Muscle strength decline inhibitor

Abstract

To provide an excellent muscle strength decline inhibitor containing Tremella fuciformis, which is suitable for daily intake and offers high efficacy and safety.SOLUTION: Tremella fuciformis exhibits an excellent muscle strength decline inhibitory effect based on white muscle synthesis promoting effect, such that it is applicable as a food, quasi-drug, or pharmaceutical having a muscle strength decline inhibitory effect.SELECTED DRAWING: None

Description

Technical Field

[0001] The present invention relates to a muscle strength decline inhibitor characterized by containing white shiitake mushrooms. More specifically, it relates to the provision of a muscle strength decline inhibitor based on the action of promoting white muscle synthesis of white shiitake mushrooms.

Background Art

[0002] Skeletal muscle is an essential organ for daily movements such as standing, walking, and holding objects, as well as for supporting the body, and plays a very important role in leading a healthy daily life. However, when skeletal muscle atrophies due to aging, disease, or injury, resulting in a decline in physical function, a decline in the function of skeletal muscle, such as a decrease in muscle strength, occurs. This condition is called sarcopenia, and if left unaddressed, a decline in mobility will become apparent and progress to locomotive syndrome. In Japan, where the aging population is advancing, locomotive syndrome has become a major social problem.

[0003] In order to suppress the decline in muscle strength, hypertrophy of muscle fibers that make up skeletal muscle is necessary, and exercise is considered effective for achieving this (Non-Patent Document 1). Suppressing the decline in muscle strength through appropriate exercise leads to the prevention of sarcopenia and locomotive syndrome described above, and is extremely important for maintaining Quality of Life (QOL). However, in modern society, lifestyle habits tend to be irregular, and it is not easy to continue exercise regularly. Furthermore, due to the effects of aging, disease, or injury-induced decline in physical function, it is not uncommon for it to become difficult to perform exercise itself.

[0004] Therefore, it is considered to have great social significance to provide means for suppressing the decline in muscle strength, improving the function of skeletal muscle, and preventing / improving sarcopenia and locomotive syndrome without necessarily requiring exercise.

[0005] Skeletal muscle fibers are broadly classified into white muscle fibers, which are excellent in contractile force and explosive power, and red muscle fibers, which are excellent in endurance. While the changes in red muscle fibers due to aging are small, it is known that the diameter of white muscle fibers significantly decreases with aging (Non-Patent Document 2). Therefore, in order to suppress the decline in muscle strength and improve the function of skeletal muscle, it is important to promote the synthesis of white muscle fibers, which significantly decline with aging.

[0006] Skeletal muscle fibers are mainly composed of proteins called actin and myosin. Among them, the protein called myosin heavy chain has different isoforms in white muscle fibers and red muscle fibers, and is important in characterizing white muscle fibers and red muscle fibers. The white muscle type myosin heavy chain is Type II Myosin Heavy Chain (MyHC II) (Non-Patent Document 3) and significantly contributes to the contractile force and contraction speed of skeletal muscle (Non-Patent Document 4). It is also a very important protein used in anaerobic exercises often performed in daily life, such as standing, sitting, and lifting objects. It has also been reported that when MyHC II is deficient, the number and weight of muscle fibers decrease (Non-Patent Document 5). Therefore, promoting the production of MyHC II and the synthesis of white muscle fibers in skeletal muscle is considered a beneficial method to hypertrophy muscle fibers and suppress the decline in muscle strength.

[0007] From such a perspective, research on compounds that hypertrophy muscle fibers has been underway, and one of them is clenbuterol. This compound has been reported to promote the synthesis of white muscle fibers in skeletal muscle and hypertrophy the entire skeletal muscle by acting on the β2-adrenergic receptor on the surface of skeletal muscle cells (Non-Patent Documents 6 and 7). However, since clenbuterol stimulates the β2-adrenergic receptor, it may be accompanied by many side effects such as an increase in heart rate, tremors, and hypokalemia, and long-term administration is considered difficult (Non-Patent Document 8).

[0008] Therefore, it is necessary to develop a food-derived muscle strength decline inhibitor that is highly safe and can be continuously ingested for a long period of time. Heretofore, a myoblast activator containing Rosa roxburghii Tratt, Agaricus blazei Murill, etc. (Patent Document 1), a muscle cell activator containing an adzuki bean extract (Patent Document 2), etc. have been proposed, but there is still a demand for providing a more effective food-derived muscle strength decline inhibitor.

[0009] In view of such a situation, as a result of conducting tests using various foods, the present inventors have found that Pleurotus ostreatus, which is a basidiomycete of the family Tricholomataceae, has an excellent effect of suppressing muscle strength decline. Although Pleurotus ostreatus is known to exhibit an action of promoting collagen production (Patent Document 3), an angiogenesis inhibitory activity (Patent Document 4), an anti-inflammatory action (Patent Document 5), etc., a muscle strength decline inhibitor characterized by containing Pleurotus ostreatus is not known at all.

Prior Art Documents

Patent Documents

[0010]

Patent Document 1

Patent Document 2

Patent Document 3

Patent Document 4

Patent Document 5

Non-Patent Documents

[0011]

Non-Patent Document 1

Non-Patent Document 2

Non-Patent Document 3

Non-Patent Document 4

Non-Patent Document 5

Non-Patent Document 6

Non-Patent Document 7

Non-Patent Document 8

Summary of the Invention

Problems to be Solved by the Invention

[0012] The present invention relates to a muscle strength decline inhibitor characterized by containing white tremella, and aims to provide a muscle strength decline inhibitor based on the action of promoting white muscle synthesis of white tremella.

Means for Solving the Problems

[0013] As the white tremella used in this study, white tremella (scientific name: Tremella fuciformis), which is a basidiomycete of the family Tremellaceae, can be used. White tremella is also known as silver ear and is considered to be native to China. Currently, it is cultivated mainly in regions with temperate to tropical climates such as Okinawa, China, India, and Indonesia, and white tremella cultivated in any region can be used. The part of white tremella used in the present invention is not particularly limited, and examples include fruiting bodies and mycelia, and it is particularly desirable to use fruiting bodies.

[0014] The white jelly mushroom used in the present invention can be used as it is, or if necessary, those that have been subjected to treatments such as juicing, drying, pulverizing, or slicing can also be used. Further, extracts obtained by extracting the white jelly mushroom as it is or after the above treatments can also be used. Examples of the solvent for extraction include water, lower alcohols (such as methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (such as 1,3-butylene glycol, propylene glycol, glycerin, etc.), ketones (such as acetone, methyl ethyl ketone, etc.), acetonitrile, esters (such as ethyl acetate, butyl acetate, etc.), hydrocarbons (such as hexane, heptane, petroleum ether, etc.), and ethers (such as ethyl ether, tetrahydrofuran, propyl ether, etc.). These solvents may be used alone or in combination of two or more. The white jelly mushroom used in the present invention is preferably extracted with a polar solvent such as water or a lower alcohol, and water extraction is particularly preferred.

[0015] The above extract may be used as the extracted liquid as it is, or if necessary, it may be used after treatments such as concentration, dilution, filtration, decolorization with activated carbon, deodorization, ethanol precipitation, fermentation, etc. Furthermore, the extracted solution may be subjected to treatments such as concentration to dryness, spray drying, freeze drying, etc., and used as a dried product.

[0016] The intake amount of the white jelly mushroom used in the present invention can be appropriately adjusted according to the dosage form, purpose of use, age, body weight, etc. The intake amount of the white jelly mushroom per day for an adult, in terms of the fruiting body of the white jelly mushroom, can be orally ingested once to several times a day in the range of 0.05 to 3,000 mg, preferably 0.5 to 2,000 mg. There may be cases where an amount less than the above intake range is sufficient, and there may also be cases where it is necessary to ingest beyond the range. Also, regarding the method of adding the medicinal ingredient in formulation, it may be added in advance or during the manufacturing process, and it may be appropriately selected considering workability.

[0017] The muscle strength decline inhibitor of the present invention can be used as a food, quasi-drug, or pharmaceutical. As a food, it can be used in the form of tablets, soft capsules, hard capsules, granules, tablets, gummies, beverages, jelly, etc. In the case of quasi-drugs and pharmaceuticals, it can be used as oral capsules, powders, granules, tablets, sugar-coated tablets, syrups, pills, suspensions, solutions, emulsions, etc., and parenteral injections, suppositories, etc. To achieve the object of the present invention, ingestion by oral administration is preferred.

[0018] The muscle strength decline inhibitor of the present invention can also contain components such as excipients, stabilizers, lubricants, preservatives, binders, disintegrants, hydrocarbons, fatty acids, alcohols, esters, pH adjusters, antiseptics, fragrances, etc. that are usually used in foods, quasi-drugs, or pharmaceuticals as long as the effects are not impaired. Furthermore, it can also contain components such as plant materials, polyphenols, vitamins, saccharides, proteins, fats and oils, etc.

[0019] The muscle strength decline inhibitor of the present invention can also be combined with other components whose muscle strength decline inhibitory effects are already known. Among them, it is particularly desirable to combine with calcium 3-hydroxy-3-methylbutyrate hydrate (HMB calcium), which is a metabolite of the essential amino acid leucine and has a muscle synthesis promoting effect and a muscle breakdown inhibitory effect. When combining white jellyfish and HMB calcium, the daily intake of HMB calcium is preferably 400 mg to 3,000 mg.

Effects of the Invention

[0020] The muscle strength decline inhibitor characterized by containing the white jellyfish of the present invention exhibits an extremely excellent muscle strength decline inhibitory effect that is effective in preventing / improving sarcopenia and locomotive syndrome based on the white muscle synthesis promoting effect of the white jellyfish.

Modes for Carrying Out the Invention

[0021] The following examples are for illustrative purposes only, and the scope of the claims of the present invention is not limited to these examples in any way. The % of the content shown in the examples indicates % by weight.

Example

[0022] Production Example 1: Hot water extract of white jellyfish mushroom 50 g of dried white jellyfish mushroom fruiting bodies were added to 1 kg of purified water, heated and extracted, and then the extract was concentrated and dried to obtain 5 g of solid matter.

[0023] Production Example 2: 50% ethanol extract of white jellyfish mushroom 100 g of dried white jellyfish mushroom fruiting bodies were added to 900 g of 50% ethanol and extracted at room temperature for 7 days. Then the extract was concentrated and dried to obtain 2.0 g of solid matter.

[0024] Production Example 3: Ethanol extract of white jellyfish mushroom 100 g of dried white jellyfish mushroom fruiting bodies were added to 900 g of ethanol and extracted at room temperature for 7 days. Then the extract was concentrated and dried to obtain 1.0 g of solid matter.

[0025] Next, formulation examples using white jellyfish mushroom are given, but the present invention is not limited thereto.

Example

[0026] Formulation Example 1: Tablet <Formulation> Component Content (%) 1. Hot water extract of white jellyfish mushroom (Production Example 1) 1.0 2. Maltitol Added to make the total amount 100 3. Cellulose 5.0 4. Sucrose fatty acid ester 3.0 <Production method> Components 1 to 3 were mixed, 10% water was added as a binder, and fluidized bed granulation was carried out. Component 4 was added to the formed granules, mixed, and tabletted to obtain tablets of 300 mg per tablet. <Dosage> Take 3 tablets per day.

[0027] Formulation Example 2 Tablet <Formulation> Ingredient Content (%) 1. Hot water extract of white jellyfish (Production Example 1) 1.0 2. HMB Calcium 50.0 3. Maltitol Added to make the total amount 100 4. Cellulose 5.0 5. Sucrose Fatty Acid Ester 3.0 <Production Method> Ingredients 1 to 4 were mixed, 10% water was added as a binder, and fluidized bed granulation was performed. Ingredient 5 was added to the formed granules and mixed, and then tableted to obtain tablets of 300 mg per tablet. <Dosage> Take 3 tablets per day.

[0028] Formulation Example 3 Hard Capsule <Formulation> Ingredient Content (%) 1. 50% Ethanol Extract of White Jellyfish (Production Example 2) 5.0 2. Corn Starch Added to make the total amount 100 3. Sucrose Fatty Acid Ester 3.0 <Production Method> Ingredients 1 to 3 were mixed and filled into No. 2 hard capsules with 250 mg to obtain hard capsule preparations. <Dosage> Take 2 capsules per day.

[0029] Formulation Example 4 Soft Capsule <Formulation> Ingredient Content (%) 1. Ethanol Extract of White Jellyfish (Production Example 3) 0.5 2. Medium Chain Fatty Acid Oil Added to make the total amount 100 3. Beeswax 5.0 4. Glycerin Fatty Acid Ester 5.0 5. Vitamin E 3.0 <Production Method> Ingredients 1 to 5 were mixed and filled with 250 mg into a film composed of gelatin and glycerin, and after drying, soft capsule preparations were obtained. <Usage> Take 3 tablets per day.

[0030] Comparative Example 1: Conventional tablet containing HMB calcium In the tablet of Formulation Example 2, the tablet obtained by replacing the hot water extract of Tremella fuciformis Berk. (Production Example 1) with maltitol was used as a conventional tablet containing HMB calcium.

[0031] Comparative Example 2: Conventional tablet In the tablet of Formulation Example 1, the tablet obtained by replacing the hot water extract of Tremella fuciformis Berk. (Production Example 1) with maltitol was used as a conventional tablet.

Example

[0032] Test Example 1: Effect of Tremella fuciformis Berk. on promoting white muscle synthesis Mouse-derived myoblasts were cultured in DMEM containing 10% fetal bovine serum. Then, they were cultured in DMEM containing 2% horse serum for 6 - 7 days to differentiate into myotube cells. To these myotube cells, the hot water extract of Tremella fuciformis Berk. (Production Example 1), the 50% ethanol extract of Tremella fuciformis Berk. (Production Example 2), or the ethanol extract of Tremella fuciformis Berk. (Production Example 3) was added at final concentrations of 50 μg / mL, 100 μg / mL, and 200 μg / mL, followed by culturing for 24 hours, and gene expression analysis was performed. Gene expression was evaluated by real-time PCR for the gene expression variation of mouse white muscle type myosin heavy chain MyHC IIb. β-actin was used as the internal standard. The gene expression without sample addition was set as 1, and the gene expression ratio was calculated.

[0033] Primer set for MyHC IIb GTGATTTCTCCTGTCACCTCTC (Sequence 1) GGAGGACCGCAAGAACGTGCTGA (Sequence 2) Primer set for β-actin AGATGACCCAGATCATGTTTGAGA (Sequence 3) CACAGCCTGGATGGCTACGTA (Sequence 4)

[0034] The results of Test Example 1 are shown in Table 1. The gene expression of MyHC IIb was enhanced in a concentration-dependent manner by the hot water extract of white jellyfish (Production Example 1), the 50% ethanol extract of white jellyfish (Production Example 2), and the ethanol extract of white jellyfish (Production Example 3). From the above results, it was clarified that white jellyfish has an excellent effect of promoting white muscle synthesis. In addition, the effect of enhancing the production of MyHC IIb by white jellyfish was also confirmed at the protein level by immunostaining using an antibody.

[0035]

Table 1

[0036] Test Example 2 Examination of the Synergistic Effect between White Jellyfish and HMB Calcium in the Action of Promoting White Muscle Synthesis HMB calcium is a metabolite of the essential amino acid leucine and is known to have an effect of promoting muscle synthesis and an effect of suppressing muscle breakdown. Therefore, the synergistic effect with white jellyfish was examined regarding the action of promoting white muscle synthesis. To the myotube cells cultured in the same manner as in Test Example 1, the hot water extract of white jellyfish (Production Example 1), the 50% ethanol extract of white jellyfish (Production Example 2), or the ethanol extract of white jellyfish (Production Example 3) was added so that the final concentration became 100 μg / mL, and further, HMB calcium was added so that the final concentration became 100 μg / mL, followed by culturing for 24 hours, and gene expression analysis was performed. The gene expression was evaluated by the real-time PCR method for the gene expression variation of MyHC IIb, which is the white muscle type myosin heavy chain of mice. β-actin was used as the internal standard. The gene expression without adding the sample was set to 1, and the gene expression ratio was calculated.

[0037] The results of Test Example 2 are shown in Table 2. The hot water extract of white jellyfish (Production Example 1), the 50% ethanol extract of white jellyfish (Production Example 2), and the ethanol extract of white jellyfish (Production Example 3) effectively enhanced the gene expression of MyHC IIb, similar to the results of Test Example 1. On the other hand, the enhancement of MyHC IIb gene expression by HMB calcium was slight. However, when the above-mentioned white jellyfish extracts (Production Examples 1 to 3) and HMB calcium were added in combination, a remarkable enhancement of MyHC IIb gene expression was shown. From the above results, it became clear that the combination of white jellyfish and HMB calcium exhibits an excellent synergistic effect in promoting white muscle synthesis.

[0038]

Table 2

[0039] Test Example 3 Effect of improving knee extension muscle strength by human consumption Forty men and women (aged 40 to 64 years) who were aware of muscle strength decline in the lower extremities were divided into 4 groups of 10 each so that their age and weight were approximately equal. Test group 1 was the group that ingested tablets containing white jellyfish (Formulation Example 1), test group 2 was the group that ingested tablets containing white jellyfish and HMB calcium (Formulation Example 2), test group 3 was the group that ingested conventional tablets containing HMB calcium (Comparative Example 1), and test group 4 was the group that ingested conventional tablets (Comparative Example 2). Each group was made to ingest 3 tablets a day, and the knee extension muscle strength of the right foot (the force applied in the extending direction from the bent knee state) was measured using a muscle strength meter before and 3 months after ingestion. The change amount of muscle strength was calculated by subtracting the measured value before ingestion from the measured value 3 months after ingestion. The unit of muscle strength was kgf (kilogram force).

[0040] The results of Test Example 3 are shown in Table 3. In Test Group 1, Test Group 2, and Test Group 3, an improvement in knee extension muscle strength was observed 3 months after drinking compared to before drinking. Among them, in Test Group 1 that ingested the tablets containing white shiitake mushroom (Formulation Example 1), an improvement in knee extension muscle strength superior to that of Test Group 3 that ingested the conventional tablets containing HMB calcium (Comparative Example 1) was observed. Furthermore, in Test Group 2 that ingested the tablets containing both white shiitake mushroom and HMB calcium (Formulation Example 2), an extremely excellent improvement in knee extension muscle strength was observed. From the above results, it became clear that white shiitake mushroom is effective in suppressing muscle strength decline, and the combination of white shiitake mushroom and HMB calcium is more effective in suppressing muscle strength decline.

[0041]

Table 3

Industrial Applicability

[0042] From the above, the present invention can be used as a muscle strength decline inhibitor containing white shiitake mushroom. The muscle strength decline inhibitor containing white shiitake mushroom of the present invention suppresses the decline of muscle strength without necessarily requiring exercise, and improves skeletal muscle function, thereby being effective in preventing / improving sarcopenia and locomotive syndrome.

Claims

1. A muscle weakness inhibitor characterized by containing white wood ear mushroom.

2. A white muscle synthesis promoter characterized by containing white wood ear mushroom.

3. A white muscle myosin heavy chain production promoter comprising white wood ear fungus.

4. A food composition for suppressing muscle weakness, promoting white muscle synthesis, or promoting white muscle-type myosin heavy chain production, comprising the agent according to any one of claims 1 to 3.

Images