Methods and products for genetic engineering

Abstract

To provide an improved tool and method for gene editing by using a CRISPR / Cas technique.SOLUTION: The present invention relates to virus-derived particles including one or more Cas proteins, and a kit and a method using the particles in order to change a target nucleic acid. The present invention further relates to (i) a fusion protein including a viral protein which self assembles for generating virus-derived particles, where the virus protein is fused to (ii) the Cas protein. In some embodiments, the fusion protein includes a cleavable portion positioned between the viral protein and the Cas protein, particularly a cleavable portion positioned between a Gag protein and a Cas9 protein.SELECTED DRAWING: None

Description

[Technical field]

[0001] FIELD OF THEINVENTION The present invention relates to the field of gene targeting by methods using virus-derived vector systems related to clustered regularly interspaced short palindromic repeats (CRISPR) and its components. [Background technology]

[0002] 2. Background of the Invention Genome editing using targetable nucleases is an emerging technology for precise genome modification of organisms ranging from bacteria to plants and animals (including humans). Its appeal is that it can be used in almost any organism where targeted genome modification has not been possible by other types of methods.

[0003] The improvement of protocols for expressing exogenous proteins in human cells is of great interest for research and medical purposes.Despite the continuous evolution of transfection methods and performance of viral vectors, the efficiency of these approaches can vary dramatically, especially in primary cells, which are highly sensitive to the modification of their environment and can change in response to transfection agents / vectors.In addition, the delivery of genetic information via the transfer of integrated / non-integrated coding DNA can cause adverse effects, such as the induction of undesired stress signals or the unexpected insertion of exogenous genes into the cell genome, which is particularly serious in the case of therapeutic applications of stem cells.

[0004] Recent approaches for targeted genome modification (Zinc Finger Nucleases (ZFNs) and Transcription Activator-Like Effector Nucleases (TALENs)) have enabled researchers to generate permanent mutations by introducing double-stranded breaks and activating repair pathways. The ability of engineered nucleases (e.g., ZFNs and TALENs) to generate DNA double-stranded breaks at desired locations in the genome has raised optimism for therapeutic applications of locus-specific genome engineering. However, these approaches are costly and time-consuming for technicians, limiting their widespread use, especially in large-scale high-throughput studies.

[0005] More recently, new tools based on an entirely separate and specific system, namely the bacterial CRISPR-associated protein-9 nuclease (Cas9) from Streptococcus pyogenes, have attracted great interest.

[0006] To achieve site-specific DNA recognition and cleavage, Cas9 must complex with both the crRNA and a separate trans-activating crRNA (tracrRNA or trRNA), which is partially complementary to the crRNA. (11) The tracrRNA is required for crRNA maturation from a primary transcript that encodes multiple pre-crRNAs.

[0007] During target DNA cleavage, the HNH and RuvC-like nuclease domains cut both DNA strands, generating a double-stranded break (DSB) at a site defined by the 20-nucleotide guide sequence (which base-pairs with the target DNA) in the associated crRNA transcript. The HNH domain cleaves the target DNA strand that is complementary to the guide RNA, whereas the RuvC domain cleaves the non-complementary strand. The double-stranded endonuclease activity of Cas9 also requires that a short conserved sequence (2-5 nt) known as a protospacer-associated motif (PAM) be immediately 3' of the crRNA-complementary sequence.

[0008] The simplicity of type II CRISPR nucleases, with only three essential components (Cas9 plus crRNA and trRNA), makes the system suitable for genome editing applications. This potential was realized in 2012 by the Doudna and Charpentier laboratories (Jinek et al., 2012, Science, Vol.337: 816-821). Based on the previously described type II CRISPR system, a simple two-component system was developed by combining trRNA and crRNA into a single synthetic single guide RNA (sgRNA). sgRNA-programmed Cas9 was shown to be as effective as Cas9 programmed with separate trRNA and crRNA in guiding targeted gene changes.

[0009] Mainly, three different variants of Cas9 nuclease are employed in genome editing protocols. The first is wild-type Cas9, which can site-specifically cleave double-stranded DNA, leading to the activation of double-strand break (DSB) repair mechanisms. DSBs can be repaired by the cellular non-homologous end joining (NHEJ) pathway (Overballe-Petersen et al., 2013, Proc Natl Acad Sci USA, Vol. 110: 19860-19865), resulting in insertions and / or deletions (indels) that disrupt the target locus. Alternatively, if a donor template with homology to the target locus is provided, DSBs can be repaired by the homology-directed repair (HDR) pathway, which allows for precise substitution mutagenesis (Overballe-Petersen et al., 2013, Proc Natl Acad Sci USA, Vol. 110: 19860-19865; Gong et al., 2005, Nat. Struct Mol Biol, Vol. 12: 304-312).

[0010] Cong and colleagues (Cong et al., 2013, Science, Vol. 339: 819-823) further developed the Cas9 system to a higher degree of precision by developing a mutant form (known as Cas9D10A) that only has nickase activity. This means that Cas9D10A only cuts one DNA strand and does not activate NHEJ. Instead, when a homologous repair template is provided, DNA repair is only carried out via the high-fidelity HDR pathway, resulting in reduced indel mutations (Cong et al., 2013, Science, Vol. 339: 819-823; Jinek et al., 2012, Science, Vol.337: 816-821; Qi et al., 2013 Cell, Vol. 152: 1173-1183). Cas9D10A is even more attractive in terms of target specificity when the locus is targeted by paired Cas9 complexes designed to generate adjacent DNA nicks.

[0011] The third mutant is nuclease-deficient Cas9 (Qi et al., 2013 Cell, Vol. 152: 1173-1183). Mutations H840A in the HNH domain and D10A in the RuvC domain inactivate cleavage activity but do not prevent DNA binding. Therefore, this mutant can be used to sequence-specifically target any region of the genome without cleavage. Alternatively, by fusing with various effector domains, dCas9 can be used as either a gene silencing or activation tool. In addition, it can be used as a visualization tool by coupling guide RNA or Cas9 protein to fluorophores or fluorescent proteins.

[0012] Following its initial demonstration in 2012 (9), the CRISPR / Cas9 system has been widely adopted by the scientific community. It is found in humans (Mali et al., 2013, Science, Vol. 339: 823-826), bacteria (Fabre et al., 2014, PLoS Negl. Trop. Dis., Vol. 8:e2671.), zebrafish (Hwang et al., 2013, PLoS One, Vol. 8:e68708.), C. elegans (Hai et al., 2014 Cell Res. doi: 10.1038 / cr.2014.11.), bacteria (Fabre et al., 2014, PLoS Negl. Trop. Dis., Vol. 8:e2671.), and plants (Mali et al., 2013, Science, Vol. 339: 823-826), Xenopus tropicalis (Guo et al., 2014, Development, Vol. 141: 707-714.), yeast (DiCarlo et al., 2013, Nucleic Acids Res., Vol. 41: 4336-4343.), Drosophila (Gratz et al., 2014 Genetics, doi:10.1534 / genetics.113.160713), monkey (Niu et al., 2014, Cell, Vol. 156: 836-843.), rabbit (Yang et al., 2014, J. Mol. Cell Biol., Vol. 6: 97-99.), pig (Hai et al., 2014, Cell Res. doi: 10.1038 / cr.2014.11.), rat (Ma et al., 2014, Cell Res., Vol. It has been successfully used to target important genes in many cell lines and organisms, including human (Mashiko et al., 2014, Dev. Growth Differ. Vol. 56: 122-125.) and mice (Mashiko et al., 2014, Dev. Growth Differ. Vol. 56: 122-129.). Currently, several groups are utilizing this method to introduce single point mutations (deletions or insertions) into specific target genes via a single gRNA.Alternatively, gRNA-specific Cas9 nuclease pairs can be used to induce large deletions or genomic rearrangements such as inversions or translocations. A recent and exciting development is the use of the dCas9 version of the CRISPR / Cas9 system to target protein domains for transcriptional regulation of specific genomic loci, epigenetic modification, and microscopic visualization.

[0013] To change target specificity, the CRISPR / Cas9 system only requires redesign of the crRNA. This is in contrast to other genome editing tools (including zinc fingers and TALENs), which require redesign of the protein-DNA interface. Furthermore, CRISPR / Cas9 allows rapid and genome-wide investigation of gene function by generating large gRNA libraries for genomic screening.

[0014] Therefore, CRISPR / Cas9 technology can be easily adapted to any gene of interest and offers unparalleled possibilities to modify genes (knockout, knockin, precise introduction of mutations). Its popularity in the scientific community has been astonishingly fast, triggering a recent surge in scientific communication using it.

[0015] Generally, CRISPR delivery is carried out by DNA transfection or through the use of viral vectors encoding Cas9, both of which are convenient but limited to certain cell types and are quite intrusive. Moreover, Cas9-mediated cleavage occurs quickly (Jinek et al., 2013, eLife, Vol. 2, e00471) and may even be toxic in the long term, so maintaining Cas9 expression for a long period of time is likely toxic and unnecessary at best. Other approaches have successfully utilized recombinant Cas9 and synthetic RNA to transfer RNPc by proteotransfection or by physical microinjection, but these CRISPR systems are still limited to targeting fragile primary cells.

[0016] There is a need in the art for improved tools and methods for gene editing using CRISPR / Cas technology. Summary of the Invention

[0017] The present invention relates to products and methods for generating alterations in genomic nucleic acid; these alterations include mutations through the introduction of nucleic acid insertions and deletions, including knock-in and knock-out genomic alterations.

[0018] More precisely, the present invention relates to products and methods of use thereof aimed at generating nucleic acid alteration events triggered by CRISPR-Cas complexes, in particular by CRISPR-Cas9 complexes.

[0019] The present invention relates to virus-derived particles comprising one or more Cas proteins, in particular the Cas9 protein.

[0020] In some embodiments, the virus-derived particle further comprises or is further complexed with one or more CRISPR-Cas system guide RNAs.

[0021] In some embodiments, the virus-derived particle further comprises or is further complexed with a targeting nucleic acid.

[0022] In some embodiments, the virus-derived particle is a retrovirus-derived particle, such as a lentivirus-derived vector particle.

[0023] The present invention further relates to a composition for altering a target nucleic acid in a eukaryotic cell, the composition comprising a virus-derived particle comprising one or more Cas proteins, in particular a Cas9 protein.

[0024] In some embodiments, the composition further comprises, or is further complexed with, one or more CRISPR-Cas system guide RNAs.

[0025] In some embodiments, the composition further comprises a targeting nucleic acid.

[0026] The present invention also relates to a kit comprising the necessary materials for preparing a virus-derived particle or composition as defined above.

[0027] It also relates to genetically modified cells, particularly in the form of stable cell lines, which produce virus-derived particles as defined herein.

[0028] The invention further relates to a fusion protein comprising (i) a viral protein that self-assembles to generate a virus-derived particle, said viral protein being fused to (ii) a Cas protein. In some embodiments, said fusion protein comprises a cleavable site located between said viral protein and said Cas protein, in particular a cleavable site located between a Gag protein and a Cas9 protein.

[0029] It also relates to nucleic acids and vectors encoding said fusion proteins. [Brief description of the drawings]

[0030] [Figure 1A]Molecular basis of Cas9-VLP assembly and transfer of CRISPR components into recipient cells. (A) Schematic of Cas9-VLP assembly from HEK293T cells. Six steps are shown: (1) HEK293T cells are transfected with GAG-CAS9, GAG ProPol and viral envelope proteins along with a construct encoding guide RNA. GAG and viral envelope tend to localize to the membrane where assembly of virus-derived particles (which may also be referred to herein as "virus-like particles" or "VLPs") occurs (2). As the concentration of GAG increases, mechanical forces induce the formation of particles (3), which will bud from the producer cell after all participants of the CRISPR machinery are incorporated (4). These particles can be concentrated and are ultrastable for 15 days at 4 °C. Through the maturation process, viral proteases may have released most of the Cas9 proteins from the GAG ​​platforms within the particles (5). Upon exposure to a target cell, the VLPs will be able to bind and fuse with the cell membrane via envelope / receptor interactions (this will therefore depend on the particle and the envelope used to pseudotype the target cell under study). After fusion with the cell membrane, the VLPs transport their cargo, which may include Cas9 / gRNA ribonucleocomplexes (probably free gRNA or Cas9 associated with a non-protease GAG) into the recipient cell (still unclear). Nevertheless, the fully active CRISPR RNPc is delivered to the nucleus of the recipient cell (probably by reassociation of Cas9 and free gRNA in the target cell) and mediates cleavage of the genomic DNA at the very location specified by the gRNA (6). (B) Molecular design of the GAG-Cas9 coding construct. The hCMVp (human cytomegalovirus early promoter) drives the expression of an mRNA incorporating an intron (rBG) and polyadenylation (rBGpA) signal, both of which are derived from the rabbit β-globin gene sequence. This construct consists of a fusion of the MLV-GAG polyprotein with a codon-optimized Cas9 sequence from Streptococcus pyogenes.Both parts are separated by an MLV protease cleavage site (ps) and a flag tag sequence fused to the Cas9 sequence. [Figure 1B]Molecular basis of Cas9-VLP assembly and transfer of CRISPR components into recipient cells. (A) Schematic of Cas9-VLP assembly from HEK293T cells. Six steps are shown: (1) HEK293T cells are transfected with GAG-CAS9, GAG ProPol and viral envelope proteins along with a construct encoding guide RNA. GAG and viral envelope tend to localize to the membrane where assembly of virus-derived particles (which may also be referred to herein as "virus-like particles" or "VLPs") occurs (2). As the concentration of GAG increases, mechanical forces induce the formation of particles (3), which will bud from the producer cell after all participants of the CRISPR machinery are incorporated (4). These particles can be concentrated and are ultrastable for 15 days at 4 °C. Through the maturation process, viral proteases may have released most of the Cas9 proteins from the GAG ​​platforms within the particles (5). Upon exposure to a target cell, the VLPs will be able to bind and fuse with the cell membrane via envelope / receptor interactions (this will therefore depend on the particle and the envelope used to pseudotype the target cell under study). After fusion with the cell membrane, the VLPs transport their cargo, which may include Cas9 / gRNA ribonucleocomplexes (probably free gRNA or Cas9 associated with a non-protease GAG) into the recipient cell (still unclear). Nevertheless, the fully active CRISPR RNPc is delivered to the nucleus of the recipient cell (probably by reassociation of Cas9 and free gRNA in the target cell) and mediates cleavage of the genomic DNA at the very location specified by the gRNA (6). (B) Molecular design of the GAG-Cas9 coding construct. The hCMVp (human cytomegalovirus early promoter) drives the expression of an mRNA incorporating an intron (rBG) and polyadenylation (rBGpA) signal, both of which are derived from the rabbit β-globin gene sequence. This construct consists of a fusion of the MLV-GAG polyprotein with a codon-optimized Cas9 sequence from Streptococcus pyogenes.Both parts are separated by an MLV protease cleavage site (ps) and a flag tag sequence fused to the Cas9 sequence. [Figure 2A] Molecular validation of gene cleavage by YFP-CRISPR-VLPs. (A) Localization of gRNA recognition sites on the YFP gene, primers used and principle of surveyor assay. L929 mouse cells were lenticularly transduced with a YFP-encoding vector at a low multiplicity of infection (MOI). Then, 72 h later, cells were treated with VLPs loaded with gRNAs targeting the YFP gene at two different positions as indicated. To confirm YFP cleavage, cells treated with Cas9-VLPs were lysed and genomic DNA was extracted and analyzed by an S1 nuclease-based surveyor assay. The test detects heteroduplexes formed when two closely related ssDNA molecules hybridize: thus, S1 nuclease digestion is evidence of DNA cleavage by Cas9. (B) Surveyor assay of L929 cells treated with VLPs loaded with gRNA2, 1 or a combination of both. Heteroduplex formation is detected for each rRNA condition, revealing a truncated YFP whose size depends on the position of the gRNA on the YFP sequence. [Figure 2B]Molecular validation of gene cleavage by YFP-CRISPR-VLPs. (A) Localization of gRNA recognition sites on the YFP gene, primers used and principle of surveyor assay. L929 mouse cells were lenticularly transduced with a YFP-encoding vector at a low multiplicity of infection (MOI). Then, 72 h later, cells were treated with VLPs loaded with gRNAs targeting the YFP gene at two different positions as indicated. To confirm YFP cleavage, cells treated with Cas9-VLPs were lysed and genomic DNA was extracted and analyzed by an S1 nuclease-based surveyor assay. The test detects heteroduplexes formed when two closely related ssDNA molecules hybridize: thus, S1 nuclease digestion is evidence of DNA cleavage by Cas9. (B) Surveyor assay of L929 cells treated with VLPs loaded with gRNA2, 1 or a combination of both. Heteroduplex formation is detected for each rRNA condition, revealing a truncated YFP whose size depends on the position of the gRNA on the YFP sequence. [Figure 3A]CRISPR-mediated disruption of YFP in L929 mouse cells by Cas9-VLP. (A) A guide RNA was made to target YFP downstream of the start codon ATG. After cleavage, cells could repair this gap by NHEJ, a mechanism that can create small deletions and indels (lesions that can change the YFP frame in some cells). Thus, three different versions of the repaired YFP can be generated by the native repair mechanism, but only one of them will restore the in-frame YFP and maintain the YFP phenotype. Thus, cleavage should induce a detectable but incomplete reduction of YFP in the target cells. (B) VLPs loaded with Cas9 and guide RNA targeting YFP were produced and directly introduced into the culture medium of YFP-L929 cells (mouse fibroblast cell line #) to stably integrate YFP into the genome by lentivector transduction. Non-enveloped VLPs were also produced and used as a negative control. After 72 hours of treatment, cells were analyzed by flow cytometry (FACS) and the overall mean fluorescence intensity (MFI) was monitored to reveal the strong effect of YFP-disrupted Cas9-VLPs on YFP L929 target cells. A 7-fold decrease in MFI was measured in cells treated with enveloped VLPs compared to untreated YFP cells or treatment with non-enveloped VLPs*. Here, we show that Cas9-VLPs loaded with specific guide RNAs can be used as CRISPR delivery agents without further concentration / purification processes. [Figure 3B]CRISPR-mediated disruption of YFP in L929 mouse cells by Cas9-VLP. (A) A guide RNA was made to target YFP downstream of the start codon ATG. After cleavage, cells could repair this gap by NHEJ, a mechanism that can create small deletions and indels (lesions that can change the YFP frame in some cells). Thus, three different versions of the repaired YFP can be generated by the native repair mechanism, but only one of them will restore the in-frame YFP and maintain the YFP phenotype. Thus, cleavage should induce a detectable but incomplete reduction of YFP in the target cells. (B) VLPs loaded with Cas9 and guide RNA targeting YFP were produced and directly introduced into the culture medium of YFP-L929 cells (mouse fibroblast cell line #) to stably integrate YFP into the genome by lentivector transduction. Non-enveloped VLPs were also produced and used as a negative control. After 72 hours of treatment, cells were analyzed by flow cytometry (FACS) and the overall mean fluorescence intensity (MFI) was monitored to reveal the strong effect of YFP-disrupted Cas9-VLPs on YFP L929 target cells. A 7-fold decrease in MFI was measured in cells treated with enveloped VLPs compared to untreated YFP cells or treatment with non-enveloped VLPs*. Here, we show that Cas9-VLPs loaded with specific guide RNAs can be used as CRISPR delivery agents without further concentration / purification processes. [Figure 4A]Deletion of the Myd88 locus using conventional Cas9 delivery methods and Cas9 VLP. (A) Schematic diagram of Myd88 genomic DNA and the location of the various tools used for the Myd88 cleavage assay. Two different CRISPR sequences were designed for the human Myd88 gene, as represented in purple and green. The grey boxes correspond to the regions where the two PCR primers hybridize. They are optimized for the amplification of gMyd88, which generates an amplicon size of 420 nt. When the CRISPR system is active in the target cells, a 160 nt deletion occurs in some cells, which can be repaired by NHEJ, resulting in a truncated gene of 260 nt size. (B) PCR amplification of gMyd88 in wt-HEK or after transfection with both Myd88 CRISPR and Cas9 coding plasmids. After extraction of genomic DNA, PCR assays were performed using the Myd88 primer set. In the population treated with CRISPR components, two amplicons are generated after cleavage of the gene at the two target locations, corresponding to the uncleaved Myd88 (or the version cleaved by a single CRISPR) and the double cut version. It can be seen that Myd88 deletion does not affect all treated cells, indicating that the cleavage mediated by the transfection CRISPR component system is not complete. (C) We also tried to deliver both Myd88 guide RNAs by Cas9-loaded VLPs. For this, we produced VLPs according to the procedure shown in Figure 1 and investigated different experimental procedures depending on the ratio of the plasmids used and the nature of the envelope (R1-R4). After collecting and concentrating them, the VLPs were introduced into the medium of HEK or Hela cells, and then the efficiency of Myd88 cleavage was evaluated by PCR. (D) Myd88 amplification using the Myd88 primer set and genomic DNA extracted from cells treated with VLPs. While all preparations were equally efficient at cleaving Myd88 in HEK cells (left panel), some differences could be seen in HeLa cells, reflecting the importance of the envelope / protein ratio used. A specific protocol appears optimal for both cell types (R1). [Figure 4B] Deletion of the Myd88 locus using conventional Cas9 delivery methods and Cas9 VLP. (A) Schematic diagram of Myd88 genomic DNA and the location of the various tools used for the Myd88 cleavage assay. Two different CRISPR sequences were designed for the human Myd88 gene, as represented in purple and green. The grey boxes correspond to the regions where the two PCR primers hybridize. They are optimized for the amplification of gMyd88, which generates an amplicon size of 420 nt. When the CRISPR system is active in the target cells, a 160 nt deletion occurs in some cells, which can be repaired by NHEJ, resulting in a truncated gene of 260 nt size. (B) PCR amplification of gMyd88 in wt-HEK or after transfection with both Myd88 CRISPR and Cas9 coding plasmids. After extraction of genomic DNA, PCR assays were performed using the Myd88 primer set. In the population treated with CRISPR components, two amplicons are generated after cleavage of the gene at the two target locations, corresponding to the uncleaved Myd88 (or the version cleaved by a single CRISPR) and the double cut version. It can be seen that Myd88 deletion does not affect all treated cells, indicating that the cleavage mediated by the transfection CRISPR component system is not complete. (C) We also tried to deliver both Myd88 guide RNAs by Cas9-loaded VLPs. For this, we produced VLPs according to the procedure shown in Figure 1 and investigated different experimental procedures depending on the ratio of the plasmids used and the nature of the envelope (R1-R4). After collecting and concentrating them, the VLPs were introduced into the medium of HEK or Hela cells, and then the efficiency of Myd88 cleavage was evaluated by PCR. (D) Myd88 amplification using the Myd88 primer set and genomic DNA extracted from cells treated with VLPs. While all preparations were equally efficient at cleaving Myd88 in HEK cells (left panel), some differences could be seen in HeLa cells, reflecting the importance of the envelope / protein ratio used. A specific protocol appears optimal for both cell types (R1). [Figure 4C]Deletion of the Myd88 locus using conventional Cas9 delivery methods and Cas9 VLP. (A) Schematic diagram of Myd88 genomic DNA and the location of the various tools used for the Myd88 cleavage assay. Two different CRISPR sequences were designed for the human Myd88 gene, as represented in purple and green. The grey boxes correspond to the regions where the two PCR primers hybridize. They are optimized for the amplification of gMyd88, which generates an amplicon size of 420 nt. When the CRISPR system is active in the target cells, a 160 nt deletion occurs in some cells, which can be repaired by NHEJ, resulting in a truncated gene of 260 nt size. (B) PCR amplification of gMyd88 in wt-HEK or after transfection with both Myd88 CRISPR and Cas9 coding plasmids. After extraction of genomic DNA, PCR assays were performed using the Myd88 primer set. In the population treated with CRISPR components, two amplicons are generated after cleavage of the gene at the two target locations, corresponding to the uncleaved Myd88 (or the version cleaved by a single CRISPR) and the double cut version. It can be seen that Myd88 deletion does not affect all treated cells, indicating that the cleavage mediated by the transfection CRISPR component system is not complete. (C) We also tried to deliver both Myd88 guide RNAs by Cas9-loaded VLPs. For this, we produced VLPs according to the procedure shown in Figure 1 and investigated different experimental procedures depending on the ratio of the plasmids used and the nature of the envelope (R1-R4). After collecting and concentrating them, the VLPs were introduced into the medium of HEK or Hela cells, and then the efficiency of Myd88 cleavage was evaluated by PCR. (D) Myd88 amplification using the Myd88 primer set and genomic DNA extracted from cells treated with VLPs. While all preparations were equally efficient at cleaving Myd88 in HEK cells (left panel), some differences could be seen in HeLa cells, reflecting the importance of the envelope / protein ratio used. A specific protocol appears optimal for both cell types (R1). [Figure 4D] Deletion of the Myd88 locus using conventional Cas9 delivery methods and Cas9 VLP. (A) Schematic diagram of Myd88 genomic DNA and the location of the various tools used for the Myd88 cleavage assay. Two different CRISPR sequences were designed for the human Myd88 gene, as represented in purple and green. The grey boxes correspond to the regions where the two PCR primers hybridize. They are optimized for the amplification of gMyd88, which generates an amplicon size of 420 nt. When the CRISPR system is active in the target cells, a 160 nt deletion occurs in some cells, which can be repaired by NHEJ, resulting in a truncated gene of 260 nt size. (B) PCR amplification of gMyd88 in wt-HEK or after transfection with both Myd88 CRISPR and Cas9 coding plasmids. After extraction of genomic DNA, PCR assays were performed using the Myd88 primer set. In the population treated with CRISPR components, two amplicons are generated after cleavage of the gene at the two target locations, corresponding to the uncleaved Myd88 (or the version cleaved by a single CRISPR) and the double cut version. It can be seen that Myd88 deletion does not affect all treated cells, indicating that the cleavage mediated by the transfection CRISPR component system is not complete. (C) We also tried to deliver both Myd88 guide RNAs by Cas9-loaded VLPs. For this, we produced VLPs according to the procedure shown in Figure 1 and investigated different experimental procedures depending on the ratio of the plasmids used and the nature of the envelope (R1-R4). After collecting and concentrating them, the VLPs were introduced into the medium of HEK or Hela cells, and then the efficiency of Myd88 cleavage was evaluated by PCR. (D) Myd88 amplification using the Myd88 primer set and genomic DNA extracted from cells treated with VLPs. While all preparations were equally efficient at cleaving Myd88 in HEK cells (left panel), some differences could be seen in HeLa cells, reflecting the importance of the envelope / protein ratio used. A specific protocol appears optimal for both cell types (R1). [Diagram 5] Dose-dependent cleavage of the Myd88 gene induced by Cas9-VLPs Cas9-VLPs loaded with two gRNAs targeting the Myd88 gene were produced, concentrated, and stored at 4°C for 15 days. Increasing amounts of VLPs were then added to the medium of HEK293T target cells plated in 12w plates (150000 cells / w). After 20 hours of VLP treatment, cells were lysed and genomic DNA was purified to analyze gene cleavage at the Myd88 locus. The signal indicating the deletion of Myd88 (260nt) increases with the amount of VLPs introduced into the medium. This indicates that Cas9-VLPs are active in target cells within 24 hours after their introduction. It was observed that the VLP preparations could be stable at least for 15 days at 4°C. [Figure 6] Cleavage of the Myd88 gene in HEK targets by Cas9-VLPs is enhanced by polybrene. A suboptimal dose of Cas9-VLPs loaded with two gRNAs targeting the Myd88 gene was introduced into the cultures of 3x10e6 HEK target cells grown in complete medium supplemented with or without hexadimethrine bromide (polybrene), a polycation that promotes contact between the particles and the target cells. 48 hours after VLP treatment, cells were lysed, genomic DNA was purified, and gene cleavage at the Myd88 locus was analyzed. Under these conditions, using a subsaturating amount of VLPs, Myd-88 cleavage is undetectable in cells cultured in standard medium, but is strongly enhanced by the addition of polybrene. [Figure 7A]Cas9-VLP-induced Myd88 gene cleavage in human monocyte-derived macrophages. Genotype (A) Cas9-VLPs loaded with two gRNAs targeting the Myd88 gene were concentrated and introduced into the culture medium of human monocyte-derived macrophages (100,000 cells / well in 48w plates) after 6 days of differentiation with granulocyte-macrophage colony-stimulating factor (GMCSF). After 48 hours of treatment with VLPs, cells were lysed and genomic DNA was purified to analyze gene cleavage at the Myd88 locus. Under these conditions, the Myd88 gene was cleaved with such high efficiency that the wt sequence was not even detectable by conventional PCR after treatment with VLPs, suggesting that the cleavage mediated by Myd88-VLPs in primary non-dividing cells was nearly complete. Phenotype (B) According to Lombardo et al.*, human macrophages die massively by apoptosis when cultured without GMCSF unless stimulated by a TLR-4 agonist such as LPS. This resistance to apoptosis is LPS and Myd88 dependent. To check whether VLP-treated cells lost their Myd88 function, we cultured them without GMCSF (in RPMI medium) and stimulated them with LPS for 72 h. Under this treatment, WT macrophages were resistant to GMCSF depletion (compare condition 2 with condition 3), whereas macrophages treated with Myd88-cleaved Cas9-VLPs died massively (condition 4). This strongly suggests that VLP treatment inactivated Myd88 at the functional level. [Figure 7B]Cas9-VLP-induced Myd88 gene cleavage in human monocyte-derived macrophages. Genotype (A) Cas9-VLPs loaded with two gRNAs targeting the Myd88 gene were concentrated and introduced into the culture medium of human monocyte-derived macrophages (100,000 cells / well in 48w plates) after 6 days of differentiation with granulocyte-macrophage colony-stimulating factor (GMCSF). After 48 hours of treatment with VLPs, cells were lysed and genomic DNA was purified to analyze gene cleavage at the Myd88 locus. Under these conditions, the Myd88 gene was cleaved with such high efficiency that the wt sequence was not even detectable by conventional PCR after treatment with VLPs, suggesting that the cleavage mediated by Myd88-VLPs in primary non-dividing cells was nearly complete. Phenotype (B) According to Lombardo et al.*, human macrophages die massively by apoptosis when cultured without GMCSF unless stimulated by a TLR-4 agonist such as LPS. This resistance to apoptosis is LPS and Myd88 dependent. To check whether VLP-treated cells lost their Myd88 function, we cultured them without GMCSF (in RPMI medium) and stimulated them with LPS for 72 h. Under this treatment, WT macrophages were resistant to GMCSF depletion (compare condition 2 with condition 3), whereas macrophages treated with Myd88-cleaved Cas9-VLPs died massively (condition 4). This strongly suggests that VLP treatment inactivated Myd88 at the functional level. [Figure 8]Cas9-VLP-induced Myd88 gene cleavage in freshly purified primary human lymphocytes. Human purified lymphocytes (Ficoll / percoll) were plated in 48w plates at 40x10e6 cells / ml in 200 μl. The cells were then treated with a fresh preparation of Cas9-VLPs targeting Myd88 and the older ones were maintained at 4°C for 20 days in transduction medium supplemented with polybrene (4 μg / ml). After 2 hours, 500 μl of fresh medium was added to the transduction medium and the cells were maintained in culture for 40 hours before they were lysed and genomic DNA was extracted. Myd88 cleavage was then investigated by PCR, revealing wt or truncated Myd88. In both VLP conditions, the Myd88 gene was cleaved. One million resting lymphocytes were genetically modified within 48 hours by a single treatment of VLPs without any apparent toxicity. [Figure 9] Cas9-VLP-induced cleavage of Myd88 gene in mouse bone marrow-derived macrophages Macrophages were differentiated from bone marrow cells flushed from mouse femurs incubated in MCSF-containing medium for 8 days. Cells were then treated with fresh preparations of Cas9-VLPs targeting mMyd88 in medium supplemented with polybrene (4 μg / ml). Of note, two new gRNAs were designed for this experiment that specifically target mouse genes. Cells were cultured for 48 h before lysis and genomic DNA extraction. Cleavage of Myd88 was then investigated by PCR, revealing either wt or truncated mouse Myd88 gene based on the design of the hMyd88 assay. In VLP-treated cells, highly efficient cleavage was detected by PCR, although bands corresponding to complete mMyd88 or partially truncated mMyd88 (only one gRNA) are faintly visible. [Figure 10A]Targeted insertion of a flag tag sequence in the endogenous DDX3 genomic locus mediated by an "all-in-one" Cas9-VLP. (A) Schematic diagram of the human DDX3 genomic locus and the various tools used in the experiment. The purple arrow represents the locus cut by DDX3 CRISPR, and the grey area represents the intronic region of DDX3. The FLAG IN rep primer (ssODN) is represented as a single-stranded DNA showing a 40 nt homologous repair arm (which is homologous to the DDX3 locus) flanking the Flag tag sequence. The primers used in the PCR assay are represented. (B) Principle of the "all-in-one" VLP delivering Cas9 protein, gRNA and repair primer. VLPs targeting DDX3 were produced, centrifuged and stored at 4°C. The VLPs and increasing amounts of ssODN were then combined and added to HEK target cells cultured in classical growth medium. Target cells were then lysed after 72 hours for preparation of protein extracts and genomic DNA. (C) Western blot analysis of cells treated with "all-in-one" DDX3 VLP. Western blot signal corresponding to the DDX3 expected molecular weight (86 KDa) revealed by flag antibody can be detected at the highest concentration of ssODN. This indicates that the Flag sequence was successfully inserted into the DDX3 locus of VLP-treated cells. This was further confirmed by PCR on genomic DNA extracted from VLP-treated cells. Since the forward primer hybridizes to the Flag sequence and the reverse primer hybridizes to an intron of DDX3, the primers used (shown in A) should amplify the DNA segment only if the Flag sequence was inserted into the DDX3 gene. As shown in the lower panel, gene modification is evident at high concentrations of primers and decreases with dose, but is still detectable at the DNA level at a low concentration of 0.01 nmol / ml (lane 4). (D) Introduction of the Flag sequence upstream of the endogenous locus of DDX3 in human monocyte-derived dendritic cells (Mo-derived DCs).VLPs and ssODN (5 nmol / μl final) were complexed and the mixture was used to treat Mo-derived DCs in transduction medium containing polybrene (4 μg / ml). Genomic DNA analysis showed that a single treatment with VLPs successfully added the flag sequence to the endogenous locus of DDX3 in human primary DCs. [Figure 10B]Targeted insertion of a flag tag sequence in the endogenous DDX3 genomic locus mediated by an "all-in-one" Cas9-VLP. (A) Schematic diagram of the human DDX3 genomic locus and the various tools used in the experiment. The purple arrow represents the locus cut by DDX3 CRISPR, and the grey area represents the intronic region of DDX3. The FLAG IN rep primer (ssODN) is represented as a single-stranded DNA showing a 40 nt homologous repair arm (which is homologous to the DDX3 locus) flanking the Flag tag sequence. The primers used in the PCR assay are represented. (B) Principle of the "all-in-one" VLP delivering Cas9 protein, gRNA and repair primer. VLPs targeting DDX3 were produced, centrifuged and stored at 4°C. The VLPs and increasing amounts of ssODN were then combined and added to HEK target cells cultured in classical growth medium. Target cells were then lysed after 72 hours for preparation of protein extracts and genomic DNA. (C) Western blot analysis of cells treated with "all-in-one" DDX3 VLP. Western blot signal corresponding to the DDX3 expected molecular weight (86 KDa) revealed by flag antibody can be detected at the highest concentration of ssODN. This indicates that the Flag sequence was successfully inserted into the DDX3 locus of VLP-treated cells. This was further confirmed by PCR on genomic DNA extracted from VLP-treated cells. Since the forward primer hybridizes to the Flag sequence and the reverse primer hybridizes to an intron of DDX3, the primers used (shown in A) should amplify the DNA segment only if the Flag sequence was inserted into the DDX3 gene. As shown in the lower panel, gene modification is evident at high concentrations of primers and decreases with dose, but is still detectable at the DNA level at a low concentration of 0.01 nmol / ml (lane 4). (D) Introduction of the Flag sequence upstream of the endogenous locus of DDX3 in human monocyte-derived dendritic cells (Mo-derived DCs).VLPs and ssODN (5 nmol / μl final) were complexed and the mixture was used to treat Mo-derived DCs in transduction medium containing polybrene (4 μg / ml). Genomic DNA analysis showed that a single treatment with VLPs successfully added the flag sequence to the endogenous locus of DDX3 in human primary DCs. [Figure 10C]Targeted insertion of a flag tag sequence in the endogenous DDX3 genomic locus mediated by an "all-in-one" Cas9-VLP. (A) Schematic diagram of the human DDX3 genomic locus and the various tools used in the experiment. The purple arrow represents the locus cut by DDX3 CRISPR, and the grey area represents the intronic region of DDX3. The FLAG IN rep primer (ssODN) is represented as a single-stranded DNA showing a 40 nt homologous repair arm (which is homologous to the DDX3 locus) flanking the Flag tag sequence. The primers used in the PCR assay are represented. (B) Principle of the "all-in-one" VLP delivering Cas9 protein, gRNA and repair primer. VLPs targeting DDX3 were produced, centrifuged and stored at 4°C. The VLPs and increasing amounts of ssODN were then combined and added to HEK target cells cultured in classical growth medium. Target cells were then lysed after 72 hours for preparation of protein extracts and genomic DNA. (C) Western blot analysis of cells treated with "all-in-one" DDX3 VLP. Western blot signal corresponding to the DDX3 expected molecular weight (86 KDa) revealed by flag antibody can be detected at the highest concentration of ssODN. This indicates that the Flag sequence was successfully inserted into the DDX3 locus of VLP-treated cells. This was further confirmed by PCR on genomic DNA extracted from VLP-treated cells. Since the forward primer hybridizes to the Flag sequence and the reverse primer hybridizes to an intron of DDX3, the primers used (shown in A) should amplify the DNA segment only if the Flag sequence was inserted into the DDX3 gene. As shown in the lower panel, gene modification is evident at high concentrations of primers and decreases with dose, but is still detectable at the DNA level at a low concentration of 0.01 nmol / ml (lane 4). (D) Introduction of the Flag sequence upstream of the endogenous locus of DDX3 in human monocyte-derived dendritic cells (Mo-derived DCs).VLPs and ssODN (5 nmol / μl final) were complexed and the mixture was used to treat Mo-derived DCs in transduction medium containing polybrene (4 μg / ml). Genomic DNA analysis showed that a single treatment with VLPs successfully added the flag sequence to the endogenous locus of DDX3 in human primary DCs. [Figure 10D]Targeted insertion of a flag tag sequence in the endogenous DDX3 genomic locus mediated by an "all-in-one" Cas9-VLP. (A) Schematic diagram of the human DDX3 genomic locus and the various tools used in the experiment. The purple arrow represents the locus cut by DDX3 CRISPR, and the grey area represents the intronic region of DDX3. The FLAG IN rep primer (ssODN) is represented as a single-stranded DNA showing a 40 nt homologous repair arm (which is homologous to the DDX3 locus) flanking the Flag tag sequence. The primers used in the PCR assay are represented. (B) Principle of the "all-in-one" VLP delivering Cas9 protein, gRNA and repair primer. VLPs targeting DDX3 were produced, centrifuged and stored at 4°C. The VLPs and increasing amounts of ssODN were then combined and added to HEK target cells cultured in classical growth medium. Target cells were then lysed after 72 hours for preparation of protein extracts and genomic DNA. (C) Western blot analysis of cells treated with "all-in-one" DDX3 VLP. Western blot signal corresponding to the DDX3 expected molecular weight (86 KDa) revealed by flag antibody can be detected at the highest concentration of ssODN. This indicates that the Flag sequence was successfully inserted into the DDX3 locus of VLP-treated cells. This was further confirmed by PCR on genomic DNA extracted from VLP-treated cells. Since the forward primer hybridizes to the Flag sequence and the reverse primer hybridizes to an intron of DDX3, the primers used (shown in A) should amplify the DNA segment only if the Flag sequence was inserted into the DDX3 gene. As shown in the lower panel, gene modification is evident at high concentrations of primers and decreases with dose, but is still detectable at the DNA level at a low concentration of 0.01 nmol / ml (lane 4). (D) Introduction of the Flag sequence upstream of the endogenous locus of DDX3 in human monocyte-derived dendritic cells (Mo-derived DCs).VLPs and ssODN (5 nmol / μl final) were complexed and the mixture was used to treat Mo-derived DCs in transduction medium containing polybrene (4 μg / ml). Genomic DNA analysis showed that a single treatment with VLPs successfully added the flag sequence to the endogenous locus of DDX3 in human primary DCs. [Figure 11]A series of possibilities using nanoblades and association with "helper" VLPs We have shown that we can create an "all-in-one" VLP incorporating Cas9, gRNA, and optionally combined with repair ssDNA, and deliver the complete package to recipient cells. This agent, shown in (a), is very versatile in itself. Since VLPs can incorporate several gRNAs and can be reliably complexed with different repair primers after production, many possibilities are offered to scientists / companies to create dedicated tools at low cost. As mentioned in (Abe et al. J Virol 1998), VLPs of different natures can be complexed outside the cell after production and can be complementary to each other, for example, one helps the other to enter the cell. Considering this property of VLPs, we can imagine other ways to prepare active agents for transporting participants of CRISPR systems by mixing particles, each dedicated to a specific cargo. In (b), a system is proposed in which gRNA-Cas9-VLPs and particles simply complexed with the repair primer can be mixed: in this case, a mixture of both types of particles would be the final active agent. Going further, gRNAs can also be packaged in specific types of particles and combined with non-loaded Cas9-VLPs after production to create a particle mixture capable of delivering all components. This system is shown in (c). Considering the theoretical possibility of incorporating several gRNAs into VLPs, in order to select different viral envelopes to pseudotype each type of VLP and to associate them with different types of ssDNA, we can even imagine more complex agents. (d). This segregation of CRISPR components in different types of particles can certainly affect the overall efficiency of the final agent, but it could offer the companies producing nanoblades extensive possibilities to improve the nanoblade service and make it less expensive. If the system in (c) is efficient enough, it would be enough to prepare a large, well-titrated batch of generic Cas9-VLPs to associate with gRNA particles specifically customized for each application.This system appears to be highly beneficial from an industrial point of view, as it provides a highly accurate molecular service that only requires the rapid and low-cost preparation of gRNA-VLPs. [Figure 12A] Western blot analysis and characterization of CAS9 virus-derived particles separated on a discontinuous sucrose gradient. Figure 12A shows a Western blot gel electrophoresis. Lanes (from left to right): (i) incubation with anti-Flag antibody; (ii) incubation with anti-VSV-G antibody; (iii) incubation with anti-CAS9 antibody; (iv) incubation with anti-GAG mlv antibody. Figure 12B shows a dot blot of fractions 1-24 collected after performing separation of CAS9 virus-derived particles on a discontinuous sucrose gradient. Columns (from left to right): fractions n°1-n°24. Lanes (top to bottom) in Figure 12B: (i) incubation with anti-VSV-G antibody; (ii) incubation with anti-CAS9 antibody, (iii) incubation with anti-GAG mlv antibody. [Figure 12B] Western blot analysis and characterization of CAS9 virus-derived particles separated on a discontinuous sucrose gradient. Figure 12A shows a Western blot gel electrophoresis. Lanes (from left to right): (i) incubation with anti-Flag antibody; (ii) incubation with anti-VSV-G antibody; (iii) incubation with anti-CAS9 antibody; (iv) incubation with anti-GAG mlv antibody. Figure 12B shows a dot blot of fractions 1-24 collected after performing separation of CAS9 virus-derived particles on a discontinuous sucrose gradient. Columns (from left to right): fractions n°1-n°24. Lanes (top to bottom) in Figure 12B: (i) incubation with anti-VSV-G antibody; (ii) incubation with anti-CAS9 antibody, (iii) incubation with anti-GAG mlv antibody. [Figure 13] Gag / Cas9 fusions actively load guide RNAs into virus-like particles (VLPs). Northern blots for conserved regions of guide RNAs using total RNA extracted from producer cells (lanes 2-4) or the corresponding purified VLPs (lanes 5-7). [Figure 14A]Figure 14A: Schematic of the coding cassettes designed for the production of MLV-based VLPs or HIV-1-based VLPs. Both cassettes were integrated into a eukaryotic expression vector with an early hCMV promoter, a rabbit B globin intron, and a rabbit pA signal. Both systems were optimized by exploring and testing various proteolytic sites separating the GAG ​​cassette from the Cas9 gene. MLV-based VLPs were produced as described elsewhere, and HIV-1-based VLPs were produced similarly, except that an HIV-1 helper construct encoding the GAG ​​POL Tat Rev proteins was transfected instead of the MLV GAG POL plasmid. The production of HIV-1 VLPs follows the same procedure as for MLV-based VLPs. Figure 14B: Concentrated VLPs engineered to incorporate guide RNAs targeting the GFP gene were used to transduce 30,000 HEK293T cells expressing GFP. HIV-1 and MLV-based particles were produced using the same loaded gRNA (target sequence: CGAGGAGCTGTTCACCGGGG-SEQ ID NO: 38). Recipient cells were plated in 96w plates the day before. Polybrene (4 μg / ml) was supplemented to the transduction medium. 72 hours after treatment with each VLP batch at three increasing doses, the fluorescence intensity was measured by a fluorometer (excitation 488, emission 535). A decrease in fluorescence was evident in VLP-treated cells compared to control untreated cells (C), indicating cleavage of the GFP gene in the recipient cells. The results show that HIV-1-based VLPs are efficient in delivering the CRISPR / CAS9 system to these recipient cells, at a slightly lower level of efficiency than MLV-based VLPs (1.5-2 times less efficient). Figure 14C: Cleavage of the WASP gene in primary human T cells stimulated with IL7. In this experiment, two guide RNAs targeting the human WASP gene were incorporated into HIV-1 or MLV-based VLPs prior to treatment of freshly purified T cells stimulated with IL-7. 500,000 cells were plated in 400 μl of RPMI medium supplemented with polybrene (4 μg / ml) and IL-7 in 24w plates.Concentrated HIV-1 or MLV VLPs (10 μl of VLPs dosed at 1 μM CAS9) were added to the culture medium. CRISPR-CAS9-induced WASP deletion was then measured by PCR in recipient cells 24 hours after treatment. Primers used for amplification of genomic WASP gene were forward: 5'-ATTGCGGAAGTTCCTCTTCTTACCCTG (SEQ ID NO: 36) reverse: 5'-TTCCTGGGAAGGGTGGATTATGACGGG (SEQ ID NO: 37). PCR conditions were 95°C for 5 minutes, followed by 25 cycles of (95°C for 30 seconds -57°C for 30 seconds -72°C for 30 seconds), followed by 72°C for 5 minutes. Amplicons were then loaded on a gel to reveal the status of WASP (wt or truncated) in VLP recipient T cells. Gel analysis, performed using ImageJ software, allowed quantification of the double cut efficiency of MLV-based VLPs (32%) and HIV-1-based VLPs (6%). [Figure 14B]Figure 14A: Schematic of the coding cassettes designed for the production of MLV-based VLPs or HIV-1-based VLPs. Both cassettes were integrated into a eukaryotic expression vector with an early hCMV promoter, a rabbit B globin intron, and a rabbit pA signal. Both systems were optimized by exploring and testing various proteolytic sites separating the GAG ​​cassette from the Cas9 gene. MLV-based VLPs were produced as described elsewhere, and HIV-1-based VLPs were produced similarly, except that an HIV-1 helper construct encoding the GAG ​​POL Tat Rev proteins was transfected instead of the MLV GAG POL plasmid. The production of HIV-1 VLPs follows the same procedure as for MLV-based VLPs. Figure 14B: Concentrated VLPs engineered to incorporate guide RNAs targeting the GFP gene were used to transduce 30,000 HEK293T cells expressing GFP. HIV-1 and MLV-based particles were produced using the same loaded gRNA (target sequence: CGAGGAGCTGTTCACCGGGG-SEQ ID NO: 38). Recipient cells were plated in 96w plates the day before. Polybrene (4 μg / ml) was supplemented to the transduction medium. 72 hours after treatment with each VLP batch at three increasing doses, the fluorescence intensity was measured by a fluorometer (excitation 488, emission 535). A decrease in fluorescence was evident in VLP-treated cells compared to control untreated cells (C), indicating cleavage of the GFP gene in the recipient cells. The results show that HIV-1-based VLPs are efficient in delivering the CRISPR / CAS9 system to these recipient cells, at a slightly lower level of efficiency than MLV-based VLPs (1.5-2 times less efficient). Figure 14C: Cleavage of the WASP gene in primary human T cells stimulated with IL7. In this experiment, two guide RNAs targeting the human WASP gene were incorporated into HIV-1 or MLV-based VLPs prior to treatment of freshly purified T cells stimulated with IL-7. 500,000 cells were plated in 400 μl of RPMI medium supplemented with polybrene (4 μg / ml) and IL-7 in 24w plates.Concentrated HIV-1 or MLV VLPs (10 μl of VLPs dosed at 1 μM CAS9) were added to the culture medium. CRISPR-CAS9-induced WASP deletion was then measured by PCR in recipient cells 24 hours after treatment. Primers used for amplification of genomic WASP gene were forward: 5'-ATTGCGGAAGTTCCTCTTCTTACCCTG (SEQ ID NO: 36) reverse: 5'-TTCCTGGGAAGGGTGGATTATGACGGG (SEQ ID NO: 37). PCR conditions were 95°C for 5 minutes, followed by 25 cycles of (95°C for 30 seconds -57°C for 30 seconds -72°C for 30 seconds), followed by 72°C for 5 minutes. Amplicons were then loaded on a gel to reveal the status of WASP (wt or truncated) in VLP recipient T cells. Gel analysis, performed using ImageJ software, allowed quantification of the double cut efficiency of MLV-based VLPs (32%) and HIV-1-based VLPs (6%). [Figure 14C]Figure 14A: Schematic of the coding cassettes designed for the production of MLV-based VLPs or HIV-1-based VLPs. Both cassettes were integrated into a eukaryotic expression vector with an early hCMV promoter, a rabbit B globin intron, and a rabbit pA signal. Both systems were optimized by exploring and testing various proteolytic sites separating the GAG ​​cassette from the Cas9 gene. MLV-based VLPs were produced as described elsewhere, and HIV-1-based VLPs were produced similarly, except that an HIV-1 helper construct encoding the GAG ​​POL Tat Rev proteins was transfected instead of the MLV GAG POL plasmid. The production of HIV-1 VLPs follows the same procedure as for MLV-based VLPs. Figure 14B: Concentrated VLPs engineered to incorporate guide RNAs targeting the GFP gene were used to transduce 30,000 HEK293T cells expressing GFP. HIV-1 and MLV-based particles were produced using the same loaded gRNA (target sequence: CGAGGAGCTGTTCACCGGGG-SEQ ID NO: 38). Recipient cells were plated in 96w plates the day before. Polybrene (4 μg / ml) was supplemented to the transduction medium. 72 hours after treatment with each VLP batch at three increasing doses, the fluorescence intensity was measured by a fluorometer (excitation 488, emission 535). A decrease in fluorescence was evident in VLP-treated cells compared to control untreated cells (C), indicating cleavage of the GFP gene in the recipient cells. The results show that HIV-1-based VLPs are efficient in delivering the CRISPR / CAS9 system to these recipient cells, at a slightly lower level of efficiency than MLV-based VLPs (1.5-2 times less efficient). Figure 14C: Cleavage of the WASP gene in primary human T cells stimulated with IL7. In this experiment, two guide RNAs targeting the human WASP gene were incorporated into HIV-1 or MLV-based VLPs prior to treatment of freshly purified T cells stimulated with IL-7. 500,000 cells were plated in 400 μl of RPMI medium supplemented with polybrene (4 μg / ml) and IL-7 in 24w plates.Concentrated HIV-1 or MLV VLPs (10 μl of VLPs dosed at 1 μM CAS9) were added to the culture medium. CRISPR-CAS9-induced WASP deletion was then measured by PCR in recipient cells 24 hours after treatment. Primers used for amplification of genomic WASP gene were forward: 5'-ATTGCGGAAGTTCCTCTTCTTACCCTG (SEQ ID NO: 36) reverse: 5'-TTCCTGGGAAGGGTGGATTATGACGGG (SEQ ID NO: 37). PCR conditions were 95°C for 5 minutes, followed by 25 cycles of (95°C for 30 seconds -57°C for 30 seconds -72°C for 30 seconds), followed by 72°C for 5 minutes. Amplicons were then loaded on a gel to reveal the status of WASP (wt or truncated) in VLP recipient T cells. Gel analysis, performed using ImageJ software, allowed quantification of the double cut efficiency of MLV-based VLPs (32%) and HIV-1-based VLPs (6%). [Figure 15A] CRISPR delivery into Thy1-GFP mouse embryos by Cas9-containing virus-derived particles Figure 15A shows the injection of CAS-containing virus-derived particles into the zona pellucida of Thy1-GFP mouse embryos. Figure 15B shows the results of cleavage of Thy1-GFP alleles in adult mice (F0) derived from mouse embryos injected with CAS9-containing virus-derived particles. Figure 15C shows the change of Thy1-GFP alleles in F1 mice derived from F0 mice shown in Figure 15B. Figure 15D, E, F and G: GFP change rate in mice #78, #79, #21 and #22, respectively, as calculated from chromatograms (results are compared to untreated Thy-GFP control mice). Horizontal axis: GFP change rate in F1 mice. *% is not perfect due to the fact that the selected Thy1-GFP line has several copies of GFP / allele (6-10). Results should be reproduced in mouse lines with one constitutive GFP copy per allele (in preparation) [Fig. 15B-15C]CRISPR delivery into Thy1-GFP mouse embryos by Cas9-containing virus-derived particles Figure 15A shows the injection of CAS-containing virus-derived particles into the zona pellucida of Thy1-GFP mouse embryos. Figure 15B shows the results of cleavage of Thy1-GFP alleles in adult mice (F0) derived from mouse embryos injected with CAS9-containing virus-derived particles. Figure 15C shows the change of Thy1-GFP alleles in F1 mice derived from F0 mice shown in Figure 15B. Figure 15D, E, F and G: GFP change rate in mice #78, #79, #21 and #22, respectively, as calculated from chromatograms (results are compared to untreated Thy-GFP control mice). Horizontal axis: GFP change rate in F1 mice. *% is not perfect due to the fact that the selected Thy1-GFP line has several copies of GFP / allele (6-10). Results should be reproduced in mouse lines with one constitutive GFP copy per allele (in preparation) [Figure 15D] CRISPR delivery into Thy1-GFP mouse embryos by Cas9-containing virus-derived particles Figure 15A shows the injection of CAS-containing virus-derived particles into the zona pellucida of Thy1-GFP mouse embryos. Figure 15B shows the results of cleavage of Thy1-GFP alleles in adult mice (F0) derived from mouse embryos injected with CAS9-containing virus-derived particles. Figure 15C shows the change of Thy1-GFP alleles in F1 mice derived from F0 mice shown in Figure 15B. Figure 15D, E, F and G: GFP change rate in mice #78, #79, #21 and #22, respectively, as calculated from chromatograms (results are compared to untreated Thy-GFP control mice). Horizontal axis: GFP change rate in F1 mice. *% is not perfect due to the fact that the selected Thy1-GFP line has several copies of GFP / allele (6-10). Results should be reproduced in mouse lines with one constitutive GFP copy per allele (in preparation) [Figure 15E]CRISPR delivery into Thy1-GFP mouse embryos by Cas9-containing virus-derived particles Figure 15A shows the injection of CAS-containing virus-derived particles into the zona pellucida of Thy1-GFP mouse embryos. Figure 15B shows the results of cleavage of Thy1-GFP alleles in adult mice (F0) derived from mouse embryos injected with CAS9-containing virus-derived particles. Figure 15C shows the change of Thy1-GFP alleles in F1 mice derived from F0 mice shown in Figure 15B. Figure 15D, E, F and G: GFP change rate in mice #78, #79, #21 and #22, respectively, as calculated from chromatograms (results are compared to untreated Thy-GFP control mice). Horizontal axis: GFP change rate in F1 mice. *% is not perfect due to the fact that the selected Thy1-GFP line has several copies of GFP / allele (6-10). Results should be reproduced in mouse lines with one constitutive GFP copy per allele (in preparation) [Figure 15F] CRISPR delivery into Thy1-GFP mouse embryos by Cas9-containing virus-derived particles Figure 15A shows the injection of CAS-containing virus-derived particles into the zona pellucida of Thy1-GFP mouse embryos. Figure 15B shows the results of cleavage of Thy1-GFP alleles in adult mice (F0) derived from mouse embryos injected with CAS9-containing virus-derived particles. Figure 15C shows the change of Thy1-GFP alleles in F1 mice derived from F0 mice shown in Figure 15B. Figure 15D, E, F and G: GFP change rate in mice #78, #79, #21 and #22, respectively, as calculated from chromatograms (results are compared to untreated Thy-GFP control mice). Horizontal axis: GFP change rate in F1 mice. *% is not perfect due to the fact that the selected Thy1-GFP line has several copies of GFP / allele (6-10). Results should be reproduced in mouse lines with one constitutive GFP copy per allele (in preparation) [Figure 15G]CRISPR delivery into Thy1-GFP mouse embryos by Cas9-containing virus-derived particles Figure 15A shows the injection of CAS-containing virus-derived particles into the zona pellucida of Thy1-GFP mouse embryos. Figure 15B shows the results of cleavage of Thy1-GFP alleles in adult mice (F0) derived from mouse embryos injected with CAS9-containing virus-derived particles. Figure 15C shows the change of Thy1-GFP alleles in F1 mice derived from F0 mice shown in Figure 15B. Figure 15D, E, F and G: GFP change rate in mice #78, #79, #21 and #22, respectively, as calculated from chromatograms (results are compared to untreated Thy-GFP control mice). Horizontal axis: GFP change rate in F1 mice. *% is not perfect due to the fact that the selected Thy1-GFP line has several copies of GFP / allele (6-10). Results should be reproduced in mouse lines with one constitutive GFP copy per allele (in preparation) DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0031] Detailed Description of the Invention The present invention relates to the use of virus-derived particles to deliver CRISPR / Cas proteins to target cells in order to generate targeted alterations in the genome of eukaryotic, preferably mammalian, and particularly human, organisms.

[0032] Surprisingly, the inventors have shown that it is possible to successfully generate site-specific genomic alterations, such as site-specific genomic deletions or site-specific genomic insertions, by delivering Cas proteins to target cells through the use of viral vector particles in which the Cas proteins are packaged.

[0033] The inventors have devised a powerful method to transfer the CRISPR activity machinery into human and other mammalian cells, including primary cell types, by using versatile virus-derived particles (also referred to herein as "virus-like particles" or "VLPs").

[0034] The inventors have shown that these VLPs ensure dose-dependent transient delivery of CRISPR-RNPc (also referred to as "CRISPR-ribonucleoprotein complex") to target cells, inducing robust and rapid cleavage of the desired target gene. As illustrated in the Examples, when using the Myd-88 gene as readout, the inventors observed complete cleavage of the latter gene in human cells within 6 hours, a remarkable rapidity that may be attributed to the high efficiency of the virus-derived particle system described herein, which involves directly delivering a Cas protein, most preferably a Cas9 protein, and a CRISPR guide RNA (also referred to herein as "gRNA"), instead of carrying out nucleic acid transfer of a polynucleotide encoding a Cas protein, as is the case with most known CRISPR delivery systems. As described in the Examples herein, CRISPR guide RNA is efficiently encapsulated in CAS-containing VLPs. As also described in the Examples, the encapsulation of CRISPR guide RNA is highly influenced by the presence of CAS protein in the VLPs.

[0035] The present inventors have also shown that CAS-containing VLPs can be prepared from various virus-derived particles, particularly those whose GAG ​​proteins can be derived from various viruses.Notably, CAS-containing virus-derived particles containing MLV-derived GAG proteins and CAS-containing virus-derived particles containing HIV1-derived GAG proteins are described in the Examples.It has been shown herein that both types of CAS-containing virus-derived particles can efficiently manipulate target genes, for example, efficiently cleave target genes.

[0036] Furthermore, the present inventors have shown that GAG-containing virus-derived particles can effectively change desired target sequences in vivo. Illustratively, it is shown in the examples that GAG-containing virus-derived particles can be used to induce desired genomic changes in live embryos (e.g., can induce breaks at desired positions in genome). It is also shown herein that the genomic changes carried out in live embryos are present in the adult mammals obtained, and then inherited to the next generation.

[0037] Our findings are particularly important considering that key gene expression processes (e.g., transcription and translation) are less active in some primary cell subsets that may be key targets for CRISPR strategies, thus reducing the efficiency of traditional delivery methods such as DNA transfection and traditional lentiviral vectors.

[0038] In this regard, the Cas9-virus-derived particle technology we have devised appears to be an optimal tool for genome editing, especially in non-activated, non-dividing primary cells such as lymphocytes, which are not amenable to transfection / transduction procedures and exhibit a low metabolism before activation.

[0039] Furthermore, our results indicate that the effect of CRISPR RNPc is transient in recipient target cells and is expected to exert its biological activity for up to several hours after introduction of the RNPc via contact of the target cells with the virus-derived particles described herein.

[0040] The transient nature of delivery of CRIPSR components to target cells and the fact that this technique does not introduce plasmid DNA into target cells are expected to reduce potential toxicity and also reduce the risk of off-target cleavage.

[0041] Moreover, the fact that this technique does not introduce plasmid DNA into the target cells makes it possible to avoid the possibility of exogenous DNA integrating into the target genome.

[0042] Illustratively, as shown in the Examples, the viral-derived particles described herein can be used to induce the expression of fragile human stem CD34 cells. + Treatment of cells or human lymphocytes did not induce detectable cytotoxicity and did not result in cell death even after injection of large amounts of the virus-derived particles.

[0043] Notably, the inventors engineered chimeric Cas9 proteins that were packaged into MLV-derived or HIV-1-derived VLPs by fusion with the structural GAG protein of a murine leukemia virus.

[0044] This concept was therefore easily extended to other viral structural proteins such as the GAG ​​polyprotein from HIV-1 or the GAG ​​polyprotein from Rous Sarcoma Virus (RSV).

[0045] The virus-derived particles produced as described herein have been shown to efficiently transfer CRISPR-RNPc into desired target cells.The use of the virus-derived particle technology described herein provides many virus envelopes that can be selected for pseudotyping the virus-derived particles, thus imparting specific properties (tropism, complement resistance, robustness) to the preparation.

[0046] Insertion of the coding sequences of the Cas protein and one or more CRISPR gRNAs into the expression cassette, in particular the coding sequences of Cas9 and specially designed gRNAs into the expression cassette, can also be performed in the backbone of a recombinant virus (e.g., measles strains or certain influenza strains) that is permissive for the integration of foreign sequences. This allows for widespread dissemination of active CRISPR RNPc in certain cells / tissues / organs that are permissive for the virus under consideration.

[0047] Besides utilizing the Cas9 Streptococcus pyogenes endonuclease, the technology described herein is easily extended to Cas proteins from other organisms (alternatively, it can be fused to structural viral proteins). A growing cohort of Cas9 derivatives can be delivered by the virus-derived particles described herein to achieve a wide variety of genomic changes, such as cleavage of only one DNA strand, activation of transcription, and labeling of precise genomic loci. As described in O'Connell et al. (2014, Nature, Vol. 516: 263-266) (which is a technology involving a small DNA sequence (PAMmer) provided in trans), the technology described herein also enables Cas-based CRISPR strategies, particularly Cas9-based CRISPR strategies, to target intracellular mRNAs and induce their cleavage. The virus-derived particle technology described herein can be adapted to this RNA targeting approach by simple combination of the particle with a ssDNA PAMmer in a model of the flagging-DDX3 strategy described in the Examples (see also Figure 10 herein).

[0048] The possibility of combining the virus-derived particles described herein with ssDNA or dsDNA after their production offers extensive possibilities in terms of industrial development and rapid and low-cost customization for various nucleic acid manipulation purposes.It should also be noted that virus-derived nanoparticles with different envelopes or protein / nucleic acid cargoes can be trans-complementary when combined as a mixture, as described by Abe et al. (1998, J Virol, Vol. 72: 6356-6361) in another technical context.

[0049] Several methods of combining virus-derived particles of the present invention to transfer CRISPR effects to target cells are described elsewhere herein. Some of these various embodiments are shown in FIG. 11 herein. Preliminary data show that when these virus-derived particles and vesicles are prepared and used as taught in Mangeot et al. (2011, Mol Ther J Am Soc Gene Ther, Vol. 19: 1956-1666) in another technical context, virus-derived particles containing Cas proteins, particularly Cas9 proteins, can be combined with vesicles incorporating one or more CRISPR gRNAs, and CRISPR action is efficient in cells treated with the resulting mixture of Cas-containing virus-derived particles and gRNA-containing vesicles. The opportunity to sequester CRISPR components into different types of particles can be very interesting from an industrial perspective, providing a versatile technical solution for generating desired nucleic acid changes.

[0050] The Cas-containing virus-derived particles described herein, particularly the Cas9-containing virus-derived particles, can be easily produced in large quantities in the absence of gRNA to obtain carefully dosed, quality-controlled batches of VLPs. These Cas9-VLPs can then be custom combined with gRNA-containing vesicles and / or target nucleic acid-containing vesicles to complement the system with a specific gRNA or a specific repair template or both.

[0051] As exemplified in detail herein, the Cas-containing virus-derived particle technology described herein offers new possibilities to the CRISPR community, particularly to upgrade the available toolbox for targeting challenging cell types and to explore innovative CRISPR-based therapeutic approaches for in / ex vivo gene therapy.

[0052] Thus, the inventors have successfully packaged a Cas protein into a virus-derived particle by devising a packaging cell expressing a cleavable fusion protein between (i) a viral structural protein and (ii) a Cas protein. Thus, the present invention relates to a virus-derived particle comprising one or more Cas proteins.

[0053] A virus-derived particle as used herein refers to a particle formed by the assembly of viral structural proteins that assemble to form a particle core, which is then enveloped in a membrane (this virus-derived particle does not contain any nucleic acid encoding a nucleic acid or protein of interest). Thus, in contrast to the majority of virus-derived particles known in the art that are designed to deliver an expressing nucleic acid to a transduced cell, the virus-derived particles described herein are designed to deliver a protein and optionally a non-coding nucleic acid (i.e. at least a Cas protein) to a transduced cell. As described in detail herein, the virus-derived particles of the invention may also contain one or more non-coding nucleic acids (this non-coding nucleic acid includes CRISPR-Cas system guide RNA and targeting nucleic acids). For clarity, it may occur that the virus-derived particles described herein may contain trace amounts of coding nucleic acid derived from the cells used to produce them, such as trace amounts of mRNA or plasmid DNA derived from said producing cells. The small amount of coding nucleic acid that may be present in some situations within the virus-derived particle is generally passively encapsulated. However, as described in detail throughout this specification, it should be clearly understood that the virus-derived particles described herein are in no way specialized for the delivery of any coding nucleic acid of interest, but in contrast, these virus-derived particles are specialized only for the delivery of proteins (mainly one or more proteins having Cas endonuclease activity) and in some embodiments further non-coding nucleic acids of interest (i.e. (i) one or more CRISPR guide RNAs and / or one or more targeting nucleic acids).

[0054] As shown in the Examples herein, the cleavable fusion protein between (i) a viral structural protein and (ii) the Cas protein is successfully incorporated into virus-derived particles produced by packaging cells, and the resulting virus-derived particles successfully deliver the Cas protein to a target cell via site-specific genomic DNA cleavage and, in some embodiments, further nucleic acid insertion by homologous recombination to alter the target cell genome. As shown in the Examples herein, the fusion protein contributes to the formation of virus-derived particles, where it associates with a viral structural protein.

[0055] In particular, the inventors have shown that successful genomic alteration is achieved by using these virus-derived particles in combination with one or more CRIPSR-Cas system guide RNAs, and in particular by using virus-derived particles which further contain said one or more CRIPSR-Cas system guide RNAs within said particle.

[0056] As shown in the Examples, the virus-derived particles described herein have been successfully used to disrupt or delete a variety of genes both in vitro and in vivo to generate organisms in which said various genes have been knocked out.

[0057] Additionally, as shown in the Examples, the virus-derived particles described herein have been successfully used for targeted insertion of a nucleic acid of interest into the genome of a target cell to generate knock-in organisms.

[0058] As experimentally demonstrated herein, the inventors fused the Cas9 protein to the GAG ​​protein of a murine leukemia virus and used this construct to produce functional Cas9-loaded virus-derived particles that delivered Cas9 activity to recipient cells.

[0059] As further experimentally demonstrated herein, the inventors fused the Cas9 protein to the GAG ​​protein of HIV-1 and used this construct to produce functional Cas9-loaded virus-derived particles that delivered Cas9 activity to recipient cells.

[0060] Also, guide RNA can be successfully incorporated into virus-derived particles to generate fully active CRISPR-RNPc in virus-like particles, which can be transmitted to recipient cells, as shown in the examples herein. The results of our experiments demonstrate the high efficiency of these Cas-containing virus-derived particles. These virus-derived particles can completely deliver CRISPR to different cell types (including primary cells) without obvious toxicity. In human naive lymphocytes simply treated with the virus-derived particles that cut human (hMyd88) gene, the cleavage efficiency of genome target nucleic acid is remarkably close to 100%.

[0061] The present invention relates to virus-derived particles comprising one or more Cas proteins. Various embodiments of the virus-derived particles described herein are shown in FIG.

[0062] Virus-derived particles As used herein, a virus-derived particle is comprised of a virus-like particle formed by one or more virus-derived proteins, and the virus-derived particle is substantially devoid of any nucleic acid encoding a nucleic acid or protein of interest, or alternatively, is devoid of any nucleic acid encoding a nucleic acid or protein of interest.Notably, the virus-derived particle of the present invention is substantially devoid of any nucleic acid encoding a viral nucleic acid or protein of interest, or alternatively, is devoid of any nucleic acid encoding a viral nucleic acid or protein of interest.The virus-derived particle of the present invention is replication-incompetent.

[0063] Virus-derived particles Any virus suitable for gene therapy may be used, including, but not limited to, adeno-associated virus ("AAV"); adenovirus; herpes virus; lentivirus and retrovirus. The adeno-associated virus ("AAV") may be selected from the group including AAV1, AAV6, AAV7, AAV8, AAV9 or rh10, which AAV is particularly suitable for use in human subjects.

[0064] Common methods known in the art for producing viral vector particles that generally contain a coding nucleic acid of interest can also be used to produce virus-derived particles of the invention that do not contain a coding nucleic acid of interest.

[0065] Conventional viral vector particles include retroviral, lentiviral, adenoviral and adeno-associated viral vector particles that are well known in the art. For a review of the various viral vector particles that can be used, the skilled artisan may refer in particular to Kushnir et al. (2012, Vaccine, Vol. 31: 58-83), Zeltons (2013, Mol Biotechnol, Vol. 53: 92-107), Ludwig et al. (2007, Curr Opin Biotechnol, Vol. 18(n°6): 537-55) and Naskalaska et al. (2015, Vol. 64 (n°1): 3-13). Furthermore, the skilled person will find references to various methods of using virus-derived particles to deliver proteins to cells in Maetzig et al. (2012, Current Gene therapy, Vol. 12: 389-409) and Kaczmarczyk et al. (2011, Proc Natl Acad Sci USA, Vol. 108 (n° 41): 16998-17003).

[0066] Generally, the virus-derived particles used according to the present invention (which may also be called "virus-like particles" or "VLPs") are formed by one or more virus-derived structural proteins and / or one more virus-derived envelope proteins.

[0067] The virus-derived particle used according to the present invention is replication incompetent in the host cell which it invades.

[0068] In a preferred embodiment, the virus-derived particle is formed by one or more retrovirus-derived structural proteins and optionally one or more virus-derived envelope proteins.

[0069] In a preferred embodiment, the virus-derived structural protein is a retroviral gag protein or a peptide fragment thereof. As known in the art, Gag and Gag / pol precursors are expressed from full-length genomic RNA as polyproteins, which require proteolytic cleavage mediated by retroviral protease (PR) to acquire a functional conformation. Furthermore, Gag, which is structurally conserved among retroviruses, is composed of at least three protein units: matrix protein (MA), capsid protein (CA) and nucleocapsid protein (NC), whereas Pol consists of retroviral protease (PR), retrotranscriptase (RT) and integrase (IN).

[0070] In some embodiments, the virus-derived particle comprises retroviral Gag proteins but does not include the Pol protein.

[0071] As is known in the art, the host range of retroviral vectors, including lentiviral vectors, can be expanded or altered by a process known as pseudotyping. Pseudotyped lentiviral vectors consist of viral vector particles bearing glycoproteins from other enveloped viruses. Such pseudotyped viral vector particles have the tropism of the virus from which the glycoproteins are derived.

[0072] In some embodiments, the virus-derived particle is a pseudotyped virus-derived particle that comprises one or more viral structural proteins or viral envelope proteins that confer tropism to the virus-derived particle for a particular eukaryotic cell. The pseudotyped virus-derived particle described herein may comprise, as the viral protein used for pseudotyping, a viral envelope protein selected from the group comprising VSV-G protein, measles virus HA protein, measles virus F protein, influenza virus HA protein, Moloney virus MLV-A protein, Moloney virus MLV-E protein, baboon endogenous retrovirus (BAEV) envelope protein, Ebola virus glycoprotein and foamy virus envelope protein, or a combination of two or more of these viral envelope proteins.

[0073] A well-known example of pseudotyping viral vector particles consists of pseudotyping viral vector particles with vesicular stomatitis virus glycoprotein (VSV-G).For pseudotyping viral vector particles, those skilled in the art can refer in particular to Yee et al. (1994, ProcNatl Acad Sci, USA, Vol. 91: 9564-9568) Cronin et al. (2005, Curr Gene Ther, Vol. 5(n°4): 387-398).

[0074] For the production of virus-derived particles, more precisely VSV-G pseudotyped virus-derived particles, for delivering a protein of interest to a target cell, the skilled person may refer to Mangeot et al. (2011, Molecular Therapy, Vol. 19 (n°9): 1656-1666).

[0075] In some preferred embodiments, the VSV-G protein used to pseudotype the virus-derived particles of the present invention has the amino acid sequence of SEQ ID NO:23, which can be encoded by a nucleic acid comprising the sequence of SEQ ID NO:28.

[0076] In some preferred embodiments, the BAEV-G (BAEV) protein used to pseudotype the virus-derived particles of the present invention has the amino acid sequence of SEQ ID NO:25, which can be encoded by a nucleic acid comprising the sequence of SEQ ID NO:27.

[0077] Thus, in some embodiments, the virus-derived particle further comprises a viral envelope protein, where (i) the viral envelope protein is derived from the same virus as the viral structural proteins (e.g., derived from the same virus as the viral Gag protein), or (ii) the viral envelope protein is derived from a different virus than the virus from which the viral structural proteins are derived (e.g., derived from a different virus than the virus from which the viral Gag protein is derived).

[0078] As will be readily appreciated by those skilled in the art, the virus-derived particles used according to the present invention may be selected in the group comprising Moloney murine leukemia virus-derived vector particles, bovine immunodeficiency virus-derived particles, simian immunodeficiency virus-derived vector particles, feline immunodeficiency virus-derived vector particles, human immunodeficiency virus-derived vector particles, equine infectious anemia virus-derived vector particles, caprine arthritis encephalitis virus-derived vector particles, baboon endogenous virus-derived vector particles, rabies virus-derived vector particles, influenza virus-derived vector particles, norovirus-derived vector particles, respiratory syncytial virus-derived vector particles, hepatitis A virus-derived vector particles, hepatitis B virus-derived vector particles, hepatitis E virus-derived vector particles, Newcastle disease virus-derived vector particles, Norwalk virus-derived vector particles, parvovirus-derived vector particles, papillomavirus-derived vector particles, yeast retrotransposon-derived vector particles, measles virus-derived vector particles and bacteriophage-derived vector particles.

[0079] In particular, the virus-derived particles used according to the invention are retrovirus-derived particles, which may be selected from Moloney murine leukemia virus-derived vector particles, bovine immunodeficiency virus-derived vector particles, simian immunodeficiency virus-derived vector particles, feline immunodeficiency virus-derived vector particles, human immunodeficiency virus-derived vector particles, equine infectious anemia virus-derived vector particles and caprine arthritis-encephalitis virus-derived vector particles.

[0080] In another embodiment, the virus-derived particle used according to the invention is a lentivirus-derived particle. Lentiviruses belong to the Retroviridae family and have the unique ability to infect non-dividing cells.

[0081] Such lentiviruses may be selected from among bovine immunodeficiency virus-derived vector particles, simian immunodeficiency virus-derived vector particles, feline immunodeficiency virus-derived vector particles, human immunodeficiency virus-derived vector particles, equine infectious anemia virus-derived vector particles and caprine arthritis-encephalitis virus-derived vector particles.

[0082] For the preparation of Moloney murine leukemia virus-derived vector particles, the skilled artisan may refer in particular to the methods disclosed in Sharma et al. (1997, Proc Natl Acad Sci USA, Vol. 94: 10803+-10808), Guibingua et al. (2002, Molecular Therapy, Vol. 5(n°5): 538-546). Moloney murine leukemia virus-derived (MLV-derived) vector particles may be selected in the group comprising MLV-A-derived vector particles and MLV-E-derived vector particles.

[0083] For the preparation of vector particles derived from the bovine immunodeficiency virus, those skilled in the art may refer in particular to the method disclosed in Rasmussen et al. (1990, Virology, Vol. 178(n°2): 435-451).

[0084] For the preparation of simian immunodeficiency virus-derived vector particles, including VSV-G pseudotyped SIV virus-derived particles, those skilled in the art may refer in particular to the methods disclosed in Mangeot et al. (2000, Journal of Virology, Vol. 71(n°18): 8307-8315), Negre et al. (2000, Gene Therapy, Vol. 7: 1613-1623) Mangeot et al. (2004, Nucleic Acids Research, Vol. 32 (n° 12), e102).

[0085] For the preparation of vector particles derived from feline immunodeficiency virus, those skilled in the art may refer in particular to the methods disclosed in Saenz et al. (2012, Cold Spring Harb Protoc, (1): 71-76; 2012, Cold Spring Harb Protoc, (1): 124-125; 2012, Cold Spring Harb Protoc, (1): 118-123).

[0086] For the preparation of vector particles derived from the human immunodeficiency virus, those skilled in the art may refer in particular to the methods disclosed in Jalaguier et al. (2011, PlosOne, Vol. 6(n°11), e28314), Cervera et al. (J Biotechnol, Vol. 166(n°4): 152-165) and Tang et al. (2012, Journal of Virology, Vol. 86(n°14): 7662-7676).

[0087] For the preparation of vector particles derived from the Equine infectious anemia virus, the skilled person may refer in particular to the method disclosed in Olsen (1998, Gene Ther, Vol. 5(n°11): 1481-1487).

[0088] For the preparation of vector particles derived from the Caprine Arthritis-Encephalitis Virus, those skilled in the art may refer in particular to the method disclosed in Mselli-Lakhal ety al. (2006, J Virol Methods, Vol. 136(n°1-2): 177-184).

[0089] For the preparation of baboon endogenous virus-derived vector particles, those skilled in the art may refer in particular to the method disclosed in Girard-Gagnepain et al. (2014, Blood, Vol. 124(n°8): 1221-1231).

[0090] For the preparation of rabies virus-derived vector particles, the skilled person may refer in particular to the methods disclosed in Kang et al. (2015, Viruses, Vol. 7: 1134-1152, doi:10.3390 / v7031134), Fontana et al. (2014, Vaccine, Vol. 32(n°24): 2799-27804) or the PCT application published under WO2012 / 0618.

[0091] For the preparation of influenza virus-derived vector particles, those skilled in the art may refer in particular to the methods disclosed in Quan et al. (2012, Virology, Vol. 430: 127-135) and Latham et al. (2001, Journal of Virology, Vol. 75(n°13),: 6154-6155).

[0092] For the preparation of norovirus-derived vector particles, those skilled in the art may refer in particular to the method disclosed in Tome-Amat et al., (2014, Microbial Cell Factories, Vol. 13: 134-142).

[0093] For the preparation of respiratory syncytial virus-derived vector particles, those skilled in the art may refer in particular to the method disclosed in Walpita et al. (2015, PlosOne, DOI:10.1371 / journal.pone.0130755).

[0094] For the preparation of Hepatitis B virus-derived vector particles, those skilled in the art may refer in particular to the method disclosed in Hong et al. (2013, Vol. 87(n°12): 6615-6624).

[0095] For the preparation of vector particles derived from Hepatitis E virus, those skilled in the art may refer in particular to the method disclosed in Li et al. (1997, Journal of Virology, Vol. 71(n°10): 7207-7213).

[0096] For the preparation of Newcastle Disease Virus-derived vector particles, those skilled in the art may refer in particular to the method disclosed in Murawski et al. (2010, Journal of Virology, Vol. 84(n°2): 1110-1123).

[0097] For the preparation of Norwalk virus-derived vector particles, those skilled in the art may refer in particular to the method disclosed in Herbst-Kralovetz et al. (2010, Expert Rev Vaccines, Vol. 9(n°3): 299-307).

[0098] For the preparation of parvovirus-derived vector particles, those skilled in the art may refer in particular to the method disclosed in Ogasawara et al. (2006, In Vivo, Vol. 20: 319-324).

[0099] For the preparation of papillomavirus-derived vector particles, those skilled in the art may refer in particular to the method disclosed in Ogasawara et al. (2006, In Vivo, Vol. 20: 319-324).

[0100] For the preparation of yeast retrotransposon-derived vector particles, those skilled in the art may refer to the methods disclosed in Peifang et al. (1994, Clin Exp Immunol, Vol. 97(n°3): 361-366) or US Pat. No. 6,060,064.

[0101] For the preparation of measles virus-derived vector particles, those skilled in the art may refer in particular to the method disclosed in Brandler et al. (2008, Vol. 31(n°2-3): 271-291).

[0102] For the preparation of bacteriophage-derived vector particles, and in particular Q-β virus-like particles, the skilled person may refer in particular to the method disclosed in Brown et al. (2009, Biochemistry, Vol. 48(n°47): 11155-11157).

[0103] As used herein, a virus-derived particle comprises the Gag protein, most preferably from a virus selected in the group comprising Rous Sarcoma Virus (RSV), Feline Immunodeficiency Virus (FIV), Simian Immunodeficiency Virus (SIV), Moloney Leukemia Virus (MLV) and Human Immunodeficiency Virus (HIV-1 and HIV-2), in particular Human Immunodeficiency Virus Type 1 (HIV-1).

[0104] In some embodiments, the virus-derived particle may also contain one or more viral envelope proteins. As known in the art, the presence of one or more viral envelope proteins may confer more specific tropism to the virus-derived particle for the targeted cells. The one or more viral envelope proteins may be selected in the group including retrovirus-derived envelope proteins, non-retroviral virus-derived envelope proteins, and chimeras of these viral envelope proteins with other peptides or proteins. An example of a non-lentiviral envelope glycoprotein of interest is the lymphocytic choriomeningitis virus (LCMV) strain WE54 envelope glycoprotein. These envelope glycoproteins increase the range of cells that can be transduced with retrovirus-derived vectors.

[0105] In some preferred embodiments, the virus-derived particles comprise a Gag protein derived from a virus selected from the group including Rous Sarcoma Virus (RSV) and Moloney Leukemia Virus (MLV).

[0106] In some preferred embodiments, the virus-derived particles used herein further comprise a pseudotyped viral envelope protein, most preferably the VSV-G protein.

[0107] Cas proteins The virus-derived particle comprises a Cas protein, which may be selected in the group comprising type I Cas proteins, type II Cas proteins and type III Cas proteins.

[0108] For the use of type I, II or III Cas proteins, the skilled artisan will be familiar with Chylinski et al. (2014, Nucleic Acids Research, Vol. 42(n°10): 6091-6105), Sinkunas et al. (2011, The EMBO Journal, Vol. 30(n°7): 1335-1342), Aliyari et al. (2009, Immunological Reviews, Vol. 227(n°1): 176-188), Cass et al. (Biosci Rep, doi:10.1042 / BSR20150043), Makarova et al. (2011, Biology Direct, Vol. 6: 38), Gasiunas et al. (2012, Proc NatlAcad Sci USA, Vol. 109(n°39): E2579-E2586), Heller et al. (2015, Nature, Vol. 519(n°7542): 199-202), Esvelt et al. (2013, Nat Methods, Vol. 10(n°11): doi :10.138 / nmeth.2681) or Chylinski et al. (2013, Biology, Vol. 10(n°5): 726-737).

[0109] In some embodiments, the CAS protein may consist of a type II Cas protein designated Cpf1, as disclosed in Zeische et al. (2015, Cell, http: / / dx.doi.org / 10.1016 / j.cell.2015.09.038, in Press).

[0110] Preferably, the virus-derived protein comprises a type II Cas protein, most preferably a Cas9 protein.

[0111] Most preferably, the Cas protein contained in the virus-derived particles described herein is the Cas9 protein or a homologue or derivative thereof. The Cas9 protein may be selected in the group comprising the Cas9 protein from Streptococcus thermophilus and the Cas9 protein from Streptococcus pyogenes or a homologue or derivative thereof. The Cas9 protein from Streptococcus thermophilus is particularly described in Gasiunas et al. (2012, Proc NatlAcad Sci USA, Vol. 109(n°39): E2579-E2586). The Cas9 protein from Streptococcus pyogenes is particularly described in Heler et al. (2015, Nature, Vol. 519(n°7542): 199-202) and Sanjana et al. (2014, Nat Methods, Vol. 11(n°18): 783-784).

[0112] Cas9 proteins that may be used in accordance with the present invention include proteins that are homologues, variants or derivatives of naturally occurring Cas9 proteins, such as the Cas9 proteins described in Cong et al. (2013, Science, Vol. 339: 819-823).

[0113] Cas9 proteins and vectors encoding the Cas9 proteins are commercially available from Sigma-Aldrich Company. Cas9 proteins and variants thereof that may be used in the virus-derived particles described herein are also described in published PCT applications WO2013 / 163628, WO2014 / 093595, WO2015 / 089247 and WO2015 / 089486.

[0114] In some embodiments, the Cas9 protein is produced so that it is incorporated into virus-derived particles during their formation. Illustratively, Cas9 can be encoded by a nucleic acid sequence inserted into an expression vector contained in a virus-derived particle producing cell. In a preferred embodiment, the Cas9-encoding nucleic acid is placed under the control of a regulatory sequence that allows its overexpression in the producing cell. In some embodiments, the Cas9 protein consists of the protein of SEQ ID NO:31, which is encoded by the nucleic acid sequence of SEQ ID NO:32.

[0115] In some embodiments of the virus-derived particles described herein, the Cas protein is produced and integrated within the virus-derived particle as a fusion protein between (i) a viral structural protein and (ii) the Cas protein. In some of these embodiments, the Cas protein is produced and integrated within the virus-derived particle as a GAG-Cas9 fusion protein. As confirmed by the inventors, such a fusion protein is successfully integrated within the resulting virus-derived particle, and the Cas portion is fully active (i.e., the Cas portion retains its endonuclease activity). According to these embodiments, the embedded Cas protein is released into the target cell after entry of the virus-derived particle.

[0116] In other embodiments, the Cas protein contained in the virus-derived particles is initially produced as a cleavable fusion protein between (i) a viral structural protein and (ii) a Cas protein. An example of such a cleavable fusion protein is the cleavable GAG-Cas9 protein described in the Examples herein. According to these other embodiments, the cleavable fusion protein is integrated into the resulting virus-derived particles upon its production by the production cell. A portion or all of the fusion protein can then be cleaved in the final virus-derived particles to provide a population of virus-derived particles including: (i) a portion of the virus-derived particles in which the cleavable fusion protein is not cleaved; (ii) a portion of the virus-derived particles in which at least a portion of the cleavable fusion protein has been cleaved, releasing a Cas protein portion within the virus-derived particle; and (iii) a portion of the virus-derived particles in which all or nearly all of the cleavable fusion protein has been cleaved, releasing all or nearly all of the Cas protein portion within the virus-derived particle. In some preferred embodiments, the cleavable GAG-Cas9 protein is a GAG-Cas9 protein having the amino acid sequence of SEQ ID NO: 22, which can be encoded by the sequence of SEQ ID NO: 26. In other embodiments, it may be used as a cleavable GAG-Cas9 protein encoded by the nucleic acid sequence of SEQ ID NO:34 (which may be referred to herein as "KLAP229").

[0117] Thus, in the virus-derived particles that can be used according to the present invention, the Cas protein, typically the Cas9 protein, can be present as (i) a non-cleavable fusion protein, typically a non-cleavable Gag-Cas9 fusion protein, (ii) a cleavable fusion protein, typically a cleavable Gag-Cas9 fusion protein, (iii) a Cas protein, typically a Cas9 protein resulting from proteolytic cleavage of said fusion protein, or (iv) both a fusion protein and a Cas protein. It should be understood that the virus-derived particles used herein are produced in packaging cells that specifically express a protein of (i) a viral structural protein and (ii) a Cas protein, typically a cleavable Gag-Cas9 fusion protein, which encompasses a cleavable fusion protein of (i) a viral structural protein and (ii) a Cas protein, typically a cleavable Gag-Cas9 fusion protein. As shown in the examples herein, the cleavable fusion protein is incorporated intact into the virus-derived particle and then at least partially cleaved in the virus-derived particle to release a functional Cas protein in the virus-derived particle. However, since the Cas protein is initially incorporated into the virus-derived particle in the form of said cleavable fusion protein, there are many intermediate states in which the Cas protein is partly present in the form of the cleavable fusion protein and partly present as free Cas protein resulting from cleavage of the cleavable fusion protein.

[0118] In a preferred embodiment, the fusion protein comprises a proteolytic cleavage site located between the viral structural protein portion and the Cas protein portion, typically between the Gag protein portion and the Cas9 protein portion. Proteolytic sites, which may also be referred to as protease sites, are well known to those skilled in the art. The protease site that may be included in the cleavable fusion protein may be a site that is cleavable by a protease selected from the group including trypsin (EC 3.4.21.4), chymotrypsin (EC 3.4.21.1), endoproteinase Glu C (EC 3.4.21.19), endoproteinase Lys-C (EC 3.4.21.50), pepsin (EC 3.4.23.1), elastase (EC 3.4.21.36) and carboxypeptidase (EC 3.4.17.1).

[0119] In some embodiments, the protease cleavage site is selected in the group comprising the amino acid sequence SSLYPALTP (SEQ ID NO:29), which can be encoded by a sequence comprising SEQ ID NO:30.

[0120] Protease-cleavable fusion proteins between Gag and a protein of interest, as well as vectors for expressing such fusion proteins, are in particular described in Voelkel et al. (2010, Proc Natl Acad Sci USA, Vol. 107(n°17): 7805-7810), to which the skilled artisan may refer.

[0121] As described in the Examples herein, the virus-derived particles of some embodiments are formed in packaging cells expressing Gag-Pro-Pol viral proteins. Without being bound to any particular theory, the inventors believe that in these embodiments, the Pro protein (i.e., viral protease) is released into the virus-derived particles and cleaves the fusion protein, typically a Gag Cas fusion protein, particularly a Gag-Cas9 fusion protein, to generate a free Cas protein, particularly a free Cas9 protein. In some preferred embodiments, the Gag-Pro-Pol protein has the amino acid sequence of SEQ ID NO:24.

[0122] However, as also illustrated in the Examples herein, in embodiments in which the virus-derived particles lack any viral proteases, for example, when the virus-derived particles are formed in packaging cells expressing viral structural proteins (e.g., Gag) and optionally one or more viral envelope proteins (e.g., VSV-G and / or BAEV-G), a functional Cas protein, typically a functional Cas9 protein, is released into the target cell.

[0123] Guide RNA When using the virus-derived particles described herein to generate site-specific alterations in a target nucleic acid, one or more CRISPR-Cas guide RNAs are required.

[0124] The number of CRISPR-Cas guide RNAs, which may also be referred to as "guide RNAs" or "gRNAs", may vary depending on the type of change to the target nucleic acid being sought. A single guide RNA may be used in combination with a virus-derived particle to generate a single DNA cleavage event in a target nucleic acid. Two or more guide RNAs may be used in combination with a virus-derived particle to generate two or more cleavage events in a target nucleic acid, or alternatively, to generate cleavage events in multiple target nucleic acids.

[0125] Methods for designing guide RNAs that combine with Cas proteins to cause cleavage of target nucleic acids are well known to those skilled in the art.As is well known in the art, guide RNAs are polynucleotides that have sufficient complementarity with target nucleic acids to hybridize with said target nucleic acids and induce sequence-specific binding of CRISPR complexes to said target nucleic acids.

[0126] To design guide RNAs, various tools are readily available to those skilled in the art, including the tool sold under the name GenCRISPR™ gRNA constructs by the Company GenScript (United States). The GenCRISPR™ gRNA constructs collection includes about six guide RNAs that specifically target each of about 20,000 genes in the human genome. Guide RNAs can also be used as Ran et al. (2013, Cell, Vol. 154: 1380-1389), Mail et al. (2013, Science, Vol. 339: 823-826), Wang et al. USA, Vol. 110: 13904-13909), Cong et al. (2013, Science, Vol. 339: 819-823), Shalem et al. (2014, Science, Vol. 343: 84-87), Maeder et al. (2013, Nat Methods; Vol. 10: 977-979), Qi et al. (2013, Cell, Vol. 152: 1173-1183), Farboud et al. (2015, Genetics, doi 10.1534 / genetics.115.175166) or Ma et al. (2013, BioMed research International, Vol. 2013, Article ID 270805, doi.org / 10.1155 / 2013 / 270805).

[0127] In some embodiments, the virus-derived particles described herein further comprise one or more CRISPR-Cas guide RNAs, each of which hybridizes to a specific target sequence contained in the target nucleic acid.

[0128] In some embodiments, the virus-derived particles described herein comprise a single guide RNA. Such embodiments of the virus-derived particles allow for a single cleavage to occur at a desired location in the target nucleic acid.

[0129] In some other embodiments, the virus-derived particles described herein comprise two different guide RNAs, each guide RNA hybridizing with a specific target sequence contained in the same target nucleic acid to generate two cleavage events at the sites recognized by each of the two different guide RNAs. Such an embodiment allows the introduction of a polynucleotide deletion framed by two cleavage sites in the target nucleic acid. When a template nucleic acid of interest is further added, such an embodiment allows the insertion of a desired exogenous nucleic acid of interest in the nucleic acid target between these two cleavage sites.

[0130] In some preferred embodiments, one or more guide RNAs are included in the virus-derived particle. Typically, the virus-derived particle is produced by a packaging cell expressing (i) necessary viral structural proteins (e.g., Gag), (ii) one or more viral envelope proteins (e.g., VSV-G and / or BAEV-G), (iii) a Cas fusion protein (e.g., Gag-Cas9 fusion protein), and (iv) one or more CRISPR-Cas guide RNAs. According to these embodiments, one or more guide RNAs are incorporated into the virus-derived particle, which are produced by the packaging cell. In these embodiments, where the virus-derived particle comprises a Cas protein, in particular a Cas9 protein, and one or more guide RNAs, the virus-derived particle comprises a CRISPR-Cas ribonucleoprotein complex, which is a complex of the Cas protein and the guide RNA.

[0131] In some of these embodiments, the virus-derived particle comprises one or more complexes of Cas proteins and guide RNAs, each CRISPR-Cas complex comprising a single Cas protein complexed with a single guide RNA. In some of these embodiments where multiple cleavages of a target nucleic acid are desired, the virus-derived particle comprises the same number of CRISPR-Cas complex species, each type of CRISPR-Cas complex being specific for generating DNA cleavage at a desired location of the target nucleic acid to which the corresponding guide RNA is hybridized.

[0132] In a further preferred embodiment, one or more guide RNAs are first produced by a specific packaging cell expressing said one or more guide RNAs, which also expresses viral proteins necessary for the production of other viral particles or other viral vesicles (or other virus-like particles or VLPs). The guide RNA-containing viral particles are then contacted with a virus-derived particle containing a Cas protein, and a final virus-derived particle is produced by complementation, which contains both the Cas protein and one or more guide RNAs originally contained in said other virus particles. For obtaining these virus-derived particles by complementation, the skilled person may refer in particular to Abe et al. (1998, Journal of Virology, Vol. 72(n°8): 6356-6361). Exemplarily, a Gag-based virus-derived particle comprising a Cas protein as described herein may be contacted with a VSV-G-based virus-derived particle comprising one or more CRSIPS-Cas guide RNAs to obtain a final virus-derived particle comprising said Cas protein and said one or more CRISPR-Cas guide RNAs, said final virus-derived particle consisting of a Gag-based VSV-G pseudotyped VLP.

[0133] In some other embodiments, part of all of the one or more guide RNAs are not contained within the virus-derived particles, but instead are complexed with these virus-derived particles. According to these other embodiments, the guide RNAs complexed with the virus-derived particles also enter the target cell together with the virus-derived particles with which they are complexed.

[0134] Targeting Nucleic Acid For purposes of altering target nucleic acids by using the virus-derived particles described herein, particularly where alteration of the target nucleic acid by homologous recombination is desired, targeting nucleic acids are further used in combination with these virus-like particles.

[0135] The method of targeting nucleic acid for changing their sequence by homologous recombination is well known to those skilled in the art.Typically, homologous repair donor nucleic acid comprises (i) a first sequence that is homologous to a first locus of target genome sequence, and (ii) a second sequence that is homologous to a second locus of genome sequence.Generally, for changing target nucleic acid by homologous recombination, said first sequence (i) and said second sequence (ii) are located on both sides of the cut site created by CRISPR-Cas / guide RNA complex.

[0136] Methods for carrying out the alteration of target nucleic acids through homologous recombination by using the CRISPR-Cas system are well known in the art. Those skilled in the art may refer in particular to Jinek et al. (2013, eLife, Vol.2: e00471, doi: 10.754 / eLife.00471) and Lin et al. (2014, eLife, Vol. 3: e04766, DOI:10.7554 / eLife.04766).

[0137] Typically, the homologous recombination template nucleic acid (which may also be referred to herein as template nucleic acid) comprises exogenous sequences of variable length flanking sequences that hybridize to the target nucleic acid at its 5' and 3' ends, respectively. If the exogenous sequence to be inserted into the genome is less than 50 nt long, the flanking hybridization sequences, also referred to as homologous recombination arms, should be in the range of 20-50 nucleotides in length. If the exogenous sequence to be inserted is more than 100 nt, the homologous recombination arms should be significantly longer (approximately 800 bp).

[0138] The targeting nucleic acid or template nucleic acid can have any suitable length, for example, about 10, 15, 20, 25, 50, 75, 100, 150, 200, 500, 1000 or more nucleotides in length. When optimally aligned, the targeting nucleic acid can overlap with one or more nucleotides of the target sequence, for example, by more than about 1, 5, 10, 15, 20 or more nucleotides.

[0139] Based on the general knowledge of those skilled in the art, virtually the only requirement for designing a targeting nucleic acid for the purposes of homologous recombination is prior knowledge of the nucleic acid sequence of the target nucleic acid.

[0140] In some embodiments, the targeting nucleic acid is contained within a virus-derived particle as described herein. According to these embodiments, the virus-derived particle comprising a Cas protein, one or more guide RNAs, and one or more targeting nucleic acids is preferably produced by a packaging cell expressing said Cas protein, the necessary viral proteins, the necessary guide RNAs, and the necessary targeting nucleic acids.

[0141] In some other embodiments, the targeting nucleic acid is not contained within the virus-derived particle, but is complexed to the virus-derived particle.

[0142] Nucleic Acid Expression Vectors As already mentioned elsewhere herein, the virus-derived particles described herein are produced in cells (also referred to herein as packaging cells) that express the necessary proteins, i.e. at least the fusion viral structural proteins / Cas proteins and one or more proteins necessary to form a viral particle, which may also be referred to as a virus-like particle or VLP). In a preferred embodiment, the packaging cell also expresses one or more CRISPR-Cas guide RNAs and optionally further a targeting nucleic acid (also referred to as a template nucleic acid).

[0143] The term "expression vector" as used herein refers to a recombinant DNA molecule that contains a desired coding sequence and the appropriate nucleic acid sequences required for the expression of the operably linked coding sequence in a particular host organism. The nucleic acid sequences required for expression in eukaryotic cells generally include promoters, enhancers, termination signals and polyadenylation signals. In some embodiments, "expression vectors" are used to allow pseudotyping of viral envelope proteins.

[0144] Generally, the vectors for expressing the required proteins or nucleic acids are vectors suitable for expressing the nucleic acid sequences in the desired host cells used as packaging cells. Preferably, the packaging cells are mammalian cells. In particular, the vectors for expressing the required proteins or nucleic acids contain open reading frames placed under the control of regulatory elements functional in the packaging cells in which their expression is required. In particular, these vectors contain, for each protein or nucleic acid to be expressed, an open reading frame and a polyadenylation sequence placed under the control of a suitable promoter sequence.

[0145] The packaging cell line provides the viral proteins necessary for particle assembly (Markowitz et al., 1988, J. Virol., Vol. 62:1120).

[0146] As is well known in the art, the nucleic acid vector is introduced into the packaging cells by any of a variety of techniques (e.g., calcium phosphate co-precipitation, lipofection, electroporation). Viral proteins produced by the packaging cells mediate the insertion of viral and Cas proteins into virus-derived particles, which are then released into the culture supernatant.

[0147] The nucleic acid vector used can be derived from a retrovirus (e.g., lentivirus). A suitable retroviral vector for producing the virus-derived particles described herein allows (1) the transfection of a packaging vector and an envelope vector into a host cell to form a packaging cell line that produces virus-derived particles that are essentially free of packaging vector RNA, and (2) the packaging of Cas protein and optionally further CRISPR guide RNA into the virus-derived particle, and finally the packaging of targeting nucleic acid into the virus-derived particle.

[0148] Vectors and packaging cells for use in accordance with the present invention are illustrated in the Examples herein.

[0149] Exemplarily, vectors for expressing viral structural / Cas proteins, such as Gag-Cas9 proteins, can be prepared by one of skill in the art as taught in Voelkel et al. (2010, Proc Natl Acad Sci USA, Vol. 107: 7805-7810).

[0150] Exemplarily, vectors for expressing viral structural proteins, such as Gag protein or Gag-Pro-Pol fusion protein, and optionally further viral envelope proteins, such as VSV-G protein or BAEV-G protein, can be prepared by those skilled in the art following the teachings of Negre et al. (2000, Gene Ther, Vol. 7: 1613-1623) and Yee et al. (1994, Methods Cell Biol, Vol. 43 PtA: 99-112).

[0151] Exemplarily, vectors for expressing CRISPR guide RNAs can be prepared as taught in Kieusseian et al. (2006, Blood, Vol. 107: 492-500).

[0152] Packaging Cells A host cell is a cell into which a vector of interest can be introduced so that it can be replicated and, in the case of an expression vector, so that one or more vector-based genes can be expressed.

[0153] Any suitable permissive or packaging cell known in the art can be used in the production of virus-derived particles as described herein. Mammalian or insect cells are preferred. Examples of cells useful in the practice of the present invention for the production of virus-derived particles include, for example, human cell lines, such as VERO, WI38, MRC5, A549, HEK293, HEK293T, B-50 or any other HeLa cell, HepG2, Saos-2, HuH7 and HT1080 cell lines.

[0154] An exemplary cell line for use as packaging cell is an insect cell line. Any insect cell that allows AAV replication and can be maintained in culture can be used according to the present invention. Examples include Spodoptera frugiperda, such as Sf9 or Sf21 cell lines, Drosophila species cell lines or mosquito cell lines, such as Aedes albopictus derived cell lines. A preferred insect cell line is Spodoptera frugiperda Sf9 cell line. The following references are incorporated herein for their teachings regarding the use of insect cells for expression of heterologous polypeptides, methods for introducing nucleic acids into such cells, and methods for maintaining such cells in culture: Methods in Molecular Biology, ed. Richard, Humana Press, NJ (1995); O'Reilly et al., Baculovirus Expression Vectors: A Laboratory Manual, Oxford Univ. Press (1994); Samulski et al., J. Vir. 63:3822-8 (1989); Kajigaya et al., Proc. Nat'l. Acad. Sci. USA 88: 4646-50 (1991); Ruffing et al., J. Vir. 66:6922-30 (1992); Kimbauer et al., Vir. 219:37-44 (1996); Zhao et al., Vir. 272:382-93 (2000); and Samulski et al., US Pat. No. 6,204,059.

[0155] Cells may be provided that already have one or more of the aforementioned functions integrated, for example a cell line with one or more vector functions integrated extrachromosomally or integrated into the chromosomal DNA of the cell, a cell line with one or more packaging functions integrated extrachromosomally or integrated into the chromosomal DNA of the cell, or a cell line with helper functions integrated extrachromosomally or integrated into the chromosomal DNA of the cell. A packaging cell line is a suitable host cell that has been transfected with one or more nucleic acid vectors and that, under achievable conditions, produces virus-derived particles that include the Cas protein and in some embodiments further one or more CRIPSR guide RNAs and ultimately further targeting nucleic acid.

[0156] As used herein, the term "packaging cell line" is typically used in reference to a cell line that expresses viral structural proteins (e.g., gag, pol and env) but does not contain a packaging signal. For example, a cell line has been engineered to have, at one chromosomal site in its genome, a 5'-LTR-gag-pol-3'-LTR fragment lacking a functional psi+ sequence (termed Δ-psi) and, at another chromosomal site, a 5'-LTR-env-3'-LTR fragment (also Δ-psi).

[0157] Several cell types can be used, including: a) NIH-3T3 mouse cells, which are currently widely used as packaging cells for producing recombinant retroviruses in clinical applications (Takahara et al., Journal of Virology, (June 1992), 66 (6) 3725-32). b) TK containing NIH-3T3 TK cells -The cell lines have been described (F. Wagner et al., EMBO Journal (1985), Vol. 4 (n°3): 663-666); these cells can die when cultured in a selective medium such as HAT. They can grow in selective media if they are complemented for the kinase thymidine function (e.g. from the HSV1-TK virus); such lines therefore offer the possibility of using the HSV1-TK gene as a selection gene. The gene encoding the thymidine kinase of HSV1 or one of its functional derivatives has also been widely used as a transgene as a prodrug transforming ganciclovir or acyclovir into a drug that is cytotoxic for the cells, so that it can be applied for the selective cell destruction of, for example, cancerous cells (see, for example, WO 95 / 22617).

[0158] Illustratively, the packaging cells may be the well-known HEK293T cell line, as shown in the Examples herein.

[0159] The present invention also provides a cell line for producing the viral particles described herein, comprising: - one or more nucleic acids encoding proteins necessary to form said virus-derived particles, and - a nucleic acid comprising an expression cassette encoding a viral structural protein-Cas fusion protein The present invention relates to a cell line comprising

[0160] In some embodiments, the nucleic acid encoding proteins necessary to form the virus-derived particles includes nucleic acid encoding a viral structural protein, such as a Gag protein.

[0161] In some embodiments, the cell line also comprises a nucleic acid encoding a viral envelope protein, such as a viral envelope protein selected in the group comprising VSV-G protein and BAEV-G protein.

[0162] In some embodiments, the cell line further comprises a nucleic acid encoding one or more CRISPR guide RNAs.

[0163] In some embodiments, the cell line further comprises nucleic acid encoding one or more targeting nucleic acids.

[0164] Compositions and kits The present invention provides virus-derived particle compositions and kits suitable for use in the treatments (in vivo or in vivo) described herein.

[0165] In some embodiments, the compositions comprise virus-derived particles that comprise a Cas protein, particularly a Cas9 protein, and lack a guide RNA and a targeting nucleic acid. In these embodiments, the gRNA or targeting nucleic acid is not present in the virus-derived particle, either as a nucleic acid within the virus-derived particle or as a nucleic acid complexed with the virus-derived particle.

[0166] The present invention relates to a composition for altering a target nucleic acid in a eukaryotic cell, the composition comprising at least one virus-derived particle as described herein.

[0167] In some embodiments, the composition further comprises one or more CRISPR-Cas system guide RNAs.

[0168] In some of these embodiments, the one or more CRISPR-Cas system guide RNAs are comprised in a virus-derived particle.

[0169] In some other embodiments, the one or more CRISPR-Cas system guide RNAs are complexed with the virus-derived particle.

[0170] In some embodiments of the composition, the composition comprises (i) a Cas-containing virus-derived particle in combination with (ii) a vesicle comprising a gRNA and / or a targeting nucleic acid. According to some of these embodiments, each gRNA present in the composition is contained in a particular type of vesicle. According to some others of these embodiments, more than one gRNA, including all gRNAs, are contained in a particular type of vesicle. In some of these embodiments, the targeting nucleic acid is contained in a particular type of vesicle. In some others of these embodiments, when more than one targeting nucleic acid is present in the composition, all targeting nucleic acids are all contained in a particular type of vesicle. In still further embodiments, all gRNAs and targeting nucleic acids present in the composition are all contained in the same vesicle.

[0171] As used herein, a "particular type" of vesicle is uniquely defined with respect to its particular content of gRNA and / or targeting nucleic acid, regardless of the structural characteristics of the vesicle itself.

[0172] Most preferably, the vesicles are composed of viral proteins. In some embodiments, the vesicles have the same viral protein structural characteristics as the virus-derived particles containing the Cas proteins described herein. In some other embodiments, the vesicles are composed primarily or entirely of viral envelope proteins, such as, for example, VSV-G or BAEV-G.

[0173] When present in the compositions of the present invention, the CAS-containing virus-derived particles and the gRNA and / or targeting nucleic acid-containing vesicles are trans-complemented to efficiently generate the desired nucleic acid changes in the target cells. Such trans-complementation in another technical context is taught by Mangeot et al. (2011, Ther J am Soc Gene Ther, Vol. 19: 1656-1666).

[0174] The compositions described herein include pharmaceutical compositions for use in practicing methods of gene therapy in a mammal in need thereof, which includes non-human mammals and human individuals in need thereof.

[0175] The compositions of the invention can be formulated for delivery to animals (e.g., livestock, e.g., cows, pigs, etc.) and other non-human mammalian subjects for veterinary use, as well as to human subjects. Virus-derived particles can be formulated with physiologically acceptable carriers for use in gene transfer and gene therapy applications.

[0176] In some embodiments, the composition further comprises one or more transduction helper compounds, preferably selected from the group comprising cationic polymers, as described in particular in Zuris et al. (2015, Nat Biotechnol, Vol. 33(n°1): 73-80). Transduction helper compounds include polybrene (which may also be referred to as hexadimethrine bromide), protamine sulfate, 12-myristate 13-acetate (which may also be referred to as phorbol myristate acetate or PMA) (described in Johnston et al., 2014, Gene Ther, Vol. 21(12): 1008-1020), vectofusin (described in Fenard et al., 2013, Molecular Therapy Nucleic Acids, Vol. 2: e90), poloxamer P338 (described in Anastasov et al., 2016, Lentiviral vectors and exosomes as gene and protein delivery tools, in Methods in Molecular Biology, Vol. 1448: 49-61), RetroNectin® reagent (commercially available from Clontech Laboratories Inc.), Viral Plus® transduction enhancer (marketed by Applied Biological Materials Inc.), TransPlus® viral transduction enhancer (marketed by Clinisciences), Lentiboost® (marketed by Sirion Biotech) or ExpressMag® transduction system (marketed by Sigma-Aldrich). As shown in the examples herein, said cationic transduction helper compound may consist of polybrene.

[0177] The virus-derived particles may be formulated in a conventional manner using one or more physiologically acceptable carriers or excipients. The virus-derived particles may be formulated for parenteral administration by injection, for example, by bolus injection or continuous infusion. The formulation for injection may be presented in unit dosage form, for example, in ampoules or in multi-dose containers, together with additional preservatives. The virus-derived particle composition may take the form of a suspension, solution or emulsion in an oily or aqueous vehicle, and may contain formulating agents such as suspending agents, stabilizing agents and / or dispersing agents. Liquid preparations of the virus-derived particle composition may be prepared by conventional means using pharma-ceutically acceptable additives, such as suspending agents (e.g., sorbitol syrup, cellulose derivatives or hydrogenated edible fats); emulsifying agents (e.g., lecithin or gum arabic); non-aqueous vehicles (e.g., almond oil, oily esters, ethyl alcohol or fractionated vegetable oils); and preservatives (e.g., methyl or propyl-p-hydroxybenzoates or sorbic acid). The preparation may also contain buffer salts. Alternatively, the composition may be in powder form for constitution with a suitable vehicle, eg, sterile pyrogen-free water, before use.

[0178] To generate a desired genomic alteration in a target cell, a target tissue or organ, or a target nucleic acid contained in a target organism, particularly a target mammal (which includes target non-human mammals and human individuals), the virus-derived particle composition of the present invention can be administered to a subject in a therapeutically effective dose. A therapeutically effective dose refers to an amount of the pharmaceutical composition sufficient to result in the amelioration of symptoms caused by the generation of a desired genomic alteration event in the target nucleic acid.

[0179] In one embodiment, the amount of the virus-derived particle composition of the present invention is administered in dose units within the range of about 0.1 to 5 micrograms (μg) / kilogram (kg). To this end, to treat an average subject weighing 70 kg, the virus-derived particle composition of the present invention may be formulated in a dose range of about 7 mg to about 350 mg. The amount of the virus-derived particle composition of the present invention that may be administered may be selected from the group including 0.1 mg / kg, 0.2 mg / kg, 0.3 mg / kg, 0.4 mg / kg, 0.5 mg / kg, 0.6 mg / kg, 0.7 mg / kg, 0.8 mg / kg, 0.9 mg / kg, 1.0 mg / kg, 1.5 mg / kg, 2.0 mg / kg, 2.5 mg / kg, 3.0 mg / kg, 3.5 mg / kg, 4.0 mg / kg, 4.5 mg / kg, or 5.0 mg / kg. In particular, for treating an average subject weighing 70 kg, the dose of virus-derived particles in a unit dose of the composition may be selected in the group including: 7 mg, 8 mg, 9 mg, 10 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 125 mg, 150 mg, 175 mg, 200 mg, 225 mg, 250 mg, 275 mg, 300 mg, 325 mg, 350 mg, 375 mg, 400 mg, 425 mg, 450 mg, 475 mg, 500 mg, 525 mg, 550 mg, 575 mg, 600 mg, 625 mg, 650 mg, 675 mg, 700 mg, 725 mg or 750 mg. These doses can be administered once or repeatedly, for example, daily, every other day, weekly, biweekly or monthly. In some embodiments, the virus-derived particle composition can be administered to a subject in one dose, or in two doses, or in three doses, or in four doses, or in five doses, or in six or more doses. The interval between doses can be determined based on the practitioner's determination that there is a need for it.

[0180] The virus-derived particle composition may be optionally presented in a pack or dispenser device that may contain one or more unit dosage forms containing the active ingredient. The pack may, for example, comprise metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration.

[0181] The virus-derived particle composition may be in liquid or solid (eg, lyophilized) form.

[0182] kit The present invention further relates to kits for preparing the virus-derived particles described herein.

[0183] The present invention relates to a kit for preparing a virus-derived particle for altering a target nucleic acid in a eukaryotic cell, comprising: - a nucleic acid comprising an expression cassette encoding a GAG-Cas fusion protein, and - a nucleic acid comprising one or more expression cassettes encoding a viral-like assembly protein The present invention relates to a kit comprising:

[0184] In some embodiments, the kit further comprises a nucleic acid comprising an expression cassette encoding a pseudotyped viral envelope protein.

[0185] In some embodiments of the kit, the viral assembly protein is a viral Gag protein.

[0186] In some embodiments, the Gag protein is encoded by an expression cassette selected from the group consisting of an expression cassette encoding the GAG-PRO-POL polyprotein and an expression cassette encoding a GAG protein.

[0187] In some embodiments, the kit further comprises one or more nucleic acids encoding a CRISPR-Cas system guide RNA.

[0188] In certain embodiments of the kits, the nucleic acids are localized in the eukaryotic cells as a result of their transfection into the eukaryotic cells. In some of these embodiments, the nucleic acids are in the form of a nucleic acid vector in the eukaryotic cells (which may also be referred to herein as packaging cells). In some others of these embodiments, some or all of the nucleic acids are integrated into the genome of the eukaryotic cells (which may also be referred to herein as packaging cells).

[0189] Thus, in some embodiments of the kits of the present invention, the eukaryotic cells comprise a packaging cell line.

[0190] The kits of the invention may optionally include different containers (e.g., vials, ampoules, test tubes, flasks or bottles) for each individual composition or element contained therein. The kits may contain additional reagents for formulation of the individual components, such as buffers, diluents, etc. Each component will generally be suitable as dispensed in its respective container or as provided in concentrated form.

[0191] Instructions for using the kit according to the methods described herein may be included. The instructional materials may include publications, records, diagrams, or any other medium of expression that may be used to communicate the usefulness of the methods of the invention in a kit for assessing oocyte quality. The package insert may include text contained on any physical medium, such as paper, cardboard, film, or may be contained on an electronic medium, such as a diskette, chip, memory stick, or other electronic storage format. The instructional materials of the kits of the invention may, for example, be attached to a container containing the other contents of the kit or may be shipped together with a container containing the kit. Alternatively, the instructional materials may be shipped separately from the container, with the intention that the recipient will use the instructional materials and the contents of the kit in a coordinated manner.

[0192] Methods for Altering a Target Nucleic Acid The virus-derived particles and compositions containing them can be used for gene therapy.

[0193] A further aspect of the invention is a method of treating a subject with the virus-derived particles of the invention, or with a composition comprising them.

[0194] Administration of the virus-derived particles to a human subject or an animal in need thereof can be by any means known in the art for administering viral vectors.

[0195] Exemplary modes of administration include rectal, transmucosal, topical, transdermal, inhalation, parenteral (e.g., intravenous, subcutaneous, intradermal, intramuscular, and intraarticular) administration, and the like, as well as direct tissue or organ injection or intrathecal, direct intramuscular, intraventricular, intravenous, intraperitoneal, intranasal, or intraocular injection. Injectables can be prepared in conventional forms, as liquid solutions or suspensions, solid forms suitable for solution or suspension in liquid prior to injection, or as emulsions. Alternatively, the virus can be administered locally rather than systemically, for example in a depot or sustained release formulation.

[0196] The present invention also provides a method for altering a target nucleic acid in a eukaryotic cell, the method comprising the steps of: a) contacting said eukaryotic cell with a virus-derived particle as described herein, or a composition as described herein, and b) harvesting said eukaryotic cells containing the altered target nucleic acid. The present invention relates to a method comprising the steps of:

[0197] In some embodiments, the virus-derived particles or compositions comprising them are administered directly to a subject in vivo. In some other embodiments, the subject's cells are provided and then the virus-derived particles or compositions comprising them are transduced into said cells in vitro. In a further method step, the transduced subject's cells are administered back into the subject's body.

[0198] In some embodiments, the methods are performed in vitro or ex vivo.

[0199] The present invention also relates to the compositions described herein for use in preventing or treating any disease or disorder amenable to gene therapy.

[0200] The present invention provides methods for preventing or treating any disease or disorder amenable to gene therapy. In one embodiment, "treatment" or "treating" refers to an improvement in a disease or disorder or at least one discernible symptom thereof. In another embodiment, "treatment" or "treating" refers to an improvement in at least one measurable physical parameter associated with a disease or disorder that is not necessarily discernible by the subject. In yet another embodiment, "treatment" or "treating" refers to physically inhibiting the progression of a disease or disorder, e.g., stabilizing a discernible symptom, physiologically inhibiting, e.g., stabilizing a physical parameter, or both. Other conditions may also be treated, including cancer, immune disorders, and veterinary conditions.

[0201] The types of diseases and disorders that can be treated by the methods of the present invention include, but are not limited to, age-related macular degeneration; diabetic retinopathy; e.g., HIV pandemic influenza, category 1 and 2 biological warfare agents, or any emerging viral infection; autoimmune diseases; cancer; multiple myeloma; diabetes; systemic lupus erythematosus (SLE); hepatitis C; multiple sclerosis; Alzheimer's disease; Parkinson's disease; amyotrophic lateral sclerosis (ALS), Huntington's disease; epilepsy; chronic obstructive pulmonary disease (COPD); joint inflammation, arthritis; myocardial infarction (MI); congestive heart failure (CHF); hemophilia A; or hemophilia B.

[0202] Infectious diseases that may be treated or prevented by the methods of the present invention are caused by infectious agents including, but not limited to, viruses, bacteria, fungi, protozoa, helminths and parasites. The present invention is not limited to the treatment or prevention of infectious diseases caused by intracellular pathogens. Many medically relevant microorganisms have been extensively described in the literature, see, for example, CG A Thomas, Medical Microbiology, Bailliere Tindall, Great Britain 1983, the entire contents of which are incorporated herein by reference.

[0203] Types of cancer that may be treated or prevented by the methods of the present invention include, but are not limited to, human sarcomas and carcinomas, such as fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma, chordoma, angiosarcoma, endothelioma, lymphangiosarcoma, lymphangioendothelial cell sarcoma, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatic carcinoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor, and cervical cancer. , testicular tumors, lung cancer, small cell lung cancer, bladder cancer, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, melanoma, neuroblastoma, retinoblastoma; leukemias, such as acute lymphocytic leukemia and acute myeloid leukemia (myeloblastic, promyelocytic, myelomonocytic, monocytic, and erythroleukemia); chronic leukemias (chronic myelocytic (granulocytic) leukemia and chronic lymphocytic leukemia); and polycythemia vera, lymphomas (Hodgkin's disease and non-Hodgkin's disease), multiple myeloma, Waldenstrom's macroglobulinemia, and heavy chain disease.

[0204] The present invention is further illustrated, but is in no way limited, by the following examples. EXAMPLES

[0205] A. Materials and Methods A.1. Constructs The GAG-Cas9 coding plasmid was designed as described in (Voelkel et al., 2010). The codon-optimized sequence of flag-Cas9 from Streptococcus pyogenes was PCR amplified using a lentiCRISPR plasmid (Addgene plasmid 4953) as a template. This last construct was a gift from the F. Zhang laboratory (Shalem et al., 2014, Science, Vol. 343: 84-87). Then, flag-Cas9 was inserted downstream of the murine leukemia virus GAG sequence (MA-CA-NC). The frame was harmonized to generate a polyprotein. Both parts were separated by an MLV-protease cleavage site that releases flag-Cas9 from the GAG ​​during the viral maturation process. The chimeric protein was expressed under the control of the hCMV promoter with an intron and a polyA signal, both of which are derived from rabbit β-globin mRNA. The expression plasmid encoding the GagProPol polyprotein of MLV (Negre et al., 2000, Gene Ther, Vol. 7: 1613-1623) and the VSVG-encoding plasmid (Yee et al., 1994, Methods Cell Biol, Vol. 43 PtA: 99-112) were described elsewhere.

[0206] < <crizi>The gRNA-encoding plasmids, designated >, are derived from a previously described lentiviral construct (Kieusseian et al., 2006, Blood, Vol. 107: 492-500) into which the U6 cassette from the lentiCRISPR plasmid was inserted. Cloning of the CRISPR gRNA sequence into CRIZI was performed between the BsmBI sites upstream of the U6 promoter according to the procedure described by the authors. The sequences of the gRNAs used in this study were designed using Crispseek software (potential off-target >3 mismatches) (Zhu et al., 2014, PloS One, Vol. 9: e108424). For each gRNA, the primer sequences are shown: [Table 1] [Table 2] [Table 3]

[0207] A.2. Production of VLPs Cas9-VLP refers to the preparation of VLPs incorporating one of several gRNAs targeting a specific gene. Preparation of VLPs requires co-transfection of several plasmids. VLPs were produced by transfection of Lenti-X™ 293T (Clontech) using JetPei (Polyplus) according to the manufacturer's instructions. JetPrime transfection agent (Polyplus) or the calcium phosphate method (CalPhos mammalian kit, Clontech) can also be used.

[0208] The classical ratio of plasmids mixed in the JetPei transfection recipe is GAG-Cas9 (20%), GagProPol (20%), VSV-G or other envelope (20%) and gRNA-encoding construct (40%).

[0209] For the Cas9Myd88VLP, two different gRNAs were introduced into the recipe to achieve simultaneous packaging of both RNA species into the nascent VLP. HEK293T cells plated at 3x10e6 cells / 10cm plate 24 hours prior to transfection were transfected with a mixture containing: -R1: 4 μg GAG-Cas9, 4 μg GagProPol, 2 μg VSVG, 2 μg BaEV envelope (Girard-Gagnepain et al., 2014), 2 μg Myd88-gRNA1-encoding plasmid, and 2 μg Myd88-gRNA2-encoding plasmid. -R2: 6 μg GAG-Cas9, 6 μg GagProPol, 4 μg VSVG, 4 μg Myd88-gRNA1-encoding plasmid, 4 μg Myd88-gRNA2-encoding plasmid. -R3: 4 μg GAG-Cas9, 8 μg GagProPol, 2 μg VSVG, 2 μg BaEV envelope, 2 μg Myd88-gRNA1-encoding plasmid, 2 μg Myd88-gRNA2-encoding plasmid. -R4: 4-6 μg GAG-Cas9, 2 μg VSVG, 2 μg BaEV envelope, 5 μg Myd88-gRNA1-encoding plasmid, 5 μg Myd88-gRNA2-encoding plasmid.

[0210] 40 hours after transfection, the VLP-containing supernatant was collected and clarified by brief centrifugation (2000 g, 3 min). The clarified Cas9-YFPVLP was directly used to transduce L929 cells. Cas9-hh / mMyd88VLP and Cas9-DDX3VLP were pelleted by ultracentrifugation at 35000 rpm in an SW41 rotor for 1 h and resuspended in ice-cold PBS overnight with gentle agitation. 10 ml of the supernatant was concentrated to produce 100 μl of concentrated VLP in cold PBS (concentration factor: 100 times). The concentrated VLP batch was stored at -80°C and shown to be stable at least 2 weeks at 4°C after thawing. Filtration of the VLP-containing supernatant can be performed using a 0.45 μm pore size filter prior to centrifugation / transduction.

[0211] A.3. Proteotransduction procedure using Cas9-VLPs Cas9-YFPVLP was transduced into 3x10e5 L929-YFP cells in 6-well plates by adding 400μl of clarified VLP-containing supernatant to 400μl of medium. After 2h, the medium was supplemented with 2ml of DMEM 10% FCS.

[0212] Transduction of primary cells was routinely performed by adding 5-20 μl of 100× VLPs to 300 μl of medium in 48-well plates. After 2 hours, the transduction medium was supplemented with 0.5 ml of fresh culture medium. The addition of polybrene was shown to confer proteotransduction potential when used at a final concentration of 4 μg / ml in the transduction medium.

[0213] A.4. PCR-Based Genotyping Assays Genomic DNA extraction of cells treated with VLPs was achieved using the Nucleospin Tissue Kit (Machery Nagel) according to the manufacturer's instructions. DNA preparations were performed 24-48 hours after VLP treatment, and further experiments show that in HEK293T recipient cells, cleavage was complete as soon as 6 hours after VLP exposure.

[0214] PCR amplification of Myd88 was carried out in 50 μl using GOTAQ polymerase (Promega). 100 ng of cellular genomic DNA was used as template for the PCR reaction as follows: 94°C for 5 min, 3 cycles of (94°C for 30 s, 68°C for 30 s), 3 cycles of (94°C for 30 s, 64°C for 30 s, 72°C for 30 s), 27 cycles of (94°C for 30 s, 57°C for 30 s, 72°C for 30 s), 72°C for 5 min, 12°C. PCR amplicons were analyzed on ethidium bromide stained 2,5% agarose gels.

[0215] A.5. Primers used for genotyping analysis (5'-NNN-3'): [Table 4] [Table 5]

[0216] A.6. Combination of Cas9-DDX3 VLP and ssDNA 15 μl of concentrated Cas9-DDX3VLP was mixed in 10 μl of PBS containing 8 μg / ml polybrene. Then, 5 μl of each dilution of Flag-DDX3 primer was supplemented to this mixture, but the best results were obtained with the higher concentration (5 μl of primer at 100 pmol / μl). This "all-in-one" complex was incubated for 15 min at 4°C, and 30 μl was added to the medium (400 μl + polybrene 4 μg / ml) of HEK293T cultured in 12-well plates (200000 cells plated the day before). After 2 hours, the transduction medium was supplemented with 1 ml of DMEM 10% FCS. After 40 hours of VLP treatment, the cells were split for amplification and analysis of the gene insertion of the flag sequence upstream of the DDX3 gene, and WB analysis was performed after 72 hours.

[0217] A.7. Flag-DDX3 primer sequence (HPLC purified): [Table 6]

[0218] Example 1: Cleavage of the YFP gene by Cas9-YFPVLP Molecular engineering of viral structures allows the creation of viruses / VLPs that can incorporate proteins of interest. Among numerous examples, we can mention the design of HIV-1 clones incorporating fluorescent genes that allow easy monitoring of infection (Dale et al., 2011, Methods San Diego Calif, Vol. 53: 20-26), VLPs with viral epitopes useful for vaccination purposes in animals (Garrone et al., 2011, Sci Transl Med, Vol. 3: 94ra71), or VLPs used to deliver proteinaceous functional cargo to recipient cells (Voelkel et al., 2010, Proc Natl Acad Sci USA, Vol. 107: 7805-7810), (Mangeot et al., 2011, Mol Ther J Am Soc Gene Ther, Vol. 19: 1656-1666). To achieve efficient production of Cas9-VLPs, Cas9 was fused to the structural GAG protein of murine leukemia virus (MLV) as previously described (Voelkel et al., 2010, supra.) Essentially, expression of this chimeric protein together with the viral protease (Pro) and envelope in HEK293T cells is expected to produce VLPs in which the Cas9 moiety is integrated into the viral core, and Cas9 is cleaved from the GAG ​​platform by the viral protease.

[0219] Given the affinity of Cas9 for gRNA, we further hypothesized that expression of gRNA in VLP-producing cells may be sufficient to allow their incorporation into particles capable of carrying all components of the CRISPR machinery. To check these hypotheses, we designed a gRNA expression plasmid to target the YFP gene and attempted to incorporate the gRNA into Cas9-VLPs produced from HEK293T cells. An overview summarizing this approach and the constructs used is shown in Figure 1. We then introduced VLP-containing supernatants into the culture medium of mouse L929 cells expressing a stable form of YFP, and then investigated the cleavage of the fluorescent gene by surveyor assay. The results shown in Figure 2 indicate that Cas9-VLPs delivered the CRISPR machinery and allowed the cleavage of the YFP gene at the expected location defined by the integrated gRNA. Disruption of this gene was associated with a dramatic and irreversible loss of fluorescence in the treated population due to the expected disruption of the YFP reading frame (Figure 3). These findings validate the use of Cas9-VLPs as potent delivery agents for CRISPR components.

[0220] Example 2: Disruption of the Myd88 gene in HEK293T and HeLa recipient cells To mediate the deletion of the hMyd88 gene, we further investigated the ability of VLPs incorporating several gRNAs. Myd88 is an important adaptor protein that transmits the signal of most TLRs that activate the transcription of nuclear factors and is particularly involved in the survival of macrophages under certain conditions (Lombardo et al., 2007, J Immunol Baltim Md 1950, Vol. 178: 3731-3739). Two gRNAs were designed to mediate two different cuts in the human Myd88 gene, resulting in the deletion of the endogenous gene (Figure 4A-B). Cas9-Myd88VLPs were produced by transfection of different combinations of plasmids (described in Materials and Methods). The released particles were then concentrated and used to alter the Myd88 gene in different recipient cells, including Hela and HEK293T. The results shown in Figure 4C and D show that all Cas9-VLP types loaded with Myd88 gRNA were efficient in deleting the predicted portion of the Myd88 gene in HEK293T cells. However, Hela cells were more reluctant and less modified by certain VLP species. In particular, we noted that VLPs lacking protease (R4) were inefficient in Hela cells but were still fully active in HEK293T target cells. These data suggest that the VLP recipe should be optimized for the target cell type. Further experiments show that the effect of Cas9-Myd88 VLPs is dose-dependent (Figure 5) and enhanced by the addition of polybrene (Figure 6).

[0221] Example 3: VLP-mediated disruption of the Myd88 gene in primary cells of human and mouse origin. A more challenging problem is to deliver CRISPR components to primary cells that are hardly permissive to traditional transfection methods and difficult to transduce by viral vectors. Therefore, we monitored the efficacy of Cas9-Myd88VLP in different cell types freshly isolated from the organism, including human macrophages derived from human monocytes. Genotypic analysis of treated cells reveals clear and highly efficient cleavage of the Myd88 gene by a single administration of Cas9-Myd88VLP to cultured macrophages (Figure 7A). Besides genotypic PCR-based assays confirming gene cleavage, Myd88 disruption is responsible for the strong phenotype shown in Figure 7B, confirming the inactivation of Myd88 function. We further validated the surprising efficiency of VLP to deliver CRISPR to primary cells in human non-activated lymphocytes (which are typically not amenable to most existing gene modification techniques) (Figure 8). To generalize our observations, we designed several other gRNAs targeting mouse Myd88 gene and prepared a VLP batch dedicated to mouse cells. As shown in Figure 9, this new VLP batch was used to deliver CRISPR RNPc to mouse origin macrophages with high efficiency. Overall, these results demonstrate that Cas9-VLP is an efficient agent for introducing functional CRISPR machinery into primary cells.

[0222] Example 4: Cas9-VLPs can mediate transfer of repair templates: creating an "all-in-one" VLP complex. Previous studies have been on the ability of MLV-derived VLPs and other VSV-G-derived particles to mediate the delivery of plasmids to human cells and function as virus-derived transfection agents (Okimoto et al., 2001, Mol Ther J Am Soc Gene Ther, Vol. 4: 232-238). Since the particles can be combined with dsDNA molecules, we speculated that MLV-derived Cas9-VLPs may support combination with ssDNA and mediate their delivery to cells. We have taken advantage of this knowledge to attempt to combine Cas9-VLPs with repair primers composed of ssDNA. With this approach, we propose to use VLPs to cut the endogenous gene and repair it in the cell by a homologous recombination-like mechanism (HR) using the provided repair template. Using the DDX3 human gene as a model, we investigated this using repair primers designed to insert a FLAG sequence upstream of the ATG codon of the endogenous DDX3 gene. Figure 10 shows the principle of this "all-in-one" VLP strategy, which we directly investigated in both transfected and primary cells. Cas9-DDX3VLP combined with Flag repair primer successfully cleaved the DDX3 gene (not shown), allowing gene-targeted insertion of the flag sequence at the correct predicted site in the 5' sequence of DDX3. This was checked by PCR-based genotyping assays and detection of flagged DDX3 protein by Western blot (Figure 10C). We also verified this result at the gene level in primary human dendritic cells exposed to a single treatment of Cas9-DDX3VLP.

[0223] Example 5: Characterization of CAS9 virus-derived particles. CAS9 VLPs were produced as disclosed in the Materials and Methods section and concentrated by a first ultracentrifugation through a 20% sucrose cushion. The resulting pellet was then resuspended in PBS and recentrifuged through two sucrose cushions (a 50% sucrose cushion at the bottom of the tube and a 20% sucrose cushion separating the 50% cushion from the sample). After 2 hours of centrifugation, the interface separating the 50% and 20% was collected and recentrifuged to obtain highly pure CAS9-VLPs, which were resuspended in PBS. 10 μg of VLPs were dissolved in Laemlli buffer and heated at 95° C. for 5 min before Western blot analysis.

[0224] Western blot analysis is shown in FIG. 12A (10 μg per lane). Antibodies used were against GAG mlv (ABCAM R187), VSVG (ABCAM P5D4), CAS9 (7A9-3A3 clone Cell Signaling), and Flag sequence added to Cas9 (Sigma). Different forms of mlv GAG are shown, corresponding to cleavage products processed by viral proteases. In particle preparations, VSVG is clearly detected at the expected size. CAS9 antibody reveals a larger product of over 200 KDa corresponding to the GAG-CAS9 fusion (expected 225 KDA), and this protein is also detected by Flag antibody (left panel). Both CAS9 and FLAG antibodies reveal smaller CAS9 products (range 160-200 KDa) that may correspond to free CAS9 protein released from GAG after protease processing or cleaved CAS9 products.

[0225] As illustrated in Figure 12B, 30 μg of total high purity VLPs were loaded onto a discontinuous sucrose gradient (10% to 60% sucrose in PBS) in a total volume of 12 ml. After 16 h of centrifugation (25000 rpm, SW41), 500 μl fractions were collected from the top of the tube and named 1 to 24. Then, 2 μl of each fraction was spotted onto a nitrocellulose membrane and immediately blocked by adding milk (TBST 5% low fat milk). Then, VSVG CAS9 and GAG MLV were detected for each fraction using the same antibodies as above. The results show that CAS9 VLPs sediment at densities of 1,14 to 1,21, with a peak at 1,17.

[0226] Example 6: Loading guide RNA into CAS9 virus-derived particles Example 6 shows that CAS9 virus-derived particles efficiently incorporate guide RNA.

[0227] Northern blot for conserved regions of guide RNA using total RNA extracted from producing cells (lanes 2-4) or corresponding purified VLPs (lanes 5-7). Lane 1. Control sample corresponding to total RNA from cells not producing VLPs. Lane 2. Total RNA from cells expressing Gag / Cas9 fusions, viral envelope and guide RNA. Lane 3. Total RNA from cells expressing Gag / Cas9 fusions, viral envelope and modified guide RNA with a longer stem structure. Lane 4. Total RNA from cells expressing wild type Cas9 and guide RNA in the absence of Gag. Lanes 5, 6 and 7. Total RNA extracted from the supernatant of the corresponding producing cells after filtration through a 0.8 μm filter to exclude cell debris (lane 5 corresponds to the supernatant of the cells in lane 2, etc.). Lane 7 shows that the guide RNA is not efficiently incorporated into the particles if the Gag / Cas9 fusion is not expressed. Interestingly, the modified guide RNAs with longer stem structures (lanes 3 and 6) appear to be incorporated into VLPs less efficiently than the wild-type guide RNA (lanes 2 and 5).

[0228] Example 7: Comparison of MLV-based and HIV-based virus-derived particles Figure 14A shows a schematic diagram of the coding cassettes designed for the production of MLV-based VLPs or HIV-1-based VLPs. Both cassettes were integrated into a eukaryotic expression vector with an early hCMV promoter, a rabbit B globin intron, and a rabbit pA signal. Both systems were optimized by searching and testing various proteolytic sites that separate the GAG ​​cassette from the Cas9 gene. MLV-based VLPs were produced as described in the Materials and Methods section, and HIV-1-based VLPs were produced similarly, except that an HIV-1 helper construct (construct of SEQ ID NO: 33) encoding the GAG ​​POL Tat Rev protein was transfected instead of the MLV GAG POL plasmid. The production of HIV-1 VLPs follows the same procedure as MLV-based VLPs.

[0229] Figure 14B shows a study in which concentrated VLPs engineered to incorporate guide RNA targeting the GFP gene were used to transduce 30,000 HEK293T cells expressing GFP. The same loaded gRNA (target sequence: CGAGGAGCTGTTCACCGGGG-SEQ ID NO: 35) was used to produce HIV-1 and MLV-based particles. Recipient cells were plated on 96w plates the day before. Polybrene (4 μg / ml) was supplemented to the transduction medium. Fluorescence intensity was measured by a fluorometer (excitation 488, emission 535) 72 hours after treatment with three increasing doses of each VLP batch. A decrease in fluorescence was evident in VLP-treated cells compared to control untreated cells (C), indicating cleavage of the GFP gene in recipient cells. The results show that HIV-1-based VLPs are efficient in delivering the CRISPR / CAS9 system to these recipient cells, with a slightly lower level of efficiency than MLV-based VLPs (1.5-2 fold less efficient).

[0230] Figure 14C shows the cleavage of the WASP gene in primary human T cells stimulated with IL7. In this experiment, two guide RNAs targeting the human WASP gene were incorporated into HIV-1 or MLV-based VLPs before treatment of freshly purified T cells stimulated with IL-7. WASP deletion by CRISPR-CAS9 was then measured by PCR in recipient cells 24 hours after treatment. Gel analysis performed using ImageJ software allowed quantification of the dual cleavage efficiency of MLV-based VLPs (32%) and HIV-1-based VLPs (6%).

[0231] Example 8: CRISPR delivery into Thy1-GFP mouse embryos by Cas9-containing virus-derived particles. Cas9 VLPs incorporating guide RNA targeting the GFP gene were produced and highly purified before being injected into the zona pellucida of mouse embryos (1-cell stage). All heterozygous embryos carried the Thy1-GFP allele responsible for GFP expression in motor neurons. The aim of this study was to evaluate the ability of VLPs to cleave GFP in embryos and to generate animals whose Thy1-GFP cassette was altered after reimplantation of VLP-treated embryos into female mice. As shown in A, a few nanoliters of the preparation (6,5 μM Cas9) were used for two injections performed without perforin treatment of the cell membrane. This injection protocol did not kill any embryos. After reimplantation, we obtained a total of 20 animals (F0). Genomic DNA was extracted from the neonatal digits and analyzed by T7 endonuclease assay to reveal cleavage of the GFP cassette. As shown in B, 6 out of 20 animals were positive in this assay (arrows), compared with 4 out of 9 in the first injection experiment (left panel): animals 5, 7, 8, 12 and animals 40 and 45 (weak) in the second injection. Animals 7, 8 and 12 were then crossed with wt-C57B6 animals to assess the inheritance of the truncated GFP allele to the offspring. As expected, approximately half of the F1 offspring were found to be heterozygous for the Thy1-GFP allele (for all three founders). The status of the Thy1-GFP allele in heterozygous F1 mice was then determined by T7-endonuclease assay shown in C*. All F1 heterozygous offspring of mouse 7 and mouse 12 and 33% of the offspring of mouse 8 were shown to have altered GFP. Sequencing of the Thy1-GFP allele was then performed for the alleles of animals #78, #79, #21 and #22 and the chromatograms were compared with the sequences obtained for Thy1-GFP untreated animals. For this purpose, the TIDE software was used to obtain histograms showing the nature of indels and the % of sequence changes for each animal**. The results shown in D, E, F and G show the % of GFP changes in F1 mice***.Altogether, these data demonstrate that Cas9-VLPs can aid in animal transgenesis and can be used as CRISPR delivery agents into mammalian embryos to effect genetic alterations without the transfer of genetic material and without damage to egg cells.

[0232] T7-endonuclease assay protocol: Mouse genomic DNA was extracted from mouse fingers using the Nucleospin Tissue Kit (Macherey Nagel). Next, 3 μl of DNA template was used in 50 μl of PCR reaction solution (PCR conditions: primers: Forward: 5'-TCTGAGTGGCAAAGGACCTTAGG (Thy1 primer - SEQ ID NO:39) Reverse: 5'-GAAGTCGTGCTGCTTCATGTGGTCGG (GFP primer - SEQ ID NO:40) using a 50 cycle incubation at 95°C for 5 min, followed by 3 cycles of (95°C for 30 s, -64°C for 30 s, -72°C for 30 s) and 25 cycles of (95°C for 30 s, -57°C for 30 s, -72°C for 30 s) followed by 72°C for 5 min.

[0233] The Thy1-GFP amplicons were then subjected to a T7 endonuclease assay in a 40 μl reaction tube as described by the manufacturer (https: / / www.neb.com / protocols / 2014 / 08 / 11 / determining-genome-targeting-efficiency-using-t7-endonuclease-i). Finally, the digestion was loaded onto a 2.5% agarose gel.

[0234] **TIDE software is a free online tool: https: / / tide.nki.nl / . Chromatogram sequences (abi files) were uploaded into the software and a TIDE run was performed without modification using the default settings. A TIDE histogram is shown.

[0235] ***% are not exact due to the fact that the selected Thy1-GFP strains have several copies of GFP / allele (6-10). Results should be reproducible in mouse strains with one constitutive GFP copy per allele (in preparation).

[0236] Other Arrays GAG-Cas9 amino acid sequence (SEQ ID NO:22): [Table 7] VSV-G amino acid sequence (SEQ ID NO:23): [Table 8] GAG PRO POL amino acid sequence (SEQ ID NO:24): [Table 9] BAEV-G amino acid sequence (SEQ ID NO:25) [Table 10] GAGmlv-CAS9 sequence (SEQ ID NO:26): [Table 11] TIFF2025063185000012.tif255165 BAEV-G baboon envelope RLESS mutant BAEVRless (also referred to in the text and figures as BRL) SEQ ID NO:27, as referred to in Girard-Gagnepain A et al. 2014. Blood. 2014 Aug 21;124(8):1221-31. doi: 10.1182 / blood-2014-02-558163. Epub 2014 Jun 20 [Table 12] VSV-G sequence (SEQ ID NO:28): [Table 13] Cutting site: Amino acid: SSLYPALTP (SEQ ID NO: 29) Nucleic acid: agttccctgtatccagccctcacacct (SEQ ID NO: 30) Cas9 amino acid sequence (SEQ ID NO:31) [Table 14] Cas9 nucleic acid sequence (SEQ ID NO:32) [Table 15] TIFF2025063185000017.tif66165 HIV-1 encapsidation construct "p8.91" (encoding HIV-1 Gag-Pol-Tat-Rev) (SEQ ID NO:33) [Table 16] TIFF2025063185000019.tif240165 TIFF2025063185000020.tif240165 TIFF2025063185000021.tif55165 Nucleic acid "KLAP229" encoding HIV-1 GAG-CAS9 (SEQ ID NO: 34) [Table 17] TIFF2025063185000023.tif238165 TIFF2025063185000024.tif255165 TIFF2025063185000025.tif35165

Table 18

Claims

1. A virus-derived particle comprising one or more Cas proteins.

2. The virus-derived particle of claim 1 , wherein the Cas protein is Cas9 or a homologue or derivative thereof.

3. 3. The virus-derived particle according to claim 1, further comprising one or more CRISPR-Cas system guide RNAs.

4. 3. The virus-derived particle of claim 1, further complexed with one or more CRISPR-Cas system guide RNAs.

5. Two CRISPR-Cas system guide RNAs, both of which hybridize to a respective target nucleic acid: - a first CRISPR-Cas system guide RNA that hybridizes to a first target sequence of the target nucleic acid, and - a second CRISPR-Cas system guide RNA that hybridizes to a second target sequence of said target nucleic acid 5. The virus-derived particle according to claim 1, further comprising or further complexed with:

6. at least: a first sequence that hybridizes with a first target sequence of a selected target nucleic acid, and - a second sequence that hybridizes with a second target sequence of said selected target nucleic acid; 6. The virus-derived particle according to any one of claims 1 to 5, further complexed with a targeting nucleic acid comprising:

7. The virus-derived particle according to any one of claims 1 to 6, which is a retrovirus-derived particle.

8. The virus-derived particle according to claim 7, which is a lentivirus-derived particle.

9. 2. The virus-derived particle of claim 1, selected from the group comprising Moloney murine leukemia virus-derived vector particles, bovine immunodeficiency virus-derived particles, simian immunodeficiency virus-derived vector particles, feline immunodeficiency virus-derived vector particles, human immunodeficiency virus-derived vector particles, equine infectious anemia virus-derived vector particles, caprine arthritis encephalitis virus-derived vector particles, baboon endogenous virus-derived vector particles, rabies virus-derived vector particles, influenza virus-derived vector particles, norovirus-derived vector particles, respiratory syncytial virus-derived vector particles, hepatitis A virus-derived vector particles, hepatitis B virus-derived vector particles, hepatitis E virus-derived vector particles, Newcastle disease virus-derived vector particles, Norwalk virus-derived vector particles, parvovirus-derived vector particles, papillomavirus-derived vector particles, yeast retrotransposon-derived vector particles, measles virus-derived vector particles and bacteriophage-derived vector particles.

10. 13. A composition for altering a target nucleic acid in a eukaryotic cell, comprising at least one virus-derived particle as defined in claim 1.

11. 11. The composition of claim 10, further comprising one or more CRISPR-Cas system guide RNAs.

12. The composition of claim 11, wherein the one or more CRISPR-Cas system guide RNAs are comprised in a virus-derived particle.

13. 11. The composition of claim 10, further comprising one or more transduction helper compounds.

14. 1. A kit for preparing a virus-derived particle for altering a target nucleic acid in a eukaryotic cell, comprising: - a nucleic acid comprising an expression cassette encoding a GAG-Cas fusion protein, and - a nucleic acid comprising one or more expression cassettes encoding a viral-like assembly protein Including the kit.

15. The kit of claim 14, further comprising a nucleic acid comprising an expression cassette encoding a pseudotyping viral envelope protein.

16. The kit according to any one of claims 9 and 10, wherein the virus-derived assembly protein is a virus-derived GAG protein.

17. The kit of claim 16, wherein the GAG ​​is encoded by an expression cassette selected in the group comprising an expression cassette encoding a GAG-PRO-POL polyprotein and an expression cassette encoding a GAG protein.

18. 15. The kit of claim 14, further comprising one or more nucleic acids encoding a CRISPR-Cas system guide RNA.

19. The kit according to any one of claims 14 to 18, wherein the nucleic acid is localised in a eukaryotic cell as a result of its transfection into said eukaryotic cell.

20. 20. The kit of claim 19, wherein the eukaryotic cells comprise a packaging cell line.

21. A cell line for producing the virus particle according to claim 1, - one or more nucleic acids encoding proteins necessary to form said virus-derived particles, and - A nucleic acid comprising an expression cassette encoding a GAG-Cas fusion protein A cell line comprising:

22. 1. An in vitro or ex vivo method for altering a target nucleic acid in a eukaryotic cell, the method comprising: a) contacting said eukaryotic cell with a virus-derived particle as defined in any one of claims 1 to 9 or a composition as defined in any one of claims 10 to 13, and b) harvesting said eukaryotic cells containing the altered target nucleic acid. The in vitro or ex vivo method includes the steps of:

23. (i) a fusion protein comprising a viral protein that self-assembles to generate a virus-derived particle, the viral protein being fused to (ii) a Cas protein.

24. 24. The fusion protein of claim 23, further comprising a cleavable site located between the viral protein and the Cas protein.

25. A fusion protein according to any one of claims 23 and 24, consisting of a GAG-Cas fusion protein, preferably a GAG-Cas9 fusion protein.

26. A nucleic acid encoding the fusion protein according to any one of claims 23 to 25.

Images