Respiratory syncytial virus vaccine

Abstract

To provide an RSV vaccine capable of inducing a balanced immune response including both cellular immunity and humoral immunity against RSV without the risk of possible insertional mutagenesis.SOLUTION: The present invention pertains to an RSV vaccine comprising at least one ribonucleic acid (RNA) polynucleotide having an open reading frame encoding at least one respiratory syncytial virus (RSV) antigenic polypeptide or an immunogenic fragment thereof and a pharmaceutically acceptable carrier.SELECTED DRAWING: None

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit under 35 U.S.C. §119(e) of U.S. Provisional Application No. 62 / 245,208, filed October 22, 2015, U.S. Provisional Application No. 62 / 247,563, filed October 28, 2015, and U.S. Provisional Application No. 62 / 248,250, filed October 29, 2015, each of which is incorporated by reference in its entirety. This application also claims the benefit under 35 U.S.C. §119(e) of U.S. Provisional Application No. 62 / 245,031, filed October 22, 2015, each of which is incorporated by reference in its entirety. [Background technology]

[0002] Respiratory syncytial virus (RSV) is a single-stranded negative-sense RNA virus belonging to the genus Pneumovirinae in the family Paramyxoviridae. Symptoms in adults typically resemble sinus infections or the common cold, although the infection may be asymptomatic. In older adults (e.g., over 60 years of age), RSV infection may progress to bronchiolitis or pneumonia. Symptoms in children are often more severe and include bronchiolitis and pneumonia. It is estimated that most children in the United States are infected with RSV by age 3. RSV virions are composed of an internal nucleocapsid consisting of viral RNA bound to nucleoprotein (N), phosphoprotein (P), and large polymerase protein (L). The nucleocapsid is surrounded by matrix protein (M) and encapsulated in a lipid bilayer that incorporates viral fusion (F) and adsorption (G) proteins as well as small hydrophobic proteins (SH). The viral genome also encodes two nonstructural proteins (NS1 and NS2) and the M2 protein, which inhibit type I interferon activity.

[0003] Deoxyribonucleic acid (DNA) vaccination is one technique used to stimulate humoral and cellular immune responses to foreign antigens, such as RSV antigens. When engineered DNA (e.g., naked plasmid DNA) is directly injected into a living host, a small number of host cells directly produce the antigen, resulting in a protective immune response. However, potential problems arise with this technique, including the possibility of insertional mutagenesis, which can lead to the activation of oncogenes or the suppression of tumor suppressor genes. Summary of the Invention

[0004] The RNA vaccines of the present disclosure can be used, for example, to induce a balanced immune response against RSV, including both cellular and humoral immunity, without the potential risk of insertional mutagenesis.

[0005] RNA (e.g., mRNA) vaccines can be used in a variety of settings depending on the prevalence of infection or the degree or level of unmet medical need. RNA vaccines can be used to treat and / or prevent infections caused by various genotypes, strains and isolates of RSV. The RNA vaccines provided herein have superior properties in that they produce greater antibody titers and faster responses compared to commercially available antiviral treatments. Without wishing to be bound by theory, it is believed that the RNA vaccines of the present disclosure are well designed to produce the proper protein conformation upon translation because the RNA vaccines utilize natural cellular machinery. Unlike conventional vaccines that are produced ex vivo and may elicit undesirable cellular responses, the RNA vaccines provided herein are delivered to cell lines in a more natural way.

[0006] Some embodiments of the present disclosure provide a respiratory syncytial virus (RSV) vaccine comprising: (i) at least one ribonucleic acid (RNA) polynucleotide having an open reading frame encoding at least one RSV antigenic polypeptide or immunogenic fragment thereof (e.g., an immunogenic fragment capable of eliciting an immune response against RSV); and (ii) a pharmaceutically acceptable carrier.

[0007] In some embodiments, at least one RNA polynucleotide comprises at least one chemical modification.

[0008] In some embodiments, the antigenic polypeptide is glycoprotein G or an immunogenic fragment thereof.

[0009] In some embodiments, the antigenic polypeptide is glycoprotein F or an immunogenic fragment thereof.

[0010] In some embodiments, the at least one antigenic polypeptide is glycoprotein F, and the at least one antigenic polypeptide is selected from G, M, N, P, L, SH, M2, NS1 and NS2.

[0011] In some embodiments, at least one antigenic polypeptide is glycoprotein F and at least two antigenic polypeptides are selected from G, M, N, P, L, SH, M2, NS1 and NS2.

[0012] In some embodiments, the RNA vaccine further comprises an adjuvant.

[0013] In some embodiments, at least one RNA polynucleotide is encoded by at least one nucleic acid sequence set forth in SEQ ID NO:1, 2, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 242, 246, 257, 258, or 259, or a homolog having at least 80% identity to a nucleic acid sequence set forth in SEQ ID NO:1, 2, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 242, 246, 257, 258, or 259. In some embodiments, at least one RNA polynucleotide is encoded by at least one nucleic acid sequence set forth in SEQ ID NO:1, 2, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 242, 246, 257, 258, or 259, or a homolog having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.8% or 99.9%) identity to a nucleic acid sequence set forth in SEQ ID NO:1, 2, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 242, 246, 257, 258, or 259. In some embodiments, at least one RNA polynucleotide is encoded by at least one fragment (e.g., a fragment having at least one antigenic sequence or at least one epitope) of a nucleic acid sequence set forth in SEQ ID NO:1, 2, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 242, 246, 257, 258 or 259.

[0014] In some embodiments, at least one RNA polynucleotide comprises at least one nucleic acid sequence set forth in any of SEQ ID NOs: 260-280, or a homologue having at least 80% identity to a nucleic acid sequence set forth in any of SEQ ID NOs: 260-280. In some embodiments, at least one RNA polynucleotide comprises at least one nucleic acid sequence set forth in any of SEQ ID NOs: 260-280, or a homologue having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.8% or 99.9%) identity to a nucleic acid sequence set forth in any of SEQ ID NOs: 260-280. In some embodiments, at least one RNA polynucleotide comprises at least one fragment (e.g., a fragment having at least one antigenic sequence or at least one epitope) of a nucleic acid sequence set forth in any of SEQ ID NOs: 260-280.

[0015] In some embodiments, the amino acid sequence of the RSV antigenic polypeptide is the amino acid sequence set forth in SEQ ID NO:3 or SEQ ID NO:4, a fragment thereof, or a homolog having at least 80% (e.g., 85%, 90%, 95%, 98%, 99%) identity thereto.

[0016] In some embodiments, the amino acid sequence of the RSV antigenic polypeptide is the amino acid sequence set forth in SEQ ID NO: 3, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 243 or 245, a fragment thereof, or a homolog having at least 80% (e.g., 85%, 90%, 95%, 98%, 99%) identity thereto.

[0017] In some embodiments, at least one RNA (e.g., mRNA) polynucleotide encodes an antigenic polypeptide having at least 90% identity to the amino acid sequence of the present disclosure and having membrane fusion activity. In some embodiments, at least one RNA polynucleotide encodes an antigenic polypeptide having at least 95% identity to the amino acid sequence of the present disclosure and having membrane fusion activity. In some embodiments, at least one RNA polynucleotide encodes an antigenic polypeptide having at least 96% identity to the amino acid sequence of the present disclosure and having membrane fusion activity. In some embodiments, at least one RNA polynucleotide encodes an antigenic polypeptide having at least 97% identity to the amino acid sequence of the present disclosure and having membrane fusion activity. In some embodiments, at least one RNA polynucleotide encodes an antigenic polypeptide having at least 98% identity to the amino acid sequence of the present disclosure and having membrane fusion activity. In some embodiments, at least one RNA polynucleotide encodes an antigenic polypeptide having at least 99% identity to the amino acid sequence of the present disclosure and having membrane fusion activity. In some embodiments, at least one RNA polynucleotide encodes an antigenic polypeptide having 95-99% identity to an amino acid sequence of the present disclosure and having membrane fusion activity.

[0018] In some embodiments, at least one RNA (eg, mRNA) polynucleotide encodes an antigenic polypeptide having an amino acid sequence of the present disclosure and is a codon-optimized mRNA.

[0019] In some embodiments, at least one RNA (e.g., mRNA) polynucleotide encodes an antigenic polypeptide having an amino acid sequence of the present disclosure and has less than 80% identity to the (corresponding) wild-type mRNA sequence. In some embodiments, at least one RNA polynucleotide encodes an antigenic polypeptide having an amino acid sequence of the present disclosure and has less than 75%, 85% or 95% identity to the wild-type mRNA sequence. In some embodiments, at least one RNA polynucleotide encodes an antigenic polypeptide having an amino acid sequence of the present disclosure and has 30-80%, 40-80%, 50-80%, 60-80%, 70-80%, 75-80% or 78-80% identity to the wild-type mRNA sequence. In some embodiments, at least one RNA polynucleotide encodes an antigenic polypeptide having an amino acid sequence of the present disclosure and has 30-85%, 40-85%, 50-85%, 60-85%, 70-85%, 75-85%, or 80-85% identity to the wild-type mRNA sequence. In some embodiments, at least one RNA polynucleotide encodes an antigenic polypeptide having an amino acid sequence of the present disclosure and has 30-90%, 40-90%, 50-90%, 60-90%, 70-90%, 75-90%, 80-90%, or 85-90% identity to the wild-type mRNA sequence.

[0020] In some embodiments, at least one RNA (e.g., mRNA) polynucleotide is encoded by a nucleic acid (e.g., DNA) having at least 90% identity to a nucleic acid sequence of the present disclosure. In some embodiments, at least one RNA polynucleotide is encoded by a nucleic acid having at least 95% identity to a nucleic acid sequence of the present disclosure. In some embodiments, at least one RNA polynucleotide is encoded by a nucleic acid having at least 96% identity to a nucleic acid sequence of the present disclosure. In some embodiments, at least one RNA polynucleotide is encoded by a nucleic acid having at least 97% identity to a nucleic acid sequence of the present disclosure. In some embodiments, at least one RNA polynucleotide is encoded by a nucleic acid having at least 98% identity to a nucleic acid sequence of the present disclosure. In some embodiments, at least one RNA polynucleotide is encoded by a nucleic acid having at least 99% identity to a nucleic acid sequence of the present disclosure. In some embodiments, at least one RNA polynucleotide is encoded by a nucleic acid having 95-99% identity to a nucleic acid sequence of the present disclosure.

[0021] In some embodiments, at least one mRNA polynucleotide is encoded by a nucleic acid having a sequence of the present disclosure and has less than 80% identity to the wild-type mRNA sequence. In some embodiments, at least one mRNA polynucleotide is encoded by a nucleic acid having a sequence of the present disclosure and has less than 75%, 85% or 95% identity to the wild-type mRNA sequence. In some embodiments, at least one mRNA polynucleotide is encoded by a nucleic acid having a sequence of the present disclosure and has less than 30-80%, 40-80%, 50-80%, 60-80%, 70-80%, 75-80% or 78-80% identity to the wild-type mRNA sequence. In some embodiments, at least one mRNA polynucleotide is encoded by a nucleic acid having a sequence of the present disclosure and has less than 30-85%, 40-85%, 50-85%, 60-85%, 70-85%, 75-85% or 80-85% identity to the wild-type mRNA sequence. In some embodiments, at least one mRNA polynucleotide is encoded by a nucleic acid having a sequence of the present disclosure and has less than 30-90%, 40-90%, 50-90%, 60-90%, 70-90%, 75-90%, 80-90% or 85-90% identity to a wild-type mRNA sequence.

[0022] In some embodiments, at least one RNA (e.g., mRNA) polynucleotide encodes an antigenic polypeptide having an amino acid sequence of the present disclosure and having at least 80% identity to the wild-type mRNA sequence, but does not include the wild-type mRNA sequence.

[0023] In some embodiments, the RSV vaccine comprises at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding at least one RSV antigenic polypeptide, wherein the RNA polynucleotide has at least one chemical modification.

[0024] In some embodiments, the RSV vaccine comprises at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding at least one RSV antigenic polypeptide, the RNA polynucleotide having at least one chemical modification and at least one 5' end cap, and the RSV vaccine is formulated in a lipid nanoparticle.

[0025] In some embodiments, the 5' end cap is 7mG(5')ppp(5')NlmpNp.

[0026] In some embodiments, the at least one chemical modification is selected from the group consisting of pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine and 2'-O-methyluridine.

[0027] In some embodiments, the lipid nanoparticles comprise a cationic lipid, a PEG-modified lipid, a sterol, and a non-cationic lipid. In some embodiments, the cationic lipid is an ionic cationic lipid, the non-cationic lipid is a neutral lipid, and the sterol is cholesterol. In some embodiments, the cationic lipid is selected from the group consisting of 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), (12Z,15Z)-N,N-dimethyl-2-nonylhenicosa-12,15-dien-1-amine (L608) and N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]heptadecan-8-amine (L530).

[0028] In some embodiments, the lipid is [ka] It is.

[0029] In some embodiments, the lipid is [ka] It is.

[0030] Some embodiments of the present disclosure provide a respiratory syncytial virus (RSV) vaccine comprising at least one ribonucleic acid (RNA) polynucleotide having an open reading frame encoding at least one RSV antigenic polypeptide, wherein at least 80% of the uracils in the open reading frame have a chemical modification, and optionally formulated into a lipid nanoparticle.

[0031] In some embodiments, 100% of the uracils in the open reading frame have a chemical modification. In some embodiments, the chemical modification is at the 5-position of the uracil. In some embodiments, the chemical modification is N1-methylpseudouridine. In some embodiments, the chemical modification is N1-methylpseudouridine at the 5-position of the uracil. In some embodiments, 100% of the uracils in the open reading frame are modified to include N1-methylpseudouridine.

[0032] Some embodiments of the present disclosure provide a method for inducing an antigen-specific immune response in a subject, comprising administering to the subject a RSV RNA (e.g., mRNA) vaccine in an amount effective to produce an antigen-specific immune response.

[0033] In some embodiments, the antigen-specific immune response comprises a T cell or B cell response, or both.

[0034] In some embodiments, the method of producing an antigen-specific immune response involves a single administration of a RSV RNA (e.g., mRNA) vaccine. In some embodiments, the method further comprises administering a booster dose of a RSV RNA (e.g., mRNA) vaccine to the subject. The booster vaccine according to the present invention can include any RSV RNA (e.g., mRNA) vaccine disclosed herein and can be the same as the RSV RNA vaccine that is initially administered. In some embodiments, the same RSV RNA vaccine is administered every year for each RSV season.

[0035] In some embodiments, the RSV RNA (e.g., mRNA) vaccine is administered to the subject by intradermal, intranasal or intramuscular injection. In some embodiments, the RSV RNA vaccine is administered to the subject by intramuscular injection.

[0036] Also provided herein is a RSV RNA (e.g., mRNA) vaccine for use in a method of inducing an antigen-specific immune response in a subject, the method comprising administering to the subject a RSV vaccine in an amount effective to produce an antigen-specific immune response.

[0037] Further provided herein is the use of a RSV RNA (e.g., mRNA) vaccine in the manufacture of a medicament for use in a method of inducing an antigen-specific immune response in a subject, the method comprising administering to the subject a RSV vaccine in an amount effective to produce an antigen-specific immune response.

[0038] Some embodiments of the present disclosure provide a RSV RNA (eg, mRNA) vaccine formulated in an amount effective to generate an antigen-specific immune response in a subject.

[0039] Another aspect of the present disclosure provides a method for inducing an antigen-specific immune response in a subject, the method comprising administering to the subject an RSV RNA (e.g., mRNA) vaccine described herein in an amount effective to produce an antigen-specific immune response in the subject.

[0040] In some embodiments, the titer of anti-RSV antigenic polypeptide antibodies produced in a subject is increased by at least 1 log compared to a control (e.g., a control vaccine). In some embodiments, the titer of anti-RSV antigenic polypeptide antibodies produced in a subject is increased by 1-3 logs compared to a control (e.g., a control vaccine).

[0041] In some embodiments, the titer of anti-RSV antigenic polypeptide antibodies produced in a subject is increased by at least 2-fold compared to a control (e.g., a control vaccine). In some embodiments, the titer of anti-RSV antigenic polypeptide antibodies produced in a subject is increased by at least 5-fold compared to a control (e.g., a control vaccine). In some embodiments, the titer of anti-RSV antigenic polypeptide antibodies produced in a subject is increased by at least 10-fold compared to a control (e.g., a control vaccine). In some embodiments, the titer of anti-RSV antigenic polypeptide antibodies produced in a subject is increased by 2-10-fold compared to a control (e.g., a control vaccine).

[0042] In some embodiments, the control is the titer of anti-RSV antigenic polypeptide antibodies produced in a subject who has not received a RSV vaccine. In some embodiments, the control is the titer of anti-RSV antigenic polypeptide antibodies produced in a subject who has received a live attenuated RSV vaccine or an inactivated RSV vaccine. In some embodiments, the control is the titer of anti-RSV antigenic polypeptide antibodies produced in a subject who has received a recombinant or purified RSV protein vaccine. In some embodiments, the control is the titer of anti-RSV antigenic polypeptide antibodies produced in a subject who has received a RSV virus-like particle (VLP) vaccine.

[0043] In some embodiments, an effective amount is a dose equivalent to at least a half-fold reduction in a standard therapeutic dose of a recombinant RSV protein vaccine, and the titer of anti-RSV antigenic polypeptide antibodies produced in the subject is equivalent to the titer of anti-RSV antigenic polypeptide antibodies produced in a control subject administered a standard therapeutic dose of a recombinant or purified RSV protein vaccine, or a live attenuated or inactivated RSV vaccine, or a RSV VLP vaccine.

[0044] In some embodiments, an effective amount is a dose equivalent to at least a quarter of the standard therapeutic dose of a recombinant RSV protein vaccine, and the titer of anti-RSV antigenic polypeptide antibodies produced in the subject is equivalent to the titer of anti-RSV antigenic polypeptide antibodies produced in a control subject administered a standard therapeutic dose of a recombinant or purified RSV protein vaccine, or a live attenuated or inactivated RSV vaccine, or a RSV VLP vaccine.

[0045] In some embodiments, an effective amount is a dose equivalent to at least a ten-fold reduction in a standard therapeutic dose of a recombinant RSV protein vaccine, and the titer of anti-RSV antigenic polypeptide antibodies produced in the subject is equivalent to the titer of anti-RSV antigenic polypeptide antibodies produced in a control subject administered a standard therapeutic dose of a recombinant or purified RSV protein vaccine, or a live attenuated or inactivated RSV vaccine, or a RSV VLP vaccine.

[0046] In some embodiments, an effective amount is a dose equivalent to at least a 100-fold reduction in a standard therapeutic dose of a recombinant RSV protein vaccine, and the titer of anti-RSV antigenic polypeptide antibodies produced in the subject is equivalent to the titer of anti-RSV antigenic polypeptide antibodies produced in a control subject administered a standard therapeutic dose of a recombinant or purified RSV protein vaccine, or a live attenuated or inactivated RSV vaccine, or a RSV VLP vaccine.

[0047] In some embodiments, an effective amount is a dose equivalent to at least a 1000-fold reduction in a standard therapeutic dose of a recombinant RSV protein vaccine, and the titer of anti-RSV antigenic polypeptide antibodies produced in the subject is equivalent to the titer of anti-RSV antigenic polypeptide antibodies produced in a control subject administered a standard therapeutic dose of a recombinant or purified RSV protein vaccine, or a live attenuated or inactivated RSV vaccine, or a RSV VLP vaccine.

[0048] In some embodiments, the effective amount is a dose equivalent to a standard therapeutic dose of a recombinant RSV protein vaccine reduced by 1 / 2 to 1 / 1000, and the titer of anti-RSV antigenic polypeptide antibodies produced in the subject is equivalent to the titer of anti-RSV antigenic polypeptide antibodies produced in a control subject administered a standard therapeutic dose of a recombinant or purified RSV protein vaccine, or a live attenuated or inactivated RSV vaccine, or a RSV VLP vaccine.

[0049] In some embodiments, the effective amount is a total dose of 25 μg to 1000 μg, or 50 μg to 1000 μg, or 25 to 200 μg. In some embodiments, the effective amount is a total dose of 50 μg, 100 μg, 200 μg, 400 μg, 800 μg, or 1000 μg. In some embodiments, the effective amount is a 25 μg dose administered to the subject a total of two times. In some embodiments, the effective amount is a 50 μg dose administered to the subject a total of two times. In some embodiments, the effective amount is a 100 μg dose administered to the subject a total of two times. In some embodiments, the effective amount is a 200 μg dose administered to the subject a total of two times. In some embodiments, the effective amount is a 400 μg dose administered to the subject a total of two times. In some embodiments, the effective amount is a 500 μg dose administered to the subject a total of two times.

[0050] In some embodiments, the effective amount administered to a subject is between 50 μg and 1000 μg total dose (RSV RNA (eg, mRNA) vaccine).

[0051] In some embodiments, the efficacy (or efficacy rate) of a RSV RNA (eg, mRNA) vaccine against RSV is greater than 60%.

[0052] Vaccine efficacy can be assessed using standard analyses (see, e.g., Weinberg et al., J Infect Dis. 2010 Jun 1;201(11):1607-10). For example, vaccine efficacy can be determined by double-blind randomized controlled clinical trials. Vaccine efficacy can be expressed as the proportional reduction in incidence rate (AR) between test cohorts of unvaccinated (ARU) and vaccinated (ARV), and can be calculated from the relative risk (RR) of disease in the vaccinated group using the following formula: Efficacy = (ARU-ARV) / ARU x 100, and Efficacy = (1-RR) x 100

[0053] Similarly, vaccine efficacy can be assessed using standard analyses (see, for example, Weinberg et al., J Infect Dis. 2010 Jun 1;201(11):1607-10). Vaccine efficacy is an assessment of how well a vaccine (which may already have proven highly effective) reduces disease in a population. This measure allows the evaluation of the net balance of benefits and adverse effects of a vaccination program, as well as the vaccine itself, under more natural conditions than controlled clinical trials. Vaccine efficacy is proportional to vaccine efficacy (potency), but is influenced by how well the target groups in the population are immunized, and by other non-vaccine related factors that affect the "real-world" outcomes of hospitalization, outpatient visits, or costs. For example, retrospective case-control analyses can be used, comparing vaccination rates between a set of infected cases and appropriate controls. Vaccine efficacy can be expressed as a rate difference using the odds ratio (OR) of developing an infection despite being vaccinated. Effectiveness rate = (1-OR) x 100

[0054] In some embodiments, the efficacy (or efficacy rate) of a RSV RNA (e.g., mRNA) vaccine against RSV is greater than 65%. In some embodiments, the efficacy (or efficacy rate) of a vaccine against RSV is greater than 70%. In some embodiments, the efficacy (or efficacy rate) of a vaccine against RSV is greater than 75%. In some embodiments, the efficacy (or efficacy rate) of a vaccine against RSV is greater than 80%. In some embodiments, the efficacy (or efficacy rate) of a vaccine against RSV is greater than 85%. In some embodiments, the efficacy (or efficacy rate) of a vaccine against RSV is greater than 90%.

[0055] In some embodiments, the vaccine immunizes a subject against RSV for up to one year (e.g., for one RSV season). In some embodiments, the vaccine immunizes a subject against RSV for up to two years. In some embodiments, the vaccine immunizes a subject against RSV for more than two years. In some embodiments, the vaccine immunizes a subject against RSV for more than three years. In some embodiments, the vaccine immunizes a subject against RSV for more than four years. In some embodiments, the vaccine immunizes a subject against RSV for five to ten years.

[0056] In some embodiments, the subject receiving the RSV RNA (e.g., mRNA) vaccine is about 5 years old or younger, between about 1 year and about 5 years old (e.g., about 1, 2, 3, 4, 5, or 6 years old), between about 6 months and about 1 year old (e.g., about 6, 7, 8, 9, 10, 11, or 12 months old), about 6 months old or younger, about 12 months old or younger (e.g., 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 month old). In some embodiments, the subject is born at full term (e.g., about 37-42 weeks old). In some embodiments, the subject is born prematurely before about 36 weeks gestation (e.g., about 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, or 25 weeks), the subject is born prematurely before about 32 weeks gestation, or the subject is born prematurely between about 32 and about 36 weeks gestation.

[0057] In some embodiments, the subject is pregnant (e.g., first, second, or third trimester) when receiving the RSV RNA (e.g., mRNA) vaccine. RSV causes infection of the lower respiratory tract, primarily in infants and young children. One-third of RSV-related deaths occur in the first year of life, with 99% of these deaths occurring in low-resource countries. It is so common in the United States that nearly all children are infected with the virus before their second birthday. Thus, the present disclosure provides a RSV vaccine for maternal immunization that improves prevention of mother-to-child transmission of RSV.

[0058] In some embodiments, the subject has a chronic lung disease (e.g., chronic obstructive pulmonary disease (COPD) or asthma). There are two forms of COPD: chronic bronchitis, which is accompanied by a long-term cough of mucus, and emphysema, which is accompanied by damage to the lungs over time. Thus, the subject who receives the RSV RNA (e.g., mRNA) vaccine may have chronic bronchitis or emphysema.

[0059] In some embodiments, the subject has been exposed to RSV, is infected with RSV, or is at risk for infection by RSV.

[0060] In some embodiments, the subject is immunocompromised (has a disorder of the immune system, eg, an immune system disease or an autoimmune disease).

[0061] In some embodiments, the subject is a geriatric subject about 60 years of age, about 70 years of age or older (eg, about 60, 65, 70, 75, 80, 85, or 90 years of age).

[0062] In some embodiments, the subject is a young adult between about 20 and about 50 years of age (eg, about 20, 25, 30, 35, 40, 45, or 50 years of age).

[0063] Some aspects of the present disclosure provide a respiratory syncytial virus (RSV) RNA (e.g., mRNA) vaccine that contains a signal peptide linked to a RSV antigenic polypeptide. Thus, in some embodiments, the RSV RNA (e.g., mRNA) vaccine contains at least one ribonucleic acid (RNA) polynucleotide having an open reading frame that encodes a signal peptide linked to a RSV antigenic peptide. Also provided herein are nucleic acids that encode the RSV RNA (e.g., mRNA) vaccines disclosed herein.

[0064] In some embodiments, the RSV antigenic peptide is a RSV adsorption protein (G) or an immunogenic fragment thereof. In some embodiments, the RSV antigenic peptide is a RSV fusion (F) glycoprotein or an immunogenic fragment thereof. In some embodiments, the RSV antigenic peptide is a nucleoprotein (N) or an immunogenic fragment thereof. In some embodiments, the RSV antigenic peptide is a phosphoprotein (P) or an immunogenic fragment thereof. In some embodiments, the RSV antigenic peptide is a large polymerase protein (L) or an immunogenic fragment thereof. In some embodiments, the RSV antigenic peptide is a matrix protein (M) or an immunogenic fragment thereof. In some embodiments, the RSV antigenic peptide is a small hydrophobic protein (SH) or an immunogenic fragment thereof. In some embodiments, the RSV antigenic peptide is a nonstructural protein 1 (NS1) or an immunogenic fragment thereof. In some embodiments, the RSV antigenic peptide is a nonstructural protein 2 (NS2) or an immunogenic fragment thereof.

[0065] In some embodiments, the signal peptide is an IgE signal peptide. In some embodiments, the signal peptide is an IgE HC (Ig heavy chain epsilon-1) signal peptide. In some embodiments, the signal peptide has the sequence MDWTWILFLVAAATRVHS (SEQ ID NO:281). In some embodiments, the signal peptide is an IgGκ signal peptide. In some embodiments, the signal peptide has the sequence METPAQLLFLLLLWLPDTTG (SEQ ID NO:282). In some embodiments, the signal peptide is encoded by the sequence TGGAGACTCCCGCTCAGCTGCTGTTTTTGCTCCTCCTATGGCTGCCGGATACCACCGGC (SEQ ID NO:287) or AUGGAGACUCCCGCUCAGCUGCUGUUUUUGCUCCUCCUAUGGCUGCCGGAUACCACCGGC (SEQ ID NO:288). In some embodiments, the signal peptide is selected from the Japanese encephalitis PRM signal sequence (MLGSNSGQRVVFTILLLLVAPAYS, SEQ ID NO: 283), the VSVg protein signal sequence (MKCLLYLAFLFIGVNCA, SEQ ID NO: 284), and the Japanese encephalitis JEV signal sequence (MWLVSLAIVTACAGA, SEQ ID NO: 285). In some embodiments, the signal peptide is MELLILKANAITTILTAVTFC (SEQ ID NO: 289).

[0066] Also provided herein is a ribonucleic acid (RNA) polynucleotide having an open reading frame encoding a membrane-bound respiratory syncytial virus (RSV) F protein, a membrane-bound DS-Cav1 (a stable pre-fusion RSV F protein), or a combination of a membrane-bound RSV F protein and a membrane-bound DS-Cav1, and a pharma- ceutical acceptable carrier.

[0067] In some embodiments, the RNA polynucleotide comprises the sequence of SEQ ID NO:5 and / or the sequence of SEQ ID NO:7.

[0068] In some embodiments, an effective amount of a RSV RNA (e.g., mRNA) vaccine (e.g., a single dose of a RSV vaccine) results in a 2-fold to 200-fold (e.g., about 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200-fold) increase in serum neutralizing antibodies to RSV compared to a control (e.g., a control vaccine). In some embodiments, a single dose of a RSV RNA (e.g., mRNA) vaccine results in about a 5-fold, 50-fold, or 150-fold increase in serum neutralizing antibodies to RSV compared to a control (e.g., a control vaccine). In some embodiments, a single dose of a RSV RNA (e.g., mRNA) vaccine results in about a 2-fold to 10-fold or about a 40-60-fold increase in serum neutralizing antibodies to RSV compared to a control (e.g., a control vaccine).

[0069] In some embodiments, the serum neutralizing antibodies are directed against RSV A and / or RSV B.

[0070] In some embodiments, the RSV vaccine is formulated in MC3 lipid nanoparticles (see, e.g., U.S. Patent Application Publication No. 2013 / 0245107A1 and International Application No. WO2010 / 054401).

[0071] Also provided herein is a method for inducing an antigen-specific immune response in a subject, the method comprising administering to the subject a RSV RNA (e.g., mRNA) vaccine comprising at least one ribonucleic acid (RNA) polynucleotide having an open reading frame encoding a membrane-bound RSV F protein, a membrane-bound DS-Cav1 (stable pre-fusion RSV F protein), or a combination of a membrane-bound RSV F protein and a membrane-bound DS-Cav1, in an amount effective to induce an antigen-specific immune response in the subject, and a pharma- ceutically acceptable carrier.

[0072] In some embodiments, the method further comprises administering a booster dose of an RSV RNA (e.g., mRNA) vaccine. In some embodiments, the method further comprises administering a second booster dose of an RSV vaccine.

[0073] In some embodiments, the efficacy of an RNA vaccine RNA (e.g., mRNA) can be significantly improved when combined with a flagellin adjuvant, particularly when mRNA encoding one or more antigens is combined with mRNA encoding flagellin.

[0074] RNA (e.g., mRNA) vaccines combined with flagellin adjuvants (e.g., mRNA-encoded flagellin adjuvants) have superior properties in that they can produce greater antibody titers and faster responses compared to commercially available vaccine formulations. Without wishing to be bound by theory, it is believed that RNA vaccines, such as mRNA polynucleotides, are better designed to produce the appropriate protein conformation for both the antigen and the adjuvant upon translation because RNA (e.g., mRNA) vaccines utilize natural cellular machinery. Unlike conventional vaccines that are produced ex vivo and can elicit undesirable cellular responses, RNA (e.g., mRNA) vaccines are delivered to cell lines in a more natural way.

[0075] Some embodiments of the present disclosure provide an RNA (e.g., mRNA) vaccine comprising at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding at least one antigenic polypeptide or immunogenic fragment thereof (e.g., an immunogenic fragment capable of inducing an immune response to the antigenic polypeptide), and at least one RNA (e.g., mRNA polynucleotide) having an open reading frame encoding a flagellin adjuvant.

[0076] In some embodiments, the at least one flagellin polypeptide (e.g., the encoded flagellin polypeptide) is a flagellin protein. In some embodiments, the at least one flagellin polypeptide (e.g., the encoded flagellin polypeptide) is an immunogenic flagellin fragment. In some embodiments, the at least one flagellin polypeptide and the at least one antigenic polypeptide are encoded by a single RNA (e.g., mRNA) polynucleotide. In other embodiments, the at least one flagellin polypeptide and the at least one antigenic polypeptide are each encoded by a different RNA polynucleotide.

[0077] In some embodiments, at least one flagellin polypeptide has at least 80%, at least 85%, at least 90%, or at least 95% identity to a flagellin polypeptide having a sequence of SEQ ID NO:173-175.

[0078] In some embodiments, the nucleic acid vaccines described herein are chemically modified. In other embodiments, the nucleic acid vaccines are unmodified.

[0079] Yet another aspect provides compositions and methods for vaccinating a subject, comprising administering to the subject a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame encoding a first respiratory virus antigenic polypeptide, wherein the RNA polynucleotide does not comprise a stabilizing element, and wherein the vaccine is not co-formulated with or co-administered with an adjuvant.

[0080] In another aspect, the present invention is a composition and method for vaccinating a subject, comprising administering to the subject a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame encoding a first viral antigenic polypeptide, wherein a dose of 10 μg / kg to 400 μg / kg of the nucleic acid vaccine is administered to the subject. In some embodiments, the dose of the RNA polynucleotide is 1-5 μg, 5-10 μg, 10-15 μg, 15-20 μg, 10-25 μg, 20-25 μg, 20-50 μg, 30-50 μg, 40-50 μg, 40-60 μg, 60-80 μg, 60-100 μg, 50-100 μg, 80-120 μg, 40-120 μg, 40-150 μg, 50-150 μg, 50-200 μg, 80-200 μg, 10 The nucleic acid vaccine may be administered to the subject at a dose of 0-200 μg, 120-250 μg, 150-250 μg, 180-280 μg, 200-300 μg, 50-300 μg, 80-300 μg, 100-300 μg, 40-300 μg, 50-350 μg, 100-350 μg, 200-350 μg, 300-350 μg, 320-400 μg, 40-380 μg, 40-100 μg, 100-400 μg, 200-400 μg, or 300-400 μg / dose. In some embodiments, the nucleic acid vaccine is administered to the subject by intradermal or intramuscular injection. In some embodiments, the nucleic acid vaccine is administered to the subject on day 0. In some embodiments, a second dose of the nucleic acid vaccine is administered to the subject on day 21.

[0081] In some embodiments, the nucleic acid vaccine administered to the subject comprises a 25 μg dose of the RNA polynucleotide. In some embodiments, the nucleic acid vaccine administered to the subject comprises a 100 μg dose of the RNA polynucleotide. In some embodiments, the nucleic acid vaccine administered to the subject comprises a 50 μg dose of the RNA polynucleotide. In some embodiments, the nucleic acid vaccine administered to the subject comprises a 75 μg dose of the RNA polynucleotide. In some embodiments, the nucleic acid vaccine administered to the subject comprises a 150 μg dose of the RNA polynucleotide. In some embodiments, the nucleic acid vaccine administered to the subject comprises a 400 μg dose of the RNA polynucleotide. In some embodiments, the nucleic acid vaccine administered to the subject comprises a 200 μg dose of the RNA polynucleotide. In some embodiments, the RNA polynucleotide accumulates at 100-fold higher levels in local lymph nodes compared to distal lymph nodes. In other embodiments, the nucleic acid vaccine is chemically modified, and in other embodiments, the nucleic acid vaccine is not chemically modified.

[0082] An aspect of the present invention provides a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame encoding a first antigenic polypeptide, the RNA polynucleotides being free of a stabilizing element and a pharma- ceutically acceptable carrier or excipient, and no adjuvant being included in the vaccine. In some embodiments, the stabilizing element is a histone stem loop. In some embodiments, the stabilizing element is a nucleic acid sequence that is GC-rich compared to a wild-type sequence.

[0083] An aspect of the present invention provides a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame encoding a first antigenic polypeptide, the RNA polynucleotide being in a formulation for in vivo administration to a host that confers an antibody titer that exceeds the antibody retention standard against the first antigen at a percentage acceptable to a human subject. In some embodiments, the antibody titer generated by the mRNA vaccine of the present invention is a neutralizing antibody titer. In some embodiments, the neutralizing antibody titer is greater than a protein vaccine. In other embodiments, the neutralizing antibody titer generated by the mRNA vaccine of the present invention is greater than an adjuvanted protein vaccine. In yet other embodiments, the titer of neutralizing antibodies produced by the mRNA vaccine of the present invention is 1,000 to 10,000, 1,200 to 10,000, 1,400 to 10,000, 1,500 to 10,000, 1,000 to 5,000, 1,000 to 4,000, 1,800 to 10,000, 2000 to 10,000, 2,000 to 5,000, 2,000 to 3,000, 2,000 to 4,000, 3,000 to 5,000, 3,000 to 4,000, or 2,000 to 2,500. Neutralizing titers are typically expressed as the maximum serum dilution required to achieve a 50% reduction in plaque counts.

[0084] Also provided is a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame encoding a first antigenic polypeptide, the RNA polynucleotides having a stabilizing element or in a formulation for in vivo administration to a host that induces higher antibody titers that last longer than those induced by an mRNA vaccine encoding the first antigenic polypeptide formulated with an adjuvant. In some embodiments, the RNA polynucleotide is formulated to produce neutralizing antibodies within one week after a single administration. In some embodiments, the adjuvant is selected from a cationic peptide and an immunostimulatory nucleic acid. In some embodiments, the cationic peptide is protamine.

[0085] Some embodiments provide nucleic acid vaccines comprising one or more RNA polynucleotides having an open reading frame containing at least one chemical modification, or optionally no nucleotide modifications, encoding a first antigenic polypeptide, wherein the RNA polynucleotides are present in a formulation for in vivo administration to a host such that the host's antigen expression levels significantly exceed the antigen expression levels provided by an mRNA vaccine encoding the first antigenic polypeptide having a stabilizing element or formulated with an adjuvant.

[0086] Another aspect provides a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame containing at least one chemical modification, or optionally no nucleotide modifications, encoding a first antigenic polypeptide, wherein the RNA polynucleotide is at least 10-fold less than the RNA polynucleotide required to produce a comparable antibody titer from an unmodified mRNA vaccine. In some embodiments, the RNA polynucleotide is present in a dose of 25-100 μg.

[0087] Aspects of the invention also provide a unit-of-use vaccine comprising 10 μg to 400 μg of one or more RNA polynucleotides having an open reading frame containing at least one chemical modification, or optionally no nucleotide modification, encoding a first antigenic polypeptide, and a pharma- ceutically acceptable carrier or excipient, formulated for delivery to a human subject. In some embodiments, the vaccine further comprises a cationic lipid nanoparticle.

[0088] Aspects of the invention provide a method of forming, maintaining or restoring antigenic memory against a respiratory virus strain in an individual or population of individuals, comprising administering to the individual or population an antigenic memory booster nucleic acid vaccine, the nucleic acid vaccine comprising (a) at least one RNA polynucleotide, the polynucleotide comprising at least one chemical modification or optionally no nucleotide modification, and comprising two or more codon-optimized open reading frames, the open reading frames encoding a set of reference antigenic polypeptides, and (b) optionally a pharmaceutically acceptable carrier or excipient. In some embodiments, the vaccine is administered to the individual via a route selected from the group consisting of intramuscular administration, intradermal administration and subcutaneous administration. In some embodiments, the administering step comprises contacting the subject's muscle tissue with a device suitable for injecting the composition. In some embodiments, the administering step comprises contacting the subject's muscle tissue with a device suitable for injecting the composition in combination with electroporation.

[0089] An embodiment of the invention provides a method of vaccinating a subject, the method comprising administering to the subject a single dose of 25 μg / kg to 400 μg / kg of a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame encoding a first antigenic polypeptide in an effective amount to vaccinate the subject.

[0090] Another aspect provides a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame comprising at least one chemical modification, the open reading frame encoding a first antigenic polypeptide, wherein the nucleic acid vaccine comprises at least 10-fold less RNA polynucleotide than is required for an unmodified mRNA vaccine to produce a comparable antibody titer. In some embodiments, the RNA polynucleotide is present in a dose of 25-100 μg.

[0091] Another aspect provides a nucleic acid vaccine comprising an LNP-formulated RNA polynucleotide having an open reading frame that does not contain nucleotide modifications (unmodified), the open reading frame encoding a first antigenic polypeptide, where the RNA polynucleotide is at least 10-fold less than the RNA polynucleotide required to produce a comparable antibody titer with an unmodified mRNA vaccine that is not formulated with LNP. In some embodiments, the RNA polynucleotide is present in a dose of 25-100 μg.

[0092] The data presented in the examples show that the formulation of the present invention can be used to significantly improve immune response. Both chemically modified and unmodified RNA vaccines are useful in the present invention. Surprisingly, in contrast to the prior art's approach that chemically unmodified mRNA is preferably used to produce vaccines and formulated in a carrier, it is described herein that chemically modified mRNA-LNP vaccines require a significantly lower effective mRNA dose than unmodified mRNA, i.e., 1 / 10 lower than unmodified mRNA formulated in a carrier other than LNP. Both chemically modified and unmodified RNA vaccines of the present invention produce better immune response than mRNA vaccines formulated in different lipid carriers.

[0093] In other aspects, the invention encompasses a method of treating an elderly subject 60 years of age or older comprising administering to the subject an effective amount of a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame encoding a respiratory virus antigenic polypeptide, thereby vaccinating the subject.

[0094] In other aspects, the invention encompasses a method of treating a juvenile subject 17 years of age or younger, comprising administering to the subject an effective amount of a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame encoding a respiratory virus antigenic polypeptide, thereby vaccinating the subject.

[0095] In other aspects, the invention encompasses a method of treating an adult subject comprising administering to the subject an effective amount of a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame encoding a respiratory virus antigenic polypeptide, thereby vaccinating the subject.

[0096] In some embodiments, the present invention is a method of vaccinating a subject with a combination vaccine comprising at least two nucleic acid sequences encoding respiratory antigens, wherein the dose of the vaccine is a combined therapeutic dose and the dose of each individual nucleic acid encoding the antigen is a sub-therapeutic dose. In some embodiments, the combined dose is 25 μg of RNA polynucleotide in the nucleic acid vaccine administered to the subject. In some embodiments, the combined dose is 100 μg of RNA polynucleotide in the nucleic acid vaccine administered to the subject. In some embodiments, the combined dose is 50 μg of RNA polynucleotide in the nucleic acid vaccine administered to the subject. In some embodiments, the combined dose is 75 μg of RNA polynucleotide in the nucleic acid vaccine administered to the subject. In some embodiments, the combined dose is 150 μg of RNA polynucleotide in the nucleic acid vaccine administered to the subject. In some embodiments, the combined dose is 400 μg of RNA polynucleotide in the nucleic acid vaccine administered to the subject. In some embodiments, the sub-therapeutic dose of each individual nucleic acid encoding an antigen is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 μg. In other embodiments, the nucleic acid vaccine is chemically modified, and in other embodiments, the nucleic acid vaccine is not chemically modified.

[0097] In some embodiments, the RNA polynucleotide is one of SEQ ID NOs: 1, 2, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 242, 246, 257, 258, or 259 and comprises at least one chemical modification. In other embodiments, the RNA polynucleotide is one of SEQ ID NOs: 1, 2, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 242, 246, 257, 258, or 259 and does not comprise any nucleotide modification or is unmodified. In yet other embodiments, at least one RNA polynucleotide encodes an antigenic protein of any of SEQ ID NOs: 3, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 243, or 245 and comprises at least one chemical modification. In other embodiments, the RNA polynucleotide encodes an antigenic protein of any of SEQ ID NOs: 3, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 243 or 245 and does not contain any nucleotide modifications or is unmodified.

[0098] Details of various embodiments of the invention are described in the following detailed description. Other features, objects, and advantages of the invention will be apparent from the detailed description and drawings, and from the claims.

[0099] The foregoing and other objects, features and advantages will become apparent from the following description of specific embodiments of the invention, as illustrated in the accompanying drawings, in which like reference characters refer to the same parts throughout the various views, and in which the drawings are not necessarily to scale, emphasis instead being placed upon illustrating the principles of various embodiments of the invention. [Brief description of the drawings]

[0100] [Figure 1]Shown are data from an immunogenicity study in mice designed to evaluate immune responses to RSV vaccine antigens delivered using various mRNA vaccines formulated with MC3 LNPs compared to protein antigens. The data showed strong neutralizing antibody titers. [Diagram 2] We show that the RNA / LNP vaccine induced a much stronger cellular immune response than the protein antigen. [Diagram 3] 3A-3C show data from intracellular cytokine staining assays to test immunogenicity in mice, showing that the RSV-F mRNA / NLP vaccine and the RSV-G mRNA / LNP vaccine, but not the DS-CAV1 protein antigen, induce a strong CD4+ immune response biased towards Th1 in mice. [Figure 4] 4A-4C show data from intracellular cytokine staining assays to test immunogenicity in mice, showing that the RSV-F mRNA / NLP vaccine and the RSV-G mRNA / LNP vaccine, but not the DS-CAV1 protein antigen, induce a strong CD8+ immune response biased towards Th1 in mice. [Diagram 5] 1 shows data from an immunogenicity study in mice, demonstrating strong neutralizing antibody titers comparable to those achieved with protein antigens adjuvanted with ADJU-PHOS®. [Figure 6] 6A-6C show data from intracellular cytokine staining assays to test immunogenicity in mice, showing that RSV-F mRNA / LNP vaccine and RSV-G mRNA / LNP vaccine, but not DS-CAV1 protein antigen, induce a strong CD4+ immune response biased towards Th1 in mice. [Figure 7]7A-7C show data from intracellular cytokine staining assays to test immunogenicity in mice. The data confirm that the RSV-F mRNA / LNP vaccine, but not the RSV-G mRNA / LNP vaccine or the DS-CAV1 protein antigen, induces a strong CD8+ immune response biased towards TH1 in mice. [Figure 8] The data from the assay are shown, which show that no virus was recovered from the lungs of any of the mice immunized with the RSV mRNA vaccine formulated in MC3 LNP, and only one animal in the low dose DS-CAV1 protein / ADJU-PHOS® vaccine had detectable virus in the nose. [Figure 9] 1 shows data from an immunogenicity study in cotton rats, demonstrating strong neutralizing antibody titers in animals immunized with various RSV mRNA vaccines formulated in MC3 LNP. [Figure 10] 1 shows cotton rat competitive ELISA data characterizing antigenic φ and antigenic site II responses to various RSV mRNA vaccines. [Figure 11] 1 shows data from a cotton rat challenge assay demonstrating the protective efficacy of a RSV mRNA vaccine formulated in MC3 LNPs. [Figure 12] Graph showing serum neutralizing antibody titers (individual NT50 and 95% confidence intervals and GMT) against RSV A induced in African green monkeys by RSV mRNA vaccine and control formulations. [Figure 13] Figures 13A-13B show graphs depicting serum antibody competition ELISA titers (at individual IT50s and GMTs with 95% confidence intervals) against palivizumab (site II) (Figure 13A) and D25 (site φ) (Figure 13B) measured at week 10 (2 weeks after PD3). [Figure 14] 14A-14B show graphs depicting the mean pulmonary viremia detected after challenge (FIG. 13A) and the mean nasal viremia detected after challenge (FIG. 13B) in African green monkeys, along with 95% confidence intervals. [Figure 15] Graphs depicting serum neutralizing antibody titers (at individual NT50s and GMTs with 95% confidence intervals) induced in RSV-experienced African green monkeys by various RSV mRNA vaccines and control formulations at two weeks post-vaccination against RSV A. [Figure 16] 1 shows a graph depicting serum neutralizing antibody titers (GMTs with 95% confidence intervals) against RSV A induced in RSV-experienced African green monkeys by various RSV mRNA vaccine and control formulations. [Figure 17] Figures 17A-17B show graphs depicting serum antibody competition ELISA titers (at individual IT50s and GMTs with 95% confidence intervals) against palivizumab (site II) (Figure 17A) and D25 (site φ) (Figure 17B) measured at baseline and 4 weeks post-immunization. [Figure 18] 18A-18B show graphs depicting RSV F-specific CD4+ (FIG. 18A) and CD8+ (FIG. 18B) T cell responses induced in RSV-experienced African green monkeys by various vaccine and control formulations. [Figure 19] Graphs depicting serum neutralizing antibody titers (at individual NT50s and GMTs with 95% confidence intervals) induced in cotton rats by various vaccine and control formulations against RSV A and RSV B at week 4 (4 weeks after dose 1 for RSV A (circles) and RSV B (squares)) and week 8 (4 weeks after dose 2 for RSV A (upward triangles) and RSV B (downward triangles)). [Figure 20] Graphs depicting the mean lung (circles) and nose (squares) viral copies measured in cotton rats following challenge with RSV B 18357, along with 95% confidence intervals. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0101] An embodiment of the present disclosure provides an RNA (e.g., mRNA) vaccine comprising (at least one) polynucleotide encoding a respiratory syncytial virus (RSV) antigen. RSV is a single-stranded negative-sense RNA virus of the genus Pneumovirinae. There are at least two antigenic subgroups of the virus, known as types A and B, which are primarily due to differences in the surface G glycoprotein. Two RSV surface glycoproteins, G and F, mediate binding and attachment to respiratory epithelial cells. The F surface glycoprotein mediates the fusion of adjacent cells. This results in the formation of syncytial cells. RSV is the most common cause of bronchiolitis. Most infected adults develop mild cold-like symptoms such as congestion, low-grade fever, and wheezing. Infants and children may develop more severe symptoms such as bronchiolitis and pneumonia. The disease can be transmitted to humans through contact with respiratory secretions.

[0102] The genome of RSV encodes at least three surface glycoproteins (including F, G, and SH), four nucleocapsid proteins (including L, P, N, and M2), and one matrix protein M. Glycoprotein F induces viral entry by fusion between the virion and the host membrane. Glycoprotein G is a type II transmembrane glycoprotein and the major adsorption protein. SH is a short integral membrane protein. Matrix protein M is present in the inner layer of the lipid bilayer and aids in virion formation. Nucleocapsid proteins L, P, N, and M2 regulate the replication and transcription of the RSV genome. It is believed that glycoprotein G anchors and stabilizes the viral particle to the bronchial epithelial cell surface, while glycoprotein F interacts with cellular glycosaminoglycans to mediate fusion to and delivery of RSV virion contents to the host cell (Krzyzaniak MA et al. PLoS Pathog 2013;9(4)).

[0103] The RSV RNA (e.g., mRNA) vaccines provided herein can be used to induce a balanced immune response, including both cellular and humoral immunity, without many of the risks associated with DNA vaccination.

[0104] The entire contents of International Application No. PCT / US2015 / 02740 are incorporated herein by reference.

[0105] The mRNA vaccines described herein have been found to be superior to current vaccines in several ways. First, lipid nanoparticle (LNP) delivery is superior to other formulations, including protamine-based vehicles described in the literature, and does not require additional adjuvants. The use of LNPs allows for the effective delivery of chemically modified or unmodified mRNA vaccines. Furthermore, LNP-formulated mRNA vaccines, both modified and unmodified, have been shown herein to be significantly superior to conventional vaccines. In some embodiments, the mRNA vaccines of the present invention are at least 10-fold, 20-fold, 40-fold, 50-fold, 100-fold, 500-fold, or 1,000-fold superior to conventional vaccines.

[0106] Although attempts have been made to create functional RNA vaccines, including mRNA vaccines and self-replicating RNA vaccines, the therapeutic efficacy of these RNA vaccines has not yet been fully established. Quite surprisingly, the inventors have found, in accordance with an embodiment of the present invention, a class of formulations for in vivo delivery of mRNA vaccines that result in significantly enhanced and in many ways synergistic immune responses, including increased production of functional antibodies with antigen generation and neutralizing capacity. These results can be achieved even when extremely low doses of mRNA are administered compared to the doses of mRNA used in other types of lipid-based formulations. The formulations of the present invention have demonstrated unexpectedly significant in vivo immune responses sufficient to establish the efficacy of functional mRNA vaccines as prophylactic and therapeutic agents. Furthermore, self-replicating RNA vaccines rely on viral replication pathways to deliver sufficient RNA to cells to produce an immunogenic response. The formulations of the present invention do not require viral replication to produce sufficient protein to produce a strong immune response. Thus, the mRNAs of the present invention are not self-replicating RNA and do not contain the components required for viral replication.

[0107] The present invention relates in some aspects to the surprising discovery that lipid nanoparticle (LNP) formulation significantly enhances the efficacy of RNA vaccines, including chemically modified and unmodified mRNA vaccines. The efficacy of LNP-formulated mRNA vaccines was tested in vivo using several different antigens. The results presented herein show the unexpected superior efficacy of LNP-formulated mRNA vaccines over other commercially available vaccines.

[0108] In addition to providing an enhanced immune response, the formulations of the present invention provide a more rapid immune response at lower doses than other vaccines tested. The mRNA-LNP formulations of the present invention also provide a quantitatively and qualitatively better immune response than vaccines formulated with different carriers.

[0109] The data described herein show that the formulations of the present invention provide unexpected and significant improvements over existing antigen vaccines. Moreover, the mRNA-LNP formulations of the present invention are superior to other vaccines, even when the dose of mRNA is lower than other vaccines. Various mRNA vaccines formulated with MC3 LNP were compared to protein antigen vaccines in mice. The data showed that compared to existing vaccines, the mRNA vaccines provided stronger neutralizing antibody titers, much higher cellular immune responses than protein antigens, and produced strong CD4+ and CD8+ immune responses with Th1 bias and lung viral reduction in mice. No virus was recovered from the lungs of any of the mice immunized with the RSV mRNA vaccine formulated with MC3 LNP, whereas virus was recovered from only one animal with a low dose of protein / adjuvant vaccine formulation. Significant neutralizing antibody titers were also achieved in rats and monkeys.

[0110] The LNP used in the test described herein has been used in various animal models and humans to deliver siRNA.In view of the observations made regarding siRNA delivery of LNP formulations, the fact that LNPs are useful for vaccines is truly surprising.It has been observed that therapeutic delivery of LNP-formulated siRNA causes undesirable inflammatory responses associated with transient IgM responses, typically leading to reduced antigen production and reduced immune response.In contrast to the findings observed with siRNA, the LNP-mRNA formulation of the present invention is shown herein to produce an increase in IgG levels sufficient for prophylaxis and therapy, rather than a transient IgM response.

[0111] Nucleic Acids / Polynucleotides The RSV vaccines provided herein comprise at least one (one or more) ribonucleic acid (RNA) polynucleotide having an open reading frame encoding at least one RSV antigenic polypeptide. In its broadest sense, the term "nucleic acid" includes any compound and / or substance that comprises a polymer of nucleotides. These polymers are referred to as polynucleotides.

[0112] In some embodiments, at least one RNA polynucleotide is encoded by at least one nucleic acid sequence set forth in SEQ ID NO:1, 2, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 242, 246, 257, 258, or 259, or a homolog having at least 80% identity to a nucleic acid sequence set forth in SEQ ID NO:1, 2, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 242, 246, 257, 258, or 259. In some embodiments, at least one RNA polynucleotide is encoded by at least one nucleic acid sequence set forth in SEQ ID NO:1, 2, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 242, 246, 257, 258, or 259, or a homolog having at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.8% or 99.9%) identity to a nucleic acid sequence set forth in SEQ ID NO:1, 2, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 242, 246, 257, 258, or 259. In some embodiments, at least one RNA polynucleotide is encoded by at least one fragment (e.g., a fragment having at least one antigenic sequence or at least one epitope) of a nucleic acid sequence set forth in SEQ ID NO: 1, 2, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 242, 246, 257, 258, or 259. In some embodiments, at least one RNA polynucleotide has at least one chemical modification. In some embodiments, at least one RNA polynucleotide is an mRNA polynucleotide, and each uracil (100% of the uracils) of the mRNA polynucleotide is chemically modified. In some embodiments, at least one RNA polynucleotide is an mRNA polynucleotide, and each uracil (100% of the uracils) of the mRNA polynucleotide is chemically modified to include N1-methylpseudouridine.

[0113] In some embodiments, the amino acid sequence of the RSV antigenic polypeptide is the amino acid sequence set forth in SEQ ID NO: 3, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 243 or 245, an (antigenic) fragment thereof, or a homolog having at least 80% (e.g., 85%, 90%, 95%, 98%, 99%) identity thereto.

[0114] A nucleic acid (also called a polynucleotide) may be or include, for example, ribonucleic acid (RNA), deoxyribonucleic acid (DNA), threose nucleic acid (TNA), glycol nucleic acid (GNA), peptide nucleic acid (PNA), locked nucleic acid (LNA, including, for example, LNA having a β-D-ribo configuration, α-LNA (a diastereomer of LNA) having an α-L-ribo configuration, 2′-amino-LNA having a 2′-amino functional group, and 2′-amino-α-LNA having a 2′-amino functional group), ethylene nucleic acid (ENA), cyclohexenyl nucleic acid (CeNA), or chimeras or combinations thereof.

[0115] In some embodiments, the polynucleotides of the present disclosure function as messenger RNA (mRNA). "Messenger RNA" (mRNA) refers to any polynucleotide that encodes (at least one) polypeptide (natural, non-natural or modified amino acid polymer) that can be translated to produce the encoded polypeptide in vitro, in vivo, in situ or ex vivo. Those of skill in the art will understand that, unless otherwise noted, the polynucleotide sequences described in this application use "T" when describing a DNA sequence, and "T" is replaced with "U" when the sequence describes an RNA (e.g., mRNA). Thus, any RNA polynucleotide encoded by a DNA identified by a particular sequence identification number can include the corresponding RNA (e.g., mRNA) sequence encoded by the DNA, where each "T" in the DNA sequence is replaced with a "U".

[0116] The basic components of an mRNA molecule typically include at least one coding region, a 5' untranslated region (UTR), a 3'UTR, a 5' cap, and a polyA tail. The polynucleotides of the present disclosure can function as mRNAs, but can be distinguished from wild-type mRNAs by their designed functional and / or structural features, which help to solve existing problems in efficient polypeptide expression using nucleic acid therapeutics.

[0117] In some embodiments, the RNA polynucleotide (e.g., mRNA) of the RSV vaccine encodes 2-10, 2-9, 2-8, 2-7, 2-6, 2-5, 2-4, 2-3, 3-10, 3-9, 3-8, 3-7, 3-6, 3-5, 3-4, 4-10, 4-9, 4-8, 4-7, 4-6, 4-5, 5-10, 5-9, 5-8, 5-7, 5-6, 6-10, 6-9, 6-8, 6-7, 7-10, 7-9, 7-8, 8-10, 8-9, or 9-10 antigenic polypeptides. In some embodiments, the RNA polynucleotide (e.g., mRNA) of the RSV RNA (e.g., mRNA) vaccine encodes at least 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 antigenic polypeptides. In some embodiments, the RNA polynucleotide (e.g., mRNA) of the RSV vaccine encodes at least 100 antigenic polypeptides or at least 200 antigenic polypeptides. In some embodiments, the RNA polynucleotide (e.g., mRNA) of the RSV vaccine encodes 1-10, 5-15, 10-20, 15-25, 20-30, 25-35, 30-40, 35-45, 40-50, 1-50, 1-100, 2-50, or 2-100 antigenic polypeptides.

[0118] The polynucleotides (e.g., mRNA) of the present disclosure are codon-optimized in some embodiments. Codon optimization methods are known in the art and can be used as described herein. Codon optimization can be used in some embodiments to match codon frequencies in the target and host organisms to ensure proper folding, bias the GC content to improve mRNA stability or reduce secondary structures, minimize tandem repeat codons or base runs that may impair gene construction or expression, customize transcriptional and translational control regions, insert or remove protein trafficking sequences, remove / add post-translational modification sites (e.g., glycosylation sites) to the encoded protein, add, remove or shuffle protein domains, insert or delete restriction sites, modify ribosome binding sites and mRNA degradation sites, adjust the translation rate to allow proper folding of various domains of the protein, or reduce or eliminate problematic secondary structures in the polynucleotide. Codon optimization tools, algorithms and services are known in the art, non-limiting examples include services by GeneArt (Life Technologies), DNA2.0 (Menlo Park Calif.), and / or proprietary methods. In some embodiments, an optimization algorithm is used to optimize open reading frame (ORF) sequences.

[0119] In some embodiments, the codon-optimized sequence shares less than 95% sequence identity to the native or wild-type sequence (e.g., a native or wild-type mRNA sequence encoding a polypeptide or protein of interest (e.g., an antigenic protein or polypeptide)). In some embodiments, the codon-optimized sequence shares less than 90% sequence identity to the native or wild-type sequence (e.g., a native or wild-type mRNA sequence encoding a polypeptide or protein of interest (e.g., an antigenic protein or polypeptide). In some embodiments, the codon-optimized sequence shares less than 85% sequence identity to the native or wild-type sequence (e.g., a native or wild-type mRNA sequence encoding a polypeptide or protein of interest (e.g., an antigenic protein or polypeptide). In some embodiments, the codon-optimized sequence shares less than 80% sequence identity to the native or wild-type sequence (e.g., a native or wild-type mRNA sequence encoding a polypeptide or protein of interest (e.g., an antigenic protein or polypeptide)). In some embodiments, the codon-optimized sequence shares less than 75% sequence identity to the native or wild-type sequence (e.g., the native or wild-type mRNA sequence encoding a polypeptide or protein of interest (e.g., an antigenic protein or polypeptide)).

[0120] In some embodiments, the codon-optimized sequence shares 65% to 85% (e.g., about 67% to about 85% or about 67% to about 80%) sequence identity to the native or wild-type sequence (e.g., the native or wild-type mRNA sequence encoding a polypeptide or protein of interest (e.g., an antigenic protein or polypeptide)). In some embodiments, the codon-optimized sequence shares 65% to 75% or about 80% sequence identity to the native or wild-type sequence (e.g., the native or wild-type mRNA sequence encoding a polypeptide or protein of interest (e.g., an antigenic protein or polypeptide)).

[0121] In some embodiments, the RSV vaccine comprises an open reading frame encoding at least one RSV antigenic polypeptide having at least one modification, at least one RNA polynucleotide having at least one 5'-end cap, and is formulated in a lipid nanoparticle. 5'-capping of the polynucleotide can be achieved simultaneously during the in vitro transcription reaction by generating a 5'-guanosine cap structure using the following chemical RNA cap analogs according to the manufacturer's protocol: 3'-O-Me-m7G(5')ppp(5')G [ARCA cap]; G(5')ppp(5')A; G(5')ppp(5')G; m7G(5')ppp(5')A; m7G(5')ppp(5')G (New England BioLabs, Ipswich, Mass.). 5'-capping of modified RNAs can be achieved post-transcriptionally by using vaccinia virus capping enzyme to generate the "cap 0" structure: m7G(5')ppp(5')G (New England BioLabs, Ipswich, MA). Cap 1 structures can be generated by using both vaccinia virus capping enzyme and 2'-O methyltransferase to generate m7G(5')ppp(5')G-2'-O-methyl. Cap 2 structures can be generated from the cap 1 structure by 2'-O-methylating the third 5'-nucleotide using 2'-O methyltransferase. Cap 3 structures can be generated from the cap 2 structure by 2'-O-methylating the fourth 5'-nucleotide using 2'-O methyltransferase. Enzymes may be derived from recombinant sources.

[0122] The modified mRNA, when transfected into mammalian cells, has a stability of 12 to 18 hours or more than 18 hours, for example, 24, 36, 48, 60, 72 or more than 72 hours.

[0123] In some embodiments, the codon-optimized RNA may have an increased G / C level. The G / C content of a nucleic acid molecule (e.g., mRNA) may affect the stability of the RNA. RNA with an increased amount of guanine (G) and / or cytosine (C) residues may be more functionally stable than RNA containing a high amount of adenine (A) and thymine (T) or uracil (U) nucleotides. As an example, WO02 / 098443 discloses a pharmaceutical composition containing an mRNA stabilized by sequence modification in the translation region. Due to the degeneracy of the genetic code, this modification is made by replacing existing codons with codons that promote greater RNA stability without changing the resulting amino acid. This approach is limited to the coding region of the RNA.

[0124] Antigens / Antigenic Polypeptides RSV is known to have at least two antigenic subgroups (A and B). This antigenic dimorphism is mainly due to differences in the surface G glycoprotein. Two surface glycoproteins, G and F, are present in the envelope and mediate attachment and fusion with respiratory epithelial cells. The F protein also mediates the fusion of adjacent cells to form the characteristic syncytial cells for which the virus is named. The epidemiological and biological significance of the two RSV antigenic variants is unclear. However, some evidence suggests a tendency for type A infections to be more severe.

[0125] The RSV genome is approximately 15,000 nucleotides long and is composed of single-stranded RNA with negative polarity. It has 10 genes encoding 11 proteins and two M2 open reading frames. The genome is transcribed sequentially from NS1 to L, with expression decreasing along its length.

[0126] NS1 and NS2 inhibit type I interferon activity. In some embodiments, the RSV vaccine comprises at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding a product of NS1, NS2, or an immunogenic fragment thereof.

[0127] N encodes a nucleocapsid protein that associates with the genomic RNA to form the nucleocapsid. In some embodiments, the RSV vaccine comprises at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding a nucleocapsid protein or an immunogenic fragment thereof.

[0128] M encodes a matrix protein required for viral assembly. In some embodiments, the RSV vaccine comprises at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding a matrix protein or an immunogenic fragment thereof.

[0129] SH, G and F form the viral coat. G protein is a highly glycosylated surface protein that functions as an adsorption protein. F protein is another important surface protein that mediates fusion, allowing the virus to enter the cytoplasm and also allows the formation of syncytia. In both subtypes of RSV, the F protein is homologous and is neutralized by antibodies directed against the F protein. In contrast, the G protein is significantly different in the two subtypes. In some embodiments, the RSV vaccine comprises at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding the SH, G or F protein, or a combination thereof, or an immunogenic fragment thereof.

[0130] Nucleolin on the cell surface is a receptor for RSV fusion protein. Inhibition of the interaction between nucleolin and RSV fusion protein has been shown to have a therapeutic effect against RSV infection in cell culture and animal models. In some embodiments, the RSV vaccine comprises at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding nucleolin or an immunogenic fragment thereof.

[0131] M2 is a second matrix protein that is also required for transcription and encodes M2-1 (elongation factor) and M2-2 (transcriptional regulation). M2 contains a CD8 epitope. In some embodiments, the RSV vaccine comprises at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding a second matrix protein or an immunogenic fragment thereof.

[0132] L encodes an RNA polymerase. In some embodiments, the RSV vaccine comprises at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding an RNA polymerase (L) or an immunogenic fragment thereof.

[0133] Phosphoprotein P is a cofactor of the L protein. In some embodiments, the RSV vaccine comprises at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding phosphoprotein P or an immunogenic fragment thereof.

[0134] Some embodiments of the present disclosure provide a RSV vaccine comprising at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding glycoprotein G or an immunogenic fragment thereof (e.g., an immunogenic fragment capable of eliciting an immune response against RSV).

[0135] Some embodiments of the present disclosure provide a RSV vaccine comprising at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding glycoprotein F or an immunogenic fragment thereof (e.g., an immunogenic fragment capable of eliciting an immune response against RSV).

[0136] Some embodiments of the present invention disclose RSV vaccines comprising at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding a polypeptide or an immunogenic fragment thereof in a post-fusion form. Further embodiments of the present invention disclose RSV vaccines comprising at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding a polypeptide or an immunogenic fragment thereof in a pre-fusion form. In some embodiments, the polypeptide or antigenic fragment thereof comprises a glycoprotein in a pre-fusion conformation, such as, but not limited to, pre-fusion glycoprotein F or DS-CAV1. Without wishing to be bound by theory, certain polypeptides or antigenic fragments thereof may contain more epitopes for neutralizing antibodies when in a pre-fusion conformation, compared to the post-fusion conformation of the same protein or immunogenic fragment thereof. For example, pre-fusion glycoprotein F or an immunogenic fragment thereof has a unique antigenic site ("antigenic site 0") at its membrane distal tip. Antigenic site 0 may, but need not, include residues 62-69 and 196-209 of the RSV F protein sequence. In some cases, a pre-fusion polypeptide or an immunogenic fragment thereof, such as, but not limited to, a pre-fusion glycoprotein F or an immunogenic fragment thereof, may elicit an immune response several times greater than that achieved by a post-fusion polypeptide or an immunogenic fragment thereof. Pre-fusion RSV glycoproteins and methods of use thereof are described in WO / 2014 / 160463, which is incorporated herein by reference in its entirety.

[0137] In some embodiments, the RSV vaccine comprises at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding glycoprotein F or glycoprotein G, or an immunogenic fragment thereof, from the RSV A2 strain (RSV A2). Other RSV strains, including subtype A and subtype B strains, are also encompassed by the present disclosure.

[0138] In some embodiments, the RSV vaccine comprises at least one RNA (eg, mRNA) having at least one modification, including, but not limited to, at least one chemical modification.

[0139] In some embodiments, the RSV antigenic polypeptide is longer than 25 amino acids and shorter than 50 amino acids. Thus, polypeptides include gene products, natural polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments, and other equivalents, variants, and analogs of the foregoing. Polypeptides may be single molecules or multi-molecular complexes, such as dimers, trimers, or tetramers. Polypeptides may also include single chain polypeptides or multi-chain polypeptides, such as antibodies or insulin, which may be associated or linked. Disulfide bonds are most commonly found in multi-chain polypeptides. The term polypeptide may also be applied to amino acid polymers in which at least one amino acid residue is an artificial chemical analog of the corresponding natural amino acid.

[0140] The term "polypeptide variant" refers to a molecule whose amino acid sequence differs from a native or reference sequence. Amino acid sequence variants may have substitutions, deletions and / or insertions at specific positions within the amino acid sequence compared to the native or reference sequence. Typically, variants have at least 50% identity to the native or reference sequence. In some embodiments, variants share at least 80% or at least 90% identity with the native or reference sequence.

[0141] In some embodiments, a "variant mimic" is provided. As used herein, a "variant mimic" contains at least one amino acid that can mimic an activating sequence. For example, glutamic acid can act as a mimic of phosphorylated threonine and / or phosphorylated serine. Alternatively, the variant mimic can result in inactivation or in an inactivated product that contains the mimic. For example, phenylalanine can act as an inactivating replacement for tyrosine, and alanine can act as an inactivating replacement for serine.

[0142] "Orthologs" refers to genes in different species that have evolved from a common ancestral gene by speciation. Orthologs usually retain the same function during evolution. Identification of orthologs is important for reliable prediction of gene function in newly sequenced genomes.

[0143] "Analog" is meant to include polypeptide variants that differ by one or more amino acid alterations, e.g., substitution, addition or deletion of an amino acid residue, but still retain one or more properties of the parent or starting polypeptide.

[0144] "Paralogues" are genes (or proteins) related by duplication within a genome. Orthologs have retained the same function during evolution, whereas paralogs have evolved new functions, even if related to the original function.

[0145] The present disclosure provides several types of polynucleotide or polypeptide-based compositions, including variants and derivatives. These include, for example, substitution, insertion / deletion, and covalent variants and derivatives. The term "derivative" is used interchangeably with the term "variant," but generally refers to a molecule that is modified and / or altered in any way compared to a reference or starting molecule.

[0146] Thus, polynucleotides encoding peptides or polypeptides containing substitutions, insertions and / or additions, deletions and covalent modifications to a reference sequence, particularly a polypeptide sequence disclosed herein, are included within the scope of this disclosure. For example, a sequence tag or one or more amino acids such as lysine can be added to the peptide sequence (e.g., at the N-terminus or C-terminus). The sequence tag can be used for detection, purification or location of the peptide. Lysine can be used to increase the solubility of the peptide or to allow biotinylation. Alternatively, amino acid residues located at the carboxy- and amino-terminal regions of the amino acid sequence of the peptide or protein can be optionally deleted to provide a truncated sequence. Alternatively, specific amino acids (e.g., C- or N-terminal residues) can be deleted depending on the use of the sequence, for example, to express the sequence as part of a larger sequence that is soluble or linked to a solid support. In alternative embodiments, sequences for (or sequences encoding) signal sequences, termination sequences, transmembrane domains, linkers, multimerization domains (e.g., foldon regions, etc.) and the like can be replaced with alternative sequences that achieve the same or similar functions. Such sequences are readily identifiable by one of ordinary skill in the art. It is also understood that some of the sequences provided herein contain sequence tags or terminal peptide sequences (e.g., at the N- or C-terminus) that can be deleted, for example, immediately prior to preparation of an RNA (e.g., mRNA) vaccine.

[0147] "Substitutional variants" with reference to polypeptides are those in which at least one amino acid residue in a native or starting sequence has been deleted and another amino acid inserted in its place at the same position. The substitutions may be single, where only one amino acid in the molecule has been substituted, or they may be multiple, where two or more amino acids have been substituted in the same molecule.

[0148] As used herein, the term "conservative amino acid substitution" refers to a substitution in which an amino acid normally present in a sequence is replaced with another amino acid having a similar size, charge, or polarity. Examples of conservative substitutions include the substitution of a non-polar (hydrophobic) residue, such as isoleucine, valine, and leucine, for another non-polar residue. Similarly, examples of conservative substitutions include the substitution of one polar (hydrophilic) residue for another polar residue, such as between arginine and lysine, between glutamine and asparagine, and between glycine and serine. In addition, the substitution of a basic residue, such as lysine, arginine, or histidine, for another basic residue, or the substitution of one acidic residue, such as aspartic acid or glutamic acid, for another acidic residue, are further examples of conservative substitutions. Examples of non-conservative substitutions include the substitution of a non-polar (hydrophobic) amino acid residue, such as isoleucine, valine, leucine, alanine, or methionine, for a polar (hydrophilic) residue, such as cysteine, glutamine, glutamic acid, or lysine, and / or the substitution of a polar residue for a non-polar residue.

[0149] A "feature" with respect to a polypeptide or polynucleotide is defined as a distinct amino acid sequence-based or nucleotide-based component of the molecule, respectively. Features of a polypeptide encoded by a polynucleotide include surface expression, local conformational shape, folds, loops, semi-loops, domains, semi-domains, sites, termini, or any combination thereof.

[0150] The term "domain," as used herein with respect to polypeptides, refers to a polypeptide motif having one or more identifiable structural or functional features or characteristics (e.g., binding ability, functioning as a site of protein-protein interaction).

[0151] As used herein with respect to polypeptides, the term "site" is used synonymously with "amino acid residue" and "amino acid side chain" when it relates to amino acid-based embodiments. As used herein with respect to polypeptides, the term "site" is used synonymously with "nucleotide" when it relates to nucleotide-based embodiments. A site represents a position within a peptide or polypeptide or polynucleotide that can be modified, manipulated, altered, derivatized, or changed within a polypeptide- or polynucleotide-based molecule.

[0152] The term "terminal" as used herein with respect to a polypeptide or polynucleotide refers to the end of the polypeptide or polynucleotide, respectively. Such end is not limited to only the first or last site of the polypeptide or polynucleotide, but may include amino acids or nucleotides added to the terminal region. Polypeptide-based molecules are those that are N-terminal (containing a free amino group (NH 2 A protein may be characterized as having both a first terminus (ending with an amino acid having a free N-terminus) and a C-terminus (ending with an amino acid having a free carboxyl group (COOH)). Proteins are sometimes composed of multiple polypeptide chains held together by disulfide bonds or non-covalent forces (multimers, oligomers). These proteins have multiple N- and C-termini. Alternatively, the ends of the polypeptide may be modified to begin or end with a non-polypeptide based moiety, such as an organic conjugate, as the case may be.

[0153] As will be appreciated by those skilled in the art, protein fragments, functional protein domains, and homologous proteins are also considered within the scope of the polypeptide of interest. For example, any protein fragment of a reference protein that is 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, or more than 100 amino acids long (i.e., a polypeptide sequence that is at least one amino acid residue shorter than the reference polypeptide sequence but otherwise identical) is provided herein. In another example, any protein that includes a stretch of 20, 30, 40, 50, or 100 amino acids that is 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100% identical to any of the sequences described herein can be utilized in accordance with the present disclosure. In some embodiments, the polypeptide includes 2, 3, 4, 5, 6, 7, 8, 9, 10, or more mutations, as indicated, of any of the sequences described or referenced herein. In some embodiments, the protein fragment is longer than 25 amino acids and shorter than 50 amino acids.

[0154] A polypeptide or polynucleotide molecule of the present disclosure may share a degree of sequence similarity or sequence identity with a reference molecule (e.g., a reference polypeptide or polynucleotide), such as a molecule described in the art (e.g., an engineered or designed molecule or a wild-type molecule). The term "identity" refers to the relationship between two or more polypeptide or polynucleotide sequences, as known in the art, determined by comparing the sequences. In the art, identity also means the degree of sequence relatedness between sequences, as determined by the number of matches between strings of two or more amino acid or nucleic acid residues. Identity evaluates the percentage of identical matches between the smaller of two or more sequences with gap alignment (if any) processed by a particular mathematical model or computer program (e.g., an "algorithm"). The identity of related peptides can be readily calculated by known methods. "Percent identity" as applied to a polypeptide or polynucleotide sequence is defined as the percentage of residues (amino acid or nucleic acid residues) in an amino acid or nucleic acid candidate sequence that are identical to the residues in the amino acid or nucleic acid sequence of a second sequence, after aligning the sequences and, if necessary, introducing gaps to achieve the maximum percent identity. Methods and computer programs for alignment are well known in the art. Identity is dependent on the calculation of percent identity, but it is understood that the value may vary depending on gaps and penalties introduced into the calculation. In general, a variant of a particular polynucleotide or polypeptide has at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, but less than 100% sequence identity to a particular reference polynucleotide or polypeptide sequence, as determined by sequence alignment programs and parameters described herein and known to those skilled in the art.Such alignment tools include those in the BLAST suite (Stephen F. Altschul, et al., (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25: 3389-3402). Another widely used local alignment method is based on the Smith-Waterman algorithm (Smith, TF & Waterman, MS (1981) "Identification of common molecular subsequences." J. Mol. Biol. 147: 195-197). A common global alignment method based on dynamic programming is the Needleman-Wunsch algorithm (Needleman, SB & Wunsch, CD (1970) "A general method applicable to the search for similarities in the amino acid sequences of two proteins." J. Mol. Biol. 48: 443-453.). More recently, the Fast Optimal Global Sequence Alignment Algorithm (FOGSAA) has been developed which is said to generate global alignments of nucleotide and protein sequences faster than other optimal global alignment methods, including the Needleman-Wunsch algorithm. Other tools are described herein, particularly in the definition of "identity" below.

[0155] As used herein, the term "homology" refers to the overall relationship between polymers, e.g., nucleic acid molecules (e.g., DNA molecules and / or RNA molecules) and / or polypeptide molecules. Polymers (e.g., nucleic acid molecules (e.g., DNA molecules and / or RNA molecules) and / or polypeptide molecules) that share a threshold level of similarity or identity determined by alignment of matching residues are called homologous. Homology is a qualitative term that describes the relationship between molecules and can be based on quantitative similarity or identity. Similarity or identity is a quantitative term that defines the degree of sequence match between two compared sequences. In some embodiments, polymers are considered to be "homologous" to each other if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% identical or similar. The term "homologous" necessarily refers to a comparison between at least two sequences (polynucleotide or polypeptide sequences). Two polynucleotide sequences are considered to be homologous if the polypeptides they encode are at least 50%, 60%, 70%, 80%, 90%, 95% or even 99% identical over at least one stretch of at least 20 amino acids. In some embodiments, homologous polynucleotide sequences are characterized by the ability to encode a uniquely specified stretch of at least 4-5 amino acids. For polynucleotide sequences less than 60 nucleotides in length, homology is determined by the ability to encode a uniquely specified stretch of at least 4-5 amino acids. Two protein sequences are considered to be homologous if the proteins are at least 50%, 60%, 70%, 80% or 90% identical over at least one stretch of at least 20 amino acids.

[0156] Homology suggests that the compared sequences evolved from a common evolutionary origin. The term "homolog" refers to a first amino acid or nucleic acid sequence (e.g., a gene (DNA or RNA) or protein sequence) that is related to a second amino acid or nucleic acid sequence by being derived from a common ancestral sequence. The term "homolog" can apply to the relationship between genes and / or proteins separated by a speciation event or between genes and / or proteins separated by a gene duplication event.

[0157] Multiprotein and multicomponent vaccines The present disclosure encompasses RSV vaccines that include multiple RNA (e.g., mRNA) polynucleotides, each encoding a single antigenic polypeptide, and RSV vaccines that include a single RNA polynucleotide that encodes more than one antigenic polypeptide (e.g., as a fusion polypeptide). Thus, a vaccine composition that includes an RNA polynucleotide having an open reading frame encoding a first RSV antigenic polypeptide and an RNA polynucleotide having an open reading frame encoding a second RSV antigenic polypeptide is understood to encompass (a) a vaccine that includes a first RNA polynucleotide that encodes a first RSV antigenic polypeptide and a second RNA polynucleotide that encodes a second RSV antigenic polypeptide, and (b) a vaccine that includes a single RNA polynucleotide that encodes a first and a second RSV antigenic polypeptide (e.g., as a fusion polypeptide). The RSV RNA vaccines of the disclosure, in some embodiments, comprise two to ten (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10) or more RNA polynucleotides, each having an open reading frame encoding a different RSV antigenic polypeptide (or a single RNA polynucleotide encoding two to ten or more different RSV antigenic polypeptides).In some embodiments, the RSV RNA vaccine comprises an RNA polynucleotide having an open reading frame encoding the RSV fusion (F) glycoprotein, an RNA polynucleotide having an open reading frame encoding the RSV attachment (G) protein, an RNA polynucleotide having an open reading frame encoding the RSV nucleoprotein (N), an RNA polynucleotide having an open reading frame encoding the RSV phosphoprotein (P), an RNA polynucleotide having an open reading frame encoding the RSV large polymerase protein (L), an RNA polynucleotide having an open reading frame encoding the RSV matrix protein (M), an RNA polynucleotide having an open reading frame encoding the RSV small hydrophobic protein (SH), an RNA polynucleotide having an open reading frame encoding the RSV nonstructural protein 1 (NS1), and an RNA polynucleotide having an open reading frame encoding the RSV nonstructural protein 2 (NS2). In some embodiments, the RSV RNA vaccine comprises an RNA polynucleotide having an open reading frame encoding the RSV fusion (F) protein, and an RNA polynucleotide having an open reading frame encoding the RSV attachment protein (G). In some embodiments, the RSV RNA vaccine comprises an RNA polynucleotide having an open reading frame encoding a RSV F protein. In some embodiments, the RSV RNA vaccine comprises an RNA polynucleotide having an open reading frame encoding a RSV N protein. In some embodiments, the RSV RNA vaccine comprises an RNA polynucleotide having an open reading frame encoding a RSV M protein. In some embodiments, the RSV RNA vaccine comprises an RNA polynucleotide having an open reading frame encoding a RSV L protein.In some embodiments, the RSV RNA vaccine comprises an RNA polynucleotide having an open reading frame encoding the RSV P protein. In some embodiments, the RSV RNA vaccine comprises an RNA polynucleotide having an open reading frame encoding the RSV SH protein. In some embodiments, the RSV RNA vaccine comprises an RNA polynucleotide having an open reading frame encoding the RSV NS1 protein. In some embodiments, the RSV RNA vaccine comprises an RNA polynucleotide having an open reading frame encoding the RSV NS2 protein.

[0158] In some embodiments, the RNA polynucleotide encodes a RSV antigenic polypeptide fused to a signal peptide (e.g., SEQ ID NO: 281 or SEQ ID NO: 282). Thus, a RSV vaccine is provided that includes at least one ribonucleic acid (RNA) polynucleotide having an open reading frame encoding a signal peptide linked to a RSV antigenic peptide.

[0159] Further provided herein is a RSV vaccine comprising any of the RSV antigenic polypeptides disclosed herein (e.g., F, G, M, N, L, P, SH, NS1, NS2, or any antigenic fragment thereof) fused to a signal peptide. The signal peptide can be fused to the N-terminus or C-terminus of the RSV antigenic polypeptide.

[0160] Signal peptide In some embodiments, the antigenic polypeptide encoded by the RSV polynucleotide comprises a signal peptide. Signal peptides comprise an N-terminal 15-60 amino acid protein, which is typically required for translocation across membranes in the secretory pathway, and thus universally control the entry of most proteins into the secretory pathway in both eukaryotic and prokaryotic organisms. Signal peptides generally consist of three regions: an N-terminal region of variable length (usually containing positively charged amino acids), a hydrophobic region, and a short carboxy-terminal peptide region. In eukaryotic organisms, the signal peptide of a nascent precursor protein (preprotein) directs ribosomes to the rough endoplasmic reticulum (ER) membrane and initiates transport of the elongating peptide chain across the membrane. However, the signal peptide is not responsible for the final destination of the mature protein. Secretory proteins that lack an address tag in their sequence are normally secreted into the external environment. The signal peptide is either cleaved from the precursor protein by a signal peptidase present in the endoplasmic reticulum (ER) or remains uncleaved and functions as a membrane anchor. In recent years, a more refined view of signal peptides has emerged, showing that the function and immunodominance of certain signal peptides is much more diverse than previously anticipated.

[0161] Signal peptides typically function to facilitate targeting of newly synthesized proteins to the endoplasmic reticulum (ER) for processing. ER processing produces mature envelope proteins, where the signal peptide is typically cleaved by a host cell signal peptidase. Signal peptides can also facilitate targeting of proteins to the cell membrane. The RSV vaccines of the present disclosure can include, for example, an RNA polynucleotide encoding an artificial signal peptide, where the signal peptide-encoding sequence is operably linked to and in-frame with the coding sequence of a RSV antigenic polypeptide. Thus, in some embodiments, the RSV vaccines of the present disclosure produce antigenic polypeptides that include a RSV antigenic polypeptide fused to a signal peptide. In some embodiments, the signal peptide is fused to the N-terminus of the RSV antigenic polypeptide. In some embodiments, the signal peptide is fused to the C-terminus of the RSV antigenic polypeptide.

[0162] In some embodiments, the signal peptide fused to the RSV antigenic polypeptide is an artificial signal peptide. In some embodiments, the artificial signal peptide fused to the RSV antigenic polypeptide encoded by the RSV RNA (e.g., mRNA) vaccine is derived from an immunoglobulin protein, such as an IgE signal peptide or an IgG signal peptide. In some embodiments, the signal peptide fused to the RSV antigenic polypeptide encoded by the RSV RNA (e.g., mRNA) vaccine is an Ig heavy chain epsilon-1 signal peptide (IgE HC SP) having the sequence MDWTWILFLVAAATRVHS (SEQ ID NO: 281). In some embodiments, the signal peptide fused to the RSV antigenic polypeptide encoded by the RSV RNA (e.g., mRNA) vaccine is an HAH signal peptide of the IgGk chain V-III region (IgGkSP) having the sequence METPAQLLFLLLLWLPDTTG (SEQ ID NO: 282). In some embodiments, the RSV antigenic polypeptide encoded by the RSV RNA (e.g., mRNA) vaccine has an amino acid sequence set forth in one of SEQ ID NOs: 1-28 fused to a signal peptide of SEQ ID NO: 281 or SEQ ID NO: 282. The examples disclosed herein are not intended to be limiting, and any signal peptide known in the art to facilitate targeting of a protein to the ER for processing and / or targeting of a protein to the cell membrane can be used in accordance with the present disclosure.

[0163] The signal peptide may have a length of 15 to 60 amino acids. For example, the signal peptide may have a length of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 amino acids. In some embodiments, the signal peptide is 20-60, 25-60, 30-60, 35-60, 40-60, 45-60, 50-60, 55-60, 15-55, 20-55, 25-55, 30-55, 35-55, 40-55, 45-55, 50-55, 15-50, 20-50, 25-50, 30-50, 35-50, It may have a length of 40-50, 45-50, 15-45, 20-45, 25-45, 30-45, 35-45, 40-45, 15-40, 20-40, 25-40, 30-40, 35-40, 15-35, 20-35, 25-35, 30-35, 15-30, 20-30, 25-30, 15-25, 20-25 or 15-20 amino acids.

[0164] The signal peptide is typically cleaved from the nascent polypeptide at a cleavage site during ER processing. The mature RSV antigenic polypeptides produced by the RSV RNA vaccines of the present disclosure typically do not contain a signal peptide.

[0165] chemical modification The RNA (e.g., mRNA) vaccines of the present disclosure, in some embodiments, comprise at least one ribonucleic acid (RNA) polynucleotide having an open reading frame encoding at least one respiratory syncytial virus (RSV) antigenic polypeptide, wherein the RNA comprises at least one chemical modification.

[0166] The terms "chemically modified" and "chemically modified" refer to modifications to at least one of the positions, patterns, percentages, or populations of adenosine (A), guanosine (G), uridine (U), thymidine (T), or cytidine (C) ribonucleosides or deoxyribonucleosides. Generally, these terms do not refer to naturally occurring ribonucleotide modifications in the 5'-terminal mRNA cap portion.

[0167] Modifications of polynucleotides include, but are not limited to, those described herein, including chemical modifications, but are not expressly limited thereto. Polynucleotides (e.g., RNA polynucleotides, such as mRNA polynucleotides) can contain modifications that are natural, non-natural, or polynucleotides can contain combinations of natural and non-natural modifications. Polynucleotides can contain any useful modification, such as modifications of sugars, nucleobases, or internucleoside linkages (e.g., phosphates, phosphodiester linkages, or linkages to phosphodiester backbones).

[0168] With respect to polypeptides, the term "modified" refers to modifications to the standard set of 20 amino acids. The polypeptides provided herein are also considered "modified" if they contain amino acid substitutions, insertions, or a combination of substitutions and insertions.

[0169] A polynucleotide (e.g., an RNA polynucleotide, such as an mRNA polynucleotide) in some embodiments comprises a variety (more than one) different modifications. In some embodiments, a specific region of a polynucleotide contains one, two or more (optionally different) nucleoside or nucleotide modifications. In some embodiments, a modified RNA polynucleotide (e.g., a modified mRNA polynucleotide), when introduced into a cell or organism, exhibits reduced degradation in the cell or organism, respectively, compared to an unmodified polynucleotide. In some embodiments, a modified RNA polynucleotide (e.g., a modified mRNA polynucleotide), when introduced into a cell or organism, may exhibit reduced immunogenicity (e.g., reduced innate response) in the cell or organism, respectively.

[0170] Polynucleotides (e.g., RNA polynucleotides, such as mRNA polynucleotides) in some embodiments contain non-naturally occurring modified nucleotides that are introduced during or after synthesis of the polynucleotide to achieve a desired function or property. Modifications may be present at the internucleotide linkages, the purine or pyrimidine bases, or the sugar. Modifications can be introduced at the ends of the strand or elsewhere in the strand using chemical synthesis or polymerase enzymes. Any region of a polynucleotide can be chemically modified.

[0171] The present disclosure provides modified nucleosides and nucleotides of polynucleotides (e.g., RNA polynucleotides such as mRNA polynucleotides). A "nucleoside" refers to a compound that contains a sugar molecule (e.g., pentose or ribose) or a derivative thereof in combination with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as a "nucleobase"). A "nucleotide" refers to a nucleoside that includes a phosphate group. Modified nucleotides can be synthesized by any useful method, for example, chemically, enzymatically, or recombinantly, to include one or more modified or non-natural nucleosides. A polynucleotide can include one or more regions of linked nucleosides. Such regions can have a variety of backbone linkages. The linkages can be standard phosphodiester linkages, in which case the polynucleotide will include a region of nucleotides.

[0172] The base pairing of modified nucleotides encompasses not only standard adenosine-thymine, adenosine-uracil or guanosine-cytosine base pairs, but also base pairs formed between nucleotides and / or modified nucleotides containing non-standard or modified bases, where the arrangement of hydrogen bond donors and hydrogen bond acceptors allows hydrogen bonding between the non-standard and standard bases, or between two complementary non-standard base structures (such as those in polynucleotides with at least one chemical modification). One example of such non-standard base pairing is the base pairing between the modified nucleotide inosine and adenine, cytosine or uracil. Any combination of bases / sugars or linkers can be incorporated into the polynucleotides of the present disclosure.

[0173] Modifications of polynucleotides (e.g., RNA polynucleotides, such as mRNA polynucleotides) useful in the compositions, vaccines, methods, and synthetic procedures of the present disclosure, including but not limited to chemical modifications, include, but are not limited to, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-methyladenosine, 2-methylthio-N6-threonylcarbamoyladenosine, N6-glycinylcarbamoyladenosine, N6-isopentenyladenosine, N6-methyladenosine, N6-threonylcarbamoyladenosine, 1,2'-O-dimethyladenosine, 1-methyladenosine, 2'-O-methyladenosine, 2'-O-ribosyladenosine (phosphate), 2 ... , 2-methylthio-N6-isopentenyladenosine, 2-methylthio-N6-hydroxynorvalylcarbamoyladenosine, 2'-O-methyladenosine, 2'-O-ribosyladenosine (phosphate), isopentenyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, N6,2'-O-dimethyladenosine, N6,2'-O-dimethyladenosine, N6,N6,2'-O-trimethyladenosine, N6,N6-dimethyladenosine, N6-acetyladenosine, N6-hydroxynorvalylcarbamoyladenosine, N6-methyl-N6-threonylcarbamoyladenosine, 2-methyladenosine, 2-methylthio-N6-isopentenyladenosine, 7-deaza-adenosine, N1-methyl-adenosine, N6,N6(dimethyl)adenine, N6-cis-hydroxy-isopentenyl-adenosine, α-thio-adenosine, 2(amino)adenine, 2(aminopropyl)adenine, 2(methylthio)N6(isopentenyl)adenine, 2-(alkyl)adenines, 2-(aminoalkyl)adenines, 2-(aminopropyl)adenine, 2-(halo)adenine, 2-(halo)adenine, 2-(propyl)adenine, 2'-amino-2'-deoxy-ATP, 2' -azido-2'-deoxy-ATP, 2'-deoxy-2'-a-aminoadenosine TP, 2'-deoxy-2'-a-azidoadenosine TP, 6(alkyl)adenine, 6(methyl)adenine, 6-(alkyl)adenine, 6-(methyl)adenine, 7(deaza)adenine, 8(alkenyl)adenine, 8(alkynyl)adenine, 8(amino)adenine, 8(thioalkyl)adenine, 8-(alkenyl)adenine, 8-(alkyl)adenine, 8-(alkynyl)adenine, 8-(amino)adenine, 8-(halo)adenine, 8-(hydroxyl)adenine, 8-(thioalkyl)adenine, 8-(thiol)adenine, 8-azido-adenosine, azaadenine, deazaadenine, N6(methyl)adenine, N6-(isopentyl)adenine, 7-deaza-8-aza-adenosine, 7-methyladenine, 1-deazaadenosine TP, 2'-fluoro-N6-Bz-deoxyadenosine TP, 2'-methyl ... -OMe-2-amino-ATP, 2'O-methyl-N6-Bz-deoxyadenosine TP, 2'-a-ethynyl adenosine TP, 2-aminoadenine, 2-amino adenosine TP, 2-amino-ATP, 2'-a-trifluoromethyl adenosine TP, 2-azidoadenosine TP, 2'-b-ethynyl adenosine TP, 2-bromoadenosine TP, 2'-b-trifluoromethyl adenosine TP, 2-chloroadenosine TP, 2'-deoxy-2',2'-Difluoroadenosine TP, 2'-deoxy-2'-a-mercaptoadenosine TP, 2'-deoxy-2'-a-thiomethoxyadenosine TP, 2'-deoxy-2'-b-aminoadenosine TP, 2'-deoxy-2'-b-azidoadenosine TP, 2'-deoxy-2'-b-bromoadenosine TP, 2'-deoxy-2'-b-chloroadenosine TP, 2'-deoxy-2'-b-fluoroadenosine TP, 2'-deoxy-2'-b-iodoadenosine TP , 2'-deoxy-2'-b-mercaptoadenosine TP, 2'-deoxy-2'-b-thiomethoxyadenosine TP, 2-fluoroadenosine TP, 2-iodoadenosine TP, 2-mercaptoadenosine TP, 2-methoxy-adenine, 2-methylthio-adenine, 2-trifluoromethyladenosine TP, 3-deaza-3-bromoadenosine TP, 3-deaza-3-chloroadenosine TP, 3-deaza-3-fluoroadenosine TP, 3-deaza-3-iodoadenosine TP, 3-deazaadenosine TP, 4'-azidoadenosine TP, 4'-carbocyclic adenosine TP, 4'-ethynyl adenosine TP, 5'-homo-adenosine TP, 8-aza-ATP, 8-bromo-adenosine TP, 8-trifluoromethyl adenosine TP, 9-deazaadenosine TP, 2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 7-deaza-8-aza-2-aminopurine, 2,6-diaminopurine, 7-deaza Aza-8-aza-adenine, 7-deaza-2-aminopurine, 2-thiocytidine, 3-methylcytidine, 5-formylcytidine, 5-hydroxymethylcytidine, 5-methylcytidine, N4-acetylcytidine, 2'-O-methylcytidine, 2'-O-methylcytidine, 5,2'-O-dimethylcytidine, 5-formyl-2'-O-methylcytidine, lysine, N4,2'-O-dimethylcytidine, N4-acetyl-2'-O-methylcytidine, N4-methylcytidine, N4,N4-dimethyl-2'-OMe-cytidine TP, 4-methylcytidine, 5-aza-cytidine, pseudo-iso-cytidine, pyrrolo-cytidine, α-thio-cytidine, 2-(thio)cytosine, 2'-amino-2'-deoxy-CTP, 2'-azido-2'-deoxy-CTP, 2'-deoxy-2'-a-aminocytidine TP, 2'-deoxy-2'-a-azidocytidine TP, 3(deaza)5(aza)cytosine, 3(methyl)cytosine, 3-(alkyl)cytosine, 3-(deaza)5(aza)cytosine, 3-(methyl)cytosine, 3-(alkyl)cytosine, 3-(methyl ... -(methyl)cytidine, 4,2'-O-dimethylcytidine, 5(halo)cytosine, 5(methyl)cytosine, 5(propynyl)cytosine, 5(trifluoromethyl)cytosine, 5-(alkyl)cytosine, 5-(alkynyl)cytosine, 5-(halo)cytosine, 5-(propynyl)cytosine, 5-(trifluoromethyl)cytosine, 5-bromo-cytidine, 5-iodo-cytidine, 5-propynylcytosine, 6-(azo)cytosine, 6-aza-cytidine, azacytosine, deazacytosine, N4(acetyl)cytosine Syn, 1-methyl-1-deaza-pseudoisocytidine, 1-methyl-pseudoisocytidine, 2-methoxy-5-methyl-cytidine, 2-methoxy-cytidine, 2-thio-5-methyl-cytidine, 4-methoxy-1-methyl-pseudoisocytidine, 4-methoxy-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-pseudoisocytidine, 5-aza-zebularine, 5-methyl-zebularine, pyrrolo-pseudoisocytidine doisocytidine, zebularine, (E)-5-(2-bromo-vinyl)cytidine TP, 2,2'-anhydro-cytidine TP hydrochloride, 2'fluoro-N4-Bz-cytidine TP, 2'fluoro-N4-acetyl-cytidine TP, 2'-O-methyl-N4-acetyl-cytidine TP, 2'O-methyl-N4-Bz-cytidine TP, 2'-a-ethynylcytidine TP, 2'-a-trifluoromethylcytidine TP, 2'-b-ethynylcytidine TP, 2'-b-trifluoromethylcytidine TP, 2'-deoxy-2',2'-difluorocytidine TP, 2'-deoxy-2'-a-mercaptocytidine TP, 2'-deoxy-2'-a-thiomethoxycytidine TP, 2'-deoxy-2'-b-aminocytidine TP, 2'-deoxy-2'-b-azidocytidine TP, 2'-deoxy-2'-b-bromocytidine TP, 2'-deoxy-2'-b-chlorocytidine TP, 2'-deoxy-2'-b-fluorocytidine TP, 2'-deoxy-2'-b-iodocytidine TP, '-Deoxy-2'-b-mercaptocytidine TP, 2'-deoxy-2'-b-thiomethoxycytidine TP, 2'-O-methyl-5-(1-propynyl)cytidine TP, 3'-ethynylcytidine TP, 4'-azidocytidine TP, 4'-carbocyclic cytidine TP, 4'-ethynylcytidine TP, 5-(1-propynyl)ara-cytidine TP, 5-(2-chloro-phenyl)-2-thiocytidine TP, 5-(4-amino-phenyl)-2-thiocytidine TP, 5 -aminoallyl-CTP, 5-cyanocytidine TP, 5-ethynyl-cytidine TP, 5-ethynyl-cytidine TP, 5'-homo-cytidine TP, 5-methoxycytidine TP, 5-trifluoromethyl-cytidine TP, N4-amino-cytidine TP, N4-benzoyl-cytidine TP, pseudoisocytidine, 7-methylguanosine, N2,2'-O-dimethylguanosine, N2-methylguanosine, wyosine, 1,2'-O-dimethylguanosine, 1-methylguanosine, Chiruguanosine, 2'-O-methylguanosine, 2'-O-ribosylguanosine (phosphate), 2'-O-methylguanosine, 2'-O-ribosylguanosine (phosphate), 7-aminomethyl-7-deazaguanosine, 7-cyano-7-deazaguanosine, archaeosine, methylwiosine, N2,7-dimethylguanosine, N2,N2,2'-O-trimethylguanosine, N2,N2,7-trimethylguanosine, N2,N2-dimethylguanosine, N2,7,2'-O-trimethylguanosine, 6-thio-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, N1-methyl-guanosine, α-thio-guanosine, 2(propyl)guanine, 2-(alkyl)guanine, 2'-amino-2'-deoxy-GTP, 2'-azido-2'-deoxy-GTP, 2'-deoxy-2'-α-aminoguanosine TP, 2'-deoxy-2'-α-azidoguanosine TP, 6(methyl)guanine, 6-(azido)guanosine, guanine, 6-(alkyl)guanine, 6-methylguanine, 6-methylguanosine, 7-alkylguanine, 7-deazaguanine, 7-methylguanine, 7-(alkyl)guanine, 7-(deaza)guanine, 7-(methyl)guanine, 8-alkylguanine, 8-alkynylguanine, 8-haloguanine, 8-thioalkylguanine, 8-(alkenyl)guanine, 8-(alkyl)guanine, 8-(alkynyl)guanine, 8-(amino)guanine, anine, 8-(halo)guanine, 8-(hydroxyl)guanine, 8-(thioalkyl)guanine, 8-(thiol)guanine, azaguanine, deazaguanine, N(methyl)guanine, N-(methyl)guanine, 1-methyl-6-thio-guanosine, 6-methoxy-guanosine, 6-thio-7-deaza-8-aza-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-methyl-guanosine, 7-deaza-8-aza-guanosine, 7-methyl-guanosine, 2'-methyl-8-oxo-guanosine, N2,N2-dimethyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, 1-Me-GTP, 2'fluoro-N2-isobutyl-guanosine TP, 2'O-methyl-N2-isobutyl-guanosine TP, 2'-a-ethynylguanosine TP, 2'-a-trifluoromethylguanosine TP, 2'-b-ethynylguanosine TP, 2'-b-trifluoromethylguanosine TP, 2'-deoxy-2',2'-difluoroguanosine TP, 2'-deoxy-2'-a-mercaptoguanosine TP, 2'-deoxy-2'-a-thiomethoxyguanosine TP, 2'-deoxy-2'-b-aminoguanosine TP, 2'-deoxy-2'-b-azidoguanosine TP, 2'-deoxy-2'-b-bromoguanosine TP, 2'-deoxy-2'-b-chloroguanosine TP, 2'-deoxy-2'-b-fluoroguanosine TP, 2'-deoxy-2'-b-iodoguanosine TP, 2'-deoxy-2'-b-mercaptoguanosine TP, 2'-deoxy-2'-, b-Thiomethoxyguanosine TP, 4'-Azidoguanosine TP, 4'-Carbocyclic guanosine TP, 4'-Ethynylguanosine TP, 5'-Homo-guanosine TP, 8-Bromo-guanosine TP, 9-Deazaguanosine TP, N2-Isobutyl-guanosine TP, 1-Methylinosine, Inosine, 1,2'-O-Dimethylinosine, 2'-O-Methylinosine, 7-Methylinosine, 2'-O-Methylinosine, Epoxyqueosine, Galactosyl-queosine, Mannosil-queosine, Queosine, Allylamino-thymidine, Azathymidine, Deazathymidine, Deoxy-thymidine, 2'-O-Methyluridine, 2-Thiouridine, 3-Methyluridine, 5-Carboxymethyluridine, 5-Hydroxyuridine, 5-Methyluridine, 5-Taurine nomethyl-2-thiouridine, 5-taurinomethyluridine, dihydrouridine, pseudouridine, (3-(3-amino-3-carboxypropyl)uridine, 1-methyl-3-(3-amino-5-carboxypropyl)pseudouridine, 1-methylpseudouridine, 1-ethyl-pseudouridine, 2'-O-methyluridine, 2'-O-methylpseudouridine, 2'-O-methyluridine, 2-thio-2'-O-methyluridine, 3-(3-amino-3-carboxypropyl)uridine, 3,2'-O-dimethyluridine, 3-methyl-pseudouridine TP, 4-thiouridine, 5-(carboxyhydroxymethyl)uridine, 5-(carboxyhydroxymethyl)uridine methyl ester, 5,2'-O-dimethyluridine, 5,6-Dihydro-uridine, 5-aminomethyl-2-thiouridine, 5-carbamoylmethyl-2'-O-methyluridine, 5-carbamoylmethyluridine, 5-carboxyhydroxymethyluridine, 5-carboxyhydroxymethyluridine methyl ester, 5-carboxymethylaminomethyl-2'-O-methyluridine, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluridine, 5-carboxymethylaminomethyluridine, 5-carbamoylmethyluridine, 5-methyl-2'-O-methyluridine, 5-methoxycarbonylmethyl-2-thiouridine, 5-methoxycarbonylmethyluridine, 5-methyluridine, 5-methoxyuridine, 5-methyl-2-thiouridine, 5-methylaminomethyl-2-selenouridine, 5-methylaminomethyl-2-thiouridine, 5-methylaminomethyluridine, 5-methyldihydrouridine, 5-oxyacetic acid-uridine TP, 5-oxyacetic acid-methylester-uridine TP, N1-methyl-pseudo-uracil , N1-ethyl-pseudo-uracil, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 3-(3-amino-3-carboxypropyl)-uridine TP, 5-(iso-pentenylaminomethyl)-2-thiouridine TP, 5-(iso-pentenylaminomethyl)-2'-O-methyluridine TP, 5-(iso-pentenylaminomethyl)uridine TP, 5-propynyluracil, α-thio-uridine, 1(aminoalkylamino-carbonylethylenyl)-2(thio)-pseudouracil, 1(aminoalkylaminocarbonylethylenyl)-2(thio)-uridine ... 1(aminocarbonylethylenyl)-2,4-(dithio)pseudouracil, 1(aminoalkylaminocarbonylethylenyl)-4(thio)pseudouracil, 1(aminoalkylaminocarbonylethylenyl)-pseudouracil, 1(aminocarbonylethylenyl)-2(thio)-pseudouracil, 1(aminocarbonylethylenyl)-2,4-(dithio)pseudouracil, 1(aminocarbonylethylenyl)-4(thio)pseudouracil, 1(aminocarbonylethylenyl)-pseudouracil, 1-substituted 2(thio)-pseudouracil, 1-substituted 2,4-(dithio)pseudouracil, 1-substituted 4(thio)pseudouracil, 1-substituted pseudouracil, 1-(aminoalkylamino-carbonylethylenyl)-2-(thio)-pseudouracil, 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine TP, 1-methyl-3-(3-amino-3-carboxypropyl)pseudo-UTP, 1-methyl-pseudo-UTP, 1-ethyl-pseudo-UTP, 2(thio)pseudouracil, 2'deoxyuridine uridine, 2'fluorouridine, 2-(thio)uracil, 2,4-(dithio)pseudouracil, 2'methyl, 2'amino, 2'azido, 2'fluoro-guanosine, 2'-amino-2'-deoxy-UTP, 2'-azido-2'-deoxy-UTP, 2'-azido-deoxyuridine TP, 2'-O-methylpseudouridine, 2'deoxyuridine, 2'fluorouridine, 2'-deoxy-2'-a-aminouridine TP, 2'-deoxy-2'-a-azidouridine TP, 2-methyl 3-(3-amino-3-carboxypropyl)uracil, 4-(thio)pseudouracil, 4-(thio)pseudouracil, 4-(thio)uracil, 4-thiouracil, 5-(1,3-diazole-1-alkyl)uracil, 5-(2-aminopropyl)uracil, 5-(aminoalkyl)uracil, 5-(dimethylaminoalkyl)uracil, 5-(guanidinium alkyl)uracil, 5-(methoxycarbonylmethyl)-2-(thio)uracil, 5-methoxycarbonyl -methyl)uracil, 5(methyl)2(thio)uracil, 5(methyl)2,4(dithio)uracil, 5(methyl)4(thio)uracil, 5(methylaminomethyl)-2(thio)uracil, 5(methylaminomethyl)-2,4(dithio)uracil, 5(methylaminomethyl)-4(thio)uracil, 5(propynyl)uracil, 5(trifluoromethyl)uracil, 5-(2-aminopropyl)uracil, 5-(alkyl)-2-(thio)pseudouracil, 5-(alkyl)-2,4(dithio)pseudouracil, 5-(alkyl)-4(thio)pseudouracil, 5-(alkyl)pseudouracil, 5-(alkyl)uracil, 5-(alkynyl)uracil, 5-(allylamino)uracil, 5-(cyanoalkyl)uracil, 5-(dialkylaminoalkyl)uracil, 5-(dimethylaminoalkyl)uracil, 5-(guanidiniumalkyl)uracil, 5-(halo)uracil, 5-(l,3-diazolyl-alkyl)uracil, 5-(methoxy)uracil, 5-( methoxycarbonylmethyl)-2-(thio)uracil, 5-(methoxycarbonyl-methyl)uracil, 5-(methyl)2(thio)uracil, 5-(methyl)2,4(dithio)uracil, 5-(methyl)4(thio)uracil, 5-(methyl)-2-(thio)pseudouracil, 5-(methyl)-2,4(dithio)pseudouracil, 5-(methyl)-4(thio)pseudouracil, 5-(methyl)pseudouracil, 5-(methylaminomethyl)-2(thio)uracil, 5-(methylaminomethyl)-2,4(dithio)uracil, 5-(methylaminomethyl)-4-(thio)uracil, 5-(propynyl)uracil, 5-(trifluoromethyl)uracil, 5-aminoallyl-uridine, 5-bromo-uridine, 5-iodo-uridine, 5-uracil, 6(azo)uracil, 6-(azo)uracil, 6-aza-uridine, allylamino-uracil, azauracil, deazauracil, N3(methyl)uracil, pseudo-UTP-1-2-ethanoic acid, pseudouracil, 4-thio-pseudo-UTP, 1-carbo 1-methyl-1-deaza-pseudouridine, 1-propynyl-uridine, 1-taurinomethyl-1-methyl-uridine, 1-taurinomethyl-4-thio-uridine, 1-taurinomethyl-pseudouridine, 2-methoxy-4-thio-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio -pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, (±)1-(2-hydroxypropyl)pseudouridine TP, (2R)-1-(2-hydroxypropyl)pseudouridine TP, (2S)-1-(2-hydroxypropyl)pseudouridine TP, (E)-5-(2-bromo-vinyl)ara-ur ... -(2-Bromo-vinyl)uridine TP, (Z)-5-(2-Bromo-vinyl)ara-uridine TP, (Z)-5-(2-Bromo-vinyl)uridine TP, 1-(2,2,2-trifluoroethyl)-pseudo-UTP, 1-(2,2,3,3,3-pentafluoropropyl)pseudouridine TP, 1-(2,2-diethoxyethyl)pseudouridine TP, 1-(2,4,6-trimethylbenzyl)pseudouridine TP, 1-(2,4,6-trimethylbenzyl)pseudouridine TP, 1-(2,4,6-trimethyl-phenyl)pseudo-UTP, 1-(2-amino-2-carboxyethyl)pseudo-UTP, 1-(2-amino-ethyl)pseudo-UTP, 1-(2-hydroxyethyl)pseudouridine TP, 1-(2-ethoxyethyl)pseudouridine TP, 1-(3,4-bis-trifluoromethoxybenzyl)pseudouridine TP, 1-(3,4-dimethoxybenzyl)pseudouridine TP, 1-(3-amino-3-carboxypropyl)pseudouridine TP, do-UTP, 1-(3-amino-propyl)pseudo-UTP, 1-(3-cyclopropyl-prop-2-ynyl)pseudo-UTP, 1-(4-amino-4-carboxybutyl)pseudo-UTP, 1-(4-amino-benzyl)pseudo-UTP, 1-(4-amino-butyl)pseudo-UTP, 1-(4-amino-phenyl)pseudo-UTP, 1-(4-azidobenzyl)pseudo-UTP, 1-(4-bromobenzyl)pseudo-UTP, 1-(4 -chlorobenzyl)pseudouridine TP, 1-(4-fluorobenzyl)pseudouridine TP, 1-(4-iodobenzyl)pseudouridine TP, 1-(4-methanesulfonylbenzyl)pseudouridine TP, 1-(4-methoxybenzyl)pseudouridine TP, 1-(4-methoxy-benzyl)pseudouridine TP, 1-(4-methoxy-benzyl)pseudouridine TP, 1-(4-methoxy-phenyl)pseudouridine TP, 1-(4-methylbenzyl)pseudouridine TP, 1-(4-methyl-benzyl)pseudouridine TP 1-(4-nitrobenzyl)pseudo-UTP, 1-(4-nitrobenzyl)pseudo-UTP, 1-(4-nitrophenyl)pseudo-UTP, 1-(4-thiomethoxybenzyl)pseudo-UTP, 1-(4-trifluoromethoxybenzyl)pseudo-UTP, 1-(4-trifluoromethylbenzyl)pseudo-UTP, 1-(5-aminopentyl)pseudo-UTP, 1-(6-aminohexyl)pseudo-UTP, 1,6-Dimethyl-pseudo-UTP, 1-[3-(2-{2-[2-(2-aminoethoxy)-ethoxy]-ethoxy}-ethoxy)-propionyl]pseudouridine TP, 1-{3-[2-(2-aminoethoxy)-ethoxy]-propionyl}pseudouridine TP, 1-acetylpseudouridine TP, 1-alkyl-6-(1-propynyl)-pseudo-UTP, 1-alkyl-6-(2-propynyl)-pseudo-UT P, 1-alkyl-6-allyl-pseudo-UTP, 1-alkyl-6-ethynyl-pseudo-UTP, 1-alkyl-6-homoallyl-pseudo-UTP, 1-alkyl-6-vinyl-pseudo-UTP, 1-allylpseudouridine TP, 1-aminomethyl-pseudo-UTP, 1-benzoylpseudouridine TP, 1-benzyloxymethylpseudouridine TP, 1-benzyl-pseudo-UTP, 1-biotinyl-, PEG2-pseudouridine TP, 1-biotinylpseudouridine TP, 1-butyl-pseudo-UTP, 1-cyanomethylpseudouridine TP, 1-cyclobutylmethyl-pseudo-UTP, 1-cyclobutyl-pseudo-UTP, 1-cycloheptylmethyl-pseudo-UTP, 1-cycloheptyl-pseudo-UTP, 1-cyclohexylmethyl-pseudo-UTP, 1-cyclohexyl-pseudo-UTP, 1-cyclooctylmethyl-pseudo-UTP, 1-cyclooctyl-pseudo-UTP, 1-cyclopentylmethyl-pseudo-UTP pseudo-UTP, 1-cyclopentyl-pseudo-UTP, 1-cyclopropylmethyl-pseudo-UTP, 1-cyclopropyl-pseudo-UTP, 1-ethyl-pseudo-UTP, 1-hexyl-pseudo-UTP, 1-homoallylpseudouridine TP, 1-hydroxymethylpseudouridine TP, 1-isopropyl-pseudo-UTP, 1-Me-2-thio-pseudo-UTP, 1-Me-4-thio-pseudo-UTP, 1-Me-alpha-thio-pseudo-UTP, 1-methanesulfonylmethylpseudouridine TP, 1-methoxy Methylpseudouridine TP, 1-methyl-6-(2,2,2-trifluoroethyl)pseudo-UTP, 1-methyl-6-(4-morpholino)-pseudo-UTP, 1-methyl-6-(4-thiomorpholino)-pseudo-UTP, 1-methyl-6-(substituted phenyl)pseudo-UTP, 1-methyl-6-amino-pseudo-UTP, 1-methyl-6-azido-pseudo-UTP, 1-methyl-6-bromo-pseudo-UTP, 1-methyl-6-butyl-pseudo-UTP, 1-methyl-6-chloro-pseudo-UTP, 1-methyl-6-cyano -pseudo-UTP, 1-methyl-6-dimethylamino-pseudo-UTP, 1-methyl-6-ethoxy-pseudo-UTP, 1-methyl-6-ethylcarboxylate-pseudo-UTP, 1-methyl-6-ethyl-pseudo-UTP, 1-methyl-6-fluoro-pseudo-UTP, 1-methyl-6-formyl-pseudo-UTP, 1-methyl-6-hydroxyamino-pseudo-UTP, 1-methyl-6-hydroxy-pseudo-UTP, 1-methyl-6-iodo-pseudo-UTP, 1-methyl-6-isopropyl-pseudo-UTP,1-Methyl-6-methoxy-pseudo-UTP, 1-methyl-6-methylamino-pseudo-UTP, 1-methyl-6-phenyl-pseudo-UTP, 1-methyl-6-propyl-pseudo-UTP, 1-methyl-6-tert-butyl-pseudo-UTP, 1-methyl-6-trifluoromethoxy-pseudo-UTP, 1-methyl-6-trifluoromethyl-pseudo-UTP, 1-morpholinomethylpseudo-UTP, 1-pentyl-pseudo-UTP, 1-phenyl-pseudo-UTP, 1-pivaloylpseudo-uridine TP, 1-propargy Lupseudouridine TP, 1-propyl-pseudo-UTP, 1-propynyl-pseudouridine, 1-p-tolyl-pseudo-UTP, 1-tert-butyl-pseudo-UTP, 1-thiomethoxymethylpseudouridine TP, 1-thiomorpholinomethylpseudouridine TP, 1-trifluoroacetylpseudouridine TP, 1-trifluoromethyl-pseudouridine TP, 1-vinylpseudouridine TP, 2,2'-anhydro-uridine TP, 2'-bromo-deoxyuridine TP, 2'-F-5-methyl-2'-deoxy-UTP, 2'-OMe- 5-Me-UTP, 2'-OMe-pseudo-UTP, 2'-a-ethynyluridine TP, 2'-a-trifluoromethyluridine TP, 2'-b-ethynyluridine TP, 2'-b-trifluoromethyluridine TP, 2'-deoxy-2',2'-difluorouridine TP, 2'-deoxy-2'-a-mercaptouridine TP, 2'-deoxy-2'-a-thiomethoxyuridine TP, 2'-deoxy-2'-b-aminouridine TP, 2'-deoxy-2'-b-azidouridine TP, 2'-deoxy-2'-b-bromouridine TP, 2'-deoxy Oxy-2'-b-chlorouridine TP, 2'-deoxy-2'-b-fluorouridine TP, 2'-deoxy-2'-b-iodouridine TP, 2'-deoxy-2'-b-mercaptouridine TP, 2'-deoxy-2'-b-thiomethoxyuridine TP, 2-methoxy-4-thio-uridine, 2-methoxyuridine, 2'-O-methyl-5-(1-propynyl)uridine TP, 3-alkyl-pseudo-UTP, 4'-azidouridine TP, 4'-carbocyclic uridine TP, 4'-ethynyluridine TP, 5-(1-propynyl)ara-uridine TP,5-(2-furanyl)uridine TP, 5-cyanouridine TP, 5-dimethylaminouridine TP, 5'-homo-uridine TP, 5-iodo-2'-fluoro-deoxyuridine TP, 5-phenylethynyluridine TP, 5-trideuteromethyl-6-deuterouridine TP, 5-trifluoromethyl-uridine TP, 5-vinylaruridine TP, 6-(2,2,2-trifluoroethyl)-pseudo-UTP, 6-(4-morpholino)-pseudo-UTP, 6-(4-thiomorpholino)-pseudo-UTP, 6-(substituted phenyl)-pseudo-UTP P, 6-amino-pseudo-UTP, 6-azido-pseudo-UTP, 6-bromo-pseudo-UTP, 6-butyl-pseudo-UTP, 6-chloro-pseudo-UTP, 6-cyano-pseudo-UTP, 6-dimethylamino-pseudo-UTP, 6-ethoxy-pseudo-UTP, 6-ethylcarboxylate-pseudo-UTP, 6-ethyl-pseudo-UTP, 6-fluoro-pseudo-UTP, 6-formyl-pseudo-UTP, 6-hydroxyamino-pseudo-UTP, 6-hydroxy-pseudo-UTP, 6-iodo-pseudo-UTP P, 6-iso-propyl-pseudo-UTP, 6-methoxy-pseudo-UTP, 6-methylamino-pseudo-UTP, 6-methyl-pseudo-UTP, 6-phenyl-pseudo-UTP, 6-phenyl-pseudo-UTP, 6-propyl-pseudo-UTP, 6-tert-butyl-pseudo-UTP, 6-trifluoromethoxy-pseudo-UTP, 6-trifluoromethyl-pseudo-UTP, alpha-thio-pseudo-UTP, pseudouridine 1-(4-methylbenzenesulfonate)TP, pseudouridine 1-(4-methylbenzoate)TP, )TP, pseudouridine TP 1-[3-(2-ethoxy)]propionic acid, pseudouridine TP 1-[3-{2-(2-[2-(2-ethoxy)-ethoxy]-ethoxy)-ethoxy}]propionic acid, pseudouridine TP 1-[3-{2-(2-[2-{2(2-ethoxy)-ethoxy}-ethoxy]-ethoxy)-ethoxy}]propionic acid, pseudouridine TP 1-[3-{2-(2-[2-ethoxy]-ethoxy)-ethoxy}]propionic acid, pseudouridine TP 1-[3-{2-(2-[2-ethoxy]-ethoxy)-ethoxy}]propionic acid, pseudouridine TP 1-[3-{2-(2-ethoxy)-ethoxy}]propionic acid,Pseudouridine TP 1-methylphosphonic acid, Pseudouridine TP 1-methylphosphonic acid diethyl ester, Pseudo-UTP-N1-3-propionic acid, Pseudo-UTP-N1-4-butanoic acid, Pseudo-UTP-N1-5-pentanoic acid, Pseudo-UTP-N1-6-hexanoic acid, Pseudo-UTP-N1-7-heptanoic acid, Pseudo-UTP-N1-methyl-p-benzoic acid, Pseudo-UTP-N1-p-benzoic acid, Wybutosin, Hydroxywybutosin, Isowyosin, Peroxywybutosin, Hypomodified Hydroxywybutosin , 4-demethylwyosine, 2,6-(diamino)purine, 1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl: 1,3-(diaza)-2-(oxo)-phenothiazin-l-yl, 1,3-(diaza)-2-(oxo)-phenoxazin-1-yl, 1,3,5-(triaza)-2,6-(dioxa)-naphthalene, 2(amino)purine, 2,4,5-(trimethyl)phenyl, 2'methyl, 2'amino, 2'azido, 2'fluoro-cytidine, 2'methyl, 2'amino, 2'azido, 2'fluoro-adenine, 2'methyl, 2'amino, 2'azido, 2'fluoro-cytidine ... 'Amino, 2'azido, 2'fluorouridine, 2'-amino-2'-deoxyribose, 2-amino-6-chloro-purine, 2-aza-inosinyl, 2'-azido-2'-deoxyribose, 2'fluoro-2'-deoxyribose, 2'fluoro-modified base, 2'-O-methyl-ribose, 2-oxo-7-aminopyridopyrimidin-3-yl, 2-oxo-pyridopyrimidin-3-yl, 2-pyridinone, 3-nitropyrrole, 3-(methyl)-7-(propynyl)isocarbostyrilyl, 3-(methyl)isocarbostyrilyl, 4-(furanyl ... 6-(methyl)-7-(aza)indolyl, 6-chloro-purine, 6-phenyl-pyrrolo-pyrimidin-2-one-3-yl, 7-(aminoalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenothiazin-1-yl,7-(aminoalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl, 7-(aminoalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazin-1-yl, 7-(aminoalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenothiazin-1-yl, 7-(aminoalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazin-1-yl, 7-(aza)indolyl, 7-(guanidiniumalkylhydroxy)-1-(aza)-2-(thio) -3-(aza)-phenoxazin-1-yl, 7-(guanidinium alkyl hydroxy)-1-(aza)-2-(thio)-3-(aza)-phenothiazin-1-yl, 7-(guanidinium alkyl hydroxy)-1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl, 7-(guanidinium alkyl hydroxy)-1,3-(diaza)-2-(oxo)-phenoxazin-1-yl, 7-(guanidinium alkyl hydroxy)-1,3-(diaza)-2-(oxo)-phenothiazin-1-yl, 7-(guanidinium alkyl hydroxy)-1,3-(diaza)-2-(oxo)-phenothiazin-1-yl, 7-(guanidinium alkyl hydroxy)-1,3-(diaza)-2-(oxo)-phenothiazin-1-yl, di-aminoalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazin-1-yl, 7-(propynyl)isocarbostyrilyl, 7-(propynyl)isocarbostyrilyl, propynyl-7-(aza)indolyl, 7-deaza-inosinyl, 7-substituted 1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl, 7-substituted 1,3-(diaza)-2-(oxo)-phenoxazin-1-yl, 9-(methyl)-imidizopyridinyl, aminoindolyl, anthracenyl, bis-ortho-(aminoalkyl hydroxy) aryloxy)-6-phenyl-pyrrolo-pyrimidin-2-one-3-yl, bis-ortho-substituted-6-phenyl-pyrrolo-pyrimidin-2-one-3-yl, difluorotolyl, hypoxanthine, imidizopyridinyl, inosinyl, isocarbostyrilyl, isoguanisine, N2-substituted purines, N6-methyl-2-amino-purines, N6-substituted purines, N-alkylated derivatives, naphthalenyl, nitrobenzimidazolyl, nitroimidazolyl, nitroindazolyl, nitropyrazolyl, nubularine, O6-substituted purines, O-alkylated derivatives,ortho-(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidin-2-one-3-yl, ortho-substituted-6-phenyl-pyrrolo-pyrimidin-2-one-3-yl, oxoformycin TP, para-(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidin-2-one-3-yl, para-substituted-6-phenyl-pyrrolo-pyrimidin-2-one-3-yl, pentacenyl, phenanthracenyl, phenyl, propynyl-7-(aza)ine, Doryl, pyrenyl, pyridopyrimidin-3-yl, pyridopyrimidin-3-yl, 2-oxo-7-amino-pyridopyrimidin-3-yl, pyrrolo-pyrimidin-2-one-3-yl, pyrrolopyrimidinyl, pyrrolopyridinyl, stilbenzyl, substituted 1,2,4-triazoles, tetracenyl, tubercidin, xanthine, xanthosine-5'-TP, 2-thio-zebularine, 5-aza-2-thio-zebularine, 7-deaza-2-thio-zebularine, 5- ... -amino-purine, pyridin-4-one ribonucleoside, 2-amino-riboside-TP, formycin ATP, formycin BTP, pyrrolosine TP, 2'-OH-ara-adenosine TP, 2'-OH-ara-cytidine TP, 2'-OH-ara-uridine TP, 2'-OH-ara-guanosine TP, 5-(2-carbomethoxyvinyl)uridine TP, and N6-(19-amino-pentaoxanone adecyl)adenosine TP.

[0174] In some embodiments, a polynucleotide (eg, an RNA polynucleotide such as an mRNA polynucleotide) comprises a combination of at least two (eg, 2, 3, 4 or more) of the foregoing modified nucleobases.

[0175] In some embodiments, the modified nucleobase in a polynucleotide (e.g., an RNA polynucleotide such as an mRNA polynucleotide) is pseudouridine (ψ), 2-thiouridine (s2U), 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio- Dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methoxyuridine, 2'-O-methyluridine, 1-methyl-pseudouridine (m1ψ), 1-ethyl-pseudouridine (e1ψ), 5-meth 5-methyl-uridine (mo5U), 5-methyl-cytidine (m5C), α-thio-guanosine, α-thio-adenosine, 5-cyanouridine, 4'-thiouridine 7-deaza-adenine, 1-methyl-adenosine (m1A), 2-methyl-adenine (m2A), N6-methyl-adenosine (m6A) and 2,6-diaminopurine, (I), 1-methyl-inosine (m1I), wyosine (imG), methylwyosine (mimG), 7- Deaza-guanosine, 7-cyano-7-deaza-guanosine (preQ0), 7-aminomethyl-7-deaza-guanosine (preQ1), 7-methyl-guanosine (m7G), 1-methyl-guanosine (m1G), 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 2,8-dimethyladenosine, 2-geranylthiouridine, 2-lysidine, 2-selenouridine, 3-(3-amino-3-carboxypropyl)-5,6-dihydrouridine, 3-(3-amino-3-carboxypropyl)pseudouridine, 3-methylpseudouridine, 5-(carboxyhydroxymethyl)-2'-O-methyluridine methyl ester, 5-aminomethyl-2-geranylthiouridine, 5-aminomethyl-2-selenouridine, 5-aminomethyluridine, 5-carbamoylhydroxymethyluridine, 5-carbamoylmethyl-2-thiouridine, 5-carboxymethyl-2-thiouridine, 5-carboxymethylaminomethyl-2-geranylthiouridine, 5-carboxymethylaminomethyl-2-selenouridine, 5-cyanomethyluridine, 5-hydroxycytidine, 5-methylaminomethyl-2-geranylthiouridine, Selected from the group consisting of 7-aminocarboxypropyl-demethyl wyosine, 7-aminocarboxypropyl wyosine, 7-aminocarboxypropyl wyosine methyl ester, 8-methyl adenosine, N4,N4-dimethylcytidine, N6-formyl adenosine, N6-hydroxymethyl adenosine, agmatidine, cyclic N6-threonylcarbamoyl adenosine, glutamyl-queosine, methylated hypomodified hydroxywyosine, N4,N4,2'-O-trimethylcytidine, geranylated 5-methylaminomethyl-2-thiouridine, geranylated 5-carboxymethylaminomethyl-2-thiouridine, Q base, preQ0 base, preQ1 base, and combinations of two or more thereof. In some embodiments, the at least one chemically modified nucleoside is selected from the group consisting of pseudouridine, 1-methyl-pseudouridine, 1-ethyl-pseudouridine, 5-methylcytosine, 5-methoxyuridine, and combinations thereof. In some embodiments, a polyribonucleotide (e.g., an RNA polyribonucleotide, such as an mRNA polyribonucleotide) comprises a combination of at least two (e.g., two, three, four or more) of the above modified nucleobases. In some embodiments, a polynucleotide (e.g., an RNA polynucleotide, such as an mRNA polynucleotide) comprises a combination of at least two (e.g., two, three, four or more) of the above modified nucleobases.

[0176] In some embodiments, modified nucleobases in a polynucleotide (e.g., an RNA polynucleotide such as an mRNA polynucleotide) are selected from the group consisting of 1-methyl-pseudouridine (m1ψ), 1-ethyl-pseudouridine (e1ψ), 5-methoxy-uridine (mo5U), 5-methyl-cytidine (m5C), pseudouridine (ψ), α-thio-guanosine, and α-thio-adenosine. In some embodiments, a polyribonucleotide comprises a combination of at least two (e.g., two, three, four or more) of the foregoing modified nucleobases.

[0177] In some embodiments, a polynucleotide (e.g., an RNA polynucleotide, such as an mRNA polynucleotide) comprises pseudouridine (ψ) and 5-methyl-cytidine (m5C). In some embodiments, a polyribonucleotide (e.g., an RNA, such as an mRNA) comprises 1-methyl-pseudouridine (m1ψ). In some embodiments, a polyribonucleotide (e.g., an RNA, such as an mRNA) comprises 1-ethyl-pseudouridine (e1ψ). In some embodiments, a polyribonucleotide (e.g., an RNA, such as an mRNA) comprises 1-methyl-pseudouridine (m1ψ) and 5-methyl-cytidine (m5C). In some embodiments, a polyribonucleotide (e.g., an RNA, such as an mRNA) comprises 1-ethyl-pseudouridine (e1ψ) and 5-methyl-cytidine (m5C). In some embodiments, a polyribonucleotide (e.g., an RNA, such as an mRNA) comprises 1-ethyl-pseudouridine (e1ψ) and 5-methyl-cytidine (m5C). In some embodiments, a polyribonucleotide (e.g., an RNA, such as an mRNA) comprises 2-thiouridine (s2U). In some embodiments, the polyribonucleotides (e.g., RNA such as mRNA) comprise 2-thiouridine and 5-methyl-cytidine (m5C). In some embodiments, the polyribonucleotides (e.g., RNA such as mRNA) comprise methoxy-uridine (mo5U). In some embodiments, the polyribonucleotides (e.g., RNA such as mRNA) comprise 5-methoxy-uridine (mo5U) and 5-methyl-cytidine (m5C). In some embodiments, the polyribonucleotides (e.g., RNA such as mRNA) comprise 2'-O-methyluridine. In some embodiments, the polyribonucleotides (e.g., RNA such as mRNA) comprise 2'-O-methyluridine and 5-methyl-cytidine (m5C). In some embodiments, the polyribonucleotides (e.g., RNA such as mRNA) comprise N6-methyl-adenosine (m6A). In some embodiments, a polyribonucleotide (eg, RNA such as mRNA) comprises N6-methyl-adenosine (m6A) and 5-methyl-cytidine (m5C).

[0178] In some embodiments, a polynucleotide (e.g., an RNA polynucleotide, such as an mRNA polynucleotide) is uniformly modified (e.g., completely modified, modified throughout the entire sequence) for a particular modification. For example, a polynucleotide can be uniformly modified with 1-methyl-pseudouridine, i.e., all uridine residues in the mRNA sequence are replaced with 1-methyl-pseudouridine. Similarly, a polynucleotide can be uniformly modified by replacing any type of nucleoside residue present in the sequence with a modified residue, such as those described above.

[0179] Exemplary nucleobases and nucleosides having modified cytosines include N4-acetyl-cytidine (ac4C), 5-methyl-cytidine (m5C), 5-halo-cytidine (e.g., 5-iodo-cytidine), 5-hydroxymethyl-cytidine (hm5C), 1-methyl-pseudoisocytidine, 2-thio-cytidine (s2C), and 2-thio-5-methyl-cytidine.

[0180] In some embodiments, the modified nucleobase is a modified uridine. Exemplary nucleobases and nucleosides having modified uridines include 1-methyl-pseudouridine (m1ψ), 1-ethyl-pseudouridine (e1ψ), 5-methoxyuridine, 2-thiouridine, 5-cyanouridine, 2'-O-methyluridine, and 4'-thiouridine.

[0181] In some embodiments, the modified nucleobase is a modified adenine. Exemplary nucleobases and nucleosides having modified adenines include 7-deaza-adenine, 1-methyl-adenosine (m1A), 2-methyl-adenine (m2A) and N6-methyl-adenosine (m6A).

[0182] In some embodiments, the modified nucleobase is modified guanine.Exemplary nucleobases and nucleosides having modified guanine include inosine (I), 1-methyl-inosine (m1I), wyosine (imG), methylwyosine (mimG), 7-deaza-guanosine, 7-cyano-7-deaza-guanosine (preQ0), 7-aminomethyl-7-deaza-guanosine (preQ1), 7-methyl-guanosine (m7G), 1-methyl-guanosine (m1G), 8-oxo-guanosine and 7-methyl-8-oxo-guanosine.

[0183] The polynucleotide of the present disclosure may be partially or completely modified throughout the entire length of the molecule.For example, one or more or all or a given type of nucleotide (e.g., purine or pyrimidine, or any one or more or all of A, G, U, C) in the polynucleotide of the present disclosure or in a given sequence region thereof (e.g., mRNA with or without polyA tail) may be uniformly modified.In some embodiments, all nucleotides X in the polynucleotide of the present disclosure (or in a given sequence region thereof) are modified nucleotides, where X is any one of nucleotides A, G, U, C, or any one of combinations A+G, A+U, A+C, G+U, G+C, U+C, A+G+U, A+G+C, G+U+C, or A+G+C.

[0184] Polynucleotides may contain modified nucleotides from about 1% to about 100% (either relative to the overall nucleotide content or relative to one or more types of nucleotides (i.e., any one or more of A, G, U, or C)), or any percentage in between (e.g., 1%-20%, 1%-25%, 1%-50%, 1%-60%, 1%-70%, 1%-80%, 1%-90%, 1%-95%, 10%-20%, 10%-25%, 10%-50%, 10%-60%, 10%-70%, 10%-80%, 10%-95%, 10%-10 ... up to 90%, 10% to 95%, 10% to 100%, 20% to 25%, 20% to 50%, 20% to 60%, 20% to 70%, 20% to 80%, 20% to 90%, 20% to 95%, 20% to 100%, 50% to 60%, 50% to 70%, 50% to 80%, 50% to 90%, 50% to 95%, 50% to 100%, 70% to 80%, 70% to 90%, 70% to 95%, 70% to 100%, 80% to 90%, 80% to 95%, 80% to 100%, 90% to 95%, 90% to 100%, and 95% to 100%). It will be understood that any remaining percentage will be accounted for by unmodified A, G, U or C occurrences.

[0185] A polynucleotide may contain as little as 1% and as much as 100% modified nucleotides, or any percentage therebetween, such as at least 5% modified nucleotides, at least 10% modified nucleotides, at least 25% modified nucleotides, at least 50% modified nucleotides, at least 80% modified nucleotides, or at least 90% modified nucleotides. For example, a polynucleotide may contain modified pyrimidines, such as modified uracil or modified cytosine. In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90% or 100% of the uracils in a polynucleotide are replaced by modified uracils (e.g., 5-substituted uracils). The modified uracils may be replaced by a compound with a single unique structure, or by multiple compounds with different structures (e.g., two, three, four or more unique structures). In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90% or 100% of the cytosines in a polynucleotide are replaced by modified cytosines (e.g., 5-substituted cytosines). The modified cytosines may be replaced by a compound having a single unique structure or by multiple compounds having different structures (e.g., two, three, four or more unique structures).

[0186] In some embodiments, the modified nucleobase is a modified uracil. Exemplary nucleobases and nucleosides having modified uracil include pseudouridine (ψ), pyridin-4-one ribonucleosides, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine (s 2 U), 4-thio-uridine (s 4 U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine (ho 5 U), 5-aminoallyl-uridine, 5-halo-uridine (e.g., 5-iodo-uridine or 5-bromo-uridine), 3-methyl-uridine (m3 U), 5-methoxy-uridine (mo 5 U), uridine 5-oxyacetic acid (cmo 5 U), uridine 5-oxyacetic acid methyl ester (mcmo 5 U), 5-carboxymethyl-uridine (cm 5 U), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine (chm 5 U), 5-carboxyhydroxymethyl-uridine methyl ester (mchm 5 U), 5-methoxycarbonylmethyl-uridine (mcm 5 U), 5-methoxycarbonylmethyl-2-thio-uridine (mcm 5 s 2 U), 5-aminomethyl-2-thio-uridine (nm 5 s 2 U), 5-methylaminomethyl-uridine (mnm 5 U), 5-methylaminomethyl-2-thio-uridine (mnm 5 s 2 U), 5-methylaminomethyl-2-seleno-uridine (mnm 5 se 2 U), 5-carbamoylmethyl-uridine (ncm 5 U), 5-carboxymethylaminomethyl-uridine (cmnm 5 U), 5-carboxymethylaminomethyl-2-thio-uridine (cmnm 5 s 2 U), 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyl-uridine (τm 5 U), 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine (τm 5 s 2 U), 1-taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine (m 5 U, i.e., having the nucleobase deoxythymine), 1-methyl-pseudouridine (m 1 ψ), 1-ethyl-pseudouridine (e 1 ψ), 5-methyl-2-thio-uridine (m 5 s2 U), 1-methyl-4-thio-pseudouridine (m 1 s 4 ψ), 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine (m 3 ψ), 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine (D), dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine (m 5 D), 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine (acp 3 U), 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine (acp 3 ψ), 5-(isopentenylaminomethyl)uridine (inm 5 U), 5-(isopentenylaminomethyl)-2-thio-uridine (inm 5 s 2 U), α-thio-uridine, 2'-O-methyl-uridine (Um), 5,2'-O-dimethyl-uridine (m 5 Um), 2'-O-methyl-pseudouridine (ψm), 2-thio-2'-O-methyl-uridine (s 2 Um), 5-methoxycarbonylmethyl-2'-O-methyl-uridine (mcm 5 Um), 5-carbamoylmethyl-2'-O-methyl-uridine (ncm 5 Um), 5-carboxymethylaminomethyl-2'-O-methyl-uridine (cmnm 5 Um), 3,2'-O-dimethyl-uridine (m 3 Um), and 5-(isopentenylaminomethyl)-2'-O-methyl-uridine (inm 5Um), 1-thio-uridine, deoxythymidine, 2'-F-ara-uridine, 2'-F-uridine, 2'-OH-ara-uridine, 5-(2-carbomethoxyvinyl)uridine and 5-[3-(1-E-propenylamino)]uridine.

[0187] In some embodiments, the modified nucleobase is a modified cytosine. Exemplary nucleobases and nucleosides having modified cytosines include 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine (m 3 C), N4-acetyl-cytidine (ac 4 C), 5-formyl-cytidine (f 5 C), N4-methyl-cytidine (m 4 C), 5-methyl-cytidine (m 5 C), 5-halo-cytidine (e.g., 5-iodo-cytidine), 5-hydroxymethyl-cytidine (hm 5 C), 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine (s 2 C), 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1-methyl-pseudoisocytidine, lysidine (k 2 C), α-thio-cytidine, 2'-O-methyl-cytidine (Cm), 5,2'-O-dimethyl-cytidine (m 5 Cm), N4-acetyl-2'-O-methyl-cytidine (ac 4 Cm), N4,2'-O-dimethyl-cytidine (m 4 Cm), 5-formyl-2'-O-methyl-cytidine (f 5 Cm), N4,N4,2'-O-trimethyl-cytidine (m 4 2Cm), 1-thio-cytidine, 2'-F-ara-cytidine, 2'-F-cytidine and 2'-OH-ara-cytidine.

[0188] In some embodiments, the modified nucleobase is a modified adenine. Exemplary nucleobases and nucleosides having modified adenines include 2-amino-purine, 2,6-diaminopurine, 2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine), 6-halo-purine (e.g., 6-chloro-purine), 2-amino-6-methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyl-adenosine (m 1 A), 2-methyl-adenine (m 2 A), N6-methyl-adenosine (m 6 A), 2-methylthio-N6-methyl-adenosine (ms 2 m 6 A), N6-isopentenyl-adenosine (i 6 A), 2-methylthio-N6-isopentenyl-adenosine (ms 2 i 6 A), N6-(cis-hydroxyisopentenyl)adenosine (io 6 A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine (ms 2 io 6 A), N6-glycinylcarbamoyl-adenosine (g 6 A), N6-threonylcarbamoyl-adenosine (t 6 A), N6-methyl-N6-threonylcarbamoyl-adenosine (m 6 t 6 A), 2-methylthio-N6-threonylcarbamoyl-adenosine (ms 2 g 6 A), N6,N6-dimethyl-adenosine (m 6 2 A), N6-hydroxynorvalylcarbamoyl-adenosine (hn 6A), 2-methylthio-N6-hydroxynorvalylcarbamoyl-adenosine (ms 2 hn 6 A), N6-acetyl-adenosine (ac 6 A), 7-methyl-adenine, 2-methylthio-adenine, 2-methoxy-adenine, α-thio-adenosine, 2'-O-methyl-adenosine (Am), N6,2'-O-dimethyl-adenosine (m 6 Am), N6,N6,2'-O-trimethyl-adenosine (m 6 2 Am), 1,2'-O-dimethyl-adenosine (m 1 Am), 2'-O-ribosyladenosine (phosphate) (Ar(p)), 2-amino-N6-methyl-purine, 1-thio-adenosine, 8-azido-adenosine, 2'-F-ara-adenosine, 2'-F-adenosine, 2'-OH-ara-adenosine and N6-(19-amino-pentaoxanone adecyl)-adenosine.

[0189] In some embodiments, the modified nucleobase is a modified guanine. Exemplary nucleobases and nucleosides having a modified guanine include inosine (I), 1-methyl-inosine (m 1 I), wyosine (imG), methylwyosine (mimG), 4-demethyl-wyosine (imG-14), isowyosine (imG2), wyosine (yW), peroxywyosine (o 2 yW), hydroxywybutosin (OhyW), low-modified hydroxywybutosin (OhyW * ), 7-deaza-guanosine, queosine (Q), epoxyqueosine (oQ), galactosyl-queosine (galQ), mannosyl-queosine (manQ), 7-cyano-7-deaza-guanosine (preQ 0 ), 7-aminomethyl-7-deaza-guanosine (preQ 1 ), Archaeosin (G + ), 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine (m 7G), 6-thio-7-methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1-methyl-guanosine (m 1 G), N2-methyl-guanosine (m 2 G), N2,N2-dimethyl-guanosine (m 2 2 G), N2,7-dimethyl-guanosine (m 2,7 G), N2,N2,7-dimethyl-guanosine (m 2,2,7 G), 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio-guanosine, α-thio-guanosine, 2'-O-methyl-guanosine (Gm), N2-methyl-2'-O-methyl-guanosine (m 2 Gm), N2,N2-dimethyl-2'-O-methyl-guanosine (m 2 2 Gm), 1-methyl-2'-O-methyl-guanosine (m 1 Gm), N2,7-dimethyl-2'-O-methyl-guanosine (m 2,7 Gm), 2'-O-methyl-inosine (Im), 1,2'-O-dimethyl-inosine (m 1 Im), 2'-O-ribosylguanosine(phosphate) (Gr(p)), 1-thio-guanosine, O6-methyl-guanosine, 2'-F-ara-guanosine, and 2'-F-guanosine.

[0190] In some embodiments, the RNA vaccine comprises 5'UTR elements, optionally a codon-optimized open reading frame and 3'UTR elements, a poly(A) sequence and / or a polyadenylation signal, and the RNA is not chemically modified.

[0191] RSV RNA vaccine: in vitro transcription of RNA (e.g., mRNA) The RSV vaccine of the present disclosure comprises at least one RNA polynucleotide, such as an mRNA (e.g., a modified mRNA). The mRNA is transcribed in vitro, for example, from a template DNA, referred to as an "in vitro transcription template". In some embodiments, the at least one RNA polynucleotide has at least one chemical modification. The at least one chemical modification may include, but is not limited to, any of the modifications described herein.

[0192] In vitro transcription of RNA is known in the art and described in International Publication No. WO / 2014 / 152027, which is incorporated herein by reference in its entirety. For example, in some embodiments, RNA transcripts are generated using an unamplified linear DNA template in an in vitro transcription reaction to generate the RNA transcript. In some embodiments, the RNA transcript is capped by enzymatic capping. In some embodiments, the RNA transcript is purified by chromatographic methods, for example, using an oligo-dT substrate. Some embodiments exclude the use of DNase. In some embodiments, the RNA transcript is synthesized from an unamplified linear DNA template encoding a gene of interest by an enzymatic in vitro transcription reaction utilizing T7 phage RNA polymerase and a nucleotide triphosphate of the desired chemical. Any number of RNA polymerases or variants can be used in the methods of the invention. The polymerase may be selected from, but is not limited to, a phage RNA polymerase, such as, for example, T7 RNA polymerase, T3 RNA polymerase, SP6 RNA polymerase, and / or a mutant polymerase (e.g., a polymerase capable of incorporating modified nucleic acids and / or modified nucleotides, including, but not limited to, chemically modified nucleic acids and / or nucleotides).

[0193] In some embodiments, unamplified linearized plasmid DNA is utilized as the template DNA for in vitro transcription. In some embodiments, the template DNA is isolated DNA. In some embodiments, the template DNA is cDNA. In some embodiments, the cDNA is formed by reverse transcription of an RNA polynucleotide, such as, but not limited to, RSV RNA, such as RSV mRNA. In some embodiments, the cell is, for example, a bacterial cell, such as E. coli, for example, DH-1 cells, transfected with a plasmid DNA template. In some embodiments, the transfected cells are cultured to replicate the plasmid DNA, and the plasmid DNA is then isolated and purified. In some embodiments, the DNA template comprises an RNA polymerase promoter, such as a T7 promoter, operably linked to a gene of interest, located 5'.

[0194] In some embodiments, the in vitro transcription template encodes a 5' untranslated (UTR) region, contains an open reading frame, encodes a 3' UTR and a poly A tail. The composition and length of the particular nucleic acid sequence of the in vitro transcription template depends on the mRNA encoded by the template.

[0195] "5' untranslated region" (UTR) refers to the region of an mRNA directly upstream (i.e., 5') from the start codon (i.e., the first codon of the mRNA transcript that is translated by the ribosome) that does not encode a polypeptide.

[0196] "3' untranslated region" (UTR) refers to the region of an mRNA immediately downstream (i.e., 3') from a stop codon (i.e., a codon in an mRNA transcript that signals the end of translation) that does not encode a polypeptide.

[0197] An "open reading frame" is a contiguous stretch of DNA that begins with a start codon (eg, methionine (ATG)), ends with a stop codon (eg, TAA, TAG, or TGA), and encodes a polypeptide.

[0198] A "poly-A tail" is a region of an mRNA downstream, e.g., directly downstream (i.e., 3') from the 3'UTR, that contains a number of consecutive adenosine monophosphates. A poly-A tail can contain 10-300 adenosine monophosphates. For example, a poly-A tail can contain 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, or 300 adenosine monophosphates. In some embodiments, a poly-A tail contains 50-250 adenosine monophosphates. In relevant biological environments (e.g., within a cell, in vivo), the poly(A) tail may function, for example, to protect the mRNA from enzymatic degradation in the cytoplasm and / or aid in transcription termination, transport of the mRNA from the nucleus, and translation.

[0199] In some embodiments, the polynucleotide comprises 200 to 3,000 nucleotides. For example, the polynucleotide may comprise 200 to 500, 200 to 1000, 200 to 1500, 200 to 3000, 500 to 1000, 500 to 1500, 500 to 2000, 500 to 3000, 1000 to 1500, 1000 to 2000, 1000 to 3000, 1500 to 3000, or 2000 to 3000 nucleotides.

[0200] Treatment method Compositions (e.g., pharmaceutical compositions), methods, kits and reagents for the prevention and / or treatment of RSV in humans and other animals are provided herein. RSV RNA (e.g., mRNA) vaccines can be used as therapeutic or prophylactic agents. They can be used as agents for the prevention and / or treatment of infectious diseases. In an exemplary embodiment, the RSV RNA vaccine of the present disclosure is used to provide prophylactic protection from RSV. Prophylactic protection from RSV can be achieved after administration of the RSV RNA vaccine of the present disclosure. The vaccine can be administered once, twice, three times, four times or more, although one administration of the vaccine (optionally followed by one booster) may be sufficient. Although less desirable, it is possible to administer the vaccine to an infected individual to achieve a therapeutic response. Dosages may need to be adjusted accordingly.

[0201] In an embodiment of the present invention, a method for eliciting an immune response against RSV in a subject is provided. The method involves administering to a subject an RSV RNA vaccine comprising at least one RNA polynucleotide having an open reading frame encoding at least one RSV antigenic polypeptide or an immunogenic fragment thereof, thereby inducing an immune response specific to the RSV antigenic polypeptide or an immunogenic fragment thereof in the subject, and the subject's anti-antigenic polypeptide antibody titer is increased after vaccination compared to the anti-antigenic polypeptide antibody titer of a subject vaccinated with a prophylactically effective dose of a conventional (e.g., non-nucleic acid) vaccine against RSV. An "anti-antigenic polypeptide antibody" is a serum antibody that specifically binds to an antigenic polypeptide.

[0202] A prophylactically effective dose is a therapeutically effective dose that prevents viral infection at a clinically acceptable level.In some embodiments, a therapeutically effective dose is the dose listed in the package insert of the vaccine.As used herein, conventional vaccine refers to a vaccine other than the mRNA vaccine of the present invention.For example, conventional vaccine includes, but is not limited to, live microbial vaccine, killed microbial vaccine, subunit vaccine, protein antigen vaccine, DNA vaccine, etc.

[0203] In some embodiments, the subject's anti-antigenic polypeptide antibody titer increases by 1 log to 10 log after vaccination compared to the anti-antigenic polypeptide antibody titer of a subject vaccinated with a prophylactically effective dose of a conventional vaccine against RSV.

[0204] In some embodiments, the subject's anti-antigenic polypeptide antibody titer increases by 1 log after vaccination compared to the anti-antigenic polypeptide antibody titer of a subject vaccinated with a prophylactically effective dose of a conventional vaccine against RSV.

[0205] In some embodiments, the subject's anti-antigenic polypeptide antibody titer increases by 2 logs after vaccination compared to the anti-antigenic polypeptide antibody titer of a subject vaccinated with a prophylactically effective dose of a conventional vaccine against RSV.

[0206] In some embodiments, the subject's anti-antigenic polypeptide antibody titer increases by 3 logs after vaccination compared to the anti-antigenic polypeptide antibody titer of a subject vaccinated with a prophylactically effective dose of a conventional vaccine against RSV.

[0207] In some embodiments, the subject's anti-antigenic polypeptide antibody titer increases by 5 logs following vaccination compared to the anti-antigenic polypeptide antibody titer of a subject vaccinated with a prophylactically effective dose of a conventional vaccine against RSV.

[0208] In some embodiments, the subject's anti-antigenic polypeptide antibody titer increases by 10 logs after vaccination compared to the anti-antigenic polypeptide antibody titer of a subject vaccinated with a prophylactically effective dose of a conventional vaccine against RSV.

[0209] In another embodiment of the present invention, a method of eliciting an immune response against RSV in a subject is provided, comprising administering to the subject an RSV RNA vaccine comprising at least one RNA polynucleotide having an open reading frame encoding at least one RSV antigenic polypeptide or immunogenic fragment thereof, thereby inducing in the subject an immune response specific to the RSV antigenic polypeptide or immunogenic fragment thereof, the immune response in the subject being equivalent to the immune response in a subject vaccinated with a conventional vaccine against RSV at a dose level between 2-100 times higher than that of the RNA vaccine.

[0210] In some embodiments, the subject's immune response is equivalent to the immune response of a subject vaccinated with a conventional vaccine at twice the dose level relative to the RSV RNA vaccine.

[0211] In some embodiments, the subject's immune response is equivalent to the immune response of a subject vaccinated with a conventional vaccine at a 3-fold dose level relative to the RSV RNA vaccine.

[0212] In some embodiments, the subject's immune response is equivalent to the immune response of a subject vaccinated with a conventional vaccine at a four-fold dose level relative to the RSV RNA vaccine.

[0213] In some embodiments, the subject's immune response is equivalent to the immune response of a subject vaccinated with a conventional vaccine at a 5-fold dose level relative to the RSV RNA vaccine.

[0214] In some embodiments, the subject's immune response is equivalent to the immune response of a subject vaccinated with a conventional vaccine at a 10-fold dose level relative to the RSV RNA vaccine.

[0215] In some embodiments, the subject's immune response is equivalent to the immune response of a subject vaccinated with a conventional vaccine at a 50-fold dose level relative to the RSV RNA vaccine.

[0216] In some embodiments, the subject's immune response is equivalent to the immune response of a subject vaccinated with a conventional vaccine at a 100-fold dose level relative to the RSV RNA vaccine.

[0217] In some embodiments, the subject's immune response is comparable to the immune response of a subject vaccinated with a conventional vaccine at a dose level 10-1000 times higher than the RSV RNA vaccine.

[0218] In some embodiments, the subject's immune response is comparable to the immune response of a subject vaccinated with a conventional vaccine at a dose level 100-1000 times higher than the RSV RNA vaccine.

[0219] In other embodiments, the immune response is assessed by determining the [protein] antibody titers in the subject.

[0220] In another aspect, the invention is a method of eliciting an immune response against RSV in a subject by administering to the subject an RSV RNA vaccine comprising at least one RNA polynucleotide having an open reading frame encoding at least one RSV antigenic polypeptide or immunogenic fragment thereof, thereby inducing an immune response in the subject specific to the RSV antigenic polypeptide or immunogenic fragment thereof, the immune response in the subject being induced 2 days to 10 weeks earlier than an immune response elicited in a subject vaccinated with a prophylactically effective dose of a conventional vaccine against RSV. In some embodiments, the immune response in the subject is induced in a subject vaccinated with a prophylactically effective dose of a conventional vaccine that is 2-fold to 100-fold higher than the RNA vaccine.

[0221] In some embodiments, an immune response in a subject is induced two days earlier than the immune response elicited in a subject vaccinated with a prophylactically effective dose of a conventional vaccine.

[0222] In some embodiments, an immune response in a subject is induced three days earlier than the immune response elicited in a subject vaccinated with a prophylactically effective dose of a conventional vaccine.

[0223] In some embodiments, an immune response in a subject is induced one week earlier than the immune response elicited in a subject vaccinated with a prophylactically effective dose of a conventional vaccine.

[0224] In some embodiments, an immune response in a subject is induced two weeks earlier than the immune response elicited in a subject vaccinated with a prophylactically effective dose of a conventional vaccine.

[0225] In some embodiments, an immune response in a subject is induced three weeks earlier than the immune response elicited in a subject vaccinated with a prophylactically effective dose of a conventional vaccine.

[0226] In some embodiments, an immune response in a subject is induced 5 weeks earlier than the immune response elicited in a subject vaccinated with a prophylactically effective dose of a conventional vaccine.

[0227] In some embodiments, an immune response in a subject is induced 10 weeks earlier than the immune response elicited in a subject vaccinated with a prophylactically effective dose of a conventional vaccine.

[0228] Broad-spectrum RSV vaccine Situations are envisioned where there is a risk of infection with two or more RSV strains. RNA (e.g., mRNA) therapeutic vaccines are particularly suited to a combination vaccine approach due to several factors, including but not limited to speed of production, ability to rapidly tailor vaccines to fit recognized geographic threats, etc. Furthermore, because the vaccine utilizes the human body to produce antigenic proteins, it is suitable for the production of larger, more complex antigenic proteins, which allows for proper folding, surface expression, antigen presentation, etc. in human subjects. To protect against two or more RSV strains, a combination vaccine can be administered that includes RNA encoding at least one antigenic polypeptide protein (or antigenic portion thereof) of a first RSV and further includes RNA encoding at least one antigenic polypeptide protein (or antigenic portion thereof) of a second RSV. The RNA (mRNA) can be formulated together, for example, in a single lipid nanoparticle (LNP) or in separate LNPs that are intended for co-administration.

[0229] Flagellin adjuvant Flagellin is a monomeric protein of about 500 amino acids that polymerizes to form flagella involved in bacterial movement. Flagellin is expressed by various flagellated bacteria (e.g., Salmonella typhimurium) and amastigotes (e.g., Escherichia coli). The sensing of flagellin by innate immune system cells (e.g., dendritic cells, macrophages) is mediated by Toll-like receptor 5 (TLR5) and Nod-like receptors (NLRs) Ipaf and Naip5. TLRs and NLRs have been identified as playing a role in activating innate and adaptive immune responses. Thus, flagellin provides an adjuvant effect in vaccines.

[0230] Nucleotide and amino acid sequences encoding known flagellin polypeptides are publicly available in the NCBI GenBank database, including flagellin sequences from S. Typhimurium, H. Pylori, V. Cholera, S. marcesens, S. flexneri, T. Pallidum, L. pneumophila, B. burgdorferei, C. difficile, R. meliloti, A. tumefaciens, R. lupini, B. clarridgeiae, P. Mirabilis, B. subtilus, L. monocytogenes, P. aeruginosa, and E. coli, among others.

[0231] Flagellin polypeptides, as used herein, refer to full-length flagellin proteins, immunogenic fragments thereof, and peptides having at least 50% sequence identity to a flagellin protein or an immunogenic fragment thereof. Exemplary flagellin proteins include flagellins from Salmonella typhi (UniPro entry number Q56086), Salmonella typhimurium (A0A0C9DG09), Salmonella enteritidis (A0A0C9BAB7), and Salmonella choleraesuis (Q6V2X8) and SEQ ID NOs: 173-175. In some embodiments, flagellin polypeptides have at least 60%, 70%, 75%, 80%, 90%, 95%, 97%, 98% or 99% sequence identity to a flagellin protein or an immunogenic fragment thereof.

[0232] In some embodiments, the flagellin polypeptide is an immunogenic fragment. An immunogenic fragment is a portion of a flagellin protein that elicits an immune response. In some embodiments, the immune response is a TLR5 immune response. An example of an immunogenic fragment is a flagellin protein in which all or part of the hinge region is deleted or replaced with other amino acids. For example, an antigenic polypeptide can be inserted into the hinge region. The hinge region is a hypervariable region of flagellin. The hinge region of flagellin is also referred to as a "D3 domain or region," a "propeller domain or region," a "hypervariable domain or region," and a "variable domain or region." "At least a portion of the hinge region," as used herein, refers to any portion of the hinge region of flagellin or the entire hinge region. In other embodiments, the immunogenic fragment of flagellin is a 20, 25, 30, 35, or 40 amino acid C-terminal fragment of flagellin.

[0233] The flagellin monomer is formed by domains D0-D3. The stems D0 and D1 are composed of long tandem alpha helices and are highly conserved among various bacteria. The D1 domain contains several amino acid stretches useful for TLR5 activation. The entire D1 domain or one or more of the active regions within the domain are immunogenic fragments of flagellin. Examples of immunogenic regions within the D1 domain include residues 88-114 and 411-431 of Salmonella typhimurium FliC flagellin. Of the 13 amino acids in the 88-100 region, at least 6 substitutions are possible between Salmonella flagellin and other flagellins that still retain TLR5 activation. Thus, immunogenic fragments of flagellin contain a flagellin-like sequence that activates TLR5 and contains a 13 amino acid motif that is 53% or more identical to the sequence of Salmonella FliC 88-100 (LQRVRELAVQSAN, SEQ ID NO: 286).

[0234] In some embodiments, an RNA (e.g., mRNA) vaccine comprises an RNA encoding a fusion protein of flagellin and one or more antigenic polypeptides. As used herein, "fusion protein" refers to the linkage of two components of a construct. In some embodiments, the carboxy terminus of an antigenic polypeptide is fused or linked to the amino terminus of a flagellin polypeptide. In other embodiments, the amino terminus of an antigenic polypeptide is fused or linked to the carboxy terminus of a flagellin polypeptide. A fusion protein can include, for example, 1, 2, 3, 4, 5, 6, or more flagellin polypeptides linked to 1, 2, 3, 4, 5, 6, or more antigenic polypeptides. When more than one flagellin polypeptide and / or more than one antigenic polypeptide is linked, such a construct may be referred to as a "multimer."

[0235] Each component of the fusion protein may be directly linked to each other or may be connected via a linker. For example, the linker may be an amino acid linker. The amino acid linker for linking the components of the fusion protein encoded by the RNA (e.g., mRNA) vaccine may include, for example, at least one element selected from the group consisting of a lysine residue, a glutamic acid residue, a serine residue, and an arginine residue. In some embodiments, the linker is 1 to 30, 1 to 25, 1 to 25, 5 to 10, 5, 15, or 5 to 20 amino acids in length.

[0236] In other embodiments, an RNA (e.g., mRNA) vaccine comprises at least two separate RNA polynucleotides, one encoding one or more antigenic polypeptides and the other encoding a flagellin polypeptide. The at least two RNA polynucleotides may be formulated together in a carrier, such as a lipid nanoparticle.

[0237] Therapeutic and Prophylactic Compositions For example, compositions (e.g., pharmaceutical compositions), methods, kits and reagents for the prevention, treatment and / or diagnosis of RSV in humans and other animals are provided herein. RSV RNA (e.g., mRNA) vaccines can be used as therapeutic or prophylactic agents. They can be used as agents for the prevention and / or treatment of infectious diseases. In some embodiments, the RSV vaccines of the present invention can be envisioned for use in priming immune effector cells, for example, by ex vivo activation of peripheral blood mononuclear cells (PBMCs) followed by infusion (reinfusion) into a subject.

[0238] In an exemplary embodiment, a RSV vaccine containing an RNA polynucleotide described herein can be administered to a subject (e.g., a mammalian subject, such as a human subject), and the RNA polynucleotide is translated in vivo to produce an antigenic polypeptide.

[0239] The RSV RNA vaccine can induce the translation of a polypeptide (e.g., an antigen or immunogen) in a cell, tissue, or organism. In an exemplary embodiment, such translation occurs in vivo, although embodiments in which such translation occurs ex vivo, in culture, or in vitro can also be envisioned. In an exemplary embodiment, a cell, tissue, or organism is contacted with an effective amount of a composition containing a RSV RNA vaccine that contains a polynucleotide having at least one translatable region that encodes an antigenic polypeptide.

[0240] An "effective amount" of an RSV RNA vaccine is provided based, at least in part, on the target tissue, the target cell type, the means of administration, the physical characteristics of the polynucleotide (e.g., size and degree of modified nucleosides) and other components of the RSV RNA vaccine, as well as other determinants. In general, an effective amount of an RSV RNA vaccine composition results in an induced or boosted immune response that correlates with antigen production in cells. In general, an effective amount of an RSV RNA vaccine containing an RNA polynucleotide with at least one chemical modification is preferably more effective than a composition containing a similar unmodified polynucleotide encoding the same antigen or peptide antigen. Increased antigen production can be indicated by increased cell transfection (percentage of cells transfected with the RNA vaccine), increased protein translation from the polynucleotide, decreased nucleic acid degradation (e.g., indicated by an increased protein translation period from the modified polynucleotide), or a change in the antigen-specific immune response of the host cell.

[0241] The term "pharmaceutical composition" refers to a combination of an active substance with an inert or active carrier, which makes the composition particularly suitable for diagnostic or therapeutic use in vivo or ex vivo. A "pharmaceutical acceptable carrier" does not cause undesired physiological effects after or upon administration to a subject. A carrier in a pharmaceutical composition must also be "acceptable" in the sense of being compatible with the active ingredient and capable of stabilizing the active ingredient. One or more solubilizing agents can be utilized as pharmaceutical carriers for delivery of the active substance. Examples of pharmaceutical acceptable carriers include, but are not limited to, biocompatible vehicles, adjuvants, additives and diluents that achieve a composition usable as a dosage form. Examples of other carriers include colloidal silicon oxide, magnesium stearate, cellulose and sodium lauryl sulfate. Further suitable pharmaceutical carriers and diluents and pharmaceutical requirements for their use are described in Remington's Pharmaceutical Sciences.

[0242] In some embodiments, RNA vaccines (including polynucleotides and their encoded polypeptides) according to the present disclosure can be used to treat or prevent RSV.

[0243] RSV RNA vaccines can be administered prophylactically or therapeutically to healthy individuals as part of an active immunization scheme, or early in infection during the incubation period or post-onset active infection. In some embodiments, the amount of the RNA vaccine of the present disclosure provided to a cell, tissue, or subject can be an amount effective for immunoprophylaxis.

[0244] RSV RNA (e.g., mRNA) vaccines can be administered with other prophylactic or therapeutic compounds. As a non-limiting example, a prophylactic or therapeutic compound can be an adjuvant or a booster. As used herein with respect to a prophylactic composition such as a vaccine, the term "booster" refers to an additional administration of a prophylactic (vaccine) composition. A booster (or booster vaccine) can be administered after a previous administration of a prophylactic composition. The time from the first administration of the prophylactic composition to the booster administration may be, but is not limited to, 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes, 7 minutes, 8 minutes, 9 minutes, 10 minutes, 15 minutes, 20 minutes, 35 minutes, 40 minutes, 45 minutes, 50 minutes, 55 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 36 hours, 2 days, 3 days, The period may be greater than 4 days, 5 days, 6 days, 1 week, 10 days, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 18 months, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, 11 years, 12 years, 13 years, 14 years, 15 years, 16 years, 17 years, 18 years, 19 years, 20 years, 25 years, 30 years, 35 years, 40 years, 45 years, 50 years, 55 years, 60 years, 65 years, 70 years, 75 years, 80 years, 85 years, 90 years, 95 years, or 99 years. In exemplary embodiments, the time from the first administration of the prophylactic composition to the booster administration may be, without limitation, 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 6 months, or 1 year.

[0245] In some embodiments, the RSV RNA vaccine can be administered intramuscularly, intranasally, or intradermally, similar to the administration of inactivated vaccines known in the art.

[0246] RSV RNA vaccines can be used in a variety of settings depending on the prevalence of infection or the degree or level of unmet medical need. As a non-limiting example, RNA vaccines can be used to treat and / or prevent a variety of infections. RNA vaccines often have superior properties in that they produce greater antibody titers and faster responses than commonly available antivirals.

[0247] Provided herein are pharmaceutical compositions comprising the RSV RNA vaccines and RNA vaccine compositions and / or complexes, optionally in combination with one or more pharma- ceutically acceptable excipients.

[0248] RSV RNA (e.g., mRNA) vaccines can be formulated or administered alone or with one or more other components. For example, RSV RNA vaccines (vaccine compositions) can include other components, including, but not limited to, adjuvants.

[0249] In some embodiments, the RSV RNA vaccine does not include an adjuvant (is adjuvant-free).

[0250] RSV RNA (e.g., mRNA) vaccines can be formulated or administered in combination with one or more pharma- ceutically acceptable excipients. In some embodiments, the vaccine composition includes at least one additional active agent, such as a therapeutically active agent, a prophylactically active agent, or a combination of both. The vaccine composition can be sterile, pyrogen-free, or both sterile and pyrogen-free. General considerations in the formulation and / or manufacture of pharmaceuticals, such as vaccine compositions, can be found, for example, in Remington: The Science and Practice of Pharmacy 21st ed., Lippincott Williams & Wilkins, 2005, which is incorporated herein by reference in its entirety.

[0251] In some embodiments, the RSV RNA vaccine is administered to a human, human patient or subject. For purposes of this disclosure, the term "active ingredient" generally refers to the RNA vaccine or polynucleotide contained therein, such as an RNA polynucleotide (e.g., an mRNA polynucleotide) that encodes an antigenic polypeptide.

[0252] Formulations of the vaccine compositions described herein can be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparation methods include the step of bringing into association an active ingredient (e.g., an mRNA polynucleotide) with an excipient and / or one or more other accessory ingredients, and then, as necessary and / or desirable, dividing, shaping and / or packaging the product into the desired single or multiple dose units.

[0253] The relative amounts of active ingredient, pharma- ceutically acceptable excipients and / or optional ingredients in a pharmaceutical composition according to the present disclosure may vary depending on the characteristics, size and / or condition of the subject being treated, as well as depending on the route by which the composition is administered. By way of example, the composition may comprise from 0.1% to 100%, e.g., from 0.5 to 50%, 1 to 30%, 5 to 80%, at least 80% (w / w) active ingredient.

[0254] RSV RNA vaccines can be formulated with one or more excipients that (1) enhance stability, (2) increase cell transfection, (3) allow sustained or delayed release (e.g., from a depot formulation), (4) alter biodistribution (e.g., targeting to a specific tissue or cell type), (5) increase in vivo translation of the encoded protein, and / or (6) alter the in vivo release profile of the encoded protein (antigen). Excipients can include, but are not limited to, lipidoids, liposomes, lipid nanoparticles, polymers, lipoplexes, core-shell nanoparticles, peptides, proteins, cells transfected with the RSV RNA vaccine (e.g., for implantation into a subject), hyaluronidase, nanoparticle mimics, and combinations thereof, in addition to any and all of the conventional excipients, such as solvents, dispersion media, diluents or other liquid vehicles, dispersion or suspension aids, surfactants, isotonicity agents, thickening or emulsifying agents, and preservatives.

[0255] stabilizing element Natural eukaryotic mRNA molecules are known to contain stabilizing elements, such as, but not limited to, an untranslated region (UTR) at its 5' end (5'UTR) and / or a UTR at its 3' end (3'UTR), in addition to other structural features, such as a 5' cap structure or a 3' poly(A) tail. Both the 5'UTR and the 3'UTR are typically transcribed from genomic DNA and are elements of the immature mRNA. The characteristic structural features of mature mRNA, such as the 5' cap and the 3' poly(A) tail, are usually added to the transcribed (immature) mRNA during mRNA processing. The 3' poly(A) tail is typically a stretch of adenine nucleotides added to the 3' end of the transcribed mRNA and may contain up to about 400 adenine nucleotides. In some embodiments, the length of the 3' poly(A) tail may be an essential element for the stability of an individual mRNA.

[0256] In some embodiments, the RNA vaccine may include one or more stabilizing elements. Stabilizing elements may include, for example, histone stem loops. A 32 kDa protein, stem loop binding protein (SLBP), has been identified. SLBP associates with histone stem loops at the 3' end of histone messages in both the nucleus and the cytoplasm. Its expression level is regulated by the cell cycle, peaking during S phase, when histone mRNA levels also increase. This protein has been found to be required for efficient 3' end processing of histone pre-mRNAs by U7 snRNP. SLBP continues to associate with stem loops after processing and then stimulates translation of mature histone mRNAs into histone proteins in the cytoplasm. The RNA binding domain of SLBP is conserved across metazoans and protozoans, and its binding to histone stem loops depends on the loop structure. The minimal binding site is at least three nucleotides 5' and two nucleotides 3' to the stem loop.

[0257] In some embodiments, the RNA vaccine comprises a coding region, at least one histone stem loop, and optionally a poly(A) sequence or polyadenylation signal. The poly(A) sequence or polyadenylation signal is generally intended to improve the expression level of the encoded protein. The encoded protein, in some embodiments, is not a histone protein, a reporter protein (e.g., luciferase, GFP, EGFP, β-galactosidase, EGFP), or a marker or selection protein (e.g., α-globin, galactokinase, and xanthine:guanine phosphoribosyltransferase (GPT)).

[0258] In some embodiments, the combination of a poly(A) sequence or a polyadenylation signal with at least one histone stem loop, both of which display alternative mechanisms in nature, act synergistically to increase protein expression above levels observed with either of the individual elements. The synergistic effect of the combination of poly(A) with at least one histone stem loop has been found to be independent of the order of the elements or the length of the poly(A) sequence.

[0259] In some embodiments, the RNA vaccine does not contain a histone downstream element (HDE). A "histone downstream element" (HDE) comprises a purine-rich polynucleotide stretch of about 15-20 nucleotides 3' to the natural stem-loop, which represents a binding site for U7 snRNA, which is involved in processing histone pre-mRNA into mature histone mRNA. In some embodiments, the nucleic acid does not contain an intron.

[0260] In some embodiments, the RNA vaccine may or may not contain enhancer and / or promoter sequences, which may be modified or unmodified, activated or inactivated. In some embodiments, the histone stem loop typically comprises an intramolecular base pairing of two adjacent partially or completely reverse-complementary sequences separated by a spacer consisting of a short sequence, which is derived from a histone gene and forms a loop of the structure. The unpaired loop region typically cannot base pair with any of the stem loop elements. This occurs more frequently in RNA, since it is a key component of many RNA secondary structures, but may also occur in single-stranded DNA as well. The stability of the stem loop structure typically depends on the length of the paired region, the number of mismatches or bulges, and the base composition. In some embodiments, wobble base pairing (non-Watson-Crick base pairing) may occur. In some embodiments, at least one histone stem loop sequence comprises a length of 15-45 nucleotides.

[0261] In other embodiments, the RNA vaccine can be removed one or more AU-rich sequences. These sequences are sometimes called AURES, and are destabilizing sequences found in 3'UTR. AURES can be removed from the RNA vaccine. Alternatively, AURES can be left in the RNA vaccine.

[0262] In some embodiments, the RNA polynucleotide does not comprise a stabilizing element.

[0263] Nanoparticle formation In some embodiments, the RSV RNA (e.g., mRNA) vaccine is formulated in a nanoparticle. In some embodiments, the RSV RNA vaccine is formulated in a lipid nanoparticle. In some embodiments, the RSV RNA vaccine is formulated in a lipid-polycation complex, referred to as a cationic lipid nanoparticle. The formation of lipid nanoparticles can be accomplished by methods known in the art and / or described in U.S. Patent Publication No. 20120178702, which is incorporated herein by reference in its entirety. By way of non-limiting example, the polycation can include a cationic peptide or polypeptide, including but not limited to polylysine, polyornithine and / or polyarginine, and the cationic peptides described in International Publication No. WO2012013326 or U.S. Patent Publication No. US20130142818, each of which is incorporated herein by reference in its entirety. In some embodiments, the RSV RNA vaccine is formulated in a lipid nanoparticle comprising a non-cationic lipid, such as, but not limited to, cholesterol or dioleoylphosphatidylethanolamine (DOPE).

[0264] Lipid nanoparticle formulations can be influenced by biophysical parameters, including but not limited to the selection of cationic lipid components, the degree of saturation of cationic lipids, the nature of PEGylation, the ratio of all components, and size.In one example by Semple et al. (Nature Biotech.2010 28:172-176, the entirety of which is incorporated herein by reference), lipid nanoparticle formulations are composed of 57.1% cationic lipid, 7.1% dipalmitoyl phosphatidylcholine, 34.3% cholesterol, and 1.4% PEG-c-DMA.As another example, it has been shown that varying the composition of cationic lipids allows siRNA to be delivered more efficiently to various antigen-presenting cells (Basha et al.Mol Ther.2011 19:2186-2200, the entirety of which is incorporated herein by reference).

[0265] In some embodiments, the lipid nanoparticle formulation may comprise 35-45% cationic lipid, 40-50% cationic lipid, 50-60% cationic lipid, and / or 55-65% cationic lipid. In some embodiments, the lipid to RNA (e.g., mRNA) ratio of the lipid nanoparticle may be 5:1 to 20:1, 10:1 to 25:1, 15:1 to 30:1, and / or at least 30:1.

[0266] In some embodiments, the ratio of PEG in the lipid nanoparticle formulation may be increased or decreased, and / or the carbon chain length of the PEG lipid may be changed from C14 to C18 to alter the pharmacokinetics and / or biodistribution of the lipid nanoparticle formulation. As a non-limiting example, the lipid nanoparticle formulation may contain a lipid molar ratio of 0.5%-3.0%, 1.0%-3.5%, 1.5%-4.0%, 2.0%-4.5%, 2.5%-5.0%, and / or 3.0%-6.0% PEG-c-DOMG (R-3-[(ω-methoxy-poly(ethylene glycol)2000)carbamoyl)]-1,2-dimyristyloxypropyl-3-amine) (also referred to herein as PEG-DOMG) relative to the cationic lipid, DSPC, and cholesterol. In some embodiments, PEG-c-DOMG may be replaced with a PEG lipid, such as, but not limited to, PEG-DSG (1,2-distearoyl-sn-glycerol, methoxypolyethylene glycol), PEG-DMG (1,2-dimyristoyl-sn-glycerol) and / or PEG-DPG (1,2-dipalmitoyl-sn-glycerol, methoxypolyethylene glycol). The cationic lipid may be selected from any lipid known in the art, such as, but not limited to, DLin-MC3-DMA, DLin-DMA, C12-200 and DLin-KC2-DMA (see, e.g., U.S. Patent Publication No. 20130245107A1).

[0267] In some embodiments, the RSV RNA (e.g., mRNA) vaccine formulation is a nanoparticle comprising at least one lipid. The lipid can be selected from, but is not limited to, DLin-DMA, DLin-K-DMA, 98N12-5, C12-200, DLin-MC3-DMA, DLin-KC2-DMA, DODMA, PLGA, PEG, PEG-DMG, PEGylated lipids, and aminoalcohol lipids. In some embodiments, the lipid can be a cationic lipid, such as, but not limited to, DLin-DMA, DLin-D-DMA, DLin-MC3-DMA, DLin-KC2-DMA, DODMA, and aminoalcohol lipids. The aminoalcohol cationic lipid can be a lipid described in U.S. Patent Application Publication No. US20130150625 (incorporated herein by reference in its entirety) and / or can be made by the methods described therein. As non-limiting examples, cationic lipids include 2-amino-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-2-{[(9Z,2Z)-octadeca-9,12-dien-1-yloxy]methyl}propan-1-ol (compound 1 of US20130150625), 2-amino-3-[(9Z)-octadec-9-en-1-yloxy]-2-{[(9Z)-octadec-9-en-1-yloxy]methyl}propan-1-ol (compound 2 of US20130150625), 2-amino-3-[ (9Z,12Z)-octadeca-9,12-dien-1-yloxy]-2-[(octyloxy)methyl]propan-1-ol (compound 3 of US20130150625), and 2-(dimethylamino)-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]-2-{[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]methyl}propan-1-ol (compound 4 of US20130150625), or any pharma- ceutically acceptable salt or stereoisomer thereof.

[0268] Lipid nanoparticle formulations typically contain lipids, in particular ionic cationic lipids, such as 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), (12Z,15Z)-N,N-dimethyl-2-nonylhenicosa-12,15-dien-1-amine (L608), or N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]heptadecan-8-amine (L530), and further contain sterols of neutral lipids and molecules capable of reducing particle aggregation, such as PEG lipids or PEG-modified lipids.

[0269] In some embodiments, the lipid nanoparticle formulation comprises: (i) 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), Dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), Di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), (12Z,15Z)-N,N-Dimethyl-2-nonylhenicosa-12,15-dien-1-amine (L608), and N,N (ii) at least one lipid selected from the group consisting of DSPC, DPPC, POPC, DOPE and SM; (iii) a sterol, e.g., cholesterol; and (iv) a PEG lipid, e.g., PEG-DMG or PEG-cDMA, in a molar ratio of 20-60% cationic lipid: 5-25% neutral lipid: 25-55% sterol: 0.5-15% PEG lipid.

[0270] In some embodiments, the lipid nanoparticle formulation comprises 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), (12 The cationic lipid selected from the group consisting of N,N-dimethyl-2-nonylhenicosa-12,15-dien-1-amine (L608) and N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]heptadecan-8-amine (L530) is contained at 25% to 75% on a molar basis, for example, 35 to 65%, 45 to 65%, 60%, 57.5%, 50% or 40% on a molar basis.

[0271] In some embodiments, the lipid nanoparticle formulation comprises 0.5%-15% on a molar basis, e.g., 3-12%, 5-10%, or 15%, 10%, or 7.5% on a molar basis of a neutral lipid. Examples of neutral lipids include, but are not limited to, DSPC, POPC, DPPC, DOPE, and SM. In some embodiments, the formulation comprises 5%-50% on a molar basis of a sterol (e.g., 15-45%, 20-40%, 40%, 38.5%, 35%, or 31% on a molar basis). A non-limiting example of a sterol is cholesterol. In some embodiments, the lipid nanoparticle formulation comprises 0.5%-20% on a molar basis (e.g., 0.5-10%, 0.5-5%, 1.5%, 0.5%, 1.5%, 3.5%, or 5% on a molar basis) of a PEG lipid or a PEG-modified lipid. In some embodiments, the PEG lipid or PEG-modified lipid comprises PEG molecules having an average molecular weight of 2,000 Da. In some embodiments, the PEG lipid or PEG-modified lipid comprises PEG molecules having an average molecular weight of less than 2,000, e.g., about 1,500 Da, about 1,000 Da, or about 500 Da. Non-limiting examples of PEG-modified lipids include PEG-distearoylglycerol (PEG-DMG) (also referred to herein as PEG-C14 or C14-PEG), PEG-cDMA (further discussed in Reyes et al. J. Controlled Release, 107, 276-287 (2005), the entire contents of which are incorporated herein by reference).

[0272] In some embodiments, the lipid nanoparticle formulation comprises, on a molar basis, 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), (1 The lipid composition contains 25 to 75% cationic lipid selected from the group consisting of (2Z,15Z)-N,N-dimethyl-2-nonylhenicosa-12,15-dien-1-amine (L608) and N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]heptadecan-8-amine (L530), 0.5 to 15% neutral lipid, 5 to 50% sterol, and 0.5 to 20% PEG lipid or PEG-modified lipid.

[0273] In some embodiments, the lipid nanoparticle formulation comprises, on a molar basis, 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), (1 The lipid composition contains 35-65% cationic lipid selected from the group consisting of (2Z,15Z)-N,N-dimethyl-2-nonylhenicosa-12,15-dien-1-amine (L608) and N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]heptadecan-8-amine (L530), 3-12% neutral lipid, 15-45% sterol, and 0.5-10% PEG lipid or PEG-modified lipid.

[0274] In some embodiments, the lipid nanoparticle formulation comprises, on a molar basis, 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), (1 The lipid composition contains 45-65% cationic lipid selected from the group consisting of (2Z,15Z)-N,N-dimethyl-2-nonylhenicosa-12,15-dien-1-amine (L608) and N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]heptadecan-8-amine (L530), 5-10% neutral lipid, 25-40% sterol, and 0.5-10% PEG lipid or PEG-modified lipid.

[0275] In some embodiments, the lipid nanoparticle formulation comprises, on a molar basis, 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L31 9), (12Z,15Z)-N,N-dimethyl-2-nonylhenicosa-12,15-dien-1-amine (L608) and N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]heptadecan-8-amine (L530), 60% cationic lipid selected from the group consisting of, 7.5% neutral lipid, 31% sterol, and 1.5% PEG lipid or PEG-modified lipid.

[0276] In some embodiments, the lipid nanoparticle formulation comprises, on a molar basis, 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L31 9), (12Z,15Z)-N,N-dimethyl-2-nonylhenicosa-12,15-dien-1-amine (L608) and N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]heptadecan-8-amine (L530), 50% cationic lipid selected from the group consisting of, 10% neutral lipid, 38.5% sterol, and 1.5% PEG lipid or PEG-modified lipid.

[0277] In some embodiments, the lipid nanoparticle formulation comprises, on a molar basis, 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), (12Z, 50% cationic lipid selected from the group consisting of 15Z)-N,N-dimethyl-2-nonylhenicosa-12,15-dien-1-amine (L608) and N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]heptadecan-8-amine (L530), 10% neutral lipid, 35% sterol, 4.5% or 5% PEG lipid or PEG-modified lipid, and 0.5% targeting lipid.

[0278] In some embodiments, the lipid nanoparticle formulation comprises, on a molar basis, 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate ... 319), (12Z,15Z)-N,N-dimethyl-2-nonylhenicosa-12,15-dien-1-amine (L608) and N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]heptadecan-8-amine (L530), 40% cationic lipid selected from the group consisting of, 15% neutral lipid, 40% sterol, and 5% PEG lipid or PEG-modified lipid.

[0279] In some embodiments, the lipid nanoparticle formulation comprises, on a molar basis, 2,2-Dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), Dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), Di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319). , (12Z,15Z)-N,N-dimethyl-2-nonylhenicosa-12,15-dien-1-amine (L608) and N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]heptadecan-8-amine (L530), 7.1% neutral lipid, 34.3% sterol, and 1.4% PEG lipid or PEG-modified lipid.

[0280] In some embodiments, the lipid nanoparticle formulation comprises, on a molar basis, 57.5% cationic lipid selected from PEG lipid, PEG-cDMA (PEG-cDMA is further discussed in Reyes et al. (J. Controlled Release, 107, 276-287 (2005), the entire contents of which are incorporated herein by reference), 7.5% neutral lipid, 31.5% sterol, and 3.5% PEG lipid or PEG-modified lipid.

[0281] In some embodiments, the lipid nanoparticle formulation consists essentially of a lipid mixture in a molar ratio of 20-70% cationic lipid: 5-45% neutral lipid: 20-55% cholesterol: 0.5-15% PEG-modified lipid. In some embodiments, the lipid nanoparticle formulation consists essentially of a lipid mixture in a molar ratio of 20-60% cationic lipid: 5-25% neutral lipid: 25-55% cholesterol: 0.5-15% PEG-modified lipid.

[0282] In some embodiments, the lipid molar ratio is 50 / 10 / 38.5 / 1.5 (mol% cationic lipid / neutral lipid (e.g., DSPC) / Chol / PEG-modified lipid (e.g., PEG-DMG, PEG-DSG, or PEG-DPG)), 57.2 / 7.1134.3 / 1.4 (mol% cationic lipid / neutral lipid (e.g., DPPC) / Chol / PEG-modified lipid (e.g., PEG-cDMA)), 40 / 15 / 40 / 5 (mol% cationic lipid / neutral lipid (e.g., DSPC) / Chol / PEG-modified lipid (e.g., PEG-DMG)), 50 / 10 / 35 / 4.5 / 0.5 (mol% cationic lipid / neutral lipid (e.g. DSPC) / Chol / PEG-modified lipid (e.g. PEG-DSG)), 50 / 10 / 35 / 5 (cationic lipid / neutral lipid (e.g. DSPC) / Chol / PEG-modified lipid (e.g. PEG-DMG)), 40 / 10 / 40 / 10 (mol% cationic lipid / neutral lipid (e.g. DSPC) / Chol / PEG-modified lipid (e.g. PEG-DMG or PEG-cDMA)), 35 / 15 / 40 / 10 (mol% cationic lipid / neutral lipid (e.g. DSPC) / Chol / PEG-modified lipid (e.g. PEG-DMG or PEG-cDMA)), or 52 / 13 / 30 / 5 (mol% cationic lipid / neutral lipid (e.g. DSPC) / Chol / PEG-modified lipid (e.g. PEG-DMG or PEG-cDMA).

[0283] Non-limiting examples of lipid nanoparticle compositions and methods for making the same are described, for example, in Semple et al. (2010) Nat. Biotechnol. 28:172-176; Jayarama et al. (2012), Angew. Chem. Int. Ed., 51:8529-8533, and Maier et al. (2013) Molecular Therapy 21, 1570-1578, the contents of each of which are incorporated by reference in their entirety.

[0284] In some embodiments, the lipid nanoparticle formulation may include cationic lipids, PEG lipids, and structured lipids, and may optionally include non-cationic lipids. As a non-limiting example, the lipid nanoparticles may include 40-60% cationic lipids, 5-15% non-cationic lipids, 1-2% PEG lipids, and 30-50% structured lipids. As another non-limiting example, the lipid nanoparticles may include 50% cationic lipids, 10% non-cationic lipids, 1.5% PEG lipids, and 38.5% structured lipids. As yet another non-limiting example, the lipid nanoparticles may include 55% cationic lipids, 10% non-cationic lipids, 2.5% PEG lipids, and 32.5% structured lipids. In some embodiments, the cationic lipid may be any cationic lipid described herein, including, but not limited to, DLin-KC2-DMA, DLin-MC3-DMA, L319, L608, and L520.

[0285] In some embodiments, the lipid nanoparticle formulations described herein may be four-component lipid nanoparticles. The lipid nanoparticles may include cationic lipids, non-cationic lipids, PEG lipids, and structured lipids. As a non-limiting example, the lipid nanoparticles may include 40-60% cationic lipids, 5-15% non-cationic lipids, 1-2% PEG lipids, and 30-50% structured lipids. As another non-limiting example, the lipid nanoparticles may include 50% cationic lipids, 10% non-cationic lipids, 1.5% PEG lipids, and 38.5% structured lipids. As yet another non-limiting example, the lipid nanoparticles may include 55% cationic lipids, 10% non-cationic lipids, 2.5% PEG lipids, and 32.5% structured lipids. In some embodiments, the cationic lipid can be any cationic lipid described herein, including, but not limited to, DLin-KC2-DMA, DLin-MC3-DMA, L319, L608, and L520.

[0286] In some embodiments, the lipid nanoparticle formulations described herein may include cationic lipids, non-cationic lipids, PEG lipids, and structural lipids. As a non-limiting example, the lipid nanoparticles include 50% cationic lipid DLin-KC2-DMA, 10% non-cationic lipid DSPC, 1.5% PEG lipid PEG-DOMG, and 38.5% structural lipid cholesterol. As a non-limiting example, the lipid nanoparticles include 50% cationic lipid DLin-MC3-DMA, 10% non-cationic lipid DSPC, 1.5% PEG lipid PEG-DOMG, and 38.5% structural lipid cholesterol. As a non-limiting example, the lipid nanoparticles include 50% cationic lipid DLin-MC3-DMA, 10% non-cationic lipid DSPC, 1.5% PEG lipid PEG-DMG, and 38.5% structural lipid cholesterol. As yet another non-limiting example, the lipid nanoparticles can comprise 55% cationic lipid L319, L608 or L520, 10% non-cationic lipid DSPC, 2.5% PEG lipid PEG-DMG, and 32.5% structural lipid cholesterol.

[0287] The relative amounts of active ingredient, pharma- ceutically acceptable excipients and / or optional components in a vaccine composition may vary depending on the identity, size and / or condition of the subject being treated, as well as the route by which the composition is administered. For example, the composition may contain 0.1%-99% (w / w) active ingredient. By way of example, the composition may contain 0.1%-100%, e.g., 0.5-50%, 1-30%, 5-80%, at least 80% (w / w) active ingredient.

[0288] In some embodiments, an RNA vaccine composition may include a polynucleotide as described herein and is formulated in lipid nanoparticles comprising DLin-MC3-DMA, cholesterol, DSPC, PEG2000-DMG, trisodium citrate buffer, sucrose, and water for injection. As a non-limiting example, the composition includes 2.0 mg / mL of a drug substance (e.g., a polynucleotide encoding RSV), 21.8 mg / mL of MC3, 10.1 mg / mL of cholesterol, 5.4 mg / mL of DSPC, 2.7 mg / mL of PEG2000-DMG, 5.16 mg / mL of trisodium citrate, 71 mg / mL of sucrose, and 1.0 mL of water for injection.

[0289] In some embodiments, the nanoparticles (e.g., lipid nanoparticles) have an average diameter of 10-500 nm, 20-400 nm, 30-300 nm, 40-200 nm, In some embodiments, the nanoparticles (e.g., lipid nanoparticles) have an average diameter of 50-150 nm, 50-200 nm, 80-100 nm, or 80-200 nm.

[0290] Liposomes, lipoplexes and lipid nanoparticles In some embodiments, the RNA vaccine pharmaceutical composition may be formulated in liposomes, such as, but not limited to, DiLa2 liposomes (Marina Biotech, Bothell, WA), SMARTICLES® (Marina Biotech, Bothell, WA), neutral DOPC (1,2-dioleoyl-sn-glycero-3-phosphocholine)-based liposomes (e.g., siRNA delivery for ovarian cancer (Landen et al. Cancer Biology & Therapy 2006 5(12)1708-1713), incorporated herein by reference in its entirety), and hyaluronan-coated liposomes (Quiet Therapeutics, Israel).

[0291] In some embodiments, RNA vaccines may be formulated in lyophilized gel-phase liposome compositions as described in U.S. Patent Application Publication No. US2012060293, which is incorporated by reference in its entirety.

[0292] Nanoparticle formulations can include phosphate conjugates.Phosphate conjugates can increase in vivo circulation time and / or enhance the targeted delivery of nanoparticles.The phosphate conjugates used in the present invention can be made by the method described in WO2013033438 or US Patent Publication No. US20130196948 (each of which is incorporated herein by reference in its entirety).As a non-limiting example, the phosphate conjugate can include any one of the compounds of formulas described in International Publication No. WO2013033438 (each of which is incorporated herein by reference in its entirety).

[0293] The nanoparticle formulation may include a polymer conjugate. The polymer conjugate may be a water-soluble conjugate. The polymer conjugate may have a structure described in US Patent Publication No. 20130059360 (the entire contents of which are incorporated herein by reference). In some embodiments, the polymer conjugate with the polynucleotide of the present invention can be prepared using the methods and / or segmented polymer reagents described in US Patent Publication No. 20130072709 (the entire contents of which are incorporated herein by reference). In other embodiments, the polymer conjugate may have a pendant side group that includes a ring moiety, such as, but not limited to, the polymer conjugate described in US Patent Publication No. US20130196948 (the entire contents of which are incorporated herein by reference).

[0294] The nanoparticle formulation may include a conjugate that improves the delivery of the nanoparticles of the present invention in a subject. Furthermore, the conjugate may inhibit the phagocytic clearance of the nanoparticles in a subject. In some embodiments, the conjugate may be a "self" peptide designed from the human membrane protein CD47 (e.g., the "self" particle described by Rodriguez et al. (Science 2013, 339, 971-975, incorporated herein by reference in its entirety). As shown by Rodriguez et al., the self peptide delayed macrophage-mediated clearance of nanoparticles and improved nanoparticle delivery. In other embodiments, the conjugate may be the membrane protein CD47 (see, e.g., Rodriguez et al. Science 2013, 339, 971-975, incorporated herein by reference in its entirety). Rodriguez et al. showed that CD47, like the "self" peptide, can increase the proportion of circulating particles in a subject compared to scrambled peptides and PEG-coated nanoparticles.

[0295] In some embodiments, the RNA vaccine of the present invention is formulated in a nanoparticle that includes a conjugate that enhances the delivery of the nanoparticle of the present invention in a subject. The conjugate may be a CD47 membrane, or the conjugate may be derived from the CD47 membrane protein, such as the "self" peptide described above. In other embodiments, the nanoparticle may include a conjugate of PEG and CD47 or a derivative thereof. In yet other embodiments, the nanoparticle may include both the above-mentioned "self" peptide and the membrane protein CD47.

[0296] In some embodiments, the "self" peptide and / or CD47 protein may be conjugated to a virus-like particle or pseudovirion, as described herein, for delivery of the RNA vaccines of the present invention.

[0297] In another embodiment, the RNA vaccine pharmaceutical composition comprises a polynucleotide of the present invention and a conjugate that can have a degradable bond.Non-limiting examples of conjugates include aromatic moieties that contain ionic hydrogen atoms, spacer moieties, and water-soluble polymers.Non-limiting examples include pharmaceutical compositions that include conjugates that have degradable bonds and methods for delivering the pharmaceutical compositions are described in US Patent Application Publication No. US20130184443, the entire contents of which are incorporated herein by reference.

[0298] The nanoparticle formulation can be a carbohydrate nanoparticle comprising a carbohydrate carrier and an RNA vaccine. Non-limiting examples of carbohydrate carriers include, but are not limited to, anhydrous modified phytoglycogen or glycogen-type substances, phytoglycogen octenyl succinate, phytoglycogen β-dextrin, anhydrous modified phytoglycogen β-dextrin (see, for example, International Publication No. WO2012109121, the entire contents of which are incorporated herein by reference).

[0299] The nanoparticle formulation of the present invention may be coated with a surfactant or polymer to improve particle delivery. In some embodiments, the nanoparticle may be coated with a hydrophilic coating, such as, but not limited to, a PEG coating and / or a coating with a neutral surface charge. A hydrophilic coating may be useful for delivering nanoparticles containing large payloads, such as, but not limited to, RNA vaccines, into the central nervous system. As a non-limiting example, nanoparticles containing hydrophilic coatings and methods for making such nanoparticles are described in U.S. Patent Application Publication No. US20130183244, the entire contents of which are incorporated herein by reference.

[0300] In some embodiments, the lipid nanoparticles of the present invention can be hydrophilic polymer particles. Non-limiting examples of hydrophilic polymer particles and methods for making hydrophilic polymer particles are described in U.S. Patent Application Publication No. US20130210991, the entire contents of which are incorporated herein by reference.

[0301] In other embodiments, the lipid nanoparticles of the present invention may be hydrophobic polymer particles.

[0302] Lipid nanoparticle formulations can be improved by replacing cationic lipids with biodegradable cationic lipids known as rapidly cleared lipid nanoparticles (reLNPs). Ionic cationic lipids, such as but not limited to DLinDMA, DLin-KC2-DMA, and DLin-MC3-DMA, have been shown to accumulate in plasma and tissues over time and can be potential toxicogens. Rapid metabolism of rapidly cleared lipids can improve the tolerability and therapeutic index of lipid nanoparticles in rats at doses as high as 1 mg / kg to 10 mg / kg. Inclusion of enzymatically degradable ester bonds can improve the degradation and metabolic profile of the cationic components while maintaining activity of the reLNP formulation. The ester bonds can be internal in the lipid chain or terminally located at the end of the lipid chain. An internal ester bond can replace any carbon in the lipid chain.

[0303] In some embodiments, the internal ester bond may be located on either side of a saturated carbon.

[0304] In some embodiments, an immune response can be elicited by delivering lipid nanoparticles that can include nanospecies, polymers and immunogens (US Patent Publication No. 20120189700 and International Publication No. WO2012099805, each of which is incorporated by reference in its entirety herein).

[0305] The polymer may encapsulate or partially encapsulate the nanospecies. The immunogen may be a recombinant protein, modified RNA and / or a polynucleotide as described herein. In some embodiments, the lipid nanoparticles may be formulated for use in a vaccine, including but not limited to, a vaccine against a pathogen.

[0306] Lipid nanoparticles may be modified by engineering the surface properties of the particles to allow the lipid nanoparticles to cross mucosal barriers. Mucus is located in mucosal tissues, including, but not limited to, the oral cavity (e.g., buccal and esophageal membranes and tonsil tissues), eyes, digestive tract (e.g., stomach, small intestine, large intestine, colon, rectum), nose, respiratory tract (e.g., membranes of nose, pharynx, trachea and bronchi), and reproductive tract (e.g., membranes of vagina, cervix and urethra). Nanoparticles larger than 10-200 nm are preferred for their high drug encapsulation efficiency and ability to provide sustained delivery of a wide range of drugs, but are considered too large to diffuse rapidly through mucosal barriers. Mucus is continuously secreted, excreted, discarded or digested, and recycled, so the majority of trapped particles can be removed from mucosal tissues within seconds or hours. Large polymeric nanoparticles (200 nm to 500 nm in diameter) densely coated with low molecular weight polyethylene glycol (PEG) diffused through mucus only 4 to 6 times slower than the same particles diffusing in water (Lai et al. PNAS 2007 104(5):1482-487; Lai et al. Adv Drug Deliv Rev. 2009 61(2):158-171, each of which is incorporated herein by reference in its entirety). Nanoparticle transport can be determined using translocation velocity and / or fluorescence microscopy, including, but not limited to, fluorescence recovery after photobleaching (FRAP) and high-resolution multiple particle tracking (MPT). As a non-limiting example, compositions capable of crossing mucosal barriers can be made as described in U.S. Pat. No. 8,241,670 or International Publication No. WO2013110028, each of which is incorporated herein by reference in its entirety.

[0307] Lipid nanoparticles engineered to pass through mucus may include polymeric materials (e.g., polymer cores) and / or polymer-vitamin conjugates and / or triblock copolymers. Polymeric materials may include, but are not limited to, polyamines, polyethers, polyamides, polyesters, polycarbamates, polyureas, polycarbonates, poly(styrenes), polyimides, polysulfones, polyurethanes, polyacetylenes, polyethylenes, polyethyleneimines, polyisocyanates, polyacrylates, polymethacrylates, polyacrylonitriles, and polyarylates. The polymeric materials may be biodegradable and / or biocompatible. Non-limiting examples of biocompatible polymers are described in International Publication No. WO2013116804, the contents of which are incorporated herein by reference in their entirety. The polymeric materials may also be irradiated. As a non-limiting example, the polymeric materials may be gamma irradiated (see, e.g., International Publication No. WO201282165, the contents of which are incorporated herein by reference in their entirety). Non-limiting examples of specific polymers include poly(caprolactone) (PCL), ethylene vinyl acetate polymer (EVA), poly(lactic acid) (PLA), poly(L-lactic acid) (PLLA), poly(glycolic acid) (PGA), poly(lactic acid-co-glycolic acid) (PLGA), poly(L-lactic acid-co-glycolic acid) (PLLGA), poly(D,L-lactide) (PDLA), poly(L-lactide) (PLLA), poly(D,L-lactide-co-caprolactone), poly(D,L-lactide-co-caprolactone-co-glycolide), poly(D,L-lactide-co-PEO-co- ... poly(D,L-lactide), poly(D,L-lactide-co-PPO-co-D,L-lactide), polyalkyl cyanoacrylates, polyurethanes, poly-L-lysine (PLL), hydroxypropyl methacrylate (HPMA), polyethylene glycol, poly-L-glutamic acid, poly(hydroxy acids), polyanhydrides, polyorthoesters, poly(ester amides), polyamides, poly(ester ethers), polycarbonates, polyalkylenes such as polyethylene and polypropylene, polyalkylene glycols such as poly(ethylene glycol) (PEG), polyalkylene oxides (PEO),Polyalkylene terephthalates such as poly(ethylene terephthalate), polyvinyl alcohol (PVA), polyvinyl ethers, polyvinyl esters such as poly(vinyl acetate), polyvinyl halides such as poly(vinyl chloride) (PVC), polyvinylpyrrolidone, polysiloxanes, polystyrene (PS), polyurethanes, derivatized celluloses such as alkyl celluloses, hydroxyalkyl celluloses, cellulose ethers, cellulose esters, nitrocellulose, hydroxypropyl cellulose, carboxymethyl cellulose, polymers of acrylic acid such as poly(methyl(meth)acrylate) (PMMA), poly(ethyl(meth)acrylate), poly(butyl(meth)acrylate), poly( poly(isobutyl (meth)acrylate), poly(hexyl (meth)acrylate), poly(isodecyl (meth)acrylate), poly(lauryl (meth)acrylate), poly(phenyl (meth)acrylate), poly(methyl acrylate), poly(isopropyl acrylate), poly(isobutyl acrylate), poly(octadecyl acrylate) and copolymers and mixtures thereof, polydioxanone and its copolymers, polyhydroxyalkanoates, polypropylene fumarate, polyoxymethylene, poloxamer, poly(ortho)esters, poly(butyric acid), poly(valeric acid), poly(lactide-co-caprolactone), PEG-PLGA-PEG, and trimethylene carbonate, polyvinylpyrrolidone. The lipid nanoparticles may be coated with or associated with copolymers, such as, but not limited to, block copolymers (such as the branched polyether-polyamide block copolymers described in International Publication No. WO2013012476, which is incorporated by reference in its entirety) and (poly(ethylene glycol))-(poly(propylene oxide))-(poly(ethylene glycol)) triblock copolymers (see, e.g., U.S. Patent Application Publication No. 20120121718, U.S. Patent Application Publication No. 20100003337, and U.S. Patent No. 8,263,665, each of which is incorporated by reference in its entirety). The copolymer may be a GRAS (Generally Recognized As Safe) polymer, and the formation of the lipid nanoparticles may be achieved by:The lipid nanoparticles can be made in such a way that no new chemical entities are generated. For example, the lipid nanoparticles can include poloxamer-coated PLGA nanoparticles, which can still pass through human mucus quickly without forming new chemical entities (Yang et al. Angew. Chem. Int. Ed. 2011 50:25972600, the entire contents of which are incorporated herein by reference). A non-limiting, scalable method for generating nanoparticles that can pass through human mucus is described by Xu et al. (see, for example, J Control Release 2013,170(2):279-86, the entire contents of which are incorporated herein by reference).

[0308] The vitamin of the polymer-vitamin conjugate can be vitamin E. The vitamin portion of the conjugate can be substituted with other suitable moieties, such as, but not limited to, vitamin A, vitamin E, other vitamins, cholesterol, hydrophobic moieties or hydrophobic components of other surfactants (e.g., sterol chains, fatty acids, hydrocarbon chains, and alkylene oxide chains).

[0309] In some embodiments, the RNA (e.g., mRNA) vaccine pharmaceutical composition may be formulated in liposomes, such as, but not limited to, DiLa2 liposomes (Marina Biotech, Bothell, WA), SMARTICLES® (Marina Biotech, Bothell, WA), neutral DOPC (1,2-dioleoyl-sn-glycero-3-phosphocholine)-based liposomes (e.g., siRNA delivery for ovarian cancer (Landen et al. Cancer Biology & Therapy 2006 5(12)1708-1713, incorporated herein by reference in its entirety)), and hyaluronan-coated liposomes (Quiet Therapeutics, Israel).

[0310] In some embodiments, RNA vaccines may be formulated in lyophilized gel-phase liposome compositions as described in U.S. Patent Application Publication No. US2012060293, which is incorporated by reference in its entirety.

[0311] Nanoparticle formulations can include phosphate conjugates.Phosphate conjugates can increase in vivo circulation time and / or increase the targeted delivery of nanoparticles.The phosphate conjugates used in the present invention can be made by the method described in WO2013033438 or US Patent Publication No. 20130196948 (each of which is incorporated herein by reference in its entirety).As a non-limiting example, the phosphate conjugate can include any one of the compounds of formulas described in International Publication No. WO2013033438 (each of which is incorporated herein by reference in its entirety).

[0312] The nanoparticle formulation may include a polymer conjugate. The polymer conjugate may be a water-soluble conjugate. The polymer conjugate may have a structure described in US Patent Publication No. 20130059360 (the entire contents of which are incorporated herein by reference). In some embodiments, the polymer conjugate with the polynucleotide of the present invention can be prepared using the methods and / or segmented polymer reagents described in US Patent Publication No. 20130072709 (the entire contents of which are incorporated herein by reference). In other embodiments, the polymer conjugate may have a pendant side group that includes a ring moiety, such as, but not limited to, the polymer conjugate described in US Patent Publication No. US20130196948 (the entire contents of which are incorporated herein by reference).

[0313] The nanoparticle formulation may include a conjugate that improves the delivery of the nanoparticles of the present invention in a subject. Furthermore, the conjugate may inhibit the phagocytic clearance of the nanoparticles in a subject. In some embodiments, the conjugate may be a "self" peptide designed from the human membrane protein CD47 (e.g., the "self" particle described by Rodriguez et al. (Science 2013, 339, 971-975, incorporated herein by reference in its entirety). As shown by Rodriguez et al., the self peptide delayed macrophage-mediated clearance of nanoparticles and improved nanoparticle delivery. In other embodiments, the conjugate may be the membrane protein CD47 (see, e.g., Rodriguez et al. Science 2013, 339, 971-975, incorporated herein by reference in its entirety). Rodriguez et al. showed that CD47, like the "self" peptide, can increase the proportion of circulating particles in a subject compared to scrambled peptides and PEG-coated nanoparticles.

[0314] In some embodiments, the RNA vaccine of the present invention is formulated in nanoparticles that contain a conjugate that improves the delivery of the nanoparticles of the present disclosure in a subject. The conjugate may be a CD47 membrane, or the conjugate may be derived from the CD47 membrane protein, such as the "self" peptide described above. In other aspects, the nanoparticles may contain PEG and a conjugate of CD47 or a derivative thereof. In yet other aspects, the nanoparticles may contain both the above-mentioned "self" peptide and the membrane protein CD47.

[0315] In other embodiments, the "self" peptide and / or CD47 protein may be conjugated to a virus-like particle or pseudovirion, as described herein, for delivery of the RNA vaccines of the present invention.

[0316] In another embodiment, the RNA vaccine pharmaceutical composition comprises a polynucleotide of the present invention and a conjugate that can have a degradable bond.Non-limiting examples of conjugates include aromatic moieties that contain ionic hydrogen atoms, spacer moieties, and water-soluble polymers.Non-limiting examples include pharmaceutical compositions that include conjugates that have degradable bonds and methods for delivering the pharmaceutical compositions are described in US Patent Application Publication No. US20130184443, the entire contents of which are incorporated herein by reference.

[0317] The nanoparticle formulation can be a carbohydrate nanoparticle comprising a carbohydrate carrier and an RNA (e.g., mRNA) vaccine. Non-limiting examples of carbohydrate carriers include, but are not limited to, anhydrous modified phytoglycogen or glycogen-type substances, phytoglycogen octenyl succinate, phytoglycogen β-dextrin, anhydrous modified phytoglycogen β-dextrin (see, e.g., International Publication No. WO2012109121, the entire contents of which are incorporated herein by reference).

[0318] The nanoparticle formulation of the present invention may be coated with a surfactant or polymer to improve particle delivery. In some embodiments, the nanoparticle may be coated with a hydrophilic coating, such as, but not limited to, a PEG coating and / or a coating with a neutral surface charge. A hydrophilic coating may be useful for delivering nanoparticles containing large payloads, such as, but not limited to, RNA vaccines, into the central nervous system. As a non-limiting example, nanoparticles containing hydrophilic coatings and methods for making such nanoparticles are described in U.S. Patent Application Publication No. US20130183244, the entire contents of which are incorporated herein by reference.

[0319] In some embodiments, the lipid nanoparticles of the present invention can be hydrophilic polymer particles. Non-limiting examples of hydrophilic polymer particles and methods for making hydrophilic polymer particles are described in U.S. Patent Application Publication No. US20130210991, the entire contents of which are incorporated herein by reference.

[0320] In other embodiments, the lipid nanoparticles of the present invention may be hydrophobic polymer particles.

[0321] Lipid nanoparticle formulations can be improved by replacing cationic lipids with biodegradable cationic lipids known as rapidly cleared lipid nanoparticles (reLNPs). Ionic cationic lipids, such as but not limited to DLinDMA, DLin-KC2-DMA, and DLin-MC3-DMA, have been shown to accumulate in plasma and tissues over time and can be potential toxicogens. Rapid metabolism of rapidly cleared lipids can improve the tolerability and therapeutic index of lipid nanoparticles in rats at doses as high as 1 mg / kg to 10 mg / kg. Inclusion of enzymatically degradable ester bonds can improve the degradation and metabolic profile of the cationic components while maintaining activity of the reLNP formulation. The ester bonds can be internal in the lipid chain or terminally located at the end of the lipid chain. An internal ester bond can replace any carbon in the lipid chain.

[0322] In some embodiments, the internal ester bond may be located on either side of a saturated carbon.

[0323] In some embodiments, an immune response can be elicited by delivering lipid nanoparticles that can include nanospecies, polymers and immunogens (US Patent Publication No. 20120189700 and International Publication No. WO2012099805, each of which is incorporated by reference in its entirety herein).

[0324] Lipid nanoparticles may be modified by engineering the surface properties of the particles to allow the lipid nanoparticles to cross mucosal barriers. Mucus is located in mucosal tissues, including, but not limited to, the oral cavity (e.g., buccal and esophageal membranes and tonsil tissues), eyes, digestive tract (e.g., stomach, small intestine, large intestine, colon, rectum), nose, respiratory tract (e.g., membranes of nose, pharynx, trachea and bronchi), and reproductive tract (e.g., membranes of vagina, cervix and urethra). Nanoparticles larger than 10-200 nm are preferred for their high drug encapsulation efficiency and ability to provide sustained delivery of a wide range of drugs, but are considered too large to diffuse rapidly through mucosal barriers. Mucus is continuously secreted, excreted, discarded or digested, and recycled, so the majority of trapped particles can be removed from mucosal tissues within seconds or hours. Large polymeric nanoparticles (200 nm to 500 nm in diameter) densely coated with low molecular weight polyethylene glycol (PEG) diffused through mucus only 4 to 6 times slower than the same particles diffusing in water (Lai et al. PNAS 2007 104(5):1482-487; Lai et al. Adv Drug Deliv Rev. 2009 61(2):158-171, each of which is incorporated herein by reference in its entirety). Nanoparticle transport can be determined using translocation velocity and / or fluorescence microscopy, including, but not limited to, fluorescence recovery after photobleaching (FRAP) and high-resolution multiple particle tracking (MPT). As a non-limiting example, compositions capable of crossing mucosal barriers can be made as described in U.S. Pat. No. 8,241,670 or International Publication No. WO2013110028, each of which is incorporated herein by reference in its entirety.

[0325] Lipid nanoparticles engineered to pass through mucus may include polymeric materials (i.e., polymer cores) and / or polymer-vitamin conjugates and / or triblock copolymers. Polymeric materials may include, but are not limited to, polyamines, polyethers, polyamides, polyesters, polycarbamates, polyureas, polycarbonates, poly(styrenes), polyimides, polysulfones, polyurethanes, polyacetylenes, polyethylenes, polyethyleneimines, polyisocyanates, polyacrylates, polymethacrylates, polyacrylonitriles, and polyarylates. The polymeric materials may be biodegradable and / or biocompatible. Non-limiting examples of biocompatible polymers are described in International Publication No. WO2013116804, the contents of which are incorporated herein by reference in their entirety. The polymeric materials may also be irradiated. As a non-limiting example, the polymeric materials may be gamma irradiated (see, for example, International Publication No. WO201282165, the contents of which are incorporated herein by reference in their entirety). Non-limiting examples of specific polymers include poly(caprolactone) (PCL), ethylene vinyl acetate polymer (EVA), poly(lactic acid) (PLA), poly(L-lactic acid) (PLLA), poly(glycolic acid) (PGA), poly(lactic acid-co-glycolic acid) (PLGA), poly(L-lactic acid-co-glycolic acid) (PLLGA), poly(D,L-lactide) (PDLA), poly(L-lactide) (PLLA), poly(D,L-lactide-co-caprolactone), poly(D,L-lactide-co-caprolactone-co-glycolide), poly(D,L-lactide-co-PEO-co- ... poly(D,L-lactide), poly(D,L-lactide-co-PPO-co-D,L-lactide), polyalkyl cyanoacrylates, polyurethanes, poly-L-lysine (PLL), hydroxypropyl methacrylate (HPMA), polyethylene glycol, poly-L-glutamic acid, poly(hydroxy acids), polyanhydrides, polyorthoesters, poly(ester amides), polyamides, poly(ester ethers), polycarbonates, polyalkylenes such as polyethylene and polypropylene, polyalkylene glycols such as poly(ethylene glycol) (PEG), polyalkylene oxides (PEO),Polyalkylene terephthalates such as poly(ethylene terephthalate), polyvinyl alcohol (PVA), polyvinyl ethers, polyvinyl esters such as poly(vinyl acetate), polyvinyl halides such as poly(vinyl chloride) (PVC), polyvinylpyrrolidone, polysiloxanes, polystyrene (PS), polyurethanes, derivatized celluloses such as alkyl celluloses, hydroxyalkyl celluloses, cellulose ethers, cellulose esters, nitrocellulose, hydroxypropyl cellulose, carboxymethyl cellulose, polymers of acrylic acid such as poly(methyl(meth)acrylate) (PMMA), poly(ethyl(meth)acrylate), poly(butyl(meth)acrylate), poly( poly(isobutyl (meth)acrylate), poly(hexyl (meth)acrylate), poly(isodecyl (meth)acrylate), poly(lauryl (meth)acrylate), poly(phenyl (meth)acrylate), poly(methyl acrylate), poly(isopropyl acrylate), poly(isobutyl acrylate), poly(octadecyl acrylate) and copolymers and mixtures thereof, polydioxanone and its copolymers, polyhydroxyalkanoates, polypropylene fumarate, polyoxymethylene, poloxamer, poly(ortho)esters, poly(butyric acid), poly(valeric acid), poly(lactide-co-caprolactone), PEG-PLGA-PEG, and trimethylene carbonate, polyvinylpyrrolidone. The lipid nanoparticles may be coated with or associated with copolymers, such as, but not limited to, block copolymers (such as the branched polyether-polyamide block copolymers described in International Publication No. WO2013012476, which is incorporated by reference in its entirety) and (poly(ethylene glycol))-(poly(propylene oxide))-(poly(ethylene glycol)) triblock copolymers (see, e.g., U.S. Patent Application Publication Nos. 20120121718 and 20100003337, and U.S. Patent No. 8,263,665, each of which is incorporated by reference in its entirety). The copolymer may be a GRAS (Generally Recognized As Safe) polymer, and the formation of the lipid nanoparticles may be achieved by:The lipid nanoparticles can be made in such a way that no new chemical entities are generated. For example, the lipid nanoparticles can include poloxamer-coated PLGA nanoparticles, which can still pass through human mucus quickly without forming new chemical entities (Yang et al. Angew. Chem. Int. Ed. 2011 50:25972600, the entire contents of which are incorporated herein by reference). A non-limiting, scalable method for generating nanoparticles that can pass through human mucus is described by Xu et al. (see, for example, J Control Release 2013,170(2):279-86, the entire contents of which are incorporated herein by reference).

[0326] The vitamin of the polymer-vitamin conjugate can be vitamin E. The vitamin portion of the conjugate can be substituted with other suitable moieties, such as, but not limited to, vitamin A, vitamin E, other vitamins, cholesterol, hydrophobic moieties or hydrophobic components of other surfactants (e.g., sterol chains, fatty acids, hydrocarbon chains, and alkylene oxide chains).

[0327] Lipid nanoparticles engineered to pass through mucus can include surface modifiers such as, but not limited to, polynucleotides, anionic proteins (e.g., bovine serum albumin), surfactants (e.g., cationic surfactants such as, for example, dimethyldioctadecyl-ammonium bromide), sugars or sugar derivatives (e.g., cyclodextrins), nucleic acids, polymers (e.g., heparin, polyethylene glycols, and poloxamers), mucolytic agents (e.g., N-acetylcysteine, mugwort, bromelain, papain, clerodendrum, acetylcysteine, bromhexine, carbocysteine, eprazinone, mesna, ambroxol, sobrerol, domiodol, letosteine, stepronin, tiopronin, gelsolin, thymosin beta 4 dornase alpha, neltenexin, erdosteine), and various DNases, including rhDNase. The surface modifier may be embedded in, enmeshed in, or disposed on the surface of the lipid nanoparticle (e.g., by coating, adsorption, covalent bonding, or other process) (see, e.g., U.S. Patent Application Publication Nos. 20100215580 and 20080166414 and US20130164343, the contents of each of which are incorporated by reference in their entirety).

[0328] In some embodiments, the lipid nanoparticles that pass through mucus can include at least one polynucleotide as described herein. The polynucleotide can be encapsulated in the lipid nanoparticle and / or disposed on the surface of the particle. The polynucleotide can be covalently attached to the lipid nanoparticle. The lipid nanoparticle formulation that passes through mucus can include a plurality of nanoparticles. In addition, the formulation can contain particles that can interact with mucus and alter the structural properties and / or adhesiveness of the surrounding mucus to reduce mucoadhesion, which can enhance delivery of lipid nanoparticles that pass through mucus to mucosal tissue.

[0329] In other embodiments, the mucus-crossing lipid nanoparticles can be hypotonic formulations that include a coating that enhances mucosal passage. The formulation can be hypotonic relative to the epithelium to which it is delivered.

[0330] Non-limiting examples of hypotonic formulations can be found in International Publication No. WO2013110028, the entire contents of which are incorporated herein by reference.

[0331] In some embodiments, to improve delivery across mucosal barriers, the RNA vaccine formulation may include or be a hypotonic solution, which has been shown to increase the rate at which mucus-inert particles, including but not limited to mucus-penetrating particles, can reach the vaginal epithelial surface (see, e.g., Ensign et al. Biomaterials 2013, 34(28):6922-9, the entire contents of which are incorporated herein by reference).

[0332] In some embodiments, the RNA vaccine is formulated as a lipoplex, including, but not limited to, the ATUPLEX™ system, DACC system, DBTC system and other siRNA lipoplex technologies from Silence Therapeutics (London, United Kingdom), STEMFECT™ from STEMGENT® (Cambridge, Mass.), and targeted and non-targeted nucleic acid delivery based on polyethylenimine (PEI) or protamine (Aleku et al. Cancer Res. 2008 68:9788-9798; Strumberg et al. Int J Clin Pharmacol Ther 2012 50:76-78; Santel et al., Gene Ther 2006 13:1222-1234; Santel et al., Gene Ther 2006 13:1360-1370; Gutbier et al., Pulm Pharmacol.Ther.2010 23:334-344;Kaufmann et al.Microvasc Res 2010 80:286-293;Weide et al.J Immunother.2009 32:498-507;Weide et al.J Immunother.2008 31:180-188;Pascolo,Expert Opin.Biol.Ther.4:1285-1294;Fotin-Mleczek et al.,2011 J.Immunother.34:1-15;Song et al.,Nature Biotechnol.2005,23:709-717;Peer et al.,Proc Natl Acad Sci US A.2007 6;104:4095-4100;deFougerolles Hum Gene Ther.2008 19:125-132, each of which is incorporated herein by reference in its entirety.

[0333] In some embodiments, such formulations may also be constructed or engineered to passively or actively target various cell types in vivo, including, but not limited to, hepatocytes, immune cells, tumor cells, endothelial cells, antigen-presenting cells, and leukocytes (Akinc et al. Mol Ther. 2010 18:1357-1364; Song et al., Nat Biotechnol. 2005 23:709-717; Judge et al., J Clin Invest. 2009 119:661-673; Kaufmann et al., Microvasc Res 2010 80:286-293; Santel et al., Gene Ther 2006 13:1222-1234; Santel et al., Gene Ther 2006 13:1360-1370; Gutbier et al., Pulm Pharmacol. Ther. 2010 23:334-344; Basha et al., Mol. Ther. 2011 19:2186-2200; Fenske and Cullis, Expert Opin Drug Deliv. 2008 5:25-44; Peer et al., Science. 2008 319:627-630; Peer and Lieberman, Gene Ther. 2011 18:1127-1133, each of which is incorporated by reference in its entirety. An example of passive targeting of formulations to hepatocytes includes DLin-DMA, DLin-KC2-DMA and DLin-MC3-DMA based lipid nanoparticle formulations that have been shown to bind apolipoprotein E and promote hepatocyte binding and uptake of the formulation in vivo (Akinc et al. Mol Ther. 2010 18:1357-1364, incorporated herein by reference in its entirety).The formulation can also be selectively targeted by expressing different ligands on its surface, as exemplified by, but not limited to, folate, transferrin, N-acetylgalactosamine (GalNAc) and antibody targeting approaches (Kolhatkar et al., Curr Drug Discov Technol. 2011 8:197-206; Musacchio and Torchilin, Front Biosci. 2011 16:1388-1412; Yu et al., Mol Membr Biol. 2010 27:286-298; Patil et al., Crit Rev Ther Drug Carrier Syst. 2008 25:1-61; Benoit et al., Biomacromolecules. 2011 12:2708-2714; Zhao et al., Expert Opin Drug Deliv. 2008 5:309-319;Akinc et al.,Mol Ther.2010 18:1357-1364;Srinivasan et al.,Methods Mol Biol.2012 820:105-116;Ben-Arie et al.,Methods Mol Biol.2012 757:497-507;Peer 2010 J Control Release.20:63-68;Peer et al.,Proc Natl Acad Sci US A.2007 104:4095-4100;Kim et al.,Methods Mol Biol.2011 721:339-353;Subramanya et al.,Mol Ther.2010 18:2028-2037;Song et al.,Nat Biotechnol.2005 23:709-717; Peer et al., Science. 2008 319:627-630; Peer and Lieberman, Gene Ther. 2011 18:1127-1133, each of which is incorporated by reference in its entirety herein).

[0334] In some embodiments, the RNA (e.g., mRNA) vaccine is formulated as a solid lipid nanoparticle. The solid lipid nanoparticle (SLN) can be spherical with an average diameter of up to 1000 nm. The SLN has a solid lipid core matrix that can solubilize lipophilic molecules and can be stabilized with surfactants and / or emulsifiers. In other embodiments, the lipid nanoparticle can be a self-assembled lipid polymer nanoparticle (see Zhang et al., ACS Nano, 2008, 2(8), pp 1696-1702, the entire contents of which are incorporated herein by reference). As a non-limiting example, the SLN can be the SLN described in International Publication No. WO2013105101, the entire contents of which are incorporated herein by reference. As another non-limiting example, the SLN can be made by the method or process described in International Publication No. WO2013105101, the entire contents of which are incorporated herein by reference.

[0335] The formulation may increase the transfection of cells by RNA vaccines and / or increase the translation of encoded proteins, but may utilize liposomes, lipoplexes or lipid nanoparticles to improve the efficiency of polynucleotide-targeted protein production.One such example is the use of lipid encapsulation to enable effective systemic delivery of polyplexed plasmid DNA (Heyes et al., Mol Ther. 2007 15:713-720, the entirety of which is incorporated herein by reference).Liposomes, lipoplexes or lipid nanoparticles may also be used to increase the stability of polynucleotides.

[0336] In some embodiments, the RNA (e.g., mRNA) vaccines of the present invention can be formulated for controlled release and / or targeted delivery. As used herein, "controlled release" refers to a release profile of a pharmaceutical composition or compound that matches a particular release pattern that achieves a therapeutic outcome. In some embodiments, the RNA vaccines can be encapsulated in a delivery material described herein and / or known in the art for controlled release and / or targeted delivery. As used herein, the term "encapsulate" means to entrap, surround, or encase. When referring to a formulation of a compound of the present invention, encapsulation can be substantial, complete, or partial. The term "substantially encapsulated" means that at least 50, 60, 70, 80, 85, 90, 95, 96, 97, 98, 99, 99.9, more than 99.9, or more than 99.999% of the pharmaceutical composition or compound of the present invention is entrapped, surrounded, or encased in the delivery material. "Partial encapsulation" means that less than 10%, 10, 20, 30, 40, 50 or less of the pharmaceutical composition or compound of the present invention is trapped, surrounded or enveloped within the delivery material. Advantageously, encapsulation can be determined by measuring leakage or activity of the pharmaceutical composition or compound of the present invention using fluorescence and / or electron microscopy. For example, at least 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 85, 90, 95, 96, 97, 98, 99, 99.9, 99.99 or more than 99.99% of the pharmaceutical composition or compound of the present invention is encapsulated within the delivery material.

[0337] In some embodiments, the controlled release formulation may include, but is not limited to, a triblock copolymer. As a non-limiting example, the formulation may include two different types of triblock copolymers (International Publication Nos. WO2012131104 and WO2012131106, the contents of each of which are incorporated herein by reference in their entirety).

[0338] In other embodiments, the RNA vaccine can be encapsulated in a lipid nanoparticle or a rapidly cleared lipid nanoparticle, which can then be encapsulated in a polymer, hydrogel, and / or surgical sealant described herein and / or known in the art. As non-limiting examples, the polymer, hydrogel, or surgical sealant can be a surgical sealant such as PLGA, ethylene vinyl acetate (EVAc), poloxamer, GELSITE® (Nanotherapeutics, Inc. (Alachua, FL)), HYLENEX® (Halozyme Therapeutics (San Diego CA)), fibrinogen polymer (Ethicon Inc. (Cornelia, GA)), TISSELL® (Baxter International, Inc. (Deerfield, IL)), PEG-based sealants, and COSEAL® (Baxter International, Inc. (Deerfield, IL)).

[0339] In other embodiments, the lipid nanoparticles may be encapsulated within any polymer known in the art that can form a gel when injected into a subject. As another non-limiting example, the lipid nanoparticles may be encapsulated within a polymer matrix that may be biodegradable.

[0340] In some embodiments, the RNA vaccine formulation for controlled release and / or targeted delivery may also include at least one controlled release coating, including, but not limited to, OPADRY®, polyvinylpyrrolidone / vinyl acetate copolymer, polyvinylpyrrolidone, hydroxypropyl methylcellulose, hydroxypropyl cellulose, hydroxyethyl cellulose, EUDRAGIT RL®, EUDRAGIT RS®, and cellulose derivatives such as ethylcellulose aqueous dispersions (AQUACOAT® and SURELEASE®).

[0341] In some embodiments, the RNA (e.g., mRNA) vaccine controlled release and / or targeted delivery formulation may include at least one degradable polyester that may contain polycationic side chains. Degradable polyesters include, but are not limited to, poly(serine ester), poly(L-lactide-co-L-lysine), poly(4-hydroxy-L-proline ester), and combinations thereof. In other embodiments, the degradable polyester may include PEG conjugates to form PEGylated polymers.

[0342] In some embodiments, an RNA vaccine controlled release and / or targeted delivery formulation comprising at least one polynucleotide may comprise at least one PEG and / or PEG-related polymer derivative as described in U.S. Pat. No. 8,404,222, the entirety of which is incorporated herein by reference.

[0343] In other embodiments, the RNA vaccine controlled release delivery formulation comprising at least one polynucleotide may be a controlled release polymer system as described in U.S. Patent Application Publication No. 20130130348, which is incorporated by reference in its entirety.

[0344] In some embodiments, the RNA (e.g., mRNA) vaccines of the invention may be encapsulated in therapeutic nanoparticles, referred to herein as "therapeutic nanoparticle RNA vaccines." Therapeutic nanoparticles may be prepared using methods described herein and known in the art, including, but not limited to, International Publication Nos. WO2010005740, WO2010030763, WO2010005721, WO2010005723, WO2012054923, U.S. Patent Application Publication Nos. US20110262491, US20100104645, US20100087337 ... Nos. 20100068285, 20110274759, 20100068286, 20120288541, 20130123351 and 20130230567, and U.S. Patent Nos. 8,206,747, 8,293,276, 8,318,208 and 8,318,211, the contents of each of which are incorporated herein by reference in their entirety. In other embodiments, the therapeutic polymeric nanoparticles can be identified by the methods described in U.S. Patent Application Publication No. US20120140790, the contents of which are incorporated herein by reference in their entirety.

[0345] In some embodiments, the therapeutic nanoparticle RNA vaccine can be formulated for sustained release. As used herein, "sustained release" refers to a pharmaceutical composition or compound that follows a release rate over a specific period of time. The specific period of time includes, but is not limited to, hours, days, weeks, months, and years. As a non-limiting example, a sustained release nanoparticle can include a polymer and a therapeutic agent, such as, but not limited to, a polynucleotide of the present invention (see International Publication No. 2010075072 and US Patent Application Publication Nos. US20100216804, US20110217377, and US20120201859, each of which is incorporated herein by reference in its entirety). In another non-limiting example, a sustained release formulation can include an agent that allows sustained bioavailability, such as, but not limited to, a crystal, a macromolecular gel, and / or a microparticle suspension (see US Patent Application Publication No. US20130150295, the contents of which are incorporated herein by reference in their entirety).

[0346] In some embodiments, therapeutic nanoparticle RNA vaccines can be formulated to be target specific. As a non-limiting example, therapeutic nanoparticles can include corticosteroids (see International Publication No. WO2011084518, which is incorporated herein by reference in its entirety). As a non-limiting example, therapeutic nanoparticles can be formulated in nanoparticles as described in International Publication Nos. WO2008121949, WO2010005726, WO2010005725, WO2011084521, and US Patent Publication Nos. US20100069426, US20120004293, and US20100104655, each of which is incorporated herein by reference in its entirety.

[0347] In some embodiments, the nanoparticles of the present invention may comprise a polymer matrix.As a non-limiting example, the nanoparticles may comprise two or more polymers, such as, but not limited to, polyethylene, polycarbonate, polyanhydride, polyhydroxy acid, polypropyl fumarate, polycaprolactone, polyamide, polyacetal, polyether, polyester, poly(orthoester), polycyanoacrylate, polyvinyl alcohol, polyurethane, polyphosphazene, polyacrylate, polymethacrylate, polycyanoacrylate, polyurea, polystyrene, polyamine, polylysine, poly(ethyleneimine), poly(serine ester), poly(L-lactide-co-L-lysine), poly(4-hydroxy-L-proline ester) or combinations thereof.

[0348] In some embodiments, the therapeutic nanoparticles may include diblock copolymers. In some embodiments, the diblock copolymers may include PEG in combination with polymers such as, but not limited to, polyethylene, polycarbonate, polyanhydride, polyhydroxy acid, polypropyl fumarate, polycaprolactone, polyamide, polyacetal, polyether, polyester, poly(orthoester), polycyanoacrylate, polyvinyl alcohol, polyurethane, polyphosphazene, polyacrylate, polymethacrylate, polycyanoacrylate, polyurea, polystyrene, polyamine, polylysine, poly(ethyleneimine), poly(serine ester), poly(L-lactide-co-L-lysine), poly(4-hydroxy-L-proline ester), or combinations thereof. In yet other embodiments, the diblock copolymers may be high-X diblock copolymers such as those described in International Publication No. WO2013120052, the entire contents of which are incorporated herein by reference.

[0349] As a non-limiting example, the therapeutic nanoparticle comprises a PLGA-PEG block copolymer (see US Patent Publication No. US20120004293 and US8,236,330, each of which is incorporated herein by reference in its entirety). In another non-limiting example, the therapeutic nanoparticle is a stealth nanoparticle comprising a diblock copolymer of PEG and PLA or PEG and PLGA (see US8,246,968 and WO2012166923, each of which is incorporated herein by reference in its entirety). In yet another non-limiting example, the therapeutic nanoparticle is a stealth nanoparticle or a target-specific stealth nanoparticle as described in US Patent Publication No. 20130172406, the contents of which are incorporated herein by reference in their entirety.

[0350] In some embodiments, the therapeutic nanoparticles may comprise multiblock copolymers (see, e.g., U.S. Pat. Nos. 8,263,665 and 8,287,910, and U.S. Patent Application Publication No. 20130195987, the contents of each of which are incorporated by reference in their entirety herein).

[0351] In yet another non-limiting example, the lipid nanoparticle comprises the block copolymer PEG-PLGA-PEG (see, e.g., the thermosensitive hydrogel (PEG-PLGA-PEG) used as a delivery vehicle for the TGF-β1 gene in Lee et al. "Thermosensitive Hydrogel as a Tgf-β1 Gene Delivery Vehicle Enhances Diabetic Wound Healing." Pharmaceutical Research, 2003 20(12):1995-2000, and as a controlled gene delivery system in Li et al. "Controlled Gene Delivery System Based on Thermosensitive Biodegradable Hydrogel" Pharmaceutical Research 2003 20(6):884- 888; and Chang et al., "Non-ionic amphiphilic biodegradable PEG-PLGA-PEG copolymer enhances gene delivery efficiency in rat skeletal muscle." J Controlled Release. 2007 118:245-253, each of which is incorporated herein by reference in its entirety). The RNA (e.g., mRNA) vaccines of the present disclosure may be formulated in lipid nanoparticles comprising PEG-PLGA-PEG block copolymers.

[0352] In some embodiments, the block copolymers described herein may be included in a polyion complex comprising a non-polymeric micelle and a block copolymer (see, e.g., U.S. Patent Application Publication No. 20120076836, which is incorporated by reference in its entirety).

[0353] In some embodiments, the therapeutic nanoparticles may comprise at least one acrylic polymer, including, but not limited to, acrylic acid, methacrylic acid, copolymers of acrylic acid and methacrylic acid, methyl methacrylate copolymers, ethoxyethyl methacrylate, cyanoethyl methacrylate, aminoalkyl methacrylate copolymers, poly(acrylic acid), poly(methacrylic acid), polycyanoacrylate, and combinations thereof.

[0354] In some embodiments, the therapeutic nanoparticles may include at least one poly(vinyl ester) polymer. The poly(vinyl ester) polymer may be a copolymer, such as a random copolymer. As a non-limiting example, the random copolymer may have a structure such as that described in International Publication No. WO2013032829 or US Patent Publication No. 20130121954, the entire contents of which are incorporated herein by reference. In some embodiments, the poly(vinyl ester) polymer may be conjugated to a polynucleotide as described herein. In other embodiments, the poly(vinyl ester) polymer that can be used in the present invention may be as described herein.

[0355] In some embodiments, the therapeutic nanoparticles may include at least one diblock copolymer. The diblock copolymer may be, but is not limited to, a poly(lactic) acid-poly(ethylene) glycol copolymer (see, e.g., International Publication No. WO2013044219, which is incorporated herein by reference in its entirety). As a non-limiting example, the therapeutic nanoparticles may be used to treat cancer (see, e.g., International Publication No. WO2013044219, which is incorporated herein by reference in its entirety).

[0356] In some embodiments, the therapeutic nanoparticles can include at least one cationic polymer, as described herein and / or known in the art.

[0357] In some embodiments, the therapeutic nanoparticles may comprise at least one amine-containing polymer, including but not limited to polylysine, polyethyleneimine, poly(amidoamine) dendrimers, poly(β-aminoesters) (see, e.g., U.S. Pat. No. 8,287,849, the entire contents of which are incorporated herein by reference), and combinations thereof. In other embodiments, the nanoparticles described herein may comprise amine-cationic lipids, such as those described in International Publication No. WO2013059496, the entire contents of which are incorporated herein by reference. In some embodiments, the cationic lipids may have amino-amine or amino-amide moieties.

[0358] In some embodiments, the therapeutic nanoparticles may include at least one degradable polyester that may contain polycationic side chains. Degradable polyesters include, but are not limited to, poly(serine ester), poly(L-lactide-co-L-lysine), poly(4-hydroxy-L-proline ester), and combinations thereof. In other embodiments, the degradable polyester may include PEG conjugates to form PEGylated polymers.

[0359] In other embodiments, the therapeutic nanoparticles may include a conjugate of at least one targeting ligand, which may be any ligand known in the art, including but not limited to, monoclonal antibodies (Kirpotin et al, Cancer Res. 2006 66:6732-6740, which is incorporated herein by reference in its entirety).

[0360] In some embodiments, therapeutic nanoparticles may be formulated in an aqueous solution and used to target cancer (see International Publication No. WO2011084513 and U.S. Patent Application Publication No. 20110294717, each of which is incorporated by reference in its entirety).

[0361] In some embodiments, therapeutic nanoparticle RNA vaccines (e.g., therapeutic nanoparticles comprising at least one RNA vaccine) can be formulated using the methods described by Podobinski et al. in U.S. Pat. No. 8,404,799, the entire contents of which are incorporated herein by reference.

[0362] In some embodiments, the RNA (e.g., mRNA) vaccine may be encapsulated in, bound to, and / or associated with synthetic nanocarriers. Synthetic nanocarriers include, but are not limited to, those described in International Publication Nos. WO2010005740, WO2012149454, and WO2013019669, and U.S. Patent Application Publication Nos. US20110262491, US20100104645, US20100087337, and US20120244222, each of which is incorporated herein by reference in its entirety. Synthetic nanocarriers may be formulated using methods known in the art and / or methods described herein. As non-limiting examples, synthetic nanocarriers can be formulated by the methods described in International Publication Nos. WO2010005740, WO2010030763, and WO201213501, and U.S. Patent Application Publication Nos. US20110262491, US20100104645, US20100087337, and US2012024422, each of which is incorporated by reference in its entirety. In other embodiments, synthetic nanocarrier formulations can be lyophilized using the methods described in International Publication No. WO2011072218 and U.S. Patent No. 8,211,473, each of which is incorporated by reference in its entirety. In yet other embodiments, formulations of the invention, including but not limited to synthetic nanocarriers, may be lyophilized or reconstituted by the methods described in U.S. Patent Publication No. 20130230568, the contents of which are incorporated herein by reference in their entirety.

[0363] In some embodiments, synthetic nanocarriers may contain reactive groups that release the polynucleotides described herein (see International Publication No. WO20120952552 and U.S. Patent Application Publication No. US20120171229, each of which is incorporated by reference in its entirety).

[0364] In some embodiments, synthetic nanocarriers may contain immune activators that enhance the immune response from delivery of the synthetic nanocarriers. As a non-limiting example, synthetic nanocarriers may include Th1 immune activators that may enhance the Th1-based response of the immune system (see International Publication No. WO2010123569 and U.S. Patent Publication No. 20110223201, each of which is incorporated by reference in its entirety herein).

[0365] In some embodiments, synthetic nanocarriers can be formulated for targeted release. In some embodiments, synthetic nanocarriers are formulated to release polynucleotides at a specified pH and / or after a desired time interval. As a non-limiting example, synthetic nanoparticles can be formulated to release RNA vaccines after 24 hours and / or at pH 4.5 (International Publication Nos. WO2010138193 and WO2010138194 and US Patent Publication Nos. US20110020388 and US20110027217, each of which is incorporated herein by reference in its entirety).

[0366] In some embodiments, synthetic nanocarriers can be formulated for controlled and / or sustained release of the polynucleotides described herein. By way of non-limiting example, synthetic nanocarriers for sustained release can be formulated by methods known in the art, described herein, and / or described in International Publication No. WO2010138192 and U.S. Patent Publication No. 20100303850, each of which is incorporated herein by reference in its entirety.

[0367] In some embodiments, the RNA vaccines may be formulated for controlled and / or sustained release, and the formulation includes at least one polymer that is a crystallizable side chain (CYSC) polymer. CYSC polymers are described in U.S. Patent No. 8,399,007, which is incorporated herein by reference in its entirety.

[0368] In some embodiments, synthetic nanocarriers can be formulated for use as a vaccine. In some embodiments, synthetic nanocarriers can encapsulate at least one polynucleotide encoding at least one antigen. As a non-limiting example, synthetic nanocarriers can include at least one antigen and an excipient for a vaccine formulation (see International Publication No. WO2011150264 and US Patent Publication No. 20110293723, each of which is incorporated herein by reference in its entirety). As another non-limiting example, a vaccine formulation can include at least two synthetic nanocarriers containing the same or different antigens and an excipient (see International Publication No. WO2011150249 and US Patent Publication No. 20110293701, each of which is incorporated herein by reference in its entirety). Vaccine formulations may be selected by methods described herein, known in the art, and / or described in International Publication No. WO2011150258 and U.S. Patent Application Publication No. US20120027806, each of which is incorporated by reference in its entirety.

[0369] In some embodiments, synthetic nanocarriers may include at least one polynucleotide encoding at least one adjuvant (e.g., flagellin protein). In some embodiments, synthetic nanocarriers may include at least one adjuvant. As non-limiting examples, adjuvants may include dimethyldioctadecylammonium bromide, dimethyldioctadecylammonium chloride, dimethyldioctadecylammonium phosphate, or dimethyldioctadecylammonium acetate (DDA), and a non-polar fraction of a Mycobacterium total lipid extract or a portion of the non-polar fraction (see, e.g., U.S. Patent No. 8,241,610, which is incorporated herein by reference in its entirety). In other embodiments, synthetic nanocarriers may include at least one polynucleotide and an adjuvant. As a non-limiting example, synthetic nanocarriers, including, optionally including, an adjuvant, can be formulated according to the methods described in International Publication No. WO2011150240 and U.S. Patent Application Publication No. US20110293700, each of which is incorporated by reference in its entirety.

[0370] In some embodiments, the synthetic nanocarrier can encapsulate at least one polynucleotide encoding a peptide, fragment or region derived from a virus. As non-limiting examples, the synthetic nanocarrier can include the nanocarriers described in International Publication Nos. WO2012024621, WO201202629 and WO2012024632 and US Patent Publication Nos. US20120064110, US20120058153 and US20120058154 (each of which is incorporated herein by reference in its entirety).

[0371] In some embodiments, synthetic nanocarriers may be conjugated to polynucleotides that may be capable of eliciting a humoral response and / or a cytotoxic T lymphocyte (CTL) response (see, e.g., International Publication No. WO2013019669, incorporated herein by reference in its entirety).

[0372] In some embodiments, the RNA vaccine may be encapsulated in, bound to, and / or associated with a zwitterionic lipid. Non-limiting examples of zwitterionic lipids and methods of using zwitterionic lipids are described in U.S. Patent Publication No. 20130216607, the entire contents of which are incorporated herein by reference. In some embodiments, zwitterionic lipids can be used in the liposomes and lipid nanoparticles described herein.

[0373] In some embodiments, the RNA vaccines may be formulated in colloidal nanocarriers, as described in US Patent Publication No. 20130197100, the contents of which are incorporated herein by reference in their entirety.

[0374] In some embodiments, the nanoparticles can be optimized for oral administration.The nanoparticles can include at least one cationic biopolymer, such as, but not limited to, chitosan or its derivatives.As a non-limiting example, the nanoparticles can be formulated by the method described in US Patent Publication No. 20120282343 (incorporated herein by reference in its entirety).

[0375] In some embodiments, the LNPs comprise the lipid KL52 (an amino lipid disclosed in US Patent Publication No. 2012 / 0295832, expressly incorporated herein by reference in its entirety). The activity and / or safety of LNP administration (as determined by examining one or more of ALT / AST, white blood cell count, and cytokine induction) may be improved by incorporating such lipids. LNPs comprising KL52 may be administered intravenously and / or in one or more doses. In some embodiments, administration of LNPs comprising KL52 results in the same or improved mRNA and / or protein expression compared to LNPs comprising MC3.

[0376] In some embodiments, RNA vaccines may be delivered using even smaller LNPs, such particles having diameters of less than 0.1 μm up to 100 nm, including but not limited to less than 0.1 μm, less than 1.0 μm, less than 5 μm, less than 10 μm, less than 15 μm, less than 20 μm, less than 25 μm, less than 30 μm, less than 35 μm, less than 40 μm, less than 50 μm, less than 55 μm, less than 60 μm, less than 65 μm, less than 70 μm, less than 75 μm, less than 80 μm, less than 85 μm, less than 90 μm, less than 95 μm, less than 100 μm, less than 125 μm, less than 150 μm, less than 175 μm, less than 200 μm, less than 225 μm, less than 250 μm. , less than 275 μm, less than 300 μm, less than 325 μm, less than 350 μm, less than 375 μm, less than 400 μm, less than 425 μm, less than 450 μm, less than 475 μm, less than 500 μm, less than 525 μm, less than 550 μm, less than 575 μm, less than 600 μm, less than 625 μm, less than 650 μm, less than 675 μm, less than 700 μm, less than 725 μm, less than 750 μm, less than 775 μm, less than 800 μm, less than 825 μm, less than 850 μm, less than 875 μm, less than 900 μm, less than 925 μm, less than 950 μm or less than 975 μm.

[0377] In other embodiments, the RNA (e.g., mRNA) vaccine is about 1 nm to about 100 nm, about 1 nm to about 10 nm, about 1 nm to about 20 nm, about 1 nm to about 30 nm, about 1 nm to about 40 nm, about 1 nm to about 50 nm, about 1 nm to about 60 nm, about 1 nm to about 70 nm, about 1 nm to about 80 nm. , about 1 nm to about 90 nm, about 5 nm to about 100 nm, about 5 nm to about 10 nm, about 5 nm to about 20 nm, about 5 nm to about 30 nm, about 5 nm to about 4 0nm, about 5nm to about 50nm, about 5nm to about 60nm, about 5nm to about 70nm, about 5nm to about 80nm, about 5nm to about 90nm, about 10 to about 5 In some embodiments, the LNP may be delivered using even smaller LNPs, which may have a diameter of about 0 nm, about 20 to about 50 nm, about 30 to about 50 nm, about 40 to about 50 nm, about 20 to about 60 nm, about 30 to about 60 nm, about 40 to about 60 nm, about 20 to about 70 nm, about 30 to about 70 nm, about 40 to about 70 nm, about 50 to about 70 nm, about 60 to about 70 nm, about 20 to about 80 nm, about 30 to about 80 nm, about 40 to about 80 nm, about 50 to about 80 nm, about 60 to about 80 nm, about 20 to about 90 nm, about 30 to about 90 nm, about 40 to about 90 nm, about 50 to about 90 nm, about 60 to about 90 nm and / or about 70 to about 90 nm.

[0378] In some embodiments, such LNPs are synthesized using methods that include a microfluidic mixer. Exemplary microfluidic mixers include, but are not limited to, slit-type interdigital micromixers, such as, but not limited to, those manufactured by Microinnova (Allerheiligen bei Wildon, Austria) and / or zigzag herringbone micromixers (SHM) (Zhigaltsev, IV et al., Bottom-up design and synthesis of limit size lipid nanoparticle systems with aqueous and triglyceride cores using millisecond microfluidic mixing has been published (Langmuir. 2012.28:3633-40; Belliveau, NM et al., Microfluidic synthesis of highly potent limit-size lipid nanoparticles for in vivo delivery of siRNA. Molecular Therapy-Nucleic Acids. 2012.1:e37; Chen, D. et al., Rapid discovery of potent siRNA-containing lipid nanoparticles enabled by controlled microfluidic formulation. J Am Chem. Soc. 2012.134(16):6948-51, each of which is incorporated by reference in its entirety.

[0379] In some embodiments, the method for producing LNPs with SHM further comprises mixing at least two input streams, which mixing occurs by microstructure-induced chaotic advection (MICA). According to this method, the fluid streams flow through channels that exist in a herringbone pattern, causing rotational flow and folding of the fluids into each other. This method can also include a surface for fluid mixing, where the surface changes direction while the fluids are circulating. Methods for producing LNPs using SHM include those disclosed in U.S. Patent Application Publication Nos. 2004 / 0262223 and 2012 / 0276209, each of which is expressly incorporated herein by reference in its entirety.

[0380] In some embodiments, the RNA vaccines of the present invention may be formulated into lipid nanoparticles generated using a micromixer such as, but not limited to, a slit-type interdigital microstructure mixer (SIMM-V2) or a standard slit-type interdigital micromixer (SSIMM) or a caterpillar (CPMM) or a jet impingement (IJMM) (Institut fur Mikrotechnik Mainz GmbH, Mainz Germany).

[0381] In some embodiments, the RNA (e.g., mRNA) vaccines of the present disclosure may be formulated in lipid nanoparticles generated using microfluidic technology (see Whitesides, George M. The Origins and the Future of Microfluidics. Nature, 2006 442:368-373; and Abraham et al. Chaotic Mixer for Microchannels. Science, 2002 295:647-651, each of which is incorporated herein by reference in its entirety). As a non-limiting example, controlled microfluidic formulation involves passive methods of mixing low Reynolds number steady pressure driven flow in microchannels (see, e.g., Abraham et al. Chaotic Mixer for Microchannels. Science, 2002 295:647-651, each of which is incorporated herein by reference in its entirety).

[0382] In some embodiments, the RNA (e.g., mRNA) vaccines of the present invention can be formulated into lipid nanoparticles generated using a micromixer chip, such as, but not limited to, those manufactured by Harvard Apparatus (Holliston, MA) or Dolomite Microfluidics (Royston, UK). Micromixer chips can be used to rapidly mix two or more fluid streams by a slit and recombination mechanism.

[0383] In some embodiments, the RNA (e.g., mRNA) vaccine of the present invention can be formulated for delivery using drug-loaded microspheres as described in International Publication No. WO2013063468 or US Patent No. 8,440,614 (each of which is incorporated herein by reference in its entirety). The microspheres can comprise compounds of formula (I), (II), (III), (IV), (V) or (VI) as described in International Publication No. WO2013063468 (the entire contents of which are incorporated herein by reference). In other aspects, amino acids, peptides, polypeptides, lipids (APPLs) are useful for delivering the RNA vaccine of the present invention to cells (see International Publication No. WO2013063468, the entire contents of which are incorporated herein by reference).

[0384] In some embodiments, the RNA (e.g., mRNA) vaccine of the present disclosure has a diameter of about 10 to about 100 nm, for example, but not limited to, about 10 to about 20 nm, about 10 to about 30 nm, about 10 to about 40 nm, about 10 to about 50 nm, about 10 to about 60 nm, about 10 to about 70 nm, about 10 to about 80 nm, about 10 to about 90 nm, about 20 to about 30 nm, about 20 to about 40 nm, about 20 to about 50 nm, about 20 to about 60 nm, about 20 to about 70 nm, about 20 to about 80 nm, about 20 to about 90 nm, about 20 to about 100 nm, about 30 to about 40 nm, about 30 to about 50 nm, about 30 to about 60 nm, about 30 to about 70 nm, about 30 to about 80 nm, about 20 to about 90 nm, about 20 to about 100 nm, about 30 to about 40 nm, about 30 to about 50 nm, about 30 to about 60 nm, about 30 to about 70 nm, about 30 to about 80 nm, about 30 to about 90 nm, about 3 ... The lipid nanoparticles may be formulated into lipid nanoparticles having a diameter of about 80 nm, about 30 to about 90 nm, about 30 to about 100 nm, about 40 to about 50 nm, about 40 to about 60 nm, about 40 to about 70 nm, about 40 to about 80 nm, about 40 to about 90 nm, about 40 to about 100 nm, about 50 to about 60 nm, about 50 to about 70 nm, about 50 to about 80 nm, about 50 to about 90 nm, about 50 to about 100 nm, about 60 to about 70 nm, about 60 to about 80 nm, about 60 to about 90 nm, about 60 to about 100 nm, about 70 to about 80 nm, about 70 to about 90 nm, about 70 to about 100 nm, about 80 to about 90 nm, about 80 to about 100 nm, and / or about 90 to about 100 nm.

[0385] In some embodiments, the lipid nanoparticles may have a diameter of about 10 to 500 nm.

[0386] In some embodiments, lipid nanoparticles can have a diameter of greater than 100 nm, greater than 150 nm, greater than 200 nm, greater than 250 nm, greater than 300 nm, greater than 350 nm, greater than 400 nm, greater than 450 nm, greater than 500 nm, greater than 550 nm, greater than 600 nm, greater than 650 nm, greater than 700 nm, greater than 750 nm, greater than 800 nm, greater than 850 nm, greater than 900 nm, 950 nm, or greater than 1000 nm.

[0387] In some embodiments, the lipid nanoparticles may be critical dimension lipid nanoparticles as described in International Publication No. WO2013059922, the entire contents of which are incorporated herein by reference. The critical dimension lipid nanoparticles may comprise a lipid bilayer surrounding an aqueous or hydrophobic core, where the lipid bilayer may comprise phospholipids, such as, but not limited to, diacylphosphatidylcholine, diacylphosphatidylethanolamine, ceramide, sphingomyelin, dihydrosphingomyelin, cephalin, cerebroside, C8-C20 fatty acid diacylphosphatidylcholine and 1-palmitoyl-2-oleoylphosphatidylcholine (POPC). In other embodiments, the critical dimension lipid nanoparticles may comprise polyethylene glycol lipids, such as, but not limited to, DLPE-PEG, DMPE-PEG, DPPC-PEG and DSPE-PEG.

[0388] In some embodiments, the RNA vaccine may be delivered, localized, and / or concentrated at a specific location using the delivery methods described in International Publication No. WO2013063530 (the entire contents of which are incorporated herein by reference). As a non-limiting example, empty polymer particles may be administered to a subject before, simultaneously with, or after delivery of the RNA vaccine to the subject. Upon contact with the subject, the empty polymer particles change volume and become lodged, embedded, immobilized, or captured at a specific location within the subject.

[0389] In some embodiments, the RNA vaccine may be formulated in an active agent release system (see, e.g., U.S. Patent Application Publication No. US20130102545, the entire contents of which are incorporated herein by reference). The active agent release system may include 1) at least one nanoparticle bound to an oligonucleotide inhibitor chain that hybridizes with a catalytically active nucleic acid, and 2) a compound bound to at least one substrate molecule that is bound to a therapeutically active substance (e.g., a polynucleotide described herein), where the therapeutically active substance is released by cleavage of the substrate molecule by the catalytically active nucleic acid.

[0390] In some embodiments, RNA (e.g., mRNA) vaccines can be formulated in nanoparticles that include an inner core that includes non-cellular material and an outer surface that includes a cell membrane. The cell membrane can be cell-derived or virus-derived. As a non-limiting example, nanoparticles can be made by the method described in International Publication No. WO2013052167 (incorporated herein by reference in its entirety). As another non-limiting example, nanoparticles described in International Publication No. WO2013052167 (incorporated herein by reference in its entirety) can be used to deliver the RNA vaccines described herein.

[0391] In some embodiments, the RNA vaccine can be formulated in a lipid bilayer (original cell) supported on a porous nanoparticle.Original cells are described in International Publication No. WO2013056132, the entire contents of which are incorporated herein by reference.

[0392] In some embodiments, the RNA vaccines described herein can be formulated in polymeric nanoparticles described in U.S. Patent Nos. 8,420,123 and 8,518,963 and European Patent No. EP2073848B1 (each of which is incorporated herein by reference in its entirety), or prepared by the methods described therein. As a non-limiting example, polymeric nanoparticles such as those described in U.S. Patent No. 8,518,963 (each of which is incorporated herein by reference in its entirety) or prepared by the methods described therein can have a high glass transition temperature. As another non-limiting example, polymeric nanoparticles for oral and parenteral formulations can be prepared by the methods described in European Patent No. EP2073848B1 (each of which is incorporated herein by reference in its entirety).

[0393] In other embodiments, the RNA (e.g., mRNA) vaccines described herein can be formulated into nanoparticles for use in imaging. The nanoparticles can be liposomal nanoparticles, such as those described in US Patent Publication No. 20130129636, the entire contents of which are incorporated herein by reference. As a non-limiting example, the liposomes can include gadolinium(III) 2-{4,7-bis-carboxymethyl-10-[(N,N-distearylamidomethyl-N'-amido-methyl]-1,4,7,10-tetra-azacyclododec-1-yl}-acetate and a neutral fully saturated phospholipid component (see, e.g., US Patent Publication No. US20130129636, the entire contents of which are incorporated herein by reference).

[0394] In some embodiments, nanoparticles that can be used in the present invention are formed by the methods described in US Patent Publication No. 20130130348, the contents of which are incorporated herein by reference in their entirety.

[0395] The nanoparticles of the present invention may further comprise nutrients, including, but not limited to, those whose deficiency may result in adverse health effects ranging from anemia to neural tube defects (see, for example, the nanoparticles described in International Publication No. WO2013072929, the entire contents of which are incorporated herein by reference).By way of non-limiting example, the nutrients may be ferrous salts, ferric salts or elemental iron, iodine, folic acid, vitamins or micronutrients.

[0396] In some embodiments, the RNA (e.g., mRNA) vaccine of the present invention can be formulated in swellable nanoparticles. The swellable nanoparticles can be, but are not limited to, those described in U.S. Patent No. 8,440,231 (the entire contents of which are incorporated herein by reference). As a non-limiting embodiment, swellable nanoparticles can be used to deliver the RNA (e.g., mRNA) vaccine of the present invention to the pulmonary system (see, e.g., U.S. Patent No. 8,440,231, the entire contents of which are incorporated herein by reference).

[0397] The RNA (e.g., mRNA) vaccines of the present invention may be formulated in polyanhydride nanoparticles, such as, but not limited to, those described in U.S. Pat. No. 8,449,916, the entire contents of which are incorporated herein by reference. The nanoparticles and microparticles of the present invention may be geometrically engineered to control macrophage and / or immune responses. In some embodiments, the geometrically engineered particles may have various shapes, sizes, and / or surface charges to incorporate the polynucleotides of the present invention for targeted delivery, such as, but not limited to, pulmonary delivery (see, for example, International Publication No. WO2013082111, the entire contents of which are incorporated herein by reference). Other physical features of the geometrically engineered particles may include, but are not limited to, fenestration, angled arms, asymmetry and surface roughness, charge, which can alter cell and tissue interactions. As a non-limiting example, the nanoparticles of the present invention may be made by the methods described in International Publication No. WO2013082111, the entire contents of which are incorporated herein by reference.

[0398] In some embodiments, the nanoparticles of the present invention may be water-soluble nanoparticles, such as, but not limited to, those described in International Publication No. WO2013090601, the entire contents of which are incorporated herein by reference. The nanoparticles may be inorganic nanoparticles with small and zwitterionic ligands to exhibit good water solubility. The nanoparticles may also have a small hydrodynamic diameter (HD), stability over time, pH and salt concentration, and low levels of non-specific protein binding.

[0399] In some embodiments, the nanoparticles of the present invention may be developed by the methods described in U.S. Patent Application Publication No. US20130172406, the contents of which are incorporated herein by reference in their entirety.

[0400] In some embodiments, the nanoparticles of the present invention are stealth nanoparticles or target-specific stealth nanoparticles, such as, but not limited to, those described in U.S. Patent Application Publication No. 20130172406, the entire contents of which are incorporated herein by reference. The nanoparticles of the present invention can be made by the methods described in U.S. Patent Application Publication No. 20130172406, the entire contents of which are incorporated herein by reference.

[0401] In other embodiments, the stealth or target-specific stealth nanoparticles may include a polymer matrix. The polymer matrix may include two or more polymers, such as, but not limited to, polyethylene, polycarbonate, polyanhydride, polyhydroxy acid, polypropyl fumerate, polycaprolactone, polyamide, polyacetal, polyether, polyester, poly(orthoester), polycyanoacrylate, polyvinyl alcohol, polyurethane, polyphosphazene, polyacrylate, polymethacrylate, polycyanoacrylate, polyurea, polystyrene, polyamine, polyester, polyanhydride, polyether, polyurethane, polymethacrylate, polyacrylate, polycyanoacrylate, or combinations thereof.

[0402] In some embodiments, the nanoparticles may be nanoparticle-nucleic acid hybrid structures with a dense layer of nucleic acid. As a non-limiting example, the nanoparticle-nucleic acid hybrid structures can be made by the methods described in US Patent Publication No. 20130171646, the entire contents of which are incorporated herein by reference. The nanoparticles may include nucleic acids, such as, but not limited to, polynucleotides described herein and / or known in the art.

[0403] At least one of the nanoparticles of the present invention can be embedded in a core nanostructure or can be covered with a low-density porous 3D structure or coating that can carry or associate at least one payload within or on the nanostructure.Non-limiting examples of nanostructures that include at least one nanoparticle are described in International Publication No. WO2013123523, the entire contents of which are incorporated herein by reference.

[0404] Vaccine administration method RSV RNA (e.g., mRNA) vaccines may be administered by any route that results in a therapeutically effective outcome. These include, but are not limited to, intradermal, intramuscular, intranasal and / or subcutaneous administration. The present disclosure provides a method that includes administering an RNA vaccine to a subject in need thereof. The exact amount required may vary from subject to subject, depending on the species, age and general condition of the subject, the severity of the disease, the particular composition, its mode of administration, its mode of activity, and the like. RSV RNA (e.g., mRNA) vaccine compositions are typically formulated in unit dosage form for ease of administration and uniformity of dose. However, it will be understood that the total daily dose of RSV RNA (e.g., mRNA) vaccine composition may be determined by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose levels, prophylactically effective dose levels, appropriate imaging dose levels for any particular patient will depend on a variety of factors, including the disease being treated and the severity of the disease, the activity of the particular compound employed, the particular composition employed, the age, weight, general condition, sex, and diet of the patient, the time of administration, route of administration and rate of excretion of the particular compound employed, the duration of treatment, drugs used in combination or concomitantly with the particular compound employed, and similar factors well known in the medical arts.

[0405] In some embodiments, the RSV RNA (e.g., mRNA) vaccine composition is administered at a dose of 0.0001 mg / kg to 100 mg / kg, 0.001 mg / kg to 0.05 mg / kg, 0.005 mg / kg to 0.05 mg / kg, 0.001 mg / kg to 0.005 mg / kg, 0.05 mg / kg to 0.5 mg / kg, 0.01 mg / kg to 50 mg / kg, 0.1 mg / kg to 40 mg / kg, 0.5 mg / kg to 30 mg / kg per kg of subject body weight per day. , 0.01 mg / kg to 10 mg / kg, 0.1 mg / kg to 10 mg / kg, or 1 mg / kg to 25 mg / kg, once or more per day, once or more per week, once or more per month, etc., at dosage levels sufficient to deliver the desired therapeutic, diagnostic, prophylactic, or imaging effect (see, e.g., unit dose ranges set forth in International Publication No. WO2013078199, incorporated herein by reference in its entirety). The desired dose may be delivered three times per day, twice per day, once per day, once every other day, once every third day, weekly, every two weeks, every three weeks, every four weeks, every two months, every three months, every six months, etc. In certain embodiments, the desired dose may be delivered using multiple administrations (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or more administrations). When multiple administrations are employed, split dosing regimens such as those described herein may be used. In exemplary embodiments, a RSV RNA (e.g., mRNA) vaccine composition can be administered at a dosage level sufficient to deliver between 0.0005 mg / kg and 0.01 mg / kg, e.g., between about 0.0005 mg / kg and about 0.0075 mg / kg, e.g., about 0.0005 mg / kg, about 0.001 mg / kg, about 0.002 mg / kg, about 0.003 mg / kg, about 0.004 mg / kg, or about 0.005 mg / kg.

[0406] In some embodiments, a RSV RNA (e.g., mRNA) vaccine composition may be administered once or twice (or more) at a dosage level sufficient to deliver 0.025 mg / kg to 0.250 mg / kg, 0.025 mg / kg to 0.500 mg / kg, 0.025 mg / kg to 0.750 mg / kg, or 0.025 mg / kg to 1.0 mg / kg.

[0407] In some embodiments, the RSV RNA (e.g., mRNA) vaccine composition comprises: g, 0.825 mg, 0.850 mg, 0.875 mg, 0.900 mg, 0.925 mg, 0.950 mg, 0.975 mg, or 1.0 mg total dose or a dose level sufficient to deliver these total doses, may be administered twice (e.g., on days 0 and 7, 0 and 14, 0 and 21, 0 and 28, 0 and 60, 0 and 90, 0 and 120, 0 and 150, 0 and 180, 0 and 3 months, 0 and 6 months, 0 and 9 months, 0 and 12 months, 0 and 18 months, 0 and 2 years, 0 and 5 years, or 0 and 10 years). Higher and lower doses and administration frequencies are encompassed by the present disclosure. For example, a RSV RNA (e.g., mRNA) vaccine composition may be administered three or four times.

[0408] In some embodiments, the RSV RNA (e.g., mRNA) vaccine composition may be administered twice (e.g., on days 0 and 7, 0 and 14, 0 and 21, 0 and 28, 0 and 60, 0 and 90, 0 and 120, 0 and 150, 0 and 180, 0 and 3 months, 0 and 6 months, 0 and 9 months, 0 and 12 months, 0 and 18 months, 0 and 2 years, 0 and 5 years, or 0 and 10 years) at a total dose of 0.010 mg, 0.025 mg, 0.100 mg, or 0.400 mg, or at a dose level sufficient to deliver these total doses.

[0409] In some embodiments, the RSV RNA (e.g., mRNA) vaccine used in the method of vaccinating a subject is administered to the subject in an amount effective for vaccinating the subject, such as a single dose of 10 μg / kg to 400 μg / kg of the nucleic acid vaccine. In some embodiments, the RNA vaccine used in the method of vaccinating a subject is administered to the subject in an amount effective for vaccinating the subject, such as a single dose of 10 μg to 400 μg of the nucleic acid vaccine. In some embodiments, the RSV RNA (e.g., mRNA) vaccine used in the method of vaccinating a subject is administered to the subject in a single dose of 25 to 1000 μg (e.g., a single dose of mRNA encoding a RSV antigen). In some embodiments, the RSV RNA vaccine is administered to a subject as a single dose of 25, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, or 1000 μg. For example, the RSV RNA vaccine can be administered to a subject as a single dose of 25-100, 25-500, 50-100, 50-500, 50-1000, 100-500, 100-1000, 250-500, 250-1000, or 500-1000 μg. In some embodiments, the RSV RNA (e.g., mRNA) vaccine used in the method of vaccinating a subject is administered to the subject as two doses, the combined doses being equivalent to 25-1000 μg of the RSV RNA (e.g., mRNA) vaccine.

[0410] The RSV RNA (e.g., mRNA) vaccine pharmaceutical compositions described herein can be formulated into dosage forms described herein, such as intranasal, intratracheal, or injectable (e.g., intravenous, intraocular, intravitreal, intramuscular, intradermal, intracardiac, intraperitoneal, and subcutaneous).

[0411] RSV RNA Vaccine Formulations and Methods of Use Some embodiments of the present disclosure provide for the formulation of a RSV RNA (e.g., mRNA) vaccine, wherein the RSV RNA vaccine is formulated in an amount effective to generate an antigen-specific immune response in a subject (e.g., the production of antibodies specific for an anti-RSV antigenic polypeptide). An "effective amount" is a dose of a RSV RNA (e.g., mRNA) vaccine effective to generate an antigen-specific immune response. Also provided herein is a method of inducing an antigen-specific immune response in a subject.

[0412] In some embodiments, the antigen-specific immune response is characterized by measuring the titer of anti-RSV antigenic polypeptide antibodies produced in a subject administered with the RSV RNA (e.g., mRNA) vaccine provided herein. Antibody titer is a measure of the amount of antibodies in a subject, e.g., the amount of antibodies specific to a particular antigen (e.g., anti-RSV antigenic polypeptide) or epitope of an antigen. Antibody titer is typically expressed as the reciprocal of the highest dilution that produces a positive result. For example, enzyme-linked immunosorbent assay (ELISA) is a common assay for determining antibody titer.

[0413] In some embodiments, antibody titers are used to assess whether a subject is infected or to determine whether immunization is required. In some embodiments, antibody titers are used to determine the strength of an autoimmune response, to determine whether a booster immunization is required, to determine whether a previous vaccine was effective, and to identify any recent or previous infections. According to the present disclosure, antibody titers are used to determine the strength of the immune response induced in a subject by a RSV RNA (e.g., mRNA) vaccine.

[0414] In some embodiments, the titer of the anti-RSV antigenic polypeptide antibody produced in the subject is increased by at least 1 log compared to a control (e.g., a control vaccine). For example, the titer of the anti-RSV antigenic polypeptide antibody produced in the subject may be increased by at least 1.5, at least 2, at least 2.5, or at least 3 logs compared to a control (e.g., a control vaccine). In some embodiments, the titer of the anti-RSV antigenic polypeptide antibody produced in the subject is increased by 1, 1.5, 2, 2.5, or 3 logs compared to a control (e.g., a control vaccine). In some embodiments, the titer of the anti-RSV antigenic polypeptide antibody produced in the subject is increased by 1 to 3 logs compared to a control (e.g., a control vaccine). For example, the titer of the anti-RSV antigenic polypeptide antibody produced in the subject may be increased by 1 to 1.5, 1 to 2, 1 to 2.5, 1 to 3, 1.5 to 2, 1.5 to 2.5, 1.5 to 3, 2 to 2.5, 2 to 3, or 2.5 to 3 logs compared to a control (e.g., a control vaccine).

[0415] In some embodiments, the titer of anti-RSV antigenic polypeptide antibodies produced in a subject is increased by at least 2-fold compared to a control (e.g., a control vaccine). For example, the titer of anti-RSV antigenic polypeptide antibodies produced in a subject can be increased by at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, or at least 10-fold compared to a control (e.g., a control vaccine). In some embodiments, the titer of anti-RSV antigenic polypeptide antibodies produced in a subject is increased by 2, 3, 4, 5, 6, 7, 8, 9, or 10-fold compared to a control (e.g., a control vaccine). In some embodiments, the titer of anti-RSV antigenic polypeptide antibodies produced in a subject is increased by 2-10-fold compared to a control (e.g., a control vaccine). For example, the titer of anti-RSV antigenic polypeptide antibodies produced in a subject may be increased by 2-10, 2-9, 2-8, 2-7, 2-6, 2-5, 2-4, 2-3, 3-10, 3-9, 3-8, 3-7, 3-6, 3-5, 3-4, 4-10, 4-9, 4-8, 4-7, 4-6, 4-5, 5-10, 5-9, 5-8, 5-7, 5-6, 6-10, 6-9, 6-8, 6-7, 7-10, 7-9, 7-8, 8-10, 8-9, or 9-10 times compared to a control (e.g., a control vaccine).

[0416] In some embodiments, the control is the titer of anti-RSV antigenic polypeptide antibodies produced in a subject who has not received a RSV RNA (e.g., mRNA) vaccine. In some embodiments, the control is the titer of anti-RSV antigenic polypeptide antibodies produced in a subject who has received a live attenuated RSV vaccine. Attenuated vaccines are viable (live) vaccines made by reducing toxicity. Attenuated viruses are modified to be harmless or less virulent compared to unmodified live viruses. In some embodiments, the control is the titer of anti-RSV antigenic polypeptide antibodies produced in a subject who has received an inactivated RSV vaccine. In some embodiments, the control is the titer of anti-RSV antigenic polypeptide antibodies produced in a subject who has received a recombinant or purified RSV protein vaccine. Recombinant protein vaccines typically contain either protein antigens produced in heterologous expression systems (e.g., bacteria or yeast) or protein antigens purified from large amounts of pathogenic organisms. In some embodiments, the control is the titer of anti-RSV antigenic polypeptide antibodies produced in a subject who has received a RSV virus-like particle (VLP) vaccine (e.g., a particle that contains viral capsid proteins but does not contain a viral genome and therefore cannot replicate / produce progeny virus). In some embodiments, the control is a VLP RSV vaccine that contains pre-fusion or post-fusion F proteins, or a combination of the two.

[0417] In some embodiments, the effective amount of the RSV RNA (e.g., mRNA) vaccine is a smaller dose than the standard of care dose of the recombinant RSV protein vaccine. As provided herein, the "standard of care" refers to medical or psychological treatment guidelines and can be general or specific. The "standard of care" defines the appropriate treatment based on scientific evidence and collaboration between medical professionals involved in the treatment of a given condition. It is the diagnostic and treatment process that a physician / clinician should follow for a particular type of patient, disease, or clinical setting. As described herein, a "standard of care dose" is a dose of a recombinant or purified RSV protein vaccine, or a live attenuated or inactivated RSV vaccine, or a RSV VLP vaccine, that a physician / clinician or other medical professional administers to a subject to treat or prevent RSV or a RSV-related condition while following standard of care guidelines for treating or preventing RSV or a RSV-related condition.

[0418] In some embodiments, the titer of anti-RSV antigenic polypeptide antibodies produced in a subject administered an effective amount of a RSV RNA vaccine is comparable to the titer of anti-RSV antigenic polypeptide antibodies produced in a control subject administered a standard therapeutic dose of a recombinant or purified RSV protein vaccine, or a live attenuated or inactivated RSV vaccine, or a RSV VLP vaccine.

[0419] In some embodiments, an effective amount of a RSV RNA (e.g., mRNA) vaccine is equivalent to a dose that is at least 2 times lower than the standard therapeutic dose of a recombinant or purified RSV protein vaccine. For example, an effective amount of a RSV RNA vaccine can be equivalent to a dose that is at least 3 times lower than the standard therapeutic dose of a recombinant or purified RSV protein vaccine, at least 4 times lower than the standard therapeutic dose of a recombinant or purified RSV protein vaccine, at least 7 times lower than the standard therapeutic dose of a recombinant or purified RSV protein vaccine, at least 8 times lower than the standard therapeutic dose of a recombinant or purified RSV protein vaccine, at least 9 times lower than the standard therapeutic dose of a recombinant or purified RSV protein vaccine, at least 10 .... In some embodiments, an effective amount of a RSV RNA vaccine is a dose equivalent to a standard therapeutic dose of a recombinant or purified RSV protein vaccine reduced by 1 / 2, 1 / 3, 1 / 4, 1 / 5, 1 / 6, 1 / 7, 1 / 8, 1 / 9, 1 / 10, 1 / 20, 1 / 50, 1 / 100, 1 / 250, 1 / 500, or 1 / 1000. In some embodiments, the titer of anti-RSV antigenic polypeptide antibodies produced in a subject administered an effective amount of a RSV RNA vaccine is equivalent to the titer of anti-RSV antigenic polypeptide antibodies produced in a control subject administered a standard therapeutic dose of a recombinant or protein RSV protein vaccine, or a live attenuated or inactivated RSV vaccine, or a RSV VLP vaccine. In some embodiments, an effective amount of a RSV RNA (e.g., mRNA) vaccine is a dose equivalent to a standard therapeutic dose of a recombinant or purified RSV protein vaccine reduced by 1 / 2 to 1 / 1000 (e.g., 1 / 2 to 1 / 100, 1 / 10 to 1 / 1000), and the titer of anti-RSV antigenic polypeptide antibodies produced in the subject is equivalent to the titer of anti-RSV antigenic polypeptide antibodies produced in a control subject administered a standard therapeutic dose of a recombinant or purified RSV protein vaccine, or a live attenuated or inactivated RSV vaccine, or a RSV VLP vaccine.

[0420] In some embodiments, an effective amount of a RSV RNA (e.g., mRNA) vaccine is 1 / 2 to 1 / 1000, 1 / 2 to 1 / 900, 1 / 2 to 1 / 800, 1 / 2 to 1 / 700, 1 / 2 to 1 / 600, 1 / 2 to 1 / 500, 1 / 2 to 1 / 400, 1 / 2 to 1 / 300, 1 / 2 to 1 / 200, 1 / 2 to 1 / 100, 1 / 2 to 1 / 90, 1 / 2 to 1 / 80, 1 / 2 to 1 / 70, 1 / 2 to 1 / 60, 1 / 2 to 1 / 50, 1 / 2 to 1 / 40, 1 / 2 to 1 / 30, 1 / 2 to 1 / 20, 1 / 2 to 1 / 10, 1 / 2 to 1 / 9, 1 / 2 to 1 / 8, 1 / 2~1 / 7, 1 / 2~1 / 6, 1 / 2~1 / 5, 1 / 2~1 / 4, 1 / 2~1 / 3, 1 / 3~1 / 1000, 1 / 3~1 / 900, 1 / 3~1 / 800, 1 / 3~1 / 700, 1 / 3~1 / 600, 1 / 3~1 / 500, 1 / 3~1 / 400, 1 / 3~1 / 300, 1 / 3~1 / 200, 1 / 3~1 / 100, 1 / 3~1 / 90, 1 / 3~1 / 80, 1 / 3~1 / 70, 1 / 3~1 / 60, 1 / 3~1 / 50, 1 / 3~1 / 40, 1 / 3~1 / 30, 1 / 3~1 / 20, 1 / 3~1 / 10, 1 / 3~1 / 9, 1 / 3~1 / 8, 1 / 3~1 / 7 , 1 / 3~1 / 6, 1 / 3~1 / 5, 1 / 3~1 / 4, 1 / 4~1 / 1000, 1 / 4~1 / 900, 1 / 4~1 / 800, 1 / 4~1 / 700, 1 / 4~1 / 600, 1 / 4~1 / 500, 1 / 4~1 / 400, 1 / 4~1 / 400, 1 / 4~1 / 200, 1 / 4~1 / 100, 1 / 4~1 / 90, 1 / 4~1 / 80, 1 / 4~1 / 70, 1 / 4~1 / 60, 1 / 4~1 / 50, 1 / 4~1 / 40, 1 / 4~1 / 30, 1 / 4~1 / 20, 1 / 4~1 / 10, 1 / 4~1 / 9, 1 / 4~1 / 8, 1 / 4~1 / 7, 1 / 4~1 / 6, 1 / 4~1 / 5, 1 / 4~1 / 4, 1 / 5~1 / 1000, 1 / 5~1 / 900, 1 / 5~1 / 800, 1 / 5~1 / 700, 1 / 5~1 / 600, 1 / 5~1 / 500, 1 / 5~1 / 400, 1 / 5~1 / 300, 1 / 5~1 / 200, 1 / 5~1 / 100, 1 / 5~1 / 90, 1 / 5~1 / 80, 1 / 5~1 / 70, 1 / 5~1 / 60, 1 / 5~1 / 50, 1 / 5~1 / 40, 1 / 5~1 / 30, 1 / 5~1 / 20, 1 / 5~1 / 10, 1 / 5~1 / 9, 1 / 5~1 / 8, 1 / 5~1 / 7, 1 / 5~1 / 6, 1 / 6~1 / 1000, 1 / 6~1 / 900,1 / 6~1 / 800、1 / 6~1 / 700、1 / 6~1 / 600、1 / 6~1 / 500、1 / 6~1 / 400、1 / 6~1 / 300、1 / 6~1 / 200、1 / 6~1 / 100、1 / 6~1 / 90、1 / 6~1 / 80、1 / 6~1 / 70、1 / 6~1 / 60、1 / 6~1 / 50、1 / 6~1 / 40、1 / 6~1 / 30、1 / 6~1 / 20、1 / 6~1 / 10、1 / 6~1 / 9、1 / 6~1 / 8、1 / 6~1 / 7、1 / 7~1 / 1000、1 / 7~1 / 900、1 / 7~1 / 800、1 / 7~1 / 700、1 / 7~1 / 600、1 / 7~1 / 500、1 / 7~1 / 400、1 / 7~1 / 300、1 / 7~1 / 200、1 / 7~1 / 100、1 / 7~1 / 90、1 / 7~1 / 80、1 / 7~1 / 70、1 / 7~1 / 60、1 / 7~1 / 50、1 / 7~1 / 40、1 / 7~1 / 30、1 / 7~1 / 20、1 / 7~1 / 10、1 / 7~1 / 9、1 / 7~1 / 8、1 / 8~1 / 1000、1 / 8~1 / 900、1 / 8~1 / 800、1 / 8~1 / 700、1 / 8~1 / 600、1 / 8~1 / 500、1 / 8~1 / 400、1 / 8~1 / 300、1 / 8~1 / 200、1 / 8~1 / 100、1 / 8~1 / 90、1 / 8~1 / 80、1 / 8~1 / 70、1 / 8~1 / 60、1 / 8~1 / 50、1 / 8~1 / 40、1 / 8~1 / 30、1 / 8~1 / 20、1 / 8~1 / 10、1 / 8~1 / 9、1 / 9~1 / 1000、1 / 9~1 / 900、1 / 9~1 / 800、1 / 9~1 / 700、1 / 9~1 / 600、1 / 9~1 / 500、1 / 9~1 / 400、1...

Claims

1. A respiratory syncytial virus (RSV) vaccine comprising at least one ribonucleic acid (RNA) polynucleotide having an open reading frame encoding at least one RSV antigenic polypeptide or immunogenic fragment thereof, and a pharma- ceutically acceptable carrier.

2. 2. The RSV vaccine of claim 1, wherein the at least one antigenic polypeptide is glycoprotein G or an immunogenic fragment thereof.

3. 2. The RSV vaccine of claim 1, wherein the at least one antigenic polypeptide is glycoprotein F or an immunogenic fragment thereof.

4. The RSV vaccine of any one of claims 1 to 3, further comprising an adjuvant.

5. 2. The RSV vaccine of claim 1, wherein the at least one RNA polynucleotide is encoded by at least one nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1, 2, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, and 27, and / or the at least one RNA polynucleotide comprises at least one nucleic acid sequence of any of SEQ ID NOs: 260-280.

6. 2. The RSV vaccine of claim 1, wherein the at least one RNA polynucleotide is encoded by at least one fragment of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1, 2, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, and 27, and / or the at least one RNA polynucleotide comprises at least one fragment of a nucleic acid sequence of any of SEQ ID NOs: 260-280.

7. 2. The RSV vaccine of claim 1, wherein the amino acid sequence of the RSV antigenic polypeptide is an amino acid sequence selected from the group consisting of SEQ ID NOs: 3, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26 and 28.

8. The RSV vaccine of any one of claims 1 to 7, wherein the open reading frame is codon optimized.

9. The RSV vaccine of any one of claims 1 to 8, which is multivalent.

10. The RSV vaccine of any one of claims 1 to 9, wherein the at least one RNA polynucleotide encodes at least two antigenic polypeptides.

11. The RSV vaccine of claim 10 , wherein the at least one RNA polynucleotide encodes at least 10 antigenic polypeptides.

12. 12. The RSV vaccine of claim 11, wherein the at least one RNA polynucleotide encodes at least 100 antigenic polypeptides.

13. The RSV vaccine of any one of claims 1 to 9, wherein the at least one RNA polynucleotide encodes between 2 and 100 antigenic polypeptides.

14. The RSV vaccine of any one of claims 1 to 13, wherein the at least one RNA polynucleotide comprises at least one chemical modification.

15. 15. The RSV vaccine of claim 14, wherein the chemical modification is selected from the group consisting of pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine and 2'-O-methyluridine.

16. The RSV vaccine of any one of claims 1 to 15, formulated in nanoparticles.

17. 17. The RSV vaccine of claim 16, wherein the nanoparticles have an average diameter of 50-200 nm.

18. 18. The RSV vaccine of claim 16 or 17, wherein the nanoparticle is a lipid nanoparticle.

19. 20. The RSV vaccine of claim 18, wherein the lipid nanoparticle comprises a cationic lipid, a PEG-modified lipid, a sterol, and a non-cationic lipid.

20. 20. The RSV vaccine of claim 19, wherein the cationic lipid is an ionic cationic lipid, the non-cationic lipid is a neutral lipid, and the sterol is cholesterol.

21. 21. The RSV vaccine of claim 20, wherein the cationic lipid is selected from the group consisting of 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), di((Z)-non-2-en-1-yl) 9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), (12Z,15Z)-N,N-dimethyl-2-nonylhenicosa-12,15-dien-1-amine (L608), and N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]heptadecan-8-amine (L530).

22. The RSV vaccine of any one of claims 16 to 21, wherein the nanoparticles have a polydispersity value of less than 0.

4.

23. 22. The RSV vaccine of any one of claims 16 to 21, wherein the nanoparticles have a neutral net charge at neutral pH values.

24. An RSV vaccine comprising at least one ribonucleic acid (RNA) polynucleotide having an open reading frame encoding at least one RSV antigenic polypeptide, at least one 5'-end cap, and at least one chemical modification, formulated within a lipid nanoparticle.

25. 25. The RSV vaccine of claim 24, wherein the 5' end cap is 7mG(5')ppp(5')NlmpNp.

26. 26. The RSV vaccine of claim 24 or 25, wherein the at least one chemical modification is selected from the group consisting of pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 5-methyluridine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine and 2'-O-methyluridine.

27. The RSV vaccine of any one of claims 16 to 26, wherein the lipid nanoparticle comprises a cationic lipid, a PEG-modified lipid, a sterol, and a non-cationic lipid.

28. 28. The RSV vaccine of claim 27, wherein the cationic lipid is an ionic cationic lipid, the non-cationic lipid is a neutral lipid, and the sterol is cholesterol.

29. 29. The RSV vaccine of claim 28, wherein the cationic lipid is selected from the group consisting of 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), di((Z)-nona-2-en-1-yl)9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), (12Z,15Z)-N,N-dimethyl-2-nonylhenicosa-12,15-dien-1-amine (L608), and N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]heptadecan-8-amine (L530).

30. 1. An RSV vaccine comprising at least one ribonucleic acid (RNA) polynucleotide having an open reading frame encoding at least one RSV antigenic polypeptide, wherein at least 80% of the uracils in said open reading frame have a chemical modification.

31. 31. The RSV vaccine of claim 30, wherein 100% of the uracils in the open reading frame have a chemical modification.

32. 32. The RSV vaccine of claim 30 or 31, wherein the chemical modification is at the 5 position of the uracil.

33. The RSV vaccine of any one of claims 30 to 32, wherein the chemical modification is N1-methylpseudouridine.

34. The RSV vaccine of any one of claims 30 to 33, formulated in a lipid nanoparticle.

35. A method for inducing an antigen-specific immune response in a subject, comprising administering to the subject an RSV vaccine described in any one of claims 1 to 34 in an amount effective to produce an antigen-specific immune response.

36. 36. The method of claim 35, wherein the antigen-specific immune response comprises a T cell response.

37. 36. The method of claim 35, wherein the antigen-specific immune response comprises a B cell response.

38. The method of any one of claims 35 to 37, wherein the method of inducing an antigen-specific immune response involves a single administration of an RSV vaccine.

39. 38. The method of any one of claims 35 to 37, further comprising administering a booster dose of the vaccine.

40. The method of any one of claims 35 to 39, wherein the vaccine is administered to the subject by intradermal or intramuscular injection.

41. 35. The RSV vaccine of any one of claims 1 to 34 for use in a method for inducing an antigen-specific immune response in a subject, the method comprising administering the RSV vaccine to the subject in an amount effective to produce an antigen-specific immune response.

42. The RSV vaccine of any one of claims 1 to 34 in the manufacture of a medicament for use in a method for inducing an antigen-specific immune response in a subject, the method comprising administering the RSV vaccine to the subject in an amount effective to produce an antigen-specific immune response.

43. 4. The RSV vaccine of claim 3, wherein the glycoprotein F or an immunogenic fragment thereof is designed to maintain a pre-fusion conformation.

44. The RSV vaccine of any one of claims 1 to 34, formulated in an amount effective to generate an antigen-specific immune response in a subject.

45. 45. The RSV vaccine of claim 44, wherein the titer of anti-RSV antigenic polypeptide antibodies produced in the subject is increased by at least 1 log compared to a control.

46. 46. ​​The RSV vaccine of claim 45, wherein the titer of anti-RSV antigenic polypeptide antibodies produced in the subject is increased by 1-3 logs compared to a control.

47. 45. The RSV vaccine of claim 44, wherein the titer of anti-RSV antigenic polypeptide antibodies produced in the subject is increased by at least 2-fold compared to a control.

48. 48. The RSV vaccine of claim 47, wherein the titer of anti-RSV antigenic polypeptide antibodies produced in the subject is increased by at least 5-fold compared to a control.

49. 49. The RSV vaccine of claim 48, wherein the titer of anti-RSV antigenic polypeptide antibodies produced in the subject is increased by at least 10-fold compared to a control.

50. 48. The RSV vaccine of claim 47, wherein the titer of anti-RSV antigenic polypeptide antibodies produced in the subject is increased by 2-10 fold compared to a control.

51. The RSV vaccine of any one of claims 44 to 50, wherein the control is the titer of anti-RSV antigenic polypeptide antibodies produced in a subject who has not received the RSV vaccine.

52. The RSV vaccine of any one of claims 44-50, wherein the control is a titer of anti-RSV antigenic polypeptide antibodies produced in a subject who has received a live-attenuated RSV vaccine or an inactivated RSV vaccine.

53. The RSV vaccine of any one of claims 44 to 50, wherein the control is the titer of anti-RSV antigenic polypeptide antibodies produced in a subject who has been administered a recombinant or purified RSV protein vaccine.

54. The RSV vaccine of any one of claims 44 to 50, wherein the control is a titer of anti-RSV antigenic polypeptide antibodies produced in a subject who has received an RSV virus-like particle (VLP) vaccine.

55. The RSV vaccine of any one of claims 44 to 54, wherein the effective amount is a dose equivalent to a standard therapeutic dose of a recombinant RSV protein vaccine reduced by at least half, and the titer of anti-RSV antigenic polypeptide antibodies produced in the subject is equivalent to the titer of anti-RSV antigenic polypeptide antibodies produced in a control subject administered a standard therapeutic dose of a recombinant or purified RSV protein vaccine, or a live-attenuated or inactivated RSV vaccine, or an RSV VLP vaccine.

56. 56. The RSV vaccine of claim 55, wherein the effective amount is a dose equivalent to a standard therapeutic dose of a recombinant RSV protein vaccine reduced by at least 4-fold, and the titer of anti-RSV antigenic polypeptide antibodies produced in the subject is equivalent to the titer of anti-RSV antigenic polypeptide antibodies produced in a control subject administered a standard therapeutic dose of a recombinant or purified RSV protein vaccine, or a live-attenuated or inactivated RSV vaccine, or an RSV VLP vaccine.

57. 57. The RSV vaccine of claim 56, wherein the effective amount is a dose equivalent to a standard therapeutic dose of a recombinant RSV protein vaccine reduced by at least 10-fold, and the titer of anti-RSV antigenic polypeptide antibodies produced in the subject is equivalent to the titer of anti-RSV antigenic polypeptide antibodies produced in a control subject administered a standard therapeutic dose of a recombinant or purified RSV protein vaccine, or a live-attenuated or inactivated RSV vaccine, or an RSV VLP vaccine.

58. 58. The RSV vaccine of claim 57, wherein the effective amount is a dose equivalent to a standard therapeutic dose of a recombinant RSV protein vaccine reduced by at least 100-fold, and the titer of anti-RSV antigenic polypeptide antibodies produced in the subject is equivalent to the titer of anti-RSV antigenic polypeptide antibodies produced in a control subject administered a standard therapeutic dose of a recombinant or purified RSV protein vaccine, or a live-attenuated or inactivated RSV vaccine, or an RSV VLP vaccine.

59. 59. The RSV vaccine of claim 58, wherein the effective amount is a dose equivalent to a standard therapeutic dose of a recombinant RSV protein vaccine reduced by at least 1 / 1000, and the titer of anti-RSV antigenic polypeptide antibodies produced in the subject is equivalent to the titer of anti-RSV antigenic polypeptide antibodies produced in a control subject administered a standard therapeutic dose of a recombinant or purified RSV protein vaccine, or a live-attenuated or inactivated RSV vaccine, or an RSV VLP vaccine.

60. 56. The RSV vaccine of claim 55, wherein the effective amount is a dose equivalent to a standard therapeutic dose of a recombinant RSV protein vaccine reduced by 1 / 2 to 1 / 1000, and the titer of anti-RSV antigenic polypeptide antibodies produced in the subject is equivalent to the titer of anti-RSV antigenic polypeptide antibodies produced in a control subject administered a standard therapeutic dose of a recombinant or purified RSV protein vaccine, or a live-attenuated or inactivated RSV vaccine, or an RSV VLP vaccine.

61. 61. The RSV vaccine of any one of claims 44-60, wherein the effective amount is a total dose of 25-1000 μg or 50-1000 μg.

62. 62. The RSV vaccine of claim 61, wherein the effective amount is a total dose of 100 μg.

63. 62. The RSV vaccine of claim 61, wherein the effective amount is a dose of 25 μg administered to the subject a total of two times.

64. 62. The RSV vaccine of claim 61, wherein the effective amount is a dose of 100 μg administered to the subject a total of two times.

65. 62. The RSV vaccine of claim 61, wherein the effective amount is a dose of 400 μg administered to the subject a total of two times.

66. 62. The RSV vaccine of claim 61, wherein the effective amount is a dose of 500 μg administered to the subject a total of two times.

67. 67. The RSV vaccine of any one of claims 44-66, wherein the effective amount of the RSV vaccine results in a 5-200 fold increase in serum neutralizing antibodies against RSV compared to a control.

68. 68. The RSV vaccine of claim 67, wherein a single dose of the RSV vaccine results in about a 2-10 fold increase in serum neutralizing antibodies against RSV compared to a control.

69. 69. The RSV vaccine of claim 68, wherein a single dose of the RSV vaccine results in about a 5-fold increase in serum neutralizing antibodies to RSV compared to a control.

70. 36. The method of claim 35, wherein the titer of anti-RSV antigenic polypeptide antibodies produced in the subject is increased by at least 1 log compared to a control.

71. 71. The method of claim 70, wherein the titer of anti-RSV antigenic polypeptide antibodies produced in the subject is increased by 1-3 logs compared to a control.

72. 71. The method of claim 70, wherein the titer of anti-RSV antigenic polypeptide antibodies produced in the subject is increased by at least 2-fold compared to a control.

73. 73. The method of claim 72, wherein the titer of anti-RSV antigenic polypeptide antibodies produced in the subject is increased by at least 5-fold compared to a control.

74. 74. The method of claim 73, wherein the titer of anti-RSV antigenic polypeptide antibodies produced in the subject is increased by at least 10-fold compared to a control.

75. 73. The method of claim 72, wherein the titer of anti-RSV antigenic polypeptide antibodies produced in the subject is increased by 2-10 fold compared to a control.

76. The method of any one of claims 70-75, wherein the control is the titer of anti-RSV antigenic polypeptide antibodies produced in a subject who has not received an RSV vaccine.

77. The method of any one of claims 70 to 75, wherein the control is a titer of anti-RSV antigenic polypeptide antibodies produced in a subject who has received a live-attenuated RSV vaccine or an inactivated RSV vaccine.

78. The method of any one of claims 70-75, wherein the control is the titer of anti-RSV antigenic polypeptide antibodies produced in a subject who has been administered a recombinant or purified RSV protein vaccine.

79. The method of any one of claims 70-75, wherein the control is a titer of anti-RSV antigenic polypeptide antibodies produced in a subject who has received an RSV VLP vaccine.

80. The method of any one of claims 70 to 75, wherein the effective amount is a dose equivalent to at least a half-reduction in a standard therapeutic dose of a recombinant RSV protein vaccine, and the titer of anti-RSV antigenic polypeptide antibodies produced in the subject is equivalent to the titer of anti-RSV antigenic polypeptide antibodies produced in a control subject administered a standard therapeutic dose of a recombinant RSV protein vaccine, or a live attenuated RSV vaccine, or an RSV VLP vaccine.

81. The method of claim 80, wherein the effective amount is a dose equivalent to at least a quarter of a standard therapeutic dose of a recombinant RSV protein vaccine, and the titer of anti-RSV antigenic polypeptide antibodies produced in the subject is equivalent to the titer of anti-RSV antigenic polypeptide antibodies produced in a control subject administered a standard therapeutic dose of a recombinant or purified RSV protein vaccine, or a live-attenuated or inactivated RSV vaccine, or an RSV VLP vaccine.

82. The method of claim 81, wherein the effective amount is a dose equivalent to a standard therapeutic dose of a recombinant RSV protein vaccine reduced by at least 10-fold, and the titer of anti-RSV antigenic polypeptide antibodies produced in the subject is equivalent to the titer of anti-RSV antigenic polypeptide antibodies produced in a control subject administered a standard therapeutic dose of a recombinant or purified RSV protein vaccine, or a live-attenuated or inactivated RSV vaccine, or an RSV VLP vaccine.

83. The method of claim 82, wherein the effective amount is a dose equivalent to a standard therapeutic dose of a recombinant RSV protein vaccine reduced by at least 100-fold, and the titer of anti-RSV antigenic polypeptide antibodies produced in the subject is equivalent to the titer of anti-RSV antigenic polypeptide antibodies produced in a control subject administered a standard therapeutic dose of a recombinant or purified RSV protein vaccine, or a live-attenuated or inactivated RSV vaccine, or an RSV VLP vaccine.

84. The method of claim 83, wherein the effective amount is a dose equivalent to a standard therapeutic dose of a recombinant RSV protein vaccine reduced by at least 1 / 1000, and the titer of anti-RSV antigenic polypeptide antibodies produced in the subject is equivalent to the titer of anti-RSV antigenic polypeptide antibodies produced in a control subject administered a standard therapeutic dose of a recombinant or purified RSV protein vaccine, or a live-attenuated or inactivated RSV vaccine, or an RSV VLP vaccine.

85. The method of claim 80, wherein the effective amount is a dose equivalent to a 2- to 1000-fold reduced standard therapeutic dose of a recombinant RSV protein vaccine, and the titer of anti-RSV antigenic polypeptide antibodies produced in the subject is equivalent to the titer of anti-RSV antigenic polypeptide antibodies produced in a control subject administered a standard therapeutic dose of a recombinant or purified RSV protein vaccine, or a live-attenuated or inactivated RSV vaccine, or an RSV VLP vaccine.

86. 86. The method of any one of claims 70 to 85, wherein the effective amount is a total dose of 50 to 1000 μg.

87. 87. The method of claim 86, wherein the effective amount is a total dose of 100 μg.

88. 87. The method of claim 86, wherein the effective amount is a dose of 25 μg administered to the subject a total of two times.

89. 87. The method of claim 86, wherein the effective amount is a dose of 100 μg administered to the subject a total of two times.

90. 87. The method of claim 86, wherein the effective amount is a dose of 400 μg administered to the subject a total of two times.

91. 87. The method of claim 86, wherein the effective amount is a dose of 500 μg administered to the subject a total of two times.

92. 92. The method of any one of claims 70-91, wherein the efficacy of the vaccine against RSV is greater than 60%.

93. 93. The method of claim 92, wherein the efficacy of the vaccine against RSV is greater than 65%.

94. 94. The method of claim 93, wherein the efficacy of the vaccine against RSV is greater than 70%.

95. 95. The method of claim 94, wherein the efficacy of the vaccine against RSV is greater than 75%.

96. 96. The method of claim 95, wherein the efficacy of the vaccine against RSV is greater than 80%.

97. 97. The method of claim 96, wherein the efficacy of the vaccine against RSV is greater than 85%.

98. 98. The method of claim 97, wherein the efficacy of the vaccine against RSV is greater than 90%.

99. 99. The method of any one of claims 70-98, wherein the vaccine immunizes the subject against RSV for up to one year or up to two years.

100. 99. The method of any one of claims 70-98, wherein the vaccine immunizes the subject against RSV for greater than two years.

101. 101. The method of claim 100, wherein the vaccine immunizes the subject against RSV for greater than three years.

102. 102. The method of claim 101, wherein the vaccine immunizes the subject against RSV for greater than four years.

103. The method of claim 102, wherein the vaccine immunizes the subject against RSV for 5 to 10 years.

104. 104. The method of any one of claims 70-103, wherein the subject is about 5 years old or younger, wherein the subject is between about 1 year and about 5 years old, wherein the subject is between about 6 months and about 1 year old, wherein the subject is about 6 months old or younger, wherein the subject is about 12 months old or younger.

105. The method of any one of claims 70 to 103, wherein the subject is an elderly subject, about 60 years of age, about 70 years of age or older.

106. 104. The method of any one of claims 70-103, wherein the subject is a young adult between about 20 and about 50 years of age.

107. 107. The method of any one of claims 70 to 106, wherein the subject is born at term.

108. 107. The method of any one of claims 70-106, wherein the subject is born prematurely before about 36 weeks gestation, wherein the subject is born prematurely before about 32 weeks gestation, or wherein the subject is born prematurely between about 32 weeks and about 36 weeks gestation.

109. The method of any one of claims 70 to 106, wherein the subject is pregnant.

110. 110. The method of any one of claims 70-109, wherein the subject has a chronic lung disease (e.g., chronic obstructive pulmonary disease (COPD) or asthma).

111. The method of any one of claims 70-110, wherein the subject has been exposed to RSV, the subject is infected with RSV, or the subject is at risk for infection by RSV.

112. The method of any one of claims 70 to 111, wherein the subject is immunocompromised.

113. 113. The method of any one of claims 70-112, further comprising administering a second dose (a booster dose) and optionally a third dose of the RSV vaccine.

114. 114. The method of any one of claims 70-113, wherein the effective amount of the RSV vaccine results in a 5-200 fold increase in serum neutralizing antibodies against RSV compared to a control.

115. 115. The method of claim 114, wherein a single dose of the RSV vaccine results in about a 2-10 fold increase in serum neutralizing antibodies against RSV as compared to a control.

116. A respiratory syncytial virus (RSV) vaccine comprising a signal peptide linked to an RSV antigenic polypeptide.

117. The RSV vaccine of claim 116, wherein the antigenic polypeptide is a fusion (F) glycoprotein or an immunogenic fragment thereof, an adsorption (G) protein or an immunogenic fragment thereof, a nucleoprotein (N) or an immunogenic fragment thereof, a phosphoprotein (P) or an immunogenic fragment thereof, a large polymerase protein (L) or an immunogenic fragment thereof, a matrix protein (M) or an immunogenic fragment thereof, a small hydrophobic protein (SH) or an immunogenic fragment thereof, a nonstructural protein 1 (NS1) or an immunogenic fragment thereof, or a nonstructural protein 2 (NS2) and an immunogenic fragment thereof.

118. 118. The RSV vaccine of claim 116 or 117, wherein the signal peptide is an IgE signal peptide or an IgGκ signal peptide.

119. 119. The RSV vaccine of claim 118, wherein the IgE signal peptide is an IgE HC (Ig heavy chain epsilon-1) signal peptide.

120. 120. The RSV vaccine of claim 119, wherein the IgE HC signal peptide has the sequence MDWTWILFLVAAATRVHS (SEQ ID NO: 281).

121. 119. The RSV vaccine of claim 118, wherein the IgGκ signal peptide has the sequence METPAQLLFLLLLWLPDTTG (SEQ ID NO: 282).

122. The RSV vaccine of any one of claims 116 to 119, wherein the signal peptide is selected from a Japanese encephalitis PRM signal sequence (MLGSNSGQRVVFTILLLLVAPAYS, SEQ ID NO: 283), a VSV g protein signal sequence (MKCLLYLAFLFIGVNCA, SEQ ID NO: 284), a Japanese encephalitis JEV signal sequence (MWLVSLAIVTACAGA, SEQ ID NO: 285), and MELLILKANAITTILTAVTFC (SEQ ID NO: 289).

123. A nucleic acid encoding the RSV vaccine of any one of claims 116 to 122.

124. A respiratory syncytial virus (RSV) vaccine comprising at least one ribonucleic acid (RNA) polynucleotide having an open reading frame encoding a signal peptide linked to an RSV antigenic peptide.

125. 125. The RSV vaccine of claim 124, wherein the RSV antigenic peptide is RSV adsorption protein (G) or an immunogenic fragment thereof.

126. 125. The RSV vaccine of claim 124, wherein the RSV antigenic peptide is the RSV fusion (F) glycoprotein or an immunogenic fragment thereof.

127. 125. The RSV vaccine of claim 124, wherein the RSV antigenic peptide is nucleoprotein (N) or an immunogenic fragment thereof.

128. 125. The RSV vaccine of claim 124, wherein the RSV antigenic peptide is a phosphoprotein (P) or an immunogenic fragment thereof.

129. 125. The RSV vaccine of claim 124, wherein the RSV antigenic peptide is the large polymerase protein (L) or an immunogenic fragment thereof.

130. 125. The RSV vaccine of claim 124, wherein the RSV antigenic peptide is matrix protein (M) or an immunogenic fragment thereof.

131. 125. The RSV vaccine of claim 124, wherein the RSV antigenic peptide is a small hydrophobic protein (SH) or an immunogenic fragment thereof.

132. 125. The RSV vaccine of claim 124, wherein the RSV antigenic peptide is nonstructural protein 1 (NS1) or an immunogenic fragment thereof.

133. 125. The RSV vaccine of claim 124, wherein the RSV antigenic peptide is nonstructural protein 2 (NS2) or an immunogenic fragment thereof.

134. 134. The RSV vaccine of any one of claims 124-133, wherein the signal peptide is an IgE signal peptide or an IgGκ signal peptide.

135. 135. The RSV vaccine of claim 134, wherein the IgE signal peptide is an IgE HC (Ig heavy chain epsilon-1) signal peptide.

136. 136. The RSV vaccine of claim 135, wherein the IgE HC signal peptide has the sequence MDWTWILFLVAAATRVHS (SEQ ID NO: 281).

137. 135. The RSV vaccine of claim 134, wherein the IgGκ signal peptide has the sequence METPAQLLFLLLLWLPDTTG (SEQ ID NO:282).

138. The RSV vaccine of any one of claims 124 to 137, wherein the signal peptide is selected from a Japanese encephalitis PRM signal sequence (MLGSNSGQRVVFTILLLLVAPAYS, SEQ ID NO: 283), a VSV g protein signal sequence (MKCLLYLAFLFIGVNCA, SEQ ID NO: 284), and a Japanese encephalitis JEV signal sequence (MWLVSLAIVTACAGA, SEQ ID NO: 285).

139. At least one ribonucleic acid (RNA) polynucleotide having an open reading frame encoding a membrane-bound respiratory syncytial virus (RSV) F protein, a membrane-bound DS-Cav1 (a stable pre-fusion RSV F protein), or a combination of a membrane-bound RSV F protein and a membrane-bound DS-Cav1; A pharma- ceutically acceptable carrier; 20. An RSV vaccine comprising:

140. 140. The RSV vaccine of claim 139, wherein the at least one RNA polynucleotide comprises the sequence set forth in SEQ ID NO:

5.

141. 141. The RSV vaccine of claim 139 or 140, wherein the at least one RNA polynucleotide comprises a sequence set forth in SEQ ID NO: 7, 257, 258 or 259.

142. 142. The RSV vaccine of any one of claims 139-141, wherein a single dose of the RSV vaccine results in a 2-10 fold increase in serum neutralizing antibodies against RSV compared to a control.

143. 143. The RSV vaccine of claim 142, wherein a single dose of the RSV vaccine results in about a 5-fold increase in serum neutralizing antibodies to RSV compared to a control.

144. 144. The RSV vaccine of claim 142 or 143, wherein the serum neutralizing antibodies are directed against RSV A and / or RSV B.

145. 145. The RSV vaccine of any one of claims 139 to 144, formulated in MC3 lipid nanoparticles.

146. A method for inducing an antigen-specific immune response in a subject, comprising administering to the subject an RSV vaccine described in any one of claims 139 to 145 in an amount effective to produce an antigen-specific immune response in the subject.

147. 147. The method of claim 146, further comprising administering a booster dose of the RSV vaccine.

148. 148. The method of claim 147, further comprising administering a second booster dose of the RSV vaccine.

149. A respiratory syncytial virus (RSV) vaccine comprising at least one messenger ribonucleic acid (mRNA) polynucleotide having a 5' terminal cap, an open reading frame encoding at least one RSV antigenic polypeptide, and a 3' poly A tail.

150. 150. The vaccine of claim 149, wherein the at least one mRNA polynucleotide is encoded by a sequence identified by SEQ ID NO:

5.

151. 150. The vaccine of claim 149, wherein the at least one mRNA polynucleotide comprises a sequence identified by SEQ ID NO:

262.

152. 150. The vaccine of claim 149, wherein the at least one RSV antigenic polypeptide comprises the sequence identified by SEQ ID NO:

6.

153. 150. The vaccine of claim 149, wherein the at least one RSV antigenic polypeptide comprises a sequence identified by SEQ ID NO:

290.

154. 150. The vaccine of claim 149, wherein the mRNA polynucleotide is encoded by the sequence identified by SEQ ID NO:

7.

155. 150. The vaccine of claim 149, wherein the mRNA polynucleotide comprises the sequence identified by SEQ ID NO:

263.

156. 150. The vaccine of claim 149, wherein the at least one RSV antigenic polypeptide comprises a sequence identified by SEQ ID NO:

8.

157. 150. The vaccine of claim 149, wherein the at least one RSV antigenic polypeptide comprises a sequence identified by SEQ ID NO:

291.

158. 158. The vaccine of any one of claims 149-157, wherein the 5' end cap is or comprises 7mG(5')ppp(5')NlmpNp.

159. 159. The vaccine of any one of claims 149-158, wherein 100% of the uracils in the open reading frame are modified to contain an N1-methylpseudouridine at position 5 of the uracil.

160. 160. The vaccine of any one of claims 149 to 159, formulated in a lipid nanoparticle comprising DLin-MC3-DMA, cholesterol, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) and polyethylene glycol (PEG) 2000-DMG.

161. 161. The vaccine of claim 160, wherein the lipid nanoparticles further comprise trisodium citrate buffer, sucrose, and water.

162. 20. A respiratory syncytial virus (RSV) vaccine comprising at least one messenger ribonucleic acid (mRNA) polynucleotide having a 5' end cap 7mG(5')ppp(5')NlmpNp, a sequence identified by SEQ ID NO:262, and a 3' poly A tail, formulated in a lipid nanoparticle comprising DLin-MC3-DMA, cholesterol, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) and polyethylene glycol (PEG) 2000-DMG, wherein a uracil nucleotide of the sequence identified by SEQ ID NO:262 has been modified to include an N1-methylpseudouridine at the 5-position of the uracil nucleotide.

163. 20. A respiratory syncytial virus (RSV) vaccine comprising at least one messenger ribonucleic acid (mRNA) polynucleotide having a 5' end cap 7mG(5')ppp(5')NlmpNp, a sequence identified by SEQ ID NO:263, and a 3' poly A tail, formulated in a lipid nanoparticle comprising DLin-MC3-DMA, cholesterol, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) and polyethylene glycol (PEG) 2000-DMG, wherein a uracil nucleotide of the sequence identified by SEQ ID NO:263 has been modified to include an N1-methylpseudouridine at the 5-position of the uracil nucleotide.

164. 1. A pharmaceutical composition for use in vaccinating a subject, comprising: comprising an effective amount of mRNA encoding a respiratory syncytial virus (RSV) antigen; The effective amount is sufficient to result in a detectable level of antigen when measured in the subject's serum 1 to 72 hours after administration of the pharmaceutical composition.

165. The composition of claim 164, wherein the antigen has a cutoff index of 1 to 2.

166. 1. A pharmaceutical composition for use in vaccinating a subject, comprising: comprising an effective amount of mRNA encoding a respiratory syncytial virus (RSV) antigen; The pharmaceutical composition, wherein the effective amount is sufficient to result in a neutralizing titer of 1,000 to 10,000 caused by neutralizing antibodies against the antigen when measured in the serum of the subject 1 to 72 hours after administration.

167. A respiratory syncytial virus (RSV) vaccine comprising at least one messenger ribonucleic acid (mRNA) polynucleotide comprising a 5' terminal cap that is 7mG(5')ppp(5')NlmpNp, a sequence identified by any one of SEQ ID NOs:260-280, and a 3' polyA tail.

Images