Modulators of chromosome 9 open reading frame 72 gene expression and uses thereof

Abstract

To provide effective treatment for a C9orf72-related disease such as amyotrophic lateral sclerosis (ALS) or frontotemporal dementia (FTD).SOLUTION: The present invention provides a fusion protein for inhibiting transcription of a mutant allele of the human C9orf72 gene in human cells.SELECTED DRAWING: None

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Patent Application No. 62 / 837,523, filed April 23, 2019, and U.S. Patent Application No. 62 / 964,844, filed January 23, 2020. The disclosures of these priority applications are incorporated herein by reference in their entireties.

[0002] Sequence Listing This application has been submitted electronically in ASCII format and contains a Sequence Listing, which is incorporated herein by reference in its entirety. Said ASCII copy, created on April 21, 2020, is named 025297_WO017_SL.txt and is 19,880 bytes in size. [Background technology]

[0003] The chromosome 9 open reading frame 72 (C9orf72) gene encodes a protein that is found abundantly in neurons. The C9orf72 protein is thought to play an important role in endosomal trafficking. The function of the C9orf72 protein is not fully understood, but recent data suggests that it plays a role in membrane trafficking along the endolysosomal pathway by regulating the function of Rab proteins.

[0004] The C9orf72 gene contains a hexanucleotide segment (G4C2; SEQ ID NO:1) in intron 1. This segment can be repeated up to 30 times in tandem without any discernible biological effect. However, more than 30 repeats, a phenomenon called hexanucleotide expansion, can lead to C9orf72-associated disorders (Renton et al., Neuron (2011) 72:257-68; Douglas, Non-coding RNA Res. (2018) 3:178-87). This expansion results in an autosomal dominant phenotype, and patients are usually heterozygous for the expanded allele. The hexanucleotide expansion causes the formation of RNA foci in cells, which appears to lead to sequestration of RNA-binding proteins and disruption of RNA metabolism. Also, non-AUG-dependent translation of hexanucleotide expansions may lead to the production of non-native proteins that potentially contain dipeptide repeats (DPRs) from all six frames in both sense and antisense orientations (Freibaum and Taylor, Front Mol Neurosci. (2017) 10:35; Douglas, supra). These proteins are prone to aggregation (Gendron et al., Acta Neuropathol. (2013) 126:829). DPRs have been reported in postmortem brain material from patients with C9orf72-associated disease (Riemslagh et al., Acta Neuropathol Commun. (2019) 7:39).

[0005] C9orf72-associated disorders include amyotrophic lateral sclerosis (ALS) and C9 familial frontotemporal dementia (C9FTD). ALS is characterized by progressive muscle weakness, loss of muscle mass and a gradual decline in the ability to move, speak, swallow, and / or breathe. ALS has an annual incidence of 1-3 cases per 100,000 people and is the most common adult-onset motor neuron disorder. The disease is fatal for most patients within 3-5 years of first symptoms. In the United States and Europe, mutations in the C9orf72 gene are responsible for approximately 30-40 percent of familial ALS cases and 5-10% of sporadic ALS cases. Some patients with C9orf72-associated ALS also develop a neurodegenerative disease that affects personality, behavior, and language, a condition called C9 frontotemporal dementia (FTD) or C9FTD (Benussi et al., Front Aging Neurosci. (2015) 7:171). Individuals who develop both conditions are diagnosed as having ALS-FTD. Summary of the Invention [Problem to be solved by the invention]

[0006] There are no effective treatments for C9orf72-associated disorders, and therefore there is an urgent need to develop effective therapies for these disorders. [Means for solving the problem]

[0007] The present disclosure provides zinc finger protein-based transcriptional modulators of human C9orf72 and the use of these modulators in the treatment of C9orf72-related disorders. In one aspect, the present disclosure provides a fusion protein comprising a zinc finger protein (ZFP) domain and a transcriptional repressor domain, wherein the ZFP domain binds to a target region in an intron segment (intron 1a) between exons 1a and 1b of a mutant allele of human C9orf72 gene. The mutant allele has an expanded G4C2 (SEQ ID NO: 1) repeat region in intron 1a, and the fusion protein targets this expanded repeat region. The mutant allele can comprise more than 30 tandem G4C2 repeats (e.g., more than 100, 200, 300, 400, 500, 600, 700, 800, 900 or 1000 repeats). A wild type allele may contain up to 30 such repeats (eg, up to 25, 20, 15, 10 or 5 repeats).

[0008] In some embodiments, the fusion protein represses transcription of a repeat-containing RNA transcript (e.g., mRNA) from a mutant allele and does not repress transcription of a wild-type RNA transcript (e.g., mRNA) from that gene.

[0009] In some embodiments, the ZFP domain binds to a sense sequence in the target region, and the sense sequence comprises one to three tandem repeats of the hexanucleotides GGGGCC (SEQ ID NO:1), GGGCCG (SEQ ID NO:2), GGCCGG (SEQ ID NO:3), GCCGGG (SEQ ID NO:4), CCGGGG (SEQ ID NO:5), or CGGGGC (SEQ ID NO:6). In certain embodiments, the fusion protein represses sense transcription from a mutant allele in human cells. In certain embodiments, the fusion protein represses sense transcription from the C9orf72 1a promoter and does not repress sense transcription from the C9orf72 1b promoter.

[0010] In some embodiments, the ZFP domain binds to an antisense sequence in a target region, and the antisense sequence comprises one to three tandem repeats of the hexanucleotides GGCCCC (SEQ ID NO:7), GCCCCG (SEQ ID NO:8), CCCCGG (SEQ ID NO:9), CCCGGC (SEQ ID NO:10), CCGGCC (SEQ ID NO:11), or CGGCCC (SEQ ID NO:12). In certain embodiments, the fusion protein suppresses antisense transcription from a mutant allele in human cells.

[0011] In some embodiments, the fusion protein suppresses both sense and antisense transcription from a mutant C9orf72 allele in a human cell. In some embodiments, the fusion protein preferentially suppresses a mutant C9orf72 allele compared to a wild-type C9orf72 allele.

[0012] In further embodiments, the fusion protein suppresses sense and / or antisense transcription from the mutant allele by at least about 30%, 40%, 75%, 90% or 95%.

[0013] In some embodiments, the fusion protein has one or more ZFP domains, each of which may contain six zinc fingers, that bind to a target sequence as shown in Table 1, and / or contains six zinc fingers (ordered F1-F6), each of which may contain a DNA binding (recognition) helix sequence as shown in a single row of Table 1, and may contain one or more mutations to residues outside the recognition helix region as shown in Table 1. In further embodiments, the fusion protein binds to a target sequence and contains a zinc finger that corresponds to an SBS number as shown in Table 1, the zinc finger contains a DNA binding (recognition) helix sequence as shown in a single row of Table 1 for the SBS number, and the SBS number is 78021, 75114, 75115, 74969, 79895, 79898, 74986, 79899, ​​79901, 79902, 79904, 79916, 75027, or 79921.

[0014] In some embodiments, the fusion protein has one or more transcriptional repressor domains, each of which may include a KRAB domain amino acid sequence from human KOX1, such as those further described below. In certain embodiments, the ZFP domain is linked to the transcriptional repressor domain via a peptide linker.

[0015] In another aspect, the present disclosure provides a nucleic acid construct comprising a coding sequence of one or more of the fusion proteins described herein, the coding sequence may be operably linked to a transcriptional regulatory element. In some embodiments, the transcriptional regulatory element comprises a mammalian promoter that is constitutively active or inducible in brain cells, and the promoter may be a human synapsin I promoter. In some embodiments, the construct is a recombinant adeno-associated virus ("AAV" or "rAAV") construct. Also provided are rAAVs comprising a recombinant AAV construct and a capsid of serotypes 1-10 (e.g., AAV2, AAV6, or AAV9) or a pseudotyped capsid derived therefrom (e.g., AAV2 / 9, AAV2 / 6, or AAV2 / 6 / 9).

[0016] In another aspect, the present disclosure provides a host cell comprising one or more fusion proteins and / or one or more nucleic acid constructs described herein.The host cell can be, for example, a human cell, for example, a neuron or a pluripotent stem cell (e.g., an embryonic stem cell or an induced pluripotent stem cell).

[0017] Also provided are pharmaceutical compositions comprising one or more of the fusion proteins, one or more nucleic acid constructs (e.g., AAV constructs), recombinant viruses (e.g., rAAV) containing the nucleic acid constructs, and / or one or more host cells, as described herein, typically in combination with one or more pharma- ceutically acceptable excipients.

[0018] In yet another aspect, the disclosure provides a method of inhibiting the transcription of a mutant C9orf72 allele in a human cell (e.g., a neuron, a glial cell, an ependymal cell, or a neuroepithelial cell), wherein the mutant allele comprises an expanded G4C2 repeat region in intron 1a, comprising introducing into the cell one or more fusion proteins, one or more nucleic acid constructs (e.g., AAV), one or more recombinant viruses, one or more host cells, and / or one or more pharmaceutical compositions as described herein. In some embodiments, the cell is in the brain or spinal cord of a patient suffering from a C9orf72-associated disorder, e.g., ALS or C9FTD.

[0019] In a related aspect, the disclosure provides a method of treating a patient suffering from a C9orf72-associated disorder, which may be selected from amyotrophic lateral sclerosis (ALS) and C9 familial frontotemporal dementia (C9FTD), comprising introducing into the patient one or more fusion proteins, one or more nucleic acid constructs (e.g., AAV), one or more host cells and / or one or more pharmaceutical compositions as described herein.

[0020] In this treatment method, the fusion protein can be introduced using a recombinant virus (e.g., AAV vector) that expresses the fusion protein. In some embodiments, the recombinant virus is administered to the patient via intracerebroventricular, intrathecal, intracranial, retro-orbital (RO), intravenous, intranasal and / or intracisternal routes. In some embodiments, two or more different fusion proteins of the present disclosure are introduced, and the coding sequences of the two or more fusion proteins can be carried in the same or different recombinant viral vectors.

[0021] Also provided in the disclosure are one or more fusion proteins and / or one or more nucleic acid constructs, one or more recombinant viruses and one or more pharmaceutical compositions for use in the methods of treatment described herein, and for use of the fusion proteins, nucleic acid constructs and recombinant viruses for the manufacture of a medicament for use in the methods of treatment described herein.

[0022] Other features, objects and advantages of the present invention will become apparent in the following detailed description. It should be understood, however, that the detailed description, while illustrating embodiments and aspects of the present invention, is given by way of illustration only and not by way of limitation. Various changes and modifications within the scope of the present invention will become apparent to those skilled in the art from the detailed description. [Brief description of the drawings]

[0023] [Figure 1-1] 1A-C represent schematic diagrams of the C9orf72 gene and the transcripts produced. FIG. 1A shows the structure of both the wild-type and expanded mutant C9orf72 alleles. The location of the G4C2 expansion on the expanded mutant allele is indicated (in the genomic region between exons 1a and 1b, i.e., in intron 1a). Exons are shown as boxes. Adapted from Douglas, supra; see also Rizzu et al. (2016) Acta Neuropathologica Communications 4:37. [Figure 1-2] Figure 1B is a close-up of the region of the mutant expanded C9orf72 allele near the G4C2 expansion, depicting the promoters and transcripts associated with the expanded allele. The approximate locations of the promoters involved in sense strand transcription (solid arrows) and antisense transcription (open arrows) are shown. Also shown are the five different sense transcripts described so far, as well as the approximate locations and transcripts in the antisense orientation. Ibid. [Figure 1-3]Figure 1C shows a model of repression of the 1a and antisense promoters by ZFP-TFs targeting the expanded region, where the ZFP-TFs bind downstream of both promoters at a location optimal for promoter regulation. The 1b promoter in this model is not repressed because the binding of the ZFP-TF is upstream of the 1b promoter. [Figure 2-1] Figures 2A-D show suppression of C9orf72 expression ("total C9") in the indicated cell types using the indicated ZFP-TFs. Additionally, the figures show suppression of expression of the longer mRNA isoform containing intron 1a (expanded), which is produced primarily by the expanded mutant allele ("repeat-containing isoform-specific"). The expanded isoform is expressed primarily in C9 patient lines. Figure 2A illustrates the PCR assays used for the total C9 assay as well as the sense and antisense repeat-containing isoform-specific assays. The top of the figure represents the genomic structure of the wild-type and expanded alleles, and the bottom of the figure shows the mRNA products made from each allele. The set of arrows on the mRNA diagram represents the PCR targets used in the total C9 assay. [Figure 2-2]2B-D are graphs showing the results of C9orf72 expression assays of different exemplary ZFP-TFs in a wild-type cell line from a healthy individual and in a fibroblast cell line "C9" from an ALS patient. The C9 cell line is characterized as "5 / 850," referring to the number of G4C2 repeats on the wild-type allele (5) and on the expanded allele (850). Left-most graph: total C9orf72 expression in wild-type cells in the third round of screening ("round 3") ("total C9"). Second graph from the left: total C9 in C9 cells in round 3. Second graph from the right: total C9 in C9 cells in the second round of screening ("round 2"). Right-most graph: expression from the expanded C9orf72 allele as determined by an isoform-specific C9orf72 assay. Round 2 screening was performed in C9 cells to evaluate isoform (or disease) specific C9orf72 transcript levels versus total C9 transcript levels after ZFP-TF treatment. In round 3, total C9 was determined in C9 cells and wild type cells to evaluate the effect of ZFP-TF on wild type (WT) alleles in C9 cells. For each ZFP-TF, concentrations of 1, 3, 10, 30, 100 and 300 ng of mRNA are shown from left to right. Figure 2B shows the results of ZFP-TFs 74949, 74951, 74954, 74955 and 74964 in the top graph, and 74969, 74971, 74973, 74978 and 74979 in the bottom graph. Figure 2B discloses SEQ ID NOs: 1, 1 and 3, respectively, in order of appearance. FIG. 2C shows the results of ZFP-TFs 74983, 74984, 74986, 74987 and 74988 in the top graph, and 74997, 74998, 75001 and 75003 in the bottom graph. FIG. 2C discloses SEQ ID NOs: 4 and 5, respectively, in order of appearance. FIG. 2D shows the results of ZFP-TFs 75023, 75027, 75031, 75032, 75055 and 75078 in the top graph, and 75090, 75105, 75109, 75114 and 75115 in the bottom graph. FIG. 2D discloses SEQ ID NOs: 8-11, respectively, in order of appearance. The sequences at the bottom of the graph represent the DNA-binding motifs of that ZFP-TF.Each ZFP-TF binds to three hexanucleotide repeats that contain its motif. Transcript levels were normalized to those of green fluorescent protein (GFP) expressed from GFP mRNA transfected with ZFP-TF mRNA. Horizontal dotted lines in the graphs indicate 50% or 70% repression as indicated. For example, for ZFP-TF75115, in the C9 strain, approximately 50% of the total isoform transcripts were repressed and about 70% of the repeat-containing isoform-specific transcripts were repressed, while in the WT strain there was minimal repression of the total isoform. The graph shows that 30% of the transcripts remain, indicating that 70% was repressed. [Figure 2-3] Same as above. [Figure 2-4] Same as above. [Figure 2-5] Same as above. [Figure 2-6] Same as above. [Diagram 2-7] Same as above. [Diagram 3] Figure 3 shows a diagram of the promoter regions of sense and antisense transcripts in the C9orf72 expanded allele. Primer pairs for specific detection of sense, total and antisense transcripts are shown. AS: antisense. ddPCR: droplet digital PCR. The figure discloses SEQ ID NOs: 1, 1 and 7, respectively, in order of appearance. [Figure 4] Figures 4A and 4B show that primers targeting intron 1b specifically detect antisense pre-mRNA. Strand-specific PCR was used to generate sense (S) or antisense (AS) cDNA templates from healthy controls (Con) or C9 cells (C9). For example, C9-AS indicates ddPCR results obtained with antisense cDNA templates generated from RNA isolated from C9 cells. Figure 4A shows that only the cDNA template C9-AS generates a PCR product, indicating the specificity of the primers for the detection of antisense pre-mRNA. Figure 4B extends the experiment in Figure 4A to cell lines derived from seven different C9orf72 patients with different G4C2 repeat lengths, and to six different healthy control lines. [Figure 5-1] Figures 5A-C are graphs showing repression of transcripts in C9 cells using repeat-containing isoform-specific assays. Figure 5A shows three experiments in which ZFP-TFs 74949, 74978, 75003, 75027, 75109, 75114, 75115, 74960 and 74967 were given at three different doses (30, 100 or 300 ng) and the amount of disease sense transcript was then measured. Figure 5B shows three experiments measuring disease antisense transcripts. Figure 5C shows three runs measuring total C9orf72 transcripts. [Figure 5-2] Same as above. [Figure 5-3] Same as above. [Figure 6] Figure 6 shows the repression of total C9 transcripts along with expanded sense and antisense transcripts (disease isoforms) in three different fibroblast cell lines from different ALS patients, each containing a different number of G4C2 repeats in its expanded allele (approximately 600, 800 and 850 repeats, respectively). The level of repression was assessed using an isoform-selective assay after cells were exposed to 100 ng of ZFP-TFs 75109, 75114 and 75115. All three ZFP-TFs maintained selective repression in all three cell lines. [Figure 7] FIG. 7 shows suppression of total C9 transcripts in two cell lines from healthy individuals with a greater than normal number of G4C2 repeats in their alleles. Healthy individuals typically have 2-5 G4C2 repeats in each of their C9orf72 alleles. However, some healthy individuals contain many more repeats. Cell lines containing a higher than normal number of repeats (5 / 8 and 5 / 20 repeats) were used to ensure that sufficient binding sites for ZFP-TFs were provided. In these cell lines, total C9 transcripts are only minimally affected. [Figure 8-1]Figures 8A-8C show the results of microarray analysis in ALS patient-derived primary fibroblasts (C921, also called C9021), in mouse primary neurons, and in human primary neurons, showing the specificity of the indicated repressors (75027, 75109, 75114, and 75115). ZFP-TF75027 targets the repeated GCCCCG (SEQ ID NO: 8) motif, while ZFP-TF75109, 75114, and 75115 target the CCGGCC (SEQ ID NO: 11) motif in the antisense strand of the C9orf72 gene. Figure 8A shows the results of microarray analysis in patient-derived primary fibroblasts (C9021) using a Thermo Fisher Clariom™ S assay that contains 21,000 wells of annotated genes in its database. The analysis was performed 24 hours after administration of 300 ng of repressors in mRNA form to C9021 cells. The graph illustrates genes that were up- or down-regulated in response to the indicated ZFP-TFs. [Figure 8-2] Figure 8B shows the results of microarray analysis in mouse primary neurons using Thermo Fisher Clariom™ D assay, which contains 140,000 annotated and unannotated coding and non-coding transcripts in its database. Analysis was performed 7 days after AAV transduction. All cells were transduced at an MOI of 3,000. The graph illustrates genes that are up- or down-regulated depending on the indicated ZFP-TF. [Figure 8-3] Figure 8C shows the results of microarray analysis in human primary neurons using Thermo Fisher Clariom™ D assay. Analysis was performed 19 days after AAV transduction of cells at an MOI of 3,000. The graph illustrates genes that were up- or down-regulated in response to the indicated ZFP-TFs. [Figure 9-1]Figure 9 shows in vivo targeting engagement of ZFPs in C9orf72 BAC transgenic mice. Panel A shows the AAV construct used for injection. The construct contains a synapsin promoter, a ZFP-KRAB coding sequence and a Venus tag. Panels B and C show the study design in which neonates are injected intracerebroventricularly (ICV) with AAV containing a ZFP-KRAB expression construct and dissected one month after injection for downstream analysis. Panel D shows the levels of sense, antisense and total C9RNA in animals injected with ZFP-KRAB(75027) in the hippocampus and cortex. Panel E shows representative images of sense and antisense RNA foci and quantification from the cornu ammonis (CA) and dentate gyrus (DG) regions of the hippocampus in animals injected with ZFP-KRAB(75027). [Figure 9-2] Same as above. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0024] The present disclosure provides zinc finger protein-based transcription factors (ZFP-TFs) that preferentially target human C9orf72 gene alleles with expanded G4C2 repeat regions and suppress the transcription of these mutant alleles into RNA. Such expanded regions can have more than 30 G4C2 repeats. The present ZFP-TFs are fusion proteins that contain (i) at least one zinc finger protein (ZFP) domain that specifically binds to a DNA motif within the repeats on either the sense or antisense strand of a mutant allele, and (ii) at least one transcriptional repressor domain that reduces the transcription of the allele in either or both the sense and antisense orientations. Reducing the level of mutant C9orf72 transcripts in neurons by introducing ZFP-TFs into the nervous system (e.g., brain and spinal cord) of a patient is predicted to inhibit (e.g., reduce or stop) the formation of disease-causing cytotoxic materials in cells. The present ZFP-TFs can be used for the treatment, including prevention and amelioration, of C9orf72-associated disorders, such as ALS and C9FTD.

[0025] Disclosed herein are methods and compositions for diagnosing, preventing and / or treating ALS and FTD.In particular, provided herein are methods and compositions for treating these diseases by modifying (e.g., regulating expression of) specific genes, including the use of engineered transcription factor repressors and nucleases.In some embodiments, regulating expression includes regulating both sense and / or antisense expression.

[0026] Thus, methods (in vivo, ex vivo and / or in vitro) of suppressing sense and / or antisense transcription of a repeat-expanded mutant allele of the C9orf72 gene in a cell (e.g., a neuron) are described herein. The methods include treating the cell with one or more repressors of the mutant C9orf72 gene allele, where the one or more repressors comprise a transcriptional repression domain and a DNA-binding domain that binds to a target site in the mutant C9orf72 gene allele. The repressor(s) may comprise one or more zinc finger protein transcription factors (ZFP-TFs comprising a ZFP DNA-binding domain), one or more TAL effector domain transcription factors (TALE-TFs comprising a TAL effector domain DNA-binding domain) and / or one or more CRISPR / Cas transcription factor systems (comprising a single guide RNA DNA-binding domain). In certain embodiments, two or more different repressors (e.g., one or more pharmaceutical compositions comprising two or more different repressors) are used. In certain embodiments, the C9orf72 gene comprises a mutant allele that comprises one or more (G4C2) repeats, and the target site bound by the DNA-binding domain of the repressor may be within one or more (G4C2) repeats. Thus, the present invention provides the use of one or more ZFP-TF, TALE-TF or CRISPR / Cas TF repressors (e.g., formulated into one or more pharmaceutical compositions comprising one or more repressors) that bind to a mutant C9orf72 expanded allele that comprises one or more (G4C2) repeats for repression of sense and / or antisense transcription (e.g., up to 50%, 70%, or more compared to untreated cells / subjects) in a subject in need thereof (e.g., a subject with ALS and / or FTD, whose disease is treated and / or whose symptoms are ameliorated). In certain embodiments, sense and / or antisense transcription is not suppressed by more than 90% of normal (control) levels.In certain embodiments, both antisense and sense transcription are suppressed at the same or different levels (e.g., antisense and sense transcription are suppressed similarly); antisense transcription is suppressed more than sense transcription, or sense transcription is suppressed more than antisense transcription. In certain embodiments, certain sense transcripts are suppressed while others are not. In some embodiments, transcription from the promoter in the 1b intron segment is not suppressed, while transcription from the promoter in the 1a intron and antisense transcripts are suppressed. In certain embodiments, transcripts containing expanded repeats are selectively suppressed (e.g., antisense transcription is suppressed, sense transcription from the 1a promoter is suppressed, and / or sense transcription from the 1b promoter is not suppressed). In certain embodiments, in the methods and uses described herein, one or more ZFP-TF repressors containing recognition helix regions as shown in Table 1 are used, which may be combined with one or more different repressors (e.g., additional different ZFP-TFs, e.g., one or more additional ZFP-TFs containing ZFPs as shown in Table 1). In certain embodiments, one or more of the repressors are administered to cells using one or more non-viral vectors (e.g., as mRNA) and / or viral vectors (e.g., AAV, such as AAV2 / 9). Multiple copies of one or more modulators (e.g., repressors) can be administered using the same or different modalities (e.g., mRNA and / or AAV). In certain embodiments, the same or different modalities can be used to deliver one or more different modulators (e.g., repressors). In vivo methods and uses in living subjects (e.g., humans) can include administration (e.g., of one or more pharmaceutical compositions comprising repressors and / or polynucleotides encoding repressors) by any suitable means, including, but not limited to, intracerebroventricular, intrathecal, intracranial, retroorbital (RO), intravenous, intranasal, and / or intracisternal vein. Brain administration can be unilateral or bilateral (e.g., to the hippocampus).Any amount (dosage) can be administered, for example, 1E10-1E13 (e.g., 6E11) vg / hemisphere. Any of the methods and uses described herein treat ALS and / or FTD (and / or treat one or more symptoms of these diseases) in a subject.

[0027] Provided herein are gene modulators of the C9orf72 gene, modulators comprising a DNA binding domain (e.g., zinc finger protein (ZFP), TAL effector domain protein (TALE) or single guide RNA) that binds to a target site of at least 12 nucleotides in the C9orf72 gene and a transcriptional regulatory domain (e.g., a repression domain). Also provided are one or more polynucleotides (e.g., viral or non-viral gene delivery vehicles, e.g., AAV vectors) that encode one or more of the gene modulators described herein. In other aspects, described herein are pharmaceutical compositions comprising one or more polynucleotides and / or one or more gene delivery vehicles as provided herein. In some embodiments, the gene modulator comprises a regulator domain, and the gene modulator (and pharmaceutical compositions comprising one or more gene modulators or polynucleotides encoding one or more gene modulators) regulates (e.g., represses or activates) expression of the C9orf72 gene. The sense and / or antisense strand of the gene may be bound and / or regulated. Also provided herein are isolated cells (including cell populations), one or more polynucleotides, one or more gene delivery vehicles and / or one or more pharmaceutical compositions comprising one or more gene modulators as described herein.Also provided are methods and uses for regulating (e.g., suppressing) C9orf72 gene expression in cells [in vitro, in vivo or ex vivo], the methods comprising administering to cells [by any method, including but not limited to intracerebroventricular, intrathecal, intracranial, retro-orbital (RO), intravenous or intracisternal] one or more gene modulators, one or more polynucleotides, one or more gene delivery vehicles and / or one or more pharmaceutical compositions as described herein.The method can be used for the treatment and / or prevention of amyotrophic lateral sclerosis (ALS) or frontotemporal dementia (FTD) in a subject.The use of one or more gene modulators, one or more polynucleotides, one or more gene delivery vehicles and / or one or more pharmaceutical compositions for the treatment and / or prevention of ALS or FTD in a subject is also provided.Also provided is a kit comprising one or more gene modulators, one or more polynucleotides, one or more gene delivery vehicles and / or one or more pharmaceutical compositions as described herein and, if appropriate, instructions for use.

[0028] Thus, in one aspect, engineered (non-naturally occurring) gene modulators (e.g., repressors) of one or more genes are provided. These gene modulators may include systems (e.g., zinc finger proteins, TAL effector (TALE) proteins, or CRISPR / dCas-TFs) that regulate (e.g., suppress) the expression of alleles. The expression of wild-type and / or mutant alleles may be regulated together or separately. In certain embodiments, the regulation of the mutant allele is at a level greater than the wild-type allele (e.g., the wild-type allele is suppressed to 50% or less of normal, while the mutant allele is suppressed to at least 70% compared to an untreated control). In some embodiments, the regulation of expression may include regulating both the sense and antisense transcripts of the C9orf72 gene. In some embodiments, the regulation of expression may predominantly regulate the sense transcript, while in other embodiments, the regulation of expression may predominantly regulate the antisense transcript.

[0029] Expanded mutations in C9orf72 alleles result in the expression of both sense and antisense RNA products associated with ALS and FTD, and thus, in one embodiment, engineered transcription factors designed to suppress the expression of these mutant C9orf72 alleles for the treatment of ALS or FTD are provided. Engineered zinc finger proteins or TALEs are non-naturally occurring zinc finger or TALE proteins whose DNA binding domains (e.g., recognition helices or RVDs) have been altered (e.g., by selection and / or rational design) to bind to preselected target sites. Any of the zinc finger proteins described herein may contain one, two, three, four, five, six or more zinc fingers, each of which has a recognition helix that binds to a target subsite in a selected sequence (e.g., a gene). In certain embodiments, the ZFP-TF comprises a ZFP having a recognition helix region as shown in a single row of Table 1. Similarly, any of the TALE proteins described herein may contain any number of TALE RVDs. In some embodiments, at least one RVD has non-specific DNA binding. In some embodiments, at least one recognition helix (or RVD) is not naturally occurring. In certain embodiments, the TALE-TF comprises a TALE that binds to at least 12 base pairs of a target site as shown in Table 1. The CRISPR / Cas-TF comprises a single guide RNA that binds to a target sequence. In certain embodiments, the engineered transcription factor binds (e.g., via a ZFP, TALE, or sgRNA DNA binding domain) to a target site that comprises at least 9-12 base pairs in a gene associated with a disease, such as a target site that comprises at least 9-20 base pairs (e.g., 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more), including contiguous or non-contiguous sequences within these target sites (e.g., target sites as shown in Table 1).In certain embodiments, the gene modulator comprises a DNA binding molecule as described herein (ZFP, TALE, single guide RNA) operably linked to a transcriptional repression domain (to form a gene repressor).

[0030] Thus, zinc finger proteins (ZFPs), Cas proteins of CRISPR / Cas systems, or TALE proteins as described herein can be placed in operative linkage with a regulatory domain (or functional domain) as part of a fusion molecule. The functional domain can be, for example, a transcription activation domain, a transcription repression domain, and / or a nuclease (cleavage) domain. By selecting either an activation domain or a repression domain for use with a DNA binding molecule, such molecules can be used to activate or repress gene expression. In certain embodiments, the functional or regulatory domain can play a role in histone post-translational modification. In some examples, the domain is a histone acetyltransferase (HAT), histone deacetylase (HDAC), histone methylase, or an enzyme that sumoylates or biotinylates histones or other enzymatic domain that allows gene repression regulated by post-translational histone modification [Kousarides, (2007) Cell 128:693-705]. In some embodiments, molecules are provided that include a ZFP, dCas, or TALE that targets a gene (e.g., C9orf72) as described herein, fused to a transcriptional repression domain that can be used to downregulate gene expression. In some embodiments, the methods and compositions of the present invention are useful for treating eukaryotic organisms. In certain embodiments, the activity of the regulatory domain is regulated by an exogenous small molecule or ligand, such that interaction with the transcriptional machinery of the cell does not occur in the absence of an exogenous ligand. Such an external ligand controls the degree of interaction of the ZFP-TF, CRISPR / Cas-TF, or TALE-TF with the transcriptional machinery. The regulatory domain can be operably linked to any part of one or more of the ZFPs, dCas, or TALEs, including between one or more ZFPs, dCas, or TALEs, outside one or more ZFPs, dCas, or TALEs, and any combination thereof. In a preferred embodiment, the regulatory domain results in repression of gene expression of the targeted gene (e.g., C9orf72).Any of the fusion proteins described herein can be formulated into a pharmaceutical composition.

[0031] In some embodiments, the artificial regulator binds to the promoter region upstream (e.g., 5') of the transcription start site (TSS) of the gene. In some embodiments, the artificial regulator binds to the region downstream of the TSS. In a preferred embodiment, the artificial regulator preferentially binds to the expanded repeat region in the C9orf72 gene. In some embodiments, the binding of the artificial regulator to the C9orf72 gene represses the expression of the promoter in the 1a intron. In some embodiments, the binding of the artificial regulator to the C9orf72 gene represses the expression of the promoter in the 1b intron. In some embodiments, the binding of the artificial regulator represses the expression from the 1a promoter and the antisense promoter, but does not repress the 1b promoter. See also Figures 1B and 1C.

[0032] In some embodiments, the methods and compositions of the invention include the use of two or more fusion molecules as described herein, for example, two or more C9orf72 modulators (artificial transcription factors). The two or more fusion molecules may bind different target sites and contain the same or different functional domains. Alternatively, the two or more fusion molecules as described herein may bind the same target site but contain different functional domains. In some examples, three or more fusion molecules are used, in others, four or more fusion molecules are used, and in others, five or more fusion molecules are used. In some embodiments, two or more, three or more, four or more, or five or more fusion molecules (or components thereof) are delivered to a cell as a nucleic acid. In preferred embodiments, the fusion molecules cause suppression of the expression of the targeted gene. In some embodiments, the two fusion molecules are given at a dose where each molecule is active on its own, but in combination, the suppression activity is additive. In some embodiments, the two fusion molecules are given at a dose where neither molecule is active on its own, but in combination, the suppression activity is synergistic.

[0033] In yet another aspect, a polynucleotide encoding any of the DNA binding domains described herein is provided.

[0034] In some embodiments, the polynucleotide encoding the DNA binding protein is an mRNA. In some aspects, the mRNA can be chemically modified [e.g., Kormann et al., (2011) Nature Biotechnology 29(2):154-7]. In other aspects, the mRNA can include an ARCA cap (see U.S. Patent Nos. 7,074,596 and 8,153,773). In further embodiments, the mRNA can include a mixture of unmodified and modified nucleotides (see U.S. Patent Publication No. 2012 / 0195936).

[0035] In yet another aspect, a gene delivery vector is provided that comprises any of the polynucleotides (e.g., repressor) as described herein.In certain embodiments, the vector is an adenovirus vector (e.g., Ad5 / F35 vector), a lentivirus vector (LV) including integration-competent or integration-defective lentivirus vector, or an adenovirus-associated virus vector (AAV).In certain embodiments, the AAV vector is an AAV2, AAV6, AAV8 or AAV9 vector, or a pseudotyped AAV vector, such as AAV2 / 8, AAV2 / 5, AAV2 / 9 and AAV2 / 6.In some embodiments, the AAV vector is an AAV vector that can cross the blood-brain barrier (e.g., US Patent Publication No. 2015 / 0079038).In other embodiments, the AAV is a self-complementary AAV (sc-AAV) or single-stranded (ss-AAV) molecule. Also provided herein is an adenovirus (Ad) vector, LV or adenovirus-associated virus vector (AAV), which comprises at least one nuclease (ZFN or TALEN) coding sequence and / or donor sequence for targeted integration into target gene.In certain embodiments, the Ad vector is a chimeric Ad vector, for example, Ad5 / F35 vector.In certain embodiments, the lentivirus vector is an integrase-defective lentivirus vector (IDLV) or integration-competent lentivirus vector.In certain embodiments, the vector is pseudotyped with VSV-G envelope or with other envelopes.

[0036] Additionally, pharmaceutical compositions are provided that include fusions such as nucleic acids and / or artificial transcription factors (e.g., ZFPs, Cas, or TALEs, or fusion molecules that include ZFPs, Cas, or TALEs). For example, certain compositions include a nucleic acid that includes a sequence encoding one of the ZFPs, Cas, or TALEs described herein, operably linked to a regulatory sequence, in combination with a pharmaceutically acceptable carrier or diluent, where the regulatory sequence allows expression of the nucleic acid in a cell. In certain embodiments, the encoded ZFP, Cas, CRISPR / Cas, or TALE regulates wild-type and / or mutant alleles. In some embodiments, the mutant allele is preferentially regulated, e.g., suppressed, over the wild-type allele. In some embodiments, the pharmaceutical composition includes a ZFP, CRISPR / Cas, or TALE that preferentially regulates the mutant allele and a ZFP, CRISPR / Cas, or TALE that regulates a neurotrophic factor. A protein-based composition includes one or more ZFPs, CRISPR / Cas, or TALEs disclosed herein and a pharmaceutically acceptable carrier or diluent.

[0037] In yet another aspect, there is also provided an isolated cell comprising any of the proteins, fusion molecules, polynucleotides and / or compositions as described herein. The isolated cell may be used for non-therapeutic uses, such as providing a cell or animal model for diagnostic and / or screening methods, and / or for therapeutic uses, such as ex vivo cell therapy.

[0038] In yet another aspect, pharmaceutical compositions are also provided that include one or more gene modulators, one or more polynucleotides (e.g., gene delivery vehicles) and / or one or more isolated cells (e.g., populations thereof) as described herein. In certain embodiments, the pharmaceutical compositions include two or more gene modulators. For example, certain compositions include a nucleic acid that includes a sequence that encodes one or more gene modulators of one of the genes associated with a rare disease as described herein (e.g., C9orf72). In certain embodiments, the gene modulator (e.g., including a ZFP, Cas, or TALE described herein) is operably linked to a regulatory sequence and combined with a pharma- ceutically acceptable carrier or diluent, and the regulatory sequence allows expression of the nucleic acid in the cell. In certain embodiments, the encoded ZFP, CRISPR / Cas, or TALE is specific for a mutant or wild-type allele (e.g., C9orf72). In some embodiments, the pharmaceutical composition comprises a ZFP-TF, CRISPR / Cas-TF or TALE-TF that regulates mutant and / or wild-type alleles (e.g., C9orf72), and comprises a TF that preferentially regulates (e.g., suppresses at a greater level) mutant alleles compared to wild-type alleles. The protein-based composition comprises one or more gene modulators as disclosed herein and a pharma-ceutically acceptable carrier or diluent. In certain embodiments, a composition comprising two or more gene modulators (carried in the same or different types of vectors, e.g., AAV vectors) is used, and one of the gene modulators may comprise a ZFP-TF repressor, including ZFPs named 74949, 74978, 75027 or 75109.

[0039] The present invention also provides methods and uses for suppressing gene expression in a subject in need thereof (e.g., a subject with a rare disease as described herein), comprising by providing the subject with one or more polynucleotides, one or more gene delivery vehicles and / or pharmaceutical compositions as described herein. In certain embodiments, the compositions described herein are used to suppress mutant C9orf72 expression in a subject, including for the treatment and / or prevention of ALS or FTD. The compositions described herein suppress gene expression for extended periods (4 weeks, 3 months, 6 months to 1 year or more) in the brain (including but not limited to the prefrontal cortex, parietal cortical lobes, occipital cortical lobes, temporal cortical lobes, including but not limited to the entorhinal cortex, hippocampus, brainstem, striatum, thalamus, midbrain, cerebellum, including but not limited to the frontal cortical lobes) and spinal cord (including but not limited to the lumbar, thoracic and cervical spinal cord regions). The compositions described herein may be provided to a subject by any means of administration, including, but not limited to, intraventricular, intrathecal, intracranial, intravenous, retroorbital (RO), intranasal and / or intracisternal administration. Kits are also provided that contain one or more of the compositions (e.g., gene modulators, polynucleotides, pharmaceutical compositions and / or cells) as described herein and instructions for use of these compositions.

[0040] In another aspect, methods are provided herein for treating and / or preventing CNS (e.g., ALS and / or FTD) using the methods and compositions described herein. In some embodiments, the methods involve compositions in which polynucleotides and / or proteins can be delivered using viral vectors, non-viral vectors (e.g., plasmids) and / or combinations thereof. In some embodiments, the methods involve compositions comprising stem cell populations comprising artificial transcription factors (e.g., ZFP-TFs, TALE-TFs or dCas-TFs). Administration of compositions (proteins, polynucleotides, cells and / or pharmaceutical compositions comprising these proteins, polynucleotides and / or cells) as described herein results in therapeutic (clinical) effects, including, but not limited to, amelioration or elimination of any of the clinical symptoms associated with ALS and / or FTD, and an increase in the function and / or number of CNS cells (e.g., neurons, astrocytes, myelin, etc.). In certain embodiments, the compositions and methods described herein reduce the expression of the sense and / or antisense transcripts of a target gene (e.g., C9orf72) by at least 30% or 40%, e.g., at least 50%, at least 70%, at least 80%, at least 90%, at least 95% or more than 95%, compared to a control that does not receive an artificial repressor as described herein. In some embodiments, a reduction of at least 50% is achieved. In certain embodiments, the artificial repressor preferentially suppresses the mutant allele (e.g., the expanded allele) compared to the wild-type allele, e.g., by at least 20% (e.g., suppresses the wild-type allele by 50% or less and suppresses the mutant allele by at least 70%). In some embodiments, the repressor preferentially suppresses the sense transcript at the mutant allele, and in other embodiments, the repressor preferentially suppresses the antisense transcript at the mutant allele. In some embodiments, the repressor suppresses both the sense and antisense transcripts at the mutant allele.

[0041] In yet another aspect, a method of delivering gene repressor to the brain of a subject using a viral or non-viral vector is described herein.In certain embodiments, the viral vector is an AAV9 vector.Delivery can be to any brain region, such as the hippocampus or entorhinal cortex, by any suitable means, including by using a cannula.Any AAV vector that provides broad delivery of gene modulator (e.g., repressor) to the brain of a subject, including by anterograde and retrograde axonal transport to brain regions that are not directly administered vectors (e.g., delivery to the putamen results in delivery to other structures such as the cortex, substantia nigra, thalamus, etc.).In certain embodiments, the subject is a human, and in other embodiments, the subject is a non-human primate.Administration can be in a single dose, or in a series of doses given simultaneously, or in multiple doses (with any timing between doses).

[0042] Thus, in another aspect, described herein is a method of preventing and / or treating a disease (e.g., ALS and / or FTD) in a subject, comprising administering a repressor of a gene to the subject using AAV. In certain embodiments, the repressor is administered to the CNS (e.g., hippocampus and / or entorhinal cortex) or PNS (e.g., spinal cord / fluid) of the subject. In other embodiments, the repressor is administered intravenously. In certain embodiments, described herein is a method of preventing and / or treating ALS or FTD in a subject, comprising administering a repressor of a C9orf72 allele (wild type and / or mutant) to the subject using one or more AAV vectors. In certain embodiments, the AAV encoding the gene modulator is administered to the CNS (brain and / or CSF) by any delivery method, including but not limited to intracerebroventricular, intrathecal, intracranial, intravenous, intranasal, retroorbital or intracisternal delivery. In other embodiments, the AAV encoding the repressor is administered directly into the subject's parenchyma (e.g., hippocampus and / or entorhinal cortex). In other embodiments, the AAV encoding the repressor is administered intravenously (IV). In any of the methods described herein, the administration may be performed once (single administration) or multiple times with the same or different doses per administration (with any number between administrations). When multiple administrations are performed, the same or different doses and / or delivery vehicles may be used (e.g., different AAV vectors administered IV and / or ICV). The methods include methods of reducing loss of muscle function, loss of physical coordination, muscle stiffness, muscle spasms, loss of speech function, difficulty swallowing, cognitive impairment, methods of reducing loss of motor function and / or methods of reducing loss of one or more cognitive functions in ALS subjects, all in comparison with subjects who do not receive the method or in comparison with the subject itself prior to receiving the method.Thus, the methods described herein result in a reduction in biomarkers and / or symptoms of rare diseases such as ALS or FTD, including the following: loss of muscle function, loss of physical coordination, muscle stiffness, muscle spasms, loss of speech function, difficulty swallowing, cognitive impairment, changes in blood and / or cerebrospinal fluid chemistry associated with ALS, including G-CSF, IL-2, IL-15, IL-17, MCP-1, MIP-1α, TNF-α and VEGF levels [see Chen et al., Front Immunol. (2018) 9:2122], and / or one or more of other biomarkers known in the art. In certain embodiments, the methods may further include administering one or more gene repressors of tau (MAPT), for example, in a subject with FTD. See, for example, US Patent Publication No. 2018 / 0153921.

[0043] In any of the methods described herein, the repressor of the targeted allele can be a ZFP-TF, e.g., a fusion protein comprising a ZFP that specifically binds to the allele and a transcriptional repression domain (e.g., KOX, KRAB, etc.). In other embodiments, the repressor of the targeted allele can be a TALE-TF, e.g., a fusion protein comprising a TALE polypeptide that specifically binds to the gene allele and a transcriptional repression domain (e.g., KOX, KRAB, etc.). In some embodiments, the targeted allele repressor is a CRISPR / Cas-TF, in which the nuclease domain in the Cas protein is inactivated, such that the protein no longer cleaves DNA. The resulting DNA binding domain guided by the Cas RNA is fused to a transcriptional repressor (e.g., KOX, KRAB, etc.) to repress the targeted allele. In some embodiments, the engineered transcription factor is capable of repressing the expression of the mutant allele but not the wild-type allele. In a further embodiment, the DNA binding molecule preferentially recognizes the hexamer GGGGCC (SEQ ID NO: 1) expansion.

[0044] In some embodiments, a sequence encoding a genetic repressor (e.g., ZFP-TF, TALE-TF, or CRISPR / Cas-TF) as described herein is inserted (integrated) into the genome, while in other embodiments, the sequence encoding the repressor is maintained episomally. In some examples, a nucleic acid encoding a TF fusion is inserted (e.g., by nuclease-mediated integration) into a safe harbor site that includes a promoter, such that the endogenous promoter drives expression. In other embodiments, a repressor (TF) donor sequence is inserted (by nuclease-mediated integration) into a safe harbor site, where the donor sequence includes a promoter that drives expression of the repressor. In some embodiments, the promoter sequence is broadly expressed, while in other embodiments, the promoter is tissue or cell / type specific. In preferred embodiments, the promoter sequence is specific for neural cells. In other embodiments, the promoter sequence is specific for muscle cells. In some embodiments, the promoter selected is characterized by having low expression. Non-limiting examples of useful promoters include neutral specific promoters NSE, Synapsin, CAMKiia and MECP.Non-limiting examples of ubiquitous promoters include CMV, CAG and Ubc.Further embodiments include the use of autoregulatory promoters as described in US Patent Publication No. 2015 / 0267205.Further embodiments include the use of autoregulatory promoters as described in US Patent Publication No. 2015 / 0267205.

[0045] In any of the methods described herein, the method can result in about 50% or more, 55% or more, 60% or more, 65% or more, about 70% or more, about 75% or more, about 85% or more, about 90% or more, about 92% or more or about 95% or more suppression, 98% or more or 99% or more of the target allele (e.g., mutant or wild-type C9orf72) in one or more neurons of a subject (e.g., a subject with ALS). In certain embodiments, the expression of the wild-type allele is suppressed by 50% or less in the subject (compared to an untreated subject), and the mutant allele is suppressed by at least 70% (70% or any value above) in the subject (compared to an untreated subject). In some embodiments, the expression of the antisense promoter is suppressed by at least 70%. In certain embodiments, expression of an antisense promoter found in the C9orf72 intron 1a, 1b and / or 1c region is suppressed by at least 70%, while expression of a sense promoter in the C9orf72 intron 1b region is suppressed by 50% or less.

[0046] In any of the methods described herein, the regulator (e.g., repressor or activator) can be delivered to the subject as a protein, a polynucleotide, or any combination of protein and polynucleotide. In certain embodiments, one or more repressors are delivered using an AAV vector. In other embodiments, at least one component of the regulator (e.g., the sgRNA of the CRISPR / Cas system) is delivered as an RNA form. In other embodiments, the regulator is delivered using any combination of the expression constructs described herein, such as one repressor (or a part thereof) on one expression construct (AAV9) and one repressor (or a part thereof) on a separate expression construct (AAV or other viral or non-viral construct).

[0047] Further, in any of the methods described herein, the regulator (e.g., repressor) may be delivered to cells (ex vivo or in vivo) at any concentration (dosage) that provides the desired effect. In some embodiments, the regulator is delivered using an adeno-associated virus (AAV) vector at 10,000-500,000 vector genomes / cell (or any value in between). In certain embodiments, the regulator is delivered using a lentiviral vector at an MOI of between 250 and 1,000 (or any value in between). In other embodiments, the regulator is delivered using a plasmid vector at 0.01-1,000 ng / 100,000 cells (or any value in between). In other embodiments, the repressor is delivered as mRNA at 150-1,500 ng / 100,000 cells (or any value in between). Additionally, for in vivo use, in any of the methods described herein, the gene modulator (e.g., repressor) may be delivered at any concentration (dosage) that results in the desired effect in a subject in need thereof. In some embodiments, the repressor is delivered using an adeno-associated virus (AAV) vector at 10,000-500,000 vector genomes / cell (or any value in between). In certain embodiments, the repressor is delivered using a lentiviral vector at an MOI of between 250 and 1,000 (or any value in between). In other embodiments, the repressor is delivered using a plasmid vector at 0.01-1,000 ng / 100,000 cells (or any value in between). In another embodiment, the repressor is delivered as mRNA at 0.01-3000 ng / cell (e.g., 50,000-200,000 (e.g., 100,000) cells (or any value in between). In another embodiment, the repressor is delivered to the brain parenchyma at 1E11-1E14 VG / ml using an adeno-associated virus (AAV) vector in a fixed volume of 1-300 μL.In another embodiment, the repressor is delivered to the CSF at 1E11-1E14 VG / ml using an adeno-associated viral (AAV) vector in a fixed volume of 0.5-10 ml.

[0048] In any of the methods described herein, the method may result in about 50% or more, 55% or more, 60% or more, 65% or more, about 70% or more, about 75% or more, about 85% or more, about 90% or more, about 92% or more, or about 95% or more modulation (e.g., suppression) of the targeted allele in one or more cells of the subject. In some embodiments, the wild-type and mutant alleles are differentially regulated, e.g., the mutant allele is preferentially modified compared to the wild-type allele (e.g., the mutant allele is suppressed by at least 70% and the wild-type allele is suppressed by 50% or less).

[0049] In any of the methods described herein, the method may result in about 50% or more, 55% or more, 60% or more, 65% or more, about 70% or more, about 75% or more, about 85% or more, about 90% or more, about 92% or more, or about 95% or more regulation (e.g., suppression) of the antisense expression of the targeted allele(s) in one or more cells of the subject. In some embodiments, the sense expression and the antisense expression in the mutant allele are differentially regulated, e.g., the expression of the antisense transcript is preferentially regulated compared to the expression of the sense transcript in the mutant allele (e.g., the antisense expression is suppressed by at least 70% and the sense expression is suppressed by 50% or less).

[0050] In further aspects, transcription factors as described herein, such as transcription factors including one or more of zinc finger proteins (ZFP-TFs), TALEs (TALE-TFs) and CRISPR / Cas-TFs, such as ZFP-TFs, TALE-TFs or CRISPR / Cas-TFs, are used to suppress the expression of mutant and / or wild-type alleles (e.g., C9orf72) in the brain (e.g., neurons) of a subject. The suppression can be about 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, about 75% or more, about 85% or more, about 90% or more, about 92% or more, or about 95% or more of the targeted allele in one or more cells of the subject compared to untreated (wild-type) cells of the subject. In certain embodiments, the suppression of the wild-type allele is 50% or less (compared to untreated cells or subjects) and the suppression of the mutant (disease or isoform variant) is at least 70% (compared to untreated cells or subjects). In certain embodiments, antisense transcription is completely (sufficiently) suppressed.In certain embodiments, the suppression of sense transcription is 50% or less (compared to untreated cells or subjects), and the suppression of antisense transcription is at least 70% (compared to untreated cells or subjects).In certain embodiments, the regulation of targeted transcription factor can be used to achieve one or more of the methods described herein.

[0051] Thus, methods and compositions are described herein for regulating the expression of genes associated with rare disorders disclosed herein, including suppression with or without the expression of exogenous sequences (such as artificial TFs).The compositions and methods may be for use in vitro (e.g., for providing cells for the study of target genes, for drug discovery and / or for making transgenic animals and animal models by its regulation), in vivo or ex vivo, and include administering artificial transcription factors or nucleases, including DNA-binding molecules that target genes associated with rare diseases, as appropriate, in the case of nucleases with donors that are integrated into genes after cleavage by nucleases.In some embodiments, donor genes (transgenes) are maintained extrachromosomally in cells.In certain embodiments, the cells are in patients with diseases.In other embodiments, the cells are modified by any of the methods described herein, and the modified cells are administered to subjects in need thereof (e.g., subjects with rare diseases). Also provided are genetically modified cells (e.g., stem cells, progenitor cells, T cells, muscle cells, etc.) that contain genetically modified genes (e.g., exogenous sequences), including cells produced by the methods described herein. These cells can be used to provide therapeutic proteins to subjects with rare diseases, for example, by administering the cells to a subject in need thereof, or by isolating the protein produced by the cells and administering the protein to a subject in need thereof (enzyme replacement therapy).

[0052] Also provided are kits that include one or more of the gene modulators (e.g., repressors) and / or polynucleotides that include components of target-modulators (or components thereof) and / or polynucleotides that encode target-modulators (or components thereof) as described herein. The kits may further include cells (e.g., neurons or muscle cells), reagents (e.g., for detecting and / or quantifying proteins, e.g., in CSF) and / or instructions for use, including methods as described herein.

[0053] The methods and compositions are further described in detail below.

[0054] I. Zinc finger protein transcription factors The ZFP-TF is a fusion protein that contains a DNA-binding zinc finger protein (ZFP) domain and a transcriptional repressor domain, and the two domains can be associated with each other by direct peptidyl linkage or peptide linker, or by dimerization (e.g., via leucine zipper, STAT protein N-terminal domain, or FK506 binding protein).As used herein, "fusion protein" refers to a polypeptide having domains that are covalently linked, as well as a complex of polypeptides that are non-covalently associated with each other.The transcriptional repressor domain can be associated with the ZFP domain at any suitable position, including the C-terminus or N-terminus of the ZFP domain.

[0055] In some embodiments, the ZFP-TFs repress transcription of the human mutant C9orf72 gene by 45% or more (e.g., 50%, 60%, 70%, 80%, 90% or 95% or more). In some embodiments, two or more of the ZFP-TFs are used simultaneously in a patient, where the ZFP-TFs bind to different DNA motifs in the sense and / or antisense strands of the expanded C9orf72 region to achieve optimal repression of mutant C9orf72 transcription.

[0056] A. Targeting of ZFP Domains The ZFP domain of the fusion protein preferentially binds to the expanded region in the mutant human C9orf72 gene allele. The human C9orf72 gene is located at position 21.2 of the short (p) arm of chromosome 9 (9p21.2). It spans base pairs 27,546,546 to 27,573,866 on the chromosome. The genomic structure of human C9orf72 is shown in Figure 1A. The DNA-binding ZFP domain of the ZFP-TF targets the fusion protein to the expanded repeat region of the mutant C9orf72 gene, bringing the transcriptional repressor domain of the fusion protein to the target region. The repressor domain then represses C9orf72 gene transcription by RNA polymerase.

[0057] In some embodiments, the target sequence in the expanded region is at least 8 bp in length. For example, the target sequence can be 8 bp to 40 bp in length, for example, 12, 15, 16, 17, 18, 19, 20, 21, 24, 27, 30, 33, or 36 bp in length. In certain embodiments, the target sequence of the ZFP-TF is 12 to 20 (e.g., 12 to 18, 15 to 19, 15, 18, or 19) bp in length. In some embodiments, the target sequence includes a non-contiguous subsequence.

[0058] The G4C2 repeat gives rise to the following hexanucleotide DNA motif in the sense and antisense strands of the gene: Motifs in the sense C9orf72 strand: (i) GGGGCC (SEQ ID NO: 1) (ii) GGGCCG (SEQ ID NO: 2) (iii) GGCCGG (SEQ ID NO: 3) (iv) GCCGGG (SEQ ID NO: 4) (v) CCGGGG (SEQ ID NO: 5) (vi) CGGGGC (SEQ ID NO: 6)

[0059] Motif in the antisense C9orf72 strand: (vii) GGCCCC (SEQ ID NO: 7) (viii) GCCCCG (SEQ ID NO: 8) (ix) CCCCGG (SEQ ID NO: 9) (x) CCCGGC (SEQ ID NO: 10) (xi) CCGGCC (SEQ ID NO: 11) (xii) CGGCCC (SEQ ID NO: 12)

[0060] In some embodiments, the target sequence of the ZFP-TF comprises one or more (e.g., 2, 3, or 4) tandem repeats of these DNA motifs. In some embodiments, the target sequence consists of three tandem repeats of one of the motifs. In some embodiments, the target sequence comprises one or more (e.g., 2 or 3) tandem repeats of the motif and a small number (e.g., 1, 2, 3, 4, or 5) of nucleotides (e.g., CC(G4C2)2GG) (SEQ ID NO: 75) from the upstream and / or downstream flanking sequence.

[0061] Target sequence may be on the sense strand of gene or on the antisense strand of gene.In certain embodiments, the ZFP-TF used in patient binds to both the sense and antisense strands of mutant allele.To ensure the accuracy of targeting, in order to reduce off-target binding by ZFP-TF, the sequence of selected C9orf72 target region preferably has less than 75% homology (for example, less than 70%, less than 65%, less than 60% or less than 50% homology) with the sequence in other genes in genome.

[0062] Other criteria for further evaluating target segments include the previous availability of ZFPs binding to such segments or related segments, the ease of designing new ZFPs that bind to a given target segment, and the risk of off-target binding.

[0063] B. Zinc finger protein domains "Zinc finger protein" or "ZFP" refers to a protein having a DNA binding domain stabilized by zinc. ZFPs bind to DNA in a sequence-specific manner. Each DNA binding domain is called a "finger." ZFPs have at least one finger, and each finger binds 2-4 base pairs of DNA, usually 3 or 4 base pairs of DNA. Each zinc finger usually contains approximately 30 amino acids and chelates zinc. Engineered ZFPs can have novel binding specificities compared to naturally occurring zinc finger proteins. Genetic engineering methods include, but are not limited to, rational design and various types of selection. Rational design includes, for example, using a database containing triplet (or quadruplet) nucleotide sequences and individual zinc finger amino acid sequences, where each triplet or quadruplet nucleotide sequence is associated with one or more amino acid sequences of zinc fingers that bind to a particular triplet or quadruplet sequence. See, for example, U.S. Patent Nos. 5,789,538, 5,925,523, 6,007,988, 6,013,453, 6,140,081, 6,200,759, 6,453,242, 6,534,261, 6,979,539, 8,586,526, 8,841,260, 8,956,828, and 9,234,016, and International Patent Nos. 5,821,522, 5,821,522, and 5,921,522. See the ZFP design methods described in detail in patent publications WO95 / 19431, WO96 / 06166, WO98 / 53057, WO98 / 53058, WO98 / 53059, WO98 / 53060, WO98 / 54311, WO00 / 27878, WO01 / 60970, WO01 / 88197, WO02 / 016536, WO02 / 099084 and WO03 / 016496.

[0064] The ZFP domain of the ZFP-TF can include at least three (e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or more) zinc fingers. A ZFP domain with three fingers typically recognizes a target site that contains 9-12 nucleotides. A ZFP domain with four fingers typically recognizes a target site that contains 12-15 nucleotides. A ZFP domain with five fingers typically recognizes a target site that contains 15-18 nucleotides. A ZFP domain with six fingers can recognize a target site that contains 18-21 nucleotides.

[0065] The target specificity of the ZFP domain can be improved by mutations to the ZFP backbone, for example, as described in US Patent Publication No. 2018 / 0087072. Mutations include those made to residues in the ZFP backbone that can nonspecifically interact with phosphates on the DNA backbone but are not involved in nucleotide target specificity. In some embodiments, the mutations include mutating cationic amino acid residues to neutral or anionic amino acid residues. In some embodiments, the mutations include mutating polar amino acid residues to neutral or nonpolar amino acid residues. In further embodiments, the mutations are made at the (-5), (-9) and / or (-14) positions relative to the DNA binding helix. In some embodiments, the zinc fingers can include one or more mutations at the (-5), (-9) and / or (-14) positions. In further embodiments, one or more zinc fingers in a multi-finger ZFP domain can include mutations at the (-5), (-9) and / or (-14) positions. In some embodiments, the amino acid at position (-5), (-9), and / or (-14) (e.g., arginine (R) or lysine (K)) is mutated to alanine (A), leucine (L), Ser (S), Asp (N), Glu (E), Tyr (Y), and / or glutamine (Q). In some embodiments, the R residue at position (-5) is mutated to Q.

[0066] Alternatively, the DNA binding domain can be derived from a nuclease, for example, the recognition sequences of homing endonucleases and meganucleases, such as I-SceI, I-CeuI, PI-PspI, PI-Sce, I-SceIV, I-CsmI, I-PanI, I-SceII, I-PpoI, I-SceIII, I-CreI, I-TevI, I-TevII, and I-TevIII, are known. See also U.S. Patent Nos. 5,420,032 and 6,833,252; Belfort et al., Nucleic Acids Res. (1997) 25:3379-88; Dujon et al., Gene (1989) 82:115-8; Perler et al., Nucleic Acids Res. (1994) 22:1125-7; Jasin, Trends Genet. (1996) 12:224-8; Gimble et al., J. Mol Biol. (1996) 263:163-80; Argast et al., J. Mol Biol. (1998) 280:345-53; and the New England Biolabs catalog.

[0067] In some embodiments, the ZFP-TF comprises one or more zinc finger domains. The domains may be linked together via an expandable flexible linker, such that, for example, one domain comprises one or more (e.g., 4, 5 or 6) zinc fingers and another domain comprises an additional one or more (e.g., 4, 5 or 6) zinc fingers. In some embodiments, the linker is a standard inter-finger linker, such that the finger array comprises one DNA binding domain comprising 8, 9, 10, 11 or 12 or more fingers. In other embodiments, the linker is an atypical linker, such as a flexible linker. For example, two ZFP domains may be linked to a transcriptional repressor TF in the following configuration (N-terminus to C-terminus): ZFP-ZFP-TF, TF-ZFP-ZFP, ZFP-TF-ZFP or ZFP-TF-ZFP-TF (two ZFP-TF fusion proteins are fused together via a linker).

[0068] In some embodiments, ZFP-TFs are "ambidextrous", i.e., they contain two zinc finger clusters (two ZFP domains) separated by an intervening amino acid, such that the two ZFP domains bind to two discontinuous target sites. An example of an ambidextrous zinc finger binding protein is SIP1, in which a cluster of four zinc fingers is located at the amino terminus of the protein and a cluster of three fingers is located at the carboxyl terminus [see Remacle et al., EMBO J. (1999) 18(18):5073-84]. Each cluster of zinc fingers in these proteins can bind to a unique target sequence, and the space between the two target sequences can include many nucleotides.

[0069] In alternative embodiments, proteins similar in function to ZFP-TFs can be used in place of ZFP-TFs. For example, instead of a ZFP domain, a transcriptional repressor fusion protein can contain a DNA-binding domain derived from a transcription activator-like effector (TALE) DNA-binding domain. See, for example, U.S. Patent Nos. 8,586,526 and 9,458,205, U.S. Patent Publication Nos. 2013 / 0196373 and 2013 / 0253040, WO2010 / 079430, Schornack et al., J Plant Physiol (2006) 163(3):256-72), Kay et al., Science (2007) 318:648-51, Moscou and Bogdanove, Science (2009) 326:1501, and Boch et al., Science (2009) 326:1509-12. In yet another example, the transcriptional repressor fusion protein can include a DNA binding domain that is a single guide RNA of the CRISPR / Cas system. See, e.g., U.S. Patent Publication No. 2015 / 0056705; Jinek et al., Science (2012) 337:816; Ramalingam et al., Genome Biol. (2013) 14:107; Hwang et al., (2013) Nature Biotechnology 31(3):227.

[0070] C. Transcriptional repressor domain The ZFP-TF comprises one or more transcriptional repressor domains that attenuate the transcriptional activity of mutant C9orf72 alleles.Non-limiting examples of transcriptional repressor domains include the KRAB domain of KOX1, KAP-1, MAD, FKHR, EGR-1, ERD, SID, TGF-beta inducible early gene (TIEG), v-ERB-A, MBD2, MBD3, DNMT family members (e.g., DNMT1, DNMT3A, DNMT3B), Rb and MeCP2.See, for example, Bird et al., Cell (1999) 99:451-54; Tyler et al., Cell (1999) 99:443-46; Knoepfler et al., Cell (1999) 99:447-50; and Robertson et al., Nature Genet. (2000) 25:338-42. Further exemplary repression domains include, but are not limited to, ROM2 and AtHD2A. See, e.g., Chem et al., Plant Cell (1996) 8:305-21; and Wu et al., Plant J. (2000) 22:19-27.

[0071] In some embodiments, the transcriptional repressor domain comprises a sequence derived from the Krüppel-associated box (KRAB) domain of human zinc finger protein 10 / KOX1 (ZNF10 / KOX1) (e.g., GenBank No. NM_015394.4). An exemplary KRAB domain sequence is: DAKSLTAWSR TLVTFKDVFV DFTREEWKLL DTAQQIVYRN VMLENYKNLV SLGYQLTKPD VILRLEKGEE PWLVEREIHQ ETHPDSETAF EIKSSV (SEQ ID NO: 13)

[0072] Variants of this KRAB sequence may also be used so long as they have the same or similar transcriptional repressor function.

[0073] D. Peptide Linker The ZFP domain and transcriptional repressor domain of the ZFP-TF and / or zinc fingers within the ZFP domain can be linked via a peptide linker, for example, a non-cleavable peptide linker of about 5 to 200 amino acids (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more amino acids). Some preferred linkers are flexible amino acid sequences that are synthesized as recombinant fusion proteins. See, for example, the above description and U.S. Patent Nos. 6,479,626, 6,903,185, 7,153,949, 8,772,453 and 9,163,245, and WO2011 / 139349. The proteins described herein can include any combination of suitable linkers. Non-limiting examples of linkers include DGGGS (SEQ ID NO:14), TGEKP (SEQ ID NO:15), LRQKDGERP (SEQ ID NO:16), GGRR (SEQ ID NO:17), GGRRGGGS (SEQ ID NO:18), LQRDGERP (SEQ ID NO:19), LRQKDGGGSERP (SEQ ID NO:20), LRQKD(G3S)2ERP (SEQ ID NO:21), TGSQKP (SEQ ID NO:22), LRQKDAARGS (SEQ ID NO:26), and LRQKDAARGSGG (SEQ ID NO:76).

[0074] In some embodiments, the peptide linker is 3-20 amino acid residues in length and is rich in G and / or S. Non-limiting examples of such linkers include G4S-type linkers ("G4S" disclosed as SEQ ID NO:23), i.e., linkers containing one or more (e.g., 2, 3, or 4) GGGGS (SEQ ID NO:23) motifs or variations of the motif (e.g., having one, two, or three amino acid insertions, deletions, and substitutions in the motif).

[0075] In some embodiments, the ZFP-TF comprises a nuclear localization signal (eg, from the SV40 middle T antigen) and / or an epitope tag (eg, FLAG and hemagglutinin).

[0076] II. Expression of ZFP-TFs The ZFP-TF of the present disclosure can be introduced into a patient by a nucleic acid molecule that encodes it. For example, the nucleic acid molecule is an RNA molecule, and the RNA molecule is introduced into the patient's brain by injection of a composition that includes a lipid:nucleic acid complex (e.g., a liposome). Alternatively, the ZFP-TF can be introduced into a patient by a nucleic acid expression vector that includes a coding sequence of the ZFP-TF. The expression vector can include expression control sequences, such as promoters, enhancers, transcription signal sequences, and transcription termination sequences, that allow expression of the coding sequence of the ZFP-TF in cells of the nervous system (e.g., the central nervous system). In some embodiments, the expression vector remains present in the cell as a stable episome. In other embodiments, the expression vector is integrated into the genome of the cell.

[0077] In some embodiments, the promoter on the vector for directing ZFP-TF expression in the brain is a constitutively active promoter or an inducible promoter. Suitable promoters include, but are not limited to, Rous sarcoma virus (RSV) long terminal repeat (LTR) promoter (with or without RSV enhancer), cytomegalovirus (CMV) promoter (with or without CMV enhancer), CMV immediate early promoter, simian virus 40 (SV40) promoter, dihydrofolate reductase (DHFR) promoter, β-actin promoter, phosphoglycerate kinase (PGK) promoter, EFlα promoter, Moloney murine leukemia virus (MoMLV) LTR. , creatine kinase-based (CK6) promoter, transthyretin promoter (TTR), thymidine kinase (TK) promoter, tetracycline-responsive promoter (TRE), hepatitis B virus (HBV) promoter, human α1-antitrypsin (hAAT) promoter, chimeric liver-specific promoter (LSP), E2 factor (E2F) promoter, human telomerase reverse transcriptase (hTERT) promoter, CMV enhancer / chicken β-actin / rabbit β-globin promoter (CAG promoter; Niwa et al., Gene (1991) 108(2):193-9) and RU-486-responsive promoter. Neuron-specific promoters, such as synapsin I promoter, calcium / calmodulin-dependent protein kinase II (CamKII) promoter, methyl CpG-binding protein 2 (MeCP2) promoter, choline acetyltransferase (ChAT) promoter and calbindin (Calb) promoter, may also be used. Astrocyte-specific promoters, such as the glial fibrillary acidic protein (GFAP) promoter or the aldehyde dehydrogenase 1 family, member L1 (Aldh1L1) promoter, can also be used. Oligodendrocyte-specific promoters, such as the Olig2 promoter, can also be used.In addition, a promoter can contain one or more autoregulatory elements by which a ZFP-TF can bind and repress its expression level to a preset threshold, see U.S. Patent No. 9,624,498.

[0078] Any method of introducing a nucleotide sequence into a cell may be used, including, but not limited to, electroporation, calcium phosphate precipitation, microinjection, cationic or anionic liposomes, liposomes combined with nuclear localization signals, naturally occurring liposomes (e.g., exosomes) or viral transduction.

[0079] For in vivo delivery of expression vector, viral transduction can be used.Various viral vectors known in the art can be adapted for use in the present disclosure, such as vaccinia vector, adenovirus vector, lentivirus vector, poxvirus vector, herpesvirus vector, adeno-associated virus (AAV) vector, retrovirus vector and hybrid virus vector.In some embodiments, the viral vector used herein is a recombinant AAV (rAAV) vector.AAV vector is particularly suitable for central nervous system (CNS) gene delivery, since AAV infects both dividing and non-dividing cells, has extremely low immunogenicity, and the viral genome exists as a stable episomal structure for long-term expression (Hadaczek et al., Mol Ther. (2010) 18:1458-61; Zaiss, et al., Gene Ther. (2008) 15:808-16).Any suitable AAV serotype can be used. For example, the AAV can be AAV1, AAV2, AAV3, AAV3b, AAV4, AAV5, AAV6, AAV7, AAV8, AAV8.2, AAV9 or AAVrhlO, or pseudotyped (e.g., AAV2 / 8, AAV2 / 5, AAV2 / 6, AAV2 / 9 or AAV2 / 6 / 9). See, e.g., U.S. Patent Nos. 7,198,951 and 9,585,971.

[0080] In some embodiments, the expression vector is an AAV vector, and the recombinant AAV virion is introduced into the target human cell by the construct, which includes a construct whose genome comprises an AAV inverted terminal repeat (ITR) sequence at both ends to allow the production of AAV virions in a production system, such as an insect cell / baculovirus production system or a mammalian cell production system. AAV can be genetically engineered so that its capsid protein has reduced immunogenicity or enhanced transduction ability in humans. In some embodiments, AAV9 is used. The viral vectors described herein can be produced using methods known in the art. Any suitable permissive or packaging cell type can be used to produce viral particles. For example, mammalian (e.g., 293) or insect (e.g., Sf9) cells can be used as packaging cell lines.

[0081] Methods for expressing therapeutic proteins, including ZFPs, in the nervous system of a patient in need thereof are described in U.S. Patent Nos. 6,309,634, 6,453,242, 6,503,717, 6,534,261, 6,599,692, 6,607,882, 6,689,558, 6,824,9 See also Nos. 78, 6,933,113, 6,953,575, 6,979,539, 7,013,219, 7,163,824, 7,182,944, 8,309,355, 8,337,458, 8,586,526, 9,050,299 and 9,089,667.

[0082] III.Medicinal Applications The ZFP-TF can be used to treat patients who need downregulation of C9orf72 expression, particularly downregulation of mutant C9orf72 allele expression. The patient suffers from or is at risk of developing C9orf72-related neurodegenerative diseases, such as ALS and C9FTD. Patients at risk include those who are genetically predisposed, have suffered repeated brain injuries, such as concussions, and have been exposed to environmental neurotoxins. The present disclosure provides a method of treating C9orf72-related neurological diseases (e.g., ALS and C9FTD) in a subject, such as a human patient, in need thereof, comprising introducing a therapeutically effective amount (e.g., an amount that allows sufficient suppression of mutant C9orf72 allele expression) of ZFP-TF (e.g., an rAAV vector expressing it) into the nervous system (e.g., CNS) of the subject. The term "treat" includes alleviating symptoms, preventing the onset of symptoms, slowing down disease progression, improving quality of life, and increasing survival.

[0083] The present disclosure provides a pharmaceutical composition comprising a viral vector, e.g., rAAV, whose recombinant genome comprises an expression cassette of ZFP-TF. The pharmaceutical composition may further comprise a pharmaceutically acceptable carrier, e.g., water, saline (e.g., phosphate-buffered saline), dextrose, glycerol, sucrose, lactose, gelatin, dextran, albumin or pectin. In addition, the composition may contain auxiliary substances, e.g., wetting or emulsifying agents, pH buffering agents, antidegradants or other agents that enhance the effectiveness of the pharmaceutical composition. The pharmaceutical composition may contain a delivery vehicle, e.g., liposomes, nanocapsules, microparticles, microspheres, lipid particles and vesicles.

[0084] The cells targeted by the therapeutic agents of the present disclosure are cells in the brain and / or spinal cord, including, but not limited to, neuronal cells (e.g., motor neurons, sensory neurons, dopamine neurons, cholinergic neurons, glutamatergic neurons, GABAergic neurons, or serotonergic neurons), glial cells (e.g., oligodendrocytes, astrocytes, pericytes, Schwann cells, or microglial cells), ependymal cells, or neuroepithelial cells. The brain regions targeted can be cortical regions, frontotemporal regions, entorhinal cortex, hippocampus, cerebellum, pons, and medulla. These regions can be reached directly by intrahippocampal, intracerebral, intracisternal (ICM) injection, or more commonly by intraparenchymal, intracerebroventricular (ICV), intrathecal, or intravenous injection. Other routes of administration include, but are not limited to, intracerebral, intracerebroventricular, intranasal, or intraocular administration. In some embodiments, the viral vector spreads into CNS tissue after direct administration into cerebrospinal fluid (CSF), for example, by intrathecal and / or intracerebral injection, or intracisternal or intraventricular injection. In other embodiments, the viral vector crosses the blood-brain barrier after intravenous administration and achieves widespread distribution throughout the CNS tissue of the subject. In other embodiments, the viral vector is delivered directly to the target region by intraparenchymal injection. In some cases, the viral vector may undergo retrograde or anterograde transport to other brain regions after intraparenchymal delivery. In some aspects, the viral vector has separate CNS tissue targeting ability (e.g., CNS tissue tropism), which allows stable and non-toxic gene transfer to be achieved with high efficiency.

[0085] For example, the pharmaceutical composition can be provided to a patient via intraventricular administration, for example, in the ventricular region of the patient's forebrain, for example, the right lateral ventricle, the left lateral ventricle, the third ventricle or the fourth ventricle.The pharmaceutical composition can be provided to a patient via intracerebral administration, for example, injection of the composition into or near the cerebrum, medulla, pons, cerebellum, intracranial cavity, meninges, dura mater, arachnoid mater or pia mater of the brain.Intracerebral administration can, in some cases, include administration of the drug to the cerebrospinal fluid (CSF) of the subarachnoid space surrounding the brain.

[0086] In some cases, intracerebral administration includes injection using stereotaxic procedures. Stereotaxic procedures are well known in the art and usually include the use of a computer and a three-dimensional scanning device that are used together to guide the injection to a specific intracerebral region, such as the ventricular region. A microinjection pump (e.g., from World Precision Instruments) can also be used. In some cases, a microinjection pump is used to deliver the composition containing the viral vector. In some cases, the injection rate of the composition is in the range of 1 μl / min to 100 μl / min. As will be understood by those skilled in the art, the injection rate will vary depending on various factors, including, for example, the age of the subject, the weight / size of the subject, the serotype of AAV, the required dosage, and the intracerebral region to be targeted. Thus, other injection rates may be considered appropriate in certain circumstances by those skilled in the art.

[0087] Delivery of rAAV to a subject can be achieved, for example, by intravenous administration. In certain instances, it may be desirable to deliver rAAV locally to brain tissue, spinal cord, cerebrospinal fluid (CSF), neurons, glial cells, meninges, astrocytes, oligodendrocytes, interstitial spaces, and the like. In some cases, recombinant AAV (e.g., 7 ~10 15 AAV can be delivered directly to the CNS by injection into the ventricular region and / or into the hippocampus, cortex, cerebellar lobule or other brain regions. AAV can be delivered using a needle, catheter or related device, for example, by stereotaxic injection, using neurosurgical techniques known in the art. See, for example, Stein et al., J Vir. (1999) 73:3424-9; Davidson et al., PNAS. (2000) 97:3428-32; Davidson et al., Nat Genet. (1993) 3:219-223; and Alisky and Davidson, Hum. Gene Ther. (2000) 11:2315-29; U.S. Patent Nos. 7,837,668 and 8,092,429.

[0088] Unless otherwise defined herein, scientific and technical terms used in connection with this disclosure shall have the meanings commonly understood by those skilled in the art. Exemplary methods and materials are described below, but methods and materials similar or equivalent to those described herein may also be used in carrying out or testing this disclosure. In case of conflict, the present specification, including definitions, shall control. In general, the nomenclature and techniques used in connection with neurology, medicine, medicinal and pharmaceutical chemistry, and cell biology described herein are well known and commonly used in the art. Enzymatic reactions and purification techniques are performed according to manufacturer's specifications as commonly accomplished in the art or as described herein. Furthermore, unless otherwise required by context, singular terms shall include plurals, and plural terms shall include the singular. Throughout this specification and the embodiments, the words "have" and "comprise" or variations such as "has", "having", "comprises" or "comprising" will be understood to imply the inclusion of the stated integer or group of integers, but not any other integer or group of integers. All publications and other references mentioned herein are incorporated by reference in their entirety. Although several documents are cited herein, this citation does not constitute an admission that any of these documents form part of the common general knowledge in the art. As used herein, the term "approximately" or "about" as applied to one or more values ​​of interest refers to a value that is similar to the stated reference value. In certain embodiments, the term refers to a range of values ​​that falls within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less in either direction (greater or less) of the stated reference value, unless otherwise stated or otherwise clear from the context.

[0089] In order that the present invention may be better understood, the following embodiments and examples are given, which are merely for illustrative purposes and should not be construed as limiting the scope of the present invention in any way.

[0090] IV. Illustrative Embodiments Non-limiting embodiments of the present disclosure are described below. 1. A method of suppressing sense and / or antisense transcription of the C9orf72 gene in a cell, comprising treating the cell with one or more repressors of the C9orf72 gene, one or more repressors comprising a transcriptional repression domain and a DNA binding domain that binds to a target site in the C9orf72 gene, wherein the one or more repressors may comprise one or more zinc finger protein transcription factors (ZFP-TFs), one or more TAL-effector domain transcription factors (TALE-TFs), and / or one or more CRISPR / Cas transcription factors. 2. The method of claim 1, wherein the C9orf72 gene comprises a mutant allele comprising one or more expanded (G4C2) repeats, and the target site may be within the one or more (G4C2) repeats. 3. Use of one or more ZFP-TFs, TALE-TFs and / or CRISPR / Cas TF repressors that bind to mutant C9orf72 expanded alleles containing one or more (G4C2) repeats for the suppression of sense and / or antisense transcription in a subject in need thereof. 4. The method or use of any of the previous embodiments, wherein antisense transcription is suppressed by at least 50% compared to untreated cells. 5. The method or use of any of the previous embodiments, wherein antisense transcription is suppressed by at least 70% compared to untreated cells. 6. The method or use of any of the previous embodiments, wherein transcripts containing the expanded repeat are selectively suppressed, antisense transcription may be suppressed, sense transcription from the 1a promoter may be suppressed, and / or sense transcription from the 1b promoter may not be suppressed. 7. The method or use of any of the previous embodiments, wherein the one or more ZFP-TF repressors comprise a ZFP having recognition helix regions in the order shown in Table 1. 8. The method or use of any of the previous embodiments, wherein the one or more ZFP-TF repressors are administered to the cell as mRNA or using a viral vector. 9. The method or use of embodiment 8, wherein the viral vector is an Ad or AAV vector. 10. The method or use of embodiment 9, wherein the AAV vector is an AAV2 / 9 vector. 11. The method or use of any of the previous embodiments, wherein the cell is in a living subject and the one or more ZFP-TF repressors are administered to the subject. 12. The method or use of embodiment 11, wherein the one or more ZFP-TF repressors are administered to the subject intracerebroventricularly, intrathecally, intracranially, retro-orbitally (RO), intravenously, intranasally and / or intracisternally. 13. The method or use of embodiment 12, wherein the ZFP-TF repressor may be an AAV vector at a dose of 1E10 to 1E13 (e.g., 6E11) vg / hemisphere, administered unilaterally or bilaterally to the subject's hippocampus. 14. The method or use of any of the previous embodiments, wherein the cell is a neuron. 15. The method or use of any of the previous embodiments, wherein two or more ZFP-TF repressors are administered. 16. The method or use of embodiment 15, wherein the two or more ZFP-TF repressors are carried in the same or different non-viral or viral vectors. 17. The method or use of any of the previous embodiments, wherein ALS and / or FTD is treated in a subject. 18. The method or use of any of the previous embodiments, wherein one or more symptoms of ALS and / or FTD are ameliorated in the subject. 19. A ZFP-TF fusion protein that binds to a target sequence and contains a zinc finger that corresponds to an SBS number as shown in Table 1, wherein the zinc finger contains a DNA-binding (recognition) helix sequence shown in a single row of Table 1 for SBS numbers, and the SBS number is 78021. 20. A ZFP-TF fusion protein that binds to a target sequence and contains a zinc finger that corresponds to an SBS number as shown in Table 1, wherein the zinc finger contains a DNA-binding (recognition) helix sequence shown in a single row of Table 1 for SBS numbers, and the SBS number is 75114. 21. A ZFP-TF fusion protein that binds to a target sequence and contains a zinc finger corresponding to an SBS number as shown in Table 1, wherein the zinc finger contains a DNA-binding (recognition) helix sequence shown in a single row of Table 1 for SBS numbers, and the SBS number is 75115. 22. A ZFP-TF fusion protein that binds to a target sequence and contains a zinc finger that corresponds to an SBS number as shown in Table 1, wherein the zinc finger contains a DNA-binding (recognition) helix sequence shown in a single row of Table 1 for SBS numbers, and the SBS number is 74969. 23. A ZFP-TF fusion protein that binds to a target sequence and contains a zinc finger corresponding to an SBS number as shown in Table 1, wherein the zinc finger contains a DNA-binding (recognition) helix sequence shown in a single row of Table 1 for SBS numbers, and the SBS number is 79895. 24. A ZFP-TF fusion protein that binds to a target sequence and contains a zinc finger corresponding to an SBS number as shown in Table 1, wherein the zinc finger contains a DNA-binding (recognition) helix sequence shown in a single row of Table 1 for SBS numbers, and the SBS number is 79898. 25. A ZFP-TF fusion protein that binds to a target sequence and contains a zinc finger that corresponds to an SBS number as shown in Table 1, wherein the zinc finger contains a DNA-binding (recognition) helix sequence shown in a single row of Table 1 for SBS numbers, and the SBS number is 74986. 26. A ZFP-TF fusion protein that binds to a target sequence and contains a zinc finger corresponding to an SBS number as shown in Table 1, wherein the zinc finger contains a DNA-binding (recognition) helix sequence shown in a single row of Table 1 for SBS numbers, and the SBS number is 79899. 27. A ZFP-TF fusion protein that binds to a target sequence and contains a zinc finger corresponding to an SBS number as shown in Table 1, wherein the zinc finger contains a DNA-binding (recognition) helix sequence shown in a single row of Table 1 for SBS numbers, and the SBS number is 79901. 28. A ZFP-TF fusion protein that binds to a target sequence and contains a zinc finger that corresponds to an SBS number as shown in Table 1, wherein the zinc finger contains a DNA-binding (recognition) helix sequence shown in a single row of Table 1 for SBS numbers, and the SBS number is 79902. 29. A ZFP-TF fusion protein that binds to a target sequence and contains a zinc finger that corresponds to an SBS number as shown in Table 1, wherein the zinc finger contains a DNA-binding (recognition) helix sequence shown in a single row of Table 1 for SBS numbers, and the SBS number is 79904. 30. A ZFP-TF fusion protein that binds to a target sequence and contains a zinc finger corresponding to an SBS number as shown in Table 1, wherein the zinc finger contains a DNA-binding (recognition) helix sequence shown in a single row of Table 1 for SBS numbers, and the SBS number is 79916. 31. A ZFP-TF fusion protein that binds to a target sequence and contains a zinc finger that corresponds to an SBS number as shown in Table 1, wherein the zinc finger contains a DNA-binding (recognition) helix sequence shown in a single row of Table 1 for SBS numbers, and the SBS number is 75027. 32. A ZFP-TF fusion protein that binds to a target sequence and contains a zinc finger that corresponds to an SBS number as shown in Table 1, wherein the zinc finger contains a DNA-binding (recognition) helix sequence shown in a single row of Table 1 for SBS numbers, and the SBS number is 79921. 33. The ZFP-TF fusion protein of any one of embodiments 19-32, wherein the ZFP-TF fusion protein comprises a transcriptional repressor domain comprising SEQ ID NO:13. 34. The ZFP-TF fusion protein of any one of embodiments 19-33, wherein the zinc finger domain and the transcriptional repressor domain are linked by a peptide linker comprising SEQ ID NO:26. EXAMPLES

[0091] [Example 1] Artificial transcriptional repressors A panel of ZFP-TFs was created to target the expanded human C9orf72 allele. Exemplary ZFP-TFs are shown in Table 1 below. These ZFP-TFs each contained a six-finger ZFP domain and a KRAB domain (SEQ ID NO: 13) as described above. A peptide linker was used to link the ZFP domain to the KRAB domain. The linker had the following amino acid sequence: LRQKDAARGS (SEQ ID NO: 26).

[0092] Table 1 shows the DNA sequence of the target site in each ZFP-TF and the amino acid sequence of the DNA-binding helix of each zinc finger (F1-F6). SEQ ID NO: is shown in parentheses. The target sequence bound by the ZFP domain in the target site is shown in uppercase letters, and the sequences flanking each are shown in lowercase letters. SEQ ID NO: 24 is the target site on the sense strand of the gene allele, and SEQ ID NO: 25 is the target site on the antisense strand of the gene allele.

[0093] The DNA-binding helix is ​​the variable part of the zinc finger and usually contains six or seven amino acid residues. The target specificity of the ZFP domain can be improved by mutations to the ZFP backbone, for example, as described in US Patent Publication No. 2018 / 0087072. The symbol "^" in the table indicates that the arginine (R) residue at the fourth position upstream of the first amino acid in the indicated helix is ​​changed to glutamine (Q). In each zinc finger helix sequence, the positions of the seven DNA-binding amino acids are numbered -1, +1, +2, +3, +4, +5 and +6. Thus, the position of the R to Q substitution is numbered (-5).

[0094] [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5]

[0095] The ZFP-TFs were evaluated by standard SELEX analysis (see, e.g., Miller et al., Nat Biotech. (2010) doi:10.1038 / nbt.1755; Wilen et al., PLoS (2011) 7(4):e1002020). All were shown to bind to their target sites.

[0096] Five human and one mouse cell line were used in the study. The C9021 fibroblast cell line was obtained from the ALS Institute at Columbia University and was derived from an ALS-FTD patient. It contained five G4C2 repeats on its normal allele and approximately 850 repeats on its expanded allele. The wild-type fibroblast cell line (NDS00035), 353TRAD and 204TDP fibroblast cell lines were obtained from the National Institute of Neurological Disorders and Stroke. The wild-type strain contains two G4C2 repeats on each allele. The 353TRAD strain contains five repeats on one allele and eight repeats on the other allele. The 204TDP has two repeats on one allele and 20 repeats on the other allele. For all fibroblast experiments, human neurons were obtained from Cell Dynamics International (iCell GABANeurons kit, 01434; Catalog No. R1013; Cell Lot No. 104901). Mouse cortical neurons were obtained from GIBCO (Cat. No. A15586). ZFP 74960, which binds to its target region but has no observable inhibitory effect, was used as a negative control.

[0097] For all experiments performed in patient-derived fibroblasts, transfection of ZFP-TF mRNA into cells was performed using a 96-well Shuttle Nucleofector system from Lonza. 1, 3, 10, 30, 100 and 300ng of ZFP-TF mRNA per 40,000 cells were transfected using the Amaxa P2 Primary Cells Nucleofector kit using the CA-137 program. After overnight incubation, cDNA was generated from the transfected cells using the Cells-to-Ct kit (Thermo Fisher Scientific) followed by gene expression analysis using qRT-PCR.

[0098] For neuronal transduction, ZFPs were made into AAV6 plasmids. Neurons were transduced with AAV6-ZFP. All transductions were performed at 3,000 MOI. Mouse neurons were harvested 7 days after transduction, while human neurons were harvested 19 days after transduction. After cells were harvested, they were processed for microarray analysis.

[0099] Screening analysis was performed in multiple rounds. In each round, ZFP was tested at multiple concentrations to identify ZFP-TFs with suitable on-target (selective repression) patterns. Round 2 of screening was performed in C9 (C9021) cells to evaluate the levels of expanded sense transcript (disease) C9orf72 versus total C9orf72 ("total C9") mature mRNA after ZFP-TF treatment. RT-PCR assay used a primer / probe set targeting intron region 1a. Expanded-sense C9orf72 transcript: Forward: 5' CCCTCTCTCCCCACTACTTG 3' (SEQ ID NO: 61) Reverse: 5' CTACAGGCTGCGGTTGTTTCC 3' (SEQ ID NO: 62) Probe: 5' TCTCACAGTACTCGCTGAGGGTGA 3' (SEQ ID NO: 63)

[0100] G4C2 expansions lead to inefficient splicing and accumulation of expansion-containing pre-mRNAs (Figure 2A). In contrast, efficiently spliced ​​wild-type (WT) pre-mRNAs are present at very low levels. By using this assay in C9021 cells, we showed that the tested ZFP-TFs exhibited widespread repression of expanded sense (disease) C9orf72 transcripts (Figure 2B-D).

[0101] To assess suppression of total C9orf72 mRNA, a different primer / probe set, denoted as “total C9” (Figure 2A), was used: Total C9orf72 mRNA: Forward: 5' CTATGTGTGTGGTGGGATATGG 3' (SEQ ID NO: 58) Reverse: 5' CTCCAGGTTATGTGAAGCAGAA 3' (SEQ ID NO:59) Probe: 5' AGGCCTGCTAAAGGATTCAACTGGAA 3' (SEQ ID NO: 60)

[0102] This primer / probe set was able to detect mRNAs containing the region spanning exons 8 and 9, which is present in all C9orf72 mRNA isoforms. As shown in Figure 2b, a number of ZFP-TFs showed moderate repression of total C9orf72 transcripts. For example, ZFP-TFs 75114 and 75115 repressed the expanded sense (disease) transcript by more than 70%, while preventing expression of total C9orf72 mRNA by more than 50% (Figure 2D, round 2 data).

[0103] In round 3, total C9orf72 mRNA was assessed and compared between C9021 and wild-type (WT) cells to further evaluate the effect of the tested ZFP-TFs on total C9orf72 mRNA levels. The data show that total C9orf72 mRNA levels in mutant cells were much more dramatically reduced than those in WT cells, and much less affected in wild-type cells treated with the same ZFP-TFs (Figure 2B-D). Overall the data illustrates that for some ZFPs, e.g., 75109, 75114 and 75115, the expanded isoforms were largely suppressed (~70%) in C9 patient fibroblast cell lines while maintaining ~50% of the total C9 transcripts.

[0104] Isoform-selective suppression of ZFP-TFs 75109, 75114 and 75115 was evaluated in fibroblasts derived from three different patients that contain different G4C2 expansion repeats (600, 800 and 850) on their expanded alleles (Figure 6). All three ZFPs showed similar behavior independent of repeat expansion length, illustrating that selective suppression of ZFP-TFs is independent of G4C2 repeat length.

[0105] Suppression of total C9 transcripts was evaluated in two cell lines derived from healthy individuals carrying a larger than normal G4C2 repeat number on their alleles (Figure 7). In the healthy cell lines, total C9 transcripts were only minimally affected. The PCR assay used to detect total C9 mRNA transcripts targets exons 8 and 9 present in both the expanded and unexpanded (WT) isoforms, so ZFP-mediated suppression of total C9 mRNA transcripts in the patient-derived cell line (C9021) is not truly representative of WT isoform levels (Figure 2A). Suppression of total C9 mRNA transcripts in response to isoform-selective ZFP-TFs (75109, 75114, and 75115) was evaluated in two different healthy lines carrying different G4C2 repeat lengths on their alleles (Figure 7). Cell line 353TREAD has 5 repeats on one allele and 8 repeats on the other allele, while cell line 204TDP has 2 repeats on one allele and 20 repeats on the other allele. In C9 line C921 (5 repeats on the unexpanded allele and 850 repeats on the expanded allele), total C9 mRNA transcripts were dose-dependently suppressed, but were only minimally affected in the two other cell lines that do not have the expanded allele, indicating that suppression of total C9 isoforms in disease line (5 / 850) was the result of suppression of the expanded isoform, and expression of the unexpanded isoform was not affected by the selective ZFP-TF (Figure 7).

[0106] Without wishing to be bound by theory, it is possible that the present ZFP-TFs may act cooperatively to selectively repress alleles with multiple repeats, which may be mediated by higher order complexes, for example, through recruitment of KAP1 corepressors that associate with the ZFP-linked KRAB domains. Under this hypothesis, a KAP1 / KRAB "scaffold" across multiple ZFP-TFs increases the stability of the transcriptional repression machinery, allowing preferential repression of expanded C9orf72 alleles over wild-type alleles. [Example 2]

[0107] Specificity of C9orf72 suppression The overall specificity of the ZFP-TFs shown in Table 1 was assessed by microarray analysis in three cell lines: C9021 fibroblasts, primary mouse cortical neurons and human neurons. For C9021 cells, briefly, 100 ng of mRNA encoding ZFP-TFs was transfected in quadruplicate into 150,000 C9021 cells. After 24 h, total RNA was extracted and processed by the manufacturer's protocol (Affymetrix Genechip MTA1.0). Robust multiarray average (RMA) was used to normalize the raw signal from each probe set. Analysis was performed using Transcriptome Analysis Console 3.0 (Affymetrix) with the "Gene-level differential expression analysis" option. ZFP-TF-transfected samples were compared to samples treated with an unrelated ZFP-TF (one that does not bind the C9orf72 target site). Change calls were reported for transcripts (probe sets) with >2-fold difference in mean signal versus control and P value <0.05 (one-way ANOVA analysis for each probe set, independent T-test).A similar procedure was also performed for neurons, except that they were transduced with AAV6 at an MOI of 3000 and cultured for 7 days for mouse neurons and 19 days for human neurons, and then harvested.

[0108] Exemplary data are shown in Figures 8A-8C. The data show that ZFP-TF75027 exhibited several off-targets in addition to C9orf72 (indicated by a circle) in both human and mouse fibroblasts and neurons, while ZFP-TF75109, 75114, and 75115 only repressed C9orf72 and had minimal off-targets. These results demonstrate that the representative ZFP-TFs are highly specific for C9orf72. [Example 3]

[0109] Detection of antisense-specific suppression Since the sense and antisense transcripts are encoded by overlapping regions of DNA, we developed a detection strategy based on differential processing of the transcripts. For the sense mRNA derived from the expanded allele, the intron containing the expanded region (intron 1a) is mis-spliced ​​and retained, while all other introns, including intron 1b, are removed. In contrast, the intron 1b region is a predicted exon in the antisense mRNA transcript and should be retained. Therefore, we designed and tested primers located within intron 1b and demonstrated specific detection of the antisense transcript as described further below.

[0110] To detect C9orf72 transcripts, we used droplet digital PCR (ddPCR). Briefly, to generate sense or antisense cDNA templates, RNA was purified from C9orf72 patient and healthy control cells (C9orf72 lines: C9-3, C9-6, C9-7, C9-5, C9-10, C9-11, C9-2, C9-4; control lines: KinALS6, Con3, Kin1ALS17, Con8, Con10, Con1; see Lagier-Tourenne et al., PNAS (2013) 110(47):E4530-9) and used to synthesize cDNA using the Superscript III (Thermo Fischer Scientific) first strand synthesis system as follows:

[0111] 1) 0.5 μg of RNA, 0.5 μL of 10 mM strand-specific primer and dNTP mix were mixed and made up to 10 μL with water. For the generation of the sense template, primer 5'CTCTAGCGACTGGTGGAATTG3' (SEQ ID NO: 64) was used. For the generation of the antisense template, primer 5'GTGCATGGCAACTGTTTGAATA3' (SEQ ID NO: 65) was used. 2) The reaction was incubated at 65° C. for 5 minutes for denaturation and placed on ice for at least 1 minute. 3) Prepare a cDNA synthesis mix using these reagents: 10x RT buffer (2 μL); 25 mM MgCl2 (4 μL); 0.1 M DTT (2 μL); RNase OUT (1 μL); Superscript III (1 μL). 4) 10 μL of this reaction was added to the RNA mix and incubated for 50 minutes at 50° C. The reaction was then inactivated by incubation at 85° C. for 5 minutes.

[0112] The templates were then subjected to ddPCR using the labeled probe according to the manufacturer's protocol. Briefly, PCR reactions were performed in ABI PCR 96-well plates using dUTP-free ddPCR Supermix for probes (Bio-Rad). PCR master mix was prepared according to the manufacturer's instructions. The antisense primer-probe set (Figure 3) located in the intron 1b region is shown below. Forward: 5' CAAAGCCTGGTGGTGTTCAA 3' (SEQ ID NO: 66) Reverse: 5' GGACATGACCTGGTTGCTTC 3' (SEQ ID NO: 67) Probe: 5' CGCGGCCAGATAGACCCAATGAGCA 3' (SEQ ID NO: 68)

[0113] The reactions were set up as follows: 1) The complete master mix was distributed evenly among the eight wells of an ABI PCR plate. 2) 10 μL of 1:10 diluted RT reaction or water was added to sample wells. 3) 15 μL of the master mix was transferred into the wells containing RT. 4) The plate was sealed, vortexed and spun down briefly.

[0114] To generate droplets, the cartridge was used as follows: 1) 70 μL of probe oil was placed in the oil well labeled on the cartridge and 20 μL of ddPCR reaction was placed in the sample well labeled. 2) A rubber gasket was placed on top of the cartridge. 3) A 40 μL drop was transferred to a new Eppendorf 96-well plate. The plate was sealed with aluminum foil and PCR was performed according to the manufacturer's protocol.

[0115] The data show that in the C9orf72 fibroblast cell line, these primers amplified an exon in the antisense expanded pre-mRNA (C9-AS) and the complementary region was not in the sense region (C9-S) (Figure 4A). Thus, the ddPCR antisense primers herein specifically detected the antisense pre-mRNA, which was clearly elevated in seven different C9 patient-derived fibroblasts compared to six different control fibroblasts (Figure 4B). [Example 4]

[0116] Expanded allelic sense and antisense pre-mRNA suppression To test activity of ZFP-TF repressors at expanded alleles, cells were treated with ZFP-TFs 74949, 74978, 75003, 75027, 75109, 75114, 75115, 74967 (Table 1) or 74960 (negative control) as described above. Two separate PCR assays were used to assess ZFP-TF-mediated repression by researchers blinded to the sample order. Each assay uses different primers / probes (Figure 5A-5C).

[0117] For runs #1 and #2, assays to measure extended sense, extended antisense and total C9 were performed as described above, except that amplification was performed using random hexamers according to standard protocols in the art and with the primers shown below: Antisense expanded C9orf72 pre-mRNA (Figure 5B): As shown in Example 3 above. Sense-expanded C9orf72 pre-mRNA (Figure 5A): This primer / probe set was able to detect mRNAs containing the region spanning exon 1a and intron 1a. Forward: 5' ACTACTTGCTCTCACAGTACTCG 3' (SEQ ID NO: 69) Reverse: 5' TAGCGCGCGACTCCTGAGTTCC 3' (SEQ ID NO: 70) Probe: 5' AGGGAAACAACCGCAGCCTGTAGCAAGCTC 3' (SEQ ID NO: 71) Total C9orf72 mRNA (Figure 5C): This primer / probe set was able to detect mRNA including the region within exon 2. Forward: 5' TGTGACAGTTGGAATGCAGTGA 3' (SEQ ID NO: 72) Reverse: 5' GCCACTTAAAGCAATCTCTGTCTTG 3' (SEQ ID NO: 73) Probe: 5' TCGACTCTTTGCCCACCGCCA 3' (SEQ ID NO: 74)

[0118] Run number 3 (Figures 5A and 5C) used the primers (Figures 2B-2D) shown above in Example 1. For the antisense disease transcript, the following primers / probe were used to detect intron region 1b (Figure 5B). Forward: 5' CAGCTTCGGTCAGAGAAATGAG 3' (SEQ ID NO: 78) Reverse: 5' AAGAGGCGCGGGTAGAA 3' (SEQ ID NO: 79) Probe: 5' CTCTCCTCAGAGCTCGACGCATTT 3' (SEQ ID NO: 80)

[0119] Despite the fact that different primer / probe sets and different PCR assays were used (runs 1 and 2 were performed with a similar but different assay than run 3), the data were consistent and the inhibition levels were comparable.

[0120] Taken together, all runs consistently demonstrated that some ZFP-TFs were able to potently repress all three transcripts (sense, antisense and total) (e.g., ZFP-TFs 74978, 75003 and 75027), whereas some ZFP-TFs (e.g., ZFP-TFs 75109, 75114 and 75115) selectively repressed sense and antisense disease transcripts (selective repression) while sparing total C9 transcripts. [Example 5]

[0121] Regulation of human C9orf72 in BAC C9orf72 transgenic mouse neurons All repressors targeting BAC mouse C9orf72 are cloned into rAAV6 vector using CMV promoter to drive expression. Recombinant AAV is produced in HEK293T cells, purified using CsCl density gradient, and titrated by real-time qPCR according to methods known in the art. Purified virus is used to infect cultured primary mouse cortical neurons with 3E5, 1E5, 3E4 and 1E4 Vg / cell. After 7 days, total RNA is extracted and RT-qPCR is used to monitor the expression of C9orf72 sense and antisense transcripts and two reference genes (e.g., Atp5b and Eif4a2).

[0122] All ZFP-TF-encoding AAV vectors efficiently silence their targets in mouse cells across a broad range of infection doses, with some ZFPs reducing targets by more than 95% at multiple doses. In contrast, no gene silencing is observed with CMV-GFP rAAV6 virus or mock-treated neurons tested at equivalent doses. [Example 6]

[0123] In vivo gene silencing driven by AAV-delivered ZFP-TFs The C9orf72 BAC transgenic mice used for the target engagement study contain a human transgene containing a 98 kb, full-length C9orf72 gene allele with approximately 500 G4C2 repeats and sequences flanking each end substantially (Liu et al., Neuron (2016) 90(3):521-34). Two ZFP-TFs with different potencies, ZFP-TF75027 or ZFP-TF75114 (ZFP-TF75027 is more potent; Figure 2D), were selected for this study. Both expression cassettes of the two fusion proteins were cloned into a rAAV vector containing a synapsin promoter to drive expression and a coding sequence for a self-cleavable peptide (e.g., 2A peptide, e.g., T2A or P2A) followed by a Venus tag to measure biodistribution (Figure 9, panel A). rAAV was produced in HEK293T cells and titered by ddPCR using primers on the ITRs.

[0124] To evaluate the effect of ZFP-TF expression on the suppression of sense and antisense transcripts containing expansions in vivo, ZFP-TF rAAV was delivered into P0 C9-BAC or WT mice by intracerebroventricular (ICV) injection. Briefly, vehicle (PBS) or ZFP-TF 75027 rAAV or ZFP-TF 75114 rAAV (total dose of 2E10 Vg per ventricle) was administered bilaterally (2 μl per ventricle) into neonatal C9-BAC mice (matched for repeat length) or WT mice ( FIG. 9 , panel C). Four weeks after injection, animals were sacrificed, one hemisphere was embedded for RNA focus analysis, and the other hemisphere was microdissected into cortex, hippocampus, and cerebellum for further analysis ( FIG. 9 , panel B). Quantification of the viral genome and Venus mRNA and protein demonstrated broad biodistribution with comparable transduction and expression of both ZFP-TF75027 and ZFP-TF75114.

[0125] Total RNA was extracted from cortical and hippocampal tissues and cDNA was generated using the iScript cDNA synthesis kit (BioRad). ddPCR was performed to measure the expression of transcripts containing the sense and antisense expansions as well as total C9 mRNA levels normalized to mouse TBP levels. The primers used in this assay were: Total C9 mRNA: Forward: 5'TGTGACAGTTGGAATGCAGTGA3' (SEQ ID NO: 72) Reverse: 5'GCCACTTAAAGCAATCTCTGTCTTG3' (SEQ ID NO: 73) Probe: 5'TCGACTCTTTGCCCACCGCCA3' (SEQ ID NO: 74) Sense expanded pre-mRNA: Forward: 5' ACTACTTGCTCTCACAGTACTCG 3' (SEQ ID NO: 69) Reverse: 5' TAGCGCGCGACTCCTGAGTTCC 3' (SEQ ID NO: 70) Probe: 5' AGGGAAACAACCGCAGCCTGTAGCAAGCTC 3' (SEQ ID NO: 71) Antisense expanded pre-mRNA: Forward: 5'AGTCGCTAGAGGCGAAAGC3' (SEQ ID NO: 81) Reverse: 5'CGAGTGGGTGAGTGAGGAG3' (SEQ ID NO: 82) Probe: 5'AAGAGGCGCGGGTAGAAGCGGGGGC3' (SEQ ID NO: 83)

[0126] The data show that ZFP-TF75027 suppressed the levels of total C9 mRNA, sense and antisense expansion-containing transcripts in the hippocampus and cortex of C9-BAC animals relative to PBS-injected controls (Figure 9, panel D). (Because the transgenic mice do not contain the WT human C9orf72 allele and the mouse C9orf72 gene does not contain G4C2 repeats, selective suppression could not be observed using this animal model). No suppression was observed with ZFP-TF75114.

[0127] Furthermore, fluorescent in situ hybridization was used to measure the levels of sense and antisense RNA aggregates (foci) found in the hippocampus after ZFP-TF injection (Figure 9, panel E). Briefly, 10 μm sections were hybridized with fluorophore-labeled probes: 5'GGCCCCGGCCCCGGCCCC-Cy3 (SEQ ID NO: 84) was used to measure sense RNA foci, and 5'GGGGCCGGGGCCGGGGCC-Cy3 (SEQ ID NO: 85) was used to measure antisense RNA foci. Stack images were acquired with a confocal microscope (LSM880) at 40x zoom. The number of sense and antisense RNA foci normalized to the total number of cells was quantified from the cornu ammonis (CA) region of the hippocampus. A smaller percentage of antisense RNA foci was observed in animals injected with ZFP-TF75027.

[0128] These results indicate that ZFP-TFs targeting C9orf72 can efficiently suppress expression of disease-causing C9orf72 alleles in vivo and that differences in the potency of ZFP-TFs can be observed.

Claims

1. A fusion protein comprising a zinc finger protein (ZFP) domain and a transcriptional repressor domain, wherein the ZFP domain binds to a target region in an intron segment between exons 1a and 1b on a mutant allele of the human C9orf72 gene, the target region comprising more than 30 Gp3 fragments. ４ C ２ A fusion protein comprising tandem repeats of (SEQ ID NO:1).

2. The fusion protein of claim 1 , which inhibits transcription of the repeat-containing mRNA from a mutant allele and does not inhibit transcription of wild-type mRNA from the gene.

3. 3. The fusion protein of claim 1 or 2, wherein the ZFP domain binds to a sense sequence in the target region, and the sense sequence comprises one to three tandem repeats of the hexanucleotides GGGGCC (SEQ ID NO:1), GGGCCG (SEQ ID NO:2), GGCCGG (SEQ ID NO:3), GCCGGG (SEQ ID NO:4), CCGGGG (SEQ ID NO:5) or CGGGGC (SEQ ID NO:6).

4. A fusion protein according to any one of claims 1 to 3, which inhibits sense transcription from a mutant C9orf72 allele in a human cell.

5. The fusion protein of claim 4, which represses sense transcription from the C9orf72 1a promoter but does not repress sense transcription from the C9orf72 1b promoter.

6. 3. The fusion protein of claim 1 or 2, wherein the ZFP domain binds to an antisense sequence in a target region, and the antisense sequence comprises one to three tandem repeats of the hexanucleotides GGCCCC (SEQ ID NO:7), GCCCCG (SEQ ID NO:8), CCCCGG (SEQ ID NO:9), CCCGGC (SEQ ID NO:10), CCGGCC (SEQ ID NO:11) or CGGCCC (SEQ ID NO:12).

7. A fusion protein according to any one of the preceding claims which inhibits antisense transcription from a mutant C9orf72 allele in human cells.

8. A fusion protein according to any one of the preceding claims which inhibits both sense and antisense transcription from mutant C9orf72 alleles in human cells.

9. 2. The fusion protein of any one of the preceding claims, which suppresses sense and / or antisense transcription from a mutant C9orf72 allele by at least about 30%, 40%, 75%, 90% or 95% and may not suppress sense transcription from the C9orf72 1b promoter.

10. The ZFP domain is Contains six zinc fingers Binds to a target sequence shown in Table 1, and / or A fusion protein described in any one of the preceding claims, comprising six zinc finger sequences of a ZFP transcription factor as shown in Table 1, and optionally comprising one or more mutations to residues outside the recognition helix region as shown in Table 1.

11. The fusion protein according to any one of the preceding claims, wherein the transcriptional repressor domain comprises a KRAB domain amino acid sequence from human KOX1.

12. The fusion protein of any one of the preceding claims, wherein the ZFP domain is linked to the transcriptional repressor domain via a peptide linker.

13. 13. A nucleic acid construct comprising a coding sequence for the fusion protein of any one of claims 1 to 12, wherein the coding sequence is operably linked to a transcriptional regulatory element.

14. 14. The nucleic acid construct of claim 13, wherein the transcriptional regulatory element is a mammalian promoter that is constitutively active or inducible in brain cells, and the promoter may be the human synapsin I promoter.

15. 15. The nucleic acid construct of claim 13 or 14, which is a viral construct, and which may be a recombinant adeno-associated viral construct.

16. A host cell comprising a nucleic acid construct according to any one of claims 13 to 15.

17. The host cell of claim 16 which is a human cell.

18. 18. The host cell of claim 17, wherein the human cell is a neuron or a pluripotent stem cell, and the stem cell may be an embryonic stem cell or an induced pluripotent stem cell (iPSC).

19. 16. A recombinant virus comprising the nucleic acid construct of claim 15, which may be a recombinant adeno-associated virus (rAAV).

20. 20. A pharmaceutical composition comprising a nucleic acid construct according to any one of claims 13 to 15 or a recombinant virus according to claim 19 and a pharma- ceutically acceptable carrier.

21. A method for inhibiting transcription of a mutant allele of the C9orf72 gene in a human cell, the mutant allele comprising an expanded G in the intron segment between exons 1a and 1b. ４ C ２ (SEQ ID NO: 1) repeat region, comprising introducing into a cell a fusion protein described in any one of claims 1 to 12, a nucleic acid construct described in any one of claims 13 to 15, a recombinant virus described in claim 19 or a pharmaceutical composition described in claim 20.

22. 22. The method of claim 21, wherein the human cell is a neuron, a glial cell, an ependymal cell or a neuroepithelial cell.

23. 23. The method of claim 21 or 22, wherein the cell is in the brain or spinal cord of a patient suffering from a C9orf72-associated disorder, which may be selected from amyotrophic lateral sclerosis (ALS) and C9 familial frontotemporal dementia (C9FTD).

24. 21. A method for treating a patient suffering from a C9orf72 associated disorder, which may be selected from amyotrophic lateral sclerosis (ALS) and C9 familial frontotemporal dementia (C9FTD), comprising introducing into the patient a fusion protein according to any one of claims 1 to 12, a nucleic acid construct according to any one of claims 13 to 15, a recombinant virus according to claim 19 or a pharmaceutical composition according to claim 20.

25. 25. The method of any one of claims 21 to 24, wherein the fusion protein is introduced via a recombinant virus expressing the fusion protein.

26. 26. The method of claim 25, wherein the recombinant virus is an adeno-associated virus (AAV), which may be of serotype 9 or pseudotype AAV2 / 9 or AAV2 / 6 / 9.

27. 27. The method of claim 25 or 26, wherein the recombinant virus is administered to the patient by intraventricular, intrathecal, intracranial, retro-orbital (RO), intravenous, intranasal and / or intracisternal routes.

28. 28. The method of any one of claims 21 to 27, wherein two or more fusion proteins according to any one of claims 1 to 12 are introduced, and the coding sequences for the two or more fusion proteins may be on the same recombinant viral vector.

29. A fusion protein according to any one of claims 1 to 12, a nucleic acid construct according to any one of claims 13 to 15, a recombinant virus according to claim 19 or a pharmaceutical composition according to claim 20 for use in a method according to any one of claims 21 to 28.

30. 29. Use of a nucleic acid construct according to any one of claims 13 to 15 or a recombinant virus according to claim 19 for the manufacture of a medicament for treating a patient in need thereof in a method according to any one of claims 21 to 28.

Images