PCR using RNA / DNA chimeric primer and method for ligating amplified fragments
By employing an RNA/DNA chimeric primer and RNaseH treatment in PCR, the method overcomes sequence-dependent limitations in nucleic acid ligation, facilitating efficient and flexible amplification and ligation for enhanced library diversity and mutation introduction.
Patent Information
- Application Number
- JP2022058415
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2022-03-31
- Publication Date
- 2025-06-02
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
Existing nucleic acid amplification and ligation methods are limited by the need for sequence-dependent restriction enzymes, which can lead to unintended cleavage and reduced flexibility in library design.
The method involves using an RNA/DNA chimeric primer for PCR, followed by RNaseH treatment to create a protruding end, allowing for sequence-independent ligation of amplified fragments without the need for restriction enzymes.
This approach enables efficient and flexible amplification and ligation of nucleic acids, allowing for higher mutation introduction rates and improved library diversity, which is beneficial for evolutionary molecular engineering applications.
Smart Images

Figure 2025083598000001_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technology of nucleic acid chemistry. More specifically, the present invention relates to PCR using an RNA / DNA chimeric primer and a method for ligating amplified fragments thereof.
Background Art
[0002] When improving the function of a protein, generally, mutations are added to the DNA encoding the protein, and substitutions and the like are often added to the amino acids. For this purpose, a library containing mutants in which amino acids at various sites are randomly substituted is created, and mutants having better functions are screened from the library. By repeating the process of adding further mutations to the obtained protein and performing screening again, it becomes possible to obtain a protein having better functions. That is, this series of operations is a new biotechnology that super-accelerates the process of natural molecular evolution in the laboratory and evolves and creates highly functional molecules such as those possessed by living organisms in front of one's eyes. Since it is similar to the process of evolution in nature, this technology is also called "evolutionary molecular engineering".
[0003] For example, Patent Document 1 (Japanese Unexamined Patent Application Publication No. 2016-098198) describes a method for producing a DNA library, which includes a step of selecting and recovering at least the DNA fragments that do not have at least nonsense mutations or frameshift mutations among a plurality of DNA fragments consisting of nucleotide sequences obtained by dividing DNA encoding an antibody into a plurality of parts, and a step of ligating at least two of the recovered DNA fragments to form DNA encoding the antibody. In this method, in the step of selecting and recovering a plurality of DNA fragments consisting of nucleotide sequences obtained by dividing DNA into a plurality of parts, the divided DNA fragments are transcribed into mRNA, the ends of the mRNA and the ends of a nucleic acid linker are ligated, a complex is formed in which the product obtained by translating the mRNA and the mRNA are ligated via the nucleic acid linker, and further, the mRNA of the complex is reverse-transcribed to recover the DNA fragments. In this method, PCR is performed on each DNA fragment using a primer having a restriction enzyme recognition sequence, and a restriction enzyme recognition site is introduced into one end or both ends of each amplified fragment. Then, the amplified fragments are cleaved with the restriction enzyme and further ligated to prepare a DNA library.
[0004] Conventionally, a method of fragmenting and ligating using a restriction enzyme to create a ligated nucleic acid fragment has been known. However, since a restriction enzyme performs sequence-dependent cleavage, if a restriction enzyme recognition sequence is contained outside a desired location, problems such as a reading frame shift due to cleavage or an inability to obtain a ligated nucleic acid fragment having a sequence as designed, and thus a protein having a function not being produced may occur. To avoid these phenomena, the degree of freedom of the library is restricted.
[0005] In recent years, a technique has been developed in which PCR is performed using a primer into which inosine is introduced at an arbitrary position, and after amplification, an enzyme that recognizes inosine and decomposes a phosphodiester bond at a specific position is used to form an overhanging end.
[0006] Non-Patent Document 1 (Baumann et al. BMC Biotechnology 2013, 13:81) discloses a technique for creating overhanging ends by performing PCR using a primer with the third base from the 5'-end as a deoxyinosine base and treating the amplification product with endonuclease V. In this method, overhanging ends can be created without using type II restriction enzymes and regardless of the sequence. This method is used not for ligating nucleic acid sequences to each other, but for direct introduction into a plasmid vector.
[0007] Patent Document 2 (Japanese Patent Application Laid-Open No. 2019-149985) discloses a technique for creating multiple amplification fragments by performing PCR using a primer containing inosine at an arbitrary position, treating the amplification product with T4 pyrimidine dimer glycosylase (PDG) or endonuclease V to create overhanging ends, and ligating the multiple amplification fragments.
[0008] As nucleic acid amplification methods, various known methods such as PCR that regularly changes temperature to repeat denaturation, annealing, and amplification, self-sustained sequence replication reaction (3SR) that amplifies isothermally, isothermal chimeric primer-initiated nucleic acid amplification (ICAN), ligase chain reaction (LCR), and LAMP method are known. In such nucleic acid amplification methods, mutant proteins having more desirable properties are produced by introducing mutations at a certain rate.
[0009] RNA / DNA chimeric primers are also used in amplification by isothermal chimeric primer-initiated nucleic acid amplification (ICAN) under isothermal conditions. In ICAN, a strand is extended using an RNA / DNA chimeric primer containing an RNA portion on the 3'-side of the primer. RNaseH cleaves the RNA portion derived from the chimeric primer, and an extension reaction accompanied by a strand displacement reaction and a template exchange reaction occurs from the cleavage site. The gene is amplified by repeated occurrence of this reaction.
[0010] In the blood of camelids such as alpacas and llamas, in addition to IgG antibodies composed of two heavy chains (H chains) and light chains (L chains), there are antibodies composed only of heavy chains (heavy chain antibodies; HCAb). The variable region of HCAb, called VHH, consists of three variable regions called CDRs (complementary determining regions) (CDR1 to CDR3) and four framework regions (FR1 to FR4). Since its molecular weight is small even when compared with IgG antibodies, Fab fragments, and single-chain antibodies scFv, it is expected to be applied to pharmaceuticals using antibody engineering technology. VHH has a low manufacturing cost, can be stably stored and transported at room temperature, and the structure of the antigen-binding site (paratope) to which VHH binds is more diverse than that of conventional antibody antigen-binding sites. Therefore, VHHs that enable various administration routes such as oral, pulmonary, and nasal administration are being developed and are expected to be applied to future drug discovery. As one of such applications, Patent Document 3 (Japanese Unexamined Patent Application Publication No. 2016-44126) proposes a method for producing a next-generation fragment antibody in which a desired mutation is introduced into each of a plurality of DNA fragments containing complementary determining regions in the heavy chain of an antibody of a camelid, these are ligated to synthesize a modified double-stranded DNA, an mRNA encoding these and a puromycin-DNA linker are bound, after preparing the mRNA-linker, these are translated in a cell-free translation system, the obtained mRNA-mutated antibody is immobilized on a solid phase, and then reverse transcription is performed to perform cDNA display and selection.
Prior Art Documents
Patent Documents
[0011]
Patent Document 1
Patent Document 2
Patent Document 3
Non-Patent Documents
[0012]
Non-Patent Document 1
Summary of the Invention
[0013] There has been a need for methods of amplifying and ligating nucleic acids that can be used for ligating nucleic acid sequences without depending on the sequence. For example, when using a primer containing inosine, the base that appears at the complementary position of inosine becomes cytosine (C). Also, the cleavage sites of endonuclease V cleave the second and third phosphodiester bonds on the 3'-side of inosine at a ratio of 95% and 5%, respectively. Therefore, there are restrictions in primer design, such as that inosine needs to be at a position corresponding to the third base of a triplet sequence where even if this third base changes, it corresponds to the same amino acid.
[0014] Also, from the perspective of evolutionary engineering, there has been a need for a method of ligating nucleic acid fragments into which mutations have been introduced with a certain probability. Therefore, for example, when it is necessary to increase the introduction of mutations accompanying PCR, it has been necessary to appropriately develop a method with a high mutation introduction rate.
[0015] Needless to say, a method with a small number of steps and few or no operations such as replacing containers is not only convenient but also desirable from the perspective of preventing contamination and the like.
[0016] The present invention is a method of performing PCR using an RNA / DNA chimeric primer, digesting a sequence derived from the RNA sequence of the primer by RNaseH treatment to create a protruding end, and using this protruding end to ligate a plurality of amplified fragments. Specifically, in the method for amplifying and ligating nucleic acids of the present invention, for a desired nucleic acid sequence, PCR is performed using one or a plurality of primer pairs in which at least one primer is an RNA / DNA chimeric primer containing an RNA sequence on the 5'-side, to create an amplified fragment using the desired nucleic acid sequence as a template, a step of digesting the RNA sequence contained in the amplified fragment by RNaseH treatment to form a protruding end, A step of creating a ligated nucleic acid by ligating at least two amplified fragments by ligating protruding ends to each other including.
[0017] In the above method, among the amplified fragments included in the ligated nucleic acid, one forward primer of a pair of primers that amplify amplified fragments adjacent to each other when ligated is an RNA / DNA chimeric primer, and the other primer pair The reverse primer is an RNA / DNA chimeric primer, and the RNA sequences contained in the forward primer and the reverse primer can have substantially complementary sequences. As a result, a single-stranded chain complementary to the end of another amplified fragment is generated at one or both ends of the amplified fragment after PCR. The ligated amplified fragment is carried out using the complementary single-stranded chain.
[0018] For PCR, any polymerase can be used as long as it is heat-resistant. For example, rTth DNA polymerase, KOD DNA polymerase which is a DNA polymerase derived from Thermococcus kodakarensis KOD 1 strain, Pfu DNA polymerase, Taq DNA polymerase, etc. can be used. For example, PrimeSTAR (registered trademark) series (manufactured by Takara Bio Inc.), TaKaRa Ex Taq (registered trademark) series (manufactured by Takara Bio Inc.), TaKaRa La Taq (registered trademark) series (manufactured by Takara Bio Inc.), TaKaRa Taq (trademark) series (manufactured by Takara Bio Inc.), Speed Star (trademark) (manufactured by Takara Bio Inc.), MightyAmp (trademark) series, Prelude (trademark) PreAmp Master Mix (manufactured by Clontech), SuperPlex (trademark) Premix (manufactured by Clontech), Titanium (registered trademark) Taq DNA polymerase (manufactured by Clontech), Advantage (registered trademark) 2 polymerase mix & PCR kit (manufactured by Clontech), Advantage (registered trademark) GC2 polymerase mix & PCR kit (manufactured by Clontech), CloneAmp (trademark) HiFi PCR Premix (manufactured by Clontech), High Yield PCR EcoDry (trademark) Premix (manufactured by Clontech), High Fidelity PCR EcoDry (trademark) Premix (manufactured by Clontech), SeqAmp (trademark) DNA Polymerase (manufactured by Clontech), KOD-Plus series (manufactured by Toyobo Co., Ltd.), KOD One (registered trademark) series (manufactured by Toyobo Co., Ltd.), KOD DNA Polymerase (manufactured by Toyobo Co., Ltd.), KOD FX Neo, KOD FX (manufactured by Toyobo Co., Ltd.), KOD -Multi&Epi- (registered trademark) (manufactured by Toyobo Co., Ltd.), Blend Taq (registered trademark) series (manufactured by Toyobo Co., Ltd.), KOD Dash (registered trademark) (manufactured by Toyobo Co., Ltd.), Quick Taq (registered trademark) (manufactured by Toyobo Co., Ltd.), rTaq DNA Polymerase (manufactured by Toyobo Co., Ltd.), Q5 High-Fidelity DNAPolymerase series (New England Biolabs Japan, Ltd.), Phusion High-Fidelity DNA Polymerase series (New England Biolabs Japan, Ltd.), OneTaq DNA Polymerase (New England Biolabs Japan, Ltd.), etc. can be widely used, but are not limited thereto, and those skilled in the art can select DNA polymerase according to the purpose.
[0019] In the case of PCR using rTthDNA polymerase, it is desirable to perform PCR in the presence of Mn 2+ or in the presence of Mg 2+ . In the case of PCR using a DNA polymerase other than rTthDNA polymerase, it is desirable to perform further reverse transcription using rTthDNA polymerase before RNaseH treatment.
[0020] Ligation of the protruding ends of the amplified fragments after PCR can be performed by an enzyme selected from the group consisting of, for example, TaqDNA ligase, T4 DNA ligase, and E.coli DNA ligase.
[0021] The present invention provides a nucleic acid fragment in which, for a desired nucleic acid sequence, at least one of a pair of primers is an RNA / DNA chimeric primer containing an RNA sequence on the 5'-side, and the nucleic acid fragment is amplified by PCR using one or more primer pairs, and contains an RNA sequence derived from the chimeric primer at either the 5'- or 3'-end, or both the 5'- and 3'-ends of the desired nucleic acid sequence.
[0022] The present invention relates to a pair of primers in which at least one primer is an RNA / DNA chimeric primer containing an RNA sequence on the 5'-side, DNA polymerase, RNaseH, and an enzyme selected from the group consisting of TaqDNA ligase, T4 DNA ligase, and E.coli DNA ligase Provided is a kit for amplifying and ligating nucleic acids, which comprises
[0023] In the method of the present invention, by using an RNA / DNA chimeric primer, overhangs can be formed, so that a target nucleic acid sequence can be easily amplified and ligated. In this method, primers can be designed without depending on the nucleic acid sequence, and the mutation introduction rate can also be changed by selecting a polymerase.
[0024] Furthermore, for example, when using a restriction enzyme, it is sequence-dependent because it is cleaved at the restriction enzyme recognition site, and when a restriction enzyme recognition site is contained outside the target site, unintended fragments may be generated. In the present invention, since nucleic acid sequences can be ligated without the need for restriction enzymes, nucleic acid ligation can be performed in a sequence-independent manner and with fewer steps. Also, during ligation, it is possible to create overhangs having a single-stranded portion longer than the overhangs generated by cleavage with a restriction enzyme. Furthermore, when using a restriction enzyme that generates overhangs, only overhangs having a single-stranded portion of about 4 bases can be formed, whereas in the present invention, for example, overhangs having a single-stranded portion of about 1 to 15 bases can be created, so that the ligation accuracy is high and ligation can be performed in a sequence-independent manner.
[0025] Furthermore, in the present invention, the mutation introduction rate can be controlled by the DNA polymerase used. For example, the mutation introduction rate can be changed depending on whether PCR is performed using a DNA polymerase with high replication fidelity, such as the KOD One (registered trademark) series (manufactured by Toyobo Co., Ltd.), the KOD-Plus series (manufactured by Toyobo Co., Ltd.), PrimeSTAR Max (manufactured by Takara Bio Inc.), CloneAmp (trademark) HiFi PCR Premix (manufactured by Clontech), Pfu DNA polymerase, or whether PCR is performed using Taq DNA polymerase or rTth DNA polymerase. Here, a DNA polymerase with high replication fidelity refers to a DNA polymerase having strong proofreading activity and having a DNA sequence replication accuracy that is about 10 times or more, preferably about 50 times or more, higher than that of Taq DNA polymerase. For example, when it is desired to amplify and ligate nucleic acids without introducing mutations, PCR is performed using a DNA polymerase with high replication fidelity. When some mutations are tolerated, PCR is performed using Taq DNA polymerase. When it is desired to introduce mutations more actively, the mutation introduction rate can be controlled by performing PCR using rTth DNA polymerase. Furthermore, when performing PCR using rTth DNA polymerase, the mutation introduction rate can be changed depending on whether Mn 2+ is added or Mg 2+ is added. That is, when it is desired to introduce more mutations, Mn 2+ is added, and when it is desired to lower the mutation introduction rate compared to when Mn 2+ is added, Mg 2+ is added. Thus, by controlling the mutation introduction rate, it can be preferably used in "evolutionary molecular engineering" to create a library containing mutants with randomly substituted amino acids at various sites and screen for proteins with more favorable properties.
[0026] Furthermore, shuffling can be performed according to the present invention using nucleic acids encoding VHHs to generate VHHs having various sequences from existing VHHs. By the method of the present invention, for example, a humanized VHH library can be created in which the framework region (FR) is designed based on the human FR sequence and the structural characteristics obtained from the crystal structure analysis data of VHHs, or various VHHs can be designed by introducing mutations into CDR3. Furthermore, by introducing mutations, the thermal stability and the like can be enhanced, or VHH antibodies with enhanced binding ability can be created by shuffling a part of the CDRs from multiple VHHs.
Brief Description of the Drawings
[0027]
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Figure 10
Mode for Carrying Out the Invention
[0028] The present invention will be described below with reference to the accompanying drawings as necessary. It should be understood that the terms used in this specification are used in the meanings commonly used in the art unless otherwise specified. Therefore, unless otherwise defined, all technical and scientific terms used in this specification have the same meaning as commonly understood by those skilled in the art to which the present invention pertains. In this specification, the singular expressions may include plural cases unless otherwise specified.
[0029] In this specification, "nucleic acid" is a biopolymer in which nucleotides consisting of a base, a sugar, and a phosphate are linked by phosphodiester bonds. Nucleic acid is a general term for ribonucleic acid (RNA) and deoxyribonucleic acid (DNA). Those with a ribose sugar are RNA, and those with 2-deoxyribose in which the hydroxyl group at the 2' position of ribose is replaced by a hydrogen group are DNA. A base is bonded to the 1' position of the sugar. Further, the 3' position of the sugar and the 5' position of the adjacent sugar are bonded in a phosphate ester structure, and this bond is repeated to form a long chain. Chain elongation in transcription, translation, and PCR proceeds in the direction from the 5' position to the 3' position. Among the two ends of the sugar chain, the side where phosphate is bonded and cut at the 5' end is called the 5' end, and the opposite side is called the 3' end. Also, the region on the adjacent nucleic acid, the 5' side is called upstream and the 3' side is called downstream. In this specification, unless otherwise specified, the length of the nucleic acid is arbitrary. Also, in this specification, "oligonucleotide derivative" or "polynucleotide derivative" is included as long as the amplification reaction is not inhibited.
[0030] PCR is a nucleic acid amplification technique, also known as polymerase chain reaction. Short single-stranded primers with sequences complementary to the target nucleic acid region, free nucleotides, and DNA polymerase are added to the template DNA to be amplified. The double-stranded DNA is denatured at high temperature to become single-stranded, then cooled to anneal the primers to the complementary sites of the single-stranded DNA, and further reheated to extend the complementary strand to the single-stranded DNA by DNA polymerase starting from the primers. Thereafter, the same cycle is repeated from the denaturation of double-stranded DNA again, and amplification proceeds, resulting in exponential amplification of the template DNA. In this specification, the term PCR also includes RT-PCR (reverse transcription polymerase chain reaction) in which reverse transcription is performed using RNA as a template and then PCR is performed on the resulting cDNA.
[0031] A primer is a short-chain oligonucleotide that serves as a starting point for DNA replication. In the PCR method, usually, a pair of primers consisting of a forward primer and a reverse primer is used. The forward primer refers to the primer that anneals to the antisense strand of the template DNA among a pair of primers used in the PCR method, and the reverse primer refers to the primer that anneals to the sense strand of the template DNA. Generally, DNA primers are used in PCR, but in the method of the present invention, one or both of the pair of primers are RNA / DNA chimeric primers. An RNA / DNA primer contains an RNA sequence on the 5' side of the primer. The length of the RNA sequence contained in the RNA / DNA primer is not particularly limited as long as it can create an overhanging end that allows the amplified fragment to be ligated appropriately. For example, an RNA sequence of about 1 to 15 residues can be included.
[0032] The DNA polymerase used in PCR is not particularly limited as long as it is a thermostable DNA polymerase, and rTth DNA polymerase, KOD DNA polymerase, Pfu DNA polymerase, PrimeSTAR Max (manufactured by Takara Bio Inc.), Taq DNA polymerase, etc. can be used, but it is not limited thereto, and those skilled in the art can select various DNA polymerases according to the purpose.
[0033] For digestion of the RNA sequence contained in the amplified fragment generated by PCR, RNase, particularly RNaseH, can be used. RNaseH, also referred to as ribonuclease H, is an endoribonuclease that hydrolytically cleaves the RNA forming a DNA / RNA hybrid double strand to generate single-stranded DNA.
[0034] Complementary refers to a state in the base sequence of a double-stranded nucleic acid where the bases that pair with each other (A and T, G and C, A and U) can form a base pair through hydrogen bonding. In this specification, it includes not only between DNA-DNA but also the complementarity between DNA-RNA. In this specification, a complementary sequence includes not only a sequence where all bases are complementary but also a case where there is a degree of complementarity that allows them to pair with each other, and this case is also referred to as having a substantially complementary sequence.
[0035] A protruding end, also referred to as a cohesive end or sticky end, refers to a terminal structure having a nucleic acid in a single-stranded state where complementary sequences protrude from the 5'-end or 3'-end of a DNA strand. In the present invention, the length of the RNA sequence contained in the RNA / DNA primer corresponds to the length of the single-stranded portion of the protruding end, and for example, a protruding end having a single-stranded portion of about 1 to 15 residues can be formed.
[0036] DNA ligase is an enzyme that connects the ends of DNA strands with phosphodiester bonds. It is used in genetic engineering to create recombinant DNA and is particularly used when ligating DNA fragments by acting on the complementary strands of overhanging ends at the ends. In the present invention, any DNA ligase can be used to ligate overhanging ends. For example, Taq DNA ligase, T4 DNA ligase, and E. coli DNA ligase can be used.
[0037] Taq DNA ligase is an enzyme that forms a phosphodiester bond between the 5'-phosphate end and the 3'-hydroxyl end of an oligonucleotide and ligates them only when the single-stranded part of the overhanging end of DNA is completely complementary and there is no gap. T4 DNA ligase is an enzyme that forms a phosphodiester bond between the 5'-phosphate end and the 3'-hydroxyl end of an oligonucleotide and ligates them, and 2+ requires Mg and ATP. E. coli DNA ligase is an enzyme that forms a phosphodiester bond between the 5'-phosphate end and the 3'-hydroxyl end of an oligonucleotide and ligates them and requires NAD.
[0038] Reverse transcription refers to the synthesis of DNA using RNA as a template in the presence of reverse transcriptase, which is an RNA-dependent DNA polymerase. Examples of reverse transcriptase include rTth DNA polymerase, which is a heat-resistant DNA polymerase derived from the hyperthermophilic bacterium Thermus thermophilus HB8. When using rTth DNA polymerase, reverse transcription can be carried out in the presence of Mn 2+ or Mg 2+ to promote its activity. When using rTth DNA polymerase, in order to promote its activity, Mn 2+ is added at a final concentration of 0.1 mM to 1.0 mM, preferably about 0.3 mM to 0.8 mM, for example, added to a final concentration of 0.63 mM, or Mg 2+ is added to a final concentration of 0.5 mM to 1.8 mM, preferably about 0.8 mM to 1.5 mM, for example, to a final concentration of 1.25 mM.
[0039] An aspect of the present invention will be described with reference to FIG. 1. In the figure, DNA1 and DNA2 are drawn separately, but DNA1 and DNA2 may be different regions of one DNA. Also, three or more pairs of primers may be used to amplify three or more DNAs or to produce three or more DNA fragments. The reverse primer of DNA1 and the forward primer of DNA2 are RNA / DNA chimeric primers. The RNA / DNA chimeric primer has an RNA sequence in its 5' (the black part in the arrow indicating the primer in the figure), and the RNA sequences in the RNA / DNA chimeric primers of DNA1 and DNA2 have complementary sequences to each other. Using DNA1 and DNA2 as templates, PCR amplification is performed by a heat-resistant DNA polymerase, for example, rTth DNA polymerase, KOD DNA polymerase, Pfu DNA polymerase, PrimeSTAR Max (manufactured by Takara Bio Inc.), or Taq DNA polymerase, etc., and reverse transcription is performed as necessary.
[0040] Subsequently, by performing RNaseH treatment, the RNA sequence contained at the end of the amplified fragment (the black part at the end of the PCR amplified fragment in the figure) is digested to create overhanging ends. The overhanging ends of DNA1 and DNA2 are single-stranded DNA sequences complementary to each other and can be specifically ligated by an enzyme that ligates by phosphodiester bond. Examples of enzymes that ligate by phosphodiester bond include enzymes selected from the group consisting of Taq DNA ligase, T4 DNA ligase, and E. coli DNA ligase.
[0041] The case of performing PCR using rTth DNA polymerase will be further described with reference to FIG. 2. When performing PCR using rTth DNA polymerase as the DNA polymerase, the complementary strand of the RNA sequence in the RNA / DNA primer is also created during amplification. When the amplified fragment amplified by PCR is treated with RNaseH to digest the RNA sequence contained at the end of the amplified fragment, a protruding end with a single-stranded portion can be created. In this figure, the case where a protruding end is finally created only at one end is shown. However, by using RNA / DNA primers for both primers (forward primer and reverse primer) of the primer pair, it is also possible to create protruding ends at both ends.
[0042] Note that when performing PCR using rTth DNA polymerase, it is desirable to perform it in the presence of Mn 2+ or Mg 2+ . In the presence of Mn 2+ , about 61 mutations are introduced into the 10,386 bases of the amplified fragment, and the mutation introduction rate is about 5.9 mutations / kbp. On the other hand, in the presence of Mg 2+ , about 420 mutations are introduced into the 129,888 bases of the amplified fragment, and the mutation introduction rate is about 3.2 mutations / kbp. This mutation introduction rate is slightly higher compared to the case of about 1.4 mutations / kbp when using Taq DNA polymerase described later. Therefore, when performing PCR using rTth DNA polymerase in the presence of Mn 2+ or Mg 2+ , it is particularly preferable for the purpose of evolutionary molecular engineering to create a library containing more mutations and screen for mutants with better functions from that library.
[0043] The case of performing PCR using Taq DNA polymerase or a DNA polymerase with high replication fidelity such as KOD DNA polymerase, Pfu DNA polymerase, and PrimeSTAR Max (manufactured by Takara Bio Inc.) will be further described with reference to FIG. 3. When performing PCR using Taq DNA polymerase or a DNA polymerase with high replication fidelity as the DNA polymerase, the complementary strand of the RNA sequence in the RNA / DNA primer is not created, and a single-stranded portion consisting of the RNA sequence remains at the end of the amplified fragment. Therefore, reverse transcription is performed using an appropriate DNA polymerase, such as rTth DNA polymerase, to create a double strand, and then treatment is performed with RNaseH. When performing reverse transcription, it is desirable to add Mn 2+ or Mg 2+ . Digesting the RNA sequence contained at the end of the amplified fragment by RNaseH treatment can create a protruding end with a single-stranded portion. This figure shows the case where a protruding end is finally created only at one end. However, by using RNA / DNA primers for both primers (forward primer and reverse primer) of the primer pair, it is also possible to create protruding ends at both ends.
[0044] In this method using Taq DNA polymerase or the like or a DNA polymerase with high replication fidelity in the PCR process, compared with the case of using rTth DNA polymerase, since a reverse transcription step by rTth DNA polymerase is required after PCR, one more step is added compared with the method of using rTth DNA polymerase in the PCR process. However, this reverse transcription step only requires adding rTth DNA polymerase or the like to the container after PCR. As described above, when performing PCR using rTth DNA polymerase, the mutation introduction rate is high, but in this method of performing PCR using Taq DNA polymerase or the like or a DNA polymerase with high replication fidelity, the mutation introduction rate is low. Specifically, when performing PCR using a DNA polymerase with high replication fidelity, such as KOD DNA polymerase, Pfu DNA polymerase, or PrimeSTAR Max (manufactured by Takara Bio Inc.), the mutation introduction rate is even lower than when using Taq DNA polymerase. Therefore, it is particularly preferable when amplifying and ligating a nucleic acid sequence without introducing a mutation into the template sequence.
[0045] The present invention will be described below based on examples. However, the following examples are for explaining the present invention and are not for limiting the present invention.
Examples
[0046] <Example 1: Construction of VHH gene using a DNA fragment prepared by PCR (Mn 2+ addition condition) by rTth DNA polymerase> Using DNA encoding VHH as a template, PCR was performed using rTth DNA polymerase with three types of primer sets. It was confirmed that protruding ends could be created by RNaseH treatment for each DNA fragment and the original sequence could be created by ligation (Figure 4).
[0047] <1-1 Preparation of RNA-containing DNA fragment by PCR> Eurofins Co., Ltd. was commissioned to synthesize artificial genes, and VHH#1, a DNA encoding VHH, was synthesized. Its DNA sequence is as follows.
[0048] VHH#1(577bp): GATCCCGCGAAATTAATACGACTCACTATAGGGGAAGTATTTTTACAACAATTACCAACAACAACAACAAACAACAACAACATTACATTTTACATTCTACAACTACAAGCCACCATGGCTGAGGTGCAGCTCGTGGAGTCTGGGGGAGGATTGGTGCAGGCTGGGGGCTCTCTGAGACTCTCGTGTGCAATTAATGACCGTACCTTTAGTAACTATTCCATGGGCTGGTTCCGCCAGGCTCCAGGGAAGGAGCGTGAGTTTGTCGCGGCTATTACTCATAATGGTAGTACAAACTTTCCAGACTCCGTGAAGGGCCGATTCACCATCTCCGTAGACAAGGCCAAGAACACGGTGTATCTGCAAATGAACAGCCTGAAACCCGAGGACACGGCCGTCTATTACTGTGCGGTAGACCATAGTTTTATCACGGTAGTACGTGGAGAGGAAGATCTCGAAGTTTGGGGCCAGGGCACCCTGGTCACTGTCTCCTCAGCGCACCACAGCGAAGACCCCACGGGGGGAGGCAGCCATCATCATCATCATCACGGCGGAAGCAGGACGGGGGGCGGCGTGGAAA (SEQ ID NO: 1) Base number: Region name 14-33: T7 promoter 34-36: 5` cap 37-107: Ω 110-114: kozak 118-516: VHH 517-528: GGGS 529-546: His Tag 547-555: GGS 556-577: NewYtag(cnvK)
[0049] Using VHH#1 as a template, PCR was performed using three types of primers to prepare three types of RNA-containing DNA fragments: VHH#1-α (SEQ ID NO: 8), VHH#1-β (SEQ ID NO: 9), and VHH#1-γ (SEQ ID NO: 10). The sequences of the three primer sets used are as follows. [Table 1]
[0050] 25 μL of 2xRT Quick Master mix (manufactured by Toyobo Co., Ltd.) as rTthDNA polymerase, 2.5 μL of 50 mM Mn(OAc) 2 2.0 μL of 10 μM Forward primer, 2.0 μL of 10 μM Reverse primer, and 2.4 μL of template DNA (1000-fold diluted plasmid) were mixed and adjusted to 50 μL with UltraPure (trademark) DNase / RNase-Free Distilled Water (UPDW) (manufactured by Thermo Fisher Scientific). The PCR program for preparing VHH#1-α and VHH#1-β was as follows, and steps 3 to 5 were repeated 25 cycles. 1. 90 °C for 30 seconds 2. 94 °C for 1 minute 3. 94 °C for 30 seconds 4. 60 °C for 30 seconds 5. 72 °C for 25 seconds 6. 72 °C for 7 minutes 7. 10 °C ∞
[0051] The PCR program for preparing VHH#1-γ was as follows, and steps 3 to 5 were repeated 25 cycles. 1. 90 °C for 30 seconds 2. 94 °C for 1 minute 3. 94 °C for 30 seconds 4. 65 °C for 30 seconds 5. 72 °C for 25 seconds 6. 72 °C for 7 minutes 7. 10 °C ∞
[0052] The sequences of the amplified VHH#1-α, VHH#1-β, and VHH#1-γ are as follows.
[0053] VHH#1-α (201bp): GATCCCGCGAAATTAATACGACTCACTATAGGGGAAGTATTTTTACAACAATTACCAACAACAACAACAAACAACAACAACATTACATTTTACATTCTACAACTACAAGCCACCATGGCTGAGGTGCAGCTCGTGGAGTCTGGGGGAGGATTGGTGCAGGCTGGGGGCTCTCTGAGACTCTCGTGTGCAATTAATGACCGT (SEQ ID NO: 8)
[0054] VHH#1-β (152bp): ATGACCGTACCTTTAGTAACTATTCCATGGGCTGGTTCCGCCAGGCTCCAGGGAAGGAGCGTGAGTTTGTCGCGGCTATTACTCATAATGGTAGTACAAACTTTCCAGACTCCGTGAAGGGCCGATTCACCATCTCCGTAGACAAGGCCAAG (SEQ ID NO: 9)
[0055] VHH#1-γ (237bp): CCAAGAACACGGTGTATCTGCAAATGAACAGCCTGAAACCCGAGGACACGGCCGTCTATTACTGTGCGGTAGACCATAGTTTTATCACGGTAGTACGTGGAGAGGAAGATCTCGAAGTTTGGGGCCAGGGCACCCTGGTCACTGTCTCCTCAGCGCACCACAGCGAAGACCCCACGGGGGGAGGCAGCCATCATCATCATCATCACGGCGGAAGCAGGACGGGGGGCGGCGTGGAAA (SEQ ID NO: 10)
[0056] <Purification of Fragment DNA Containing 1-2 RNA Region> The RNA-containing DNA fragments were purified using AMPure XP (manufactured by Beckman Coulter) according to the attached manual. Elution was performed with 30 μL of UPDW.
[0057] <1-3 Overhang formation by RNaseH treatment> To 27 μL of the purified RNA-containing DNA fragment DNA solution, 0.3 μL of RNaseH (manufactured by Takara Bio Inc.) and 3.0 μL of 10x NEBuffer2 (manufactured by New England Biolabs) were added, and the RNA portion was degraded by incubating at 37 °C for 30 minutes.
[0058] <1-4 Ligation of DNA fragments by T4 DNA ligase> For each DNA fragment of VHH#1-α, VHH#1-β, and VHH#1-γ having overhangs, ligation was performed in all combinations. Each DNA fragment was mixed to an equimolar amount, 2.0 μL of 10x T4 ligase buffer and 1.0 μL of T4 DNA ligase (manufactured by Takara Bio Inc.) were added, and the reaction solution was adjusted with UPDW to a volume of 20 μL. After incubation at 16 °C for 24 hours, the reaction samples were confirmed by 4% denaturing polyacrylamide gel electrophoresis (PAGE) containing 8 M urea (Figure 5).
[0059] The specific PAGE conditions are as follows. First, 4.8 g of urea (manufactured by Fujifilm Wako Pure Chemical Corporation), 1.0 mL of 5xTBE (manufactured by Nippon Gene), and 1.0 mL of 40% (w / v) acrylamide bis mixture (19:1) (manufactured by Fujifilm Wako Pure Chemical Corporation) were mixed and made up to 10 mL with MilliQ water. It was warmed in a microwave oven for about 10 seconds to completely melt the urea. 25 μL of 20% (w / v) ammonium persulfate solution and 10 μL of N,N,N’,N’-tetramethylethylenediamine (manufactured by Fujifilm Wako Pure Chemical Corporation) were added and gently mixed, then poured into a gel plate (8x9 cm size, 1 mm thick) for the Rapidus Mini Slab Electrophoresis Tank (manufactured by ATTO) and left standing at room temperature for 30 minutes to solidify the gel. The gel was set in the Rapidus Mini Slab Electrophoresis Tank set at 60 °C, and prerun was performed at 200 V for 10 minutes. 2 μL of 2x loading buffer was added to 1 μL of the sample, boiled at 95 °C for 3 minutes, then applied to the gel and electrophoresed at 200 V for 25 minutes. The gel was stained with a SYBR Nucleic Acid Gel Stain (manufactured by Thermo Fisher Scientific) solution diluted 10,000-fold with TE (pH 8.0) and confirmed with an Amersham Typhoon scanner (manufactured by Cytiva).
[0060] As is clear from Figure 5, the ligation products expected under the mixing conditions of α and β, β and γ, and α, β, and γ were confirmed, and it was confirmed that ligation of the protruding ends of the complementary sequences was performed.
[0061] <1-5 Confirmation of Ligation Products by Cloning and Sequencing> Cloning and direct sequencing of the ligation product were performed to further confirm that the target sequence was constructed. First, for the ligation product, PCR was performed using the Newleft and NewYtag (cnvK) primers and Taq DNA polymerase (Takara Ex Taq (manufactured by Takara Bio Inc.)) with the following program, repeating steps 2-4 30 cycles. 1. 98 °C for 2 minutes 2.98 °C for 10 seconds 3.66 °C for 5 seconds 4.72 °C for 1 minute 5.72 °C for 2 minutes 6.10 °C for ∞
[0062] After confirming the PCR product by 8M urea containing 4% denaturing PAGE, it was purified by AMPure XP according to the protocol and eluted in 40 μL of UPDW. Using Ligation high Ver.2 (manufactured by Toyobo Co., Ltd.), the above purified product was manually inserted into the pGEM-T Easy vector (manufactured by Promega Corporation). According to the manual, competent cell DH5α was transformed with the vector into which the generated product was inserted, seeded on an LB plate (+100 μg / mL ampicillin), and plate culture was performed.
[0063] Escherichia coli derived from colonies whose inserts could be confirmed by colony PCR was cultured overnight in 5 mL of LB liquid medium (+100 μg / mL ampicillin), and the cells were collected by centrifugation the next day. Then, the plasmid was purified according to the manual using the FastGene Plasmid Mini Kit (manufactured by Nippon Genetics Co., Ltd.). Sequencing of 18 plasmids was outsourced to Eurofins Genomics K.K. As a result, among the 18 samples, only 1 sample had the same sequence as the target DNA. As a result of calculating the number of mutations, the error rate was 5.9 errors per 1000 bp (61 errors / 10386 bp (577 bp x 18)).
[0064] <Example 2: Ligation Using PCR Product by rTth DNA Polymerase (Mg 2+ Addition Conditions)> Mn 2+ Since the mutation introduction rate is slightly higher in PCR using rTth DNA polymerase in the presence of Mn, suppression of the mutation introduction rate by the use of Mg 2+ was investigated.
[0065] <2-1 Mg 2+Construction of VHH Gene Using DNA Fragments Prepared by PCR under Added Conditions> 50 mM of Mn(OAc) 2 to 50 mM of MgCl 2 except for the change, the VHH gene was constructed under the same conditions as the experiment described in Example 1. The ligation results of each fragment of VHH#1-α, VHH#1-β, and VHH#1-γ are shown in Figure 6. Even when using the DNA fragments prepared under the Mg 2+ addition conditions, the expected ligation products of α and β, β and γ, and α, β, and γ could be confirmed respectively.
[0066] Mg 2+ To evaluate the error rate of the VHH gene constructed by the method using, next-generation sequencing (NGS) was used for analysis. NGS was performed using the MiSeq Reagent Kit v3 (600-cycle) (manufactured by Illumina). The sample for NGS analysis was prepared according to the manual of the Nextera XT DNA Library Prep Kit (manufactured by Illumina). First, two-step PCR amplification was performed using the PAGE-purified target VHH gene as a template. PCR was performed using PrimeSTAR Max (manufactured by Takara Bio). The first-step PCR was performed using the primer set described below. The obtained PCR product was purified using AMPure XP, and the purified product was used as a template for the second-step PCR. For the second-step PCR, the index-adding primer specified in the kit was used. The PCR product was purified using AMPure XP in the same manner as above, and the DNA concentration was measured using NanoPad DS-11 (manufactured by DeNovix). Further, the DNA was made single-stranded, and after dilution and other treatments, it was loaded into the cartridge, and then the reagent cartridge was set on the MiSeq System (manufactured by Illumina) and run.
[0067]
Table 2
[0068] VHH sequences were extracted from the output data of NGS, and 300 sequences were randomly selected from them for sequence confirmation. A total of 420 mutations were confirmed in the 300 sequences. Therefore, the mutation rate was 3.2 errors per 1000 bp (420 errors / 129888 bp (577 bp x 300 sequences)). Mn 2+ Since the error rate under the addition condition was 5.9 errors / 1000 bp, Mn 2+ instead, Mg 2+ was added, and it was found that the mutation rate could be suppressed to about half.
[0069] In addition, rTth DNA polymerase has been reported to have reverse transcription activity under the Mn 2+ addition condition. However, this time, it was confirmed that reverse transcription could be carried out with about several base pairs even under the Mg 2+ addition condition.
[0070] <2-2 Shuffling between VHH genes> A model experiment was conducted to produce a total of 9 types of VHH gene sequences by dividing three types of VHH genes with a common framework region (FR) within FR3 and performing ligation between mixtures of N-terminal and C-terminal fragments (Figure 7). The N-terminal fragment was designated as A, and the C-terminal fragment was designated as B. The three types of VHH genes used were as shown in SEQ ID NO: 1, SEQ ID NO: 11, and SEQ ID NO: 12.
[0071] VHH#2 (577 bp): ATCCCGCGAAATTAATACGACTCACTATAGGGGAAGTATTTTTACAACAATTACCAACAACAACAACAAACAACAACAACATTACATTTTACATTCTACAACTACAAGCCACCATGGCTGAGGTGCAGCTCGTGGAGTCTGGGGGAGGGTCGGTGCAGGCTGGGGGCTCTTTGAGACTCTCCTGTTCAGCCTCTGGACCCGAATGGCGGCACTATCACATGGGCTGGTTCCGCCAGCCTCCAGGAAAGGAACGTGAGTTTGTAGCCGCTATCAGCTGGAGTGGAGGCACCACAATGTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATGTTAAGAATACGGTGTATTTGCAAATGAACAGCCTGAAACCTGAGGACACGGCCGTTTATTACTGTGCAGCTGGGGACACGGTAGTAGCCTTACTAGATTATCGCGCCTACTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCAGAACCCAAGACACCAAAACCACAATCGGGGGGAGGCAGCCATCATCATCATCATCACGGCGGAAGCAGGACGGGGGGCGGCGTGGAAA (SEQ ID NO: 11)
[0072] VHH#3 (577bp): GATCCCGCGAAATTAATACGACTCACTATAGGGGAAGTATTTTTACAACAATTACCAACAACAACAACAAACAACAACAACATTACATTTTACATTCTACAACTACAAGCCACCATGGCTGAGGTGCAGCTCGTGGAGTCTGGCGGGGACTTGGTGCAGCCTGGGGGGTCTCTCAATCTCTCCTGTGTAGCCGACGCGACCATCTTCGGCTCTAATTCGATGGCCTGGTTCCGCCAATATCCGGGAAAGCAGCGCGACTTACTCGCAACGGTGGCGAGAAATGGTAACACGGGCTATGTGGACTCCGTGAAGGGCCGATTCACCATTTCCAGAGACGACGGACAGAACATAGTGTATTTGCAAATGAACAGCCTGAAACCTGAGGACACAGCCCTTTACACCTGTAATTTGAAAAGGTACCGGATGGGCTTCATTCTAGACGGTGACTACTGGGGCCAGGGGACCCAGGTCACCGTCTCCTCAGAACCCAAGACACCAAAACCACAATCGGGGGGAGGCAGCCATCATCATCATCATCACGGCGGAAGCAGGACGGGGGGCGGCGTGGAA (SEQ ID NO: 12)
[0073] <2-3 shuffling> Using the primers in Table 1 and Table 3 and the templates of VHH#1 to VHH#3 in the combinations of Table 4, PCR was carried out in the presence of Mg 2+ to prepare, from VHH#1 to VHH#3 respectively, Fragment A which is the 5'-side DNA fragment and Fragment B which is the 3'-side DNA fragment. The conditions for each PCR of Fragment A and B were as follows, and Steps 3 to 5 were repeated 25 cycles.
[0074] Fragment A 1. 90 °C for 30 seconds 2. 94 °C for 1 minute 3. 94 °C for 30 seconds 4. 60 °C for 30 seconds 5.72 °C for 25 seconds 6.72 °C for 7 minutes 7.10 °C for ∞
[0075] Fragment B 1.90 °C for 30 seconds 2.94 °C for 1 minute 3.94 °C for 30 seconds 4.65 °C for 30 seconds 5.72 °C for 25 seconds 6.72 °C for 7 minutes 7.10 °C for ∞
[0076]
Table 3
[0077]
Table 4
[0078] The PCR products were purified using AMPure XP (manufactured by Beckman Coulter). For the ligation reaction, a mixture of Fragment A (3.0 μL of each fragment, total 9.0 μL) and Fragment B (3.0 μL of each fragment, total 9.0 μL), 4.0 μL of 10xT4 ligase buffer, and 2.0 μL of T4 DNA ligase (manufactured by Takara Bio) were added, and the reaction solution was adjusted to 40 μL with UPDW. After incubation at 16 °C for 24 hours, each ligation product was confirmed by 4% denaturing PAGE containing 8 M urea (Figure 8).
[0079] <Sequence analysis of ligation products by next-generation sequencing (NGS)> The ligation products of the Fragment A mixture and the Fragment B mixture were analyzed by NGS. The NGS analysis was performed in the same manner as in Example 2-1. As a result of the NGS analysis, 9 types of expected VHH genes were included (Table 5), confirming that shuffling was successful.
[0080]
Table 5
[0081] <Example 3: Preparation of RNA-containing PCR products by combining general PCR and reverse transcription with rTth DNA polymerase> As a method for preparing RNA-containing PCR products using RNA / DNA chimeric primers and rTth DNA polymerase, a method of performing reverse transcription of the RNA overhanging end portion with rTth DNA polymerase after general PCR was examined. The template DNA and RNA / DNA chimeric primers used in the examination are as follows.
[0082] PF_1D11-#81(567bp) GATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCAATGGAAGTACAATTAGTTGAATCTGGTGGTGGGCTTGTACAGCCAGGTGGGAGTCTGCGCCTGAGCTGTGCAGCGAGTGGTCGTACTTTCTCTCGTTACACTATGGGTTGGTTTCGCCAGGCACCGGGAAAAGGCCGTGAGGGCGTGGCGGCTATCAACACTGGTGCTGGTACTACTTACTACGCTGACTCGGTCAAAGGCCGGTTTACCATCAGCCGTGACAACGCGAAGAACACCCTGTATCTCCAGATGAATTCCCTGCGTGCTGAAGATACTGCCGTGTACTACTGCGCTGCCCAGACCTCTGATTACAACGGTTGGGGTAACCGTTATTGGGGTCAAGGCACGTTGGTGACAGTCTCTTCAGGGGGAGGATCCCATCATCATCATCATCACGGCGGAAGCAGGACGGGGGGCGGCGTGGAAA (SEQ ID NO: 17)
[0083] First, using PF_1D11-#81 as a template, a primer set of FW-Shuffling-PL (SEQ ID NO: 18) and NewYtag(cnvk) (SEQ ID NO: 7) shown below, and PCR conditions were examined using rTthDNA polymerase (using RT Quick Master mix). The final concentrations were 1xRT-PCR Quick Master Mix, 0.3 μM FW-Shuffling-PL, 0.3 μM NewYtag(cnvK), 0.04 ng / μL template DNA, 0 to 2.5 mM Mn(OAc) 2 or MgCl 2 A 20 μL PCR reaction solution was prepared to be as follows. The PCR program was as follows, and steps 2 to 4 were repeated 15 cycles.
[0084] FW-Shuffling-PL (lowercase letters are RNA) 5’-gaagauacTGCCGTGTACTACTGC-3’ (SEQ ID NO: 18)
[0085] 1. 94 °C for 1 minute 2. 94 °C for 30 seconds 3. 60 °C for 30 seconds 4. 72 °C for 1 minute 5. 72 °C for 2 minutes 6. 16 °C ∞
[0086] For comparison and for use in the next examination process, PCR was also performed using PrimeSTAR Max (manufactured by Takara Bio Inc.). A 50 μL PCR reaction solution was prepared so that the final concentrations were 1xPrimeSTAR Max, 0.3 μM FW-Shuffling-PL, 0.3 μM NewYtag(cnvK), and 0.04 ng / μL template DNA. The PCR program was as follows, and steps 1 to 3 were repeated 15 cycles. 1. 95 °C for 10 seconds 2. 50 °C for 5 seconds 3. 72 °C for 5 seconds 4. 16 °C ∞
[0087] 1 μL aliquots of each PCR reaction mixture were applied to 8 M urea-containing 4.5% denaturing PAGE (60 °C, 200 V, 20 minutes) to confirm the PCR products (Figure 9). In the PCR samples using PrimeSTAR Max, two bands were confirmed, which were considered to be a 160-mer extended by FW-Shuffling-PL and a 152-mer extended by NewYtag(cnvK) (lane 2). On the other hand, in some of the PCR products using rTth DNA polymerase (lanes 4, 5, 10, 11), only a band considered to be a 160-mer was confirmed. This is thought to be because the complementary DNA was extended to the RNA part by rTth DNA polymerase. Two bands were confirmed in lanes 6, 7, and 12, which is thought to be because the RNA part was degraded due to too high concentrations of Mn 2+ or Mg 2+ . Also, in these lanes, sub-bands appeared slightly above 200 bp. Based on the above results, the conditions for synthesizing the complementary strand to the RNA part of the PCR product using PrimeSTAR Max were investigated with the final concentration of Mn 2+ set to 0.63 mM or the final concentration of Mg 2+ set to 1.25 mM.
[0088] The PCR samples using PrimeSTAR Max were purified with AMPure XP and eluted with 30 μL of UPDW. Using 3 μL of this purified product, 25 μL of reaction samples were prepared to have a final concentration of 1x RT-PCR Quick Master Mix, 0.63 mM of Mn(OAc) 2 , or 1.25 mM of MgCl 2 . For reference, 1 μL was taken, and for the reaction, 10 μL x 2 were taken and incubated at 60 °C and 72 °C for 10 minutes each. Further, each reaction solution was dispensed into 5 μL x 2, 0.5 μL of 10x NEBuffer2 and 0.2 μL of RNaseH were added to one of them, and it was further incubated at 37 °C for 10 minutes. 1 μL aliquots of each reaction solution were applied to 8 M urea-containing 4.5% denaturing PAGE (60 °C, 200 V, 20 minutes) to confirm the products (Figure 10). Mn 2+ or Mg 2+Under any conditions, it is considered that reverse transcription can be carried out because only the 160mer band can be confirmed under the condition of 72°C (lanes 5 and 10). Furthermore, by treating with RNaseH, a band considered to be 152mer appears again, which is thought to be due to the degradation of the RNA part. From the above results, it was confirmed that a protruding end can be created by performing reverse transcription with rTthDNA polymerase on the PCR product using an RNA / DNA chimeric primer and further treating with RNaseH.
Claims
1. Performing PCR using one or more primer pairs in which at least one primer is an RNA / DNA chimeric primer containing an RNA sequence on the 5'-side for a desired nucleic acid sequence, and creating an amplified fragment using the desired nucleic acid sequence as a template; Digesting the RNA sequence contained in the amplified fragment by RNaseH treatment to form overhanging ends; Connecting at least two amplified fragments by connecting the overhanging ends to create a connected nucleic acid; A method for connecting nucleic acids, comprising:
2. Among the amplified fragments contained in the connected nucleic acid, the forward primer of one of the primer pairs for amplifying the amplified fragments adjacent to each other when connected is an RNA / DNA chimeric primer, and the reverse primer of the other primer pair is an RNA / DNA chimeric primer, and the RNA sequences contained in the forward primer and the reverse primer have substantially complementary sequences. The method according to claim 1.
3. The method according to claim 1 or 2, wherein the PCR is performed using rTth DNA polymerase.
4. The PCR is performed in the presence of Mn 2+ The method according to claim 3, wherein the method is performed in the presence of Mn
5. The PCR is carried out in the presence of Mg 2+ The method according to claim 3
6. The method according to claim 1, wherein the PCR is performed using a DNA polymerase with high replication fidelity or Taq DNA polymerase, and reverse transcription is further performed using rTth DNA polymerase before RNaseH treatment.
7. The reverse transcription is carried out in the presence of Mn 2+ The method according to claim 6, wherein the reverse transcription is carried out in the presence of Mn 2+ .
8. The reverse transcription is carried out in the presence of Mg 2+ The method according to claim 6, wherein the reverse transcription is carried out in the presence of Mg
9. The method according to claim 1, wherein the connection of the overhanging ends is performed by an enzyme selected from the group consisting of Taq DNA ligase, T4 DNA ligase, and E. coli DNA ligase.
10. A nucleic acid fragment containing an RNA sequence derived from the chimeric primer at either the 5'-end or the 3'-end, or both the 5'-end and the 3'-end of the desired nucleic acid sequence, amplified by PCR using a primer pair in which at least one primer of the pair of primers is an RNA / DNA chimeric primer containing an RNA sequence on the 5'-side for the desired nucleic acid sequence.
11. DNA polymerase, RNaseH, An enzyme selected from the group consisting of Taq DNA ligase, T4 DNA ligase, and E. coli DNA ligase A kit for amplifying and connecting nucleic acids by the method according to any one of claims 1 to 9, comprising:
Citation Information
Patent Citations
Method of fabricating DNA library for fabricating next-generation type fragment antibody, library fabricated by using the method, and next-generation type fragment antibody
JP2016044126A
DNA library production method, DNA library, screening method, and screening kit
JP2016098198A
Method for producing linked nucleic acid fragment, linked nucleic acid fragment, and library composed of linked nucleic acid fragments
JP2019149985A