Luminescent protein

Abstract

To provide a luminescent protein that emits light at high light intensity in a plurality of wavelength regions.SOLUTION: A luminescent protein comprises a complex of a bacterial luciferase and a fluorescent protein, where the bacterial luciferase has a LuxA subunit and a LuxB subunit, and the fluorescent protein is fused with the bacterial luciferase via the LuxA subunit.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to a photoprotein comprising a luciferase derived from a luminous bacterium. [Background technology]

[0002] Among the luminescence phenomena in which a luminescent substrate is oxidized by a catalytic enzyme called luciferase, those that occur within living organisms are classified as bioluminescence. Thousands of organisms that exhibit bioluminescence are known, among which luciferases and luminescent substrates have been identified, and these are used, for example, in genetic engineering to quantify proteins in cells using light as an indicator.

[0003] There are several species of eubacteria (bacteria) that produce luminescence (luminous bacteria). Light generation in luminous bacteria occurs through an enzymatic reaction of a substrate catalyzed by bacterial luciferase (Non-Patent Documents 1 and 2). Specifically, bacterial luciferase oxidizes reduced flavin mononucleotide (FMNH2) and long-chain fatty aldehyde (RCHO) to produce flavin mononucleotide (FMN) and the corresponding long-chain fatty acid (RCOOH), and during this reaction, light with a maximum wavelength around 490 nm is generated.

[0004] The basic enzymes required for luminescence in luminous bacteria are encoded by a single operon (lux operon) called luxCDABE, which is found in all species of luminous bacteria (Non-Patent Documents 1 and 2). luxA and luxB encode the α (LuxA) and β (LuxB) subunits of the heterodimeric protein of bacterial luciferase, respectively. luxC, luxD, and luxE are genes that encode a complex for synthesizing and recycling fatty aldehydes, which are substrates for luciferase. It has been observed that by co-expressing the above five lux genes in bacteria other than luminous bacteria or yeast cells, spontaneous luminescence (autoluminescence) is observed without the need for external substrate supply (Non-Patent Documents 3 and 4). In mammalian cells or plant cells, by co-expressing FMN oxidoreductase (LuxG) in addition to the above five lux genes, sufficient amounts of FMNH2 can be produced, which enables stable bioluminescence (Non-Patent Documents 5-8).

[0005] Unlike imaging using fluorescent proteins, bioluminescence imaging does not require external excitation light, and therefore has the advantage of being less susceptible to problems such as phototoxicity, photobleaching, and sample-derived fluorescence background. In particular, reporters based on bacterial luciferase have the advantages of a high signal-to-noise ratio (S / N ratio) and ease of handling. In addition, because there is no interference with the spectral analysis of excitation light, a wider spectral range can be analyzed than with fluorescent proteins. On the other hand, bacterial bioluminescence imaging has issues such as low brightness and long exposure time, which has limited its use (Non-Patent Documents 9 and 10).

[0006] Non-Patent Document 11 describes that by fusing bacterial LuxB with a circularly permuted yellow fluorescent protein Venus, bioluminescence resonance energy transfer (BRET) was induced within the cells, and 10 times the luminescence intensity was achieved in a short time compared to Lux alone. Furthermore, it was revealed that by introducing this into plant and animal cells, high luminescence was also achieved in these cells. [Prior art documents] [Non-patent literature]

[0007] [Non-Patent Document 1] Meighen, E., A., Microbiol. Rev. 55, 123-142 (1991) [Non-Patent Document 2] Dunlap, P., Adv. Biochem. Eng. Biotechnol. 144, 37-64 (2014) [Non-Patent Document 3] Frackman, S. et al., J. Bacteriol. 172, 5767-5773 (1990) [Non-Patent Document 4] Gupta, RK et al., FEMS Yeast Res. 4, 305-313 (2003) [Non-Patent Document 5] Close, DM et al., PLoS One 5, e12441 (2010) [Non-Patent Document 6] Krichevsky, A. et al., PLoS One 5, e15461 (2010) [Non-Patent Document 7] Xu, T. et al., PLoS One 9, e96347 (2014) [Non-Patent Document 8] Gregor, C. et al. Proc. Natl. Acad. Sci. USA 116, 26491-26496 (2019) [Non-Patent Document 9] Close, DM et al., J. Biomed. Opt. 16, 047003 (2011) [Non-Patent Document 10] Gregor, C. et al., Proc. Natl. Acad. Sci. USA 115, 962-967 (2018) [Non-Patent Document 11] Kaku, T. et al., Nature Scientific Reports, 11, 14994 (2021) Summary of the Invention [Problem to be solved by the invention]

[0008] As mentioned above, it was demonstrated that by using the bacterial lux operon and fusing the fluorescent protein Venus with luxB, it is possible to construct a highly luminescent photoprotein capable of spontaneously emitting light within a cell. The light emitted by this system is yellow-green (maximum wavelength 528 nm), but for use in cell experiments that require multiple types of reporters, it is desirable to have multiple types of photoproteins that emit light of different wavelengths.

[0009] An object of the present invention is to provide a photoprotein that emits high-intensity light in multiple wavelength ranges. Another object of the present invention is to provide a nucleic acid encoding the photoprotein that emits high-intensity light in multiple wavelength ranges, a vector incorporating the nucleic acid, and a cell incorporating the nucleic acid. [Means for solving the problem]

[0010] The present invention provides the following: [1] A luminescent protein comprising a complex of bacterial luciferase and a fluorescent protein, the bacterial luciferase having a LuxA subunit and a LuxB subunit, and the fluorescent protein being fused to the LuxA subunit. [2] The photoprotein described in [1], wherein the LuxA subunit is a polypeptide consisting of an amino acid sequence represented by SEQ ID NO: 1, or a polypeptide consisting of an amino acid sequence having 50% or more sequence identity to the amino acid sequence represented by SEQ ID NO: 1. [3] The photoprotein described in [1] or [2], wherein the LuxB subunit is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 2 or a polypeptide consisting of an amino acid sequence having 50% or more sequence identity to the amino acid sequence represented by SEQ ID NO: 2. [4] The photoprotein according to any one of [1] to [3], wherein the fluorescent protein is selected from a cyan fluorescent protein, a green fluorescent protein, a yellow fluorescent protein, an orange fluorescent protein, and a red fluorescent protein. [5] The cyan fluorescent protein is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 3, or a polypeptide having 60% or more sequence identity with the amino acid sequence represented by SEQ ID NO: 3 and having the function of emitting fluorescence with a maximum fluorescence wavelength of 450 to 500 nm, or a circular permutation product of any of these polypeptides; the green fluorescent protein is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 4, or a polypeptide having 60% or more sequence identity with the amino acid sequence represented by SEQ ID NO: 4 and having the function of emitting fluorescence with a maximum fluorescence wavelength of 500 to 520 nm, or a circular permutation product of any of these polypeptides; the yellow fluorescent protein is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 5, or a polypeptide having 60% or more sequence identity with the amino acid sequence represented by SEQ ID NO: 5, and The photoprotein according to [4], wherein the orange fluorescent protein is a polypeptide having the function of emitting fluorescence having a maximum fluorescence wavelength of 520 to 550 nm, or a circular permutation of any of these polypeptides; the orange fluorescent protein is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 6, or a polypeptide having 60% or more sequence identity with the amino acid sequence shown in SEQ ID NO: 6 and having the function of emitting fluorescence having a maximum fluorescence wavelength of 550 to 580 nm, or a circular permutation of any of these polypeptides; or the red fluorescent protein is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 7, or a polypeptide having 60% or more sequence identity with the amino acid sequence shown in SEQ ID NO: 7 and having the function of emitting fluorescence having a maximum fluorescence wavelength of 580 to 620 nm, or a circular permutation of any of these polypeptides. [6] A nucleic acid comprising a base sequence encoding a fusion of bacterial luciferase LuxA and a fluorescent protein. [7] The nucleic acid according to [6], further comprising a nucleotide sequence encoding LuxB of bacterial luciferase. [8] An expression vector incorporating the nucleic acid according to [6] or [7]. [9] A cell into which a nucleic acid having a base sequence encoding a fusion of bacterial luciferase LuxA and a fluorescent protein, and a nucleic acid having a base sequence encoding LuxB have been introduced.

[10] The cell according to [9], which is a bacterium, a fungal cell, a plant cell or an animal cell.

[11] A method for producing a luminescent protein, comprising expressing a nucleic acid having a base sequence encoding a fusion of LuxA of bacterial luciferase and a fluorescent protein, and a nucleic acid having a base sequence encoding LuxB. Effect of the Invention

[0011] According to the present invention, it is possible to provide a plurality of types of photoproteins that emit high-intensity light in a plurality of wavelength ranges. In addition, according to the present invention, it is possible to provide a nucleic acid encoding a photoprotein that emits high-intensity light in a plurality of wavelength ranges, a vector incorporating the nucleic acid, and a cell incorporating the nucleic acid. [Brief description of the drawings]

[0012] [Figure 1] FIG. 1 is a schematic diagram showing the mechanism of spontaneous light emission by the lux operon. [Diagram 2] FIG. 1 is a diagram showing the three-dimensional structure of an example of the photoprotein of the present invention. [Diagram 3] FIG. 1 is an alignment of the amino acid sequences of LuxA from Photorhabdus luminescens (SEQ ID NO: 1) and Photobacterium leiognathi (SEQ ID NO: 9). [Figure 4] FIG. 1 is an alignment of the amino acid sequences of LuxB from Photorhabdus luminescens (SEQ ID NO: 2) and Photobacterium leiognathi (SEQ ID NO: 10). [Diagram 5] FIG. 1 is a schematic diagram showing the structure of a fusion product of the LuxA subunit constituting the photoprotein of the present invention with various fluorescent proteins (cyan fluorescent protein, green fluorescent protein, yellow fluorescent protein, orange fluorescent protein, and red fluorescent protein). [Figure 6] The photographs show E. coli cultures containing luminescent proteins (CNLX, GNLX, YNLX, ONLX, and RNLX) that were expressed by co-expression of LuxBCDE and fusion proteins of various fluorescent proteins and LuxA. In the figure, the labels "blue-cyan," "cyan," "blue-green-green," "green," "yellow," and "red" at the bottom indicate the color of each culture as determined by visual inspection. [Figure 7] Graph showing the emission spectra of Lux photoprotein (control) and photoproteins fused with fluorescent proteins (CNLX, GNLX, YNLX, ONLX, and RNLX). The vertical axis shows the relative emission intensity when the emission intensity at the maximum wavelength of each photoprotein is set to 1. [Figure 8] 1 is a graph showing the luminescence intensity of various photoproteins (CNLX, GNLX, YNLX, ONLX, and RNLX) (n=3). The vertical axis shows the relative luminescence intensity when the luminescence intensity of the control is set to 1. In the figure, the error bars show the standard error. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0013] 1.Definition / Configuration In the present specification, the term "luminescent protein" refers to a protein that induces a reaction accompanied by luminescence in a specific substrate through an enzyme reaction, and is also referred to as a "chemiluminescent protein." In the present specification, the term "cyan nano-lantern based on Lux (CNLX)" refers to a protein that emits light with a maximum wavelength of 450 to 500 nm (450 nm or more and less than 500 nm, the same applies below). In the present specification, the term "green nano-lantern based on Lux (GNLX)" refers to a protein that emits light with a maximum wavelength of 500 to 520 nm. In the present specification, the term "yellow nano-lantern based on Lux (YNLX)" refers to a protein that emits light with a maximum wavelength of 520 to 550 nm. In the present specification, the term "orange nano-lantern based on Lux (ONLX)" refers to a protein that emits light with a maximum wavelength of 550 to 580 nm. As used herein, the term "red light-emitting protein (Red Nano-Lantern based on Lux (RNLX))" refers to a protein that emits light with a maximum wavelength of 580 to 620 nm.

[0014] In the present specification, the term "fluorescent protein" refers to a fluorescent protein that emits fluorescence when irradiated with excitation light having a specific wavelength. The fluorescent protein in the present specification is selected from cyan fluorescent protein, green fluorescent protein, yellow fluorescent protein, orange fluorescent protein, and red fluorescent protein. In the present specification, the term "cyan fluorescent protein" refers to a fluorescent protein having a maximum fluorescence wavelength of 450 to 500 nm. The cyan fluorescent protein is not particularly limited as long as it is a fluorescent protein that emits fluorescence in this range, and for example, mTurquoise2 (excitation wavelength 434 nm, maximum fluorescence wavelength 474 nm) and the like can be used. In the present specification, the term "green fluorescent protein" refers to a fluorescent protein having a maximum fluorescence wavelength of 500 to 520 nm. The fluorescent protein is not particularly limited as long as it is a fluorescent protein that emits fluorescence in this range, and for example, sfGFP (maximum fluorescence wavelength 510 nm), Gamillux (excitation wavelength 504 nm, maximum fluorescence wavelength 519 nm), and the like can be used. In the present specification, the term "yellow fluorescent protein" refers to a fluorescent protein having a maximum fluorescence wavelength of 520 to 550 nm. The yellow fluorescent protein is not particularly limited as long as it is a fluorescent protein that emits fluorescence in this range, and for example, Venus (excitation wavelength 515 nm, maximum fluorescence wavelength 528 nm) can be used. In this specification, the term "orange fluorescent protein" refers to a fluorescent protein with a maximum fluorescence wavelength of 550 to 580 nm. The orange fluorescent protein is not particularly limited as long as it is a fluorescent protein that emits fluorescence in this range, and for example, mKOκ (excitation wavelength 551 nm, maximum fluorescence wavelength 563 nm) can be used. In this specification, the term "red fluorescent protein" refers to a fluorescent protein with a maximum fluorescence wavelength of 580 to 620 nm. The red fluorescent protein is not particularly limited as long as it is a fluorescent protein that emits fluorescence in this range, and for example, mScarlet-I (excitation wavelength 569 nm, maximum fluorescence wavelength 594 nm) can be used.

[0015] In this specification, "bacterial luciferase" refers to luciferase expressed by luminous bacteria. More specifically, "bacterial luciferase" refers to an enzyme containing a complex of two subunits, LuxA subunit and LuxB subunit. "Luminous bacteria" here refers to bacteria having the property of chemiluminescence, more specifically, bacteria having a lux operon in the genome. Known luminous bacteria include Photorhabdus luminescens, Photobacterium leiognathi, Photobacterium phosphoreum, Vibrio fischeri, etc., all of which are included in the "luminous bacteria" of this specification.

[0016] As used herein, the term "nucleic acid" refers to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), and unless otherwise specified herein, it refers to DNA.

[0017] In this specification, the term "lux operon" refers to a group of genes related to the spontaneous luminescence of luminous bacteria, specifically, an operon having the structure luxC-luxD-luxA-luxB-luxE. In addition, luxG may be linked after luxE. Figure 1 shows the relationship between the lux operon of luminous bacteria and the mechanism of spontaneous luminescence. luxD encodes an enzyme that reduces intracellular fatty acyl-acyl carrier protein (ACP) to produce fatty acids. luxE encodes an enzyme that produces an acyl enzyme intermediate from fatty acids. luxC encodes an enzyme that synthesizes fatty aldehydes, which are substrates for luciferase, from the acyl enzyme intermediate. luxA and luxB encode two subunits of luciferase, the LuxA subunit and the LuxB subunit, respectively. Luciferase oxidizes fatty aldehydes and reduced flavin mononucleotide (FMNH2) to produce fatty acids and FMN, which emits light. luxG encodes an enzyme that reduces FMN. As described above, the lux operon oxidizes and recycles the luminescent substrate, thereby enabling spontaneous light emission within the cell.

[0018] In this specification, "sequence identity" means the percentage of identical amino acids or bases in the total overlapping amino acid sequence (including the amino acid at the translation initiation point) or base sequence (including the initiation codon) in the optimal alignment when two amino acid sequences or base sequences are aligned with or without introducing gaps, and is calculated by formula (1). Sequence identity can be easily examined using BLAST (Basic Local Alignment Search Tool), an algorithm commonly used in this field. For example, BLAST is available to anyone from websites such as NCBI (National Center for Biotechnology Information) and KEGG (Kyoto Encyclopedia of Genes and Genomes), and sequence identity can be easily examined using default parameters. Sequence identity (%) = number of matches (ignoring gaps) / length of the shorter sequence (length excluding gaps) × 100... Formula (1)

[0019] 2. Photoproteins A first embodiment of the present invention is a luminescent protein, which comprises a complex of bacterial luciferase and a fluorescent protein, the bacterial luciferase having a LuxA subunit and a LuxB subunit, and the fluorescent protein fused to the LuxA subunit.

[0020] FIG. 2 shows a three-dimensional structure diagram of an example of the luminescent protein of the present invention. The luminescent protein of this embodiment includes a complex of a LuxA subunit fused with a fluorescent protein and a LuxB subunit. The complex of the LuxA subunit and the LuxB subunit has a function as a bacterial luciferase, that is, a function of oxidizing a substrate (luciferin) and generating light at that time. Although bacterial luciferase alone generates light, the present inventors have found that when a fluorescent protein is fused to the LuxA subunit of bacterial luciferase, it has a function of generating stronger light. This is considered to be because BRET occurs in the fluorescent protein upon receiving light generated by the action of luciferase. Furthermore, the present inventors have found that BRET occurs similarly even if the fluorescent protein fused to the LuxA subunit is changed to a fluorescent protein with a different fluorescent wavelength region. That is, the luminescent protein of this embodiment is capable of generating light in a wide wavelength region.

[0021] In this embodiment, the LuxA subunit is preferably a polypeptide consisting of an amino acid sequence represented by SEQ ID NO: 1, or a polypeptide consisting of an amino acid sequence having a sequence identity of 50% or more, particularly 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more, with the amino acid sequence represented by SEQ ID NO: 1. The amino acid sequence represented by SEQ ID NO: 1 is identical to the amino acid sequence of the LuxA subunit of Photorhabdus luminescens. A polypeptide consisting of an amino acid sequence having a sequence identity of 50% or more (particularly 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more) with the amino acid sequence represented by SEQ ID NO: 1 is preferably a polypeptide that functions as a LuxA subunit, that is, functions as a luciferase by forming a complex with the LuxB subunit.

[0022] 3 shows an alignment of the amino acid sequences of the LuxA subunit of Photorhabdus luminescens (SEQ ID NO: 1) and the LuxA subunit of Photobacterium leiognathi (SEQ ID NO: 9). The sequence homology between the two sequences is 62.7%.

[0023] In this embodiment, the LuxB subunit is preferably a polypeptide consisting of an amino acid sequence represented by SEQ ID NO: 2, or a polypeptide consisting of an amino acid sequence having a sequence identity of 50% or more, particularly 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more, with the amino acid sequence represented by SEQ ID NO: 2. The amino acid sequence represented by SEQ ID NO: 2 is identical to the amino acid sequence of the LuxB subunit of Photorhabdus luminescens. A polypeptide consisting of an amino acid sequence having a sequence identity of 50% or more (particularly 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more) with the amino acid sequence represented by SEQ ID NO: 2 is preferably a polypeptide that functions as a LuxB subunit, that is, functions as a luciferase by forming a complex with the LuxA subunit.

[0024] 4 shows an alignment of the amino acid sequences of the LuxB subunit of Photorhabdus luminescens (SEQ ID NO: 2) and the LuxB subunit of Photobacterium leiognathi (SEQ ID NO: 10). The sequence homology between the two sequences is 51.7%.

[0025] In this embodiment, the fluorescent protein fused with LuxA is preferably any one of the fluorescent proteins selected from cyan fluorescent protein, green fluorescent protein, yellow fluorescent protein, orange fluorescent protein and red fluorescent protein. The cyan fluorescent protein is not particularly limited as long as it is a protein that emits fluorescence with a maximum fluorescence wavelength of 450 to 500 nm, but may be, for example, a polypeptide (mTurquoise2ΔC10) consisting of the amino acid sequence represented by SEQ ID NO: 3, or a polypeptide having a sequence identity of 60% or more, particularly 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more or 99% or more with the amino acid sequence represented by SEQ ID NO: 3 and having the function of emitting fluorescence with a maximum fluorescence wavelength of 450 to 500 nm, or a circular permutation product of any one of these polypeptides. The green fluorescent protein is not particularly limited as long as it is a protein that emits fluorescence with a maximum fluorescence wavelength of 500 to 520 nm, but can be, for example, a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 4 (sfGFPΔC10), or a polypeptide that has 60% or more, particularly 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 4 and has the function of emitting fluorescence with a maximum fluorescence wavelength of 500 to 520 nm, or a circular permutation product of any of these polypeptides. The yellow fluorescent protein is not particularly limited as long as it is a protein that emits fluorescence with a maximum fluorescence wavelength of 520 to 550 nm, but can be, for example, a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 5 (VenusΔC10), or a polypeptide that has 60% or more, particularly 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more sequence identity to the amino acid sequence represented by SEQ ID NO: 5 and has the function of emitting fluorescence with a maximum fluorescence wavelength of 520 to 550 nm, or a circular permutation product of any of these polypeptides.The orange fluorescent protein is not particularly limited as long as it is a protein that emits fluorescence with a maximum fluorescence wavelength of 550 to 580 nm, but can be, for example, a polypeptide (mKOκ) consisting of the amino acid sequence shown in SEQ ID NO: 6, or a polypeptide that has 60% or more, particularly 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 6 and has the function of emitting fluorescence with a maximum fluorescence wavelength of 550 to 580 nm, or a circular permutation product of any of these polypeptides. The red fluorescent protein is not particularly limited as long as it is a protein that emits fluorescence with a maximum fluorescence wavelength of 580 to 620 nm, but for example, it can be a polypeptide (mScarlet-IΔC10) consisting of the amino acid sequence represented by SEQ ID NO: 7, or a polypeptide having a sequence identity of 60% or more, particularly 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more with the amino acid sequence represented by SEQ ID NO: 7 and having the function of emitting fluorescence with a maximum fluorescence wavelength of 580 to 620 nm, or a circular permutation of any of these polypeptides. In this specification, "ΔC10" refers to the deletion of 10 amino acids on the C-terminal side from the known amino acid sequence.

[0026] A fusion product of LuxA with a cyan fluorescent protein, a green fluorescent protein, a yellow fluorescent protein, an orange fluorescent protein, or a red fluorescent protein forms a complex with LuxB to form a cyan fluorescent protein (CNLX), a green fluorescent protein (GNLX), a yellow fluorescent protein (YNLX), an orange fluorescent protein (ONLX), or a red fluorescent protein (RNLX), respectively.

[0027] 3. Nucleic acid The second embodiment of the present invention is a nucleic acid for expressing a luminescent protein. The nucleic acid of this embodiment is characterized in that it contains a base sequence encoding a fusion of a LuxA subunit of bacterial luciferase and a fluorescent protein. The nucleic acid of this embodiment preferably contains a base sequence encoding a LuxB subunit of bacterial luciferase in the same nucleic acid molecule or as a separate nucleic acid molecule. The nucleic acid of this embodiment is used to co-express a fusion of a LuxA subunit and a fluorescent protein and a LuxB subunit in a single cell, thereby enabling the expression of the luminescent protein described in the first embodiment in the cell.

[0028] The nucleotide sequence of the gene encoding LuxA may be optimized to suit the host into which it is to be incorporated. For example, when incorporated into Escherichia coli, the gene (luxA) encoding LuxA having the amino acid sequence represented by SEQ ID NO: 1 may have the nucleotide sequence represented by SEQ ID NO: 11. Also, the gene (luxA) encoding LuxA having the amino acid sequence represented by SEQ ID NO: 9 may have the nucleotide sequence represented by SEQ ID NO: 19. In this case, the gene having the nucleotide sequence represented by SEQ ID NO: 19 corresponds to an orthologue of the gene having the nucleotide sequence represented by SEQ ID NO: 11. That is, in the method of the present invention, LuxA may be a protein encoded by an orthologue of the gene encoding the LuxA subunit of Photorhabdus luminescens.

[0029] The nucleotide sequence of the gene encoding LuxB may be optimized to suit the host into which it is to be incorporated. For example, when incorporated into E. coli, the gene (luxB) encoding LuxB having the amino acid sequence represented by SEQ ID NO: 2 may have the nucleotide sequence represented by SEQ ID NO: 12. Also, the gene (luxB) encoding LuxB having the amino acid sequence represented by SEQ ID NO: 10 may have the nucleotide sequence represented by SEQ ID NO: 20. In this case, the gene having the nucleotide sequence represented by SEQ ID NO: 20 corresponds to an orthologue of the gene having the nucleotide sequence represented by SEQ ID NO: 12. That is, in the method of the present invention, LuxB may be a protein encoded by an orthologue of the gene encoding the LuxB subunit of Photorhabdus luminescens.

[0030] The base sequence of a gene encoding a fluorescent protein (fluorescent protein gene) may be optimized to suit the host into which it is to be incorporated. For example, when incorporated into E. coli, a gene encoding a cyan fluorescent protein having an amino acid sequence represented by SEQ ID NO: 3 may have a base sequence represented by SEQ ID NO: 13. A gene encoding a green fluorescent protein having an amino acid sequence represented by SEQ ID NO: 4 may have a base sequence represented by SEQ ID NO: 14. A gene encoding a yellow fluorescent protein having an amino acid sequence represented by SEQ ID NO: 5 may have a base sequence represented by SEQ ID NO: 15. A gene encoding an orange fluorescent protein having an amino acid sequence represented by SEQ ID NO: 6 may have a base sequence represented by SEQ ID NO: 16. A gene encoding a red fluorescent protein having an amino acid sequence represented by SEQ ID NO: 7 may have a base sequence represented by SEQ ID NO: 17.

[0031] The fluorescent protein gene and luxA may be linked in any manner as long as they are expressed as a fusion product, but it is preferable that they are linked in the order of fluorescent protein gene-luxA from the 5'-end (upstream). A sequence encoding a linker or the like may be provided at the linking site of both genes, so long as it does not prevent expression as a fusion product. luxB may also be linked to the 3'-end (downstream) of luxA. In this case, it is preferable that a ribosome binding sequence (e.g., CTAAGGAAAAGAA (SEQ ID NO: 8)) is provided between luxA and luxB to allow each of luxA and luxB to express a subunit.

[0032] Additionally, luxC, luxD, luxE and / or luxG may be included within the same nucleic acid molecule or as separate nucleic acid molecules, if desired.

[0033] 4. Expression Vectors A third embodiment of the present invention is a vector for expressing a photoprotein. The expression vector of this embodiment is characterized in that the nucleic acid of the second embodiment is incorporated therein.

[0034] The type of expression vector is not particularly limited as long as it is suitable for the host cell into which it is to be incorporated, and can be selected appropriately. For example, a plasmid, a phage, etc. can be used. The expression vector can be particularly suitable for introduction into bacteria, fungal cells, plant cells, or animal cells. As the expression vector, a commercially available one can be used as appropriate. For example, when Escherichia coli is used as the host, pRSET B (Thermo Fisher Scientific), pBAD (Thermo Fisher Scientific), pCold (Takara Bio Inc.), etc. can be suitably used.

[0035] The expression vector contains at least a nucleotide sequence encoding a fusion product of the LuxA subunit and a fluorescent protein. It may further contain a nucleotide sequence encoding the LuxB subunit. Furthermore, it may contain luxC, luxD, luxE and / or luxG as necessary. Alternatively, these genes may be separately incorporated into two or more expression vectors and introduced simultaneously into the same cell.

[0036] 5.Cells The fourth embodiment of the present invention is a cell into which a gene for expressing a luminescent protein is incorporated. The cell of this embodiment is characterized in that a nucleic acid having a base sequence encoding a fusion of LuxA of bacterial luciferase and a fluorescent protein, and a nucleic acid having a base sequence encoding LuxB are introduced. The type of cell is not particularly limited, but it is sometimes preferable to use bacteria, fungal cells, plant cells, or animal cells. Since the luminescent protein of the present invention can be used, for example, as a marker for monitoring the behavior of cells, it is preferable to appropriately select a host cell into which a gene is incorporated depending on the purpose.

[0037] The cell of this embodiment is prepared, for example, by introducing the expression vector of the third embodiment into a cell of interest. The expression vector contains at least a fluorescent protein gene, luxA, and may contain luxB in the same vector, if necessary. Alternatively, luxB may be contained in a separate vector and introduced into the same cell together with the vector containing luxA. Furthermore, if necessary, luxC, luxD, luxE and / or luxG may each be contained in the above vector or in a separate vector and introduced into the same cell together with at least the fluorescent protein, luxA and luxB.

[0038] The cell of this embodiment contains at least the fluorescent protein genes luxA and luxB, and optionally luxC, luxD, luxE and / or luxG. By introducing the above genes into the cell of this embodiment, it is possible for the cell to emit light in response to the addition of a substrate or to emit light spontaneously.

[0039] 6. Method for producing photoproteins A sixth embodiment of the present invention is a method for producing a photoprotein, which comprises expressing a nucleic acid having a base sequence encoding a fusion of LuxA of bacterial luciferase and a fluorescent protein, and a nucleic acid having a base sequence encoding LuxB.

[0040] The method of this embodiment may include a step of preparing an expression vector containing a nucleic acid having a base sequence encoding a fusion of LuxA of bacterial luciferase and a fluorescent protein and a nucleic acid having a base sequence encoding LuxB. Alternatively, the method of this embodiment may include a step of separately preparing an expression vector containing a nucleic acid having a base sequence encoding a fusion of LuxA of bacterial luciferase and a fluorescent protein and an expression vector containing a nucleic acid having a base sequence encoding LuxB. The method of this embodiment may also include a step of preparing one or more expression vectors containing luxC, luxD, luxE and / or luxG.

[0041] The method of this embodiment may include a step of introducing the expression vector prepared above into cells. The cells used here are not particularly limited, and may be, for example, bacteria, fungal cells, plant cells, or animal cells. Furthermore, the method of this embodiment may include a step of culturing the cells into which the expression vector has been introduced. This step produces a luminescent protein in the cells, and the cells emit light due to the supply of a luminescent substrate (luciferin) to the cells or the production of the luminescent substrate in the cells. Alternatively, a luminescent protein that emits light in the presence of a luminescent substrate can be obtained from the cultured cells through bacterial collection, cell disruption, and protein purification. EXAMPLES

[0042] EXAMPLES Hereinafter, examples are presented to explain the present invention in detail, but are not intended to limit the scope of the present invention to the examples.

[0043] Example 1: Preparation of luminescent E. coli (1) Preparation of luxAB insertion vector The Lux gene was cloned from the plasmid pAKlux1 (plasmid #14073, Addgene) incorporating the luxCDABE of Photorhabdus luminescens. Using pAKlux1 as a template, luxAB was amplified with the following primer set (SEQ ID NOs: 21 and 22) in such a way that the ribosome binding sequence CTAAGGAGAAGAA (SEQ ID NO: 8) was inserted between luxA and luxB. Forward primer (BamHI-G-luxA) CACCGGATCCGATGAAATTTGGAAACTTTTTG (SEQ ID NO: 21) Reverse primer (EcoRI-LuxB) CACCGAATTCTTAGGTATATTCCATGTGGTAC (SEQ ID NO: 22) To allow bicistronic expression of the luxAB operon in E. coli, the PCR-amplified luxAB fragment was digested with BamHI and EcoRI, and the fragment was ligated into pRSET B (Thermo Fisher Scientific) at the corresponding site, resulting in pRSETB-luxAB.

[0044] (2) Preparation of expression vectors for various luminescent proteins To synthesize the luminescent proteins CNLX, GNLX, YNLX, ONLX, and RNLX, luminescent protein expression vectors were prepared using the genes of the fluorescent proteins mTurquoise2, sfGFP, Venus, mKOκ, and mScarlet-I. However, mTurquoise2, sfGFP, Venus, and mScarlet-I were genes encoding an amino acid sequence (ΔC10) in which 10 amino acids were deleted from the C-terminal side of the known amino acid sequence. The amino acid sequences of Turquoise2ΔC10, sfGFPΔC10, VenusΔC10, mKOκ, and mScarlet-IΔC10 are shown as SEQ ID NOs: 3, 4, 5, 6, and 7, respectively. The DNAs encoding these are shown as SEQ ID NOs: 13, 14, 15, 16, and 17, respectively. Each gene was amplified using gene-specific primers and a PCR amplification reagent (KOD-Plus-Neo, Toyobo Co., Ltd.). The amplified DNA was transformed into pRSET using the TEDA method (see Xia, Y., et al. Nucleic Acids Research, 47(3), e15 (2019)). B The vector was inserted upstream of luxA in -luxAB. Cloning was performed using the E. coli strain XL10-GOLD, and the gene sequences were confirmed to obtain various luminescence protein expression vectors (pCNLX(mTurquoise2ΔC10:luxA+luxB), pGNLX(sfGFPΔC10:luxA+luxB), pYNLX(VenusΔC10:luxA+luxB, pONLX(mKOκ:luxA+luxB), and pRNLX(mScarlet-IΔC10:luxA+luxB)).

[0045] FIG. 5 shows a schematic diagram of the structure of the fusion protein constituting each photoprotein (CNLX, GNLX, YNLX, ONLX, and RNLX). CNLX has a structure in which the amino acid sequence of positions 1 to 229 of SEQ ID NO: 3 and the amino acid sequence of positions 2 to 359 of SEQ ID NO: 1 are linked with two amino acids of EL (glutamic acid-leucine) sandwiched between them. GNLX has a structure in which the amino acid sequence of positions 1 to 229 of SEQ ID NO: 4 and the amino acid sequence of positions 2 to 359 of SEQ ID NO: 1 are linked with two amino acids of EL sandwiched between them. YNLX has a structure in which the amino acid sequence of positions 1 to 229 of SEQ ID NO: 5 and the amino acid sequence of positions 2 to 359 of SEQ ID NO: 1 are linked with two amino acids of EL sandwiched between them. ONLX has a structure in which the amino acid sequence of positions 1 to 218 of SEQ ID NO: 6 and the amino acid sequence of positions 2 to 359 of SEQ ID NO: 1 are linked with two amino acids of EL sandwiched between them. RNLX has a structure in which the amino acid sequence of positions 1 to 222 of SEQ ID NO: 7 and the amino acid sequence of positions 2 to 359 of SEQ ID NO: 1 are linked with the two amino acids EL sandwiched between them.

[0046] (3) Preparation of luxCDE vector The genes of LuxC (amino acid sequence SEQ ID NO: 23 / base sequence SEQ ID NO: 26), LuxD (amino acid sequence SEQ ID NO: 24 / base sequence SEQ ID NO: 27), and LuxE (amino acid sequence SEQ ID NO: 25 / base sequence SEQ ID NO: 28) were cloned from the plasmid pAKlux1. luxCDE was amplified by PCR using the following primer set (SEQ ID NOs: 30 and 31) so that the ribosome binding sequences TAGGTAAAGT (SEQ ID NO: 18) and AATCTATTGAGATATTCTATCACTCAAATAGCAATATAAGGACTCTCT (SEQ ID NO: 29) were inserted between luxC-luxD and luxD-luxE, respectively. Forward primer (Fwd-BamHI-luxC) TAGGATCCATGACTAAAAAAATTTCATTCATTATTAACG (SEQ ID NO: 30) Reverse primer (Rev-EcoRI-luxE) CACCGAATTCAACTATCAAACGCTTCG (SEQ ID NO: 31) The PCR-amplified luxC-luxD-luxE fragment was digested with BamHI and EcoRI, and the fragment was inserted into pRSET B (Thermo Fisher Scientific) in frame to obtain the luxCDE vector.

[0047] (4) Preparation and cultivation of E. coli expressing photoproteins The luminescent protein expression vectors prepared in (2) were combined with the luxCDE vector to transform the E. coli strain JM109(DE3) to construct a co-expression system of luminescent protein and LuxCDE. As a control, pRSET, which does not contain a fluorescent protein gene, was used. B E. coli was transformed in the same manner using a combination of the -luxAB and luxCDE vectors. The transformed E. coli was cultured in 200 mL of LB liquid medium containing 100 μg / mL carbenicillin at 23°C and 130 rpm for 60 hours with shaking. After the culture, 150 μL of each culture solution was dispensed into a PCR PP tube and photographed under a light-blocking condition with a digital single-lens camera (Sony α7S) with an exposure time of 8 seconds. The photographs are shown in Figure 6. It was confirmed that the luminescence intensity of all the fluorescent protein-LuxA fusion proteins was higher than that of Lux alone (control). It was also shown that by changing the type of fluorescent protein to be combined, high luminescence intensity could be obtained over a wide wavelength range.

[0048] Example 2: Preparation of photoproteins (1) Preparation and extraction of photoproteins Escherichia coli strain JM109(DE3) was transformed with each of the luminescent protein expression vectors prepared in Example 1(2) and cultured in LB liquid medium at 23°C for 60 hours with shaking. Escherichia coli was recovered from the culture medium and cytoplasmic proteins were extracted using a French press. The target proteins were isolated using a Ni-NTA agarose column (QIAGEN) and dissolved in 20 mM HEPES buffer (pH 7.4) to obtain various luminescent proteins (CNLX, GNLX, YNLX, ONLX and RNLX). As a control, pRSET, which had no fluorescent protein gene inserted, was used. BAn E. coli strain was transformed with -luxAB in the same manner, and cultured and protein extracted to obtain a luminescent protein (LuxA+LuxB) solution.

[0049] (2) Extracellular luminescence test Each photoprotein was added to a 20 mM HEPES buffer (pH 7.4, 37°C) containing 10 μM FMN, 40 μM decanal, and 200 μM 1-benzyl-1,4-dihydronicotinamide (BNAH) to a final concentration of 0.8 μM. Immediately after addition, the emission spectrum of each photoprotein solution was measured using a PMA-12 multichannel spectrometer (Hamamatsu Photonics) with an exposure time of 30 seconds. At the same time, 100 μL of each solution was dispensed into a 96-well microwell plate (n=3), and the emission of light at all wavelengths was measured using a microplate reader (Corona Multigrating Microplate Reader SH-9000Lab, Hitachi High-Tech). Figure 7 shows the emission spectrum of each photoprotein. The vertical axis of the graph shows the relative emission intensity, with the emission intensity at the maximum wavelength of each photoprotein set to 1. Figure 8 shows the emission intensity of each photoprotein. The error bars in the figure show the standard error. As shown in Figure 7, it was found that luminescence over a wide wavelength range was possible by changing the type of fluorescent protein combined with LuxA. In addition, as shown in Figure 8, it was found that LuxA fused to any fluorescent protein showed significantly higher luminescence intensity compared to Lux alone (control).

Claims

1. A luminescent protein comprising a complex of bacterial luciferase and a fluorescent protein, said bacterial luciferase having a LuxA subunit and a LuxB subunit, and said fluorescent protein being fused to the LuxA subunit.

2. The photoprotein described in claim 1, wherein the LuxA subunit is a polypeptide consisting of an amino acid sequence represented by SEQ ID NO: 1 or a polypeptide consisting of an amino acid sequence having 50% or more sequence identity with the amino acid sequence represented by SEQ ID NO:

1.

3. The luminescent protein described in claim 1, wherein the LuxB subunit is a polypeptide consisting of an amino acid sequence represented by SEQ ID NO: 2 or a polypeptide consisting of an amino acid sequence having 50% or more sequence identity with the amino acid sequence represented by SEQ ID NO:

2.

4. The luminescent protein of claim 1 , wherein the fluorescent protein is selected from cyan fluorescent protein, green fluorescent protein, yellow fluorescent protein, orange fluorescent protein and red fluorescent protein.

5. The cyan fluorescent protein is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 3, or a polypeptide having 60% or more sequence identity with the amino acid sequence represented by SEQ ID NO: 3 and having the function of emitting fluorescence with a maximum fluorescence wavelength of 450 to 500 nm, or a circular permutation product of any of these polypeptides; The green fluorescent protein is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 4, or a polypeptide having 60% or more sequence identity with the amino acid sequence represented by SEQ ID NO: 4 and having the function of emitting fluorescence with a maximum fluorescence wavelength of 500 to 520 nm, or a circular permutation product of any of these polypeptides; The yellow fluorescent protein is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO:5, or a polypeptide having a sequence identity of 60% or more with the amino acid sequence represented by SEQ ID NO:5 and having the function of emitting fluorescence with a maximum fluorescence wavelength of 520 to 550 nm, or a circular permutation product of any of these polypeptides; The orange fluorescent protein is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 6, or a polypeptide having 60% or more sequence identity with the amino acid sequence represented by SEQ ID NO: 6 and having the function of emitting fluorescence with a maximum fluorescence wavelength of 550 to 580 nm, or a circular permutation of any of these polypeptides; or The red fluorescent protein is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 7, or a polypeptide having 60% or more sequence identity with the amino acid sequence represented by SEQ ID NO: 7 and having the function of emitting fluorescence with a maximum fluorescence wavelength of 580 to 620 nm, or a circular permutation product of any of these polypeptides. The photoprotein according to claim 4.

6. A nucleic acid comprising a base sequence encoding a fusion of bacterial luciferase LuxA and a fluorescent protein.

7. The nucleic acid of claim 6, further comprising a base sequence encoding LuxB of bacterial luciferase.

8. An expression vector incorporating the nucleic acid according to claim 6.

9. A cell into which a nucleic acid having a base sequence encoding a fusion of LuxA of bacterial luciferase and a fluorescent protein, and a nucleic acid having a base sequence encoding LuxB have been introduced.

10. 10. The cell of claim 9 which is a bacterium, a fungal cell, a plant cell or an animal cell.

11. A method for producing a luminescent protein, comprising expressing a nucleic acid having a base sequence encoding a fusion of LuxA of bacterial luciferase with a fluorescent protein, and a nucleic acid having a base sequence encoding LuxB.

Images