Compositions and methods for TTR gene editing and treating ATTR amyloidosis comprising corticosteroid or use thereof

Abstract

To provide compositions and methods for treating a subject having amyloidosis associated with transthyretin (ATTR).SOLUTION: Compositions and methods for editing within the TTR gene, e.g., introducing double-stranded breaks, in combination with administration of a corticosteroid are provided. The composition comprises (i) an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent and (ii) a guide RNA.SELECTED DRAWING: None

Description

Technical Field

[0001] This patent application claims priority to U.S. Provisional Application No. 62 / 825,676, filed on March 28, 2019 and U.S. Provisional Application No. 62 / 825,637, filed on March 28, 2019, the contents of each of which are hereby incorporated by reference in their entirety for all purposes into this specification.

[0002] This application includes a Sequence Listing that has been electronically submitted in ASCII format, the entire contents of which are hereby incorporated by reference into this specification. The name of the ASCII copy created on March 20, 2020 is 2020-03-20_01155-0029-00PCT_ST25.txt and the size is 967 KB.

Background Art

[0003] Transthyretin (TTR) is a protein produced by the TTR gene and normally functions to transport retinol and thyroxine throughout the body. TTR is primarily synthesized in the liver and produced only slightly in the choroid plexus and retina. TTR normally circulates as a soluble tetrameric protein in the blood.

[0004] Pathogenic variants of TTR that can disrupt tetramer stability can be encoded by mutant alleles of the TTR gene. Mutant TTR can give rise to misfolded TTR that can generate amyloid (i.e., aggregates of misfolded TTR protein). In some cases, pathogenic variants of TTR can cause amyloidosis, i.e., diseases resulting from the accumulation of amyloid. For example, misfolding The wild-type TTR monomer can polymerize within amyloid fibrils in tissues such as the peripheral nerves, heart, and gastrointestinal tract. Amyloid plaques can also contain wild-type TTR deposited on misfolded TTR. In addition, in men over 60 years old, misfolding and deposition of wild-type TTR are observed, which are associated with heart rhythm problems, heart failure, and carpal tunnel. Amyloidosis characterized by TTR deposition can be referred to as "ATTR", "TTR-related amyloidosis", "TTR amyloidosis", or "ATTR amyloidosis", "ATTR familial amyloidosis" (when associated with genetic mutations within the family), or "ATTRwt" or "wild-type ATTR" (when resulting from misfolding and deposition of wild-type TTR).

[0005] ATTR can present a wide range of symptoms, and patients with different types of ATTR can have different characteristics and prognoses. Some types of ATTR include familial amyloid polyneuropathy (FAP), familial amyloid cardiomyopathy (FAC), and wild-type TTR amyloidosis (wt-TTR amyloidosis). FAP generally presents with sensorimotor neuropathy, while FAC and wt-TTR amyloidosis generally present with congestive heart failure. FAP and FAC are usually associated with genetic mutations in the TTR gene, and over 100 different mutations in the TTR gene have been associated with ATTR. In contrast, wt-TTR amyloidosis is associated with aging.

[0006] aging.

[0007] ​​​​​​​​​​​​associated with age and not associated with genetic mutations in TTR. Approximately 50 ,000 patients worldwide are estimated to be at risk of developing FAP and FAC.

[0008] Over 100 mutations in TTR are associated with ATTR, but certain mutations are more closely associated with neuropathy and / or cardiomyopathy. For example, the mutation at T60 in TTR is associated with both cardiomyopathy and neuropathy, the mutation at V30 is more associated with neuropathy, and the mutation at V122 is more associated with cardiomyopathy.

[0009] Various treatment approaches for ATTR have been studied, but there are no approved drugs that stop the progression of the disease and improve the quality of life. Liver transplantation has been studied for the treatment of ATTR, but its use is declining because of the significant risks and the possibility that disease progression may continue after transplantation. Small molecule stabilizers such as diflunisal and tafamidis appear to slow the progression of

[0010] ATTR, but these agents do not stop the progression of the disease. Approaches using small interfering RNA (siRNA) knockdown, antisense knockdown, or monoclonal antibodies targeting amyloid fibrils for destruction are also currently being studied, but the results regarding short-term suppression of TTR expression are encouraging pre-data and there is a need for treatments that can produce long-term suppression of

Summary of the Invention

[0011] Administration of foreign RNA can result in unwanted innate immune responses in the context of gene editing and therapy. Thus, the present disclosure provides compositions and methods for gene editing that can reduce inflammation or immune responses. For example, co-administration of corticosteroids to a subject receiving guide RNA can reduce such inflammation or immune responses.

[0012] Accordingly, the following embodiments are provided. In some embodiments, the invention provides compositions and methods that use corticosteroids in combination with a guide RNA and optionally an RNA-guided DNA binding agent such as a CRISPR / Cas system to substantially reduce or knock out the expression of the TTR gene, thereby substantially reducing or eliminating the production of the TTR protein associated with ATTR. Modification of the TTR gene to substantially reduce or eliminate the production of the TTR protein associated with ATTR can result in long-term reduction or elimination.

Means for Solving the Problems

[0013] The following embodiments are provided herein.

[0014] Embodiment 1 is a method of treating transthyretin-related amyloidosis (ATTR) comprising administering to a subject in need thereof a corticosteroid and a composition, the composition comprising (i) an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent, and (ii) a guide RNA, wherein the guide RNA is a. a guide sequence selected from SEQ ID NOs: 5-82, b. at least 17, 18, 19, or is 20 consecutive nucleotides, or c. a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to the sequence selected from SEQ ID NOs: 5-82, comprising a guide RNA, and thereby treating ATTR, a method

[0015] Embodiment 2 is a method of reducing TTR serum concentration, comprising administering a corticosteroid and a composition to a subject in need thereof, the composition comprising (i) a nucleic acid encoding an RNA-guided DNA binding agent or an RNA-guided DNA binding agent, and (ii) a guide RNA wherein a. a guide sequence selected from SEQ ID NOs: 5-82, b. at least 17, 18, 19, or 20 consecutive nucleotides of the sequence selected from SEQ ID NOs: 5-82, or c. a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to the sequence selected from SEQ ID NOs: 5-82, comprising a guide RNA, and thereby reducing the TTR serum concentration, a method

[0016] Embodiment 3 is a method of reducing or preventing the accumulation of amyloid or amyloid fibrils containing TTR in a subject, comprising administering a corticosteroid and a composition to a subject in need thereof, the composition comprising (i) a nucleic acid encoding an RNA-guided DNA binding agent or an RN A-guided DNA binding agent, and (ii) a guide RNA wherein a. a guide sequence selected from SEQ ID NOs: 5-82, b. at least 17, 18, 19, or b. at least 17, 18, 19, or​ is 20 consecutive nucleotides, or c. a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to a sequence selected from SEQ ID NOs: 5-82, comprising a guide RNA, and thereby reducing the accumulation of amyloid or amyloid fibrils, a method.

[0017] Embodiment 4 is a composition comprising a guide RNA, wherein the guide RNA a. a guide sequence selected from SEQ ID NOs: 5-82, b. at least 17, 18, 19, or is 20 consecutive nucleotides of a sequence selected from SEQ ID NOs: 5-82, or c. a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to a sequence selected from SEQ ID NOs: 5-82, comprising, inducing a double-strand break (DSB) within the TTR gene in a subject and modifying the TTR gene in the cell or subject, treating amyloidosis (ATTR) related to TTR in the subject, reducing the TTR serum concentration in the subject, and / or reducing or preventing the accumulation of amyloid or amyloid fibrils in the subject, a composition for use in combination with a corticosteroid.

[0018] Embodiment 5 is a composition comprising a vector encoding a guide RNA, wherein the guide RNA A a. a guide sequence selected from SEQ ID NOs: 5-82, b. at least 17, 18, 19, or is 20 consecutive nucleotides of a sequence selected from SEQ ID NOs: 5-82, or ​​​​c. An array that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to an array selected from SEQ ID NOs: 5-82, comprising a guide array, inducing a double-strand break (DSB) within the TTR gene in a subject, modifying the TTR gene in a cell or subject, treating amyloidosis (ATTR) related to TTR in a subject, reducing the TTR serum concentration in a subject, and / or reducing or preventing the accumulation of amyloid or amyloid fibrils in a subject, a composition for use in combination with a corticosteroid.

[0019] Embodiment 6 is a composition comprising: (i) a guide RNA comprising: a. a guide sequence selected from SEQ ID NOs: 5-82, b. at least 17, 18, 19, or 20 consecutive nucleotides of a sequence selected from SEQ ID NOs: 5-82, or c. a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to a sequence selected from SEQ ID NOs: 5-82; and (ii) an mRNA encoding an RNA-guided DNA binding agent, the open reading frame of which comprises a sequence having at least 95% identity to SEQ ID NO: 311, the open reading frame of which has at least 95% identity to SEQ ID NO: 311 over at least its first 30, 50, 70, 1 00, 150, 200, 250, or 300 nucleotides, the open reading frame of which has at least 75% of its codons listed in Table 1, ​​​​​​​comprising a set of codons, which is the codon in question, The open reading frame has an adenine content in the range of its minimum adenine content ~ 150% of its minimum adenine content, and / or The open reading frame has an adenine nucleotide content in the range of its minimum adenine nucleotide content ~ 150% of its minimum adenine nucleotide content, and is inducing a double-strand break (DSB) within the TTR gene in a subject and modifying the TTR gene in the cell or subject, treating amyloidosis (ATTR) related to TTR in the subject, reducing the TTR serum concentration in the subject, and / or reducing or preventing the accumulation of amyloid or amyloid fibrils in the subject, a composition for use in combination with a corticosteroid.

[0020] Embodiment 7 is a composition, (i) a vector encoding a guide RNA, wherein the guide RNA is a. a guide sequence selected from SEQ ID NOs: 5 to 82, b. at least 17, 18, 19, or 20 consecutive nucleotides of a sequence selected from SEQ ID NOs: 5 to 82, or c. a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to a sequence selected from SEQ ID NOs: 5 to 82, comprising a vector, (ii) an mRNA encoding an RNA-guided DNA binding agent, wherein the open reading frame comprises a sequence having at least 95% identity with SEQ ID NO: 311, the open reading frame has at least its first 30, 50, 70, ​​​​​100, 150, 200, 250, or 300 nucleotides in length and having at least 95% identity with SEQ ID NO: 311, wherein the open reading frame consists of a set of codons, at least 75% of which are codons listed in Table 1, and the open reading frame has an adenine content in the range of its minimum adenine content to 150% of its minimum adenine content, and / or the open reading frame has an adenine dinucleotide content in the range of its minimum adenine dinucleotide content to 150% of its minimum adenine dinucleotide content, and is a composition for use in combination with a corticosteroid in a method for inducing double-strand breaks (DSBs) within the TTR gene in a subject, modifying the TTR gene in a cell or subject, treating transthyretin-related amyloidosis (ATTR) in a subject, reducing the TTR serum concentration in a subject, and / or reducing or preventing the accumulation of amyloid or amyloid fibrils in a subject. Embodiment 8 is a composition or method for use in any one of the uses of Embodiments 1-3 or 5-7, wherein the method comprises administering the composition by an infusion longer than 30 minutes, such as longer than 60 minutes, or longer than 120 minutes.

[0021]

[0022] Embodiment 9 is a composition or method of any one of the preceding embodiments, wherein the guide RNA comprises a guide sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82.

[0023] Embodiment 10 is a composition or method of any one of the preceding embodiments, wherein the guide RNA comprises a guide sequence selected from SEQ ID NO: 5, 6, 7, 8, 9, 12, 13, 14, 15, 16, 17, 22, 23, 27, 29, 30, 35, 36, 37, 38, 55, 6 1, 63, 65, 66, 68, or 69.

[0024] Embodiment 11 is a composition of any one of Embodiments 4-10 for use in inducing a double-strand break (DSB) in the TTR gene in a cell or subject.

[0025] Embodiment 12 is a composition of any one of Embodiments 4-11 for use in modifying the TTR gene in a cell or subject.

[0026] Embodiment 13 is a composition of any one of Embodiments 4-12 for use in treating transthyretin-related amyloidosis (ATTR) in a subject.

[0027] Embodiment 14 is a composition of any one of Embodiments 4-13 for use in reducing the TTR serum concentration in a subject.

[0028] Embodiment 15 is a composition of any one of Embodiments 4-14 for use in reducing or preventing the accumulation of amyloid or amyloid fibrils in a subject.

[0029] Embodiment 16 is a method or composition for use of any one of the preceding embodiments, wherein the corticosteroid is dexamethasone, betamethasone, prednisone, prednisolone, methylprednisolone, cortisone, hydrocortisone, triamcinolone, or etamcinonab. ​

[0030] Embodiment 17 is a composition for any one of the methods or uses in the preceding embodiments, wherein the corticosteroid is dexamethasone.

[0031] Embodiment 18 is a composition for any one of the methods or uses in the preceding embodiments, wherein the corticosteroid is administered before the composition.

[0032] Embodiment 19 is a composition for any one of the methods or uses in the preceding embodiments, wherein the corticosteroid is administered after the composition.

[0033] Embodiment 20 is a composition for any one of the methods or uses in the preceding embodiments, wherein the corticosteroid is administered simultaneously with the composition.

[0034] Embodiment 21 is a composition for any one of the methods or uses in the preceding embodiments, wherein the corticosteroid is administered within about 5 minutes to about 168 hours before the composition is administered.

[0035] Embodiment 22 is a composition for any one of the methods or uses in the preceding embodiments, wherein the corticosteroid is administered within about 5 minutes to about 168 hours after the composition is administered.

[0036] Embodiment 23 is a composition for any one of the methods or uses in the preceding embodiments, wherein the corticosteroid is administered 5 minutes, 10 minutes, 15 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 6 hours, 12 hours, 18 hours, 1 day, 1.5 days, 2 days, 3 days, 4 days, 5 days, 6 days, or 1 week before the composition is administered.

[0037] ​​​​​​​​​​​ Embodiment 24 is a composition for any one of the methods or uses of the preceding embodiments, wherein the corticosteroid is administered 5 minutes, 10 minutes, 15 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 6 hours, 12 hours, 18 hours, 1 day, 1.5 days, 2 days, 3 days, 4 days, 5 days, 6 days, or 1 week before the composition is administered.

[0038] Embodiment 25 is a composition for any one of the methods or uses of the preceding embodiments, wherein at least two doses of corticosteroid are administered before or after the administration of the composition.

[0039] Embodiment 26 is a composition for any one of the methods or uses of the preceding embodiments, wherein at least two doses of corticosteroid and at least two doses of the composition are administered.

[0040] Embodiment 27 is a composition for any one of the methods or uses of the preceding embodiments, wherein the corticosteroid is administered to the subject at a dose of 0.75 mg to 20 mg.

[0041] Embodiment 28 is a composition for the method or use of Embodiment 27, wherein the corticosteroid is administered to the subject at a dose of about 0.01 to 0.4 mg / kg, for example, 0.1 to 0.35 mg / kg or 0.25 to 0.35 mg / kg.

[0042] Embodiment 29 is a composition for any one of the methods or uses of the preceding embodiments, wherein the corticosteroid is administered to the subject parenterally or by injection.

[0043] Embodiment 30 is a composition for the preceding embodiments, wherein the corticosteroid is administered to the subject via intravenous injection. ​​​​​​It is a composition for any one of the methods or uses of the embodiments.

[0044] Embodiment 31 is a composition for any one of the methods or uses of any one of the preceding embodiments, wherein the corticosteroid is administered to the subject intramuscularly or by injection. It is a composition for any one of the methods or uses of any one of the preceding embodiments, wherein the corticosteroid is administered to the subject intramuscularly or by injection.

[0045] Embodiment 32 is a composition for any one of the methods or uses of Embodiments 1 to 31, wherein the corticosteroid is administered orally to the subject. It is a composition for any one of the methods or uses of any one of the preceding embodiments, wherein the corticosteroid is administered orally to the subject.

[0046] Embodiment 33 is a composition for any one of the methods or uses of Embodiment 32, wherein the corticosteroid is administered orally to the subject before the composition is administered to the subject by intravenous injection. It is a composition for any one of the methods or uses of Embodiment 32, wherein the corticosteroid is administered orally to the subject before the composition is administered to the subject by intravenous injection. It is a composition for any one of the methods or uses of Embodiment 32, wherein the corticosteroid is administered orally to the subject after the composition is administered to the subject by intravenous injection.

[0047] Embodiment 34 is a composition for any one of the methods or uses of Embodiment 32, wherein the corticosteroid is administered orally to the subject after the composition is administered to the subject by intravenous injection. It is a composition for any one of the methods or uses of Embodiment 32, wherein the corticosteroid is administered orally to the subject after the composition is administered to the subject by intravenous injection. It is a composition for any one of the methods or uses of Embodiment 32, wherein the corticosteroid is administered orally to the subject after the composition is administered to the subject by intravenous injection.

[0048] Embodiment 35 is a composition for any one of the methods or uses of Embodiments 32 and 33, wherein the corticosteroid is dexamethasone, and dexamethasone is administered orally to the subject in an amount of 20 mg for 6 to 12 hours before the composition is administered to the subject. It is a composition for any one of the methods or uses of Embodiments 32 and 33, wherein the corticosteroid is dexamethasone, and dexamethasone is administered orally to the subject in an amount of 20 mg for 6 to 12 hours before the composition is administered to the subject. It is a composition for any one of the methods or uses of Embodiments 32 and 33, wherein the corticosteroid is dexamethasone, and dexamethasone is administered orally to the subject in an amount of 20 mg for 6 to 12 hours before the composition is administered to the subject.

[0049] Embodiment 36 is a composition for any one of the methods or uses of Embodiments 32, 33, or 35, wherein the corticosteroid is dexamethasone, and dexamethasone is administered intravenously to the subject in an amount of 20 mg for 30 minutes to 6 to 12 hours before the composition is administered to the subject. It is a composition for any one of the methods or uses of Embodiments 32, 33, or 35, wherein the corticosteroid is dexamethasone, and dexamethasone is administered intravenously to the subject in an amount of 20 mg for 30 minutes to 6 to 12 hours before the composition is administered to the subject. It is a composition for any one of the methods or uses of Embodiments 32, 33, or 35, wherein the corticosteroid is dexamethasone, and dexamethasone is administered intravenously to the subject in an amount of 20 mg for 30 minutes to 6 to 12 hours before the composition is administered to the subject. It is a composition for any one of the methods or uses of Embodiments 32, 33, or 35, wherein the corticosteroid is dexamethasone, and dexamethasone is administered intravenously to the subject in an amount of 20 mg for 30 minutes to 6 to 12 hours before the composition is administered to the subject.

[0050] Embodiment 37 is a composition for any one of the methods or uses of the preceding embodiments, wherein the composition is administered by infusion for about 45 to 75 minutes, 75 to 105 minutes, 105 to 135 minutes, 135 to 165 minutes, 165 to 195 minutes, 195 to 225 minutes, 225 to 255 minutes, 255 to 285 minutes, 285 to 315 minutes, 315 to 345 minutes, or 345 to 375 minutes. In some embodiments, the composition is administered by infusion for about 1.5 to 6 hours. Embodiment 38 is a composition for any one of the methods or uses of the preceding embodiments, wherein the composition is administered by infusion for about 60 minutes, about 90 minutes, about 120 minutes, about 150 minutes, about 180 minutes, or about 240 minutes. Embodiment 39 is a composition for any one of the methods or uses of the preceding embodiments, wherein the composition is administered by infusion for about 120 minutes. Embodiment 40 is a composition for any one of the methods or uses of the preceding embodiments, wherein the corticosteroid is dexamethasone. Embodiment 41 is a composition for any one of the methods or uses of the preceding embodiments, wherein the method further comprises administering an infusion prophylaxis, the infusion prophylaxis comprising one or more of acetaminophen, an H1 blocker, or an H2 blocker, and optionally, one or more of acetaminophen, an H1 blocker, or an H2 blocker is administered simultaneously with and / or prior to the corticosteroid.

[0051]

[0052]

[0053]

[0054]

[0055] ​​​​​​​​​​​​​Embodiment 42 is a composition for the method or use of Embodiment 41, wherein each of acetaminophen, an H1 blocker, or an H2 blocker is administered.

[0056] Embodiment 42a is a composition for the method or use of Embodiment 41 or 42, wherein an H1 blocker and / or an H2 blocker is administered orally.

[0057] Embodiment 42b is a composition for the method or use of any one of Embodiments 41 - 42a, wherein the injection prophylaxis comprises an intravenous corticosteroid (e.g., dexamethasone 8 - 12 mg, or 10 mg or an equivalent) and acetaminophen (e.g., oral acetaminophen 500 mg).

[0058] Embodiment 42c is a composition for the method or use of any one of Embodiments 41 - 42b, wherein the injection prophylaxis is administered as a necessary pre - medication before administering a guide RNA - containing composition, e.g., an LNP composition.

[0059] Embodiment 43 is a composition for the method or use of any one of Embodiments 41 - 42c, wherein the H1 blocker is diphenhydramine.

[0060] Embodiment 44 is a composition for the method or use of any one of Embodiments 41 - 43, wherein the H2 blocker is ranitidine.

[0061] Embodiment 45 is a composition for the method or use of any one of the preceding embodiments, wherein the first dose of corticosteroid is administered about 8 - 24 hours before the composition is administered, and the second dose of corticosteroid is administered about 1 - 2 hours before the composition is administered. ​

[0062] Embodiment 46 is a composition for any one of the methods or uses of the preceding embodiments, wherein the first dose of corticosteroid is administered orally and the second dose of corticosteroid is administered intravenously before the composition is administered.

[0063] Embodiment 47 is a composition for any one of the methods or uses of Embodiments 45 and 46, wherein the method further comprises administering one or more of acetaminophen, an H1 blocker, or an H2 blocker, and optionally, one or more of acetaminophen, an H1 blocker, or an H2 blocker is administered simultaneously with the second dose of corticosteroid.

[0064] Embodiment 48 is a composition for any one of the methods or uses of the preceding embodiments, wherein the first dose of corticosteroid is administered orally about 8 to 24 hours before the composition is administered and the second dose of corticosteroid is administered intravenously about 1 to 2 hours before the composition is administered.

[0065] Embodiment 49 is a composition for any one of the methods or uses of the preceding embodiments, wherein the first dose of corticosteroid is administered orally about 8 to 24 hours before the composition is administered and the second dose of corticosteroid is administered intravenously about 1 to 2 hours before the composition is administered, simultaneously with the administration of acetaminophen, an H1 blocker, and an H2 blocker.

[0066] Embodiment 50 is a composition for any one of the methods or uses of the preceding embodiments, wherein the corticosteroid is dexamethasone, and about 8 to 24 hours before the composition is administered to a subject, the first dose of dexamethasone is in an amount of about 6 to 10 mg. ​​​​​​​​​​​​​Administered orally to an elephant, a second dose of dexamethasone is in an amount of about 8-12 mg, and the composition is administered to the elephant about 1-2 hours before oral administration of acetaminophen and intravenous administration of an H1 blocker and an H2 blocker, and is administered intravenously to the subject, optionally, the H1 blocker is diphenhydramine, the H2 blocker is ranitidine, and / or optionally , the subject is human, and is a composition for any one of the methods or uses of the preceding embodiments.

[0067] Embodiment 51 is such that the corticosteroid is dexamethasone, and a first dose of dexamethasone is orally administered to the subject in an amount of 8 mg about 8-24 hours before the composition is administered to the subject, a second dose of dexamethasone is in an amount of 10 mg, and is administered intravenously to the subject about 1-2 hours before the composition is administered to the subject, along with oral administration of acetaminophen and intravenous administration of an H1 blocker and an H2 blocker, optionally, the H1 blocker is diphenhydramine, the H2 blocker is ranitidine, and is a composition for any one of the methods or uses of the preceding embodiments.

[0068] Embodiment 52 is such that the composition is administered by infusion in an amount of 3 mg / kg for about 1.5-6 hours, a first dose of corticosteroid is orally administered about 8-24 hours before the composition is infused, a second dose of corticosteroid is intravenously administered about 1-2 hours before the composition is infused, and is a composition for any one of the methods or uses of the preceding embodiments.

[0069] Embodiment 53 is by administering a corticosteroid, a composition comprising guide RNA ​​​​​​A composition for any one of the methods or uses of the prior embodiments for improving tolerability .

[0070] Embodiment 54 is a composition for any one of the methods or uses of the prior embodiments that reduces the incidence or severity of one or more of inflammation, nausea, vomiting, elevated blood ALT concentration, hyperpyrexia, and / or hyperalgesia in response to a composition containing guide RNA by administering a corticosteroid . . .

[0071] Embodiment 55 is a composition for any one of the methods or uses of the prior embodiments that reduces or inhibits the production or activity of one or more interferons and / or inflammatory cytokines in response to a composition containing guide RNA by administering a corticosteroid . . .

[0072] Embodiment 56 is a composition for any one of the methods or uses of the prior embodiments in which the composition reduces serum TTR levels .

[0073] Embodiment 57 is a composition for the method or use of Embodiment 56 in which the serum TTR level is reduced by at least 50% compared to the serum TTR level before administration of the composition .

[0074] Embodiment 58 is a composition for the method or use of Embodiment 56 in which the serum TTR level is reduced by 50 - 60%, 60 - 70%, 70 - 80%, 80 - 90%, 90 - 95%, 95 - 98%, 98 - 99%, or 99 - 100% compared to the serum TTR level before administration of the composition .

[0075] Embodiment 59 is a composition for any one of the prior embodiments in which the composition causes editing of the TTR gene A composition for one method or use.

[0076] Embodiment 60 is a composition for the method or use of Embodiment 59, where the editing is calculated as a percentage of the aggregate being edited (editing percentage).

[0077] Embodiment 61 is a composition for the method or use of Embodiment 60, where the editing percentage is 30 - 99% of the aggregate.

[0078] Embodiment 62 is a composition for the method or use of Embodiment 61, where the editing percentage is 30 - 35%, 35 - 40%, 40 - 45%, 45 - 50%, 50 - 55%, 55 - 60%, 60 - 65%, 65 - 70%, 70 - 75%, 75 - 80%, 80 - 85%, 85 - 90%, 90 - 95%, or 95 - 99% of the aggregate. 5%, 45 - 50%, 50 - 55%, 55 - 60%, 60 - 65%, 65 - 70 ~75%, 75 - 80%, 80 - 85%, 85 - 90%, 90 - 95%, or 95 - 9 9% of the aggregate.

[0079] Embodiment 63 is a composition for the method or use of any one of the preceding embodiments, which reduces amyloid deposition in at least one tissue.

[0080] Embodiment 64 is a composition for the method or use of Embodiment 63, where at least one tissue includes one or more of the stomach, colon, sciatic nerve, or dorsal root ganglion.

[0081] Embodiment 65 is a composition for the method or use of any one of Embodiments 63 or 64, where amyloid deposition is measured 8 weeks after administration of the composition.

[0082] Embodiment 66 is a composition for the method or use of any one of Embodiments 63 - 65, where amyloid deposition is compared to a negative control or the level measured before administration of the composition. ​ is as follows.

[0083] Embodiment 67 is a composition for any one of the methods or uses of Embodiments 63 - 66, wherein amyloid deposition is measured in a biopsy sample and / or by immunostaining. is as follows. is as follows.

[0084] Embodiment 68 is a composition for any one of the methods or uses of Embodiments 63 - 67, wherein amyloid deposition is reduced by 30 - 35%, 35 - 40%, 40 - 45%, 45 - 50%, 50 - 55%, 55 - 60%, 60 - 65%, 65 - 70%, 70 - 75%, 75 - 80%, 80 - 85%, 85 - 90 %, 90 - 95%, or 95 - 99% compared to the amyloid deposition observed in a negative control. is as follows. is as follows.

[0085] Embodiment 69 is a composition for any one of the methods or uses of Embodiments 63 - 68, wherein amyloid deposition is reduced by 30 - 35%, 35 - 40%, 40 - 45%, 45 - 50%, 50 - 55%, 55 - 60%, 60 - 65%, 65 - 70%, 70 - 75%, 75 - 80%, 80 - 85%, 85 - 90 %, 90 - 95%, or 95 - 99% compared to the amyloid deposition observed prior to administration of the composition. is as follows. is as follows.

[0086] Embodiment 70 is a composition for any one of the methods or uses of the preceding embodiments, wherein the composition is administered or delivered at least twice. is as follows.

[0087] Embodiment 71 is a composition for the method or use of Embodiment 70, wherein the composition is administered or delivered at least three times. is as follows.

[0088] Embodiment 72 is a composition for the method or use of Embodiment 70, wherein the composition is administered or delivered at least four times. It is a composition for a method or use.

[0089] Embodiment 73 is a composition for the method or use of Embodiment 70, wherein the composition is administered or delivered up to 5, 6, 7, 8, 9, or 10 times. or delivered.

[0090] Embodiment 74 is a composition for the method or use of any one of Embodiments 70-73, wherein the administration or delivery is performed at intervals of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, or 15 days. or delivered.

[0091] Embodiment 75 is a composition for the method or use of any one of Embodiments 70-73, wherein the administration or delivery is performed at intervals of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, or 15 weeks. or delivered.

[0092] Embodiment 76 is a composition for the method or use of any one of Embodiments 70-73, wherein the administration or delivery is performed at intervals of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, or 15 months. or delivered.

[0093] Embodiment 77 is a method or composition of any one of the preceding embodiments, wherein the guide sequence is selected from SEQ ID NOs: 5-82. or composition.

[0094] Embodiment 78 is a method or composition of any one of the preceding embodiments, wherein the guide RNA is at least partially complementary to a target sequence present in the human TTR gene. or composition.

[0095] Embodiment 79 is a method or composition of any one of the preceding embodiments, wherein the target sequence is in exon 1, 2, 3, or 4 of the human TTR gene. It is the method or composition of Embodiment 78 as described herein.

[0096] Embodiment 80 is the method or composition of Embodiment 78, where the target sequence is within exon 1 of the human TTR gene.

[0097] Embodiment 81 is the method or composition of Embodiment 78, where the target sequence is within exon 2 of the human TTR gene.

[0098] Embodiment 82 is the method or composition of Embodiment 78, where the target sequence is within exon 3 of the human TTR gene.

[0099] Embodiment 83 is the method or composition of Embodiment 78, where the target sequence is within exon 4 of the human TTR gene.

[0100] Embodiment 84 is a composition for any one of the methods or uses of the preceding embodiments, where the guide sequence is complementary to the target sequence within the plus strand of TTR.

[0101] Embodiment 85 is a method or composition of any one of Embodiments 1 to 83, where the guide sequence is complementary to the target sequence within the minus strand of TTR.

[0102] Embodiment 86 is a method or composition of any one of Embodiments 1 to 83, where the first guide sequence is complementary to the first target sequence within the plus strand of the TTR gene, and the composition further comprises a second guide sequence that is complementary to the second target sequence within the minus strand of the TTR gene.

[0103] Embodiment 87 is a composition of the preceding embodiments, where the guide RNA is dual guide (dgRNA). It is any one of the methods or compositions of the state.

[0104] Embodiment 88 is the method or composition of Embodiment 1, wherein the guide RNA is a single guide (sgRNA). It is any one of the methods or compositions of Embodiments 1 to 86.

[0105] Embodiment 89 is the method or composition of Embodiment 88, wherein the sgRNA contains any one of the guide sequences of SEQ ID NOs: 5 to 82 and any one of nucleotides 21 to 100 of SEQ ID NO. 3. It is the method or composition of Embodiment 88. It is.

[0106] Embodiment 90 is any one of the methods or compositions of Embodiments 88 and 89, wherein the sgRNA contains a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to a sequence selected from SEQ ID NOs: 87 to 124. It is. It is the method or composition of Embodiment 88. It is.

[0107] Embodiment 91 is the method or composition of Embodiment 88, wherein the sgRNA contains a sequence selected from SEQ ID NOs: 87 to 124. It is the method or composition of Embodiment 88.

[0108] Embodiment 92 is any one of the methods or compositions of the previous embodiments, wherein the guide RNA contains at least one modification. It is.

[0109] Embodiment 93 is the method or composition of Embodiment 92, wherein at least one modification contains a 2'-O-methyl (2'-O-Me) modified nucleotide. It is the method or composition of Embodiment 92.

[0110] Embodiment 94 is the method or composition of Embodiment 92 or 93, wherein at least one modification contains a phosphorothioate (PS) bond between nucleotides. It is.

[0111] Embodiment 95 is any one method or composition of Embodiments 92-94, wherein at least one modification comprises a 2'-fluoro (2'-F) modified nucleotide.

[0112] Embodiment 96 is any one method or composition of Embodiments 92-95, wherein at least one modification comprises a 5'-end modification, a 3'-end modification, or both a 5'- and 3'-end modification.

[0113] Embodiment 97 is any one method or composition of Embodiments 92-96, wherein at least one modification comprises a modification in one or more of the first 5 nucleotides at the 5'-end.

[0114] Embodiment 98 is any one method or composition of Embodiments 92-97, wherein at least one modification comprises a modification in one or more of the last 5 nucleotides at the 3'-end.

[0115] Embodiment 99 is any one method or composition of Embodiments 92-98, wherein at least one modification comprises a PS bond between the first 4 nucleotides.

[0116] Embodiment 100 is any one method or composition of Embodiments 92-99, wherein at least one modification comprises a PS bond between the last 4 nucleotides.

[0117] Embodiment 101 is any one method or composition of Embodiments 92-100, wherein at least one modification comprises a 2'-O-Me modified nucleotide in the first 3 nucleotides at the 5'-end.

[0118] ​​​​​​​​​​Embodiment 102 is any one of Embodiments 92 to 101, wherein at least one modification comprises a 2'-O-Me modified nucleotide in the last three nucleotides at the 3' end. method or composition.

[0119] Embodiment 103 is any one of Embodiments 92 to 102, wherein the guide RNA comprises the modified nucleotide of SEQ ID NO: 3. method or composition.

[0120] Embodiment 104 is any one of the preceding embodiments, wherein the composition further comprises a pharmaceutically acceptable excipient. method or composition.

[0121] Embodiment 105 is any one of the preceding embodiments, wherein the guide RNA is associated with a lipid nanoparticle (LNP). method or composition.

[0122] Embodiment 106 is the method or composition of Embodiment 105, wherein the LNP comprises an ionizable lipid.

[0123] Embodiment 107 is the method or composition of Embodiment 106, wherein the LNP comprises a biodegradable ionizable lipid.

[0124] Embodiment 108 is any one of Embodiments 105 to 107, wherein the LNP comprises an amine lipid, such as a CCD lipid. method or composition.

[0125] Embodiment 109 is any one of Embodiments 105 to 108, wherein the LNP comprises a helper lipid. method or composition.

[0126] Embodiment 110 is the method or composition of any one of Embodiments 105 to 109, wherein the LNP comprises a stealth lipid, and optionally (i) The LNP contains a lipid component, and the lipid component contains about 50 to 60 mol% of an amine lipid such as lipid A amine lipid, about 8 to 10 mol% of neutral lipid, and about 2.5 to 4 mol% of stealth lipid ( for example, PEG lipid), and the remainder of the lipid component is a helper lipid, and the N / P ratio of the LNP composition is about 6, (ii) The LNP contains about 50 to 60 mol% of an amine lipid such as lipid A, and about 27 to 39. 5 mol% of helper lipid, about 8 to 10 mol% of neutral lipid, and about 2.5 to 4 mol% of stealth lipid (for example, PEG lipid), and the N / P ratio of the LNP composition is about 5 to 7 (for example, about 6), (iii) The LNP contains a lipid component, and the lipid component contains about 50 to 60 mol% of an amine lipid such as lipid A, about 5 to 15 mol% of neutral lipid, and about 2.5 to 4 mol% of stealth lipid (for example, PEG lipid), and the remainder of the lipid component is a helper lipid, and the N / P ratio of the LNP composition is about 3 to 10, (iv) The LNP contains a lipid component, and the lipid component contains about 40 to 60 mol% of an amine lipid such as lipid A, about 5 to 15 mol% of neutral lipid, and about 2.5 to 4 mol% of stealth lipid (for example, PEG lipid), and the remainder of the lipid component is a helper lipid, and the N / P ratio of the LNP composition is about 6, (v) The LNP contains a lipid component, and the lipid component contains about 50 to 60 mol% of an amine lipid such as lipid A, about 5 to 15 mol% of neutral lipid, and about 1.5 to 10 mol% of stealth lipid (for example, PEG lipid), and the remainder of the lipid component is a helper lipid, and the N / P ratio of the LNP composition is about 6, (vi) The LNP contains a lipid component, and the lipid component contains about 40 to 60 mol% of an amine lipid such as An amine lipid, about 0 to 10 mol% of a neutral lipid, and about 1.5 to 10 mol% of a stealth lipid (for example, a PEG lipid), wherein the remainder of the lipid component is a helper lipid, and the N / P ratio of the LNP composition is about 3 to 10, (vii) The LNP contains a lipid component, and the lipid component contains about 40 to 60 mol% of an amine lipid such as lipid A , less than about 1 mol% of a neutral lipid, and about 1.5 to 10 mol% of a stealth lipid (for example, a PEG lipid), wherein the remainder of the lipid component is a helper lipid, and the N / P ratio of the LNP composition is about 3 to 10, (viii) The LNP contains a lipid component, and the lipid component contains about 40 to 60 mol% of any amine lipid such as lipid A and about 1.5 to 10 mol% of a stealth lipid (for example, a PEG lipid), wherein the remainder of the lipid component is a helper lipid, and the N / P ratio of the LNP composition is about 3 to 10 and the LNP composition essentially does not contain or contains no neutral phospholipid, or (ix) The LNP contains a lipid component, and the lipid component contains about 50 to 60 mol% of an amine lipid such as lipid A and about 8 to 10 mol% of a neutral lipid and about 2.5 to 4 mol% of a stealth lipid (for example, a PEG lipid), wherein the remainder of the lipid component is a helper lipid, and the N / P ratio of the LNP composition is about 3 to 7, a method or composition according to any one of embodiments 105 to 109.

[0127] Embodiment 111 is a method or composition according to any one of embodiments 105 to 110, wherein the LNP contains a neutral lipid.

[0128] Embodiment 112 is a method or composition according to any one of embodiments 105 to 111, wherein the amine lipid is present at about 50 mol%.

[0129] ​​​​​​​ Embodiment 113 is any one of the methods or compositions of Embodiments 105-112, in which neutral lipid is present at about 9 mol%.

[0130] Embodiment 114 is any one of the methods or compositions of Embodiments 105-113, in which stealth lipid is present at about 3 mol%.

[0131] Embodiment 115 is any one of the methods or compositions of Embodiments 105-114, in which helper lipid is present at about 38 mol%.

[0132] Embodiment 116 is any one of the methods or compositions of Embodiments 105-115, in which the N / P ratio of the LNP composition is about 6.

[0133] Embodiment 117 is any one of the methods or compositions of Embodiments 105-116, in which the LNP contains a lipid component, the lipid component contains about 50 mol% of an amine lipid such as lipid A, about 9 mol% of a neutral lipid such as DSPC, and about 3 mol% of a stealth lipid such as a PEG lipid (e.g., PEG2k-DMG), and the remainder of the lipid component is a helper lipid such as cholesterol, and the N / P ratio of the LNP composition is about 6.

[0134] Embodiment 118 is any one of the methods or compositions of Embodiments 105-117, in which the amine lipid is lipid A.

[0135] Embodiment 119 is any one of the methods or compositions of Embodiments 105-118, in which the neutral lipid is DSPC.

[0136] Embodiment 120 is any one of the methods or compositions of Embodiments 105-119, in which the stealth lipid is PEG2k-DMG. ​​​​​​​​​​One of any 19 methods or compositions.

[0137] Embodiment 121 is one of any 19 methods or compositions of Embodiments 105 - 120, wherein the helper lipid is cholesterol. One of any 19 methods or compositions.

[0138] Embodiment 122 is one of any 19 methods or compositions of Embodiments 105 - 121, wherein the LNP contains a lipid component, the lipid component contains about 50 mol% lipid A, about 9 mol% DSPC, and about 3 mol% PEG2k - DMG, the remainder of the lipid component is cholesterol, and the N / P ratio of the LNP composition is about 6. One of any 19 methods or compositions. Embodiment 123 is one of any 19 methods or compositions of the preceding embodiments, wherein the composition further comprises an RNA - guided DNA binding agent. One of any 19 methods or compositions.

[0139] Embodiment 124 is one of any 19 methods or compositions of the preceding embodiments, wherein the composition further comprises a polynucleotide encoding an RNA - guided DNA binding agent. One of any 19 methods or compositions.

[0140] Embodiment 125 is the method or composition of Embodiment 124, wherein the polynucleotide is mRNA. One of any 19 methods or compositions.

[0141] Embodiment 126 is one of any 19 methods or compositions of Embodiments 123 - 125, wherein the RNA - guided DNA binding agent is a Cas nuclease. One of any 19 methods or compositions.

[0142] Embodiment 127 is one of any 19 methods or compositions of Embodiments 123 - 126, wherein the RNA - guided DNA binding agent is a Cas derived from a type II CRISPR / Cas system. One of any 19 methods or compositions.

[0143] Embodiment 128 is one of any 19 methods or compositions of Embodiments 123 - 127, wherein the RNA - guided DNA binding agent is a Cas derived from a type II CRISPR / Cas system. One of any 19 methods or compositions.

[0144] Embodiment 128 is a method or composition of any one of Embodiments 123 to 127, wherein the RNA-guided DNA binding agent is Cas9.

[0145] Embodiment 129 is a method or composition of Embodiment 128, wherein the RNA-guided DNA binding agent is S.pyogenes Cas9 nuclease.

[0146] Embodiment 130 is a method or composition of any one of Embodiments 124 to 129, wherein the polynucleotide comprises an open reading frame encoding an RNA-guided DNA binding agent, and a. the open reading frame comprises a sequence having at least 95% identity with SEQ ID NO: 311, and b. the open reading frame has at least 95% identity with SEQ ID NO: 311 over at least its first 30, 50, 70, 1 00, 150, 200, 250, or 300 nucleotides, and c. the open reading frame consists of a set of codons, at least 75% of which are codons listed in Table 4, and d. the open reading frame has an adenine content in the range of its minimum adenine content to 150% of its minimum adenine content, and / or e. the open reading frame has an adenine dinucleotide content in the range of its minimum adenine dinucleotide content to 150% of its minimum adenine dinucleotide content.

[0147] Embodiment 131 is a method or composition of any one of Embodiments 124 to 129, wherein the open reading frame has at least 10%, 12%, 15%, 20%, 25%, 30%, or 35% of its sequence identical to SEQ ID NO: ​The composition or method of Embodiment 130 having at least 95% identity with 311 .

[0148] Embodiment 132 is the composition or method of Embodiment 130 or 131, wherein the open reading frame has at least 9 5%, 96%, 97%, 98%, 99%, 99.5%, or 100% identity with SEQ ID NO: 311 and contains the sequence.

[0149] Embodiment 133 is the composition or method of any one of Embodiments 130 - 132, wherein at least 75%, 80 %, 85%, 90%, 95%, 98%, 99%, or 100% of the codons of the open reading frame are the codons listed in Table 4 .

[0150] Embodiment 134 is the composition or method of any one of Embodiments 130 - 133, wherein the open reading frame has an adenine content in the range of its minimum adenine content to 101%, 102%, 103%, 105%, 1 10%, 115%, 120%, 125%, 130%, 135%, 140%, 145%, or 150% of its minimum adenine content .

[0151] Embodiment 135 is the composition or method of any one of Embodiments 130 - 134, wherein the open reading frame has an adenine dinucleotide content in the range of its minimum adenine dinucleotide content to 101%, 102%, 103%, 105%, 110%, 115%, 120%, 125%, 130%, 135%, 140%, 145%, or 150% of its minimum adenine dinucleotide content .

[0152] ​​Embodiment 136 is a composition or method of any one of Embodiments 124 to 135, wherein the polynucleotide has at least 90% identity with any one of SEQ ID NOs: 232, 234, 236, 238, 241, or 275 to 277 and includes a 5’ UTR.

[0153] Embodiment 137 is a composition or method of any one of Embodiments 124 to 136, wherein the polynucleotide includes a 3’UTR having at least 90% identity with any one of SEQ ID NOs: 233, 235, 237, 239, or 240.

[0154] Embodiment 138 is a composition or method of any one of Embodiments 124 to 137, wherein the polynucleotide includes a 5’UTR and a 3’UTR from the same source.

[0155] Embodiment 139 is a composition or method of any one of Embodiments 124 to 138, wherein the polynucleotide includes a 5’ cap selected from Cap0, Cap1, and Cap2.

[0156] Embodiment 140 is a composition or method of any one of Embodiments 124 to 139, wherein the open reading frame includes a sequence having at least 9 5%, 96%, 97%, 98%, 99%, 99.5%, or 100% identity with SEQ ID NO: 311.

[0157] Embodiment 141 is a composition or method of any one of Embodiments 125 to 140, wherein at least 10% of the uridine in the mRNA is replaced with modified uridine.

[0158] Embodiment 142 is a composition or method of any one of Embodiments 125 to 141, wherein the modified uridine is N1-methyl-pseudouridine, pseudouridine A composition or method according to Embodiment 141, which is one or more of gin, 5-methoxyuridine, or 5-iodouridine. A composition or method of Form 141.

[0159] Embodiment 143 is a composition or method of Embodiment 141, wherein the modified uridine is one or both of N1-methyl-pseudouridine or 5-methoxyuridine. A composition or method of Embodiment 141. .

[0160] Embodiment 144 is a composition or method of Embodiment 141, wherein the modified uridine is N1-methyl-pseudouridine. A composition or method of Embodiment 141.

[0161] Embodiment 145 is a composition or method of Embodiment 141, wherein the modified uridine is 5-methoxyuridine. A composition or method of Embodiment 141.

[0162] Embodiment 146 is a composition or method of any one of Embodiments 141 to 145, wherein 15% to 45% of the uridine is replaced by the modified uridine. A composition or method of any one of Embodiments 141 to 145.

[0163] Embodiment 147 is a composition or method of any one of Embodiments 141 to 146, wherein at least 20% or at least 30% of the uridine is replaced by the modified uridine. A composition or method of any one of Embodiments 141 to 146. A composition or method of any one of Embodiments 141 to 146.

[0164] Embodiment 148 is a composition or method of Embodiment 147, wherein at least 80% or at least 90% of the uridine is replaced by the modified uridine. A composition or method of Embodiment 147.

[0165] Embodiment 149 is a composition or method of Embodiment 147, wherein 100% of the uridine is replaced by the modified uridine. A composition or method of Embodiment 147.

[0166] Embodiment 150 is a composition or method of Embodiments 123 to 1, wherein the RNA-guided DNA binding agent is modified. One of any 49 methods or compositions.

[0167] Embodiment 151 is a method or composition of Embodiment 150, wherein the modified RNA-guided DNA binding agent comprises a nuclear localization signal (NLS). Embodiment 151 is a method or composition of Embodiment 150, wherein the modified RNA-guided DNA binding agent comprises a nuclear localization signal (NLS).

[0168] Embodiment 152 is a method or composition of any one of the preceding embodiments, wherein the composition is a pharmaceutical formulation and further comprises a pharmaceutically acceptable carrier. Embodiment 152 is a method or composition of any one of the preceding embodiments, wherein the composition is a pharmaceutical formulation and further comprises a pharmaceutically acceptable carrier.

[0169] Embodiment 153 is a composition for use in a method or use of any one of the preceding embodiments, wherein the composition reduces or prevents amyloid or amyloid fibrils comprising TTR. Embodiment 153 is a composition for use in a method or use of any one of the preceding embodiments, wherein the composition reduces or prevents amyloid or amyloid fibrils comprising TTR.

[0170] Embodiment 154 is a composition for use in a method or use of Embodiment 153, wherein the amyloid or amyloid fibrils are within nerves, the heart, or the gastrointestinal tract. Embodiment 154 is a composition for use in a method or use of Embodiment 153, wherein the amyloid or amyloid fibrils are within nerves, the heart, or the gastrointestinal tract.

[0171] Embodiment 155 is a composition for use in a method or use of any one of the preceding embodiments, wherein non-homologous end joining (NHEJ) causes mutations during the repair of double-strand breaks (DSBs) in the TTR gene. Embodiment 155 is a composition for use in a method or use of any one of the preceding embodiments, wherein non-homologous end joining (NHEJ) causes mutations during the repair of double-strand breaks (DSBs) in the TTR gene. Embodiment 155 is a composition for use in a method or use of any one of the preceding embodiments, wherein non-homologous end joining (NHEJ) causes mutations during the repair of double-strand breaks (DSBs) in the TTR gene.

[0172] Embodiment 156 is a composition for use in a method or use of Embodiment 155, wherein NHEJ causes deletions or insertions of nucleotides during the repair of DSBs in the TTR gene. Embodiment 156 is a composition for use in a method or use of Embodiment 155, wherein NHEJ causes deletions or insertions of nucleotides during the repair of DSBs in the TTR gene. Embodiment 156 is a composition for use in a method or use of Embodiment 155, wherein NHEJ causes deletions or insertions of nucleotides during the repair of DSBs in the TTR gene.

[0173] Embodiment 157 is a composition for use in a method or use of Embodiment 156, wherein the deletion or insertion of nucleotides induces a frameshift or nonsense mutation in the TTR gene. Embodiment 157 is a composition for use in a method or use of Embodiment 156, wherein the deletion or insertion of nucleotides induces a frameshift or nonsense mutation in the TTR gene. Embodiment 157 is a composition for use in a method or use of Embodiment 156, wherein the deletion or insertion of nucleotides induces a frameshift or nonsense mutation in the TTR gene.

[0174] Embodiment 158 is a composition for the method or use of Embodiment 155 or 156, wherein a frameshift or nonsense mutation is induced in at least 5 0% of the TTR genes.

[0175] Embodiment 159 is a composition for the method or use of Embodiment 158, wherein a frameshift or nonsense mutation is induced in 50% - 60 %, 60% - 70%, 70% or 80%, 80% - 90%, 90 - 95%, 95% - 9 9%, or 99% - 100% of the TTR genes.

[0176] Embodiment 160 is a composition for the method or use of any one of Embodiments 156 - 159, wherein a nucleotide deletion or insertion occurs at least 50 times more in the TTR gene than at the off-target site.

[0177] Embodiment 161 is a composition for the method or use of Embodiment 160, wherein a nucleotide deletion or insertion occurs 50 - 150 times, 150 - 500 times, 500 - 150 0 times, 1500 - 5000 times, 5000 - 15000 times, 15000 - 30000 times, or 30000 - 60000 times more in the TTR gene than at the off-target site.

[0178] Embodiment 162 is a composition for the method or use of any one of Embodiments 156 - 161, wherein a nucleotide deletion or insertion occurs at 3 or fewer, 2 or fewer, 1 or fewer, or 0 off-target sites in primary human hepatocytes, and optionally, the off-target sites do not occur in protein-coding regions within the genome of primary human hepatocytes. ​

[0179] Embodiment 163 is a method or composition for use, wherein the number of off-target sites where nucleotide deletions or insertions occur in cells overexpressing Cas9 is less than the number of off-target sites where nucleotide deletions or insertions occur in primary human hepatocytes, and optionally, the off-target sites do not occur within the protein-coding regions in the genome of primary human hepatocytes, as in Embodiment 162. and occur at off-target sites in primary human hepatocytes, and optionally, the off-target sites do not occur within the protein-coding regions in the genome of primary human hepatocytes. and occur at off-target sites in primary human hepatocytes, and optionally, the off-target sites do not occur within the protein-coding regions in the genome of primary human hepatocytes. and occur at off-target sites in primary human hepatocytes, and optionally, the off-target sites do not occur within the protein-coding regions in the genome of primary human hepatocytes, as in Embodiment 162. method or composition for use.

[0180] Embodiment 164 is a method or composition for use according to Embodiment 163, wherein the cells overexpressing Cas9 are HEK293 cells that stably express Cas9. method or composition for use according to Embodiment 163, wherein the cells overexpressing Cas9 are HEK293 cells that stably express Cas9.

[0181] Embodiment 165 is a method or composition for use according to any one of Embodiments 162 to 164, wherein the number of off-target sites in primary human hepatocytes is determined by analyzing genomic DNA derived from primary human hepatocytes transfected in vitro with Cas9 mRNA and guide RNA, and optionally, the off-target sites do not occur within the protein-coding regions in the genome of primary human hepatocytes. RNA and guide RNA, and optionally, the off-target sites do not occur within the protein-coding regions in the genome of primary human hepatocytes. RNA and guide RNA, and optionally, the off-target sites do not occur within the protein-coding regions in the genome of primary human hepatocytes. RNA and guide RNA, and optionally, the off-target sites do not occur within the protein-coding regions in the genome of primary human hepatocytes, as in any one of Embodiments 162 to 164. method or composition for use.

[0182] Embodiment 166 is a method or composition for use according to any one of Embodiments 162 to 164, wherein the number of off-target sites in primary human hepatocytes is determined by an oligonucleotide insertion assay that includes analyzing genomic DNA derived from primary human hepatocytes transfected in vitro with Cas9 mRNA, guide RNA, and donor oligonucleotide, and optionally, the off-target sites do not occur within the protein-coding regions in the genome of primary human hepatocytes. RNA, guide RNA, and donor oligonucleotide, and optionally, the off-target sites do not occur within the protein-coding regions in the genome of primary human hepatocytes. RNA, guide RNA, and donor oligonucleotide, and optionally, the off-target sites do not occur within the protein-coding regions in the genome of primary human hepatocytes. RNA, guide RNA, and donor oligonucleotide, and optionally, the off-target sites do not occur within the protein-coding regions in the genome of primary human hepatocytes. RNA, guide RNA, and donor oligonucleotide, and optionally, the off-target sites do not occur within the protein-coding regions in the genome of primary human hepatocytes, as in any one of Embodiments 162 to 164. method or composition for use.

[0183] Embodiment 167 is such that the sequence of the guide RNA is a) SEQ ID NO: 92 or 104, b) SEQ ID NO: 87, 89, 96, or 113, c) SEQ ID NO: 100, 102, 106, 111, or 112, or d) SEQ ID NO: 88, 90, 91, 93, 94, 95, 97, 101, 103, 108 or 109, and

[0184] optionally, the guide RNA does not generate indels at off-target sites occurring within the protein-coding region in the genome of primary human hepatocytes, and is any one of the methods or compositions of the previous embodiments.

[0185] Embodiment 168 is a composition for reducing the level of TTR in a subject by administering the composition, and is any one of the methods or uses of the previous embodiments.

[0186] Embodiment 169 is a composition for the method or use of Embodiment 168, wherein the level of TTR is reduced by at least 50%.

[0187] Embodiment 170 is a composition for the method or use of Embodiment 169, wherein the level of TTR is reduced by 50% - 60%, 60% - 70%, 70% or 80%, 80% - 90%, 90 - 95%, 95% - 99%, or 99% - 100%.

[0188] Embodiment 171 is a composition for the method or use of Embodiment 168 or 169, wherein the level of TTR is measured in serum, plasma, blood, cerebrospinal fluid, or sputum.

[0189] ​​​​Embodiment 172 is a composition for the method or use of Embodiment 168 or 169, wherein the level of TTR is measured in the liver, choroid plexus, and / or retina.

[0190] Embodiment 173 is a composition for the method or use of any one of Embodiments 168 - 172, wherein the level of TTR is measured via an enzyme-linked immunosorbent assay (ELISA).

[0191] Embodiment 174 is a composition for the method or use of any one of the preceding embodiments, wherein the subject has ATTR.

[0192] Embodiment 175 is a composition for the method or use of any one of the preceding embodiments, wherein the subject is human.

[0193] Embodiment 176 is a composition for the method or use of Embodiment 174 or 175, wherein the subject has ATTRwt.

[0194] Embodiment 177 is a composition for the method or use of Embodiment 174 or 175, wherein the subject has hereditary ATTR.

[0195] Embodiment 178 is a composition for the method or use of any one of the preceding embodiments, wherein the subject has a family history of ATTR.

[0196] Embodiment 179 is a composition for the method or use of any one of the preceding embodiments, wherein the subject has familial amyloid polyneuropathy.

[0197] Embodiment 180 is a composition for the method or use of any one of the preceding embodiments, wherein the subject has only neurological symptoms of ATTR, or mainly neurological symptoms of ATTR A composition for any one of the methods or uses of the prior embodiments, having

[0198] Embodiment 181 is a composition for any one of the methods or uses of Embodiments 1 to 179, wherein the subject has familial amyloid cardiomyopathy. A composition for any one of the methods or uses.

[0199] Embodiment 182 is a composition for any one of the methods or uses of Embodiments 1 to 179 or 181, wherein the subject has only cardiac symptoms of ATTR or mainly cardiac symptoms of ATTR. A composition for any one of the methods or uses. is.

[0200] Embodiment 183 is a composition for any one of the methods or uses of the prior embodiments, wherein the subject expresses TTR having a V30 mutation. A composition for any one of the methods or uses.

[0201] Embodiment 184 is a composition for the method or use of Embodiment 183, wherein the V30 mutation is V30A, V30G, V30L, or V30M. A composition for the method or use.

[0202] Embodiment 185 is a composition for any one of the methods or uses of the prior embodiments, wherein the subject expresses TTR having a T60 mutation. A composition for any one of the methods or uses.

[0203] Embodiment 186 is a composition for the method or use of Embodiment 185, wherein the T60 mutation is T60A. A composition for the method or use.

[0204] Embodiment 187 is a composition for any one of the methods or uses of the prior embodiments, wherein the subject expresses TTR having a V122 mutation. A composition for any one of the methods or uses.

[0205] Embodiment 188 is a composition for the method or use of Embodiment 187, wherein the V122 mutation is V122A, V122I, or V122(-). A composition for the method or use.

[0206] Embodiment 189 is a composition for any one of the preceding embodiments, wherein the subject expresses wild-type TTR, for a method or use.

[0207] Embodiment 190 is a composition for any one of Embodiments 1-182 or 189, wherein the subject does not express TTR having a V30, T60, or V122 mutation, for a method or use.

[0208] Embodiment 191 is a composition for any one of Embodiments 1-182 or 189-190, wherein the subject does not express TTR having a pathological mutation, for a method or use.

[0209] Embodiment 192 is a composition for any one of Embodiments 190-192, wherein the subject is homozygous for wild-type TTR, for a method or use.

[0210] Embodiment 193 is a composition for any one of the preceding embodiments, wherein the subject experiences improvement, stabilization, or a slower rate of change in the symptoms of sensorimotor neuropathy after administration.

[0211] Embodiment 194 is a composition for the method or use of Embodiment 193, wherein improvement, stabilization, or a slower rate of change in sensorimotor neuropathy is measured using electromyography, nerve conduction studies, or patient-reported outcomes.

[0212] Embodiment 195 is a composition for any one of the preceding embodiments, wherein the subject experiences improvement, stabilization, or a slower rate of change in the symptoms of congestive heart failure.

[0213] ​​​​​​​​​​Embodiment 196 is one in which congestive heart failure is improved, stabilized, or the change is slowed down and is a composition for the method or use of Embodiment 195, which is measured using a cardiac biomarker test, a pulmonary function test, a chest x-ray, or an electrocardiogram method

[0214] Embodiment 197 is a composition for the method or use of any one of the preceding embodiments, in which the composition or pharmaceutical formulation is administered via a viral vector

[0215] Embodiment 198 is a composition for the method or use of any one of the preceding embodiments, in which the composition or pharmaceutical formulation is administered via lipid nanoparticles

[0216] Embodiment 199 is a composition for the method or use of any one of the preceding embodiments, in which the subject is tested for specific mutations within the TTR gene before administering the composition or formulation

[0217] Embodiment 200 is a method or composition of any one of Embodiments 1 to 199, in which the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 5

[0218] Embodiment 201 is a method or composition of any one of Embodiments 1 to 199, in which the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 6

[0219] Embodiment 202 is a method or composition of any one of Embodiments 1 to 199, in which the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 7

[0220] Embodiment 203 is a method or composition of any one of Embodiments 1 to 199, in which the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 8 ​​​​​​​​​

[0221] Embodiment 204 is one method or composition of any one of Embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 9.

[0222] Embodiment 205 is one method or composition of any one of Embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 10.

[0223] Embodiment 206 is one method or composition of any one of Embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 11.

[0224] Embodiment 207 is one method or composition of any one of Embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 12.

[0225] Embodiment 208 is one method or composition of any one of Embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 13.

[0226] Embodiment 209 is one method or composition of any one of Embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 14.

[0227] Embodiment 210 is one method or composition of any one of Embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 15.

[0228] Embodiment 211 is one method or composition of any one of Embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 16.

[0229] Embodiment 212 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 17, and it is any one method or composition of Embodiments 1 to 199.

[0230] Embodiment 213 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 18, and it is any one method or composition of Embodiments 1 to 199.

[0231] Embodiment 214 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 19, and it is any one method or composition of Embodiments 1 to 199.

[0232] Embodiment 215 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 20, and it is any one method or composition of Embodiments 1 to 199.

[0233] Embodiment 216 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 21, and it is any one method or composition of Embodiments 1 to 199.

[0234] Embodiment 217 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 22, and it is any one method or composition of Embodiments 1 to 199.

[0235] Embodiment 218 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 23, and it is any one method or composition of Embodiments 1 to 199.

[0236] Embodiment 219 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 24, and it is any one method or composition of Embodiments 1 to 199.

[0237] Embodiment 220 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 25, It is any one method or composition of Embodiments 1 to 199.

[0238] Embodiment 221 is an embodiment where the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 26. It is any one method or composition of Embodiments 1 to 199.

[0239] Embodiment 222 is an embodiment where the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 27. It is any one method or composition of Embodiments 1 to 199.

[0240] Embodiment 223 is an embodiment where the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 28. It is any one method or composition of Embodiments 1 to 199.

[0241] Embodiment 224 is an embodiment where the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 29. It is any one method or composition of Embodiments 1 to 199.

[0242] Embodiment 225 is an embodiment where the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 30. It is any one method or composition of Embodiments 1 to 199.

[0243] Embodiment 226 is an embodiment where the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 31. It is any one method or composition of Embodiments 1 to 199.

[0244] Embodiment 227 is an embodiment where the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 32. It is any one method or composition of Embodiments 1 to 199.

[0245] Embodiment 228 is an embodiment where the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 33. It is any one method or composition of Embodiments 1 to 199.

[0246] Embodiment 229 is one method or composition of any one of Embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 34.

[0247] Embodiment 230 is one method or composition of any one of Embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 35.

[0248] Embodiment 231 is one method or composition of any one of Embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 36.

[0249] Embodiment 232 is one method or composition of any one of Embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 37.

[0250] Embodiment 233 is one method or composition of any one of Embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 38.

[0251] Embodiment 234 is one method or composition of any one of Embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 39.

[0252] Embodiment 235 is one method or composition of any one of Embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 40.

[0253] Embodiment 236 is one method or composition of any one of Embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 41.

[0254] ​​​​​​​​Embodiment 237 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 42, and it is any one method or composition of Embodiments 1 to 199.

[0255] Embodiment 238 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 43, and it is any one method or composition of Embodiments 1 to 199.

[0256] Embodiment 239 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 44, and it is any one method or composition of Embodiments 1 to 199.

[0257] Embodiment 240 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 45, and it is any one method or composition of Embodiments 1 to 199.

[0258] Embodiment 241 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 46, and it is any one method or composition of Embodiments 1 to 199.

[0259] Embodiment 242 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 47, and it is any one method or composition of Embodiments 1 to 199.

[0260] Embodiment 243 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 48, and it is any one method or composition of Embodiments 1 to 199.

[0261] Embodiment 244 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 49, and it is any one method or composition of Embodiments 1 to 199.

[0262] Embodiment 245 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 50, It is any one method or composition of Embodiments 1 to 199.

[0263] Embodiment 246 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 51. It is any one method or composition of Embodiments 1 to 199.

[0264] Embodiment 247 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 52. It is any one method or composition of Embodiments 1 to 199.

[0265] Embodiment 248 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 53. It is any one method or composition of Embodiments 1 to 199.

[0266] Embodiment 249 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 54. It is any one method or composition of Embodiments 1 to 199.

[0267] Embodiment 250 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 55. It is any one method or composition of Embodiments 1 to 199.

[0268] Embodiment 251 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 56. It is any one method or composition of Embodiments 1 to 199.

[0269] Embodiment 252 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 57. It is any one method or composition of Embodiments 1 to 199.

[0270] Embodiment 253 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 58. It is any one method or composition of Embodiments 1 to 199.

[0271] Embodiment 254 is one method or composition of any one of Embodiments 1 to 199, where the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 59.

[0272] Embodiment 255 is one method or composition of any one of Embodiments 1 to 199, where the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 60.

[0273] Embodiment 256 is one method or composition of any one of Embodiments 1 to 199, where the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 61.

[0274] Embodiment 257 is one method or composition of any one of Embodiments 1 to 199, where the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 62.

[0275] Embodiment 258 is one method or composition of any one of Embodiments 1 to 199, where the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 63.

[0276] Embodiment 259 is one method or composition of any one of Embodiments 1 to 199, where the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 64.

[0277] Embodiment 260 is one method or composition of any one of Embodiments 1 to 199, where the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 65.

[0278] Embodiment 261 is one method or composition of any one of Embodiments 1 to 199, where the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 66.

[0279] ​​​​​​​​Embodiment 262 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 67, and it is any one method or composition of Embodiments 1 to 199.

[0280] Embodiment 263 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 68, and it is any one method or composition of Embodiments 1 to 199.

[0281] Embodiment 264 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 69, and it is any one method or composition of Embodiments 1 to 199.

[0282] Embodiment 265 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 70, and it is any one method or composition of Embodiments 1 to 199.

[0283] Embodiment 266 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 71, and it is any one method or composition of Embodiments 1 to 199.

[0284] Embodiment 267 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 72, and it is any one method or composition of Embodiments 1 to 199.

[0285] Embodiment 268 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 73, and it is any one method or composition of Embodiments 1 to 199.

[0286] Embodiment 269 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 74, and it is any one method or composition of Embodiments 1 to 199.

[0287] Embodiment 270 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 75, It is any one method or composition of Embodiments 1 to 199.

[0288] Embodiment 271 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 76. It is any one method or composition of Embodiments 1 to 199.

[0289] Embodiment 272 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 77. It is any one method or composition of Embodiments 1 to 199.

[0290] Embodiment 273 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 78. It is any one method or composition of Embodiments 1 to 199.

[0291] Embodiment 274 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 79. It is any one method or composition of Embodiments 1 to 199.

[0292] Embodiment 275 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 80. It is any one method or composition of Embodiments 1 to 199.

[0293] Embodiment 276 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 81. It is any one method or composition of Embodiments 1 to 199.

[0294] Embodiment 277 is such that the sequence selected from SEQ ID NOs: 5 to 82 is SEQ ID NO: 82. It is any one method or composition of Embodiments 1 to 199.

[0295] Embodiment 278 is the use of a composition or formulation of any of the preceding embodiments for the preparation of a medicament for treating a human subject having ATTR. It is the use of a composition or formulation of any of the preceding embodiments for the preparation of a medicament for treating a human subject having ATTR.

Brief Description of the Drawings

[0296]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10A

Figure 10B

Figure 11A

Figure 11B

Figure 12A

Figure 12B

Figure 12C

Figure 13

Figure 14A-14B

Figure 15A

Figure 15B

Figure 16

Figure 17

Figure 18

Figure 19A-19B

Figure 19C-19D

Figure 20

Figure 21A

Figure 21B

Figure 22A

Figure 22B

Figure 23A

Figure 23B

Figure 24A

Figure 24B

Figure 25A-25B

Figure 25C-25D

Figure 26A

Figure 26B

Figure 26C

Figure 27A

Figure 27B

Figure 27C

Figure 28A

Figure 28B

Figure 28C

Figure 29

Figure 30

Figure 31A

Figure 31B

Figure 31C

BRIEF DESCRIPTION OF THE DRAWINGS

[0297] Here, specific embodiments of the present invention will be referred to in detail, and examples of embodiments of the present invention are illustrated in the accompanying drawings Although the present invention will be described in conjunction with the illustrated embodiments, it will be understood that they are not intended to limit the present invention to those embodiments. On the contrary, the present invention is intended to cover all alternatives, modifications, and equivalents that may be included within the scope of the present invention as defined by the appended claims. Before explaining the present teachings in detail, it should be understood that the present disclosure is not limited to specific compositions or process steps and may therefore vary. As used in this specification and the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a conjugate" includes a plurality of conjugates, reference to "a cell" includes a plurality of cells, and the like.

[0298] Numerical ranges include the values defining the range. Measured and measurable values are understood to be approximate values, taking into account significant digits and errors associated with the measurements. Also, "comprise", "comprises", "comprising", "contain", "contains", "containing", "include", "includes", "including", and "consist of" are used interchangeably and are intended to have the same broad meaning. It should be noted that "consist of" excludes any additional elements, steps, or ingredients not specified. When a composition, method, or apparatus is described as "consisting of" certain elements, steps, or ingredients, it is understood that the composition, method, or apparatus does not include any other elements, steps, or ingredients other than those specifically recited. When a composition, method, or apparatus is described as "consisting essentially of" certain elements, steps, or ingredients, it is understood that the composition, method, or apparatus includes those specifically recited elements, steps, or ingredients

[0299] and any other elements, steps, or ingredients that do not materially affect the basic and novel characteristics of the composition, method, or apparatus. The terms "first", "second", and the like are used herein to distinguish one element, step, or ingredient from another and are not intended to denote a particular order or importance. The terms "comprise", "comprises", "comprising", "contain", "contains", "containing", "include", "includes", "including", and "consist of" are used interchangeably and are intended to have the same broad meaning. "consist of" excludes any additional elements, steps, or ingredients not specified. The use of "comprises", "comprising", "includes", and "including" is not intended to be limiting. The above summary and the following detailed description are both exemplary and are merely for the purpose of explanation and are not to be construed as limiting the teachings. Unless otherwise specifically stated in the above specification, embodiments of the present specification that enumerate various components as "comprising" are also assumed to "consist of" or "consist essentially of" the enumerated components. Embodiments of the present specification that enumerate various components as "consisting of" are also assumed to "comprise" or "consist essentially of" the enumerated components. Embodiments of the present specification that enumerate various components as "consisting essentially of" are also assumed to "consist of" or "comprise" the enumerated components (this interchangeability does not apply to the use of these terms in the claims). The term "or" is used in an inclusive sense, i.e., equivalent to "and / or", unless the context clearly indicates otherwise. The headings of the chapters used in this specification are for structural purposes only and are not to be construed as limiting the desired subject matter. Any material incorporated by reference that conflicts with any term defined in this specification or any other explicit content of this specification, this specification shall prevail. Although the present teachings are described in conjunction with various embodiments, it is not intended to limit the present teachings to such embodiments. On the contrary, the present teachings are to be understood by those skilled in the art. It is to be understood that.

[0300] Unless otherwise specifically stated in the above specification, embodiments of the present specification that enumerate various components as "comprising" are also assumed to "consist of" or "consist essentially of" the enumerated components. Embodiments of the present specification that enumerate various components as "consisting of" are also assumed to "comprise" or "consist essentially of" the enumerated components. Embodiments of the present specification that enumerate various components as "consisting essentially of" are also assumed to "consist of" or "comprise" the enumerated components (this interchangeability does not apply to the use of these terms in the claims). The term "or" is used in an inclusive sense, i.e., equivalent to "and / or", unless the context clearly indicates otherwise. Unless otherwise specifically stated in the above specification, embodiments of the present specification that enumerate various components as "comprising" are also assumed to "consist of" or "consist essentially of" the enumerated components. Embodiments of the present specification that enumerate various components as "consisting of" are also assumed to "comprise" or "consist essentially of" the enumerated components. Embodiments of the present specification that enumerate various components as "consisting essentially of" are also assumed to "consist of" or "comprise" the enumerated components (this interchangeability does not apply to the use of these terms in the claims). The term "or" is used in an inclusive sense, i.e., equivalent to "and / or", unless the context clearly indicates otherwise. Unless otherwise specifically stated in the above specification, embodiments of the present specification that enumerate various components as "comprising" are also assumed to "consist of" or "consist essentially of" the enumerated components. Embodiments of the present specification that enumerate various components as "consisting of" are also assumed to "comprise" or "consist essentially of" the enumerated components. Embodiments of the present specification that enumerate various components as "consisting essentially of" are also assumed to "consist of" or "comprise" the enumerated components (this interchangeability does not apply to the use of these terms in the claims). The term "or" is used in an inclusive sense, i.e., equivalent to "and / or", unless the context clearly indicates otherwise. Unless otherwise specifically stated in the above specification, embodiments of the present specification that enumerate various components as "comprising" are also assumed to "consist of" or "consist essentially of" the enumerated components. Embodiments of the present specification that enumerate various components as "consisting of" are also assumed to "comprise" or "consist essentially of" the enumerated components. Embodiments of the present specification that enumerate various components as "consisting essentially of" are also assumed to "consist of" or "comprise" the enumerated components (this interchangeability does not apply to the use of these terms in the claims). The term "or" is used in an inclusive sense, i.e., equivalent to "and / or", unless the context clearly indicates otherwise. Unless otherwise specifically stated in the above specification, embodiments of the present specification that enumerate various components as "comprising" are also assumed to "consist of" or "consist essentially of" the enumerated components. Embodiments of the present specification that enumerate various components as "consisting of" are also assumed to "comprise" or "consist essentially of" the enumerated components. Embodiments of the present specification that enumerate various components as "consisting essentially of" are also assumed to "consist of" or "comprise" the enumerated components (this interchangeability does not apply to the use of these terms in the claims). The term "or" is used in an inclusive sense, i.e., equivalent to "and / or", unless the context clearly indicates otherwise. Unless otherwise specifically stated in the above specification, embodiments of the present specification that enumerate various components as "comprising" are also assumed to "consist of" or "consist essentially of" the enumerated components. Embodiments of the present specification that enumerate various components as "consisting of" are also assumed to "comprise" or "consist essentially of" the enumerated components. Embodiments of the present specification that enumerate various components as "consisting essentially of" are also assumed to "consist of" or "comprise" the enumerated components (this interchangeability does not apply to the use of these terms in the claims). The term "or" is used in an inclusive sense, i.e., equivalent to "and / or", unless the context clearly indicates otherwise. Unless otherwise specifically stated in the above specification, embodiments of the present specification that enumerate various components as "comprising" are also assumed to "consist of" or "consist essentially of" the enumerated components. Embodiments of the present specification that enumerate various components as "consisting of" are also assumed to "comprise" or "consist essentially of" the enumerated components. Embodiments of the present specification that enumerate various components as "consisting essentially of" are also assumed to "consist of" or "comprise" the enumerated components (this interchangeability does not apply to the use of these terms in the claims). The term "or" is used in an inclusive sense, i.e., equivalent to "and / or", unless the context clearly indicates otherwise. It is assumed that (this interchangeability does not apply to the use of these terms in the claims). The term "or" is used in an inclusive sense, i.e., equivalent to "and / or", unless the context clearly indicates otherwise. Unless the context clearly indicates otherwise, the term "or" is used in an inclusive sense, i.e., equivalent to "and / or". That is, it is used in a meaning equivalent to "and / or".

[0301] The headings of the chapters used in this specification are for structural purposes only and are not to be construed as limiting the desired subject matter. Any material incorporated by reference that conflicts with any term defined in this specification or any other explicit content of this specification, this specification shall prevail. Although the present teachings are described in conjunction with various embodiments, it is not intended to limit the present teachings to such embodiments. On the contrary, the present teachings are to be understood by those skilled in the art. Any material incorporated by reference that conflicts with any term defined in this specification or any other explicit content of this specification, this specification shall prevail. Although the present teachings are described in conjunction with various embodiments, it is not intended to limit the present teachings to such embodiments. On the contrary, the present teachings are to be understood by those skilled in the art. Any material incorporated by reference that conflicts with any term defined in this specification or any other explicit content of this specification, this specification shall prevail. Although the present teachings are described in conjunction with various embodiments, it is not intended to limit the present teachings to such embodiments. On the contrary, the present teachings are to be understood by those skilled in the art. On the contrary, the present teachings are to be understood by those skilled in the art. As will be understood, various alternatives, modifications, and equivalents are included.

[0302] I. Definitions Unless otherwise specified, the following terms and phrases used in this specification are intended to have the following meanings. To have.

[0303] "Polynucleotide" and "nucleic acid" refer to a multimeric compound containing nucleosides or nucleoside analogs having nitrogenous heterocyclic bases or base analogs linked together along a backbone (including polymers that are conventional RNA, DNA, hybrid RNA-DNA, and their analogs). The nucleic acid "backbone" can be composed of various linkages including sugar-phosphate diester linkages, peptide-nucleic acid linkages ("peptide nucleic acid" or PNA, PCT WO95 / 32305), phosphorothioate linkages, methylphosphonate linkages, or combinations of one or more of these. The sugar moiety of the nucleic acid can be ribose, deoxyribose, or a similar compound having a substitution, for example, a 2'methoxy or 2'halide substitution. The nitrogenous bases are conventional bases (A, G, C, T, U), their analogs (e.g., modified uridines such as 5-methoxyuridine, pseudouridine, or N1-methylpseudouridine), inosine, purine or pyrimidine derivatives (e.g., N-methyl deoxyguanosine, deaza- or aza-purines, deaza- or aza-pyrimidines, pyrimidine bases having a substituent at the 5- or 6-position (e.g., 5-methylcytosine), purine bases having a substituent at the 2, 6, or 8-position, 2-amino-6-methylaminopurine, O 4 6 ​​​​​​​​​​​​​​​-Methylguanine, 4-thio-pyrimidine, 4-amino-pyr imidine, 4-dimethylhydrazine-pyrimidine, and O 4 -alkyl-pyrimidine, U.S. Patent No. 5,378,825 and PCT No. WO93 / 13121) may also be used. For general considerations, see The Biochemistry of the Nuc leic Acids 5-36, Adams et al., ed., 11 th ed . 1992). Nucleic acids may contain one or more "abasic" residues in which the backbone does not contain a nitrogenous base at the polymer position (U.S. Patent No. 5,585,481). Nucleic acids may contain only conventional RNA or DNA sugars, bases, and linkages, or may contain both conventional components and substitutions (e.g., a polymer containing a conventional base with a 2'-methoxy linkage, or both a conventional base and one or more base analogs). Nucleic acids contain bicyclic furanose units locked into an RNA mimetic sugar structure and include "locked nucleic acids" (LNAs), analogs containing one or more LNA nucleotide mo nomers that enhance hybridization affinity for complementary RNA and DNA sequences (Vester and Wengel, 2004, Biochemistry 43(42):13233- 41). RNA and DNA have different sugar moieties and may differ by the presence of uracil or its analogs in RNA and thymine or its analogs in DNA.

[0304] As used herein, "polypeptide" refers to a multimeric compound containing amino acid residues that can adopt a three-dimensional conformation. Polypeptides include, but are not limited to, enzymes, enzyme Precursor proteins, regulatory proteins, structural proteins, receptors, nucleic acid-binding proteins, antibodies, etc. are included. The polypeptide may include post-translational modifications, non-natural amino acids, artificial groups, etc., but not necessarily so. The polypeptide may include post-translational modifications, non-natural amino acids, artificial groups, etc., but not necessarily so. The polypeptide may include post-translational modifications, non-natural amino acids, artificial groups, etc., but not necessarily so.

[0305] "Guide RNA", "gRNA", and "guide" are used interchangeably herein to refer to either crRNA (also known as CRISPR RNA) or a combination of crRNA and trRNA (also known as tracrRNA). CrRNA and trRNA can associate as single-stranded RNA molecules (single-guide RNA, sgRNA) or can associate in two separate RNA molecules (dual-guide RNA, dgRNA). "Guide RNA" or "gRNA" refers to various types. TrRNA can be a naturally occurring sequence or a trRNA sequence that has modifications or diversity compared to a naturally occurring sequence. The guide RNA can include modified RNAs as described herein. "Guide RNA", "gRNA", and "guide" are used interchangeably herein to refer to either crRNA (also known as CRISPR RNA) or a combination of crRNA and trRNA (also known as tracrRNA). CrRNA and trRNA can associate as single-stranded RNA molecules (single-guide RNA, sgRNA) or can associate in two separate RNA molecules (dual-guide RNA, dgRNA). "Guide RNA" or "gRNA" refers to various types. TrRNA can be a naturally occurring sequence or a trRNA sequence that has modifications or diversity compared to a naturally occurring sequence. The guide RNA can include modified RNAs as described herein. "Guide RNA", "gRNA", and "guide" are used interchangeably herein to refer to either crRNA (also known as CRISPR RNA) or a combination of crRNA and trRNA (also known as tracrRNA). CrRNA and trRNA can associate as single-stranded RNA molecules (single-guide RNA, sgRNA) or can associate in two separate RNA molecules (dual-guide RNA, dgRNA). "Guide RNA" or "gRNA" refers to various types. TrRNA can be a naturally occurring sequence or a trRNA sequence that has modifications or diversity compared to a naturally occurring sequence. The guide RNA can include modified RNAs as described herein. "Guide RNA", "gRNA", and "guide" are used interchangeably herein to refer to either crRNA (also known as CRISPR RNA) or a combination of crRNA and trRNA (also known as tracrRNA). CrRNA and trRNA can associate as single-stranded RNA molecules (single-guide RNA, sgRNA) or can associate in two separate RNA molecules (dual-guide RNA, dgRNA). "Guide RNA" or "gRNA" refers to various types. TrRNA can be a naturally occurring sequence or a trRNA sequence that has modifications or diversity compared to a naturally occurring sequence. The guide RNA can include modified RNAs as described herein. "Guide RNA", "gRNA", and "guide" are used interchangeably herein to refer to either crRNA (also known as CRISPR RNA) or a combination of crRNA and trRNA (also known as tracrRNA). CrRNA and trRNA can associate as single-stranded RNA molecules (single-guide RNA, sgRNA) or can associate in two separate RNA molecules (dual-guide RNA, dgRNA). "Guide RNA" or "gRNA" refers to various types. TrRNA can be a naturally occurring sequence or a trRNA sequence that has modifications or diversity compared to a naturally occurring sequence. The guide RNA can include modified RNAs as described herein. "Guide RNA", "gRNA", and "guide" are used interchangeably herein to refer to either crRNA (also known as CRISPR RNA) or a combination of crRNA and trRNA (also known as tracrRNA). CrRNA and trRNA can associate as single-stranded RNA molecules (single-guide RNA, sgRNA) or can associate in two separate RNA molecules (dual-guide RNA, dgRNA). "Guide RNA" or "gRNA" refers to various types. TrRNA can be a naturally occurring sequence or a trRNA sequence that has modifications or diversity compared to a naturally occurring sequence. The guide RNA can include modified RNAs as described herein. "Guide RNA", "gRNA", and "guide" are used interchangeably herein to refer to either crRNA (also known as CRISPR RNA) or a combination of crRNA and trRNA (also known as tracrRNA). CrRNA and trRNA can associate as single-stranded RNA molecules (single-guide RNA, sgRNA) or can associate in two separate RNA molecules (dual-guide RNA, dgRNA). "Guide RNA" or "gRNA" refers to various types. TrRNA can be a naturally occurring sequence or a trRNA sequence that has modifications or diversity compared to a naturally occurring sequence. The guide RNA can include modified RNAs as described herein. "Guide RNA", "gRNA", and "guide" are used interchangeably herein to refer to either crRNA (also known as CRISPR RNA) or a combination of crRNA and trRNA (also known as tracrRNA). CrRNA and trRNA can associate as single-stranded RNA molecules (single-guide RNA, sgRNA) or can associate in two separate RNA molecules (dual-guide RNA, dgRNA). "Guide RNA" or "gRNA" refers to various types. TrRNA can be a naturally occurring sequence or a trRNA sequence that has modifications or diversity compared to a naturally occurring sequence. The guide RNA can include modified RNAs as described herein. "Guide RNA", "gRNA", and "guide" are used interchangeably herein to refer to either crRNA (also known as CRISPR RNA) or a combination of crRNA and trRNA (also known as tracrRNA). CrRNA and trRNA can associate as single-stranded RNA molecules (single-guide RNA, sgRNA) or can associate in two separate RNA molecules (dual-guide RNA, dgRNA). "Guide RNA" or "gRNA" refers to various types. TrRNA can be a naturally occurring sequence or a trRNA sequence that has modifications or diversity compared to a naturally occurring sequence. The guide RNA can include modified RNAs as described herein.

[0306] As used herein, "guide sequence" is complementary to a target sequence and functions to direct a guide RNA to the target sequence for binding or modification (e.g., cleavage) by an RNA-guided DNA binder. "Guide sequence" can also be referred to as "targeting sequence" or "spacer sequence". The guide sequence can be, for example, 20 base pairs in length in the case of Streptococcus pyogenes (i.e., Spy Cas9) and related Cas9 homologs / orthologs. For example, 15, 16, 17, 18, 19, 21, 22, 23, 24, or 25 nucleotides in length. As used herein, "guide sequence" is complementary to a target sequence and functions to direct a guide RNA to the target sequence for binding or modification (e.g., cleavage) by an RNA-guided DNA binder. "Guide sequence" can also be referred to as "targeting sequence" or "spacer sequence". The guide sequence can be, for example, 20 base pairs in length in the case of Streptococcus pyogenes (i.e., Spy Cas9) and related Cas9 homologs / orthologs. For example, 15, 16, 17, 18, 19, 21, 22, 23, 24, or 25 nucleotides in length. As used herein, "guide sequence" is complementary to a target sequence and functions to direct a guide RNA to the target sequence for binding or modification (e.g., cleavage) by an RNA-guided DNA binder. "Guide sequence" can also be referred to as "targeting sequence" or "spacer sequence". The guide sequence can be, for example, 20 base pairs in length in the case of Streptococcus pyogenes (i.e., Spy Cas9) and related Cas9 homologs / orthologs. For example, 15, 16, 17, 18, 19, 21, 22, 23, 24, or 25 nucleotides in length. As used herein, "guide sequence" is complementary to a target sequence and functions to direct a guide RNA to the target sequence for binding or modification (e.g., cleavage) by an RNA-guided DNA binder. "Guide sequence" can also be referred to as "targeting sequence" or "spacer sequence". The guide sequence can be, for example, 20 base pairs in length in the case of Streptococcus pyogenes (i.e., Spy Cas9) and related Cas9 homologs / orthologs. For example, 15, 16, 17, 18, 19, 21, 22, 23, 24, or 25 nucleotides in length. As used herein, "guide sequence" is complementary to a target sequence and functions to direct a guide RNA to the target sequence for binding or modification (e.g., cleavage) by an RNA-guided DNA binder. "Guide sequence" can also be referred to as "targeting sequence" or "spacer sequence". The guide sequence can be, for example, 20 base pairs in length in the case of Streptococcus pyogenes (i.e., Spy Cas9) and related Cas9 homologs / orthologs. For example, 15, 16, 17, 18, 19, 21, 22, 23, 24, or 25 nucleotides in length. As used herein, "guide sequence" is complementary to a target sequence and functions to direct a guide RNA to the target sequence for binding or modification (e.g., cleavage) by an RNA-guided DNA binder. "Guide sequence" can also be referred to as "targeting sequence" or "spacer sequence". The guide sequence can be, for example, 20 base pairs in length in the case of Streptococcus pyogenes (i.e., Spy Cas9) and related Cas9 homologs / orthologs. For example, 15, 16, 17, 18, 19, 21, 22, 23, 24, or 25 nucleotides in length. As used herein, "guide sequence" is complementary to a target sequence and functions to direct a guide RNA to the target sequence for binding or modification (e.g., cleavage) by an RNA-guided DNA binder. "Guide sequence" can also be referred to as "targeting sequence" or "spacer sequence". The guide sequence can be, for example, 20 base pairs in length in the case of Streptococcus pyogenes (i.e., Spy Cas9) and related Cas9 homologs / orthologs. For example, 15, 16, 17, 18, 19, 21, 22, 23, 24, or 25 nucleotides in length. Shorter or longer arrays, such as , can also be used as guides. For example, in some embodiments, the guide sequence comprises at least 17, 18, 19, or 20 consecutive nucleotides of a sequence selected from SEQ ID NOs: 5-82. In some embodiments, the target sequence is, for example, within a gene or on a chromosome and is, for example, complementary to the guide sequence. In some embodiments, the degree of complementarity or identity between the guide sequence and its corresponding target sequence can be about 75%, 80%, 85%, 88%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%. For example, in some embodiments, the guide sequence has about 75%, 80%, 85%, 88%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to at least 17, 18, 19, or 20 consecutive nucleotides of a sequence selected from SEQ ID NOs: 5-82. In some embodiments, the guide sequence and the target sequence can be 100% complementary or identical. In other embodiments, the guide sequence and the target sequence may contain at least one mismatch. For example, the guide sequence and the target sequence may contain 1, 2, 3, or 4 mismatches, and the full length of the target sequence is at least 17, 18, 19, 20, or more base pairs. In some embodiments, the guide sequence and the target sequence may contain 1-4 mismatches, and the guide sequence comprises at least 17, 18, 19, 20, or more nucleotides. In some embodiments, the guide sequence and the target sequence contain 1, 2, 3, or may contain four mismatches, and the guide sequence consists of 20 nucleotides comprise.

[0307] Since the nucleic acid substrate of the Cas protein is double-stranded nucleic acid, the target sequence of the Cas protein includes both the plus strand and the minus strand of genomic DNA (i.e., a given sequence and the reverse complement of that sequence ). Therefore, when it is said that the guide sequence is "complementary to the target sequence", it should be understood that the guide RNA can be directed to bind to the reverse complement of the target sequence . Thus, in some embodiments, when the guide sequence binds to the reverse complement of the target sequence, the guide sequence is identical to a specific nucleotide of the target sequence (e.g., a target sequence without PAM), except for the substitution of U with T in the guide sequence . .

[0308] As used herein, "RNA-guided DNA binder" means a polypeptide or a complex of polypeptides having RNA and DNA binding activities, or a DNA binding subunit of such a complex, and the DNA binding activity is sequence-specific and depends on the sequence of RNA . Exemplary RNA-guided DNA binders include Cas cleave se / nickase and its inactivated form ("dCas DNA binder") . "Cas nuclease", also referred to herein as "Cas protein", includes Cas cleave se, Cas nickase, and dCas DNA binder. Cas cleave se / nickase and dCas DNA binder include Csm or Cmr complex of type III CRISP ​​​​Type I CRISPR systems, their Cas3 subunits, and class 2 Cas nucleases are included. As used herein, "class 2 Cas nuclease" is a single-stranded polypeptide having RNA-guided DNA binding activity, such as Cas9 nuclease or Cpf1 nuclease. Class 2 Cas nucleases include class 2 Cas cleases and class 2 Cas nickases (e.g., H840A, D10A, or N863A variants) that further have RNA-guided DNA cleavage or nicking activity, and class 2 dCas DNA binders in which the cleavage / nicking activity is inactivated. Class 2 Cas nucleases include, for example, Cas9, Cpf1, C2c1, C2c2, C2c3, HF Cas9 (e.g., N497A, R661A, Q695A, Q926A variants), HypaCas9 (e.g., N692A, M694A, Q695A, H698A variants), eSPCas9(1.0) (e.g., K810A, K1003A, R1060A variants), and eSPCas9(1.1) (e.g., K848A, K1003A, R1060A variants) proteins, and their modifications. The Cpf1 protein (Zetsche et al., Cell, 163:1-13 (2015)) is homologous to Cas9 and contains an RuvC-like nuclease domain. The Cpf1 sequence of Zetsche is incorporated by reference in its entirety. See, for example, Tables S1 and S3 of Zetsche. "Cas9" includes Spy Cas9, the variants of Cas9 listed herein, and their equivalents. For example, Makarova et al., Nat Re v Microbiol, 13(11):722-36(2015), Shmakov et al., Molecular Cell, 60:385-397 (2015). Light.

[0309] "Modified uridine," as used herein, refers to a compound that has the same hydrogen bond acceptor as uridine and is is used to refer to nucleosides other than thymidine that have one or more structural differences. In some embodiments, the modified uridine is a substituted uridine, i.e., one or more aprotic substituents (e.g., alkoxy, e.g., methoxy) are substituted in place of a proton. In some embodiments, the modified uridine is a pseudouridine. In some embodiments, the modified uridine is a substituted pseudouridine, i.e. That is, one or more aprotic substituents (e.g., alkyl, e.g., methyl) are Alternatively placed pseudouridine, e.g., N1-methylpseudouridine. In some embodiments, the modified uridine is a substituted uridine, a pseudouridine, or substituted pseudouridine.

[0310] As used herein, a "uridine position" refers to a position occupied by a uridine or a modified uridine. Thus, for example, "the 100th position of a uridine" refers to a position in a polynucleotide where the nucleotide sequence is A polynucleotide in which 100% of the bases are modified uridines is a polynucleotide that is identical to a conventional RNA of the same sequence (where all bases are Modifications are made to all positions that could be uridines in the Unless otherwise indicated, the sequences in this disclosure or the accompanying sequence listing ( sequence table or sequence listing U in the polynucleotide sequence can be uridine or a modified uridine.

[0311] As used herein, when alignment of a first sequence to a second sequence shows that more than X% overall of the positions in the second sequence are matched by the first sequence the first sequence is considered to "contain a sequence having at least X% identity" to the second sequence. For example, the sequence AAGA contains a sequence having 100% identity to the sequence AAG, because the alignment gives 100% identity in that there is a match at all three positions of the second sequence. The difference between RNA and DNA (generally, thymidine is exchanged for uridine, or vice versa), and the presence of nucleotide analogs such as modified uridines do not contribute to differences in identity or complementarity between polynucleotides as long as the relevant nucleotides (such as thymidine, uridine, or modified uridine, etc.) have the same complement (for example, adenosine for all of thymidine, uridine, or modified uridine; another example is cytosine and 5-methylcytosine, both of which have guanosine or modified guanosine as a complement). Thus, for example, the sequence 5'-AXG where X is any modified uridine, such as pseudouridine, N1-methylpseudouridine, or 5-methoxyuridine, is considered to be 100% identical to AUG in that both are completely complementary to the same sequence (5'-CAU). Exemplary alignment algorithms are the Smith-Waterman and Needleman-Wunsch algorithms, which are well known in the art. One of ordinary skill in the art can align For a given pair of sequences, it will be understood which selection of algorithms and parameter settings is appropriate. Generally, for amino acids with similar lengths and expected identities, for sequences greater than 50% or for nucleotides, for sequences greater than 75%, the Needleman-Wunsch algorithm with the default settings of the Needleman-Wunsch algorithm interface provided by EBI on the www.ebi.ac.uk web server is generally appropriate. For sequences greater than 50% for amino acids with generally similar lengths and expected identities, or for sequences greater than 75% for nucleotides, the Needleman-Wunsch algorithm with the default settings of the Needleman-Wunsch algorithm interface provided by EBI on the www.ebi.ac.uk web server is generally appropriate. www.ebi.ac.uk web server using the default settings of the Needleman-Wunsch algorithm interface provided by EBI The Needleman-Wunsch algorithm is generally appropriate.

[0312] As used herein, "mRNA" refers to a polynucleotide that is RNA or modified RNA and can be translated into a polypeptide (i.e., can function as a substrate for translation by ribosomes and aminoacylated tRNA). mRNA can include a ribose residue or an analog thereof, such as a 2'-methoxyribose residue, and can include a phosphosugar backbone. In some embodiments, the sugar of the nucleic acid phosphosugar backbone consists essentially of ribose residues, 2'-methoxyribose residues, or combinations thereof. Generally, mRNA does not contain a substantial amount of thymidine residues (e.g., 0 residues or less than 30, 20, 10, 5, 4, 3, or 2 thymidine residues, or a thymidine content of less than 10%, 9%, 8%, 7%, 6%, 5%, 4%, 4%, 3%, 2%, 1%, 0.5%, 0.2%, or 0.1%). mRNA can include modified uridine at some or all of its uridine positions. As used herein, "mRNA" refers to a polynucleotide that is RNA or modified RNA and can be translated into a polypeptide (i.e., can function as a substrate for translation by ribosomes and aminoacylated tRNA). mRNA can include a ribose residue or an analog thereof, such as a 2'-methoxyribose residue, and can include a phosphosugar backbone. In some embodiments, the sugar of the nucleic acid phosphosugar backbone consists essentially of ribose residues, 2'-methoxyribose residues, or combinations thereof. Generally, mRNA does not contain a substantial amount of thymidine residues (e.g., 0 residues or less than 30, 20, 10, 5, 4, 3, or 2 thymidine residues, or a thymidine content of less than 10%, 9%, 8%, 7%, 6%, 5%, 4%, 4%, 3%, 2%, 1%, 0.5%, 0.2%, or 0.1%). mRNA can include modified uridine at some or all of its uridine positions.

[0313] As used herein, the "minimum uridine content" of a given ORF is (a) all ​​​​​​​​​​Using the minimum uridine codon at the position, and (b) encoding the same amino acid sequence as the given ORF which is the uridine content of the ORF. The minimum uridine codon for a given amino acid is the codon with the least amount of uridine (except for the codons for phenylalanine, which is usually 0 or 1, and the minimum uridine codon has 2 uridines). Modified uridine residues are considered equivalent to uridine for the purpose of evaluating the minimum uridine content.

[0314] As used herein, the "minimum uridine dinucleotide content" of a given ORF is , (a) using the minimum uridine codon (as described above) at all positions, and (b) the possible minimum uridine dinucleotide ( UU) content of the ORF that encodes the same amino acid sequence as the given ORF. The uridine dinucleotide (UU) content can be expressed in absolute terms, either as the count of UU dinucleotides in the ORF or as the proportion of positions occupied by the uridine of the uridine dinucleotide (e.g., in AUUAU, since 2 out of 5 positions are occupied by the uridine of the uridine dinucleotide, the uridine dinucleotide content is 40%). Modified uridine residues are considered equivalent to uridine for the purpose of evaluating the minimum uridine dinucleotide content.

[0315] As used herein, the "minimum adenine content" of a given open reading frame (ORF) is the adenine content of the ORF that (a) uses the minimum adenine codon at all positions and (b) encodes the same amino acid sequence as the given ORF. For a given amino The minimum adenine codon of an acid is the codon having the least amount of adenine (except for the codons for lysine and asparagine, which is usually 0 or 1, and the minimum adenine codon has 2 adenines). Modified adenine residues are considered equivalent to adenine for the purpose of evaluating the minimum adenine content. When used herein, the "minimum adenine dinucleotide content" of a given open reading frame (ORF) is (a) using the minimum adenine codon (as described above) at all positions, and (b) the possible minimum adenine dinucleotide (AA) content of an ORF that encodes the same amino acid sequence as the given ORF. The adenine dinucleotide (AA) content can be expressed in absolute terms based on either the count of AA dinucleotides in the ORF or the proportion of positions occupied by adenine of the adenine dinucleotide (e.g., UAAUA has an adenine dinucleotide content of 40% because 2 out of 5 positions are occupied by adenine of the adenine dinucleotide). Modified adenine residues are considered equivalent to adenine for the purpose of evaluating the minimum adenine dinucleotide content. Modified adenine residues are considered equivalent to adenine for the purpose of evaluating the minimum adenine content. When used herein, the "minimum adenine codon" of an acid is the codon having the least amount of adenine (except for the codons for lysine and asparagine, which is usually 0 or 1, and the minimum adenine codon has 2 adenines). Modified adenine residues are considered equivalent to adenine for the purpose of evaluating the minimum adenine content.

[0316] As used herein, the "minimum adenine nucleotide content" of a given open reading frame (ORF) is (a) using the minimum adenine codon (as described above) at all positions, and (b) the possible minimum adenine nucleotide (AA) content of an ORF that encodes the same amino acid sequence as the given ORF. The adenine nucleotide (AA) content can be expressed in absolute terms based on either the count of AA nucleotides in the ORF or the proportion of positions occupied by adenine of the adenine nucleotide (e.g., UAAUA has an adenine nucleotide content of 40% because 2 out of 5 positions are occupied by adenine of the adenine nucleotide). Modified adenine residues are considered equivalent to adenine for the purpose of evaluating the minimum adenine nucleotide content. When used herein, the "minimum adenine codon" of an acid is the codon having the least amount of adenine (except for the codons for lysine and asparagine, which is usually 0 or 1, and the minimum adenine codon has 2 adenines). Modified adenine residues are considered equivalent to adenine for the purpose of evaluating the minimum adenine content. When used herein, the "minimum adenine codon" of an acid is the codon having the least amount of adenine (except for the codons for lysine and asparagine, which is usually 0 or 1, and the minimum adenine codon has 2 adenines). Modified adenine residues are considered equivalent to adenine for the purpose of evaluating the minimum adenine content. When used herein, the "minimum adenine codon" of an acid is the codon having the least amount of adenine (except for the codons for lysine and asparagine, which is usually 0 or 1, and the minimum adenine codon has 2 adenines). Modified adenine residues are considered equivalent to adenine for the purpose of evaluating the minimum adenine content. When used herein, the "minimum adenine codon" of an acid is the codon having the least amount of adenine (except for the codons for lysine and asparagine, which is usually 0 or 1, and the minimum adenine codon has 2 adenines). Modified adenine residues are considered equivalent to adenine for the purpose of evaluating the minimum adenine content. When used herein, the "minimum adenine codon" of an acid is the codon having the least amount of adenine (except for the codons for lysine and asparagine, which is usually 0 or 1, and the minimum adenine codon has 2 adenines). Modified adenine residues are considered equivalent to adenine for the purpose of evaluating the minimum adenine content. When used herein, the "minimum adenine codon" of an acid is the codon having the least amount of adenine (except for the codons for lysine and asparagine, which is usually 0 or 1, and the minimum adenine codon has 2 adenines). Modified adenine residues are considered equivalent to adenine for the purpose of evaluating the minimum adenine content. When used herein, the "minimum adenine codon" of an acid is the codon having the least amount of adenine (except for the codons for lysine and asparagine, which is usually 0 or 1, and the minimum adenine codon has 2 adenines). Modified adenine residues are considered equivalent to adenine for the purpose of evaluating the minimum adenine content. When used herein, the "minimum adenine codon" of an acid is the codon having the least amount of adenine (except for the codons for lysine and asparagine, which is usually 0 or 1, and the minimum adenine codon has 2 adenines). Modified adenine residues are considered equivalent to adenine for the purpose of evaluating the minimum adenine content. When used herein, the "minimum adenine codon" of an acid is the codon having the least amount of adenine (except for the codons for lysine and asparagine, which is usually 0 or 1, and the minimum adenine codon has 2 adenines). Modified adenine residues are considered equivalent to adenine for the purpose of evaluating the minimum adenine content.

[0317] As used herein, "TTR" refers to transthyretin, the gene product of the TTR gene. As used herein, "TTR" refers to transthyretin, the gene product of the TTR gene.

[0318] As used herein, "amyloid" refers to abnormal aggregates of proteins or peptides that are normally soluble. Amyloid is insoluble and can form proteinaceous deposits in organs and tissues. The protein or peptide in amyloid is As used herein, "amyloid" refers to abnormal aggregates of proteins or peptides that are normally soluble. Amyloid is insoluble and can form proteinaceous deposits in organs and tissues. The protein or peptide in amyloid is As used herein, "amyloid" refers to abnormal aggregates of proteins or peptides that are normally soluble. Amyloid is insoluble and can form proteinaceous deposits in organs and tissues. The protein or peptide in amyloid is Multiple copies of the protein stick together and misfold into a form that allows them to form protofibrils. Some forms of amyloid can have normal functions in the human body, but as used herein, "amyloid" refers to abnormal or pathological aggregates of proteins. Amyloid can include a single protein or peptide, such as TTR, or multiple proteins or peptides, such as TTR and additional proteins. As used herein, "amyloid fibrils" refer to insoluble fibers of amyloid that are resistant to degradation. Amyloid fibrils can cause symptoms based on specific proteins or peptides, as well as the tissues and cell types in which they aggregate. As used herein, "amyloidosis" refers to a disease characterized by symptoms caused by the deposition of amyloid or amyloid fibrils. Amyloidosis can affect many organs, including the heart, kidneys, liver, spleen, nervous system, and gastrointestinal tract. As used herein, "ATTR", "TTR-related amyloidosis", "TTR amyloidosis", "ATTR amyloidosis", or "amyloidosis related to TTR" refer to amyloidosis associated with the deposition of TTR.

[0319] As used herein, "familial amyloid cardiomyopathy" or "FAC" refers to hereditary transthyretin amyloidosis (ATTR) characterized primarily by restrictive cardiomyopathy.

[0320]

[0321]

[0322] In FAC, congestive heart failure is common. The average age of onset is approximately 60 to 70 years old. It exists, and the estimated lifespan after diagnosis is 4 to 5 years.

[0323] As used herein, "familial amyloid polyneuropathy" or "FAP" refers to hereditary transthyretin amyloidosis (ATTR) characterized mainly by sensorimotor neuropathy. In FAP, autonomic neuropathy is common. Although neuropathy is the main feature, the symptoms of FAP can also include cachexia, renal failure, and heart disease. The average age of onset of FAP is approximately 30 to 50 years old, and the estimated lifespan after diagnosis is 5 to 15 years. As used herein, "wild-type ATTR" and "ATTRwt" refer to ATTR not associated with pathological TTR mutations such as T60A, V30M, V30A, V30G, V30L, V122I, V122A, or V122(-). ATTRwt has also been called senile systemic amyloidosis. The onset typically occurs in men over 60 years old, and the most common symptoms are abnormal heartbeats such as congestive heart failure and atrial fibrillation. Further symptoms include shortness of breath, fatigue, dizziness, swelling (especially in the legs), nausea, angina, sleep disorders, and

[0324] results of heart dysfunction such as weight loss. A history of carpal tunnel syndrome indicates an increased risk of ATTRwt and, in some cases, may indicate early disease. ATTRwt generally causes a decline in heart function over time, but since wild-type TTR deposits accumulate more slowly, it may have a better prognosis than hereditary ATTR. Existing treatments are similar to other forms of ATTR (except for liver transplantation) and generally include diuretics. V30M, V30A, V30G, V30L, V122I, V122A, or V122 (-), etc. ATTRwt has also been called senile systemic amyloidosis. The onset typically occurs in men over 60 years old, and the most common symptoms are abnormal heartbeats such as congestive heart failure and atrial fibrillation. Further symptoms include shortness of breath, fatigue, dizziness, swelling (especially in the legs), nausea, angina, sleep disorders, and results of heart dysfunction such as weight loss. A history of carpal tunnel syndrome indicates an increased risk of ATTRwt and, in some cases, may indicate early disease. ATTRwt generally causes a decline in heart function over time, but since wild-type TTR deposits accumulate more slowly, it may have a better prognosis than hereditary ATTR. Existing treatments are similar to other forms of ATTR (except for liver transplantation) and generally include diuretics. include shortness of breath, fatigue, dizziness, swelling (especially in the legs), nausea, angina, sleep disorders, and weight loss, which are the results of heart dysfunction. A history of carpal tunnel syndrome indicates an increased risk of ATTRwt and, in some cases, may indicate early disease. ATTRwt generally causes a decline in heart function over time, but since wild-type TTR deposits accumulate more slowly, it may have a better prognosis than hereditary ATTR. Existing treatments are similar to other forms of ATTR (except for liver transplantation) and generally include diuretics. ATTRwt generally causes a decline in heart function over time, but since wild-type TTR deposits accumulate more slowly, it may have a better prognosis than hereditary ATTR. Existing treatments are similar to other forms of ATTR (except for liver transplantation) and generally include diuretics. ATTRwt generally causes a decline in heart function over time, but since wild-type TTR deposits accumulate more slowly, it may have a better prognosis than hereditary ATTR. Existing treatments are similar to other forms of ATTR (except for liver transplantation) and generally include diuretics. Existing treatments are similar to other forms of ATTR (except for liver transplantation) and generally include diuretics. From the restriction of fluid and salt intake to anticoagulants, and in severe cases until heart transplantation, it aims to support or improve heart function. Nevertheless, similar to FAC, ATTRwt may die from heart failure within 3 to 5 years from diagnosis.

[0325] The guide sequences useful for the guide RNA compositions and methods described herein are shown in Table 1 and throughout this application.

[0326] As used herein, "hereditary ATTR" refers to ATTR associated with a mutation in the sequence of the TTR gene. Known mutations in the TTR gene associated with ATTR include mutations that result in TTR having a substitution of T6 0A, V30M, V30A, V30G, V30L, V122I, V122A, or V1 22(-). The mutations include those that result in TTR having a substitution of T60A, V30M, V30A, V30G, V30L, V122I, V122A, or V122(-).

[0327] As used herein, "indel" refers to an insertion / deletion mutation consisting of a number of nucleotides that are either inserted or deleted at the site of a double-strand break (DSB) within the target nucleic acid. The mutations include those that result in TTR having a substitution of T60A, V30M, V30A, V30G, V30L, V122I, V122A, or V122(-). The mutations include those that result in TTR having a substitution of T60A, V30M, V30A, V30G, V30L, V122I, V122A, or V122(-).

[0328] As used herein, "knockdown" refers to a decrease in the expression of a specific gene product (e.g., protein, mRNA, or both). Protein knockdown can be measured by detecting the protein secreted by a tissue or cell aggregate (e.g., in serum or cell culture medium), or by detecting the total cellular amount of the protein from the tissue or cell aggregate of interest. Methods for measuring mRNA knockdown are known and involve isolating mRNA from the tissue or cell aggregate of interest. Protein knockdown can be measured by detecting the protein secreted by a tissue or cell aggregate (e.g., in serum or cell culture medium), or by detecting the total cellular amount of the protein from the tissue or cell aggregate of interest. (e.g., in serum or cell culture medium) by detecting the protein secreted by a tissue or cell aggregate, or by detecting the total cellular amount of the protein from the tissue or cell aggregate of interest. Protein knockdown can be measured by detecting the protein secreted by a tissue or cell aggregate (e.g., in serum or cell culture medium), or by detecting the total cellular amount of the protein from the tissue or cell aggregate of interest. Protein knockdown can be measured by detecting the protein secreted by a tissue or cell aggregate (e.g., in serum or cell culture medium), or by detecting the total cellular amount of the protein from the tissue or cell aggregate of interest. mRNA knockdown can be measured by methods known in the art and involves isolating mRNA from the tissue or cell aggregate of interest. Protein knockdown can be measured by detecting the protein secreted by a tissue or cell aggregate (e.g., in serum or cell culture medium), or by detecting the total cellular amount of the protein from the tissue or cell aggregate of interest. mRNA knockdown can be measured by methods known in the art and involves isolating mRNA from the tissue or cell aggregate of interest. Including NA sequencing. In some embodiments, "knockdown" refers to a certain loss of expression of a specific gene product, e.g., a reduction in the amount of transcribed mRNA, or also a reduction in the amount of protein expressed or secreted by a cell aggregate (including in vivo aggregates such as those found in tissues). When used herein, "knockout" refers to the loss of expression of a specific protein in a cell. Knockout can be measured by detecting the amount of protein secretion from a tissue or cell aggregate (e.g., in serum or cell culture medium), or by detecting the total cellular amount of protein in a tissue or cell aggregate. In some embodiments, a method for "knocking out" TTR in one or more cells (including cell aggregates that include in vivo aggregates such as those found in tissues) is provided. In some embodiments, knockout is a complete loss of expression of TTR protein in the cell, rather than the formation of a mutant TTR protein created, e.g., by an indel. When used herein, "mutant TTR" refers to the gene product of TTR (i.e., the TTR protein) that has a change in its amino acid sequence as compared to the wild-type amino acid sequence of TTR. The human wild-type TTR sequence is available at NCBI Gene ID:7276; Ensembl: ENSG00000118271. For example, mutant forms of TTR associated with ATTR in humans include T60A, V30M, V30A, V30G, V30L, V122I, V122A, or V122(-). It may refer to a reduction in the amount of protein expressed or secreted by a cell aggregate (including in vivo aggregates such as those found in tissues).

[0329] When used herein, "knockout" refers to the loss of expression of a specific protein in a cell. Knockout can be measured by detecting the amount of protein secretion from a tissue or cell aggregate (e.g., in serum or cell culture medium), or by detecting the total cellular amount of protein in a tissue or cell aggregate. In some embodiments, a method for "knocking out" TTR in one or more cells (including cell aggregates that include in vivo aggregates such as those found in tissues) is provided. In some embodiments, knockout is a complete loss of expression of TTR protein in the cell, rather than the formation of a mutant TTR protein created, e.g., by an indel. It can be measured by detecting the amount of protein secretion from a tissue or cell aggregate (e.g., in serum or cell culture medium), or by detecting the total cellular amount of protein in a tissue or cell aggregate. In some embodiments, a method for "knocking out" TTR in one or more cells (including cell aggregates that include in vivo aggregates such as those found in tissues) is provided. In some embodiments, knockout is a complete loss of expression of TTR protein in the cell, rather than the formation of a mutant TTR protein created, e.g., by an indel. It can be measured by detecting the amount of protein secretion from a tissue or cell aggregate (e.g., in serum or cell culture medium), or by detecting the total cellular amount of protein in a tissue or cell aggregate. In some embodiments, a method for "knocking out" TTR in one or more cells (including cell aggregates that include in vivo aggregates such as those found in tissues) is provided. In some embodiments, knockout is a complete loss of expression of TTR protein in the cell, rather than the formation of a mutant TTR protein created, e.g., by an indel. It can be measured by detecting the amount of protein secretion from a tissue or cell aggregate (e.g., in serum or cell culture medium), or by detecting the total cellular amount of protein in a tissue or cell aggregate. In some embodiments, a method for "knocking out" TTR in one or more cells (including cell aggregates that include in vivo aggregates such as those found in tissues) is provided. In some embodiments, knockout is a complete loss of expression of TTR protein in the cell, rather than the formation of a mutant TTR protein created, e.g., by an indel. In some embodiments, a method for "knocking out" TTR in one or more cells (including cell aggregates that include in vivo aggregates such as those found in tissues) is provided. In some embodiments, knockout is a complete loss of expression of TTR protein in the cell, rather than the formation of a mutant TTR protein created, e.g., by an indel. In some embodiments, a method for "knocking out" TTR in one or more cells (including cell aggregates that include in vivo aggregates such as those found in tissues) is provided. In some embodiments, knockout is a complete loss of expression of TTR protein in the cell, rather than the formation of a mutant TTR protein created, e.g., by an indel. In some embodiments, knockout is a complete loss of expression of TTR protein in the cell, rather than the formation of a mutant TTR protein created, e.g., by an indel. In some embodiments, knockout is a complete loss of expression of TTR protein in the cell, rather than the formation of a mutant TTR protein created, e.g., by an indel. In some embodiments, knockout is a complete loss of expression of TTR protein in the cell, rather than the formation of a mutant TTR protein created, e.g., by an indel.

[0330] When used herein, "mutant TTR" refers to the gene product of TTR (i.e., the TTR protein) that has a change in its amino acid sequence as compared to the wild-type amino acid sequence of TTR. The human wild-type TTR sequence is available at NCBI Gene ID:7276; Ensembl: ENSG00000118271. For example, mutant forms of TTR associated with ATTR in humans include T60A, V30M, V30A, V30G, V30L, V122I, V122A, or V122(-). When used herein, "mutant TTR" refers to the gene product of TTR (i.e., the TTR protein) that has a change in its amino acid sequence as compared to the wild-type amino acid sequence of TTR. The human wild-type TTR sequence is available at NCBI Gene ID:7276; Ensembl: ENSG00000118271. For example, mutant forms of TTR associated with ATTR in humans include T60A, V30M, V30A, V30G, V30L, V122I, V122A, or V122(-). When used herein, "mutant TTR" refers to the gene product of TTR (i.e., the TTR protein) that has a change in its amino acid sequence as compared to the wild-type amino acid sequence of TTR. The human wild-type TTR sequence is available at NCBI Gene ID:7276; Ensembl: ENSG00000118271. For example, mutant forms of TTR associated with ATTR in humans include T60A, V30M, V30A, V30G, V30L, V122I, V122A, or V122(-). The human wild-type TTR sequence is available at NCBI Gene ID:7276; Ensembl: ENSG00000118271. For example, mutant forms of TTR associated with ATTR in humans include T60A, V30M, V30A, V30G, V30L, V122I, V122A, or V122(-). For example, mutant forms of TTR associated with ATTR in humans include T60A, V30M, V30A, V30G, V30L, V122I, V122A, or V122(-). For example, mutant forms of TTR associated with ATTR in humans include T60A, V30M, V30A, V30G, V30L, V122I, V122A, or V122(-). is obtained.

[0331] As used herein, "mutant TTR" or "mutant TTR allele" refers to a TTR sequence having a change in the nucleotide sequence of TTR as compared to the wild-type sequence (NCBI Gene ID: 7276; Ensembl: ENSG0000011 8271). 8271)

[0332] As used herein, "ribonucleoprotein" (RNP) or "RNP complex" refers to a guide RNA that includes an RNA-guided DNA binder, such as a Cas nuclease, such as a Cas cleaver zyme, Cas nickase, or dCas DNA binder (e.g., Cas9). In some embodiments, the guide RNA guides an RNA-guided DNA binder, such as Cas9, to a target sequence, and the guide RNA hybridizes to the target sequence, and a drug binds to the target sequence, where the drug is a cleaver or nickase and can perform cleavage or nicking after binding.

[0333] As used herein, "target sequence" refers to a nucleic acid sequence within a target gene that has complementarity to the guide sequence of a gRNA. Through the interaction between the target sequence and the guide sequence, an RNA-guided DNA binder binds within the target sequence and is potentially directed to form a nick or cleavage (depending on the activity of the drug).

[0334]

[0334] As used herein, "treatment" refers to the administration or any application of treatment for a disease or disorder in a subject, including inhibiting the disease, halting its progression, alleviating one or more symptoms of the disease, curing the disease, or ameliorating one or more symptoms of the disease. including preventing recurrence of the above symptoms. For example, treatment of ATTR may include alleviating the symptoms of ATTR.

[0335] As used herein, the term "pathogenic variant" means that a gene product such as TTR has a high probability of being unable to cause, promote, contribute to, or inhibit the onset of diseases such as ATTR.

[0336] As used herein, the term "lipid nanoparticle" (LNP) refers to a particle containing a plurality (i.e., more than one) of lipid molecules that physically associate with each other by intermolecular forces. LNPs can be, for example, microspheres (single-layer and multi-layer vesicles, e.g., in some embodiments, substantially spherical, and in more particular embodiments, may contain an aqueous core) including a lamellar phase lipid bilayer of "liposomes" that may contain a substantial portion of an RNA molecule, e.g., (), a dispersed phase in an emulsion, a micelle, or an internal phase in a suspension. Emulsions, micelles, and suspensions can be suitable compositions for local and / or topical delivery. See, for example, WO2017173054A1 and WO2019067992 the entire contents of which are incorporated herein by reference. Any LNP known to those skilled in the art capable of delivering nucleotides to a subject can be utilized together with a guide RNA and a nucleic acid encoding an RNA-guided DNA binder described herein.

[0337] As used herein, the term "donor oligonucleotide" or "donor template" refers to a desired nucleic acid to be inserted at a target site (e.g., a target site in genomic DNA). ​ Refers to an oligonucleotide containing a nucleic acid sequence. The donor oligonucleotide may be a single-stranded oligonucleotide or a double-stranded oligonucleotide. In some embodiments, the donor oligonucleotide may be delivered together with a nucleic acid sequence encoding a guide RNA and an RNA-guided DNA binding agent (e.g., Cas9) via the use of an LNP or transfection. The donor oligonucleotide may be a single-stranded oligonucleotide or a double-stranded oligonucleotide. In some embodiments, the donor oligonucleotide may be delivered together with a nucleic acid sequence encoding a guide RNA and an RNA-guided DNA binding agent (e.g., Cas9) via the use of an LNP or transfection. the donor oligonucleotide may be delivered together with a nucleic acid sequence encoding a guide RNA and an RNA-guided DNA binding agent (e.g., Cas9) via the use of an LNP or transfection. the donor oligonucleotide may be delivered together with a nucleic acid sequence encoding a guide RNA and an RNA-guided DNA binding agent (e.g., Cas9) via the use of an LNP or transfection.

[0338] As used herein, the term "nuclear localization signal" (NLS) or "nuclear localization sequence" refers to an amino acid sequence that induces the transport of a molecule containing or linked to such a sequence into the nucleus of a eukaryotic cell. The nuclear localization signal may form part of the molecule to be transported. In some embodiments, the NLS may be linked to the rest of the molecule by covalent bonds, hydrogen bonds, or ionic interactions. As used herein, the term "nuclear localization signal" (NLS) or "nuclear localization sequence" refers to an amino acid sequence that induces the transport of a molecule containing or linked to such a sequence into the nucleus of a eukaryotic cell. As used herein, the term "nuclear localization signal" (NLS) or "nuclear localization sequence" refers to an amino acid sequence that induces the transport of a molecule containing or linked to such a sequence into the nucleus of a eukaryotic cell. The nuclear localization signal may form part of the molecule to be transported. As used herein, the term "nuclear localization signal" (NLS) or "nuclear localization sequence" refers to an amino acid sequence that induces the transport of a molecule containing or linked to such a sequence into the nucleus of a eukaryotic cell. The nuclear localization signal may form part of the molecule to be transported. In some embodiments, the NLS may be linked to the rest of the molecule by covalent bonds, hydrogen bonds, or ionic interactions. As used herein, the term "nuclear localization signal" (NLS) or "nuclear localization sequence" refers to an amino acid sequence that induces the transport of a molecule containing or linked to such a sequence into the nucleus of a eukaryotic cell. The nuclear localization signal may form part of the molecule to be transported. In some embodiments, the NLS may be linked to the rest of the molecule by covalent bonds, hydrogen bonds, or ionic interactions.

[0339] As used herein, the phrase "pharmaceutically acceptable" generally means non-toxic, not biologically undesirable, not otherwise unacceptable for pharmaceutical use, and useful for preparing a pharmaceutical composition. As used herein, the phrase "pharmaceutically acceptable" generally means non-toxic, not biologically undesirable, not otherwise unacceptable for pharmaceutical use, and useful for preparing a pharmaceutical composition. As used herein, the phrase "pharmaceutically acceptable" generally means non-toxic, not biologically undesirable, not otherwise unacceptable for pharmaceutical use, and useful for preparing a pharmaceutical composition.

[0340] The term "about" or "approximately" means an acceptable error for a particular value determined by one of ordinary skill in the art, which depends in part on how the value is measured or determined. The term "about" or "approximately" means an acceptable error for a particular value determined by one of ordinary skill in the art, which depends in part on how the value is measured or determined. The term "about" or "approximately" means an acceptable error for a particular value determined by one of ordinary skill in the art, which depends in part on how the value is measured or determined.

[0341] As used herein, "infusion" refers to the active administration of one or more agents over an infusion time of, for example, approximately 30 minutes to 12 hours. In some embodiments, the one or more agents As used herein, "infusion" refers to the active administration of one or more agents over an infusion time of, for example, approximately 30 minutes to 12 hours. In some embodiments, the one or more agents The agent comprises, for example, an LNP containing an mRNA encoding an RNA-guided DNA binding agent (such as Cas9) described herein and a gRNA described herein.

[0342] As used herein, "pre-infusion prophylaxis" refers to a regimen administered to a subject prior to treatment (including, for example, administration of the LNP) that includes one or more or all of an intravenous corticosteroid (such as 10 mg of dexamethasone or an equivalent), an antipyretic (such as 500 mg of oral acetaminophen or paracetamol), an intravenous H1 blocker (such as 50 mg of diphenhydramine or an equivalent), and an intravenous H2 blocker (such as 50 mg of ranitidine or an equivalent). Pre-infusion prophylaxis is optionally combined with pre-administration of an oral corticosteroid (such as 8 mg of dexamethasone or an equivalent). In some embodiments, the oral corticosteroid is administered 8 to 24 hours before treatment. In some embodiments, one or more or all of an intravenous corticosteroid (such as 10 mg of dexamethasone or an equivalent), 500 mg of oral acetaminophen, an intravenous H1 blocker (such as 50 mg of diphenhydramine or an equivalent), and an intravenous H2 blocker (such as 50 mg of ranitidine or an equivalent) are administered 1 to 2 hours before treatment. In some embodiments, the H1 blocker and / or the H2 blocker are administered orally.

[0343] II. Methods and Compositions for Targeting the TTR Gene As described herein, treating amyloidosis (ATTR) associated with TTR in a subject, reducing the TTR serum concentration in a subject, and / or amyloid or ​​​​Methods for reducing or preventing the accumulation of amyloid fibrils, and methods for such methods Related compositions, including compositions for use, are disclosed. Corticosteroids, guide RNA, RNA-guided DNA binders, or Also disclosed herein are polynucleotides encoding the RNA-guided DNA binding agents. For example, in some embodiments, LNP compositions are provided for use in The disclosed compositions, such as compositions, include a guide RNA targeting TTR and, optionally, a RNase A (RNase B) that targets TTR. A-guided DNA binding agents, or such RNA-guided DNA binding agents (e.g., CRIS The nucleic acid includes an open reading frame encoding a PR / Cas system. Subjects treated with such methods and compositions include those having a wild-type or non-wild-type TTR gene sequence. For example, ATTR (ATTRwt, or inherited or The subject may have a familial form of the disease.

[0344] Administration of corticosteroids, infusion prophylaxis, and guide RNA-containing compositions described herein The dosage, frequency, and mode of administration can be independently controlled.

[0345] In some embodiments, the corticosteroid is a guideline R In some embodiments, the corticosteroid is administered prior to the NA-containing composition. , after the guide RNA-containing composition described herein. In the method, a corticosteroid is administered simultaneously with a guide RNA-containing composition described herein. In some embodiments, multiple doses of the corticosteroid are administered It is administered before or after the administration of the composition containing guide RNA. In some embodiments, the multiple doses of the guide RNA-containing composition are administered before or after the administration of the corticosteroid. In some embodiments, multiple doses of corticosteroid and multiple doses of the guide RNA-containing composition are administered.

[0346] A guide RNA-containing composition, for example, an LNP composition containing a guide RNA and optionally a polynucleotide encoding an RNA-guided DNA binder, may be administered by infusion. In some embodiments, the composition is administered by an infusion longer than 30 minutes. In some embodiments, the composition is administered by a 30-minute infusion. In some embodiments, the composition is administered by an infusion longer than 60 minutes. In some embodiments, the composition is administered by an infusion longer than 90 minutes. In some embodiments, the composition is administered by an infusion longer than 120 minutes, longer than 150 minutes, longer than 180 minutes, longer than 240 minutes, longer than 300 minutes, or longer than 360 minutes. In some embodiments, the composition is administered by an infusion of at least 1 hour, at least 2 hours, at least 4 hours, at least 6 hours, at least 7 hours, at least 8 hours, at least 9 hours, at least 10 hours, at least 11 hours, or at least 12 hours. In some embodiments, the composition is administered by an infusion of 0.5 to 1.5 hours, 1.5 to 2.5 hours, 2.5 to 3.5 hours, 3.5 to 4.5 hours, 4.5 to 5.5 hours, 5.5 to 6.5 hours, 6.5 to 7.5 hours, 7.5 to 8.5 hours, 8.5 to 9.5 hours, 9.5 to 10.5 hours, 10.5 to 11.5 hours, or 11.5 to 12.5 hours. It is administered by infusion over time. In some embodiments, the composition is infused for about 60 minutes, about 90 minutes, about 120 minutes, about 150 minutes, about 180 minutes, about 240 minutes, about 300 minutes , or about 360 minutes. In some embodiments, the composition is infused for about 45 - 75 minutes, 75 - 105 minutes, 105 - 135 minutes, 135 - 165 minutes, 165 - 195 minutes, 195 - 225 minutes, 225 - 255 minutes, 255 - 285 minutes, 285 - 315 minutes, 315 - 345 minutes, or 345 - 375 minutes. In some embodiments, the composition is administered by infusion for about 1.5 - 6 hours.

[0347] In some embodiments, the corticosteroid is administered within about 5 minutes to about 168 hours before the administration of the guide RNA-containing composition described herein. In some embodiments , the corticosteroid is administered within about 5 minutes to about 168 hours after the administration of the guide RNA-containing composition described herein. In some embodiments, the corticosteroid is administered at 5 minutes, 10 minutes, 15 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 6 hours, 12 hours before the administration of the guide RNA-containing composition described herein, 18 hours, 24 hours, 36 hours, 48 hours, 72 hours, 96 hours, 120 hours, 144 hours, 168 hours, or an amount of time within a range limited by any two of the foregoing values, and is administered. In some embodiments, the corticosteroid is administered at 1 hour, 2 hours, 3 hours, 4 hours, 6 hours after the administration of the guide RNA-containing composition described herein, 12 hours, 18 hours, 24 hours, 36 hours, 48 hours, 72 hours, 96 hours, 120 hours,​ administered in an amount of time limited by time, 144 hours, 168 hours, or any two of the foregoing values. In certain embodiments, the corticosteroid is administered about 8 to 24 hours before administration of the guide RNA-containing composition, and the injection prophylaxis is administered 1 to 2 hours before administration of the guide RNA-containing composition. The corticosteroid can be administered with or substantially simultaneously with the administration of the guide RNA-containing composition described herein. Where appropriate, a dose of corticosteroid can be administered as at least two sub-doses administered separately at appropriate intervals. In some embodiments, the corticosteroid is administered at least twice before administration of the guide RNA-containing composition described herein. In some embodiments, a dose of corticosteroid is administered at least twice after administration of the guide RNA-containing composition described herein. In some embodiments, the corticosteroid is administered at intervals of 1 hour, 2 hours, 3 hours, 4 hours, 6 hours, 12 hours, 18 hours, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 days, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 weeks, or in an amount of time limited by any two of the foregoing values (e.g., before, with, and / or after administration of the guide RNA-containing composition described herein). In some embodiments, the corticosteroid is administered 1 hour, 2 hours, 3 hours, 4 hours, 6 hours, 12 hours, 18 hours, 1, 2, 3, 4, 5, 6, 7, 8, before administration of the guide RNA-containing composition described herein.

[0348] ​​​​​​​​​​​​​​For 9, 10, 11, 12, 13, 14, 15 days, 3, 4, 5, 6, 7, 8, 9, 10, 1 at intervals of 1, 12, 13, 14, or 15 weeks, or within a time amount limited by any two of the aforementioned values and is administered. In some embodiments, the corticosteroid is administered 1 hour, 2 hours, 3 hours, 4 hours, 6 hours, 12 hours, 18 hours, 1, 2, 3, 4, 5, 6, 7, 8 9, 10, 11, 12, 13, 14, 15 days, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 weeks after administration of the guide RNA-containing composition described herein, or within a time amount limited by any two of the aforementioned values and is administered.

[0349] In some embodiments, the corticosteroid is administered at least twice. In some embodiments, the corticosteroid is administered at least three times. In some embodiments, the corticosteroid is administered at least four times. In some embodiments, the corticosteroid is administered a maximum of 5, 6, 7, 8, 9 times, or 10 times. The first dose may be oral, and the second dose or subsequent doses may be parenteral, for example, by injection. Alternatively, the first dose may be parenteral, and the second dose or subsequent doses may be by oral administration. In some embodiments, the corticosteroid is administered orally before intravenous administration of the guide RNA-containing composition described herein. In some embodiments, the corticosteroid is administered during or at the time of intravenous administration of the guide RNA-containing composition described herein.

[0350] In some embodiments, the corticosteroid is administered orally before intravenous administration of the guide RNA -containing composition described herein. In some embodiments, the corticosteroid is administered during or at the time of intravenous administration of the guide RNA-containing composition described herein. It is administered orally later.

[0351] A. Corticosteroid, injection prophylaxis The corticosteroids used in the disclosed methods and compositions are useful for treating subjects undergoing gene editing and / or therapy with gene editing compositions. Without wishing to be bound by any particular theory, corticosteroids may be useful for reducing inflammation or the immune response to foreign RNA (mRNA encoding a guide RNA or an RNA-guided DNA binder). The corticosteroids used in the disclosed methods and compositions are known in the art and / or may be any of those commercially available from several sources. In some embodiments, injection prophylaxis is administered to the subject prior to the gene editing composition, e.g., at a time 1 to 2 hours prior to administration of the gene editing composition. In some embodiments injection prophylaxis comprises one or more, or all, of an intravenous corticosteroid (e.g., dexamethasone 8 - 12 mg, e.g., 10 mg or an equivalent, or any of the other corticosteroids described elsewhere herein), an antipyretic (e.g., oral acetaminophen (also called paracetamol) 500 mg), an H1 blocker (e.g., diphenhydramine 50 mg or an equivalent), an H2 blocker (e.g., ranitidine 50 mg or an equivalent). In some embodiments, injection prophylaxis comprises an intravenous corticosteroid (e.g., dexamethasone 8 - 12 mg, e.g., 10 mg or an equivalent) and an antipyretic (e.g., oral acetaminophen or paracetamol 500 mg). In some embodiments

[0352] ​​​​​​​​​​In one embodiment, an H1 blocker (e.g., diphenhydramine 50 mg or an equivalent) and / or an H2 blocker (e.g., ranitidine 50 mg or an equivalent) is administered orally. In some embodiments, an H1 blocker (e.g., diphenhydramine 50 mg or an equivalent) and / or an H2 blocker (e.g., ranitidine 50 mg or an equivalent) is administered intravenously. In some embodiments, an intravenous H1 blocker and / or an intravenous H2 blocker is replaced with an equivalent, e.g., an equivalent administered orally. In addition to, or instead of, this, an oral corticosteroid (e.g., dexamethasone 6- 10 mg, e.g., 8 mg or an equivalent, or any of the other corticosteroids described elsewhere in this specification) may be administered, e.g., 8-24 hours before treatment. These dosages may be used, for example, when the subject is a human, e.g., an adult human. In some embodiments, prophylactic infusion is an intravenous corticosteroid (e.g., dexamethasone 10 mg or an equivalent) that may reduce the severity of inflammation, an oral acetaminophen 500 mg that may reduce pain and fever and / or inhibit COX enzymes and / or prostaglandins, and an intravenous H1 blocker (e.g., diphenhydramine 50 mg or an equivalent) and an intravenous H2 blocker (e.g., ranitidine 50 mg or an equivalent) that act to block the action of histamine at the H1 and H2 receptors, optionally preceded by administration of oral dexamethasone (an amount of 8 mg or an equivalent) 8-24 hours before administration of the gene editing composition. Prophylactic infusion is designed to reduce adverse reactions associated with administration of a guide RNA-containing composition (e.g., an LNP composition). These dosages may be used, for example, when the subject is a human, e.g., an adult human. In some embodiments, prophylactic infusion is an intravenous corticosteroid (e.g., dexamethasone 10 mg or an equivalent) that may reduce the severity of inflammation, an oral acetaminophen 500 mg that may reduce pain and fever and / or inhibit COX enzymes and / or prostaglandins, and an intravenous H1 blocker (e.g., diphenhydramine 50 mg or an equivalent) and an intravenous H2 blocker (e.g., ranitidine 50 mg or an equivalent) that act to block the action of histamine at the H1 and H2 receptors, optionally preceded by administration of oral dexamethasone (an amount of 8 mg or an equivalent) 8-24 hours before administration of the gene editing composition. Prophylactic infusion is designed to reduce adverse reactions associated with administration of a guide RNA-containing composition (e.g., an LNP composition). In some embodiments, prophylactic infusion is an intravenous corticosteroid (e.g., dexamethasone 10 mg or an equivalent) that may reduce the severity of inflammation, an oral acetaminophen 500 mg that may reduce pain and fever and / or inhibit COX enzymes and / or prostaglandins, and an intravenous H1 blocker (e.g., diphenhydramine 50 mg or an equivalent) and an intravenous H2 blocker (e.g., ranitidine 50 mg or an equivalent) that act to block the action of histamine at the H1 and H2 receptors, optionally preceded by administration of oral dexamethasone (an amount of 8 mg or an equivalent) 8-24 hours before administration of the gene editing composition. Prophylactic infusion is designed to reduce adverse reactions associated with administration of a guide RNA-containing composition (e.g., an LNP composition). In some embodiments, prophylactic infusion is an intravenous corticosteroid (e.g., dexamethasone 10 mg or an equivalent) that may reduce the severity of inflammation, an oral acetaminophen 500 mg that may reduce pain and fever and / or inhibit COX enzymes and / or prostaglandins, and an intravenous H1 blocker (e.g., diphenhydramine 50 mg or an equivalent) and an intravenous H2 blocker (e.g., ranitidine 50 mg or an equivalent) that act to block the action of histamine at the H1 and H2 receptors, optionally preceded by administration of oral dexamethasone (an amount of 8 mg or an equivalent) 8-24 hours before administration of the gene editing composition. Prophylactic infusion is designed to reduce adverse reactions associated with administration of a guide RNA-containing composition (e.g., an LNP composition). In some embodiments, prophylactic infusion is an intravenous corticosteroid (e.g., dexamethasone 10 mg or an equivalent) that may reduce the severity of inflammation, an oral acetaminophen 500 mg that may reduce pain and fever and / or inhibit COX enzymes and / or prostaglandins, and an intravenous H1 blocker (e.g., diphenhydramine 50 mg or an equivalent) and an intravenous H2 blocker (e.g., ranitidine 50 mg or an equivalent) that act to block the action of histamine at the H1 and H2 receptors, optionally preceded by administration of oral dexamethasone (an amount of 8 mg or an equivalent) 8-24 hours before administration of the gene editing composition. Prophylactic infusion is designed to reduce adverse reactions associated with administration of a guide RNA-containing composition (e.g., an LNP composition). In some embodiments, prophylactic infusion is an intravenous corticosteroid (e.g., dexamethasone 10 mg or an equivalent) that may reduce the severity of inflammation, an oral acetaminophen 500 mg that may reduce pain and fever and / or inhibit COX enzymes and / or prostaglandins, and an intravenous H1 blocker (e.g., diphenhydramine 50 mg or an equivalent) and an intravenous H2 blocker (e.g., ranitidine 50 mg or an equivalent) that act to block the action of histamine at the H1 and H2 receptors, optionally preceded by administration of oral dexamethasone (an amount of 8 mg or an equivalent) 8-24 hours before administration of the gene editing composition. Prophylactic infusion is designed to reduce adverse reactions associated with administration of a guide RNA-containing composition (e.g., an LNP composition). is possible. In some embodiments, corticosteroids and / or premedication are , administered as the necessary premedication before administering the guide RNA-containing composition (e.g., LNP composition). administered.

[0353] In some embodiments, the corticosteroid is administered concurrently with one or more of acetaminophen, an H1 blocker, or an H2 blocker. In some embodiments, the corticosteroid is administered concurrently with acetaminophen and an H1 blocker. In some embodiments, the corticosteroid is administered concurrently with acetaminophen and an H2 blocker. In some embodiments, the corticosteroid is administered concurrently with an H1 blocker and an H2 blocker. In some embodiments, the H1 blocker and / or the H2 blocker is administered orally. In some embodiments, the composition is administered concurrently with acetaminophen, an H1 blocker, and an H2 blocker.

[0354] Many H1 blockers and H2 blockers are known in the art. In some embodiments, the H1 blocker is diphenhydramine, clemastine, cetirizine, terfenadine, doxylamine, mirtazapine, brompheniramine, triprolidine, cyproheptadine, loratadine, hydroxyzine, cinnarizine, astemizole, azatadine, meclizine, carbinoxamine, epinastine, olopatadine, triprolidine, brom pheniramine, ketotifen, fexofenadine, desloratadine, azelastine, di menhydrinate, promethazine, mequitazine, emedastine, levocabastine, chlor Pheniramine, cyclizine, alimemazine, phenindamine, pheniramine, metapyrine n, flunarizine, mianserin, levocetirizine, esmirtazapine, mepyramine, a lcaftadine, antazoline, chloropyramine, dimethindene, dimethothiazine, acri bastine, chlorpheniramine maleate, ebastine, mizolastine, gsk-10 04723, oxatomide, chlorpheniramine, bepotastine, bucrizine, lisperi done, methdilazine, maprotiline, diphenylpyraline, bromodiphenhydramine, diprasidone, olanzapine, clozapine, promazine, trazodone, doxepin, desi pramine, orphenadrine, methotrimeprazine, clofedanol, chlorprotixy sen, quetiapine, asenapine, benzatropine, aripiprazole, amitriptyli ne, imipramine, nortriptyline, trimipramine, isothipendyl, chlorproma zine, iloperidone, zuclopenthixol, chlorcyclizine, amoxapine, butri pthyrine, cariprazine, bilastine, dosulepin, rupatadine, pizotifen, tonzi luramine, benzquinamine, propiomazine, aceprometazine, aripiprazole lau roxyl, or deptropine.

[0355] In some embodiments, the H2 blocker is ranitidine, nizatidine, cimetidine, or famotidine. Equivalent corticosteroids and dosages can be found, for example, in Liu et al.,Allergy,Asthma&Clinical Immunolog y,2013,9:30. Equivalent antihistamines (H1 blockers and / or H2 blockers) and dosages are suitable members of the types known in the art includes the customary dosage for

[0356] In some embodiments, at least two doses of corticosteroid are administered prior to administration of the composition. In some embodiments, after the first dose of corticosteroid is administered, a second dose of corticosteroid is administered before the composition is administered. In some embodiments, the first dose of corticosteroid is administered within 8 to 24 hours before the composition is administered. In some embodiments, the first dose of corticosteroid is orally administered within 8 to 24 hours before the composition is administered. In some embodiments, the second dose of corticosteroid is administered within 1 to 2 hours before the composition is administered. In some embodiments, the second dose of corticosteroid is intravenously administered within 1 to 2 hours before the composition is administered. In some embodiments the first dose of corticosteroid is administered within 8 to 24 hours before the composition is administered and the second dose of corticosteroid is administered within 1 to 2 hours before the composition is administered.

[0357] In some embodiments, the first dose of corticosteroid is orally administered and the second dose of corticosteroid is intravenously administered before the composition is administered. In some embodiments, the first dose of corticosteroid is orally administered within 8 to 2 4 hours before the composition is administered and the second dose of corticosteroid is intravenously administered within 1 to 2 hours before the composition is administered.

[0358] In some embodiments, the first dose of corticosteroid is orally administered and the first The corticosteroid at a dose of 2 is administered simultaneously with one or more of acetaminophen, an H1 antagonist, or an H2 antagonist before the composition is administered. In some embodiments the first dose of corticosteroid is administered orally and the second dose of corticoster oid is administered simultaneously with acetaminophen, an H1 antagonist, and an H2 antagonist before the composition is administered. In some embodiments, the first dose of corticosteroid is administered orally within 8 to 24 hours before the composition is administered, and the second dose of corticoster oid is administered intravenously simultaneously with one or more of acetaminophen, an H1 antagonist, or an H2 antagonist within 1 to 2 hours before the composition is administered. In some embodiments the first dose of corticosteroid is administered orally within 8 to 24 hours before the composition is administered, and the second dose of corticoster oid is administered intravenously simultaneously with acetaminophen, an H1 antagonist, and an H2 antagonist within 1 to 2 hours before the composition is administered. In some embodiments, the first dose of corticosteroid is administered orally within 8 to 24 hours before the composition is administered, and the second dose of corticosteroid is administered intravenously simultaneously with acetaminophen, an H1 antagonist, and an H2 antagonist within 1 to 2 hours before the composition is administered, acetaminophen is administered orally, and the H1 antagonist and the H2 antagonist are administered intravenously. In some embodiments, administering the corticosteroid improves the tolerability of the composition containing the guide RNA. For example, a guide RNA not containing a corticosteroid

[0359] In some embodiments, administering the corticosteroid improves the tolerability of the composition containing the guide RNA. For example, a guide RNA not containing a corticosteroid In some embodiments, administering the corticosteroid improves the tolerability of the composition containing the guide RNA. For example, a guide RNA not containing a corticosteroid The administration of a corticosteroid reduces inflammation, nausea, vomiting, and other symptoms compared to the administration of a composition containing One or more adverse effects, such as vomiting, elevated ALT blood levels, hyperthermia, and / or hyperalgesia In some embodiments, the corticosteroid In response to the composition comprising the guide RNA, one or more interferons are administered. and / or reducing or inhibiting the production or activity of proinflammatory cytokines.

[0360] Exemplary corticosteroids include, but are not limited to, dexamethasone, betamethasone, prednisone, prednisolone, methylprednisolone, cortisone, hydrocortisone methasone, triamcinolone, or ethamethasone, or a pharma- ceutically acceptable salt thereof. Exemplary corticosteroids include, but are not limited to, dexamethasone, Betamethasone, prednisone (Rayos®, Horizon Pharma ), prednisolone (Pred Forte®, Allergan, Omni pred™, Novartis), methylprednisolone (Medrol™ ), Pharmacia & Upjohn, Solu-Medrolx (registered trademark), P harmacia&Upjohn), cortisone, hydrocortisone, triamcinolone , ethamethasone, budesonide (ENTOCORT®, Perrigo Pha Rma Intl., Rhinocort®, Symbicort® ), Astrazeneca Pharms, Ulceris®, Valea nt Pharms), paramethasone, and deflazacort. In an embodiment, the corticosteroid is dexamethasone.

[0361] The corticosteroid used in the disclosed method may be administered according to regimens known in the art, for example, according to regimens approved by the US FDA. Suitable modes of administration include , but are not limited to, enteral administration, topical administration, and parenteral administration. As used herein, the terms "parenteral administration" and "administered parenterally" mean modes of administration other than enteral (including oral) and topical administration (usually by injection), and include, but are not limited to, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, intratracheal, subcutaneous, subepidermal, intraarticular, subcapsular, subarachnoid, intraspinal, and intrasternal injections and infusions. In some embodiments, the corticosteroid is administered parenterally or by injection to the subject. In some embodiments, the corticosteroid is administered to the subject by intravenous injection. In some embodiments, the corticosteroid is administered orally or enterally to the subject. In some embodiments, the corticosteroid is administered topically to the subject.

[0362] In some embodiments, for example, including administration for use in or to a human subject, the corticosteroid may be administered in an amount in the range of about 0.75 mg to about 25 mg. In some embodiments, for example, including administration for use in or to a human subject, the corticosteroid may be administered in an amount in the range of about 0.01 to 0.5 mg / kg, for example, in the range of 0.1 to 0.40 mg / kg or 0.25 to 0.40 mg / kg.

[0363] In one example, dexamethasone is orally administered in an amount of 2 0 mg or 25 mg, 6 to 12 hours before the intravenous administration of the guide RNA. In another example, dexamethasone is intravenously administered in an amount of 20 mg or 25 mg for 30 minutes, 6 to 12 hours before the intravenous administration of the guide RNA. In another example, dexamethasone is orally administered in an amount of 8 to 12 mg, for example, 10 mg, 8 to 24 hours before the injection of the guide RNA composition. In another example, dexamethasone is intravenously administered in an amount of 8 to 12 mg, for example, 10 mg, 1 to 2 hours before the injection of the guide RNA composition. In another example, dexamethasone is orally administered in an amount of 8 to 12 mg, for example, 10 mg, 8 to 24 hours before the injection of the guide RNA composition, and dexamethasone is intravenously administered in an amount of 8 to 1 2 mg, for example, 10 mg, 1 to 2 hours before the injection of the guide RNA composition.

[0364] In some embodiments, the corticosteroid is dexamethasone, and dexamethasone is orally administered to the subject in an amount of 8 mg, 8 to 24 hours before the composition is administered to the subject. In some embodiments, the corticosteroid is dexamethasone and dexamethasone is orally administered to the subject in an amount of 8 mg, 8 to 24 hours before the composition is administered to the subject.

[0365] In some embodiments, the corticosteroid is dexamethasone, and dexamethasone is intravenously administered to the subject in an amount of 10 mg, 1 to 2 hours before the composition is administered to the subject. In some embodiments, the corticosteroid is dexamethasone and 、1 to 2 hours before the composition is administered to the subject, dexamethasone is administered to the subject in an amount of 10 mg by intravenous administration.

[0366] In some embodiments, the corticosteroid is dexamethasone, and 8 to 24 hours before the composition is administered to the subject, a first dose of dexamethasone is administered orally to the subject in an amount of 8 mg, and 1 to 2 hours before the composition is administered to the subject, a second dose of dexamethasone is administered intravenously to the subject in an amount of 10 mg.

[0367] In some embodiments, the corticosteroid is dexamethasone, and 8 to 24 hours before the composition is administered to the subject, a first dose of dexamethasone is administered orally to the subject in an amount of 8 mg, and 1 to 2 hours before the composition is administered to the subject, a second dose of dexamethasone is administered intravenously to the subject in an amount of 10 mg, and the second dose of corticosteroid is administered concomitantly with one or more of acetaminophen, an H1 blocker, or an H2 blocker thereof.

[0368] In some embodiments, the corticosteroid is dexamethasone, and 8 to 24 hours before the composition is administered to the subject, a first dose of dexamethasone is administered orally to the subject in an amount of 8 mg, and 1 to 2 hours before the composition is administered to the subject, a second dose of dexamethasone is administered intravenously to the subject in an amount of 10 mg, and the second dose of corticosteroid is administered concomitantly with acetaminophen, an H1 blocker, and an H2 blocker.

[0369] In some embodiments, the corticosteroid is dexamethasone, and the composition Eight to twenty-four hours before the composition is administered to the subject, a first dose of dexamethasone is orally administered to the subject in an amount of 8 mg, and one to two hours before the composition is administered to the subject, a second dose of dexamethasone is intravenously administered to the subject in an amount of 10 mg, simultaneously with the oral administration of acetaminophen and the intravenous administration of an H1 blocker and an H2 blocker.

[0370] In some embodiments, the corticosteroid is dexamethasone, and eight to twenty-four hours before the composition is administered to the subject, a first dose of dexamethasone is orally administered to the subject in an amount of 8 mg, and one to two hours before the composition is administered to the subject, a second dose of dexamethasone is intravenously administered to the subject in an amount of 10 mg, simultaneously with the oral administration of 500 mg of acetaminophen and the intravenous administration of 50 mg of an H1 blocker and 50 mg of an H2 blocker.

[0371] Furthermore, it is recognized by those skilled in the art that depending on the selection of a particular corticosteroid, the dosage of the corticosteroid can be readily adjusted. For example, for purposes of comparison, the following are mg dosages of appropriate equivalents of corticosteroids. Hydrocortisone 200 mg, cortisone 25 mg, prednisone or prednisolone 5 mg, deflazacort 6 mg, methylprednisolone 4 mg, dexamethasone or betamethasone 0.75 mg, triamcinolone 4 mg. Thus, the dosages of corticosteroids presented in the above examples are based on dexamethasone, but if another corticosteroid is administered to a patient, those skilled in the art will be able to calculate the equivalent dosages of other corticosteroids using the above conversion information.

[0372] ​​​​​​​​​​​​​​ B. Guide RNA (gRNA) The guide RNAs used in the disclosed methods and compositions target the TTR gene and include a guide sequence. Exemplary guide sequences targeting the TTR gene are shown in Table 1 with SEQ ID NOs: 5 to 82.

Table 1-1

Table 1-2

Table 1-3

Table 1-4

Table 1-5

Table 1-6

Table 1-7

[0373] Each of the above guide sequences may further contain additional nucleotides for forming a crRNA, for example, at its 3' end, having the following exemplary nucleotide sequence following the guide sequence. GUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO: 126) For sgRNA, the above guide sequence may further contain additional nucleotides for forming an sgRNA, for example, having the following exemplary nucleotide sequence following the 3' end of the guide sequence. In the 5' to 3' orientation, GUUUUAGAGCUAGAAA UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAA . For sgRNA, the above guide sequence may further contain additional nucleotides for forming an sgRNA, for example, having the following exemplary nucleotide sequence following the 3' end of the guide sequence. In the 5' to 3' orientation, GUUUUAGAGCUAGAAA UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAA UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAA AAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 125).

[0374] In some embodiments, the sgRNA is modified. In some embodiments the sgRNA comprises the modification pattern shown below in SEQ ID NO: 3, where N is any natural or non-natural nucleotide, and the entirety of the Ns comprises a guide sequence as described herein such that the modified sgRNA comprises the sequence: mN*mN*mN*NNNNN NNNNNNNNNNNNGUUUUAGAmGmCmUmAmGmAmAmAmUmA mGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmU mGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmG mGmUmGmCmU*mU*mU*mU (SEQ ID NO: 3), where "N" may be any natural or non-natural nucleotide. For example, included herein is the sequence SEQ ID NO: 3, where N is replaced with any of the guide sequences disclosed herein The modification remains as shown in SEQ ID NO: 3 regardless of the N substitutions for the guide nucleotides. That is, the guide nucleotides are replaced with "N", but the first three nucleotides are 2’OMe modified and phosphorothioate bonds are present between the first and second nucleotides, between the second and third nucleotides, and between the third and fourth nucleotides.

[0375] In some embodiments, any one of the sequences listed in Table 2 is included .

Table 2-1

Table 2-2

Table 2-3

Table 2-4

Table 2-5

Table 2-6

Table 2-7

Table 2-8

Table 2-9

Table 2-10

[0376] Alignment mapping of guide IDs with corresponding sgRNA IDs, and provide the homology to the cynomolgus monkey genome and cynomolgus monkey-compatible guide IDs in Table 3 。

Table 3-1

Table 3-2

Table 3-3

Table 3-4

Table 3-5

[0377] In some embodiments, the gRNA is capable of catalyzing the synthesis of a nuclease (e.g., a C-type nucleotide sequence such as Cas9). The RNA-guided DNA binding agent, which may be a nuclease, is coupled to a target DNA in TTR. The gRNA contains a guide sequence that directs the gRNA to a target sequence. The gRNA may comprise a guide sequence 17, 18, 19, or In some embodiments, the crRNA may comprise 20 consecutive nucleotides. The gRNA contains at least 17, 18, 19, or 20 of the guide sequences shown in Table 1. Approximately 75%, 80%, 85%, 90%, 95%, 96%, and 97% for consecutive nucleotides , 98%, 99%, or 100% identity. In some embodiments, the gRNA is about 75%, 80%, or 100% identical to the guide sequence shown in Table 1. 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity The gRNA may further comprise a trRNA. In each of the compositions and methods described herein, the crRNA and trRNA A may be associated as a single RNA (sgRNA) or on a separate RNA. In the context of sgRNA, crRNA and trRNA may be The components of A are covalently linked, for example, via a phosphodiester bond or other covalent bond. It is possible.

[0378] In each of the compositions, uses and methods described herein, a guide RNA A may comprise two RNA molecules as a "dual guide RNA" or "dgRNA." It is. The dgRNA includes, for example, a first RNA molecule containing a crRNA containing the guide sequence shown in Table 1 and a second RNA molecule containing a trRNA. The first RNA molecule and the second RNA molecule may not be covalently bonded, but may form an RNA duplex by base pairing between the crRNA and trRNA portions.

[0379] In each embodiment of the compositions, uses and methods described herein, the guide RN A includes a single RNA molecule as "single guide RNA" or "sgRNA" obtained. The sgRNA may include a crRNA (or a portion thereof) containing the guide sequence shown in Table 1 covalently bonded to a trRNA. The sgRNA may also include 17 of the guide sequences shown in Table 1, 18, 19, or 20 consecutive nucleotides. In some embodiments the crRNA and trRNA are covalently bonded via a linker. In some embodiments the sgRNA forms a stem-loop structure by base pairing between the crRNA and trRNA portions. In some embodiments, the crRNA and trR NA are covalently bonded via one or more bonds that are not phosphodiester bonds.

[0380] In some embodiments, the trRNA may include all or a portion of the trRNA sequence derived from a naturally occurring CRISPR / Cas system. In some embodiments, the t rRNA includes a wild-type trRNA that is truncated or modified at the tip. The length of the trRNA depends on the CRISPR / Cas system used. In some embodiments, the trRN A is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, ​​​19, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, or 100 comprises or consists of more than nucleotides. In some embodiments, the trRNA may comprise a specific secondary structure such as, for example, one or more hairpin structures or stem-loop structures, or one or more bulge structures.

[0381] In some embodiments, the composition comprises one or more guide RNAs comprising a guide sequence selected from SEQ ID NOs: 5-82.

[0382] In some embodiments, the composition comprises a gRNA comprising a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to a sequence selected from SEQ ID NOs: 5-82.

[0383] In some embodiments, the composition comprises one or more guide RNAs comprising a guide sequence selected from SEQ ID NOs: 5-72, 74-78, and 80 - 82. In some embodiments, the composition comprises a gRNA comprising a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92 %, 91%, or 90% identical to a sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82. In some embodiments, the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 5, 6, 7, 8, 9, 12, 13, 14, 15, 16, 17, 22, 23, 2 7, 29, 30, 35, 36, 37, 38, 55, 61, 63, 65, 66, 68, or 69. In some embodiments, the sequence selected from SEQ ID NOs: 5-72, 74-78, and 8 0-82 is SEQ ID NO: 5, 6, 7, 8, 9, 12, 13, 14, 15, 16, 17, 22, 23, 2 An array selected from 0 to 82 is array number 5, 6, 9, 13, 14, 15, 16, 17, 22, 23, 27, 30, 35, 36, 37, 38, 55, 63, 65, 66, 68, or 69.

[0384] In other embodiments, the composition comprises at least one guide sequence selected from any two or more of the guide sequences of SEQ ID NOs: 5 to 82, for example, at least two gR NAs. In some embodiments, the composition comprises at least two gRNAs each comprising a guide sequence selected from the sequences of SEQ ID NOs: 5 to 82 and having at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identity. .

[0385] In other embodiments, the composition comprises at least one guide sequence selected from any two or more of the guide sequences selected from SEQ ID NOs: 5 to 72, 74 to 78, and 80 to 82, for example, at least two gRNAs. In some embodiments , the composition comprises at least two gRNAs each comprising a guide sequence selected from any one of the sequences selected from SEQ ID NOs: 5 to 72, 74 to 78, and 80 to 82 and having at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92% , 91%, or 90% identity. In some embodiments, the sequence selected from SEQ ID NOs: 5 to 72, 74 to 78, and 80 to 82 comprises at least two gRNAs each comprising a guide sequence selected from any one or two sequences selected from SEQ ID NOs: 5, 6, 7, 8, 9, 12, 13, 14, 15, 16, 1 7, 22, 23, 27, 29, 30, 35, 36, 37, 38, 55, 61, 63, 65 , 66, 68, or 69. In some ​​​​​​In one embodiment, the sequences selected from SEQ ID NOs: 5 to 72, 74 to 78, and 80 to 82 include one sequence selected from SEQ ID NOs: 5, 6, 9, 13, 14, 15, 16, 17, 22, 23, 27, 3 0, 35, 36, 37, 38, 55, 63, 65, 66, 68, or 69, or include two sequences.

[0386] In some embodiments, the gRNA is an sgRNA comprising any one of the sequences shown in Table 2 (SEQ ID NOs: 87 to 12 4). In some embodiments, the gRNA comprises any one of the sequences shown in Table 2 (SEQ ID NOs: 87 to 124), but does not include the indicated modifications (i.e., unmodified SEQ ID NOs: 87 to 124) and is an sgRNA. In some embodiments, the sgRNA has a sequence that is at least 9 9%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90 % identical to any one of the nucleic acids of SEQ ID NOs: 87 to 124. In some embodiments, the sgRNA has a sequence that is at least 99%, 98%, 97%, 96%, 95%, 94% 93%, 92%, 91%, or 90% identical to any one of the nucleic acids of SEQ ID NOs: 87 to 124, but does not include the indicated modifications (i.e., unmodified SEQ ID NOs: 87 to 124). In some embodiments, the sgRNA includes any one of the guide sequences shown in Table 1 instead of the guide sequences shown in the sgRNA sequences of Table 2 with SEQ ID NOs: 87 to 124, regardless of the presence or absence of modifications.

[0387] In some embodiments, the gRNA is an sgRNA comprising any one of SEQ ID NOs: 87 to 113, 115 to 120, or 122 to 124. In some embodiments, wherein the gRNA comprises any one of SEQ ID NOs: 87-113, 115-120, or 122-124, and does not contain the modifications shown in Table 2 (i.e., unmodified SEQ ID NOs: 87- 113, 115-120, or 122-124) sgRNA. In some embodiments, the sgRNA comprises a sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any of the nucleic acids of SEQ ID NOs: 87-113, 115-120, or 122-1 24. In some embodiments, the sgRNA comprises a sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93% 92%, 91%, or 90% identical to any of the nucleic acids of SEQ ID NOs: 87-113, 115-120, or 122-124, but does not contain the indicated modifications (i.e., unmodified SEQ ID NOs: 87-113, 115-120, or 122-124) sequence. In some embodiments, the sgRNA, regardless of the presence or absence of modifications, contains any one of the guide sequences shown in Table 1 instead of the guide sequence shown in the sgRNA sequence of Table 2 at SEQ ID NOs: 87-11 3, 115-120, or 122-124. The guide RNAs provided herein may be useful for recognizing (e.g., hybridizing to) target sequences within the TTR gene. For example, the TTR target sequence may be recognized and cleaved by a provided Cas nuclease that includes the guide RNA. Thus, an RNA-guided DNA binder, e.g., a Cas nuclease, may be directed to the target sequence of the TTR gene by the guide RNA, and the guide sequence of the guide RNA hybridizes to the target sequence.

[0388] The guide RNAs provided herein may be useful for recognizing (e.g., hybridizing to) target sequences within the TTR gene. For example, the TTR target sequence may be recognized and cleaved by a provided Cas nuclease that includes the guide RNA. Thus, an RNA-guided DNA binder, e.g., a Cas nuclease, may be directed to the target sequence of the TTR gene by the guide RNA, and the guide sequence of the guide RNA hybridizes to the target sequence. Hybridize, and the RNA-guided DNA binding agent, e.g., Cas nuclease, cleaves the target sequence. Cut.

[0389] In some embodiments, the selection of one or more guide RNAs is determined based on a target sequence within the TTR gene. Determined based on the target sequence within the TTR gene.

[0390] Without being bound by any particular theory, mutations in a particular region of a gene (e.g., a frameshift mutation resulting from an indel that occurs as a result of a nuclease-mediated DSB) may be less tolerated than mutations in other regions of the gene, and thus the location of the DSB is an important factor in the amount or type of protein knockdown that can result. In some embodiments, a gRNA that is complementary or has complementarity to a target sequence within TTR is used to direct the RNA-guided DNA binding agent to a specific location within the TTR gene. In some embodiments, the gRNA is designed to have a guide sequence that is complementary or has complementarity to a target sequence within exon 1, exon 2, exon 3, or exon 4 of TTR. For example, a frameshift mutation resulting from an indel that occurs as a result of a nuclease-mediated DSB May be less tolerated than mutations in other regions of the gene, and thus the location of the DSB is an important factor in the amount or type of protein knockdown that can result. In the amount or type of protein knockdown that can result. In some embodiments, a gRNA that is complementary or has complementarity to a target sequence within TTR is used to direct the RNA-guided DNA binding agent to a specific location within the TTR gene. To direct the RNA-guided DNA binding agent to a specific location within the TTR gene. In some embodiments, the gRNA is designed to have a guide sequence that is complementary or has complementarity to a target sequence within exon 1, exon 2, exon 3, or exon 4 of TTR. To a target sequence within exon 1, exon 2, exon 3, or exon 4 of TTR. Or has a guide sequence having complementarity thereto.

[0391] In some embodiments, the guide sequence is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91% Identical to a target sequence present within the human TTR gene. In some embodiments, the target sequence can be complementary to the guide sequence of the guide RNA. In some embodiments, the degree of complementarity or identity between the guide sequence of the guide RNA and the corresponding target sequence is at least At least at 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% can be. In some embodiments, the target sequence and the guide sequence of the gRNA can be 100 % complementary or identical. In other embodiments, the target sequence and the gRNA guide sequence may contain at least one mismatch. For example, the target sequence and the guide sequence of the gRNA may contain 1, 2, 3, or 4 mismatches, where the total length of the guide sequence is about 20. In some embodiments, the target sequence and the g RNA guide sequence may contain 1 to 4 mismatches, where the guide sequence is 20 nucleotides.

[0392] C. Modification of gRNA In some embodiments, the gRNA is chemically modified. A gRNA containing one or more modified nuc leosides or nucleotides is referred to as a "modified" gRNA or "chemically modified" gRN A to denote the presence of one or more non-natural and / or naturally occurring components or structures used in place of or in addition to the standard A, G, C, and U residues. In some embodiments, the modified gRNA is synthesized using non-standard nucleosides or nucleotides and is referred to herein as "modified". Modified nuc leosides or nucleotides include (i) modifications in the phosphodiester backbone linkage, e.g., replacement of one or both of the non-bridging phosphate oxygens and / or one or more of the bridging phosphate oxygens (exemplary backbone modifications), (ii) components of the ribose sugar, e.g., modification of the 2'-hydroxyl of the ribose sugar, e.g., replacement (exemplary sugar modifications), (iii) the phosphate moiety ... ... Large-scale replacement (exemplary backbone modification) with the "dephosphorylated" linker, (iv) modification or replacement of naturally occurring nucleobases, including those by non-standard nucleobases (exemplary base modification), (v) replacement or modification of the ribose phosphate backbone (exemplary backbone modification), (vi) modification of the 3'- or 5'-end of the oligonucleotide, e.g., removal, modification or replacement of the terminal phosphate group, or conjugation of a moiety, cap, or linker (such 3'- or 5'-cap modifications may include modifications of the sugar and / or backbone), and (vii) one or more modifications or replacements of the sugar (exemplary sugar modification). Chemical modifications such as those listed above can be combined to provide modified gRNAs containing nucleosides and nucleotides (collectively "residues") that can have two, three, four, or more modifications. For example, a modified residue can have a modified sugar and a modified nucleobase. In some embodiments, each base of the gRNA is modified, e.g., all bases have a modified phosphate group such as a phosphorothioate group. In certain embodiments, all or substantially all of the phosphate groups of the gRNA molecule are replaced by phosphorothioate groups. In some embodiments, the modified gRNA contains at least one modified residue at or near the 5'-end of the RNA. In some embodiments, the modified gRNA contains at least one modified residue at or near the 3'-end of the RNA. In some embodiments, the gRNA has 1, 2, 3, or more modified residues. Removal, modification or replacement of the terminal phosphate group, or conjugation of a moiety, cap, or linker (such 3'- or 5'-cap modifications may include modifications of the sugar and / or backbone). Such 3' or 5' cap modifications may include modifications of the sugar and / or backbone. One or more modifications or replacements of the sugar (exemplary sugar modification). Can include.

[0393] Combinations of chemical modifications such as those listed above can be used to provide modified gRNAs containing nucleosides and nucleotides (collectively "residues") that can have two, three, four, or more modifications. For example, a modified residue can have a modified sugar and a modified nucleobase. In some embodiments, each base of the gRNA is modified, e.g., all bases have a modified phosphate group such as a phosphorothioate group. In certain embodiments, all or substantially all of the phosphate groups of the gRNA molecule are replaced by phosphorothioate groups. In some embodiments, the modified gRNA contains at least one modified residue at or near the 5'-end of the RNA. In some embodiments, the modified gRNA contains at least one modified residue at or near the 3'-end of the RNA. Replaced. In some embodiments, the modified gRNA contains at least one modified residue at or near the 5'-end of the RNA. In some embodiments, the modified gRNA contains at least one modified residue at or near the 3'-end of the RNA. Contains.

[0394] In some embodiments, the gRNA has 1, 2, 3, or more modified residues. comprises. In some embodiments, at least 5% of the positions within the modified gRNA (e.g., at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% , at least 95%, or 100%) are modified nucleosides or nucleotides .

[0395] Unmodified nucleic acids may be susceptible to degradation, for example, by intracellular nucleases or those found in serum. For example, nucleases can hydrolyze the phosphodiester bonds of nucleic acids . Thus, in one aspect, the gRNAs described herein can include one or more modified nucleosides or nucleotides to introduce stability against nucleases, for example, those derived from within cells or in serum. In some embodiments, the modified gRNA molecules described herein can exhibit a reduced innate immune response when introduced into cell aggregates both in vivo and ex vivo . The term "innate immune response" includes the cellular response to foreign nucleic acids, including single-stranded nucleic acids, that includes the induction and release of cytokines (particularly interferons) and cell death .

[0396] .

[0396] In some embodiments of backbone modification, the phosphate group of the modified residue can be modified by replacing one or more oxygens with different substituents. Further, modified residues, such as those present in modified nucleic acids, can be non-modified phosphate moieties as described herein . may involve large-scale replacement by modified phosphate groups. In some embodiments, the phosphorus skeleton modification may include modifications that result in either an uncharged linker or a charged linker with an asymmetric charge distribution.

[0397] Examples of modified phosphate groups include phosphorothioate, phosphor selenate, boranophosphate, boranophosphate ester, hydrogen phosphonate, phosphoramidate, alkyl or aryl phosphonate, and phosphotriester. The phosphorus atom in an unmodified phosphate group is achiral. However, replacement of one of the non-bridging oxygens by one of the above-described atoms or groups of atoms can render the phosphorus atom chiral. The chiral phosphorus atom can have either an “R” configuration (designated herein as Rp) or an “S” configuration (designated herein as Sp). The backbone can also be modified by replacement of the bridging oxygen (i.e., the oxygen that links the phosphate to the nucleoside) with nitrogen (bridging phosphoramidate), sulfur (bridging phosphorothioate), and carbon (bridging methylene phosphonate). The replacement can occur at either one or both of the bridging oxygens.

[0398] The phosphate group can be replaced by a non-phosphorus-containing linking group in certain backbone modifications. In some embodiments, a charged phosphate group can be replaced by a neutral moiety. Examples of moieties that can replace the phosphate group include, but are not limited to, for example, methylphosphonic acid, hydroxylamino, siloxane, carbonate, carboxymethyl, carbamate, amide, thioether, ethylene oxide linker, sulfonate, sulfo It may contain amide, thioformacetal, formacetal, oxime, methyleneimino, methyl ene methylimino, methylenehydrazo, methylene dimethylhydrazo, methyleneo xymethylimino.

[0399] Phosphate linkers and ribose sugars can also be mimicked by scaffolds that can be replaced by nuclease-resistant nucleosides or nucleotides to construct nucleic acids. Such modifications can include backbone and sugar modifications. In some embodiments, nucleic acid bases can be tethered by alternative backbones. Examples can include, without limitation, morpholino, cyclobutyl , pyrrolidine, and peptide nucleic acid (PNA) nucleoside alternatives.

[0400] Modified nucleosides and modified nucleotides can include one or more modifications to the sugar, i.e., sugar modifications. For example, the 2'-hydroxyl group (OH) may be modified, for example by many different "oxy" or "deoxy" substituents. In some embodiments, modifications to the 2'-hydroxyl group further deprotonate so that the hydroxyl no longer forms a 2 '-alkoxide ion, which can enhance the stability of the nucleic acid.

[0401] Examples of 2'-hydroxyl group modifications are alkoxy or aryloxy (OR, where "R" is alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar and can be), polyethylene glycol (PEG), O(CH 2 CH 2O) n CH 2 CH 2 OR wherein R is, for example, H or optionally substituted alkyl, and n is an integer from 0 to 2 which can be an integer of 0 (e.g., 0 to 4, 0 to 8, 0 to 10, 0 to 16, 1 to 4, 1 to 8, 1 to 10, 1 to 16, 1 to 20, 2 to 4, 2 to 8, 2 to 10, 2 to 16, 2 to 20, 4 to 8, 4 to 10, 4 to 16, and 4 to 20). In some embodiments the 2'-hydroxyl group modification can be 2'-O-Me. In some embodiments the 2'-hydroxyl group modification can be 2'-fluoro modification which replaces the 2'-hydroxyl group with fluorine In some embodiments, the 2'-hydroxyl group modification can include "locked" nucleic acid (LNA) in which the 2'-hydroxyl is connected to the 4'-carbon of the same ribose sugar via, for example, a C 1-6 alkylene or C 1-6 heteroalkylene bridge and exemplary bridges include methylene, propylene, ether, or amino bridges, O -amino (wherein the amino can be, for example, NH , alkylamino, dialkylamino, hetero 2 cyclic, arylamino, diarylamino, heteroarylamino, or di heteroarylamino, ethylenediamine, or polyamino), and aminoalkoxy, O(CH ) -amino (wherein the amino can be, for example, NH 2 ) n and the amino can be, for example, NH 2 , alkyl amino, dialkylamino, heterocyclic, arylamino, diarylamino, he teroarylamino, or diheteroarylamino, ethylenediamine, or poly may include (which may be a rear amino). In some embodiments, the 2'-hydroxyl group modification may include "unlocked" nucleic acids (UNA) in which the ribose ring lacks a C2'-C3' bond. In some embodiments, the 2'-hydroxyl group modification may include a methoxyethyl group (MOE), (OCH 2 CH 2 OCH 3 , for example, a PEG derivative). may be included.

[0402] "Deoxy" 2'-modifications are hydrogen (i.e., deoxyribose sugar, e.g., the overhang of a partial dsRNA), halo (e.g., bromo, chloro, fluoro, or iodo), amino (where amino may be, for example, NH , alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or an amino acid), NH(CH CH 2 NH) CH2CH -amino (where amino may be, for example, as described herein), -NH 2 CH 2 NH) n CH2CH 2 -amino (where amino may be, for example, as described herein), -NH C(O)R (where R may be, for example, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar), cyano, mercapto, alkyl-thio-alkyl , thioalkoxy, and may include alkyl, cycloalkyl, aryl, alkenyl and alkynyl, and optionally may be substituted by an amino, for example, as described herein. Sugar modifications contain one or more carbons and are opposite in configuration to the corresponding carbons in ribose.

[0403] It may contain a glycosyl group having a stereochemical configuration. Thus, the modified nucleic acid may contain nucleotides containing, for example, arabinose as the sugar. The modified nucleic acid may also contain abasic sugars. These abasic sugars may also be further modified at one or more of the constituent sugar atoms. The modified nucleic acid may also contain one or more sugars that are of the L-form, such as L-nucleosides. The modified nucleosides and modified nucleotides described herein that can be incorporated into the modified nucleic acid may contain modified bases, also referred to as nucleobases. Examples of nucleobases include, but are not limited to, adenine (A), guanine (G), cytosine (C), and uracil (U). These nucleobases can be modified or completely replaced to yield modified residues that can be incorporated into the modified nucleic acid. The nucleobases of the nucleotides can independently be selected from purines, pyrimidines, purine analogs, or pyrimidine analogs. In some embodiments, the nucleobases can include, for example, naturally occurring bases and synthetic derivatives of the bases. In embodiments using dual guide RNAs, each of the crRNA and tracrRNA may contain modifications. Such modifications may be present at one or both ends of the crRNA and / or tracrRNA. In embodiments including an sgRNA, one or more residues at one or both ends of the sgRNA may be chemically modified, or the entire sgRNA may be chemically modified. Certain embodiments include 5'-end modifications. Certain embodiments include 3'-end modifications. In certain embodiments, the guide RNA molecule In embodiments using dual guide RNAs, each of the crRNA and tracrRNA may contain modifications. Such modifications may be present at one or both ends of the crRNA and / or tracrRNA. In embodiments including an sgRNA, one or more residues at one or both ends of the sgRNA may be chemically modified, or the entire sgRNA may be chemically modified. Certain embodiments include 5'-end modifications. Certain embodiments include 3'-end modifications. In certain embodiments, the guide RNA molecule

[0404] The modified nucleosides and modified nucleotides described herein that can be incorporated into the modified nucleic acid may contain modified bases, also referred to as nucleobases. Examples of nucleobases include, but are not limited to, adenine (A), guanine (G), cytosine (C), and uracil (U). These nucleobases can be modified or completely replaced to yield modified residues that can be incorporated into the modified nucleic acid. The nucleobases of the nucleotides can independently be selected from purines, pyrimidines, purine analogs, or pyrimidine analogs. In some embodiments, the nucleobases can include, for example, naturally occurring bases and synthetic derivatives of the bases. The modified nucleosides and modified nucleotides described herein that can be incorporated into the modified nucleic acid may contain modified bases, also referred to as nucleobases. Examples of nucleobases include, but are not limited to, adenine (A), guanine (G), cytosine (C), and uracil (U). These nucleobases can be modified or completely replaced to yield modified residues that can be incorporated into the modified nucleic acid. The nucleobases of the nucleotides can independently be selected from purines, pyrimidines, purine analogs, or pyrimidine analogs. In some embodiments, the nucleobases can include, for example, naturally occurring bases and synthetic derivatives of the bases. The modified nucleosides and modified nucleotides described herein that can be incorporated into the modified nucleic acid may contain modified bases, also referred to as nucleobases. Examples of nucleobases include, but are not limited to, adenine (A), guanine (G), cytosine (C), and uracil (U). These nucleobases can be modified or completely replaced to yield modified residues that can be incorporated into the modified nucleic acid. The nucleobases of the nucleotides can independently be selected from purines, pyrimidines, purine analogs, or pyrimidine analogs. In some embodiments, the nucleobases can include, for example, naturally occurring bases and synthetic derivatives of the bases. The modified nucleosides and modified nucleotides described herein that can be incorporated into the modified nucleic acid may contain modified bases, also referred to as nucleobases. Examples of nucleobases include, but are not limited to, adenine (A), guanine (G), cytosine (C), and uracil (U). These nucleobases can be modified or completely replaced to yield modified residues that can be incorporated into the modified nucleic acid. The nucleobases of the nucleotides can independently be selected from purines, pyrimidines, purine analogs, or pyrimidine analogs. In some embodiments, the nucleobases can include, for example, naturally occurring bases and synthetic derivatives of the bases. The modified nucleosides and modified nucleotides described herein that can be incorporated into the modified nucleic acid may contain modified bases, also referred to as nucleobases. Examples of nucleobases include, but are not limited to, adenine (A), guanine (G), cytosine (C), and uracil (U). These nucleobases can be modified or completely replaced to yield modified residues that can be incorporated into the modified nucleic acid. The nucleobases of the nucleotides can independently be selected from purines, pyrimidines, purine analogs, or pyrimidine analogs. In some embodiments, the nucleobases can include, for example, naturally occurring bases and synthetic derivatives of the bases. The modified nucleosides and modified nucleotides described herein that can be incorporated into the modified nucleic acid may contain modified bases, also referred to as nucleobases. Examples of nucleobases include, but are not limited to, adenine (A), guanine (G), cytosine (C), and uracil (U). These nucleobases can be modified or completely replaced to yield modified residues that can be incorporated into the modified nucleic acid. The nucleobases of the nucleotides can independently be selected from purines, pyrimidines, purine analogs, or pyrimidine analogs. In some embodiments, the nucleobases can include, for example, naturally occurring bases and synthetic derivatives of the bases. The modified nucleosides and modified nucleotides described herein that can be incorporated into the modified nucleic acid may contain modified bases, also referred to as nucleobases. Examples of nucleobases include, but are not limited to, adenine (A), guanine (G), cytosine (C), and uracil (U). These nucleobases can be modified or completely replaced to yield modified residues that can be incorporated into the modified nucleic acid. The nucleobases of the nucleotides can independently be selected from purines, pyrimidines, purine analogs, or pyrimidine analogs. In some embodiments, the nucleobases can include, for example, naturally occurring bases and synthetic derivatives of the bases. The modified nucleosides and modified nucleotides described herein that can be incorporated into the modified nucleic acid may contain modified bases, also referred to as nucleobases. Examples of nucleobases include, but are not limited to, adenine (A), guanine (G), cytosine (C), and uracil (U). These nucleobases can be modified or completely replaced to yield modified residues that can be incorporated into the modified nucleic acid. The nucleobases of the nucleotides can independently be selected from purines, pyrimidines, purine analogs, or pyrimidine analogs. In some embodiments, the nucleobases can include, for example, naturally occurring bases and synthetic derivatives of the bases.

[0405] In embodiments using dual guide RNAs, each of the crRNA and tracrRNA may contain modifications. Such modifications may be present at one or both ends of the crRNA and / or tracrRNA. In embodiments including an sgRNA, one or more residues at one or both ends of the sgRNA may be chemically modified, or the entire sgRNA may be chemically modified. Certain embodiments include 5'-end modifications. Certain embodiments include 3'-end modifications. In certain embodiments, the guide RNA molecule In embodiments using dual guide RNAs, each of the crRNA and tracrRNA may contain modifications. Such modifications may be present at one or both ends of the crRNA and / or tracrRNA. In embodiments including an sgRNA, one or more residues at one or both ends of the sgRNA may be chemically modified, or the entire sgRNA may be chemically modified. Certain embodiments include 5'-end modifications. Certain embodiments include 3'-end modifications. In certain embodiments, the guide RNA molecule In embodiments using dual guide RNAs, each of the crRNA and tracrRNA may contain modifications. Such modifications may be present at one or both ends of the crRNA and / or tracrRNA. In embodiments including an sgRNA, one or more residues at one or both ends of the sgRNA may be chemically modified, or the entire sgRNA may be chemically modified. Certain embodiments include 5'-end modifications. Certain embodiments include 3'-end modifications. In certain embodiments, the guide RNA molecule In embodiments using dual guide RNAs, each of the crRNA and tracrRNA may contain modifications. Such modifications may be present at one or both ends of the crRNA and / or tracrRNA. In embodiments including an sgRNA, one or more residues at one or both ends of the sgRNA may be chemically modified, or the entire sgRNA may be chemically modified. Certain embodiments include 5'-end modifications. Certain embodiments include 3'-end modifications. In certain embodiments, the guide RNA molecule In embodiments using dual guide RNAs, each of the crRNA and tracrRNA may contain modifications. Such modifications may be present at one or both ends of the crRNA and / or tracrRNA. In embodiments including an sgRNA, one or more residues at one or both ends of the sgRNA may be chemically modified, or the entire sgRNA may be chemically modified. Certain embodiments include 5'-end modifications. Certain embodiments include 3'-end modifications. In certain embodiments, the guide RNA molecule In embodiments using dual guide RNAs, each of the crRNA and tracrRNA may contain modifications. Such modifications may be present at one or both ends of the crRNA and / or tracrRNA. In embodiments including an sgRNA, one or more residues at one or both ends of the sgRNA may be chemically modified, or the entire sgRNA may be chemically modified. Certain embodiments include 5'-end modifications. Certain embodiments include 3'-end modifications. In certain embodiments, the guide RNA molecule One or more or all of the nucleotides in the single-stranded overhang of the son are deoxynucleotides. It is a tide.

[0406] In some embodiments, the guide RNA disclosed herein is the "Chemically Modified Guide R" filed on December 8, 2016. NAs" includes one of the modification patterns disclosed in US62 / 431,756 entitled "Chemically Modified Guide R NAs", the contents of which are hereby incorporated by reference in their entirety. In some embodiments, the present invention includes a gRNA comprising one or more modifications. In some

[0407] embodiments, the modification includes a 2'-O-methyl (2'-O-Me) modified nucleotide. In some embodiments, the modification includes a phosphorothioate ( PS) bond between nucleotides. The terms "mA", "mC", "mU", or "mG" can be used to represent nucleotides modified by 2'-O-Me. The modification of 2'-O-methyl can be depicted as follows.

[0408] Another chemical modification shown to affect the nucleotide sugar ring is halogen substitution. For example, a 2'-fluoro (2'-F) substitution on the nucleotide sugar ring can increase oligonucleotide bond affinity and nuclease stability.

[0409] In the present application, the terms "fA", "fC", "fU", or "fG" are 2'-F

Chemical formula

[0410] Another chemical modification shown to affect the nucleotide sugar ring is halogen substitution. For example, a 2'-fluoro (2'-F) substitution on the nucleotide sugar ring can increase oligonucleotide otide bond affinity and nuclease stability. In the present application, the terms "fA", "fC", "fU", or "fG" are 2'-F

[0411] substituted. It can be used to represent the replaced nucleotide.

[0412] The substitution of 2'-F can be depicted as follows. [Chemical formula]

[0413] Phosphorothioate (PS) linkage or bond refers to a bond in which one non-bridging phosphorus oxygen in a phosphodiester linkage, for example, the bond between nucleotide bases, is replaced by sulfur. When generating oligonucleotides using phosphorothioate, the modified oligonucleotide can also be referred to as an S-oligo.

[0414] To indicate PS modification, "*" can be used. In this application, the terms A*, C*, U*, or G* are used to indicate the nucleotide that is linked to the adjacent (e.g., 3') nucleotide by a PS bond.

[0415] In this application, the terms "mA*", "mC*", "mU*", or "mG*" are used to indicate the nucleotide that is substituted with 2'-O-Me and linked to the next (e.g., 3') nucleotide by a PS bond.

[0416] The following figure shows the substitution of S for non-bridging phosphorus oxygen, resulting in a PS bond instead of a phosphodiester bond. [Chemical formula]

[0417] Apurinic nucleotide refers to one that lacks a nitrogenous base. The following figure depicts an oligonucleotide having a site of base deficiency (also known as apurinic). ​ [Chemical formula]

[0418] The inverted base refers to one having a connection inverted from the normal 5'-to-3' connection ( i.e., either a 5'-to-5' connection or a 3'-to-3' connection). For example, [Chemical formula]

[0419] The abasic nucleotide can bond with an inverted bond. For example, the abasic nucleo tide may be connected to the 5'-nucleotide at the terminal via a 5'-5' connection, or the abasic nucleotide may be connected to the 3'-nucleotide at the terminal via a 3'-3' connection. The inverted abasic nucleotide at either the 5' or 3' nucleotide at the terminal may also be referred to as an inverted abasic terminal cap.

[0420] In some embodiments, one or more of the first 3, 4, or 5 nucleotides at the 5' terminus, and one or more of the last 3, 4, or 5 nucleotides at the 3' terminus are modified. In some embodiments, the modification is 2'- O-Me, 2'-F, an inverted abasic nucleotide, a PS bond, or other nucleotide modification well-known in the art to increase stability and / or performance.

[0421] In some embodiments, the first 4 nucleotides at the 5' terminus, and the last 4 nucleotides at the 3' terminus are linked using phosphorothioate (PS) bonds. ​

[0422] In some embodiments, the first three nucleotides at the 5' end, and the last three nucleotides at the 3' end include 2'-O-methyl (2'-O-Me) modified nucleotides. In some embodiments, the first three nucleotides at the 5' end, and the last three nucleotides at the 3' end include 2'-fluoro (2'-F) modified nucleotides. In some embodiments, the first three nucleotides at the 5' end, and the last three nucleotides at the 3' end include inverted abasic nucleotides.

[0423] In some embodiments, the guide RNA includes a modified sgRNA. In some embodiments, the sgRNA includes a modification pattern shown in SEQ ID NO: 3, where N is any natural or unnatural nucleotide, and the entirety of N includes a guide sequence that directs a nuclease to a target sequence.

[0424] In some embodiments, the guide RNA includes an sgRNA shown in any one of SEQ ID NOs: 87 to 124. In some embodiments, the guide RNA includes an sgRNA that includes any one of the guide sequences of SEQ ID NOs: 5 to 82 and the nucleotide of SEQ ID NO: 125, where the nucleotide of SEQ ID NO: 125 is at the 3' end of the guide sequence, and the guide sequence can be modified as shown in SEQ ID NO: 3.

[0425] In some embodiments, the guide RNA includes a guide sequence selected from SEQ ID NOs: 5 to 72, 74 to 78, and 80 to 82, and nucleotides 21 to 100 of SEQ ID NO: 3, ​ comprising an sgRNA that includes, with the nucleotide of SEQ ID NO: 3 at the 3' end of the guide sequence, the guide sequence can be modified as shown in SEQ ID NO: 3.

[0426] D.RNA-guided DNA binding agent In some embodiments, the RNA-guided DNA binding agent is a Class 2 Cas nuclease. In some embodiments, the RNA-guided DNA binding agent has cleavage activity, which may also be referred to as double-stranded endonuclease activity. In some embodiments, the RNA-guided DNA binding agent comprises a Cas nuclease, e.g., a Class 2 Cas nuclease e.g., it may be a type II, V, or VI Cas nuclease). Examples of Class 2 Cas nucleases include, for example, Cas9, Cpf1, C2c1, C2c2, and C2c3 proteins, and modifications thereof. Examples of Cas9 nucleases include those of the type II CRISPR systems of S. pyogenes, S. aureus, and other prokaryotic organisms (see, e.g., the list in the following paragraph), as well as their modified (e.g., engineered or mutant) forms. See, e.g., US201 6 / 0312198A1, US2016 / 0312199A1. Other examples of Cas nucleases include the Csm or Cmr complexes of type III CRISPR systems, or Cas10, Csm1, or its Cmr2 subunit, and the Cascade complex of type I CRISPR systems, or its Cas3 subunit. In some embodiments, the Cas nuclease may be derived from a type IIA, IIB, or IIC system. For discussions of various CRISPR systems and Cas nucleases, see, e.g., form may be derived from a type IIA, IIB, or IIC system. For discussions of various CRISPR systems and Cas nucleases, see, e.g., Examples of various CRISPR systems and Cas nucleases are provided, and for a discussion of various CRISPR systems and Cas nucleases, see, e.g., For example, see Makarova et al., Nat. Rev. Microbiol. 9:4 67 - 477 (2011), Makarova et al., Nat. Rev. Mic robiol, 13:722 - 36 (2015), Shmakov et al., Mo lecular Cell, 60:385 - 397 (2015). In some embodiments, the RNA - guided DNA - binding agent is a Cas nuclease, e.g., Ca s9 nuclease. In some embodiments, the RNA - guided DNA - binding agent is a C as nickase, e.g., Cas9 nickase. In some embodiments, the R NA - guided DNA - binding agent is a Cas9 nuclease, e.g., a nuclease or a nick ase. In some embodiments, the RNA - guided DNA - binding agent is an S.pyoge nes Cas9 nuclease, e.g., a nuclease.

[0427] Non - limiting exemplary species from which a Cas nuclease can be derived include Strepto coccus pyogenes, Streptococcus thermophil us, Streptococcus sp., Staphylococcus aure us, Listeria innocua, Lactobacillus gasser i, Francisella novicida, Wolinella succino genes, Sutterella wadsworthensis, Gammapro teobacterium, Neisseria meningitidis, Camp ylobacter jejuni, Pasteurella multocida, F ibrobacter succinogene, Rhodospirillum ru brum, Nocardiopsis dassonvillei, Streptomy ces pristinaespiralis, Streptomyces virid ochromogenes, Streptomyces viridochromoge nes, Streptosporangium roseum, Streptospor angium roseum, Alicyclobacillus acidocald arius, Bacillus pseudomycoides, Bacillus s elenitireducens, Exiguobacterium sibiricu m, Lactobacillus delbrueckii, Lactobacillu s salivarius, Lactobacillus buchneri, Trep onema denticola, Microscilla marina, Burkh olderiales bacterium, Polaromonas naphtha lenivorans, Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcystis aeru ginosa, Synechococcus sp., Acetohalobium a rabaticum, Ammonifex degensii, Caldicelulo siruptor becscii, Candidatus Desulforudis 、Clostridium botulinum, Clostridium diffi cile, Finegoldia magna, Natranaerobius the rmophilus, Pelotomaculum thermopropionicu m, Acidithiobacillus caldus, Acidithiobaci llus ferrooxidans, Allochromatium vinosum , Marinobacter sp., Nitrosococcus halophil us, Nitrosococcus watsoni, Pseudoalteromon as haloplanktis, Ktedonobacter racemifer, Methanohalobium evestigatum, Anabaena var iabilis, Nodularia spumigena, Nostoc sp., A rthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotog a mobilis, Thermosipho africanus, Streptoc occus pasteurianus, Neisseria cinerea, Cam pylobacter lari, Parvibaculum lavamentivo rans, Corynebacterium diphtheria, Acidamin ococcus sp., Lachnospiraceae bacterium ND 2006, and Acaryochloris marina.

[0428] In some embodiments, the Cas nuclease is Streptococcus It is a Cas9 nuclease derived from pyogenes. In some embodiments, C as nuclease is a C as9 nuclease derived from Streptococcus thermophilus. In some embodiments, the Cas nuclease is Ne isseria meningitidis-derived Cas9 nuclease. In some embodiments, the Cas nuclease is a Cas9 nuclease derived from Staphylococcus aur eus. In some embodiments, the Cas nuclease is a Cpf1 nuclease derived from Francisella novicida . In some embodiments, the Cas nuclease is an Acidaminococc us sp.-derived Cpf1 nuclease. In some embodiments, Cas nuclease is a Cpf1 nuclease derived from Lachnospiraceae bacterium ND2006 . In further embodiments, the Cas nuclease is , Francisella tularensis, Lachnospiraceae bacterium, Butyrivibrio proteoclasticus, P eregrinibacteria bacterium, Parcubacteria bacterium, Smithella, Acidaminococcus, Can didatus Methanoplasma termitum, Eubacteri um eligens, Moraxella bovoculi, Leptospira inadai, Porphyromonas crevioricanis, Prev otella disiens, or derived from Porphyromonas macacae is a future Cpf1 nuclease. In certain embodiments, the Cas nuclease is A Cpf1 nuclease derived from cidaminococcus or Lachnospiraceae nuclease.

[0429] Wild-type Cas9 has two nuclease domains, RuvC and HNH. R The uvC domain cleaves the non-target DNA strand, and the HNH domain cleaves the target strand of the DNA to do. In some embodiments, the Cas9 nuclease comprises more than one RuvC domain main and / or more than one HNH domain. In some embodiments , the Cas9 nuclease is wild-type Cas9. In some embodiments, Ca s9 can induce double-strand breaks in the target DNA. In certain embodiments The Cas nuclease may cleave dsDNA, cleave one strand of dsDNA or may not have DNA cleavage or nickase activity. For example The exemplary Cas9 amino acid sequence is provided as SEQ ID NO: 203. An exemplary Cas9 mRNA ORF sequence containing start and stop codons is provided as SEQ ID NO: 311 . An exemplary Cas9 mRNA coding sequence suitable for inclusion in a fusion protein is provided as SEQ ID NO number 210.

[0430] In some embodiments, a chimeric Cas nuclease is used, and one domain or region of the protein is replaced by a portion of a different protein. In some embodiments, the Cas nuclease domain may be replaced by a domain from a different nuclease such as Fok1 nuclease. In some embodiments, the Cas nu The nuclease may be a modified nuclease.

[0431] In other embodiments, the Cas nuclease may be derived from a type I CRISPR / Cas system. In some embodiments, the Cas nuclease may be a component of the type I CRISPR / Cas cascade complex. In some embodiments, the Cas nuclease may be a Cas3 protein. In some embodiments, the Cas nuclease may be derived from a type III CRISPR / Cas system. In some embodiments, the Cas nuclease may have RNA cleavage activity. In some embodiments, the RNA-guided DNA binder may have single-strand nickase

[0432] activity, i.e., it can cleave one DNA strand to produce a single-strand break (also known as a "nick"). In some embodiments, the RNA-guided DNA binder comprises a Cas nickase. A nickase is an enzyme that makes a nick in dsDNA, i.e., it cleaves one strand of the DNA double helix but not the other. In some embodiments, the Cas nickase is, for example, a form of a Cas nuclease (such as the Cas nuclease described above) in which the endonucleolytic active site has been inactivated by one or more modifications (e.g., point mutations) in the catalytic domain. For example, for a discussion of Cas nickases and exemplary catalytic domain modifications, see U.S. Patent No. 8,889,356. In some embodiments, a Cas nickase such as Cas9 nickase has an inactivated RuvC or HNH domain. Exemplary Cas9 nickases are described. For example, a Cas9 nickase has an inactivated RuvC or HNH domain. Exemplary Cas9 The Cas9 nickase amino acid sequence is provided as SEQ ID NO: 206 and includes start and stop codons. An exemplary Cas9 nickase mRNA ORF sequence that includes them is provided as SEQ ID NO: 207. An exemplary Cas9 nickase mRNA coding sequence suitable for inclusion in a fusion protein is provided as SEQ ID NO: 211.

[0433] In some embodiments, the RNA-guided DNA binder is modified to contain only one functional nuclease domain. For example, the nuclease domain of the agent protein may be mutated or modified to be completely or partially deleted in order to reduce its nucleic acid cleavage activity. In some embodiments, a nickase having a reduced activity RuvC domain is used. In some embodiments, a nickase having an inactive RuvC domain is used. In some embodiments, a nickase having a reduced activity HNH domain is used. In some embodiments, a nickase having an inactive HNH domain is used.

[0434] In some embodiments, conserved amino acids within the Cas protein nuclease domain are substituted to reduce or modify nuclease activity. In some embodiments, the Cas nuclease may include amino acid substitutions within the RuvC or RuvC-like nuclease domain. Exemplary amino acid substitutions in the RuvC or RuvC-like nuclease domain include D10A (based on the S. pyogenes Cas9 protein). For example, Zetsche et al. (2015) C See Ell Oct 22:163(3):759-771. In some embodiments the Cas nuclease may contain amino acid substitutions within the HNH or HNH-like nuclease domain. Exemplary amino acid substitutions in the HNH or HNH-like nuclease domain include E762A, H840A, N863A, H983A, and D98 6A (based on the Cas9 protein of S. pyogenes). See, for example, Jentsche et al. (2015). Further exemplary amino acid substitutions include D917A, E1006A, and D1255A (based on the Francisella novicida U112 Cpf1 (FnCpf1) sequence (UniProtKB-A 0Q7Q2 (CPF1_FRATN)). See, for example, Jentsche et al. (2015). Further exemplary amino acid substitutions include D917A, E1006A, and D1255A (based on the Francisella novicida U112 Cpf1 (FnCpf1) sequence (UniProtKB-A 0Q7Q2 (CPF1_FRATN)). In some embodiments, the nucleic acids encoding nickases are provided in combination with a pair of guide RNAs that are complementary to the sense and antisense strands of the target sequence, respectively. In this embodiment, the guide RNAs direct the nickase to the target sequence by generating nicks on opposite strands of the target sequence (i.e., double nicking), introducing a DSB. In some embodiments, the use of double nicking can improve specificity and reduce off-target effects. In some embodiments, the nickase is used with two separate guide RNAs that target opposite strands of the DNA to produce double nicks within the target DNA. In some embodiments, the nickase is used with two separate guide RNAs selected to be in very close proximity to produce double nicks within the target DNA.

[0435] In some embodiments, the nucleic acids encoding nickases are provided in combination with a pair of guide RNAs that are complementary to the sense and antisense strands of the target sequence, respectively. In this embodiment, the guide RNAs direct the nickase to the target sequence by generating nicks on opposite strands of the target sequence (i.e., double nicking), introducing a DSB. In some embodiments, the use of double nicking can improve specificity and reduce off-target effects. In some embodiments, the nickase is used with two separate guide RNAs that target opposite strands of the DNA to produce double nicks within the target DNA. In some embodiments, the nickase is used with two separate guide RNAs selected to be in very close proximity to produce double nicks within the target DNA. In some embodiments, the nucleic acids encoding nickases are provided in combination with a pair of guide RNAs that are complementary to the sense and antisense strands of the target sequence, respectively. In this embodiment, the guide RNAs direct the nickase to the target sequence by generating nicks on opposite strands of the target sequence (i.e., double nicking), introducing a DSB. In some embodiments, the use of double nicking can improve specificity and reduce off-target effects. In some embodiments, the nickase is used with two separate guide RNAs that target opposite strands of the DNA to produce double nicks within the target DNA. In some embodiments, the nickase is used with two separate guide RNAs selected to be in very close proximity to produce double nicks within the target DNA. In some embodiments, the nucleic acids encoding nickases are provided in combination with a pair of guide RNAs that are complementary to the sense and antisense strands of the target sequence, respectively. In this embodiment, the guide RNAs direct the nickase to the target sequence by generating nicks on opposite strands of the target sequence (i.e., double nicking), introducing a DSB. In some embodiments, the use of double nicking can improve specificity and reduce off-target effects. In some embodiments, the nickase is used with two separate guide RNAs that target opposite strands of the DNA to produce double nicks within the target DNA. In some embodiments, the nickase is used with two separate guide RNAs selected to be in very close proximity to produce double nicks within the target DNA. In some embodiments, the nucleic acids encoding nickases are provided in combination with a pair of guide RNAs that are complementary to the sense and antisense strands of the target sequence, respectively. In this embodiment, the guide RNAs direct the nickase to the target sequence by generating nicks on opposite strands of the target sequence (i.e., double nicking), introducing a DSB. In some embodiments, the use of double nicking can improve specificity and reduce off-target effects. In some embodiments, the nickase is used with two separate guide RNAs that target opposite strands of the DNA to produce double nicks within the target DNA. In some embodiments, the nickase is used with two separate guide RNAs selected to be in very close proximity to produce double nicks within the target DNA. In some embodiments, the nucleic acids encoding nickases are provided in combination with a pair of guide RNAs that are complementary to the sense and antisense strands of the target sequence, respectively. In this embodiment, the guide RNAs direct the nickase to the target sequence by generating nicks on opposite strands of the target sequence (i.e., double nicking), introducing a DSB. In some embodiments, the use of double nicking can improve specificity and reduce off-target effects. In some embodiments, the nickase is used with two separate guide RNAs that target opposite strands of the DNA to produce double nicks within the target DNA. In some embodiments, the nickase is used with two separate guide RNAs selected to be in very close proximity to produce double nicks within the target DNA. In some embodiments, the nucleic acids encoding nickases are provided in combination with a pair of guide RNAs that are complementary to the sense and antisense strands of the target sequence, respectively. In this embodiment, the guide RNAs direct the nickase to the target sequence by generating nicks on opposite strands of the target sequence (i.e., double nicking), introducing a DSB. In some embodiments, the use of double nicking can improve specificity and reduce off-target effects. In some embodiments, the nickase is used with two separate guide RNAs that target opposite strands of the DNA to produce double nicks within the target DNA. In some embodiments, the nickase is used with two separate guide RNAs selected to be in very close proximity to produce double nicks within the target DNA. In some embodiments, the nucleic acids encoding nickases are provided in combination with a pair of guide RNAs that are complementary to the sense and antisense strands of the target sequence, respectively. In this embodiment, the guide RNAs direct the nickase to the target sequence by generating nicks on opposite strands of the target sequence (i.e., double nicking), introducing a DSB. In some embodiments, the use of double nicking can improve specificity and reduce off-target effects. In some embodiments, the nickase is used with two separate guide RNAs that target opposite strands of the DNA to produce double nicks within the target DNA. In some embodiments, the nickase is used with two separate guide RNAs selected to be in very close proximity to produce double nicks within the target DNA. In some embodiments, the nucleic acids encoding nickases are provided in combination with a pair of guide RNAs that are complementary to the sense and antisense strands of the target sequence, respectively. In this embodiment, the guide RNAs direct the nickase to the target sequence by generating nicks on opposite strands of the target sequence (i.e., double nicking), introducing a DSB. In some embodiments, the use of double nicking can improve specificity and reduce off-target effects. In some embodiments, the nickase is used with two separate guide RNAs that target opposite strands of the DNA to produce double nicks within the target DNA. In some embodiments, the nickase is used with two separate guide RNAs selected to be in very close proximity to produce double nicks within the target DNA. In some embodiments, the nucleic acids encoding nickases are provided in combination with a pair of guide RNAs that are complementary to the sense and antisense strands of the target sequence, respectively. In this embodiment, the guide RNAs direct the nickase to the target sequence by generating nicks on opposite strands of the target sequence (i.e., double nicking), introducing a DSB. In some embodiments, the use of double nicking can improve specificity and reduce off-target effects. In some embodiments, the nickase is used with two separate guide RNAs that target opposite strands of the DNA to produce double nicks within the target DNA. In some embodiments, the nickase is used with two separate guide RNAs selected to be in very close proximity to produce double nicks within the target DNA. In some embodiments, the nucleic acids encoding nickases are provided in combination with a pair of guide RNAs that are complementary to the sense and antisense strands of the target sequence, respectively. In this embodiment, the guide RNAs direct the nickase to the target sequence by generating nicks on opposite strands of the target sequence (i.e., double nicking), introducing a DSB. In some embodiments, the use of double nicking can improve specificity and reduce off-target effects. In some embodiments, the nickase is used with two separate guide RNAs that target opposite strands of the DNA to produce double nicks within the target DNA. In some embodiments, the nickase is used with two separate guide RNAs selected to be in very close proximity to produce double nicks within the target DNA.

[0436] In some embodiments, the RNA-guided DNA binding agent lacks nuclease and nickase activities. In some embodiments, the RNA-guided DNA binding agent comprises a dCas DNA binding polypeptide. The dCas polypeptide has DNA binding activity while being essentially devoid of catalytic (nuclease / nickase) activity. In some embodiments, the dCas polypeptide is a dCas9 polypeptide. In some embodiments, the RNA-guided DNA binding agent lacking nuclease and nickase activities, or the dCas DNA binding polypeptide, is an aspect of a Cas nuclease (e.g., the Cas nuclease described above) whose endonuclease active site has been inactivated by one or more modifications (e.g., point mutations) within its catalytic domain. See, for example, US2014 / 0186958A1, US2015 / 0166980A1. An exemplary dCas9 amino acid sequence is provided as SEQ ID NO: 208. An exemplary dCas9 mRNA ORF sequence including start and stop codons is provided as SEQ ID NO: 209. An exemplary dCas9 mRNA coding sequence suitable for inclusion in a fusion protein is provided as SEQ ID NO: 346.

[0437] a) Heterologous functional domains, nuclear localization signals In some embodiments, the RNA-guided DNA binding agent (e.g., a Cas9 nuclease such as S. pyogenes Cas9) comprises one or more heterologous functional domains (e.g., is a fusion polypeptide or comprises a fusion polypeptide).

[0438] ​​​​​​​​​​​​​In some embodiments, the heterologous functional domain can facilitate the cellular nuclear transport of the RNA-guided DNA binding agent. For example, the heterologous functional domain can be a nuclear localization signal (NLS). In some embodiments, the RNA-guided DNA binding agent can be fused with 1 to 10 NLSs. In some embodiments, the RNA-guided DNA binding agent can be fused with 1 to 5 NLSs. In some embodiments, the RNA-guided DNA binding agent can be fused with 1 NLS. When 1 NLS is used, the NLS can be linked at the N-terminal or C-terminal of the sequence of the RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent can be fused to at least 1 NLS at the C-terminus. The NLS can also be inserted into the sequence of the RNA-guided DNA binding agent. In other embodiments, the RNA-guided DNA binding agent can be fused with more than 1 NLS. In some embodiments, the RNA-guided DNA binding agent can be fused with 2, 3, 4, or 5 NLSs. In some embodiments, the RNA-guided DNA binding agent can be fused with 2 NLSs. In certain situations, the 2 NLSs can be the same (e.g., 2 SV40 NLSs) or different. In some embodiments, the RNA-guided DNA binding agent is fused to the sequence of 2 SV40 NLSs linked at the carboxy terminus. In some embodiments, the RNA-guided DNA binding agent may be fused with 2 NLSs, one linked to the N-terminal and one linked to the C-terminal. In some embodiments, the RNA-guided DNA binding agent can be fused with 3 NLSs. In some embodiments, the RNA-guided DNA binding agent is NLS It can be fused without. In some embodiments, the NLS is a single-segment sequence, e.g., S V40 NLS, PKKKRKV (SEQ ID NO: 278) or PKKKRRV (SEQ ID NO: 290). In some embodiments, the NLS is a two-segment sequence, e.g., KRPAATKKAGQAKKKK (SEQ ID NO: 91), which is the NLS of nucleoplasmin It may be. In some embodiments, the NLS sequence is LAAKRSRTT (SEQ ID NO: 279), QAAKRSRTT (SEQ ID NO: 280), PAPAKRERTT (SEQ ID NO: 281), QAAKRPRTT (SEQ ID NO: 282), RAAKRPRTT (SEQ ID NO: 283), AAAKRSWSMAA (SEQ ID NO: 284), AAAKRVWSMAF (SEQ ID NO: 285), AAAKRSWSMAF (SEQ ID NO: 286), AAAKRKYFAA (SEQ ID NO: 287), RAAKRKAFAA (SEQ ID NO: 288), or RAAKRKYFA V (SEQ ID NO: 289). In certain embodiments, a single PKKKRKV (SEQ ID NO: 278) NLS can be linked at the C-terminus of the RNA-guided DNA binder. More than one linker is optionally included at the fusion site. In some embodiments, one or more of the NLSs of any of the foregoing embodiments are present in the RNA-guided DNA binder in combination with one or more additional heterologous functional domains, such as any of the heterologous functional domains described below. In some embodiments, the heterologous functional domain can modify the intracellular half-life of the RNA-guided DNA binder. In some embodiments, the half-life of the RNA-guided DNA binder can be increased. In some embodiments, the RNA-guided DNA binder.

[0439] In some embodiments, the heterologous functional domain can modify the intracellular half-life of the RNA-guided DNA binder. In some embodiments, the half-life of the RNA-guided DNA binder can be increased. In some embodiments, the half-life of the RNA-guided DNA binder can be increased. The half-life can be reduced. In some embodiments, the heterologous functional domain is an RNA guide that can increase the stability of the DNA binder. In some embodiments, the heterologous func tional domain can reduce the stability of the RNA-guided DNA binder. In some embodiments, the heterologous functional domain can function as a proteolytic signal peptide. In some embodiments, proteolysis can be mediated by a proteolytic enzyme such as, for example, a proteasome, a lysosomal protease, or a calpain protease. In some embodiments, the heterologous functional domain can contain a PEST sequence. In some embodiments, the RNA-guided DNA binder can be modified by the addition of ubiquitin or a polyubiquitin chain. In some embodiments, the ubiquitin can be a ubiquitin-like protein (UBL). Non-limiting examples of ubiquitin-like proteins include small ubiquitin-like modifier (SUMO), ubiquitin cross-reactive protein (UCRP, also known as interferon-stimulated gene-15 (ISG15)), ubiquitin-related modifier-1 (URM1), developmentally downregulated protein-8 expressed by neural progenitor cells (NEDD8, also called Rub 1 in S. cerevisiae), human leukocyte antigen F-associated (FAT10), autophagy-8 (ATG 8) and -12 (ATG12), Fau ubiquitin-like protein (FUB1), membrane-anchored UBL (MUB), ubiquitin-fold modifier-1 (UFM1), and ubiquitin-like protein-5 (UBL5). protein (UCRP, also known as interferon-stimulated gene-15 (ISG15)), ubiquitin-related modifier-1 (URM1), developmentally downregulated protein-8 expressed by neural progenitor cells (NEDD8, also called Rub 1 in S. cerevisiae), human leukocyte antigen F-associated (FAT10), autophagy-8 (ATG 8) and -12 (ATG12), Fau ubiquitin-like protein (FUB1), membrane-anchored UBL (MUB), ubiquitin-fold modifier-1 (UFM1), and ubiquitin-like protein-5 (UBL5). 8) and -12 (ATG12), Fau ubiquitin-like protein (FUB1), membrane-anchored UBL (MUB), ubiquitin-fold modifier-1 (UFM1), and ubiquitin-like protein-5 (UBL5). 8) and -12 (ATG12), Fau ubiquitin-like protein (FUB1), membrane-anchored

[0440] ​In some embodiments, the heterologous functional domain may be a marker domain . Non-limiting examples of marker domains include fluorescent proteins, purification tags, epitope tags , and reporter gene sequences. In some embodiments, the marker domain may be a fluorescent protein. Non-limiting examples of suitable fluorescent proteins include green fluorescent protein (e.g., GFP, GFP-2, tagGFP, turboGFP , sfGFP, EGFP, Emerald, Azami Green, Monomeric Azami Green, CopGFP, AceGFP, ZsGreen1), yellow fluorescent protein (e.g., YFP, EYFP, Citrine, Venus, YPet , PhiYFP, ZsYellow1), blue fluorescent protein (e.g., EBFP, E BFP2, Azurite, mKalamal, GFPuv, Sapphire, T-sapphire ), cyan fluorescent protein (e.g., ECFP, Cerulean, CyPet , AmCyan1, Midoriishi-Cyan), red fluorescent protein (e.g ., mKate, mKate2, mPlum, DsRed monomer, mCherry, m RFP1, DsRed-Express, DsRed2, DsRed-Monomer, HcRed-Tandem, HcRed1, AsRed2, eqFP611, mRaspberry , mStrawberry, Jred), and orange fluorescent protein (mOrange , mKO, Kusabira-Orange, Monomeric Kusabira-Orange , mTangerine, tdTomato), or any other suitable fluorescent protein. In other embodiments, the marker domain is a purification tag It may also be a glycosylation and / or epitope tag. Non-limiting exemplary tags include glutathione-S-transferase (GST), chitin binding protein (CBP), maltose binding protein (MBP), thioredoxin (TRX), poly(NANP), tandem affinity purification (TAP) tag, myc, AcV5, AU1, AU5, E, ECS E2, FLAG, HA, nus, Softag 1, Softag 3, Strep , SBP, Glu-Glu, HSV, KT3, S, S1, T7, V5, VSV-G, 6x His, 8xHis, biotin carboxyl carrier protein (BCCP), poly-His , and calmodulin. Non-limiting exemplary reporter genes include glutathione-S-transferase (GST), horseradish peroxidase (HR P), chloramphenicol acetyltransferase (CAT), β-galactosidase , β-glucuronidase, luciferase, or a fluorescent protein.

[0441] In additional embodiments, the heterologous functional domain can target the RNA-guided DNA binder to a specific organelle, cell type, tissue, or organ. In some embodiments, the heterologous functional domain can target the RNA-guided DNA binder to mitochondria.

[0442] In further embodiments, the heterologous functional domain may be an effector domain. When the RNA-guided DNA binder is directed to its target sequence, for example, when a Cas nuclease is directed to the target sequence by a gRNA, the effector domain can modify or affect the target sequence. In some embodiments, the effector The domains include nucleic acid binding domains, nuclease domains (e.g., non-Cas nuclease domains), and ze domain), epigenetic modification domain, transcriptional activation domain, or transcriptional repression domain In some embodiments, the heterologous functional domain may be selected from a nucleic acid domain. nuclease, such as FokI nuclease. See, e.g., U.S. Patent No. 9,023,649. In some embodiments, the heterologous functional domain is a transcriptional activator or is a transcriptional repressor. For example, Qi et al., “Repurposing CR ISPR as an RNA-guided platform for seque nce-specific control of gene expression” ,Cell 152:1173-83(2013), Perez-Pinera et. al., “RNA-guided gene activation by CRISP R-Cas9-based transcription factors,”Nat. Methods 10:973-6(2013), Mali et al., “CAS9 transcriptional activators for target s pecificity screening and paired nickases for cooperative genome engineering,”Nat .Biotechnol.31:833-8(2013), Gilbert et al. .,“CRISPR-mediated modular RNA-guided re gulation of transcription in eukaryotes, ”See Cell 154:442-51(2013). Thus, the RNA-guided DNA binding agent can essentially become a transcription factor that is directed to bind to a desired target sequence using a guide RNA. In certain embodiments, the DNA modification domain is a methylation domain such as a demethylation domain or a methyltransferase domain. In certain embodiments, the effector domain is a DNA modification domain such as a base editing domain. In certain embodiments, the DNA modification domain is a nucleic acid editing domain that introduces a specific modification to DNA, for example, a deaminase domain. See, for example, WO201 5 / 089406, US 2016 / 0304846. The nucleic acid editing domains, deaminase domains, and Cas9 variants described in WO2015 / 08 9406 and US2016 / 0304846 are incorporated herein by reference.

[0443] A nucleic acid comprising an open reading frame encoding an E.RNA-guided DNA binding agent A nucleic acid comprising an ORF encoding an RNA-guided DNA binding agent disclosed herein (e.g., a Cas9 nuclease such as S.pyogenes C as9) may optionally be combined with a composition or method using any of the gRNAs disclosed herein. In any of the embodiments described herein, the nucleic acid comprising an open reading frame encoding an RNA-guided DNA binding agent may be an mRNA. 1. ORF with low adenine content

[0444] In some embodiments, the RNA-guided DNA binding agent, e.g., S.pyogen The ORF encoding a Cas9 nuclease such as Cas9 has an adenine content in the range of its minimum adenine content to about 150% of its minimum adenine content. In some embodiments, the adenine content of the ORF is about 145% or less, 140% or less, 135% or less, 130% or less, 125% or less, 120% or less, 11 5% or less, 110% or less, 105% or less, 104% or less, 103% or less, 102% or less, or 101% or less of its minimum adenine content. In some embodiments, the ORF has an adenine content equal to its minimum adenine content. In some embodiments, the ORF has an adenine content that is about 150% or less of its minimum adenine content. In some embodiments, the ORF has an adenine content that is about 145% or less of its minimum adenine content. In some embodiments, the ORF has an adenine content that is about 140% or less of its minimum adenine content. In some embodiments, the ORF has an adenine content that is about 135% or less of its minimum adenine content. In some embodiments, the ORF has an adenine content that is about 130% or less of its minimum adenine content. In some embodiments the ORF has an adenine content that is about 125% or less of its minimum adenine content. In some embodiments, the ORF has an adenine content that is about 120% or less of its minimum adenine content. In some embodiments, the ORF has an adenine content that is about 115% or less of its minimum adenine content. In some embodiments, the O RF has an adenine content that is about 110% or less of its minimum adenine content. In some embodiments, the ORF has an adenine content that is about 105 of its minimum adenine content. % is as follows. In some embodiments, the ORF has an adenine content that is about 104% or less of its minimum adenine content. In some embodiments, the ORF has an adenine content that is about 103% or less of its minimum adenine content. In some embodiments, the ORF has an adenine content that is about 102% or less of its minimum adenine content. In some embodiments, the ORF has an adenine content that is about 101% or less of its minimum adenine content. In some embodiments, the ORF has an adenine content that is within the range of its minimum adenine content to 200% of its minimum adenine content. In some embodiments, the adenine dinucleotide content of the ORF is about 195% or less, 190% or less, 185% or less,

[0445] In some embodiments, the ORF has an adenine dinucleotide content that is within the range of its minimum adenine dinucleotide content to 200% of its minimum adenine dinucleotide content. In some embodiments, the adenine dinucleotide content of the ORF is about 195% or less, 190% or less, 185% or less, 180% or less, 175% or less, 170% or less, 165% or less, 160% or less, 155% or less, 150% or less, 145% or less, 140% or less, 135% or less, 130% or less, 125% or less, 120% or less, 115% or less, 110% or less, 105% or less, 104% or less, 103% or less, 102% or less, or 101% or less of its minimum adenine dinucleotide content. In some embodiments, the ORF has an adenine dinucleotide content equal to its minimum adenine dinucleotide content. In some embodiments, the ORF has an adenine dinucleotide content that is about 200% or less of its minimum adenine dinucleotide content. In some embodiments, the ORF has an adenine dinucleotide content that is about 195% or less of its minimum adenine dinucleotide content. In some embodiments, the ORF has an adenine dinucleotide content that is about 195% or less of its minimum adenine dinucleotide content. In some embodiments, the ORF has an adenine dinucleotide content that is about 195% or less of its minimum adenine dinucleotide content. In some embodiments, the ORF has an adenine dinucleotide content that is about 195% or less of its minimum adenine dinucleotide content. In some embodiments, the ORF has an adenine dinucleotide content that is about 195% or less of its minimum adenine dinucleotide content. The nucleotide content is about 190% or less of its minimum adenine nucleotide content. In some embodiments, the ORF has an adenine nucleotide content of about 185% or less of its minimum adenine nucleotide content. In some embodiments, the ORF has an adenine nucleotide content of about 180% or less of its minimum adenine nucleotide content. In some embodiments, the ORF has an adenine nucleotide content of about 175% or less of its minimum adenine nucleotide content. In some embodiments, the ORF has an adenine nucleotide content of about 170% or less of its minimum adenine nucleotide content. In some embodiments, the ORF has an adenine nucleotide content of about 165% or less of its minimum adenine nucleotide content. In some embodiments, the ORF has an adenine nucleotide content of about 160% or less of its minimum adenine nucleotide content. In some embodiments, the ORF has an adenine nucleotide content of about 155% or less of its minimum adenine nucleotide content. In some embodiments, the ORF has an adenine nucleotide content equal to its minimum adenine nucleotide content. In some embodiments, the ORF has an adenine nucleotide content of about 150% or less of its minimum adenine nucleotide content. In some embodiments, the ORF has an adenine nucleotide content of about 145% or less of its minimum adenine nucleotide content. In some embodiments, the ORF has an adenine nucleotide content of about 145% or less of its minimum adenine nucleotide content. In some embodiments, the ORF has an adenine nucleotide content of about 145% or less of its minimum adenine nucleotide content. In some embodiments, the ORF has an adenine nucleotide content of about It is about 140% or less of the small adenine nucleotide content. In some embodiments , the ORF has an adenine nucleotide content that is about 135% or less of its minimum adenine nucleotide content . In some embodiments, the ORF has an adenine nucleotide content that is about 130% or less of its minimum adenine nucleotide content. In some embodiments, the ORF has an adenine nucleotide content that is about 125% or less of its minimum adenine nucleotide content. In some embodiments, the ORF has an adenine nucleotide content that is about 120 % or less of its minimum adenine nucleotide content. In some embodiments, the ORF has an adenine nucleotide content that is about 115% or less of its minimum adenine nucleotide content. In some embodiments , the ORF has an adenine nucleotide content that is about 110% or less of its minimum adenine nucleotide . In some embodiments, the ORF has an adenine nucleotide content that is about 105% or less of its minimum adenine nucleotide content . In some embodiments, the ORF has an adenine nucleotide content that is about the most 104% or less of its minimum adenine nucleotide content. In some embodiments , the ORF has an adenine nucleotide content that is about 103% or less of its minimum adenine nucleotide content . In some embodiments, the ORF has an adenine nucleotide content that is about 102% or less of its minimum adenine nucleotide content. In some embodiments, the ORF has an adenine nucleotide content that is about 101% or less of its minimum adenine nucleotide content.

[0446] In some embodiments, the ORF has an adenine nucleotide content that ranges from its minimum adenine nucleotide content to 90% or less of the maximum adenine nucleotide content of a reference sequence that encodes the same protein as the mRNA in question. In some embodiments, the adenine nucleotide content of the ORF is about 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 40% or less, 35% or less, 3 0% or less, 25% or less, 20% or less, 15% or less, 10% or less, or 5% or less of the maximum adenine nucleotide content of a reference sequence that encodes the same protein as the mRNA in question.

[0447] In some embodiments, the ORF has an adenine trinucleotide content that ranges from 0 adenine trinucleotides to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 3 0, 40, or 50 adenine trinucleotides (where longer numbers of adenine are counted as the number of distinct three-adenine segments within them; for example, an adenine tetranucleotide contains 2 adenine trinucleotides, and an adenine pentanucleotide contains 3 adenine trinucleotides, etc.). In some embodiments, the ORF has an adenine trinucleotide content that ranges from 0% adenine trinucleotides to 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7 %, 0.8%, 0.9%, 1%, 1.5%, or 2% adenine trinucleotides, where the percentage of adenine trinucleotides is calculated based on the total number of trinucleotides in the ORF. Sequences occupied by adenine that form part of d (or even a longer number of adenines) Calculated as a percentage of the positions in, resulting in the sequences UUUAAA and UUUUAA AA each have an adenine trinucleotide content of 50%. For example, in some embodiments, the ORF has an adenine trinucleotide content of 2% or less. For example , in some embodiments, the ORF has an adenine trinucleotide content of 1.5% or less. In some embodiments, the ORF has an adenine trinucleotide content of 1% or less. In some embodiments, the ORF has an adenine trinucleotide content of 0.9% or less. In some embodiments, the ORF has an adenine trinucleotide content of 0.8% or less. In some embodiments, the ORF has an adenine trinucleotide content of 0.7% or less. In some embodiments the ORF has an adenine trinucleotide content of 0.6% or less. In some embodiments, the ORF has an adenine trinucleotide content of 0.5% or less. In some embodiments, the ORF has an adenine trinucleotide content of 0.4% or less. In some embodiments, the ORF has an adenine trinucleotide content of 0.3% or less. In some embodiments, the ORF has an adenine trinucleotide content of 0.2% or less. In some embodiments, the ORF has an adenine trinucleotide content of 0.1% or less. In some embodiments, nucleic acids encoding RNA guide DNA binding agents that include ORFs that do not contain adenine trinucleotides are provided.

[0448] ​In some embodiments, the ORF has an adenine nucleotide content that ranges from its minimum adenine nucleotide content to 90% or less of the maximum adenine nucleotide content of a reference sequence that encodes the same protein as the problematic mRNA. In some embodiments, the adenine nucleotide content of the ORF is about 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, or 5% or less of the maximum adenine nucleotide content of a reference sequence that encodes the same protein as the problematic mRNA. For example, by using minimum adenine codons in a sufficient fraction of the ORF, a given ORF can have its adenine content or adenine dinucleotide content or adenine nucleotide content reduced. For example, the amino acid sequence of an RNA-guided DNA binder can be reverse-translated into an ORF sequence by converting the amino acids to codons, and some or all of the ORF uses the exemplary minimum adenine codons shown below. In some embodiments, at least about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, about 99%, or about 100% of the codons in the ORF are the codons listed in Table 4. In some embodiments, the adenine nucleotide content of the ORF ranges from its minimum adenine nucleotide content to the adenine nucleotide content up to 90% or less of the maximum adenine nucleotide content of a reference sequence that encodes the same protein as the problematic mRNA. In some embodiments, the adenine nucleotide content of the ORF is about 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, or 5% or less of the maximum adenine nucleotide content of a reference sequence that encodes the same protein as the problematic mRNA. For example, by using minimum adenine codons in a sufficient fraction of the ORF, a given ORF can have its adenine content or adenine dinucleotide content or adenine nucleotide content reduced. For example, the amino acid sequence of an RNA-guided DNA binder can be reverse-translated into an ORF sequence by converting the amino acids to codons, and some or all of the ORF uses the exemplary minimum adenine codons shown below. In some embodiments, at least about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, about 99%, or about 100% of the codons in the ORF are the codons listed in Table 4. In some embodiments, the adenine nucleotide content of the ORF ranges from its minimum adenine nucleotide content to the adenine nucleotide content up to 90% or less of the maximum adenine nucleotide content of a reference sequence that encodes the same protein as the problematic mRNA. In some embodiments, the adenine nucleotide content of the ORF is about 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, or 5% or less of the maximum adenine nucleotide content of a reference sequence that encodes the same protein as the problematic mRNA. For example, by using minimum adenine codons in a sufficient fraction of the ORF, a given ORF can have its adenine content or adenine dinucleotide content or adenine nucleotide content reduced. For example, the amino acid sequence of an RNA-guided DNA binder can be reverse-translated into an ORF sequence by converting the amino acids to codons, and some or all of the ORF uses the exemplary minimum adenine codons shown below. In some embodiments, at least about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, about 99%, or about 100% of the codons in the ORF are the codons listed in Table 4.

[0449] For example, by using minimum adenine codons in a sufficient fraction of the ORF, a given ORF can have its adenine content or adenine dinucleotide content or adenine nucleotide content reduced. For example, the amino acid sequence of an RNA-guided DNA binder can be reverse-translated into an ORF sequence by converting the amino acids to codons, and some or all of the ORF uses the exemplary minimum adenine codons shown below. In some embodiments, at least about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, about 99%, or about 100% of the codons in the ORF are the codons listed in Table 4. For example, by using minimum adenine codons in a sufficient fraction of the ORF, a given ORF can have its adenine content or adenine dinucleotide content or adenine nucleotide content reduced. For example, the amino acid sequence of an RNA-guided DNA binder can be reverse-translated into an ORF sequence by converting the amino acids to codons, and some or all of the ORF uses the exemplary minimum adenine codons shown below. In some embodiments, at least about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, about 99%, or about 100% of the codons in the ORF are the codons listed in Table 4. For example, by using minimum adenine codons in a sufficient fraction of the ORF, a given ORF can have its adenine content or adenine dinucleotide content or adenine nucleotide content reduced. For example, the amino acid sequence of an RNA-guided DNA binder can be reverse-translated into an ORF sequence by converting the amino acids to codons, and some or all of the ORF uses the exemplary minimum adenine codons shown below. In some embodiments, at least about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, about 99%, or about 100% of the codons in the ORF are the codons listed in Table 4. For example, by using minimum adenine codons in a sufficient fraction of the ORF, a given ORF can have its adenine content or adenine dinucleotide content or adenine nucleotide content reduced. For example, the amino acid sequence of an RNA-guided DNA binder can be reverse-translated into an ORF sequence by converting the amino acids to codons, and some or all of the ORF uses the exemplary minimum adenine codons shown below. In some embodiments, at least about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, about 99%, or about 100% of the codons in the ORF are the codons listed in Table 4. For example, by using minimum adenine codons in a sufficient fraction of the ORF, a given ORF can have its adenine content or adenine dinucleotide content or adenine nucleotide content reduced. For example, the amino acid sequence of an RNA-guided DNA binder can be reverse-translated into an ORF sequence by converting the amino acids to codons, and some or all of the ORF uses the exemplary minimum adenine codons shown below. In some embodiments, at least about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, about 99%, or about 100% of the codons in the ORF are the codons listed in Table 4. For example, by using minimum adenine codons in a sufficient fraction of the ORF, a given ORF can have its adenine content or adenine dinucleotide content or adenine nucleotide content reduced. For example, the amino acid sequence of an RNA-guided DNA binder can be reverse-translated into an ORF sequence by converting the amino acids to codons, and some or all of the ORF uses the exemplary minimum adenine codons shown below. In some embodiments, at least about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, about 99%, or about 100% of the codons in the ORF are the codons listed in Table 4. For example, by using minimum adenine codons in a sufficient fraction of the ORF, a given ORF can have its adenine content or adenine dinucleotide content or adenine nucleotide content reduced. For example, the amino acid sequence of an RNA-guided DNA binder can be reverse-translated into an ORF sequence by converting the amino acids to codons, and some or all of the ORF uses the exemplary minimum adenine codons shown below. In some embodiments, at least about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, about 99%, or about 100% of the codons in the ORF are the codons listed in Table 4. For example, by using minimum adenine codons in a sufficient fraction of the ORF, a given ORF can have its adenine content or adenine dinucleotide content or adenine nucleotide content reduced. For example, the amino acid sequence of an RNA-guided DNA binder can be reverse-translated into an ORF sequence by converting the amino acids to codons, and some or all of the ORF uses the exemplary minimum adenine codons shown below. In some embodiments, at least about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, about 99%, or about 100% of the codons in the ORF are the codons listed in Table 4. [Table 4]

[0450] In some embodiments, at least about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, about 99%, or about 100% of the codons are the codons listed in Table 4 A nucleic acid encoding an RNA-guided DNA binding agent (e.g., a Cas9 nuclease such as S.p yogenes Cas9) comprising an ORF consisting of a set of certain codons is provided . In some embodiments, the ORF has a minimum nucleotide homopolymer, e.g., a string of repeated identical nucleotides. For example, in some embodiments, when selecting the minimum uridine codon from the codons listed in Table 4 , the nucleic acid selects the minimum adenine codon that reduces the number and length of nucleotide homopolymers, e.g., selecting GCG instead of GCC for alanine, or selecting GGC instead of GGG for glycine, and is constructed thereby.

[0451] In any of the preceding embodiments, the nucleic acid can be mRNA.

[0452] 2. Increase translation and / or codons corresponding to highly expressed tRNAs, exemplary codon sets In some embodiments, the nucleic acid comprises an ORF having codons that increase translation in mammals such as humans. In further embodiments, the nucleic acid comprises an ORF having codons that increase translation in an organ (e.g., the liver) of a mammal (e.g., a human). In further embodiments, the nucleic acid comprises an ORF having codons that increase translation in a cell type (e.g., hepatocytes) of a mammal (e.g., a human) . The increase in translation in mammals, cell types, organs of mammals, humans, organs of humans, etc. is compared to the degree of translation of the wild-type sequence of the ORF compared to, or the ORF having the best similarity at the organism or amino acid level from which the ORF is derived contained organisms (e.g., S. pyogenes, S. aureus, or, if it can be a Cas nuclease derived from a prokaryote, another prokaryote, e.g., a Cas nuclease derived from another prokaryote listed below) can be determined by comparing with an ORF having a codon distribution that matches the codon distribution of the Cas nuclease derived from a prokaryote described below. Alternatively, in some embodiments, the increase in translation of the Cas9 sequence in mammals, cell types, mammalian organs, humans, human organs, etc. is determined by comparing with the translation of an ORF having the sequence of SEQ ID NO: 205, including any applicable point mutations, heterologous domains, etc. The codons useful for increasing expression in humans, including human liver and human hepatocytes, may be codons corresponding to highly expressed tRNAs in human liver / hepatocytes, which are described in Dittmar KA, PLoS Genetics 2(12):e221(2006). In some embodiments, at least about 75%, 80%, 85%, 90%, 9 5%, 96%, 97%, 98%, 99%, or 100% of the codons in the ORF are codons corresponding to highly expressed tRNAs (e.g., the most highly expressed tRNA for each amino acid) in mammals such as humans . In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in the ORF are codons corresponding to highly expressed tRNAs (e.g., the most highly expressed tRNA for each amino acid) in mammalian organs such as human organs . In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% of the codons in the ORF are, for example, codons corresponding to highly expressed tRNAs in human liver / hepatocytes, which are described in Dittmar KA, PLoS Genetics 2(12):e221(2006). In some embodiments, at least about 75%, 80%, 85%, 90%, 9 5%, 96%, 97%, 98%, 99%, or 100% of the codons in the ORF are codons corresponding to highly expressed tRNAs (e.g., the most highly expressed tRNA for each amino acid) in mammals such as humans . In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in the ORF are codons corresponding to highly expressed tRNAs (e.g., the most highly expressed tRNA for each amino acid) in mammalian organs such as human organs . In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% of the codons in the ORF are codons corresponding to highly expressed tRNAs (e.g., the most highly expressed tRNA for each amino acid) in mammalian organs such as human organs. In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% of the codons in the ORF or 100% is a codon corresponding to a highly expressed tRNA in mammalian liver such as human liver (e.g., the highest expressed tRNA for each amino acid). In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96 %, 97%, 98%, 99%, or 100% of the codons in the ORF are codons corresponding to highly expressed tRNAs in mammalian hepatocytes such as human hepatocytes (e.g., the highest expressed tRNA for each amino acid).

[0453] Alternatively, codons corresponding to highly expressed tRNAs in an organism (e.g., human) may generally be used.

[0454] Any of the aforementioned approaches to codon selection can start, for example, from the codons in Table 4 and then, when more than one option is available, generally in an organism (e.g., human) or in either the organ or cell type of interest, e.g., liver or hepatocytes (e.g., human liver or human hepatocytes), be combined with the minimum adenine codons shown above by using codons corresponding to more highly expressed tRNAs.

[0455] In some embodiments, at least 75%, 80%, 85% , 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in the ORF are codons derived from the codon sets shown in Table 5 (e.g., low U1, low A, or low A / U codon sets). The codons in the low U1, low G, low C, low A, and low A / U sets also use codons corresponding to more highly expressed tRNAs when more than one option is available, while the ones shown are used. Use codons that minimize nucleotides. In some embodiments, within the ORF at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98 %, 99%, or 100% of the codons are codons derived from the low-U1 codon set shown in Table 5 . In some embodiments, at least 75%, 80%, 85% of the codons in the ORF are 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons shown in Table 5 are codons derived from the low-A codon set. In some embodiments, at least 75%, 80%, 85% of the codons in the ORF are 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons shown in Table 5 are codons derived from the low-A / U codon set.

Table 5

[0456] 3. Exemplary sequences In some embodiments, the ORF encoding the RNA-guided DNA binder comprises a sequence having at least 93% identity with SEQ ID NO: 311, and / or the ORF is having at least 93% identity with SEQ ID NO: 311 over at least its first 50, 200, 250, or 300 nucleotides, or having at least its first 30, 50, 70, 100, 150, 200, 250, or 300 nucleotides having at least 95% identity with SEQ ID NO: 311, and / or the ORF is composed of a set of codons in which at least 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% of the codons are codons listed in Table 1, and / or the OR is composed of a set of codons in which at least 95%, 96%, 97%, 98%, 99%, 99.5%, or F is the adenine content from the minimum adenine content to 123% of the minimum adenine content. and / or the ORF has an adenine dinucleotide content ranging from Small adenine dinucleotide content - 150% of the minimum adenine dinucleotide content The range is.

[0457] In some embodiments, the polynucleotide encoding the RNA-guided DNA binding agent The code has at least 95%, 96%, 97%, 98%, 99%, 99.5% identity with SEQ ID NO: 377. %, or 100% identity.

[0458] In some embodiments, the ORF encoding the RNA-guided DNA binding agent has the sequence Numbers 201, 204, 207, 209, 210, 211, 212, 214, 215, 21 7, 218, 220, 221, 223, 224, 226, 227, 229, 230, 25 At least one of 0, 252, 254, 265, 266, or 307 to 375 In some embodiments, the mRNA comprises a sequence having at least 90% identity to the RNA. The ORF comprises an A-guided DNA binder, and the RNA-guided DNA binder is represented by SEQ ID NO: No. 203, 206, 208, 213, 216, 219, 222, 225, 228, 268 or an amplified sequence having at least 90% identity with any one of 386 to 396 The ORF contains an amino acid sequence, and the adenine content is within the range of the minimum adenine content to the minimum amino acid content. Up to 150% of the adenine content and / or adenine dinucleotide content The amount is the minimum adenine dinucleotide content ~ the minimum adenine dinucleotide content In some embodiments, the encoded RNA guide The DNA binder comprises an amino acid sequence having at least 90% identity with any one of SEQ ID NOs: 203, 206, 208, 213, 216, 219, 222, 225, 228, 268, or 386 - 396, and the ORF has a uridine content in the range from its minimum uridine content to 150% of its minimum uridine content, and / or a uridine dinucleotide content in the range from its minimum uridine dinucleotide content to 150% of its minimum uridine dinucleotide content. In some such embodiments, both the adenine and uridine nucleotide contents are each 150% or less of their respective minimum values. In some embodiments, both the adenine and uridine dinucleotide contents are each 150% or less of their respective minimum values. In some embodiments, the mRNA comprises a sequence having at least 90% identity with any one of SEQ ID NOs: 243, 244, 251, 253, 255 - 261, or 2 67, and this sequence comprises an ORF encoding an RNA-guided DNA binder. In some embodiments, the mRNA comprises a sequence having at least 90% identity with any one of SEQ ID NOs: 243, 244, 251, 253, 255 - 261, or 2 67, and this sequence comprises an ORF encoding an RNA-guided DNA binder, and the first 3 nucleotides of SEQ ID NOs: 243, 244, 251 , 253, 255 - 261, or 267 are deleted. In some embodiments, any of the aforementioned identity levels is at least 95%, at least 98%, at least 99%, or 100%.

[0459] In some embodiments, the ORF encoding the RNA-guided DNA binding agent is at least the first 30, 50, 70, 100, 150, 200, 250, or 300 nucleotides over which has at least 90% identity with any one of SEQ ID NOs: 201, 204, 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or any one of 307- 375. The first 30, 50, 70, 100, 150, 200, 250, or 300 nucleotides are measured from the first nucleotide of the start codon (typically, ATG), such that A is nucleotide 1, T is nucleotide 2, etc. In some embodiments, the open reading frame has at least 90% identity with any one of SEQ ID NOs: 201, 204, 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or any one of 307-375 over at least the first 10%, 12% 15%, 20%, 25%, 30%, or 35% of its sequence. The length of the ORF sequence is the number of nucleotides from the start of the start codon to the end of the stop codon, and the first 10%, 12%, 15%, 20%, 25%, 30%, or 35% of that sequence corresponds to the number of nucleotides starting from the first nucleotide of the start codon that constitutes a predetermined percentage of the total sequence length.

[0460] In some embodiments, the nucleic acid comprising the ORF encoding the RNA-guided DNA binder has at least 90% identity with SEQ ID NO: 243, and the ORF of SEQ ID NO: 243 (i.e., SEQ ID NO: 204) is replaced with any one of the ORFs of SEQ ID NOs: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307 - 375, and comprises a sequence. In some embodiments, the nucleic acid comprising the ORF encoding the RNA-guided DNA binder has at least 90% identity with SEQ ID NO: 244, and the ORF of SEQ ID NO: 244 (i.e., SEQ ID NO: 204) is replaced with any one of the ORFs of SEQ ID NOs: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307 - 375, and comprises a sequence. That is, SEQ ID NO: 204) is replaced with any one of the ORFs of SEQ ID NOs: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307 - 375, and comprises a sequence. In some embodiments, the nucleic acid comprising the ORF encoding the RNA-guided DNA binder has at least 90% identity with SEQ ID NO: 256, and the ORF of SEQ ID NO: 256 (i.e., SEQ ID NO: 204) is replaced with any one of the alternative ORFs of SEQ ID NOs: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307 - 375, and comprises a sequence. That is, SEQ ID NO: 204)

[0461] In some embodiments, the nucleic acid comprising the ORF encoding the RNA-guided DNA binder has at least 90% identity with SEQ ID NO: 243, and the ORF of SEQ ID NO: 243 (i.e., SEQ ID NO: 204) is replaced with any one of the ORFs of SEQ ID NOs: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307 - 375, and comprises a sequence. In some embodiments, the nucleic acid comprising the ORF encoding the RNA-guided DNA binder has at least 90% identity with SEQ ID NO: 244, and the ORF of SEQ ID NO: 244 (i.e., SEQ ID NO: 204) is replaced with any one of the ORFs of SEQ ID NOs: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307 - 375, and comprises a sequence. That is, SEQ ID NO: 204) is replaced with any one of the ORFs of SEQ ID NOs: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307 - 375, and comprises a sequence. In some embodiments, the nucleic acid comprising the ORF encoding the RNA-guided DNA binder has at least 90% identity with SEQ ID NO: 256, and the ORF of SEQ ID NO: 256 (i.e., SEQ ID NO: 204) is replaced with any one of the alternative ORFs of SEQ ID NOs: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307 - 375, and comprises a sequence. That is, SEQ ID NO: 204)

[0462] In some embodiments, the nucleic acid comprising the ORF encoding the RNA-guided DNA binder has at least 90% identity with SEQ ID NO: 256, and the ORF of SEQ ID NO: 256 (i.e., SEQ ID NO: 204) is replaced with any one of the alternative ORFs of SEQ ID NOs: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307 - 375, and comprises a sequence. In some embodiments, the nucleic acid comprising the ORF encoding the RNA-guided DNA binder has at least 90% identity with SEQ ID NO: 256, and the ORF of SEQ ID NO: 256 (i.e., SEQ ID NO: 204) is replaced with any one of the alternative ORFs of SEQ ID NOs: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307 - 375, and comprises a sequence. That is, SEQ ID NO: 204) is replaced with any one of the alternative ORFs of SEQ ID NOs: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307 - 375, and comprises a sequence. In some embodiments, the nucleic acid comprising the ORF encoding the RNA-guided DNA binder has at least 90% identity with SEQ ID NO: 256, and the ORF of SEQ ID NO: 256 (i.e., SEQ ID NO: 204) is replaced with any one of the alternative ORFs of SEQ ID NOs: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307 - 375, and comprises a sequence. That is, SEQ ID NO: 204)

[0463] In some embodiments, the nucleic acid comprising an ORF encoding an RNA-guided DNA binding agent has at least 90% identity with SEQ ID NO: 257, and the ORF of SEQ ID NO: 257 (i.e., SEQ ID NO: 204) is SEQ ID NO: 207, 209, 210, 211, 212, 21 4, 215, 217, 218, 220, 221, 223, 224, 226, 227, 22 9, 230, 250, 252, 254, 265, 266, or any one of the ORFs from 307 to 375, and comprises a sequence in which it is replaced.

[0464] In some embodiments, the nucleic acid comprising an ORF encoding an RNA-guided DNA binding agent has at least 90% identity with SEQ ID NO: 258, and the ORF of SEQ ID NO: 258 (i.e., SEQ ID NO: 204) is SEQ ID NO: 207, 209, 210, 211, 212, 21 4, 215, 217, 218, 220, 221, 223, 224, 226, 227, 22 9, 230, 250, 252, 254, 265, 266, or any one of the ORFs from 307 to 375, and comprises a sequence in which it is replaced.

[0465] In some embodiments, the nucleic acid comprising an ORF encoding an RNA-guided DNA binding agent has at least 90% identity with SEQ ID NO: 259, and the ORF of SEQ ID NO: 259 (i.e., SEQ ID NO: 204) is SEQ ID NO: 207, 209, 210, 211, 212, 21 4, 215, 217, 218, 220, 221, 223, 224, 226, 227, 22 9, 230, 250, 252, 254, 265, 266, or any one of the ORFs from 307 to 375, and comprises a sequence in which it is replaced.

[0466] ​​​​​​​​​In some embodiments, a nucleic acid comprising an ORF encoding an RNA-guided DNA binding agent is The acid has at least 90% identity to SEQ ID NO:260 and is That is, SEQ ID NO: 204) is SEQ ID NO: 207, 209, 210, 211, 212, 21 4, 215, 217, 218, 220, 221, 223, 224, 226, 227, 22 9, 230, 250, 252, 254, 265, 266, or 307-375 It contains a sequence that is replac...

Claims

1. A method for treating TTR-associated amyloidosis (ATTR), comprising administering to a patient in need thereof The method includes administering to a subject a corticosteroid and a composition, the composition comprising: i) an RNA-guided DNA-binding agent or a nucleic acid encoding an RNA-guided DNA-binding agent; ii) a guide RNA, a. a guide sequence selected from SEQ ID NOs: 5-82; b. At least 17, 18, 19, or 20 of a sequence selected from SEQ ID NOs: 5 to 82 is 20 consecutive nucleotides, or c. At least 99%, 98%, 97%, or more of a sequence selected from SEQ ID NOs: 5 to 82; 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical guide sequences a guide RNA comprising a sequence; This method thereby treats ATTR.

2. A method for reducing TTR serum concentrations comprising administering a corticosteroid to a subject in need thereof. and administering a composition, the composition comprising: (i) an RNA-guided DNA binding agent or or a nucleic acid encoding an RNA-guided DNA-binding agent; and (ii) a guide RNA, a. a guide sequence selected from SEQ ID NOs: 5-82; b. At least 17, 18, 19, or 20 of a sequence selected from SEQ ID NOs: 5 to 82 is 20 consecutive nucleotides, or c. At least 99%, 98%, 97%, or more of a sequence selected from SEQ ID NOs: 5 to 82; 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical guide sequences a guide RNA comprising a sequence; thereby reducing TTR serum concentrations.

3. Reducing or inhibiting accumulation of amyloid or amyloid fibrils containing TTR in a subject A method of preventing the disease comprising administering a corticosteroid and a composition to a subject in need thereof. wherein the composition comprises: (i) an RNA-guided DNA binding agent or an RNA-guided DNA binding agent; (ii) a guide RNA, a. a guide sequence selected from SEQ ID NOs: 5-82; b. at least 17, 18, 19, or 20 of a sequence selected from SEQ ID NOs: 5 to 82; 20 consecutive nucleotides, or c. A sequence selected from SEQ ID NOs: 5 to 82 and at least 99%, 98%, 97%, 9 Guide sequences that are 6%, 95%, 94%, 93%, 92%, 91%, or 90% identical and a guide RNA comprising: thereby reducing the accumulation of amyloid or amyloid fibrils.

4. A composition comprising a guide RNA, the guide RNA comprising: a. a guide sequence selected from SEQ ID NOs: 5-82; b. at least 17, 18, 19, or 2 of a sequence selected from SEQ ID NOs: 5-82 0 consecutive nucleotides, or c. A sequence selected from SEQ ID NOs: 5 to 82 and at least 99%, 98%, 97%, 96%, %, 95%, 94%, 93%, 92%, 91%, or 90% identical guide sequences Including, Inducing a double strand break (DSB) in the TTR gene in a subject, and modifying the TTR gene to treat TTR-associated amyloidosis (ATA) in a subject. R) to reduce TTR serum concentrations in a subject and / or to treat amyloidosis in a subject. Methods for reducing or preventing accumulation of corticosteroids or amyloid fibrils A composition for use in combination with a roid.

5. A composition comprising a vector encoding a guide RNA, the guide RNA comprising: a. a guide sequence selected from SEQ ID NOs: 5-82; b. at least 17, 18, 19, or 20 of a sequence selected from SEQ ID NOs: 5 to 82; 20 consecutive nucleotides, or c. A sequence selected from SEQ ID NOs: 5 to 82 and at least 99%, 98%, 97%, 9 Guide sequences that are 6%, 95%, 94%, 93%, 92%, 91%, or 90% identical Including, Inducing a double strand break (DSB) in the TTR gene in a subject, and modifying the TTR gene to treat TTR-associated amyloidosis (ATA) in a subject. R) to reduce TTR serum concentrations in a subject and / or to treat amyloidosis in a subject. Methods for reducing or preventing accumulation of corticosteroids or amyloid fibrils A composition for use in combination with a roid.

6. 1. A composition comprising: (i) a guide RNA, a. a guide sequence selected from SEQ ID NOs: 5-82; b. At least 17, 18, 19, or 20 of a sequence selected from SEQ ID NOs: 5 to 82 is 20 consecutive nucleotides, or c. At least 99%, 98%, 97%, or more of a sequence selected from SEQ ID NOs: 5 to 82; 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical guide sequences a guide RNA comprising a sequence; (ii) an mRNA encoding an RNA-guided DNA-binding agent, a. an open reading frame that is at least 95% identical to SEQ ID NO:311 comprising a sequence having the following structure: b. The open reading frame is a sequence of at least the first 30, 50, 7 Sequences spanning 0, 100, 150, 200, 250, or 300 nucleotides has at least 95% identity to SEQ ID NO:311, c. The open reading frame has at least 75% of its codons aligned in Table 1. a set of codons, each of which is a codon listed in d. The open reading frame has an adenine content of at least one of the following: and / or e. the open reading frame has an adenine dinucleotide content of from the minimum adenine dinucleotide content of 150 to the minimum adenine dinucleotide content of 150 % range of mRNA, Inducing a double strand break (DSB) in the TTR gene in a subject, and modifying the TTR gene to treat TTR-associated amyloidosis (ATA) in a subject. R) to reduce TTR serum concentrations in a subject and / or to treat amyloidosis in a subject. Methods for reducing or preventing accumulation of corticosteroids or amyloid fibrils A composition for use in combination with a roid.

7. 1. A composition comprising: (i) a vector encoding a guide RNA, the guide RNA comprising: a. a guide sequence selected from SEQ ID NOs: 5-82; b. At least 17, 18, 19, or 20 of a sequence selected from SEQ ID NOs: 5 to 82 is 20 consecutive nucleotides, or c. At least 99%, 98%, 97%, or more of a sequence selected from SEQ ID NOs: 5 to 82; 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical guide sequences A vector containing the columns; (ii) an mRNA encoding an RNA-guided DNA-binding agent, a. an open reading frame that is at least 95% identical to SEQ ID NO:311 comprising a sequence having the following structure: b. The open reading frame is a sequence of at least the first 30, 50, 7 Sequences spanning 0, 100, 150, 200, 250, or 300 nucleotides has at least 95% identity to SEQ ID NO:311, c. The open reading frame has at least 75% of its codons aligned in Table 1. a set of codons, each of which is a codon listed in d. The open reading frame has an adenine content of at least one of the following: and / or e. the open reading frame has an adenine dinucleotide content of from the minimum adenine dinucleotide content of 150 to the minimum adenine dinucleotide content of 150 % range of mRNA, Inducing a double strand break (DSB) in the TTR gene in a subject, and modifying the TTR gene to treat TTR-associated amyloidosis (ATA) in a subject. R) to reduce TTR serum concentrations in a subject and / or to treat amyloidosis in a subject. Methods for reducing or preventing accumulation of corticosteroids or amyloid fibrils A composition for use in combination with a roid.

8. The method may last for more than 30 minutes, for example more than 60 minutes, or more than 120 minutes.

8. The method of claim 1, further comprising administering the composition by injection. A composition or method for use as described in claim 1.

9. The guide RNA is selected from SEQ ID NOs: 5-72, 74-78, and 80-82. The composition or method of any one of claims 1 to 8, comprising a guide sequence comprising

10. The guide RNA is selected from SEQ ID NOs: 5, 6, 7, 8, 9, 12, 13, 14, 15, 16, １７、２２、２３、２７、２９、３０、３５、３６、３７、３８、５５、６１、６３、６ 5, 66, 68, or 69. The composition or method described in paragraph .

11. Inducing a double strand break (DSB) in the TTR gene in a cell or subject; Modifying the TTR gene in a cell or subject, or generating a gene associated with TTR in a subject. and treating amyloidosis (ATTR) or reducing TTR serum concentrations in a subject. or reduce or decrease accumulation of amyloid or amyloid fibrils in a subject. A composition according to any one of claims 4 to 10 for use in the prevention of

12. The corticosteroid may be dexamethasone, betamethasone, prednisone, solone, methylprednisolone, cortisone, hydrocortisone, triamcinolone, or etamethazoneb. Composition for.

13. 13. The method according to claim 1, wherein the corticosteroid is dexamethasone. A composition for the described method or use.

14. 14. Any of claims 1 to 13, wherein the corticosteroid is administered prior to the composition. A composition for the method or use according to claim 1.

15. 15. Any of claims 1 to 14, wherein the corticosteroid is administered after the composition. A composition for the method or use according to claim 1.

16. 16. The method of claim 1, wherein the corticosteroid is administered simultaneously with the composition.

2. A composition for the method or use according to claim 1.

17. The corticosteroid is administered within about 5 minutes to about 168 hours prior to administration of the composition. The method or composition for use according to any one of claims 1 to 16, wherein the composition is administered to

18. The corticosteroid is administered within about 5 minutes to about 168 hours after the composition is administered. The method or composition for use according to any one of claims 1 to 17, wherein the composition is administered to

19. The corticosteroid is administered 5 minutes, 10 minutes, 15 minutes, 30 minutes, or 1 hour, 2 hours, 3 hours, 4 hours, 6 hours, 12 hours, 18 hours, 1 day, 1.5 days, 2 days 19. The method according to claim 1 , wherein the administration is performed 3 days, 4 days, 5 days, 6 days, or 1 week before the administration of the method according to claim 1 . Item 14. A composition for the method or use according to item 13.

20. At least two doses of the corticosteroid are administered before or after administration of the composition.

20. A composition for the method or use according to any one of claims 1 to 19,

21. at least two doses of said corticosteroid and at least two doses of said composition The method or composition for use according to any one of claims 1 to 20, wherein

22. The corticosteroid is administered to the subject at a dose of 0.75 mg to 20 mg, or about 0.01 to 0.4 mg / kg, for example, 0.1 to 0.35 mg / kg or 0.25 to 22. The method according to any one of claims 1 to 21, wherein the compound is administered at a dose of 0.35 mg / kg. or a composition for use.

23. 2. The method of claim 1, wherein the corticosteroid is administered to the subject via intravenous injection.

3. A composition for the method or use according to any one of claims 2 to 3.

24. The corticosteroid is orally administered to the subject, and optionally, the corticosteroid orally to the subject before the composition is administered to the subject by intravenous injection. The method or composition for use according to any one of claims 1 to 23, wherein the composition is administered

25. The corticosteroid is dexamethasone, and the dexamethasone is orally administered to the subject in an amount of 20 mg 6 to 12 hours before administration of the compound to the subject; or the dexamethasone is administered in an amount of 20 mg or less prior to administration of the composition to the subject.

25. The method of claim 24, wherein the subject is administered intravenously for 30 minutes to 6 to 12 hours in an amount of or a composition for use.

26. The composition is allowed to stand for about 60 minutes, about 90 minutes, about 120 minutes, about 150 minutes, about 180 minutes, or by infusion over about 240 minutes according to any one of claims 1 to 25. A composition for the method or use of.

27. 27. The method according to claim 1, wherein the corticosteroid is dexamethasone. A composition for the described method or use.

28. The method further comprises administering an infusion prophylaxis, the infusion prophylaxis being acetaminophen. and optionally, one or more of an acetonitrile, an H1 blocker, or an H2 blocker. One or more of an aminophen, an H1 blocker, or an H2 blocker is administered in combination with said corticosteriodine.

28. The method according to claim 1, wherein the composition is administered simultaneously with the inhibitor and / or before the inhibitor. Item 14. A composition for the method or use according to item 13.

29. 2. The method of claim 1, wherein each of the acetaminophen, an H1 blocker, or an H2 blocker is administered.

29. A composition for the method or use according to claim 28.

30. 28. The method of claim 27, wherein the H1 blocker and / or the H2 blocker are administered orally.

29. A composition for the method or use according to claim 29.

31. The infusion prophylaxis includes intravenous corticosteroids (e.g., dexamethasone 8-12 mg, or 10 mg or equivalent) and acetaminophen (e.g., oral acetaminophen 31. The method or use according to any one of claims 28 to 30, comprising 500 mg of phenanthrene. Composition for.

32. The injection prophylaxis is required before administering a guide RNA-containing composition, e.g., an LNP composition. The method or use according to any one of claims 28 to 31, administered as an essential premedication. Composition for.

33. 33. The method according to any one of claims 28 to 32, wherein the H1 blocker is diphenhydramine. Compositions for the methods or uses.

34. 34. The method of any one of claims 28 to 33, wherein the H2 blocker is ranitidine. or a composition for use.

35. A first dose of the corticosteroid is administered about 8 to 24 hours before the composition is administered. and a second dose of the corticosteroid is administered about 1 to 2 hours after the composition is administered. The method or composition for use according to any one of claims 1 to 35, wherein the composition is administered shortly before thing.

36. The method further comprises administering one or more of acetaminophen, an H1 blocker, or an H2 blocker. Optionally, the method further comprises administering to the subject a combination of acetaminophen, an H1 blocker, or one or more of an H2 blocker is administered simultaneously with said second dose of said corticosteroid; 36. The composition for use or method according to claim 35,

37. A first dose of the corticosteroid is administered about 8 to 24 hours before the composition is administered. orally, and a second dose of the corticosteroid is administered about 1 to 2 days after the composition is administered. The method or use according to any one of claims 1 to 36, wherein the drug is administered intravenously 2 hours before the administration of the drug. Composition for.

38. A first dose of the corticosteroid is administered about 8 to 24 hours before the composition is administered. orally, and a second dose of the corticosteroid is administered about 1 to 2 days after the composition is administered. Two hours before, acetaminophen, H1 blockers, and H2 blockers were administered intravenously.

38. A composition for the method or use according to any one of claims 1 to 37,

39. the corticosteroid is dexamethasone, and the composition is administered to the subject. and about 8 to 24 hours prior to administration of the first dose of dexamethasone in an amount of about 6 to 10 mg. a second dose of dexamethasone in an amount of about 8-12 mg, Approximately 1 to 2 hours before the composition is administered to the subject, acetaminophen may be administered orally. and an H1 blocker and an H2 blocker are administered intravenously to the subject, Optionally, the H1 blocker is diphenhydramine and the H2 blocker is ranitidine. and / or optionally, the subject is a human. A composition for the method or use described in.

40. the corticosteroid is dexamethasone, and the composition is administered to the subject. A first dose of the dexamethasone is administered to the subject in an amount of 8 mg about 8-24 hours prior to administration of the first dose of the dexamethasone to the subject. and a second dose of the dexamethasone in an amount of 10 mg, and the composition is Approximately 1-2 hours before administration to the subject, oral administration of acetaminophen and H1 blockers and an H2 blocker administered intravenously to said subject, and optionally 1 , wherein the H1 blocker is diphenhydramine and the H2 blocker is ranitidine.

40. A composition for use according to any one of claims 1 to 39.

41. The composition is administered by infusion in an amount of 3 mg / kg for about 1.5 to 6 hours, A dose of the corticosteroid is orally administered about 8 to 24 hours before the composition is injected. and a second dose of the corticosteroid is administered about 1-2 hours before the composition is injected.

41. The method or composition for use according to any one of claims 1 to 40, wherein the Composition.

42. Administration of the corticosteroid increases tolerance of the composition comprising the guide RNA.

42. A composition for use or method according to any one of claims 1 to 41, which improves the properties of the composition.

43. The corticosteroid is administered to the subject, and the subject responds to the composition comprising the guide RNA. In addition, inflammation, nausea, vomiting, elevated ALT levels in the blood, hyperthermia, and / or hyperalgesia may occur. The method according to any one of claims 1 to 42, which reduces the incidence or severity of one or more of the following: A composition for the method or use of.

44. The corticosteroid is administered to the subject, and the subject responds to the composition comprising the guide RNA. and the production or activity of one or more interferons and / or inflammatory cytokines. For the method or use according to any one of claims 1 to 43, composition.

45. The composition according to any one of claims 1 to 44, wherein the composition reduces serum TTR levels. Compositions for the methods or uses.

46. compared to the serum TTR level prior to administration of the composition, the serum TTR level is at least 46. ​​The method or composition for use according to claim 45, wherein the concentration of .alpha.-tocopherol is reduced by 50%.

47. 47. Any one of claims 1 to 46, wherein the composition causes editing of the TTR gene. A composition for the method or use described in.

48. The edit is calculated as a percentage of the collection that is edited (edit percentage), and optionally 48. The method of claim 47, wherein the edit percentage is between 30 and 99% of the collection. or a composition for use.

49. wherein the composition reduces amyloid deposition in at least one tissue, and optionally The at least one tissue is one or more of the stomach, colon, sciatic nerve, or dorsal root ganglion.

49. A composition for the method or use according to any one of claims 1 to 48 comprising:

50. 50. Any one of claims 1 to 49, wherein the composition is administered or delivered at least twice. A composition for the method or use described in.

51. The administration or delivery is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 1 3, 14, or 15 days, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 , 13, 14, or 15 weeks, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 51. The method of claim 50, wherein the administration is at intervals of 11, 12, 13, 14, or 15 months. Composition for the method or use.

52. Any one of claims 1 to 51, wherein the guide sequence is selected from SEQ ID NOs: 5 to 82.

20. The method or composition according to claim 19,

53. The guide RNA is at least partially aligned to a target sequence present in the human TTR gene.

53. The method or composition of any one of claims 1 to 52, which is complementary.

54. the target sequence is within exon 1, 2, 3, or 4 of the human TTR gene; 54. The method or composition of claim 53.

55. The guide sequence is complementary to a first target sequence in the positive strand of the TTR gene. and the composition is complementary to a second target sequence within the minus strand of the TTR gene. The method of any one of claims 1 to 54, further comprising a second guide sequence which is is a composition.

56. Any of claims 1 to 55, wherein the guide RNA is a single guide RNA (sgRNA).

2. The method or composition according to claim 1 .

57. The sgRNA comprises a guide sequence of any of SEQ ID NOs: 5-82 and nucleotide 2 of SEQ ID NO:

3.

57. The method or composition of claim 56, comprising any one of 1 to 100.

58. The sgRNA is at least 99%, 99%, or 100% identical to a sequence selected from SEQ ID NOs: 87-124. 8%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical 57. The method or composition of claim 56, comprising a guide sequence which is

59. 59. The method of claim 58, wherein the sgRNA comprises a sequence selected from SEQ ID NOs: 87 to 124. The method or composition described above.

60. 60. The method according to any one of claims 1 to 59, wherein the guide RNA comprises at least one modification. The method or composition described.

61. The at least one modification is a 2'-O-methyl (2'-O-Me) modified nucleotide. , phosphorothioate (PS) internucleotide linkage, or 2'-fluoro (2'-F) 61. The method or composition of claim 60, comprising modified nucleotides.

62. The at least one modification is a PS bond between the first four nucleotides, a PS bond between the last four nucleotides, Internucleotide PS bonds, 2'- in the first three nucleotides at the 5' end at the O-Me modified nucleotide and / or at the last three nucleotides at the 3' end 62. The method according to claim 60 or 61, comprising 2'-O-Me modified nucleotides in is a composition.

63. 63. Any of claims 60 to 62, wherein the guide RNA comprises modified nucleotides of SEQ ID NO:

3. The method or composition according to any one of claims 1 to 5.

64. Any of claims 1 to 63, wherein the guide RNA is associated with a lipid nanoparticle (LNP). The method or composition according to any one of claims 1 to 5.

65. 65. The method or composition of claim 64, wherein the LNP comprises an ionizable lipid.

66. 66. The method of claim 64 or 65, wherein the LNP comprises a biodegradable ionizable lipid. is a composition.

67. 66. The method of claim 64 or 65, wherein the LNP comprises an amine lipid, e.g., a CCD lipid. The method or composition of claim 1.

68. The method according to any one of claims 64 to 66, wherein the LNP comprises a helper lipid. Or compositions.

69. The LNPs comprise a stealth lipid, and optionally, (i) the LNP comprises a lipid component, the lipid component being about 50-60 mol % lipid A amine lipids such as amine lipids, about 8-10 mol % neutral lipids, and about 2.5-4 mol % ester lipids. and a helper lipid (e.g., a PEG lipid), with the remainder of the lipid component being a helper lipid; the N / P ratio of the LNP composition is about 6; (ii) the LNPs comprise about 50-60 mol % of an amine lipid, such as lipid A, and about 27-3 9.5 mol % of helper lipid, about 8-10 mol % of neutral lipid, and about 2.5-4 mol % of and l% stealth lipid (e.g., PEG lipid), and the N / P ratio of the LNP composition is about 5 to 7 (e.g., about 6); (iii) the LNP comprises a lipid component, the lipid component being about 50-60 mol % lipid amine lipid such as Substance A, about 5-15 mol % neutral lipid, and about 2.5-4 mol % s and a helper lipid (e.g., a PEG lipid), with the remainder of the lipid component being a helper lipid. and the N / P ratio of the LNP composition is about 3 to 10; (iv) the LNP comprises a lipid component, the lipid component being about 40-60 mol % lipid Amine lipid such as A, about 5-15 mol % neutral lipid, and about 2.5-4 mol % stearyl lipid. and a helper lipid (e.g., a PEG lipid), with the remainder of the lipid component being a helper lipid. the N / P ratio of the LNP composition is about 6; (v) the LNP comprises a lipid component, the lipid component being about 50-60 mol % lipid A amine lipids such as 5 to 15 mol % neutral lipids and about 1.5 to 10 mol % stearyl lipids. and a helper lipid (e.g., a PEG lipid), with the remainder of the lipid component being a helper lipid. the N / P ratio of the LNP composition is about 6; (vi) the LNP comprises a lipid component, the lipid component comprising about 40-60 mol % lipid Amine lipid such as A, about 0-10 mol % neutral lipid, and about 1.5-10 mol % of S and a helper lipid (e.g., a PEG lipid), with the remainder of the lipid component being a helper lipid. and the N / P ratio of the LNP composition is about 3 to 10; (vii) the LNP comprises a lipid component, the lipid component being about 40-60 mol % lipid amine lipids such as Substance A, less than about 1 mol % neutral lipids, and about 1.5-10 mol % s and a helper lipid (e.g., a PEG lipid), with the remainder of the lipid component being a helper lipid. and the N / P ratio of the LNP composition is about 3 to 10; (viii) the LNP comprises a lipid component, and the lipid component comprises about 40-60 mol % An amine lipid such as lipid A and about 1.5 to 10 mol % of a stealth lipid (e.g., PEG lipid The remainder of the lipid component is a helper lipid, and the N / P of the LNP composition The ratio is about 3 to 10, and the LNP composition is essentially free of neutral phospholipids; and does not include, or (ix) the LNP comprises a lipid component, the lipid component being about 50-60 mol % lipid Amine lipid such as A, about 8-10 mol% neutral lipid, and about 2.5-4 mol% stearyl lipid. and a helper lipid (e.g., a PEG lipid), with the remainder of the lipid component being a helper lipid. The method according to any one of claims 64 to 67, wherein the N / P ratio of the LNP composition is about 3 to 7. The method or composition described above.

70. 70. The method of any one of claims 64 to 69, wherein the LNP comprises a neutral lipid. composition.

71. The LNP comprises a lipid component, the lipid component being about 50 mol % of an amine such as lipid A. % of a carboxylic acid lipid, about 9 mol % of a neutral lipid such as DSPC, and about 3 mol % of a PEG lipid. and a stealth lipid (e.g., PEG2k-DMG), with the remainder of the lipid component being a collagen. and the N / P ratio of the LNP composition is about 6.

71. The method or composition of any one of paragraphs 64 to 70.

72. The LNP comprises a lipid component, the lipid component being about 50 mol % of lipid A and about 9 m % DSPC and about 3 mol % PEG2k-DMG, the remainder of the lipid component being is cholesterol, and the N / P ratio of the LNP composition is about 6.

71. The method or composition of any one of claims 71 to 79.

73. 73. Any one of claims 1 to 72, wherein the composition further comprises an RNA-guided DNA binding agent. The method or composition according to claim 1.

74. The composition further comprises a polynucleotide encoding an RNA-guided DNA binding agent.

73. The method or composition of any one of claims 1 to 72.

75. 75. The method or composition of claim 74, wherein the polynucleotide is mRNA.

76. Any of claims 73 to 75, wherein the RNA-guided DNA binding agent is Cas cleavase. The method or composition according to any one of claims 1 to 5.

77. The polynucleotide comprises an open reading frame encoding an RNA-guided DNA binding agent. Includes a frame. a. the open reading frame has at least 95% identity with SEQ ID NO:311 and b. The open reading frame is at least the first 30, 50, 70, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1000, 1500, 1000, 1500, 2500, 3500, 4500, 5000, 6000, 7000, 8000, 9000, 10000, 15 ... , 100, 150, 200, 250, or 300 nucleotides. No. 311, c. The open reading frame has at least 75% of its codons listed in Table 4. a set of codons, d. The open reading frame has an adenine content of at least its minimum adenine content. and / or e. The open reading frame has an adenine dinucleotide content of Minimum adenine dinucleotide content - 150% of the minimum adenine dinucleotide content 77. The method or composition of any one of claims 74 to 76, wherein

78. The polynucleotide is selected from the group consisting of SEQ ID NOs: 232, 234, 236, 238, 241, or 5'UTR having at least 90% identity to any one of 275 to 277 and / or any of SEQ ID NOs: 233, 235, 237, 239, or 240.

78. The method of claim 74, comprising: A composition or method according to any one of the preceding claims.

79. The polynucleotide is an mRNA, and at least one of the uridines in the mRNA is 79. The composition of any one of claims 74 to 78, wherein 0% of the uridine derivatives are substituted with modified uridines. method.

80. 80. The method according to any one of claims 73 to 79, wherein the RNA-guided DNA binding agent is modified. The method or composition described.

81. 9. The modified RNA-guided DNA binding agent comprises a nuclear localization signal (NLS).

0. The method or composition according to claim 0.

82. The composition according to claim 1, wherein the composition is a pharmaceutical formulation and further comprises a pharma- ceutically acceptable carrier.

81. The method or composition of any one of claims 81 to 81.

83. The composition reduces or prevents amyloid or amyloid fibrils containing TTR.

83. A composition for the method or use according to any one of claims 1 to 82.

84. Non-homologous end joining (NHEJ) introduces mutations during repair of DSBs in the TTR gene.

84. A composition for use or method according to any one of claims 1 to 83, which causes

85. The sequence of the guide RNA is a) SEQ ID NO: 92 or 104, b) SEQ ID NO: 87, 89, 96, or 113; c) SEQ ID NO: 100, 102, 106, 111, or 112, or d) SEQ ID NOs: 88, 90, 91, 93, 94, 95, 97, 101, 103, 108 , or 109, Optionally, the guide RNA is located within a protein coding region in the genome of the primary human hepatocyte. Any one of claims 1 to 84, wherein the nucleic acid sequence does not generate indels at off-target sites occurring in 20. The method or composition according to claim 19,

86. Administering the composition reduces the level of TTR in the subject, and optionally 86. The method of claim 1, wherein the level of TTR is reduced by at least 50%. A composition for the described method or use.

87. The level of TTR is measured in serum, plasma, blood, cerebrospinal fluid, or sputum, or in the liver, blood, or blood plasma. and optionally, the level of TTR is measured in the retina, the plexus, and / or the retina, 87. The method of claim 86, wherein the antibody is measured via an enzyme-linked immunosorbent assay (ELISA). is a composition for use.

88. The subject is a patient with ATTR, familial amyloid polyneuropathy or familial amyloidosis. The method or composition for use according to any one of claims 1 to 87, wherein the patient has cardiomyopathy. 。

89. The method or use according to any one of claims 1 to 88, wherein the subject is a human. Composition for.

90. The subject is administered the composition or formulation prior to administering the composition or formulation to a specific mutation in the TTR gene. A composition for the method or use according to any one of claims 1 to 89, Composition.

91. Any of claims 1 to 90 for the preparation of a medicament for treating a human subject having ATTR. Use of any of the compositions or formulations described herein.

Images