Plants whose flower color is changed and method for producing the same

Abstract

To provide plants whose flower color is changed.SOLUTION: A method for producing a plant comprises accumulating anthocyanidin pigments in the cells of the petals of a plant at a concentration of 30 mass% or more relative to the total amount of pigments present in the cells, in which the flower color of the plant after the anthocyanidin pigments have been accumulated is changed so that the b* value in the CIE L*a*b* color system is decreased, as compared to the flower color of the plant before the anthocyanidin pigments have been accumulated.SELECTED DRAWING: Figure 12

Description

[Technical field]

[0001] The present invention relates to plants having altered flower colour and methods for producing the same. [Background technology]

[0002] The flower industry strives to develop new and diverse varieties. One effective way to develop new varieties is to change the flower color, and using classical breeding methods, most commercial varieties have been produced with a variety of flower colors.

[0003] A method for producing a plant having blue flower colors has been reported so far, for example, in Patent Document 1. More specifically, the method of Patent Document 1 is a method for producing a plant having blue flower colors, and is characterized in that a delphinidin-type anthocyanin in which the 3' and 5' positions of the anthocyanin B ring are glycosidated coexists with a flavone glycoside or a flavonol glycoside in plant cells.

[0004] Furthermore, Patent Document 2 discloses a novel Mandevilla plant having a flower color of a new tone that has not been produced so far. More specifically, the novel Mandevilla plant of Patent Document 2 is a Mandevilla plant containing at least one type of carotenoid pigment in its petals, characterized in that the carotenoid pigment is neoxanthin or a derivative thereof. [Prior art documents] [Patent documents]

[0005] [Patent Document 1] International Publication No. 2017 / 169699 [Patent Document 2] JP 2021-175402 A [Non-patent literature]

[0006] [Non-Patent Document 1] Tatsuzawa, F. et. al. Biochem. Systemat. Ecol. 99, 2021, 104347 [Non-Patent Document 2] Macz-Pop, GA et. al. Food Chem. 94, 2006, 448-456 [Non-Patent Document 3] Oyama, K. et. al. J. Agric. Food Chem. 63, 2015, 7630-7635 Summary of the Invention [Problem to be solved by the invention]

[0007] There remains a need for development of plants with altered flower color.

[0008] For example, until now, only varieties of Mandevilla plants have been known with white, pink, and red flower colors, and although Patent Document 2 provides a new colored Mandevilla plant that contains carotenoid pigments, research on blue-colored Mandevilla plants is still needed.

[0009] The present invention is intended to improve the above-mentioned circumstances, and an object of the present invention is to provide a plant with altered flower color and a method for producing the same. [Means for solving the problem]

[0010] The present invention which achieves the above object is as follows.

[0011] <Aspect 1> A method for producing a plant, comprising the steps of: The method comprises accumulating anthocyanidin pigments in cells of petals of the plant in an amount of 30% by mass or more relative to the total amount of pigments present in the cells; and The flower color of the plant after accumulating the anthocyanidin pigment is compared with the flower color of the plant before accumulating the anthocyanidin pigment, * a* b * b in color system * The value of is decreasing. method. <Aspect 2> The method according to aspect 1, wherein the anthocyanidin pigment is accumulated by at least partially deleting an anthocyanidin modifying enzyme gene. <Aspect 3> The method comprises at least partially deleting the promoter region of the anthocyanidin modifying enzyme gene; and The anthocyanidin modifying enzyme is selected from anthocyanidin glycosidase genes and / or anthocyanidin 3-glucoside glycosidase genes. The method according to embodiment 2. <Aspect 4> The anthocyanidin glycosylase is a galactosyltransferase; and In the promoter region of the galactosyltransferase gene, at least one sequence selected from the group consisting of the sequence shown in SEQ ID NO: 1, the sequence shown in SEQ ID NO: 2, and sequences having at least 90% identity thereto is deleted. The method according to embodiment 3. <Aspect 5> The anthocyanidin 3-glucosidyltransferase is a xylosyltransferase; and In the promoter region of the xylosyltransferase gene, at least one sequence selected from the group consisting of the sequence shown in SEQ ID NO: 3 and a sequence having at least 90% identity thereto is inserted. The method according to embodiment 3. <Aspect 6> The method according to any one of aspects 1 to 5, wherein the anthocyanidin pigment is cyanidin. Aspect 7 The method of any one of aspects 1 to 6, wherein the anthocyanidin pigment is localized in the cytoplasm of the cell. <Aspect 8> The method according to any one of aspects 1 to 7, wherein chlorogenic acid and aluminum ions are contained in cells of petals of the plant. <Aspect 9> The method according to any one of aspects 1 to 8, wherein the plant is at least one selected from the group consisting of Apocynaceae plants, Solanaceae plants, Azollaceae plants, and Scrophulariaceae plants. Aspect 10 The method according to any one of aspects 1 to 9, wherein the plant is at least one species selected from the group consisting of plants of the genus Mandevilla, plants of the genus Petunia, and plants of the genus Torenia. <Aspect 11> 11. The method of claim 10, wherein the plant is a plant deposited at the National Institute of Technology and Evaluation, International Patent Organism Depositary (NITE-IPOD) under accession number FERM ABP-22483, or a progeny thereof. Aspect 12 In the petal cells of plants, The anthocyanidin pigment is accumulated in an amount of 30% by mass or more relative to the total amount of pigment present in the cell; and At least a portion of the anthocyanidin modifying enzyme gene is deleted. plant. Aspect 13 13. The plant of embodiment 12, wherein the anthocyanidin pigment is localized in the cytoplasm of the cell. Aspect 14 The method comprises at least partially deleting the promoter region of the anthocyanidin modifying enzyme gene; and 14. The plant according to aspect 12 or 13, wherein the anthocyanidin modifying enzyme is selected from anthocyanidin glycosidase and / or anthocyanidin 3-glucoside glycosidase. Aspect 15 The anthocyanidin glycosylase is a galactosyltransferase; and In the promoter region of the galactosyltransferase gene, at least one sequence selected from the group consisting of the sequence shown in SEQ ID NO: 1, the sequence shown in SEQ ID NO: 2, and sequences having at least 90% identity thereto is deleted. 15. The plant of embodiment 14. Aspect 16 The anthocyanidin 3-glucosidyltransferase is a xylosyltransferase; and In the promoter region of the xylosyltransferase gene, at least one sequence selected from the group consisting of the sequence shown in SEQ ID NO: 3 and a sequence having at least 90% identity thereto is inserted. 15. The plant of embodiment 14. Aspect 17 17. The plant according to any one of aspects 12 to 16, wherein the anthocyanidin pigment is cyanidin. Aspect 18 18. The plant according to any one of aspects 12 to 17, wherein chlorogenic acid and aluminum ions are contained in cells of petals of the plant. Aspect 19 19. The plant according to any one of aspects 12 to 18, wherein the plant is at least one species selected from the group consisting of Apocynaceae plants, Solanaceae plants, Azocapsaceae plants, and Scrophulariaceae plants. <Aspect 20> 20. The plant according to any one of aspects 12 to 19, wherein the plant is at least one species selected from the group consisting of plants of the genus Mandevilla, plants of the genus Petunia, and plants of the genus Torenia. Aspect 21 21. The plant according to claim 20, wherein the Mandevilla plant is a plant deposited at the National Institute of Technology and Evaluation, International Patent Organism Depositary (NITE-IPOD) under accession number FERM ABP-22483, or a progeny thereof. Aspect 22 22. A progeny of the plant according to any one of embodiments 12 to 21. Aspect 23 22. Propagation material of the plant according to any one of aspects 12 to 21. Aspect 24 A part, tissue or cell of the plant according to any one of aspects 12 to 21. Effect of the Invention

[0012] According to the present invention, a plant having a changed flower color can be provided. [Brief description of the drawings]

[0013] [Figure 1] FIG. 1 shows the results of pigment analysis in Example 1. [Diagram 2] FIG. 2 shows the results of HPLC analysis in Example 1. [Diagram 3] FIG. 3 is a diagram showing the results of the structure analysis in the second embodiment. [Figure 4] FIG. 4 shows the expression analysis of the galactosyltransferase gene and the xylosyltransferase gene in Example 3. [Diagram 5] FIG. 5 shows the results of LC-MS analysis in Example 4. [Figure 6] FIG. 6 shows the results of extraction using various solvents in Example 5. [Figure 7] FIG. 7 shows the experiment of Example 6. [Figure 8] FIG. 8 shows the analysis results and alignment of the nucleotide sequences of galactosyltransferase genes in Example 7. [Figure 9] FIG. 9 shows the analysis results and alignment of the base sequences of the xylosyltransferase genes in Example 7. [Figure 10] FIG. 10 shows a design for producing a genetic marker in Example 7. [Figure 11] FIG. 11 shows the PCR amplification results in Example 7. [Figure 12] FIG. 12 is a diagram showing intracellular localization of the dye in Example 8. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0014] DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS The present invention will be described in detail below with reference to the preferred embodiments. Note that the present invention is not limited to the following embodiments, and various modifications can be made within the scope of the present invention.

[0015] <<How to create plants>> The method for producing a plant of the present invention (hereinafter also simply referred to as the "method of the present invention") comprises the steps of: The method comprises accumulating anthocyanidin pigments in cells of plant petals at 30% by mass or more of the total amount of pigments present in the cells; The flower color of the plant after accumulating anthocyanidin pigments is compared to the flower color of the plant before accumulating anthocyanidin pigments, and the flower color of the plant after accumulating anthocyanidin pigments is compared to the CIE L * a * b * b in color system * The value of is decreasing. method It is.

[0016] There has been a technical idea of ​​accumulating anthocyanin pigments in the form of glycosides in petal cells, as described in the above-mentioned Patent Document 1. In addition, it is known that pigments in the aglycon state are generally unstable and are stabilized in cells by undergoing modifications such as glycosylations and acylations, and therefore there has been no report of the technical idea of ​​accumulating anthocyanidin pigments, i.e., pigments in the aglycon state, in petal cells, nor of anthocyanidin pigments accumulating in the petal cells of plants.

[0017] Therefore, the technical idea of ​​the present invention, which is to accumulate anthocyanidin pigments in an amount of 30 mass% or more of the total amount of pigments present in the petal cells of a plant, is novel, and the results of Examples 1 to 8 described below suggest that the method of the present invention makes it possible to accumulate anthocyanidin pigments in the petal cells of a plant (in particular, in the cytoplasm).

[0018] According to the method of the present invention, anthocyanidin pigments can be accumulated in the cells of plant petals at 30% by mass or more relative to the total amount of pigments present in the cells. More specifically, the accumulated amount of anthocyanidin pigments can be 30% by mass or more, 35% by mass or more, 40% by mass or more, 45% by mass or more, 50% by mass or more, 55% by mass or more, 60% by mass or more, 65% by mass or more, 70% by mass or more, 75% by mass or more, 80% by mass or more, 85% by mass or more, 90% by mass or more, 95% by mass or more, 99% by mass or more, or about 100% by mass relative to the total amount of pigments present in the cells. The accumulated amount of anthocyanidin pigments and the total amount of pigments present in the cells can be determined, for example, by extracting pigments from freeze-dried petals with a mixture of trifluoroacetic acid and acetonitrile and performing HPLC analysis. More specifically, reference may be made to Examples 1 and 2 described below.

[0019] In the present invention, the amount of anthocyanidin pigment in a plant after accumulation of the anthocyanidin pigment is not particularly limited, and may be, for example, 0.05 mg or more, 0.1 mg or more, 0.2 mg or more, 0.3 mg or more, 0.4 mg or more, 0.5 mg or more, 0.6 mg or more, 0.7 mg or more, 0.8 mg or more, 0.9 mg or more, 1.0 mg or more, 1.0 mg or more, 1.2 mg or more, 1.3 mg or more, 1.4 mg or more, 1.5 mg or more, or 2.0 mg or more, or 2.5 mg or less, 2.0 mg or less, 1.8 mg or less, 1.5 mg or less, or 1.1 mg or less, per 1 g of petals.

[0020] In the present invention, the indicator of the change in flower color of a plant before and after accumulation of anthocyanidin pigments is CIE L * a * b * b in color system * More specifically, the flower color of a plant after accumulating anthocyanidin pigments can be evaluated by the CIE L value, as compared to the flower color of a plant before accumulating anthocyanidin pigments. * a * b * b in color system * It is sufficient that the value of

[0021] where CIE L * a * b * The color system is a standardized color system by the International Commission on Illumination (CIE) and is widely known as a method of expressing color tones. * a * b * ) color system. * a * b * In the color system, lightness is L * and chromaticity, which indicates hue and saturation, is expressed as a * and b * It is expressed as a * and b * indicates the color direction, and a * is red direction, -a is red direction * is the green direction, b is the * is the yellow direction, and -b * indicates the blue direction. * , a * and b * Each value of can be obtained from the tristimulus values ​​X, Y, and Z using the following equation: L * = 116 (Y / Y0) 1 / 3 - 16; a * = 500 [(X / X0) 1 / 3 - (Y / Y0) 1 / 3 ]; and b * = 200 [(Y / Y0) 1 / 3 - (Z / Z0) 1 / 3 ] However, X / X 0、 Y / Y0 and Z / Z0 are > 0.008856, where X0, Y0 and Z0 represent the tristimulus values ​​of the standard illuminant.

[0022] Also, CIE L * a * b * Color analysis according to the color system can be easily performed using an integrating sphere type spectrophotometer, for example a commercially available spectrophotometer (CM-2022, Konica Minolta).

[0023] According to the method of the present invention, this b * A decrease in the value of b means that the flower color of the plant after accumulating anthocyanidin pigments shifts to a more blue color. * The degree of decrease in the value is not particularly limited, and may be, for example, 5.0 or more, 10.0 or more, 15.0 or more, 20.0 or more, 25.0 or more, 30.0 or more, 35.0 or more, 40.0 or more, 45.0 or more, or 50.0 or more.

[0024] In the present invention, the flower color of the plant after accumulation of anthocyanidin pigments is * The value of is not particularly limited, and may be, for example, 20.0 or less, 15.0 or less, 10.0 or less, 5.0 or less, 1.0 or less, or 0 or less. * The value of may preferably be less than 0. * When the value of is less than 0, more specifically, the absolute value may be, for example, 1.0 or more, 5.0 or more, 10.0 or more, 15.0 or more, 20.0 or more, 25.0 or more, or 30.0 or more.

[0025] In one embodiment, according to the method of the present invention, when a Mandevilla plant having a red flower color is used, the flower color of the Mandevilla plant after accumulation of anthocyanidin pigments is compared to the flower color (red) of the Mandevilla plant before accumulation of anthocyanidin pigments, and the flower color of the Mandevilla plant after accumulation of anthocyanidin pigments is CIE L * a * b * b in color system * The value of can be decreased from "20.9" to "-30.9", that is, the color can be shifted toward the blue side.

[0026] Plants that can be used in the method of the present invention are not particularly limited, and may be, for example, at least one species selected from the group consisting of Apocynaceae plants, Solanaceae plants, Linderniaceae plants, and Scrophulariaceae plants.

[0027] Furthermore, the plant applicable to the method of the present invention may be at least one species selected from the group consisting of Mandevilla plants, Petunia plants, and Torenia plants, but is not limited thereto.

[0028] Generally, it is known that the red, blue, and purple flower colors found in plants are derived from anthocyanin pigments. Anthocyanin pigments are formed when sugar is added to anthocyanidin (aglycone) pigments by glycosylase enzymes.

[0029] In the present invention, an anthocyanidin pigment is an aglycone of an anthocyanin pigment and has the structure of a compound represented by the following general formula (I): [ka] (In formula (I), R 1 , R 2 , R 3 , R 4 , R 5 , R 6 , and R 7 may each independently be a hydrogen atom, an -OH group, or an -OCH3 group.

[0030] In the general formula (I), they are classified into three types, pelargodinin, cyanidin, and delphinidin, depending on the number of hydroxy groups in the B ring of the anthocyanidin moiety. In addition, various anthocyanin pigments can exist depending on the type and number of sugars added to the A ring and C ring of the anthocyanidin moiety.

[0031] In the method of the present invention, the anthocyanidin pigment may be cyanidin, which has the structure shown in formula (II): [ka]

[0032] In the method of the present invention, for example, when a Mandevilla plant having red flowers is used, it is preferable to accumulate cyanidin in the petal cells of the plant, so that the flower color of the Mandevilla plant after accumulating cyanidin can be changed to blue compared to the flower color (red) of the Mandevilla plant before accumulating cyanidin.

[0033] In the present invention, anthocyanidin pigments may be in the form of localization in the cytoplasm of plant petal cells, and may be in the state of localization in the cytoplasm of plant petal epidermal cells in particular.In contrast, anthocyanin pigments are generally localized in the vacuole of petal cells.In addition, the confirmation of the location of pigments in cells (i.e., the location where they exist) can be carried out, for example, by preparing protoplasts from petals and observing them with a phase contrast microscope using a hemocytometer slide.

[0034] In the method of the present invention, anthocyanidin pigments can be accumulated in the petal cells of a plant by at least partially deleting anthocyanidin modifying enzyme genes. Here, the anthocyanidin modifying enzyme may be an enzyme capable of modifying anthocyanidin in the aglycone state, for example, an enzyme for glycosidation of anthocyanidin or an enzyme for acylation of anthocyanidin.

[0035] In one embodiment of the present invention, the anthocyanidin modifying enzyme may be selected from anthocyanidin glycosidase and / or anthocyanidin 3-glucoside glycosidase. In this case, in the method of the present invention, anthocyanidin pigments can be accumulated by at least partially deleting anthocyanidin glycosidase gene and / or anthocyanidin 3-glucoside glycosidase gene, and preferably, anthocyanidin pigments can be accumulated by at least partially deleting both anthocyanidin glycosidase gene and anthocyanidin 3-glucoside glycosidase gene.

[0036] Without being limited by theory, for example, by at least partially deleting the anthocyanidin glycosyltransferase gene and the anthocyanidin 3-glucoside glycosyltransferase gene in the cells of the petals of a plant, anthocyanidin pigments cannot be converted to their glycoside anthocyanins, and as a result, anthocyanidin pigments may accumulate. The sites of deletion of the anthocyanidin glycosyltransferase gene and the anthocyanidin 3-glucoside glycosyltransferase gene are not particularly limited, and may be, for example, the respective promoter regions.

[0037] Furthermore, the deletion of anthocyanidin modifying enzyme genes may be achieved using conventional techniques in the art, such as mutagenesis by irradiation with gamma rays, heavy ion beams, etc., RNAi, genome editing, etc. More specifically, deletion, insertion, substitution, and / or addition of at least a portion of the DNA sequence in the anthocyanidin modifying enzyme genes may be achieved.

[0038] In the method of the present invention, the anthocyanidin glycosyltransferase may be, for example, a galactosyltransferase. The galactosyltransferase gene may have the DNA sequence shown in SEQ ID NO: 4 and the amino acid sequence shown in SEQ ID NO: 5. The anthocyanidin 3-glucoside glycosyltransferase may be, for example, a xylosyltransferase. The xylosyltransferase gene may have the DNA sequence shown in SEQ ID NO: 6 and the amino acid sequence shown in SEQ ID NO: 7.

[0039] For example, when cyanidin is treated with galactosyltransferase and xylosyltransferase, cyanidin can undergo a two-step saccharification reaction to become the cyanidin glycoside shown in formula (III) below. In the first step, galactose is added to the 3-position of cyanidin by galactosyltransferase to become cyanidin 3-galactoside. In the second step, xylose can be further added to cyanidin 3-galactoside by xylosyltransferase.

[0040] [ka] (In formula (III), Gal represents galactose, and Xyl represents xylose.)

[0041] Furthermore, in the method of the present invention, when the anthocyanidin glycosylase is a galactosyltransferase, at least one sequence selected from the group consisting of the sequence shown in SEQ ID NO: 1, the sequence shown in SEQ ID NO: 2, and sequences having at least 90% identity thereto may be deleted in the promoter region of the galactosyltransferase gene.

[0042] Furthermore, in order to identify whether a galactosyltransferase gene has a deleted sequence, PCR primers may be designed to span the deleted portion, as compared with the case of a gene without a deleted sequence, and PCR is performed using the designed primers. If an amplified fragment of the desired length is obtained, the gene can be identified as having a deleted sequence.

[0043] In the method of the present invention, when the anthocyanidin 3-glucoside glycosyltransferase is a xylosyltransferase, at least one sequence selected from the group consisting of the sequence shown in SEQ ID NO: 3 and a sequence having at least 90% identity thereto may be inserted in the promoter region of the xylosyltransferase gene.

[0044] In addition, in the case of xylosyltransferase, whether or not a sequence has been inserted can be identified by, for example, designing PCR primers from the inserted portion compared to the case of a gene without an inserted sequence, and then performing PCR using the designed primers. If an amplified fragment of the desired length is obtained, the sequence can be identified as having been inserted.

[0045] In the present invention, the term "identity" refers to the amount (number) of amino acid residues or bases constituting two chains in a polypeptide sequence (or amino acid sequence) or polynucleotide sequence (or base sequence) that can be determined to be identical in terms of their matching relationship with each other, and refers to the degree of sequence correlation between two polypeptide sequences or two polynucleotide sequences, and "identity" can be easily calculated. Numerous methods for measuring identity between two polynucleotide or polypeptide sequences are known, and the term "identity" is well known to those skilled in the art (see, e.g., Lesk, AM (Ed.), Computational Molecular Biology, Oxford University Press, New York, (1988); Smith, DW (Ed.), Biocomputing: Informatics and Genome Projects, Academic Press, New York, (1993); Grifin, AM & Grifin, HG (Ed.), Computer Analysis of Sequence Data: Part I, Human Press, New Jersey, (1994); von Heinje, G., Sequence Analysis in Molecular Biology, Academic Press, New York, (1987); Gribskov, M. & Devereux, J. (Ed.), Sequence Analysis Primer, M-Stockton Press, New York, (1991) etc.).

[0046] In addition, the numerical value of "identity" described in this specification may be a numerical value calculated using an identity search program known to those skilled in the art, unless otherwise specified, but is preferably a numerical value calculated using the ClustalW program of the MacVector application (version 9.5 Oxford Molecular Ltd., Oxford, England). In the present invention, the degree of "identity" between each sequence may be, for example, about 90% or more, 91% or more, 92% or more, 93% or more, or 94% or more, preferably 95% or more, more preferably 96% or more, even more preferably 97% or more, particularly preferably 98% or more, and most preferably 99% or more.

[0047] In the present invention, chlorogenic acid and aluminum ion may be contained in the petal cells of the plant.When chlorogenic acid and aluminum ion exist, the flower color can be changed more strongly by the copigment effect.For example, when using a Mandevilla plant with a red flower color, when chlorogenic acid and aluminum ion exist in the petal cells of the plant, the flower color of the Mandevilla plant after accumulating cyanidin can be changed more strongly to blue than the flower color (red) of the Mandevilla plant before accumulating cyanidin.

[0048] "plant" The present invention also provides a plant. The plant of the present invention comprises: In the petal cells of plants, The anthocyanidin pigment is accumulated at 30% by mass or more of the total amount of pigment present in the cell, and At least a portion of the anthocyanidin modifying enzyme gene is deleted. It is a plant.

[0049] The plant of the present invention may be produced by the method of the present invention described above. For this purpose, the description of the anthocyanidin-modifying enzyme may be appropriately referred to in the description of the method of the present invention described above.

[0050] In addition, at least a part of the promoter region of the anthocyanidin modifying enzyme gene may be deleted in the plant of the present invention. The anthocyanidin modifying enzyme may be selected from anthocyanidin glycosyltransferase and / or anthocyanidin 3-glucoside glycosyltransferase. In addition, when the anthocyanidin glycosyltransferase is a galactosyltransferase, at least one sequence selected from the group consisting of the sequence shown in SEQ ID NO: 1, the sequence shown in SEQ ID NO: 2, and sequences having at least 90% identity thereto may be deleted in the promoter region of the galactosyltransferase gene. In addition, when the anthocyanidin 3-glucoside glycosyltransferase is a xylosyltransferase, at least one sequence selected from the group consisting of the sequence shown in SEQ ID NO: 3 and sequences having at least 90% identity thereto may be inserted in the promoter region of the xylosyltransferase gene.

[0051] The anthocyanidin pigment of the plant of the present invention may be localized in the cytoplasm of the petal cells of the plant, and in the plant of the present invention, the anthocyanidin pigment may be cyanidin.

[0052] The plant of the present invention may be at least one species selected from the group consisting of Apocynaceae plants, Solanaceae plants, Azocapsaceae plants, and Scrophulariaceae plants, and more specifically, may be at least one species selected from the group consisting of Mandevilla plants, Petunia plants, and Torenia plants.

[0053] The Mandevilla plant according to the present invention can be produced from a Mandevilla plant deposited at the National Institute of Technology and Evaluation, Patent Biological Depositary (NITE-IPOD) under the accession number FERM ABP-22483 or its progeny using conventional techniques in plant breeding. Such conventional techniques may include conventional propagation techniques such as vegetative propagation and seed propagation, as well as tissue culture techniques for culturing plant cells, tissues or organs, and recombinant gene techniques that can directly introduce useful traits. The Mandevilla plant according to the present invention can typically be produced by vegetative propagation of a Mandevilla plant or its progeny deposited at the National Institute of Technology and Evaluation, Patent Biological Depositary (NITE-IPOD) under the accession number FERM ABP-22483 on September 22, 2023. Examples of "vegetative propagation" include techniques such as cuttings (including leaf cuttings), layering, stem laying (pressing method), division, grafting, and the like, as well as clone seedlings created by tissue culture, with cuttings being particularly preferred.

[0054] "Cutting" is an asexual propagation method in which a part of a plant that does not have a stem or roots is cut off and trained to become an independent plant with a stem and roots. Depending on the part used, examples include branch cuttings, trunk cuttings (stem cuttings), root cuttings, and leaf cuttings. Cuttings are typically performed by inserting part of a branch or trunk (stem) of a parent plant into soil and leaving a part of it above ground. In the present invention, there are no particular limitations on the part used for "cutting".

[0055] For the cutting, a branch mutation of a Mandevilla plant or its progeny deposited at the National Institute of Technology and Evaluation, Patent Biological Depositary (NITE-IPOD) under the accession number FERM ABP-22483 may be used. "Branch mutation" refers to a phenomenon in which flowers, buds, leaves, etc., of only a certain branch of a plant develop genetic traits different from those of the individual due to a mutation in the growing point, or an individual that has expressed such a phenomenon. In a plant, the body is formed from the growing point forward and forward, so that there is a possibility that the mutated part is distinguished from the non-mutated part and fixed as a trait. Therefore, by performing cuttings using a branch of a branch mutation having at least one changed flower, it is possible to create a new variety of a Mandevilla plant having other traits while maintaining a desired trait (e.g., blue flower color).

[0056] In another aspect of the present invention, the present invention provides propagation materials (vegetative propagation materials such as cuttings, seeds, etc.), plant parts (flowers, stems, branches, leaves, roots, etc.), tissues, or cells of the above-mentioned Mandevilla plant or its progeny.

[0057] In a further aspect, the present invention provides a product derived from the Mandevilla plant or its progeny, typically a potted plant, a cut flower, or a processed product made from the cut flower.

[0058] In this specification, the term "offspring" includes the self- or cross-pollination progeny of the Mandevilla plant deposited at the National Institute of Technology and Evaluation, Patent Biological Depositary (NITE-IPOD) under the accession number FERM ABP-22483, and includes not only the first generation but all generations of offspring of the Mandevilla plant deposited at the National Institute of Technology and Evaluation, Patent Biological Depositary (NITE-IPOD) under the accession number FERM ABP-22483. Furthermore, in this specification, the term "offspring" includes those produced from the parent Mandevilla plant based on conventional techniques in plant breeding, and may include those produced by conventional breeding techniques such as vegetative propagation and seed propagation of the parent plant, tissue culture techniques for cultivating plant cells, tissues, or organs, and gene recombination techniques that can directly introduce useful traits, as well as mutants such as branch mutations of the parent Mandevilla plant. Such offspring preferably have desired characteristics derived from the parent Mandevilla plant. EXAMPLES

[0059] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.

[0060] Example 1 In Example 1, the pigment compositions contained in the petal cells of the blue cultivar (MW65) and red cultivar (173), which are owned by Suntory Flowers Ltd., were analyzed by HPLC. Here, the hybrid (13918) was a cross between the blue cultivar (MW65) as the mother and a cultivar of a different lineage from the red cultivar (173) as the father.

[0061] In addition, the above varieties (blue varieties, red varieties, and their hybrids) are CIE L * a * b * The color analysis according to the color system was carried out using a commercially available spectrophotometer (CM-2022, Konica Minolta). The results are shown in Table 1 below.

[0062] [Table 1]

[0063] Non-Patent Document 1 reports that cyanidin is the main anthocyanidin in the petal cells of Mandevilla plants. Therefore, the anthocyanin pigments in the petals of each of the above varieties (blue variety, red variety, and hybrids thereof) were analyzed as follows.

[0064] (test solution preparation) 0.5 mg of each freeze-dried petal was added with 4 mL of 0.1% TFA / 50% acetonitrile, and anthocyanin pigments were extracted under ultrasound for 20 minutes. The glycosides were analyzed by HPLC directly from this extract. In the case of analysis of aglycones excluding sugars, etc., the above extract was dried overnight in a desiccator, dissolved in 6N HCl, saponified in a boiling water bath for 20 minutes, extracted with amyl alcohol, and then analyzed by HPLC.

[0065] (HPLC analysis) The analytical equipment used was a Shimadzu Prominence HPLC system (LC-20AD, SIL-20AC, CBM-20A, CTO-20AC, SPD-M20A, SPD-20A). For glycoside analysis, an RSpak DE-413L (250 mm x 4.6 mm ID, Shodex) column was used, and the LC mobile phases were 0.5% TFA / water for mobile phase A and 0.5% TFA-containing 50% CH3CN / water for mobile phase B. The binary gradient gradient was changed from 20% to 100% over 15 minutes, and then the mobile phase B concentration was kept at 100% for 10 minutes at a flow rate of 0.4 mL / min. For the analysis of aglycones, a YMC-Pack ODS-A (150 mm x 6 mm ID, YMC) column was used, and the LC mobile phase was acetic acid / methanol / water (15 / 17.5 / 67.5, vol / vol) at a flow rate of 1.0 mL / min. The peaks were identified and quantified using cyanidin, delphinidin, pelargonidin, malvidin, peonidin, and petunidin as standard substances.

[0066] As a result, as shown in Figure 1, it was found that cyanidin was the major anthocyanidin in both the blue cultivar (MW65) and the red cultivar (173) in the samples from which sugars had been removed by acid hydrolysis. This result is consistent with the report in Non-Patent Document 1.

[0067] As shown in Figure 2, in the analysis with sugar still attached, specifically high peaks (peak A and peak B) were detected in the red variety (173) and the blue variety (MW65), respectively. In the hybrid variety (13918), both peaks (peak A and peak B) were detected. In Example 2 described below, structural analysis was performed on these peaks.

[0068] Example 2 The structures of peaks A and B in the red variety (173) and blue variety (MW65) in Example 1 above were estimated by LC-MS.

[0069] More specifically, the petal extract was prepared using 5% AcOH, 50% MeCN-5%AcOH, and MeCN-5% AcOH. The LC-MS experiment was performed using an LCMS-IT-TOF (Shimadzu) with a YMC-Triart C18 (3 μm, 2.1x100 mm, YMC) column. The LC mobile phases were 0.1% formic acid / water (mobile phase A) and 0.1% formic acid / acetonitrile (mobile phase B). The binary gradient gradient was changed from 20% to 100% over 15 min, and then the mobile phase B concentration was 100% for 10 min at a flow rate of 0.4 mL / min. The anthocyanin peaks were extracted from the chromatogram at 530 nm, and the structures were analyzed based on the MS and MS / MS spectra.

[0070] As a result, as shown in FIG. 3, peak A of the red variety (173) was found to be cyanidin 3-O-[2-O-(xylosyl)-galactoside] as described in Non-Patent Document 1.

[0071] On the other hand, peak B of the blue variety (MW65) was surprisingly found to be completely unmodified cyanidin (aglycone) = anthocyanidin (Figure 3). There were almost no known precedents for aglycones to accumulate in high concentrations in plants, so this analytical result overturned conventional wisdom.

[0072] In addition, it has been reported in Non-Patent Document 2 that anthocyanidins accumulate in the pericarp of some kidney bean varieties, but the percentage is only 22%. In contrast, it was found that cyanidin, shown by peak B, accumulates to 70% by mass or more of the total amount of pigments in the cytoplasm and vacuoles of petal cells of a blue variety (MW65).

[0073] Example 3 In the blue cultivar (MW65), we hypothesized that high accumulation of anthocyanidins was due to reduced expression or enzymatic activity in the petals of the galactosyltransferase gene and xylosyltransferase gene, which are thought to be necessary for the synthesis of cyanidin 3-O-[2-O-(xylosyl)-galactoside] from cyanidin aglycone.

[0074] First, the galactosyltransferase and xylosyltransferase genes in Mandevilla were identified as follows. Glycosyltransferase genes were listed from the gene group estimated from the Mandevilla genome sequence, and the amino acid sequences of the proteins they encoded were aligned with previously reported anthocyanidin glycosyltransferase sequences using ClustalW, and a phylogenetic tree was created using ETE3. From the resulting phylogenetic tree, genes that are thought to be orthologs of previously reported galactosyltransferase and xylosyltransferase genes in other plants were estimated. Expression analysis of the gene group was performed using RNA-seq and RT-PCR.

[0075] (RNA-seq method) After pretreatment with Fruit-mate for RNA Purification (Takara Bio), total RNA was extracted from Mandevilla petals using RNeasy Plant mini (Qiagen). A library for RNA-Seq was prepared using MGIEasy RNA Directional Library Prep Set (MGI). Paired-end sequence data of 150 bases was obtained using MGI DNBSeq-G400RS. After removing low-quality sequences and adapter sequences, the expression levels were calculated by mapping to the reference sequence.

[0076] (Quantitative RT-PCR method) The total RNA was subjected to reverse transcription reaction using ReverTra Ace (Toyobo) to prepare cDNA. Quantitative PCR was performed using PowerUp SYBR Green Master Mix (Applied Biosystems) and StepOnePlus real-time PCR system (Applied Biosystems). The expression level was calculated using the actin gene as an endogenous control.

[0077] As a result, as shown in Figure 4, both genes (galactosyltransferase gene and xylosyltransferase gene) were highly expressed in the red cultivar (173), but their expression was hardly observed in the blue cultivar (MW65). This result also indicates that it is consistent with the idea that most of the cyanidin in blue mandevilla is not modified with sugar and exists in the form of aglycone.

[0078] Example 4 Aglycones are generally unstable, and are known to be stabilized in cells by modifications such as glycosylation and acylation. One of the possibilities for stabilizing the aglycone of highly accumulated cyanidin is the copigment effect (see, for example, Non-Patent Document 3). The copigment effect is well known in hydrangea, and is an effect in which anthocyanins combine with substances such as flavones (these substances are mostly colorless or pale yellow) and metal ions in the body to enhance the blue color. Substances that may act as one of the causes of blue flowers were searched for in a blue variety (MW65) using LC-MS.

[0079] (LC-MS) Petal extracts were prepared using 5% AcOH, 50% MeCN-5%AcOH, and MeCN-5% AcOH. LC-MS experiments were performed using an LCMS-IT-TOF (Shimadzu) with a YMC-Triart C18 (3μm, 2.1x100mm, YMC) column. The LC mobile phases were 0.1% formic acid / water (mobile phase A) and 0.1% formic acid / acetonitrile (mobile phase B). The binary gradient gradient was changed from 20% to 100% over 15 minutes, and then the mobile phase B concentration was 100% for 10 minutes at a flow rate of 0.4mL / min. A large peak was found for blue-stained Mandevilla at around 6.3 minutes in the chromatogram at 325nm. The structure of this peak was analyzed based on the MS and MS / MS spectra.

[0080] As a result, it was found that chlorogenic acid (3-CQA) accumulated at high concentrations in the blue cultivar (MW65), as shown in Figure 5. It was suggested that this chlorogenic acid (3-CQA) may contribute to the blue color of the blue cultivar (MW65).

[0081] Example 5 When 2 g of the petals of the blue cultivar Mandevilla was squeezed using a garlic squeezer, a red juice was obtained at pH 3.7 (see Figure 6 (a)). This result suggests that cyanidin aglycone is red at low pH and that it may be necessary for cyanidin aglycone to be localized in the cytoplasm in order to produce a blue color.

[0082] When the petals of the blue variety of Mandevilla were treated with various solvents, all of the pigments were extracted into the methanol when it was extracted with amphiphilic methanol, turning the petals white and all of the pigments being extracted (see Figure 6 (b)). This is thought to be because both the cyanidin aglycone and glycoside were extracted, and the methanol containing the pigments turned blue.

[0083] On the other hand, when extraction was performed using the organic solvent hexane (hydrophobic), the hexane was colorless and transparent, but the petals turned red (see Figure 6 (c)). This is thought to be because the fat-soluble aglycone was extracted, but the glycosides remained, causing the petals to turn red.

[0084] Example 6 In order to observe color development under neutral conditions that mimic the cytoplasmic environment, an in vitro pigment reconstitution experiment was performed. Cyanidin chloride (ChromaDex) and 3-O-Caffeoylquinic acid (Nagara Science) were dissolved in DMSO to a concentration of 10 mM. A reconstitution experiment with cyanidin alone was performed by adding the above cyanidin chloride solution to a 50 mM phosphate buffer solution of pH 4.4 to 9.3 to a concentration of 0.5 mM, mixing and reacting at room temperature. A reconstitution experiment with copigments and metal ions was performed by adding the above cyanidin chloride solution and 3-O-Caffeoylquinic acid solution to a 50 mM phosphate buffer solution of pH 4.4 to 9.3 to a concentration of 0.5 mM, adding an aluminum ion solution (1 mM ammonium aluminum sulfate solution) to an aluminum ion concentration of 0.1 mM, mixing and reacting at room temperature (see the table in Figure 7).

[0085] As a result, it was observed that cyanidin aglycone alone turned blue at neutral pH (see Figure 7). This strongly suggests that when cyanidin aglycone is present in the cytoplasm, it can turn blue by itself without the action of copigments or metal ions.

[0086] Example 7 In order to prepare a marker specific to the blue variety (MW65), the above-mentioned galactosyltransferase gene and xylosyltransferase gene and their neighboring base sequences were analyzed. As a result, it was found that two deletions of 16 bp and 30 bp were present in the promoter region of the galactosyltransferase gene, and a 173 bp insertion was present in the promoter region of the xylosyltransferase gene, which were specific to the blue variety (see Figures 8 and 9). In addition, two sequences of paternal and maternal origin were obtained from the red variety (173), which were named 173-h1 and 173-h2, respectively. Therefore, the galactosyltransferase gene of the red variety 173-h1 has the sequence shown in SEQ ID NO: 8, and the galactosyltransferase gene of the red variety 173-h2 has the sequence shown in SEQ ID NO: 9. In addition, the xylosyltransferase gene of the red variety 173-h1 has the sequence shown in SEQ ID NO: 10, and the xylosyltransferase gene of the red variety 173-h2 has the sequence shown in SEQ ID NO: 11.

[0087] For the galactosyltransferase gene, PCR primers were designed to span this deleted region (g21571-F7 (SEQ ID NO: 12): ACTGGCCTCGCCATTAACG, g21571-R5 (SEQ ID NO: 13): GTAATTTAATTAAGATGCGTAATTCTCTG) (see FIG. 10).

[0088] Furthermore, for the xylosyltransferase gene, PCR primers were designed within this insert (g19028-F7 (SEQ ID NO: 14): AGTGTCTCTTCCTTAGTTCCTG, g19028-R5 (SEQ ID NO: 15): CTGAATTTTAAGAGATCGTTCATAATACG) (see FIG. 10).

[0089] PCR was performed using DNA extracted from leaves of blue (MW65), red (173), and hybrid (13918) varieties using NucleoSpin Plant II (MACHEREY-NAGEL) as a template and the primers described above. PCR was performed using Tks gflex DNA polymerase (Takara Bio) under the following conditions: 98°C for 15 seconds, 60°C for 20 seconds, and 68°C for 30 seconds, for 30 cycles.

[0090] As a result, a 122 bp amplified fragment was obtained for the galactosyltransferase gene in the blue cultivar (MW65) and the hybrid (13918), whereas no amplification was observed in the red cultivar (173) (see Figure 11(a)). A 121 bp amplified fragment was obtained for the xylosyltransferase gene in the blue cultivar (MW65) and the hybrid (13918), whereas no amplification was observed in the red cultivar (173) (see Figure 11(b)).

[0091] It was found that by performing PCR using these primers and examining whether an amplified fragment of the desired length was obtained, it is possible to easily identify the blue variety (MW65) and its progeny.

[0092] Example 8 To confirm the intracellular localization of the pigments, protoplasts were prepared from petals of the blue cultivar (MW65), red cultivar (173), and hybrid cultivar (13918), and the location of the pigments was confirmed.

[0093] Protoplasts were prepared as follows. 0.1 g of petal fragments and 10 mL of enzyme solution (1% (w / v) Cellulase “ONOZUKA” RS (Yakult Pharmaceutical Co., Ltd.), 1% (w / v) Mecerozyme (Yakult Pharmaceutical Co., Ltd.), 180 mM KCl, 20 mM CaCl2, 20 mM MgCl2 pH 5.5) were added to a 100 mL Erlenmeyer flask and incubated for 90 minutes in an incubator at 30°C with reciprocal shaking at 40 mm amplitude and 50 strokes per minute. The mixture was transferred to a 50 mL round-bottom glass centrifuge tube and centrifuged at 100×g (730 rpm) for 2 minutes to precipitate the protoplasts, which were then gently suspended in the remaining liquid with a pipette. 10 mL of 0.5 M Mannitol was added to the suspension and suspended, and the suspension was used as a sample for observation. The samples were placed on a slide glass for blood cell counting and observed under a phase contrast microscope BX40 (Olympus).

[0094] In the red cultivar (173), the red pigment was uniformly distributed in the vacuoles (see Figure 12(a) and (b)), whereas in the blue cultivar (MW65), the cytoplasm, but not the vacuoles, was observed to be stained blue, and blue granular structures were also observed (see Figure 12(e) and (f)).

[0095] In the hybrid (13918), both states were observed, with the vacuoles stained uniformly red, while blue granular structures were observed localized in the cytoplasm (see Figure 12 (c) and (d)). This revealed that cyanidin aglycone is localized in the cytoplasm, not in the vacuoles where glycosides are localized, and that it forms granular structures in some parts. This localization of the pigment in the cytoplasm is a previously unknown phenomenon, and is thought to be a trait that characterizes the blue variety (MW65) and its progeny.

Claims

**Claim 1** A method for producing a plant, comprising accumulating anthocyanidin pigment in cells of the petals of the plant in an amount of 30% by mass or more based on the total amount of pigments present in the cells, and Compared with the flower color of the plant before accumulating the anthocyanidin pigment, the flower color of the plant after accumulating the anthocyanidin pigment has a change such that the value of b in the CIE ＊ a ＊ b ＊ color system decreases, ＊ and is changing. the method. **Claim 2** The method according to claim 1, wherein the anthocyanidin pigment is accumulated by at least partially deleting an anthocyanidin-modifying enzyme gene. **Claim 3** Comprising at least partially deleting a promoter region of the anthocyanidin-modifying enzyme gene, and the anthocyanidin-modifying enzyme is selected from anthocyanidin glycosyltransferase and / or anthocyanidin 3-glucoside glycosyltransferase, The method according to claim 2. **Claim 4** The anthocyanidin glycosyltransferase is a galactose transferase, and in the promoter region of the galactose transferase gene, at least one sequence selected from the group consisting of the sequence shown in SEQ ID NO: 1, the sequence shown in SEQ ID NO: 2, and sequences having at least 90% identity thereto is deleted, The method according to claim 3. **Claim 5** The anthocyanidin 3-glucoside glycosyltransferase is a xylose transferase, and in the promoter region of the xylose transferase gene, at least one sequence selected from the group consisting of the sequence shown in SEQ ID NO: 3 and sequences having at least 90% identity thereto is inserted, The method according to claim 3. **Claim 6** The method according to claim 1 or 2, wherein the anthocyanidin pigment is cyanidin. **Claim 7** The method according to claim 1 or 2, wherein the anthocyanidin pigment is localized in the cytoplasm of the cells. **Claim 8** The method according to claim 1 or 2, wherein chlorogenic acid and aluminum ions are contained in the cells of the petals of the plant. **Claim 9** The method according to claim 1 or 2, wherein the plant is at least one selected from the group consisting of plants of the family Caryophyllaceae, Solanaceae, Brassicaceae, and Pedaliaceae. **Claim 10** The method according to claim 1 or 2, wherein the plant is at least one selected from the group consisting of plants of the genus Mandevilla, Petunia, and Torenia. **Claim 11** The method according to claim 10, wherein the Mandevilla plant is a plant with accession number FERM BP-22483 or its descendants, which was deposited with the Patent Biological Depositary Center (NITE-IPOD), National Institute of Technology and Evaluation, under the accession number FERM ABP-22483.

12. In the cells of the petals of the plant, the anthocyanidin pigment is accumulated at 30% by mass or more relative to the total amount of pigments present in the cells, and at least a part of the anthocyanidin-modifying enzyme gene is deleted. A plant.

13. The plant according to claim 12, wherein the anthocyanidin pigment is localized in the cytoplasm of the cells.

14. Including at least partially deleting the promoter region of the anthocyanidin-modifying enzyme gene, and the anthocyanidin-modifying enzyme is selected from anthocyanidin glycosyltransferase and / or anthocyanidin 3-glucoside glycosyltransferase. The plant according to claim 12.

15. The anthocyanidin glycosyltransferase is a galactose transferase, and in the promoter region of the galactose transferase gene, at least one sequence selected from the group consisting of the sequence shown in SEQ ID NO: 1, the sequence shown in SEQ ID NO: 2, and sequences having at least 90% identity therewith is deleted. The plant according to claim 14.

16. The anthocyanidin 3-glucoside glycosyltransferase is a xylose transferase, and in the promoter region of the xylose transferase gene, at least one sequence selected from the group consisting of the sequence shown in SEQ ID NO: 3 and sequences having at least 90% identity therewith is inserted. The plant according to claim 14.

17. The plant according to claim 12, wherein the anthocyanidin pigment is cyanidin.

18. The plant according to claim 12, wherein chlorogenic acid and aluminum ions are contained in the cells of the petals of the plant.

19. The plant according to claim 12, wherein the plant is at least one selected from the group consisting of plants of the family Caryophyllaceae, Solanaceae, Brassicaceae, and Pedaliaceae.

20. The plant according to claim 12, wherein the plant is at least one selected from the group consisting of plants of the genus Mandevilla, Petunia, and Torenia.

21. The mandevilla plant is a plant with the accession number FERM BP-22483 or its progeny deposited with the Patent Biological Depositary, National Institute of Technology and Evaluation (NITE-IPOD) under the accession number FERM ABP-22483, wherein the progeny has anthocyanidin pigments accumulated at 30% by mass or more relative to the total amount of pigments present in the cells of the petals of the plant, and at least a part of the anthocyanidin-modifying enzyme gene is deleted, The plant according to claim 20.

22. Progeny of the plant according to any one of claims 12 to 21, wherein the progeny has anthocyanidin pigments accumulated at 30% by mass or more relative to the total amount of pigments present in the cells of the petals of the plant, and at least a part of the anthocyanidin-modifying enzyme gene is deleted, Progeny.

23. Propagating material of the plant according to any one of claims 12 to 21, wherein the plant has anthocyanidin pigments accumulated at 30% by mass or more relative to the total amount of pigments present in the cells of the petals of the plant, and at least a part of the anthocyanidin-modifying enzyme gene is deleted, Propagating material.

24. A part, tissue or cell of the plant body of the plant according to any one of claims 12 to 21, wherein the plant has anthocyanidin pigments accumulated at 30% by mass or more relative to the total amount of pigments present in the cells of the petals of the plant, and at least a part of the anthocyanidin-modifying enzyme gene is deleted, A part, tissue or cell of the plant body.

Images