosed antisense oligonucleotides may comprise one or more LNA nucleosides or 2' sugar modified nucleosides, where the 2' position is -F; -CF3, -CN, - N3, -NO, -NO2, -O-(C1-C10 alkyl), -S-(C1-C10 ar -alkyl), -NH-(C1-C10 alkyl), or -N(C1-C10 alkyl)2; -O-(C2-C10 alkenyl), -S-(C2-C10 alkenyl), -NH-(C 2-C10 alkenyl), or -N(C2-C10 alkenyl)2; -O-(C2-C 10 alkynyl), -S-(C2-C10 alkynyl), -NH-(C2-C10 alkynyl) -N(C2-C10 alkynyl), -O--(C1-C10 alkylene)-O --(C1-C10 alkyl), -O-(C1-C10 alkylene)-NH-(C1-C 10 alkyl), -O-(C1-C10 alkylene)-NH(C1-C10 alkyl)2 , -NH-(C1-C10 alkylene)-O-(C1-C10 alkyl), and -N( C1-C10 alkyl)-(C1-C10 alkylene)-O-(C1-C10 alkyl) and is substituted by a substituent independently selected from the group consisting of:

[0082] In some embodiments, the disclosed oligonucleotides comprise at least one LNA units, e.g., 1, 2, 3, 4, 5, 6, 7, or 8 LNA units, e.g. , 2 to 6 LNA units, for example, 3 to 7 LNA units, 4 to 8 LNA units In some embodiments, the LNA unit may include 3, 4, 5, 6 or 7 LNA units. In some embodiments, all of the modified nucleosides are LNA nucleosides. In embodiments, the LNA comprises a 2'-4' biradical bond of -L-, where -L- is - In some embodiments, -O-CH2- is optionally substituted. , LNA comprises a 2'-4' biradical bond of -L-, where -L- is -O-CH In some embodiments, the LNA comprises a 2'-4' biradical bond of -L-. In a further embodiment, the oligonucleotide is The nucleotide is beta-D-oxy-LNA and the following LNA units: beta-D or Thio-LNA, amino-LNA, oxy-LNA, or alpha-LNA and / or ENA, or a combination thereof. In a further embodiment, all LNA cytosine units are 5-methyl-cytosine. In some embodiments, the oligonucleotide or contiguous nucleotide sequence is The string comprises at least one LNA unit at the 5' end of the nucleotide sequence and at least one LNA unit at the 3' end of the nucleotide sequence. The LNA unit has at least two LNA units.

[0083] In some embodiments, the disclosed oligonucleotides recruit RNase H. In some embodiments, the oligonucleotide can be a single The gapmer design or structure is also referred to as a "gapmer." In the structure, the oligonucleotide has at least three distinct structural sequences in the '5->3' orientation. The region includes a 5'-flank, a gap, and a 3'-flank, FG-F'. In total, the flanking regions F and F' (also called wing regions) are comprises a contiguous stretch of modified nucleosides that is complementary to the AS target nucleic acid, while The gap region, G, is the region where the nucleotide is inserted when the oligonucleotide forms a duplex with the target nucleic acid. An endonuclease, preferably an endonuclease, such as an RNase, e.g., an RNase It contains a contiguous stretch of nucleotides that can recruit H. Nucleosides that can recruit RNases, especially RNase H, are involved in the synthesis of DNA, alpha α-L-oxy-LNA, 2'-fluoro-ANA and UNA. The regions F and F' adjacent to the 5' and 3' ends of the region G are preferably non-nucleotidic. Reagent-recruiting nucleosides (nucleosides with 3'-endo structures), more preferably In some embodiments, the 3' fragment comprises one or more affinity-enhancing modified nucleosides. The link contains at least one LNA nucleoside, preferably at least two LNA nucleosides. In some embodiments, the 5' flank comprises at least one LNA In some embodiments, both the 5' and 3' flanking regions include In some embodiments, all of the flanking regions include LNA nucleosides. In another embodiment, the flanking region is , both LNA nucleosides and other nucleosides (mixed flanks), e.g., DNA Nucleosides and / or non-LNA modified nucleosides, e.g., 2'-substituted nucleosides. In this case, the gap may contain affinity-enhancing modified nucleosides, preferably Often, LNA, e.g., beta-D-oxy-LNA, is flanked at the 5' and 3' ends. At least five RNase H-recruiting nucleosides (nucleosides with 2'-endo structures) A gap is defined as a contiguous sequence of a sequence of amino acids, preferably DNA. The nucleosides of the 5' and 3' flanking regions adjacent to the region are The modified nucleoside is preferably a non-nuclease recruiting nucleoside. For oligonucleotides with mixed flanks containing DNA, the 5' and 3' nucleotides A nucleoside is a modified nucleoside.

[0084] Methods for producing the disclosed oligonucleotides are known. In the present study, methods use phosphoramidite chemistry (e.g., Caruthers et al., 1999). 87, Methods in Enzymology vol.154, pages 2 In a further embodiment, the method comprises the steps of: The method further comprises reacting the peptide sequence with a conjugate moiety (ligand).

[0085] In some embodiments, one or more modified internucleoside linkages contain a chiral atom. Oligonucleotide methodologies that provide stereochemical control at the site of synthesis are utilized. For example, these The methodology of WO2010 / 064146 and WO2014 is incorporated by reference. / 012081, WO2015 / 107425, WO2016 / 079183, WO20 16 / 079181, WO2016 / 096938, WO2017 / 194498, and See WO2018 / 177825.

[0086] Those skilled in the art will appreciate that useful nucleic acids provided by this disclosure can be synthesized using the oligonucleotides described herein. It will be appreciated that the present invention includes those that preserve and / or express the sequences of the nucleic acid sequences. In embodiments, such nucleic acids are expressed in cells (e.g., microbial cells, e.g., for production, and / or mammalian cells, e.g., for therapeutic purposes) and / or in cells. The vector may be or contain a vector suitable for replication and / or expression in a mammalian cell. Those skilled in the art are aware of various techniques (e.g., by polymerase chain reaction). Amplification, e.g., cleavage, e.g., by restriction digestion, in vitro, e.g., by gap repair or in vivo ligation. (e.g., recombinant nucleic acid techniques using

[0087] Any of the aforementioned oligonucleotides and / or oligonucleotide conjugates Also disclosed are pharmaceutical compositions comprising the above and a pharma- ceutically acceptable diluent, carrier, salt and / or adjuvant (excipient). Pharmaceutically acceptable diluents include phosphate buffered saline (PBS) and pharma- ceutically acceptable salts include, but are not limited to, sodium and potassium salts. In some embodiments, the diluent is artificial cerebrospinal fluid (aCSF).

[0088] The disclosed oligonucleotides can be used in combination with pharma- ceutical compositions or formulations. The composition may be mixed with any acceptable active or inactive substance for formulation of a pharmaceutical composition. The products and methods include, but are not limited to, the route of administration, the extent of the disease, or the dose administered. It depends on a number of criteria that cannot be determined.

[0089] Those skilled in the art will now describe methods for storing and / or administering nucleic acid therapeutics, such as oligonucleotide therapeutics. We recognize a variety of formulation strategies that are useful. For example, Pushpendra et al., " Nucleic Acids as Therapeutics”, From Nucl eic Acid Sequences to Molecular Medicine s, eds. Erdmann and Barciszewski, Springer-Ve rlag, 2012; Juliano “Delivery of Therapeut ic Oligonucleotides” Nuc.Acids.Res.44:65 18, 2016.

[0090] In some embodiments, the oligonucleotide is formulated as a prodrug. In particular, with respect to oligonucleotide conjugates, the prodrug may be coupled to the site of action, e.g. Once delivered to the target cell, the conjugate moiety can be cleaved from the oligonucleotide. do.

[0091] A method for treating or preventing a disease, comprising administering a therapeutically or prophylactically effective amount of a compound according to the invention to a patient of the present invention. The oligonucleotide, oligonucleotide conjugate, or pharmaceutical composition disclosed herein The present invention also provides a method of treating a disease comprising administering the composition to a subject suffering from or suspected of having the disease. As shown.

[0092] For the manufacture of a medicament for the treatment of a disorder as referred to herein or Also disclosed is the use of the disclosed oligonucleotides for methods of treating such disorders. .

[0093] The disclosed pharmaceutical compositions can be administered topically (e.g., to the skin, inhalation, eye, or ear), or Enteral (e.g., orally or via the gastrointestinal tract), or parenteral (e.g., intravenously The drug may be administered intravenously (subcutaneously, intramuscularly, intracerebrally, intracerebroventricularly, or intrathecally). In embodiments, the disclosed pharmaceutical compositions are administered intravenously, intraarterially, subcutaneously, intraperitoneally, or intramuscularly. Intrathecal or intracranial, e.g., intracerebral or intraventricular, injection or infusion, In some embodiments, the oligonucleotide is administered intracerebrally. or by intracerebroventricular injection. In another embodiment, the active oligonucleotide Alternatively, the oligonucleotide conjugate is administered intrathecally. In the present invention, the pharmaceutical composition is administered intracerebrally and intramedullary cisternae (intracisternae magna) It is administered by injection.

[0094] In some embodiments, AS therapy using the pharmaceutical compositions described herein includes The drug is administered to a subject or subjects suffering from or suspected of suffering from S. In this morphology, the subject has a genetic trait associated with a defect in the maternal UBE3A gene. In some embodiments, the AS-associated genetic trait is a maternal deletion or In some embodiments, the AS-associated genetic trait is, or comprises, uniparental dissociation. In some embodiments, the AS-associated genetic trait is or comprises: In some embodiments, the AS-associated genetic The objective feature is or includes an imprinting defect.

[0095] In some embodiments, the subject is diagnosed with one or more developmental histories and and / or laboratory findings, such as being determined to have one or more of the following: There are: (i) Normal prenatal and birth histories, with normal head circumference and no major congenital anomalies; History; (ii) difficulty feeding the newborn and / or infant; (iii) Evidence of developmental delay by age 6–12 months, occasionally with trunk hypotonia associated with state; (iv) unsteady limb movements and / or increased laughter; (v) development is delayed but progresses (no loss of skills); (vi) normal metabolic, hematological, and chemical laboratory profiles; (vii) Structurally normal brain (minor cortical lesions) as assessed using MRI or CT (They may have vascular atrophy or dysmyelination).

[0096] Alternatively or additionally, in some embodiments, the subject has a condition consistently associated with AS. The patient is determined to exhibit one or more clinical features consistent with the present invention, for example, one or more of the following: Have: (i) developmental delay, functionally significant; (ii) Movement or balance disorders, usually gait ataxia and / or shuddering movements of the limbs. In some embodiments, such movement disorders may be mild. Such movement disorders may not manifest as obvious ataxia, but may include, for example, forward leaning, instability, may be or include numbness, clumsiness, or quick, jerky movements; (iii) Peculiar behavior: increased frequency of laughing / smiling; apparent happiness; easily An excitable personality, often accompanied by excited hand-flapping or waving movements; Any combination of hyperactive behaviors (iv) Speech impairment, e.g., absent or minimal use of language; alternative or Additionally, sensitivity and non-verbal communication skills are stronger than verbal skills. stomach.

[0097] Alternatively or additionally, in some embodiments, the subject suffers from AS frequently (e.g., occasionally). Approximately 80% of cases are associated with one or more clinical features, such as one of the following: It has been decided to show the above: (i) Retarded and disproportionate growth in head circumference, usually resulting in By the end of the study, microencephaly occurs (≦2 S.D. of normal OFC). The disease is more pronounced in individuals with 15q11.2-q13 deletions; (ii) epileptic seizures, usually with onset by age 3. In some embodiments, Although seizure severity may decrease with age, some embodiments may nonetheless In some cases, the seizure disorder continues into adulthood. (iv) abnormal EE with a characteristic pattern as known in the art G. In some embodiments, the EEG abnormalities occur in the first 2 years of life and are consistent with clinical features may precede a clinical epileptic event and may not correlate with a clinical epileptic event.

[0098] Alternatively or additionally, in some embodiments, the subject suffers from AS occasionally (e.g., over time). Approximately 20%–80% of patients with glaucoma have one or more clinical features associated with glaucoma, such as It has been determined that the condition exhibits one or more of the following: (i) Flat back of the head (ii) Occipital artery groove (iii) Sticking out the tongue (iv) Tongue thrusting; difficulty sucking / swallowing (v) Feeding problems and / or hypotonia in infants (vi) Maxillary prognathism (vii) Wide-open mouth and widely spaced teeth (viii) Frequent drooling (ix) Excessive chewing / mouth movement behavior (x) Strabismus (xi) hypopigmented skin, light hair and eye color, in some embodiments, It is determined by comparison with the family and is typically seen only in cases of deletions. (xii) Excessive deep tendon reflexes in the lower extremities (xiii) Elevated and curved arm position, especially during locomotion (xiv) Wide-legged gait with pronated or everted ankles (xv) Increased sensitivity to heat (xvi) abnormal sleep-wake cycles and reduced need for sleep (xvii) An interest in / fascination with water; certain papers and plastics, etc. Fascination with rustling objects (xviii) Abnormal food-related behavior (xix) Obesity (in older children) (xx) Scoliosis (xxi)Constipation

[0099] In some embodiments, a nucleic acid therapy as described herein (e.g., ASO, etc.) Therapeutic regimens for the treatment of AS using oligonucleotide therapy (such as ribosome inhibitors) are described herein. One or more pharmaceutical compositions that contain and / or deliver the oligonucleotides described herein. The administration of the above doses or containing the same.

[0100] In some embodiments, the subject on whom the provided therapeutic regimen is administered is, for example, one or other nucleic acid therapy (e.g., one or more other oligonucleotides targeting UBE3A-AS). currently receiving or previously receiving one or more other AS therapies, including trehalose, ... , WO2014004572A3, US9617539B2, US2017036259 2A1, and EP2864479B1.

[0101] In some embodiments, the subject to whom the therapeutic regimen provided is administered is a subject who has been Have previously suffered or are currently suffering from epileptic seizures and / or are taking anti-seizure therapy For example, in some embodiments, the subject has received or previously received one or more Valproic acid, clonazepam, phenobarbital, topiramate, carbamazepine, Lamotrigine, levetiracetam, phenytoin, zonisamide, ethosuximide, gabapentin tin, felbatame, oxcarbazepine, tranexene ranxene), ACTS, nitrazepam, pregabalin, mysoline, vigabatrin, etc. In some particular embodiments, the subject has previously undergone or may have undergone , one or more of valproic acid, clonazepam, phenobarbital, topiramate, carbamazepine Previously received or have received zepine, lamotrigine, and / or levetiracetam It's fine.

[0102] Alternatively or additionally, in some embodiments, the subject is on, e.g., a ketogenic diet, low The patient may have previously undergone or may be undergoing dietary therapy such as glycemic index therapy.

[0103] Still further alternatively or additionally, in some embodiments, the subject is administered a vagus nerve stimulation factor. have previously undergone or may have undergone treatment with

[0104] As will be apparent to one of skill in the art reading this disclosure, the methods of treatment provided are As described above, oligonucleotides and further therapies (e.g., alternative oligonucleotides) may be used. and / or antiepileptic therapy and / or one or more other therapeutic interventions) The method includes administering both, so that the subject is receiving a combination therapy (e.g., Intrathecal administration Use of the oligonucleotides disclosed herein for the manufacture of a medicament in the form of a dosage for is also disclosed.

[0105] The present invention relates to a method for the manufacture of a pharmaceutical agent in a dosage form for intracerebral or intraventricular administration. The use of oligonucleotides is also disclosed.

[0106] The oligonucleotides disclosed herein for the manufacture of a pharmaceutical dosage form for intraventricular administration. The use of otides is also disclosed.

[0107] In some embodiments, the oligonucleotides disclosed herein are administered in combination with another therapeutic agent. The therapeutic agent may be, for example, an anticonvulsant.

[0108] Numerous embodiments of the invention have been described. Nonetheless, the spirit and scope of the invention are to be understood as being within the scope of the invention. It will be understood that various modifications may be made without departing from the scope of the invention. , other embodiments are within the scope of the following claims. EXAMPLES

[0109] Example 1: result RNA-sequencing analysis of mouse and human CNS reveals stability and We identified regions that are believed to be important for transcription and / or transcriptional function. Further analysis of the regions showed a low level of sequence conservation between mouse and human (Figures 1A-1D).

[0110] Based on these findings, we aimed to target specific regions in the Ube3a-AS transcript. A mouse-specific ASO was designed to target this region (Table 6 and Figure 2A). To test whether O reactivates the expression of the paternal Ube3a allele, primary hippocampal nigra Neuronal cultures were generated from the Ube3aYFP reporter mouse model (Ube3a+ / YFP; Fig. 2B ), and at day in vitro (DIV), the control ASO [ASO-C( 10uM, n=3)], and three ASOs targeting Ube3a-AS [ASO-1.1; ASO-1.2, ASO-3.1 (1 μM, 5 μM, and 15 μM, n = 3)], and ASO-B (1 μM, 5 μM, and 15 μM, n = 3). Neurons were treated with topotecan [Topotecan (300 nM, n = 3)] and negative control Three days after treatment (10 DIV), Paternal Ube3aYFP protein levels in individual cells using immunofluorescence imaging Compared with the controls (ASO-C and Veh), each treatment significantly reduced paternal Ub Increased e3aYFP protein levels, ASO-1.1 (15 μM), ASO-3.1 (15 μM), and topotecan treatment (Figures 2D and 2E) achieved similar levels. was

[0111] A human-specific ASO was then designed to target this region, which is Non-polymorphic regions and regions conserved in macaques (rhesus and cynomolgus monkeys) ( The four ASOs targeted human induced pluripotent stem (HST)-derived ... iPSC neural progenitor cells differentiate into GABAergic neurons over a 14 DIV period. , followed by control ASO [ASO-C (10 μM, n = 3)], topotecan [Topo (1 μM , n = 2)], as well as six ASOs targeting UBE3A-AS [ASO-1, AS O-2, ASO-3, ASO-4, ASO-5, and ASO-6 (10 μM, n = 3) In addition, the patient was treated with AS targeted to the intronic region downstream of SNORD109B. After 6 days of treatment (20 DIV), RNA was isolated from neurons. We isolated and estimated steady-state RNA levels of UBE3A-AS and UBE3A versus control treatment. Except for ASO-7, each ASO significantly increased UBE3A-AS RNA levels (Fig. 3B). The effect of ASO-2 and ASO-4 on the expression of β-lactamase inhibitors was significantly reduced in mice with ASO-2 and ASO-4 having the greatest effect (Table 8 and Figure 3C). UBE3A RNA levels were also increased after treatment with each ASO ( Fig. 3D ).

[0112] Considering the effect on UBE3A-AS RNA levels, the efficacy of ASO-4 was further GABAergic iPSC-derived neurons were cultured at 14 DIV for 10 days. ASO-4 in a 1 / 2 log dose curve of 100 mg / kg / day, as a positive control, and for comparison between treatments. The patients were treated with topotecan [1nM, 3nM, 10nM, 30nM, 100nM, 30 0 nM, 1 μM, 3 μM, 10 μM, and 30 μM (ASO-4, n = 6; topotecan At 20 DIV, steady-state RNA levels of UBE3A-AS were measured. Dose-response curves were fitted to determine IC50 and Emax (i.e., maximum UBE3A-AS inhibition) ) was estimated (Table 9 and Figure 4A). The dose-response curves of ASO-4 and topotecan were significantly (parallel test: F(3,145) = 11.2, p < 0.0001), and therefore the relative No potency was estimated. Equivalence studies were performed to assess the IC50 and E The maximum was not equivalent [ASO-4 / topotecan IC50 ratio: = 1.2 (significant difference) Lower Confidence Limit = 1.1; Upper Confidence Limit = 1.3; Emax Ratio = -4.1 (Lower Confidence Limit = -12.9; Confidence upper limit = 4.8).

[0113] Next, SNORD116, IPW, and SNORD, which are located upstream of the ASO-4 target region, 115, and SNORD109A RNA, the efficacy of ASO-4 and topotecan The results were examined (see Figure 1A). Except for SNORD116, ASO-4 inhibited IPW , SNORD115, and SNORD109A / B RNA levels. In contrast, topotecan inhibited SNORD11 6, for IPW, SNORD115, and SNORD109A / B RNA levels A significant effect was observed, which was dose-dependent (Table 10 and Figures 4B-4E). Except for the concentrations of topotecan (3 μM, 10 μM, and 30 μM; Figure 4F), ASO-4 and Both rituximab and topotecan increased total UBE3A RNA levels in a dose-dependent manner.

[0114] At later time points in the differentiation of iPSC-derived neurons, the efficacy of ASO-4 was further enhanced. GABAergic iPSC-derived neurons were cultured in cultured AS-treated control mice at 59 DIV. O [ASO-C, 10 μM (n = 3)] and ASO-4 [1 μM, 5 μM, and 10 (n=3)] and the steady-state RNA levels of UBE3A-AS and UBE3A The IL-1 expression level was measured as described above (Figure 4G). Unlike neurons, UBE3A and UBE3A-AS RNA levels were highly inverted For example, the UBE3A-AS RNA level was proportional to the The effect of ASO-4 (10 μM) was similar between neurons treated at 14 and 59 DIV. [20DIV: UBE3A-AS: ↓ 87% (95% confidence interval (CI): 80~ 95%); 65DIV:↓81% (95% CI:74-88%)] were UBE3A R The effect of ASO-4 on NA levels was substantially increased in treated neurons at 59 DIV had been [20DIV: ↑30% (95%CI: 16-44%); 65DIV: ↑86% (95%CI:59%~113%)].

[0115] Then, ASO-4 (ASO-4.1, ASO-4.2, ASO-4.3, and ASO-4.4) The target sequence of ASO-3 (ASO-3.1 and ASO-3.2) and two other target regions, ASO-4.4 and ASO-3.1, To optimize ASO-3.2 and ASO-3.3) and ASO-6 (ASO-6.1) (Table 11) Further ASOs were designed to target the 5'-end of UBE3A-AS. For comparison purposes, ASO-4 was produced by two different vendors (ASO-4.S , Sigma;ASO-4.I, Integrated DNA Technologi Human iPSC-derived neurons (GABAergic) were cultured at 14 DIV for 5 days. The 1 / 2 log dose curves of ASO-3.1, ASO-3.2, ASO-4.S, and AS O-4.I, ASO-4.1, ASO-4.2, ASO-4.3, ASO-4.4, and and ASO-6.1 [30 nM, 100 nM, 300 nM, 1 μM (n = 6)]. At 20 DIV, the IC50 and Emax of each ASO were estimated as described above ( Figure 5A-B and Table 12. Dose-response curves were similar between ASOs (parallel studies: F(16 ,513)=1.6, p=0.06), ASO-4 and ASO-6.1 had the highest relative The efficacy of ASO-4.S and ASO-4.I was not observed (Table 13). There wasn't.

[0116] At later time points in the differentiation of iPSC-derived neurons, ASO-4 and ASO- The efficacy of 6.1 was further investigated. GABAergic iPSC-derived neurons were cultured in 29D IV, treated with ASO-4 and ASO-6 at a 10-point 1 / 2 log dose curve. [1nM, 3nM, 10nM, 30nM, 100nM, 300nM, 1μM, 3μM , 10 μM, and 30 μM (n=3)]. At 35 DIV, the IC50 and Emax was estimated as described above (Figures 5C-D and Table 14). O-4 and ASO-6.1 were not similar (parallel test: F(3,172) = 22. 7, p<0.0001). Equivalence testing demonstrated that ASO-4 and ASO-6.1 were of equivalent efficacy. The results showed that the ASO-6.1 / ASO-4 ratios were significantly different from the IC50 / IC50 ratios, but had different Emax values. 0=1.03 (Lower Confidence Limit=1.0;Upper Confidence Limit=1.1);Emax=-1.3 (Lower Confidence Limit= -2.6; upper confidence limit = -0.08)], ASO-6.1 is the maximum UBE3A-AS level The effect of ASO-4 and ASO-6.1 on UBE3A RNA levels was The effects were similar, with each treatment increasing RNA levels in a dose-dependent manner (Figure 5D).

[0117] ASO-4 and ASO-6.1 induce activation of glutamatergic iPSC-derived neurons Glutamatergic iPSC-derived neurons were also examined at 14 DIV. , treated with a 10-point 1 / 2 log dose curve of ASO-4 and ASO-6.1 [1nM, 3nM, 10nM, 30nM, 100nM, 300nM, 1μM, 3μM, 1 0 μM, and 30 μM (n = 3)]. At 20 DIV, the IC50 and Emax of each ASO were The dose-response curves of ASO- 4 and ASO-6.1 were similar and not significantly different (parallel tests: F(3,165) = 1.9, p=0.1), with ASO-6.1 having the highest relative efficacy (Table 16). As shown, ASO-4 and ASO-6.1 inhibited the UBE3A RNase inhibitor in a dose-dependent manner. A levels were increased (Fig. 5F), but the high levels could not be attributed to the treatment for each concentration. There was a degree of variation (R2=0.17).

[0118] conclusion To develop a treatment for AS, we aimed to identify specific regions in mouse and human neurons. The targeted ASO inhibited Ube3a-AS / UBE3A-AS and paternal Ube3a / U Experiments were performed to determine whether the expression of the BE3A allele could be reactivated. The findings suggest that ASOs targeting this region in mouse and human neurons have potent It has antisense activity and has been shown to reverse Ube3a / UBE3A imprinting.

[0119] Two of the three ASOs targeting Ube3a-AS (ASO-1.1 and ASO -3.1) suppressed the expression of the paternal Ube3a allele in mouse neurons by using the optimal concentration of Reactivation occurred to a level similar to that achieved by potecan (300 nM).

[0120] Similarly, each of the human-specific ASOs suppressed UBE3 expression in human iPSC-derived neurons. ASO-4 and AS significantly reduced the steady-state RNA levels of A-AS. O-6.1 almost completely abolished the expression of UBE3A-AS. 6.1 Given that the target region is 100% conserved between humans and macaques, The efficacy of their ASO was evaluated in vivo in either cynomolgus or rhesus macaques. Unlike topotecan, ASO-4 inhibits the upstream SNORD116, For IPW, SNORD115, or SNORD109A / B RNA, if any However, ASOs have only a small effect on transcription at or downstream of the target region. This is consistent with the idea.

[0121] Low concentrations (3 nM) of ASO-4 and ASO-6.1 inhibited the UBE3A-AS RNA transcription factor (UBE3A-AS) signaling. Although higher concentrations (≥100 nM) of ASO significantly reduced UBE3A RNA levels, This suggests that UBE3A-AS is not essential for increasing the transcription of UBE3A. A specific threshold required to inhibit, or inactivate, UBE3A-AS is required to inhibit, the paternal UB To quantify the time lag leading to E3A reactivation or UBE3A RNA levels It may reflect the sensitivity of the assay used.

[0122] In summary, the findings suggest that ASOs targeting candidate regions in UBE3A-AS may be effective in preventing and treating inflammatory bowel disease. Almost completely abolishing UBE3A imprinting in IL-1, and preparing for future clinical development This suggests that they have uncovered at least two ASOs.

[0123] Different RNA modifications [2'-hydroxymethyl (2'-OMe), 2'-methoxyethyl (2'-OMe), 2'-MOE, and locked nucleic acid (LNA)], and backbone [phosphorothioate ( PS) and phosphodiester (PO)], ASO-4 and ASO-6. Derivatives of 1 were also designed (Table 17). [Table 6] [Table 7] [Table 8] JPEG2025041632000014.jpg235146JPEG2025041632000015.jpg237146JPEG2025041632000016.jpg23351 [Table 9] [Table 10] [Table 11] [Table 12] [Table 13] [Table 14] [Table 15] [Table 16] [Table 17]

[0124] material and method Antisense oligonucleotide design Antisense oligonucleotides (ASOs) are a class of oligos that are a statistical folding mechanism of nucleic acids. and Software for the Study of Regulatory RNAs). , the candidate ASO with the lowest binding site disruption energy and free binding energy (20 18mers) were identified for each target sequence, and then motifs with enhanced effect were identified. The lowest predicted free end of the target sequence generated by Soligo was ASOs were further filtered based on their accessibility within the secondary structure to the center of energy mass. In some cases, the sequences generated by RNAfold and Mfold were Secondary structure models were compared using the lowest free energy structure.

[0125] Human ASOs were filtered using the following criteria: 1) the target sequence was polymorphic; [dbSNP138, dbSNP150, and 1000 Genomes Phase 3 phylogenetic 2) the target sequence is a rhesus macaque and cynomolgus macaques; 3) the target sequence was conserved Located upstream of Snord115 / SNORD115 snoRNA (per exon) The remaining ASOs were then analyzed by free energy (<=-8 kcal / mol), target Average mismatch probability for site nucleotides, binding site disruption energy (low>high), secondary Position within the structure (Ensembl center of mass) and sequence motifs associated with high / low efficacy The ranking was based on the presence / absence of

[0126] Mouse primary hippocampal neurons Primary cultures of hippocampal neurons were cultured in Ube3am+ / pYFP males and wild-type C57BL / P0-P1 offspring mice (Ube3am+ / p+ and Ube3) were obtained by mating 6J females. am+ / pYFP). Genotypes were determined using previously described methods. Briefly, hippocampal neurons were cultured with poly-D-lysine (152028, Ther. mo Fisher Scientific) and laminin (23017-01, Th 96-well plate coated with ermo Fisher Scientific In a standard bottom plate, B27 (Invitrogen) and penicillin / streptomycin were added. Neurobasal A medium (Invitrogen) supplemented with ampictomycin (Invitrogen) was used. The culture medium was maintained at 37 °C for 3 h under 5% CO2 until use. The culture was maintained at 7°C.

[0127] Mouse Neuron Imaging Mouse primary hippocampal neurons were cultured at 10 DIV (3 days after treatment) in 4% paraformaldehyde. The cultures were then washed twice with 1X PBS and fixed with 1X PBS. They were fixed in 4% paraformaldehyde for 15 minutes and then washed three times in 1X PBS. The cells were incubated in 0.3% T-PBS supplemented with 5% goat or donkey serum (T-PBS). The cells were blocked in Lyton-X100 for 1-2 hours at room temperature with gentle agitation. Cells were incubated with anti-GFP [Novus Biologicals, NB 600-308 ( heron)] and anti-NeuN (Millipore, 05-557(mouse)] antibodies The cells were incubated with 0.1% The sections were washed three times for 15 minutes each in 1XPBS with Tween 20, then incubated with anti-rabbit 488 (Jackson ImmunoResearch, 111-545-144) and anti-mouse Cy3 (Jackson ImmunoResearch, 115-165 -166) The cells were then incubated with the secondary antibody for 24 hours at 4°C in the dark. The sections were washed 4 times for 15 minutes each in 1X PBS with 0.1% Tween 20. Hoechst stain (Thermo Fisheye) was used at a dilution of 1:1000 in the eye wash. Nuclei were labeled using a 35-well plate (Sigma Scientific).

[0128] Cytation 5 and Gen5 Image+ software (BioTek, Plates were imaged using a 4X contrast medium (Inooski, VT). Using inverted focus, create 5x4 autofocus images with overlapping tiles for automatic image stitching. A montage image of each well was created by acquiring 1000 x 1000 pixels of the chromatogram. The filters used were , DAPI (377,477), GFP (469,525), and RFP (531,5 93) Exposure times and gains were determined for each plate using negative and positive controls. The same focal height was used as for the GFP and RFP filters. Autofocus was performed on the nuclei (Hoechst stain, DAPI) for each well. Images were stitched together with Gen5 Image+ software.

[0129] IN Cell Developer 6.0(GE Healthcare Lif (E Sciences, Pittsburgh, PA) for single-cell image analysis. Briefly, nuclei (Hoechst stain, DAPI) or mature neurons were stained. For either NeuN or RFP, randomly selected cells were By optimizing inclusion and exclusion parameters based on size and intensity, A track mask was created. The mean and median intensity values ​​of GFP were then calculated for the selected mask. The intensity values ​​for Ube3aYFP in each cell were acquired within the boundaries of each cell.

[0130] Human induced pluripotent stem cell-derived neurons GABAergic and glutamatergic induced pluripotent stem cell (iPSC)-derived neural precursors Cells (NRC-100-010-001 and GNC-301-030-001, Cell lular Dynamics International, Madison WI) were differentiated into neurons according to the manufacturer's protocol. are thawed, resuspended in a chemically defined medium, and supplemented with poly-D-lysine and laminin. The cells were added to sterile culture plates coated with 100% ethanol. 24 hours after plating, the culture The medium was then replaced, and then half of the medium was replaced every 3-5 days thereafter.

[0131] RNA isolation For cultured iPSC-derived neurons, the Cell-to-CT kit (The rmo Fisher Scientific) was used with a lysate volume of 55 μl. RNA isolation and cDNA synthesis were performed.

[0132] Analysis of RNA levels Steady-state RNA levels of target transcripts were determined by TaqMan quantitative reverse transcription PCR (q The total reaction volume was 10 uL, with 2 μl cDNA, 1X Gene Expression Master Mix (4369016, ThermoFisher Sher Scientific, Waltham, MA), and 1X TaqMan Primer assays (Thermo Fisher Scientific) were included. The cycling conditions were 50°C for 2 min, 95°C for 10 min, and 95°C for 15 s. and 60°C for 1 min for 40 cycles, with readings taken at the 60°C step of each cycle. The reactions were performed in a BIO-RAD T1000 CFX96 thermocycler (B The measurements were performed at io-Rad Laboratories, Hercules CA. , internal control (PPIA, Hs99999904_m1, Thermo Fisher S cientific) and the target [UBE3A-AS, Hs01372957_m1;S NORD116-11, Hs04275268_gH;SNORD115, Hs0427 5288_gH;IPW, Hs03455409_s1;SNORD109A / B, AP 47WVR (Thermo Fisher Scientific); UBE3A: Word ATATGTGGAAGCCGGAATCT (sequence number 500); reverse: CC CAGAACTCCCTAATCAGAA (SEQ ID NO: 501); and probe: ATG ACGGTGGCTATACCAGG (SEQ ID NO: 502)] reaction was performed together. and install the BIORAD CFX Maestro software (Bio-Rad Labs. Samples with an internal control Cq value ≥ 30 were filtered out. Data quality was visually inspected for technical and / or plate replicate defects. The measures for inferential and descriptive statistics were ΔΔCq values ​​(2- ΔΔCq=2-(Cq[target]-Cq[internal control])-(Cq[target]-Cq[internal control] ])).

[0133] Example 2: Identification of ASO target regions Analysis of RNA-sequencing data generated from mouse tissues and cells revealed that Snord1 The 3'-end of the 15 cluster and 5 of the Ube3a antisense (Ube3a-AS) transcript The region located between the '-end of Snord115 and the '-end of Snord115 host gene transcription Genes thought to be important for the processing of Ube3a and transcription of Ube3a-AS The RNA-sequencing data generated from human tissues contains a transcription factor (Figure 6A-6D). Analysis of the ribosomal protein revealed that the ribosomal protein is located between the 3' end of the SNORD115 cluster and SNORD109B. 7A-7G), which is similar to what was observed in mice. However, comparative analysis of this region revealed no sequence conservation between humans and rodents. showed little or no effect at all.

[0134] material and method RNA-sequencing RNA was purified using Qiagen RNAeasy Plus (74136, Qiagen, H RNA was isolated using the Qubit fluorescence spectrophotometer (St. Ilden, Germany). The amount of RNA was determined using Thermo Fisher Scientific. Quality is 4200 Agilent TapeStation (Agilent, San The RNA-sequencing libraries were evaluated using the I Ilumina TruSeq Stranded Total RNA Kit (200 20597, Illumina, Inc., San Diego, CA) as provided by the manufacturer. The 75 base pair paired end sequencing was performed using the Texas Instruments s A&M Institute for Genome Sciences and At the Society Genomics core, NextSeq 500 (Il Raw sequencing reads were performed using a 30-nm chromatograph (LumiNova, San Diego, CA). The resulting FASTQ sequences were processed using CASAVA. was investigated using.

[0135] FASTQ sequences were generated using Hisat2 (version 2.1.0) with the following settings: The alignment was performed against the original reference assembly (hg19): --fr. Then, the alignment was Convert the resulting SAM sequence to a binary BAM sequence and index it. The BAM files from each sample were combined and sorted using Samtools. The aligned sequences were generated and indexed using Samtools. Filtered and non-uniquely aligned using mtools view commands Reads with poor quality (quality >1) were excluded.

[0136] Transcript assembly was performed using Stringtie (version 1.3.4) with the following options: .d) was produced from a sample synthesized using: (stranded) --rf-f0- j2. gffread (GFF utilities, Johns Hopkins University, Center for Computational Biol. Using the genomic DNA sequence, single exon transcripts were excluded from the assembled transcripts. .

[0137] Example 3: Identification of lead ASOs ASO-4 and ASO-6.1 target sequences and have different backbone designs and RNA Eighteen ASOs consisting of A modifications were designed to identify potential lead ASOs ( Table 17). Normal iPSC-derived neurons (GABAergic) scored 1 / 2 of 10. Neuroprogenitors were treated with each ASO in a log dose curve and IC50 and Emax were compared. Cells were differentiated into neurons at 18 DIV and then cultured in a 10-point 1 / 2 log dose-response ASO[1nM, 3nM, 10nM, 30nM, 100nM, 300nM, 1μM, 3μ At 24 DIV, UBE3A Steady-state RNA levels of -AS were measured and dose-response curves were fitted as described above ( (Figure 8A and Table 18). The dose-response curves were significantly different (parallel test: F(51,606) = 7.86; p < 0.0001; R2 = 0.90), so no relative efficacy could be estimated. Hierarchical clustering of the fitted curves revealed three clusters of ASOs. Cluster 1 represented the nine most potent ASOs (Figures 8B and 8C). Analysis of cluster 1 showed that A SO had similar curves (parallel test: F(24,299) = 1.01; p = 0.5; R2 = 0.93), ASO-4.4.PS.L was at least three times more potent than other ASOs. However, further analysis showed that ASO-4.4.PS.L, AS O-6.1.PS.M and ASO-6.1.PO-1.M have equivalent IC50 values The other ASOs showed slightly less potency (Table 20). Based on the selection criteria, ASO-4.4.PS.L and ASO-6.1.PO-1.O were further was investigated by [Table 18] [Table 19] [Table 20]

[0138] material and method Methods were similar to those described in Example 2 unless otherwise stated.

[0139] Example 4: ASO-6.1-PO-1 in Angelman syndrome iPSC neurons Pharmacodynamic analysis of ASO-4.4.O and ASO-4.4.PS.L The efficacy of ASO-6.1.PS.O and ASO-4.4.PS.L was then confirmed in 15q Derivation of iPSCs from an Angelman syndrome patient with a maternal deletion of the 11-q13 region Induced pluripotent stem cells were differentiated into neurons and then 0-point 1 / 2 log dose curves of ASO-6.1.PO-1.O and ASO-4. 4.PS.L[1nM, 3nM, 10nM, 30nM, 100nM, 300nM, 1μM , 3 μM, 10 μM, and 30 μM (n=3). Six days after treatment, UB Steady-state RNA levels of E3A-AS were measured and dose-response curves were fitted as described above. Dose-response curves were similar between ASOs (parallel studies: F(3,13 2)=1.07, p=0.4, R2=0.82), ASO-4.4.PS.L(437n M) was approximately 2.7-fold more potent than ASO-6.1.PO-1.O (1.22uM). The IC50 values ​​were equivalent [ASO-6.1.PO-1.O / ASO-4. 4. PS.L IC50 ratio: = 0.96 (lower confidence limit = 0.9; upper confidence limit = 1.0). E The maximum values ​​were similar (30 μM: ASO-4.4.PS.L = 0.01 ± 0.0007 ;ASO-6.1.PO-1.O=0.05±0.004), with a confidence interval of [ASO-6. 1.PO-1.O / ASO-4.4.PS.LE maximum ratio: = -9.1 (confidence limit = -2 24; upper confidence limit = 205)] and were not considered equivalent.

[0140] material and method Methods were similar to those described in Example 2 unless otherwise stated.

[0141] Angelman syndrome induced pluripotent stem cell-derived neurons Angelman syndrome iPSCs (AG1-0 iPSCs) (ECN001, Ker afast, Boston, MA) was prepared using human embryonic stem cell medium [DMEM / F12(113 30-057, Gibco Biosciences, Dublin, Ireland) , 20% Knockout Serum Replacement (10828-028, Thermo F isher Scientific), 1X Non-Essential Amino Acids, 2mM L-Glutamine , 7 μl / mL 2-mercaptoethanol, and 4 μg / mL basal fibroblast growth factor In the first passage, PluriST EM human ES / iPS medium (SCM130, Millipore Sigma, Burl AG1-0 cells were passaged according to the product manual for 100-mL chromatographs (St. This medium is feeder-free and requires Dispase II (SC) to dissociate the cells. M133, Millipore Sigma) is used. ESC eligibility matrix (354277, Corning BD Biosciences es, Corning, NY) was used as the extracellular matrix. The matrix was modified with biclonectin (CC130, Millipore Sigma). During subsequent passages, the area of ​​differentiation was expanded until differentiated cells represented approximately <5% of the colony. After four subsequent passages, AG1-0 cells were cultured with extracellular matrix and We used the Millipore ES / iPS Neurogenesis Kit (S The first passage was performed using 100% ... This was performed using EZ-LiFT (SCM139, Millipore Sigma), We obtained high-quality iPS cells. Neural progenitor cells were frozen at stage zero (P0) and then cultured. The cells were thawed for differentiation. Differentiation was performed in 10-mL culture medium containing poly-D-lysine (10 μg / mL) and laminin [1 Sterile culture plates coated with 0.0 μg / mL (23017-015, Gibco) Differentiation was performed in differentiation medium (SCM111) for 10 days in vitro. In this case, cells were cultured in Cellular Dynamics Maintenance Medium (NRM-100-121-001, Cellular Dynamics International, Madison; The cells were differentiated in WI.

[0142] Example 5: Treated with ASO-6.1-PO-1.O and ASO-4.4.PS.L Expression of PWS polycistronic transcripts in Angelman syndrome iPSC neurons Analysis ASO-4.4.PS.L and ASO-6.1.PO-1.O were used to identify PWS multicistroke To determine whether mitochondrial DNA affects the levels of RNA transcripts encoded by mitochondrial transcripts, RNA-sequencing was performed on AS iPS cells treated with each ASO, and SN URF, SNRPN, SNORD116 host gene transcript (SNHG116), SNOR D116 snoRNA, IPW, SNORD115 host gene transcripts (SNHG115 ), SNORD115 snoRNA, and UBE3A-AS steady-state RNA levels was quantified. UBE3A steady-state RNA levels were also measured. Angelman syndrome iPS cells were differentiated into neurons as described above and then cultured in vehicle (1% HO, n=3), ASO-4.4.PS.L (30uM, n=3) and ASO-6.1.P After 6 days of treatment, total cells isolated from the cultures were RNA RNA-sequencing was performed on RNA (rRNA-depleted). SNH To generate annotations for G116, SNHG115, and UBE3A-AS transcripts, A transcriptome was assembled from the vehicle RNA-seq data and then The gene annotations were integrated into the control gene annotation. Definition of 116, SNORD116 snoRNA, and SNORD115 snoRNA Steady-state RNA levels were similar and not significantly different. ASO-6.1.PO-1. ASO-4.4.PS.L, but not O, reduced IPW levels (1.5-fold) but not potently. The results were not significant. ASO-6.1.PO-1.O and ASO-4.4.PS.L ASO- significantly reduced SNHG115 and UBE3A-AS RNA levels. 6.1.PO-1.O and ASO-4.4.PS.L were compared to SNHG115 levels however, ASO-4.4.PS.L had a similar effect to ASO-6.1.PO- 1.O (ASO-4.4.PS.L: -6.1 fold change; ASO-6.1.PO-1.O: -2.8-fold change) on UBE3A-AS RNA levels. ASO treatment increased UBE3A RNA levels by approximately 1.2-fold, but had no effect. was not significant (Figure 10 and Table 21). [Table 21]

[0143] material and method Methods were similar to those described in Example 4 unless otherwise stated.

[0144] Differential expression analysis of PWS RNA Normalized FPKM (fractions per million) of RefSeq gene annotations The values ​​are calculated using Cuffnorm with the default settings and the following options: The FPKM values ​​for each gene annotation are estimated for each sample in the output file were determined and used for descriptive and inferential statistics.

[0145] Example 6: ASO-6.1-PO-1.O and ASO-4 in cynomolgus macaques .4.Pharmacodynamic analysis of PS.L The ASO-4 and ASO-6 target regions are expressed across several non-human primate (NHP) species. Therefore, both safety and efficacy studies in large animal models are warranted. ASO-4.4.PS.L and ASO-6 in the central nervous system (CNS) To investigate the efficacy of .1.PO-1.O, the ASO was administered intrathecal lumbar puncture to the cynomolgus monkey. The mice were then delivered to lunar macaques. Animals received either vehicle (0.9% saline, n = 5), ASO-6. 1.PO-1.O (10 mg, n = 3), and ASO.4.4.PS.L (10 mg, After 28 days of treatment, central nervous system (CNS) tissue The steady-state RNA levels of UBE3A-AS were measured. .4.PS.L had a higher UBE3A-AS RNA level than ASO-6.1.PO-1.O. ASO-4.4.PS.L had a greater effect on the IL-1 receptor agonist than the IL-1 receptor agonist (Table 22). Reduced UBE3A-AS RNA in the CNS regions of the temporal lobe, primary motor cortex, and pons It has a significant effect on the medulla, hippocampus, globus pallidus, frontal cortex (coronae radiata), prefrontal cortex, and lumbar spinal cord. Similarly, ASO-6.1.PO-1.O showed U-regulated activation in most CNS regions. BE3A-AS RNA levels were decreased, with the greatest effect in the pons, oculomotor nucleus, and spinal cord. This was observed in the lumbar region (Figure 11 and Table 23). [Table 22] [Table 23] JPEG2025041632000032.jpg23494

[0146] material and method Administration of ASO The NHP study is funded by the Northern Biomedical Research and At Charles River Laboratories, The Animal Care and Use Committees The study was conducted using a protocol approved by the National Institute of Integrative Medicine (NII). Male and female crabeaters weighing 2–4 kg were Macaques (Macaca fascicularis) were anesthetized and administered a single 1 mL dose of A SO or vehicle was administered by intrathecal lumbar puncture. A dosing solution is prepared by dissolving the lyophilized ASO in sodium chloride. The CNS and spinal cord samples were collected and the CNS was filtered through a 0.2 μm filter. Tissue samples were snap frozen and stored at -80°C until RNA isolation. Stored it.

[0147] RNA isolation A 4 mm tissue punch was taken from each region of interest, approximately half of which was reserved for RNA isolation. RNA isolation was performed using the Qiagen RNeasy Plus Mini Kit (74136, Tissue disintegration and lysis were performed using a TissueLyser The RNA was purified using 2 volumes of 30 mL of 5 mm stainless steel beads in 100 mL of PBS. The RNA was eluted in 0.0 μl of water for a total elution volume of 60 μl. RNA XR assay (Q33224, Thermo Fisher Scientific cDNA was quantified using the High Performance RNA-to-cDNA Kit (43 87406, Thermo Fisher Scientific) in a total reaction volume of 50 μL. l and synthesized from 2 μg of input RNA.

[0148] Analysis of UBE3A-AS RNA levels in tissues UBE3A-AS RNA levels in cynomolgus macaques were analyzed using SYBR green quantitative river ELISA kit. The total reaction volume was 10 μl. 2 μl of cDNA, 1X PowerUp SYBR Green Master Mix (A 25741, Thermo Fisher Scientific), and 500 nM The primers included were forward and reverse. Cycling conditions were: 50° C. 2 min, 95°C for 2 min, and 40 cycles of 95°C for 15 s and 60°C for 1 min. The reaction was run at 60°C and readings were taken at the 60°C step of each cycle. Run on a RAD T1000 CFX96 thermocycler and use internal controls (PPIA, Forward: GTCTCCTTCGAGCTGTTTGC (SEQ ID NO:503); Reverse :CCTTTCTCTCCAGTGCTCAGA (SEQ ID NO:504)) and target (U BE3A-AS, forward: CCTGTGAACTTTCAACCAGGA (sequence no. No. 505); Reverse: GGATCAGACTCCAGGCCTTC (SEQ ID NO: 506) ) reactions were performed separately. Data was collected and initial analysis was performed using the BIORAD CFX Ma The data were analyzed using estro software, and in-depth statistical analysis was performed using Excel and JMP. This was carried out using

[0149] Example 7: ASOs targeting exon boundaries of spliced ​​UBE3A-AS transcripts In some embodiments, the target sequence is UBE3A-AS exons 1-5 and SNO The exon boundary includes RD109B exons 1 and 2. The target sequence is 19 nucleotides representing the 5' and 3' ends of the exon) centered on the exon boundary It consists of 38 nucleotides (19 nucleotides of each exon) arranged as follows: Includes segments 1-2, 2-3, 3-4, 5-6, 7-8, 9-10, and 11-12. There were 12 segments of sequence with exon boundaries including the chromosome 11. The chromosome coordinates are shown in Table 2. 4. Spliced ​​exons (|, exon junctions) and intermediate A single synthetic junction sequence was generated showing the sequence of the incoming exon ([]). ASOs (20-, 19-, and 18-mers) targeting the Chthon junction Provided in Table 25.

[0150] Synthesized junction sequence AATGAAATCTTCTGATTTG|TAAGACATGCTGCCAAGAG[ ]ATTAGTTTTACACCTTCAG|GATAAAAGACTGCTGAGAAG []GTTTAAGGATGCTATTCTG|AAAAGACTGTGGAGGAAG A[]TTAAGGAAACCATCTCTGG|GATAAGGATGACTGAGG AA[]ATTTAAGGATGCCACTCTG|GTTAAAAGCTGAAACA ACT[]GAAACTTCAGGGAAAAGAG|AAGGCCTGGAATCTG ATCC (sequence number 489). |=3'-5' exon junction [] = sequence of intervening exons [Table 24] [Table 25] JPEG2025041632000035.jpg236100

[0151] Example 8: siRNA, shRNA, and and CRISPR Guide As noted above, in some embodiments, the disclosed oligonucleotides are Functional nucleic acids, such as siRNAs, shRNAs, or other nucleic acid sequences that block, mutate, or delete a nucleic acid sequence. or nuclease gRNA.

[0152] Examples of siRNAs targeting UBE3a-AS exons 1 to 5 are listed in Table 26. Examples of shRNAs targeting UBE3a-AS exons 1 to 5 are provided in Table 2. 7. Examples of gRNAs targeting UBE3a-AS exons 1-5 is provided in Table 28. [Table 26] JPEG2025041632000037.jpg23419 [Table 27] [Table 28]

[0153] Unless otherwise defined, all technical and scientific terms used herein are within the scope of the present invention. The same meaning as that generally understood by a person skilled in the art to which the disclosed invention pertains. Publications cited herein and the materials for which they are cited are hereby incorporated by reference. Specifically incorporated into the specification.

[0154] Those skilled in the art will be able to ascertain, using no more than routine experimentation, the specific features described herein. Many equivalents to the embodiments of the present invention will be recognized or may be ascertained. Such equivalents are intended to be encompassed by the scope of the following claims.

Claims

1. A sequence of nucleic acid sequence SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, or SEQ ID NO:

5. A contiguous sequence of 10 to 30 nucleotides having at least 98% complementarity to the adjacent sequence. An antisense oligonucleotide comprising a nucleotide sequence

2. The oligonucleotide is selected from the group consisting of SEQ ID NO: 6, 7, 8, 9, 10, or 11. The oligonucleotide of claim 1 , comprising a sequence selected from the group consisting of:

3. The oligonucleotide of claim 1 or 2, comprising one or more modified nucleosides. Chid.

4. wherein the one or more modified nucleosides are 2' sugar modified nucleosides. The oligonucleotide according to claim 3.

5. The one or more 2' sugar modified nucleosides are 2'-O-alkyl-RNA, 2' -O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA , 2'-amino-DNA, 2'-fluoro-DNA, arabinonucleic acid (ANA), 2'-fluoro 1. The nucleosides of claim 1 , wherein the nucleosides are independently selected from the group consisting of: fluoro-ANA, and LNA nucleosides.

5. The oligonucleotide according to claim 4.

6. The method according to claim 5, wherein the one or more modified nucleosides are LNA nucleosides. The oligonucleotides listed above.

7. the oligonucleotide comprises at least one modified internucleoside linkage; The oligonucleotide of claim 1.

8. The internucleoside linkages in the contiguous nucleotide sequence are phosphorothioate nucleotides. The oligonucleotide of claim 7, wherein the linkage is an internucleotide.

9. The oligonucleotide of claim 1, wherein the oligonucleotide is capable of recruiting RNase H. The oligonucleotides described.

10. The oligonucleotide of claim 9, wherein the oligonucleotide is a gapmer. Do.

11. The oligonucleotide is a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 362-392. The oligonucleotide of claim 10 having a sequence.

12. One or more oligonucleotides according to any one of claims 1 to 11, and pharmaceutical A pharmaceutical composition comprising a physiologically acceptable diluent, solvent, carrier, salt and / or adjuvant (excipient).

13. A therapeutically or prophylactically effective amount of the composition of claim 12 is administered to a patient suffering from Angelman syndrome. administering to a subject having or suspected of having angelica A method for treating or preventing Mann's syndrome.

Images