Chimeric antigen receptor targeting sialyl lewis a and uses thereof

Abstract

To provide a chimeric antigen receptor targeting Sialyl Lewis A and uses thereof.SOLUTION: The presently disclosed subject matter provides for methods and compositions for treating cancer (e.g., pancratic cancer). The presently disclosed subject matter relates to antigen recognizing receptors (e.g., chimeric antigen receptors (CARs)) that specifically target Sialyl Lewis A (e.g., human Sialyl Lewis A), and immunoresponsive cells comprising such CARs. The presently disclosed Sialyl Lewis A-specific CARs have enhanced immune-activating properties, including anti-tumor activity. The presently disclosed subject matter provides for methods and compositions for treating cancer (e.g., pancratic cancer).SELECTED DRAWING: None

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Application No. 62 / 748,198, filed October 19, 2018, the contents of which are incorporated by reference in their entirety and priority is claimed.

[0002] introduction The subject matter of the present disclosure provides methods and compositions for treating cancer (e.g., pancreatic cancer). The subject matter of the present disclosure relates to chimeric antigen receptors (CARs) that specifically target sialyl Lewis A. The subject matter of the present disclosure further provides immunoresponsive cells that include such CARs, as well as methods of using such CARs and such cells to treat cancer (e.g., pancreatic cancer). [Background technology]

[0003] Cell-based immunotherapy is a potentially curative therapy for the treatment of cancer. T cells and other immune cells can be modified to target tumor antigens by the introduction of genetic material that encodes an artificial or synthetic receptor for the antigen, called a chimeric antigen receptor (CAR), specific for the selected antigen. Targeted T cell therapy using CARs has shown recent clinical success in the treatment of hematological malignancies (Dunbar et al., Science (2018);359) To date, responses to CAR therapy targeting solid tumors have been relatively poor (Sadelain et al., Nature (2017);545:423-431). One of the challenges to overcome in all cancers, and in solid tumors in particular, is antigenic heterogeneity. While all or most B-cell malignancies express CD19 (Brentjens et al., Nat Med (2003);9:279-286), many potential CAR targets are expressed on only a small proportion of all tumor cells within a patient. Low-level antigen expression may also result in resistance to CAR therapy (Fry et al., Nat Med (2018); 24:20-28). Targeting two or more antigens can be implemented in defined escape populations or clonal events (Wilkie et al., J Clin Immunol (2012); 32:1059-1070; Kloss et al., Nat Biotechnol (2013); 31:71-75; Ruella et al., J Clin Invest (2016); 126:3814-3826; Hegde et al., J Clin Invest (2016); 126:3036-3052; Zah et al., Cencer Immunol Res 2016; 4:498-508), but other approaches are needed to overcome larger or undefined target heterogeneity. Therefore, novel therapeutic strategies are needed to design CARs that target antigens highly expressed in solid tumor cells and that can induce potent anticancer effects with minimal toxicity. [Prior art documents] [Non-patent literature]

[0004] [Non-Patent Document 1] Dunbar et al., Science (2018);359 [Non-Patent Document 2] Sadelain et al., Nature (2017);545:423-431 [Non-Patent Document 3] Brentjens et al., Nat Med (2003); 9:279-286 [Non-Patent Document 4] Fry et al., Nat Med (2018); 24:20-28 [Non-Patent Document 5] Wilkie et al., J Clin Immunol (2012); 32:1059-1070 [Non-Patent Document 6] Kloss et al., Nat Biotechnol (2013); 31:71-75 [Non-Patent Document 7] Ruella et al., J Clin Invest (2016); 126:3814-3826 [Non-Patent Document 8] Hegde et al., J Clin Invest (2016); 126:3036-3052 [Non-Patent Document 9] Zah et al., Cecer Immunol Res 2016; 4:498-508 Summary of the Invention [Means for solving the problem]

[0005] The subject matter of the present disclosure generally provides chimeric antigen receptors (CARs) that target sialyl Lewis A.

[0006] In certain embodiments, the CAR comprises an extracellular antigen-binding domain, a transmembrane domain, and an intracellular domain, and the extracellular antigen-binding domain cross-competes with a reference antibody, or antigen-binding portion thereof, for binding to Sialyl Lewis A. In some such embodiments, the reference antibody, or antigen-binding portion thereof, that binds to Sialyl Lewis A comprises a heavy chain variable region comprising one, two, or three heavy chain complementarity determining regions (CDR1, CDR2, and / or CDR3) and a light chain variable region comprising one, two, or three light chain CDRs (CDR1, CDR2, and / or CDR3), wherein the heavy chain CDR1, CDR2, and CDR3 and the light chain CDR1, CDR2, and CDR3 are selected from the heavy chain CDR1, CDR2, and CDR3 and the light chain CDR1, CDR2, and CDR3 of any one of the antibodies disclosed in U.S. Patent No. 9,475,874, the contents of which are incorporated by reference in their entirety.

[0007] In certain embodiments, the CAR comprises an extracellular antigen-binding domain, a transmembrane domain, and an intracellular domain, wherein the extracellular antigen-binding domain cross-competes with a reference antibody, or antigen-binding portion thereof, for binding to Sialyl Lewis A, and the reference antibody, or antigen-binding portion thereof, comprises a heavy chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO:1, a heavy chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO:2, a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO:3, a light chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO:4, a light chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO:5, and a light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO:6.

[0008] In certain embodiments, the CAR comprises an extracellular antigen-binding domain, a transmembrane domain, and an intracellular domain, wherein the extracellular antigen-binding domain binds to an epitope on Sialyl Lewis A that is identical to or overlaps with a reference antibody, or antigen-binding portion thereof, wherein the reference antibody, or antigen-binding portion thereof, comprises a heavy chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO:1, a heavy chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO:2, a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO:3, a light chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO:4, a light chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO:5, and a light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO:6.

[0009] In certain embodiments, the CAR comprises an extracellular antigen-binding domain, a transmembrane domain, and an intracellular domain, wherein the extracellular antigen-binding domain specifically binds sialyl Lewis A and comprises a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO:3, or a conservative modification thereof, and a light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO:6, or a conservative modification thereof.

[0010] In certain embodiments, the extracellular antigen-binding domain comprises a heavy chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO:2, or a conservative modification thereof, and a light chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO:5, or a conservative modification thereof.

[0011] In certain embodiments, the extracellular antigen-binding domain comprises a heavy chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO:1, or a conservative modification thereof, and a light chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO:4, or a conservative modification thereof.

[0012] In certain embodiments, the CAR comprises an extracellular antigen-binding domain, a transmembrane domain, and an intracellular domain, wherein the extracellular antigen-binding domain specifically binds to sialyl Lewis A and comprises a heavy chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO:1, a heavy chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO:2, and a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO:3.

[0013] In certain embodiments, the CAR comprises an extracellular antigen-binding domain, a transmembrane domain, and an intracellular domain, wherein the extracellular antigen-binding domain specifically binds to sialyl Lewis A and comprises a light chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO:4, a light chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO:5, and a light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO:6.

[0014] In certain embodiments, the extracellular antigen-binding domain comprises a heavy chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO:1, a heavy chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO:2, a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO:3, a light chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO:4, a light chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO:5, and a light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO:6.

[0015] In certain embodiments, the CAR comprises an extracellular antigen-binding domain, a transmembrane domain, and an intracellular domain, wherein the extracellular antigen-binding domain specifically binds to sialyl Lewis A and comprises a heavy chain variable region comprising an amino acid sequence that is at least about 80% homologous (e.g., at least about 80% identical) to SEQ ID NO: 7. In certain embodiments, the extracellular antigen-binding domain comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 7.

[0016] In certain embodiments, the CAR comprises an extracellular antigen-binding domain, a transmembrane domain, and an intracellular domain, wherein the extracellular antigen-binding domain specifically binds to sialyl Lewis A and comprises a light chain variable region comprising an amino acid sequence that is at least about 80% homologous (e.g., at least about 80% identical) to SEQ ID NO: 8. In certain embodiments, the extracellular antigen-binding domain comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 8.

[0017] In certain embodiments, the CAR comprises an extracellular antigen-binding domain, a transmembrane domain, and an intracellular domain, wherein the extracellular antigen-binding domain specifically binds to Sialyl Lewis A; a) a heavy chain variable region comprising an amino acid sequence that is at least about 80% homologous (e.g., at least about 80% identical) to SEQ ID NO:7, and b) a light chain variable region comprising an amino acid sequence that is at least about 80% homologous (e.g., at least about 80% identical) to SEQ ID NO:8. Includes.

[0018] In certain embodiments, the extracellular antigen-binding domain comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:7 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:8.

[0019] In certain embodiments, the extracellular antigen-binding domain comprises a heavy chain variable region comprising an amino acid sequence that is at least about 80% homologous (e.g., at least about 80% identical) to SEQ ID NO:7 and a light chain variable region comprising an amino acid sequence that is at least about 80% homologous (e.g., at least about 80% identical) to SEQ ID NO:8. In certain embodiments, the extracellular antigen-binding domain comprises a heavy chain variable region comprising an amino acid sequence set forth in SEQ ID NO:7 and a light chain variable region comprising amino acids having the sequence set forth in SEQ ID NO:8. In certain embodiments, the extracellular antigen-binding domain comprises a heavy chain variable region comprising an amino acid sequence set forth in SEQ ID NO:7 and a light chain variable region comprising amino acids having the sequence set forth in SEQ ID NO:8.

[0020] In certain embodiments, the extracellular antigen-binding domain comprises a single chain variable fragment (scFv). In certain embodiments, the extracellular antigen-binding domain comprises a human scFv. In certain embodiments, the extracellular antigen-binding domain comprises an optionally cross-linked Fab. In certain embodiments, the extracellular antigen-binding domain comprises an F(ab) 2 In certain embodiments, scFv, Fab and F(ab) 2 One or more of the following are included in the fusion protein with the heterologous sequence to form the extracellular antigen-binding domain. In certain embodiments, the extracellular antigen-binding domain comprises a linker between the heavy and light chain variable regions of the extracellular antigen-binding domain. In certain embodiments, the extracellular antigen-binding domain comprises a signal peptide covalently linked to the 5' end of the extracellular antigen-binding domain.

[0021] In certain embodiments, the transmembrane domain comprises a CD8 polypeptide, a CD28 polypeptide, a CD3ζ polypeptide, a CD4 polypeptide, a 4-1BB polypeptide, an OX40 polypeptide, an ICOS polypeptide, a CTLA-4 polypeptide, a PD-1 polypeptide, a LAG-3 polypeptide, a 2B4 polypeptide, a BTLA polypeptide, a synthetic peptide (not based on a protein associated with immune response), or a combination thereof. In certain embodiments, the intracellular domain further comprises at least one costimulatory signaling region. In certain embodiments, the at least one costimulatory signaling region comprises a CD28 polypeptide, a 4-1BB polypeptide, an OX40 polypeptide, an ICOS polypeptide, a DAP-10 polypeptide, or a combination thereof. In certain embodiments, the at least one costimulatory signaling region comprises a CD28 polypeptide.

[0022] In certain embodiments, the intracellular signaling domain of the CAR described herein comprises a wild-type CD3ζ polypeptide or a modified CD3ζ polypeptide. In some embodiments, the modified CD3ζ polypeptide (a) lacks all or a portion of at least one or more (e.g., one, two, or three) immunoreceptor tyrosine-based activation motifs (ITAMs), which may be or include ITAM1, ITAM2, and / or ITAM3, and / or (b) lacks all or a portion of at least one or more (e.g., one, two, or three) basic-rich stretch (BRS) regions, which may include BRS regions. In certain embodiments, the modified CD3ζ polypeptide contained in the intracellular signaling domain of the CAR described herein comprises at least one or more of the following features: a) lacking ITAM2 or a portion thereof, and optionally further lacking i) ITAM3 or a portion thereof and / or ii) ITAM1 or a portion thereof; b) lacking ITAM1 or a portion thereof, and optionally further lacking ITAM3 or a portion thereof; c) lacking ITAM3 or a portion thereof; d) a deletion of ITAM2 or a portion thereof, and optionally further comprising i) a deletion of ITAM3 or a portion thereof and / or ii) a deletion of ITAM1 or a portion thereof; e) comprising a deletion of ITAM1 or a portion thereof, and optionally further comprising a deletion of ITAM3 or a portion thereof; and / or f) Contains a deletion of ITAM3 or a portion thereof.

[0023] In certain embodiments, the modified CD3ζ polypeptide comprised in the intracellular signaling domain of a CAR described herein comprises at least one or more of the following features: a) lacking BRS2 or a portion thereof, and optionally further lacking i) BRS3 or a portion thereof and / or ii) BRS1 or a portion thereof; b) lacking BRS1 or a portion thereof, and optionally further lacking BRS3 or a portion thereof; c) lacking BRS3 or a portion thereof; and / or d) lacking BRS1 or a portion thereof, BRS2 or a portion thereof, and BRS3 or a portion thereof; e) comprising a deletion of BRS2 or a portion thereof, and optionally further comprising i) a deletion of BRS3 or a portion thereof and / or ii) a deletion of BRS1 or a portion thereof; f) comprising a deletion of BRS1 or a portion thereof, and optionally further comprising a deletion of BRS3 or a portion thereof; g) comprises a deletion of BRS3 or a portion thereof; and / or h) Includes deletions of BRS1 or a portion thereof, BRS2 or a portion thereof, and BRS3 or a portion thereof.

[0024] In certain embodiments, the modified CD3ζ polypeptide comprised in the intracellular signaling domain of a CAR described herein lacks ITAM2, ITAM3, BRS2, ​​and BRS3 or comprises a deletion of ITAM2, ITAM3, BRS2, ​​and BRS3.

[0025] In certain embodiments, the transmembrane domain of a CAR described herein is or comprises a native or modified transmembrane domain of a molecule selected from the group consisting of a CD8 polypeptide, a CD28 polypeptide, a CD3ζ polypeptide, a CD4 polypeptide, a 4-1BB polypeptide, an OX40 polypeptide, a CD166 polypeptide, a CD166 polypeptide, a CD8a polypeptide, a CD8b polypeptide, an ICOS polypeptide, an ICAM-1 polypeptide, a CTLA-4 polypeptide, a CD27 polypeptide, a CD40 / My88 peptide, an NKGD2 peptide, or a combination thereof.

[0026] In certain embodiments, the CAR described herein further comprises a hinge / spacer region, e.g., between the extracellular antigen-binding domain and the transmembrane domain of the CAR. In some embodiments, such hinge / spacer region is or comprises a native or modified hinge / spacer region of a molecule selected from the group consisting of a CD8 polypeptide, a CD28 polypeptide, a CD3ζ polypeptide, a CD4 polypeptide, a 4-1BB polypeptide, an OX40 polypeptide, a CD166 polypeptide, a CD166 polypeptide, a CD8a polypeptide, a CD8b polypeptide, an ICOS polypeptide, an ICAM-1 polypeptide, a CTLA-4 polypeptide, a CD27 polypeptide, a CD40 / My88 peptide, an NKGD2 peptide, or a combination thereof.

[0027] In certain embodiments, the CARs described herein comprise a transmembrane domain and a hinge / spacer region, both of which are derived from the same molecule. For example, in certain embodiments, the CARs described herein comprise a) the hinge / spacer region of the CD28 polypeptide and the transmembrane domain of the CD28 polypeptide; b) the hinge / spacer region of the CD84 polypeptide and the transmembrane domain of the CD84 polypeptide; c) the hinge / spacer region of the CD166 polypeptide and the transmembrane domain of the CD166 polypeptide; d) the hinge / spacer region of a CD8a polypeptide and the transmembrane domain of a CD8a polypeptide; or e) the hinge / spacer region of the CD8b polypeptide and the transmembrane domain of the CD8b polypeptide Includes.

[0028] In certain embodiments, CAR comprises the hinge / spacer region of CD166 polypeptide and the transmembrane domain of CD166 polypeptide.In certain embodiments, CAR described herein comprises a transmembrane domain and a hinge / spacer region, each of which is derived from different molecules.For example, in certain embodiments, such CAR can comprise the hinge / spacer region of CD28 polypeptide and the transmembrane domain of ICOS polypeptide.

[0029] In certain embodiments, the CAR described herein is recombinantly expressed or expressed from a vector. In certain embodiments, such a vector is a retroviral vector (e.g., a gamma-retroviral vector).

[0030] The subject matter of the present disclosure further provides an immunoresponsive cell comprising a CAR disclosed herein. In certain embodiments, such an immunoresponsive cell is transduced with a vector comprising a CAR described herein. In certain embodiments, the CAR described herein is constitutively expressed on the surface of the immunoresponsive cell. Examples of immunoresponsive cells that are useful according to the present disclosure include, but are not limited to, T cells, natural killer (NK) cells, human embryonic stem cells, lymphoid progenitor cells, T cell precursor cells (T cells), human NK cells, ... In certain embodiments, the immunoresponsive cells comprising the CAR described herein are T cells. In certain embodiments, such T cells are selected from the group consisting of cytotoxic T lymphocytes (CTLs), regulatory T cells, and central memory T cells. Be selected.

[0031] The presently disclosed subject matter also provides a nucleic acid molecule encoding a CAR disclosed herein.

[0032] The presently disclosed subject matter further provides vectors comprising each of the nucleic acid molecules disclosed herein. In certain embodiments, such vectors are retroviral vectors (e.g., gamma-retroviral vectors).

[0033] The subject matter of the present disclosure also provides a host cell that expresses a nucleic acid molecule comprising a nucleic acid sequence encoding a CAR as disclosed herein. In certain embodiments, such a host cell is a T cell.

[0034] Additionally, the presently disclosed subject matter provides methods for generating immunoresponsive cells that bind sialyl Lewis A. In certain embodiments, such methods comprise introducing into an immunoresponsive cell a nucleic acid sequence encoding a CAR disclosed herein.

[0035] Furthermore, the presently disclosed subject matter provides compositions comprising immunoresponsive cells (e.g., those disclosed herein) that bind to sialyl Lewis A. In certain embodiments, such compositions are pharmaceutical compositions comprising immunoresponsive cells (e.g., those disclosed herein) that bind to sialyl Lewis A and a pharma- ceutically acceptable carrier.

[0036] Furthermore, the subject of the present disclosure provides a method for treating and / or preventing malignant growth in a subject.In certain embodiments, the method comprises administering to the subject an effective amount of the immunoresponsive cell disclosed herein or the composition disclosed herein.In certain embodiments, the malignant growth is pancreatic cancer.In certain embodiments, the method reduces or eradicates tumor burden in the subject.In certain embodiments, the subject is a human.

[0037] The subject matter of the present disclosure also provides a kit for treating and / or preventing malignant growth.In certain embodiments, the kit comprises the immunoresponsive cell disclosed herein.In certain embodiments, the kit further comprises written instructions for using the immunoresponsive cell to treat a subject with neoplasm.In certain embodiments, the malignant growth is pancreatic cancer.

[0038] The following detailed description, given by way of example and not intended to limit the invention to the specific embodiments described, can be understood in conjunction with the accompanying drawings. [Brief description of the drawings]

[0039] [Figure 1-1]1A-1F show that radiation therapy (RT) sensitizes pancreatic cancer to killing by CAR T cells without affecting target antigen expression. FIG. 1A is a graph showing tumor cell viability 48 hours after exposure to various doses of radiation. FIG. 1B is a graph showing Capan2 pancreatic cancer cells exposed to low dose RT (2 Gy) and incubated with CAR T cells at the indicated ratios for 18 hours after 48 hours, after which the percent killing was determined. FIG. 1C shows that target antigen expression levels were unchanged 48 hours after RT. FIG. 1D shows that transcriptomic analysis of target cells 6 hours after RT reveals several apoptotic pathways that were significantly affected. FIG. 1E is a graph showing TRAIL mRNA expression and protein levels in the medium of CAR T cells after exposure to target antigen (sialyl Lewis A (LeA)-expressing capan2 cells). FIG. 1F is a graph showing TRAIL protein quantified in the medium of LBBz and L(del)CAR T cells grown on target cells expressing or not expressing the target antigen. LFC = log2 fold change, E:T = effector:target. [Figure 1-2] Same as above. [Diagram 2] Figures 2A-2C show that TRAIL expressed by activated CAR T cells is functionally significant against antigen-negative tumor cells in a heterogeneous tumor population exposed to low dose radiation. Figure 2A shows that CAR-activated T cells produce TRAIL that acts on radiosensitizing antigen-positive and antigen-negative tumor cells. Figures 2B-2C show that Ag+ cells were mixed with luciferase-expressing Ag- cells at a 75:25 ratio, exposed to low dose RT, and co-cultured with the indicated CAR T cells for 4 days, followed by quantification of Ag- cell killing. [Figure 3-1]Figures 3A-3B show that sensitizing RT transcriptionally primes pancreatic cancer cells for TRAIL-induced death. Figure 3A shows that RNA expression levels of signaling molecules known to mediate various TRAIL responses, including survival and migration, tumor-supportive inflammation, necroptosis, apoptosis, and death receptor endocytosis, were quantified in three biological replicates by RNAseq before and after RT exposure in Capan2 pancreatic cancer cells. Significantly induced and downregulated molecules are shown in red and green, respectively, with the degree represented by a color gradient. Molecules in grey were not significantly altered. Figure 3B shows that CTV-labeled Ag- cells were exposed to RT 2 days prior to co-culture with unlabeled Ag+ cells, Annexin V595, and TRAIL- / - or TRAILwtCAR T cells. Cultures were monitored by live video microscopy, and Ag- cell apoptosis was quantified over time. [Figure 3-2] Same as above. [Figure 4-1] Figures 4A-4M show that sensitizing RT enables CAR T cells to eliminate xenogeneic PDAC in vivo. Figure 4A shows Capan2 tumor cells mixed 75:25 LeA(+):(-) and then injected into the pancreas of NSG mice. After tumors were allowed to establish for 9 days, mice were administered RT followed by CAR T cells. Figure 4B shows waterfall plots of tumor volume change at death between different treatment groups. Figures 4C-4H are graphs illustrating that BLI was performed weekly. Figures 4I-4K show that T cell infiltration of tumors from CAR or RT+CAR treated mice was determined using BLI T cell imaging (detecting G-Luc in transduced T cells) over the first 19 days (Figure 4I) and by IHC from mice sacrificed at day 21 (Figures 4J-4K, all ns). Figure 4L shows that tumors in progressed mice display reduced target antigen expression over time by FACS. Figure 4M is a graph showing BLI of mice treated with RT+L(del) or RT+L(del)-TRAIL CAR T cells. [Figure 4-2] Same as above. [Figure 4-3] Same as above. [Figure 4-4] Same as above. [Figure 4-5] Same as above. [Figure 5-1] 5A-5G show outcomes of DLBCL patients with heterologous tumors treated with palliative RT and CAR T cells. FIG. 5A shows that total or local RT was delivered to mice bearing pancreatic heterologous tumors using image-guided radiation, followed by delivery of CAR T cells. FIG. 5B-5D show graphs showing that tumor burden was monitored by BLI. FIG. 5E-5F illustrate patient biopsies before CAR T cell treatment examined by IHC (FIG. 5E) and flow cytometry (FIG. 5F) for CD19. FIG. 5G shows FDG-PET scans before and 1, 2 and 6 months after palliative lower limb RT and whole body 1928z CAR T cells. [Figure 5-2] Same as above. [Figure 5-3] Same as above. [Figure 6-1] Figures 6A-6C show that CARs targeting LeA specifically lyse cells expressing LeA. Figure 6A shows LBBz CAR T cell design containing membrane-bound G-Luc for imaging. Figure 6B shows that endogenous LeA expression in PC3, Capan2 and BxPC3 cells was examined by flow cytometry. Figure 6C is a graph illustrating PC3, Capan2 or BxPC3 cells mixed with LBBz or L28z CAR T cells or untransduced T cells at various effector:target ratios for 18 hours followed by quantification of target cell killing. [Figure 6-2] Same as above. [Figure 6-3] Same as above. [Figure 6-4] Same as above. [Figure 7]Figure 7 shows that Capan2 cells were FACS sorted into LeA+ and LeA- populations and then mixed at a ratio of 75:25 LeA+ / - tumor cells. LeA-sorted Capan2 cells remain LeA- over time. [Figure 8] Figure 8 is a graph showing that TRAILwt or CRISPR knockout CAR T cells were stimulated in targets and then TRAIL mRNA was quantified and compared to wt unstimulated CAR T cells. [Figure 9] Figure 9 is a table showing fold changes in mRNA after low-dose RT of molecules known to mediate various TRAIL processes, including survival and migration, tumor-supportive inflammation, necroptosis, apoptosis, and death receptor endocytosis. Molecules with adjusted p-values ​​less than 0.05 are shown. [Figure 10] FIG. 10 shows a typical T cell profile after CAR transduction and TCR knockout and before in vivo injection. [Figure 11] Figure 11 is a graph showing that CAR T cell tumour infiltration quantified over time by CTZ T cell bioluminescence imaging demonstrates that both TRAIL knockout LBBz CAR T cells and L(del)CAR T cells accumulate in pancreatic tumours over time. [Figure 12-1] Figures 12A-12B show that CAR T cells persist in vivo, invade tumors, and reduce Ag+ tumor cells in mice bearing xenogeneic Ag+ / - pancreatic cancer. Figure 12A shows that cells isolated from blood, spleen, and tumors from mice treated with CAR T cells 6 weeks prior were analyzed for CAR T cell content (pure T cell population control shown below). Figure 12B shows IHC of LeA expression from pancreatic tumors at different time points after CAR T cell treatment, demonstrating a reduction in target antigen-expressing tumor cells throughout therapy. [Figure 12-2] Same as above. [Figure 12-3] Same as above. [Figure 13]Figure 13 is a graph showing T cell accumulation in tumors of mice treated with total or local RT. LBBz CAR T cells in pancreatic tumors were quantified over time using bioluminescence imaging in mice treated with local RT, total RT (TBI) or no RT followed by CAR T cells. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0040] The presently disclosed subject matter provides antigen binding proteins, such as chimeric antigen receptors (CARs), that target sialyl Lewis A.

[0041] The subject matter of the present disclosure also relates to immunoresponsive cells (e.g., T cells (e.g., cytotoxic T lymphocytes (CTLs), regulatory T cells, central memory T cells, etc.), natural killer (NK) cells, etc.) that comprise a Lewis A-targeted CAR and / or a nucleic acid(s) encoding same. Also provided are human embryonic stem cells, lymphoid progenitor cells, T cell precursor cells and pluripotent stem cells from which lymphoid cells can be differentiated) and methods of using such immunoresponsive cells to treat and / or prevent tumors, e.g., pancreatic cancer.

[0042] I. Certain Definitions Unless otherwise defined, all technical and scientific terms used herein have the meanings commonly understood by those skilled in the art to which the present invention belongs.The following references provide one of the techniques with many common definitions of the terms used in the present invention: Singleton et al., Dictionary of Microbiology and Molecular Biology (2nd ed. 1994), The Cambridge Dictionary of Science and Technology (Walker ed., 1988), The Glossary of Genetics, 5th Ed., R. Rieger et al. (eds.), Springer Verlag (1991), and Hale & Marham, The Harper Collins Dictionary of Biology (1991).As used herein, the following terms have the meanings ascribed to them below, unless otherwise stated.

[0043] As used herein, the term "about" or "approximately" means within an acceptable error range of a particular value as determined by a person skilled in the art, which depends in part on the way in which the value is measured or determined, i.e., the limitations of the measurement system. For example, "about" may mean within 3 or more than 3 standard deviations, as is customary in the art. Alternatively, "about" may mean within a range of up to 20%, preferably up to 10%, more preferably up to 5%, and even more preferably up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term may mean within an order of magnitude, preferably within 5-fold, more preferably within 2-fold of a value.

[0044] As used herein, the term "cell population" refers to a population of at least two cells that express similar or different phenotypes. In a non-limiting example, a cell population can include at least about 10, at least about 100, at least about 200, at least about 300, at least about 400, at least about 500, at least about 600, at least about 700, at least about 800, at least about 900, at least about 1000 cells that express similar or different phenotypes.

[0045] As used herein, the term "antibody" refers not only to intact antibody molecules, but also to fragments of antibody molecules that retain immunogen-binding ability. Such fragments are also well known in the art and are routinely used both in vitro and in vivo. Thus, as used herein, the term "antibody" refers not only to intact immunoglobulin molecules, but also to the well-known active fragments F(ab') 2 and Fab. F(ab') , which lacks the Fc fragment of an intact antibody. 2 And Fab fragments are cleared more rapidly from the circulation and may have less non-specific tissue binding than intact antibodies (Wahl et al., J. Nucl. Med. 24:316-325 (1983)). The antibodies of the present invention include whole natural antibodies, bispecific antibodies, chimeric antibodies, Fab, Fab', single chain V region fragments (scFv), fusion polypeptides and non-conventional antibodies. In certain embodiments, an antibody is a glycoprotein comprising at least two heavy (H) chains and two light (L) chains interconnected by disulfide bonds. Each heavy chain comprises a heavy chain variable region (herein referred to as V H ) and heavy chain constant (C H The heavy chain constant region is composed of three domains, CH1, CH2 and CH3. Each light chain comprises a light chain variable region (herein referred to as V L ) and light chain constant C L The light chain constant region consists of one domain, C L It consists of: V H and V LThe regions can be further subdivided into regions of hypervariability, called complementarity determining regions (CDRs), interspersed with regions that are more conserved, called framework regions (FRs). H and V L is composed of three CDRs and four FRs arranged in the following order from amino terminus to carboxy terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The variable regions of the heavy and light chains contain binding domains that interact with antigens. The constant region of the antibody can mediate the binding of immunoglobulins to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component of the classical complement system (C1q).

[0046] As used interchangeably herein, the terms "antigen-binding portion," "antigen-binding fragment," or "antigen-binding region" of an antibody refer to the region or portion of an antibody that binds to an antigen and confers antigen specificity to the antibody, and a fragment of an antigen-binding protein, e.g., an antibody, includes one or more fragments of an antibody that retain the ability to specifically bind to an antigen (e.g., a peptide / HLA complex). It has been shown that the antigen-binding function of an antibody can be performed by fragments of a full-length antibody. Examples of antigen-binding portions encompassed within the term "antibody fragment" of an antibody include Fab fragments, V and V fragments. L , V H , C L and a monovalent fragment consisting of the CH1 domain, F(ab) 2 a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region, V H and an Fd fragment consisting of the CH1 domain, a V L and V H Fv fragment consisting of domains, V H These include dAb fragments consisting of domains (Ward et al., 1989 Nature 341:544-546) as well as isolated complementarity determining regions (CDRs).

[0047] In addition, two domains of the Fv fragment, V L and V Hare encoded by separate genes, L and V H The antibody fragments can be linked using recombinant methods by synthetic linkers that allow the domains to be produced as a single protein chain that pairs to form monovalent molecules. These are known as single-chain Fvs (scFvs), see, e.g., Bird et al., 1988 Science 242:423-426, and Huston et al., 1988 Proc. Natl. Acad. Sci. 85:5879-5883. These antibody fragments can be synthesized using conventional techniques known to those of skill in the art. The fragments are obtained using the same techniques as are intact antibodies and the fragments screened for utility in the same manner as are intact antibodies.

[0048] As used herein, the term "single chain variable fragment" or "scFv" refers to a V H ::V L Covalently linked immunoglobulin (e.g., mouse or human) heavy chains (V H ) and light chain (V L ) is a fusion protein of the variable regions of the heavy chain (V H ) and light chain (V L ) directly bonded to V H N-terminus and V L or V H The C-terminus of L The extracellular antigen-binding domains are linked by a linker (e.g., about 10, 15, 20, 25 amino acids) that encodes a peptide connecting the N-terminus of the heavy chain variable region and the light chain variable region of the light chain variable region. The linker is usually glycine-rich for flexibility and serine- or threonine-rich for solubility. The linker can link the heavy chain variable region and the light chain variable region of the light chain variable region of the light chain variable region. In certain embodiments, the linker comprises amino acids having the sequence shown in SEQ ID NO: 11 as provided below. GGGGSGGGGSGGGGS [SEQ ID NO: 11]

[0049] In one particular embodiment, the nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:11 is shown in SEQ ID NO:12, provided below: GGCGGCGGCGGATCTGGAGGTGGTGGCTCAGGTGGCGGAGGCTCC [SEQ ID NO: 12]

[0050] Despite the removal of the constant region and the introduction of the linker, the scFv protein retains the specificity of the original immunoglobulin. Single-chain Fv polypeptide antibodies are characterized by the VFv domain as described by Huston, et al. (Proc. Nat. Acad. Sci. USA, 85:5879-5883, 1988). H and V L The scFvs can be expressed from nucleic acids containing sequences encoding the scFvs. See also U.S. Patent Nos. 5,091,513, 5,132,405, and 4,956,778, and U.S. Patent Application Publication Nos. 20050196754 and 20050196754. Antagonist scFvs with inhibitory activity have also been described (e.g., Zhao et al., Hyrbidoma (Larchmt) 2008 27(6):455-51; Peter et al., J Cachexia Sarcopenia Muscle 2012 August 12, Shieh et al., J Imunol2009 183(4):2277-85, Giomarelli et al., Thromb Haemost 2007 97(6):955-63, Fife eta., J Clin Invst 2006 116(8):2252-61, Brocks et al. al., Immunotechnology 1997 3(3):173-84; see also Moosmayer et al., Ther Immunol 1995 2(10:31-40) ). Agonistic scFvs with stimulatory activity have been described (e.g., Peter et al., J Bioi Chern 2003 25278(38):36740-7, Xie et al., Nat Biotech 1997 15(8):768-71, Ledbetter et al., Crit Rev Immunol1997 17(5-6):427-55, Ho et al. al., BioChim Biophys Acta 2003 1638(3):257-66).

[0051] As used herein, "F(ab)" refers to the fragment of an antibody structure that binds to an antigen but is monovalent and does not have the Fc portion; for example, digestion of an antibody with the enzyme papain results in two F(ab) fragments and an Fc fragment (e.g., heavy (H) chain constant region; the Fc region that does not bind to antigen).

[0052] As used herein, "F(ab') 2 "F(ab')" refers to an antibody fragment produced by pepsin digestion of a whole IgG antibody, which fragment has two antigen-binding (ab') (bivalent) regions, each (ab') region containing two separate amino acid chains, a portion of a heavy chain and a light (L) chain linked by an S-S bond for binding to the antigen, and the remaining portions of the heavy chains linked together. 2 The Fab' fragment can be separated into two individual Fab' fragments.

[0053] As used herein, the term "vector" refers to any genetic element, e.g., plasmid, phage, transposon, cosmid, chromosome, virus, virion, etc., which, when associated with the appropriate control elements, is capable of replication and of transferring genetic sequences into a cell. Thus, the term includes cloning and expression vehicles as well as viral and plasmid vectors.

[0054] As used herein, the term "expression vector" refers to a recombinant nucleic acid sequence, e.g., a recombinant DNA molecule, that contains a desired coding sequence and appropriate nucleic acid sequences necessary for the expression of the operably linked coding sequence in a particular host organism. Nucleic acid sequences necessary for expression in prokaryotes usually include a promoter, an operator (optional), and a ribosome binding site, often along with other sequences. Eukaryotic cells are known to utilize promoters, enhancers, and termination and polyadenylation signals.

[0055] As used herein, "CDR" is defined as the complementarity determining region amino acid sequences of an antibody that are the hypervariable regions of immunoglobulin heavy and light chains. See, for example, Kabat et al., Sequences of Proteins of Immunological Interest, 4th US Department of Health and Human Services, National Institutes of Health (1987). Generally, an antibody contains three heavy and three light chain CDRs or CDR regions in the variable region. CDRs provide the majority of contact residues for the binding of the antibody to an antigen or epitope. In certain embodiments, the CDR regions are delineated using the Kabat system (Kabat, EA, et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, US Department of Health and Human Services, National Institutes of Health). Services, NIH Publication No. 91-3242).

[0056] As used herein, the term "affinity" refers to a measure of binding strength. Without wishing to be bound by theory, affinity depends on the closeness of the stereochemical fit between the antibody binding site and the antigenic determinant, on the size of the area of ​​contact between them, and on the distribution of charged and hydrophobic groups. Affinity also includes the term "avidity", which refers to the strength of antigen-antibody binding after the formation of a reversible complex. Methods for calculating the affinity of an antibody to an antigen are known in the art and include the use of binding experiments to calculate affinity. Antibody activity in functional assays (e.g., flow cytometry assays) also reflects antibody affinity. Antibodies and affinities may be characterized phenotypically and compared using functional assays (e.g., flow cytometry assays).

[0057] The nucleic acid molecule useful in the subject matter of the present disclosure includes any nucleic acid molecule that encodes a polypeptide or a fragment thereof. In certain embodiments, the nucleic acid molecule useful in the subject matter of the present disclosure includes a nucleic acid molecule that encodes an antibody or an antigen-binding portion thereof. Such a nucleic acid molecule does not need to be 100% identical to an endogenous nucleic acid sequence, but usually shows substantial identity. A polynucleotide that has "substantial homology" or "substantial identity" to an endogenous sequence is usually capable of hybridizing with at least one strand of a double-stranded nucleic acid molecule. "Hybridizing" refers to the pairing of a double-stranded molecule between complementary polynucleotide sequences (e.g., genes described herein) or portions thereof under various conditions of stringency (see, for example, Wahl, GM and SL Berger (1987) Methods Enzymol. 152:399, Kimmel, AR (1987) Methods Enzymol. 152:507).

[0058] The term "substantially homologous" or "substantially identical" refers to a polypeptide or nucleic acid molecule that exhibits at least 50% homology or identity to a reference amino acid sequence (e.g., any one of the amino acid sequences described herein) or nucleic acid sequence (e.g., any one of the nucleic acid sequences described herein). For example, such a sequence is at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95% or even about 99% homologous (e.g., identical) at the amino acid level or nucleic acid to the sequence used for comparison.

[0059] Sequence homology or sequence identity is usually measured using sequence analysis software (e.g., the sequence analysis software package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705, BLAST, BESTFIT, GAP or PILEUP / PRETTYBOX programs). Such software matches identical or similar sequences by assigning degrees of various substitutions, deletions and / or other modifications. In an exemplary approach to determining the degree of identity, the BLAST program may be used, e.g. -3 from e-100 A probability score between indicates closely related sequences.

[0060] In certain embodiments, the term "cross-compete" or "compete" refers to a cross-competition between the binding of the extracellular antigen-binding domain of a CAR of the disclosure to a given antigen, e.g., between the V of any one of the scFvs of the disclosure. H and V L CDR1, CDR2 and CDR3 sequences or V H and V LThe term "cross-competing" or "competing" refers to a situation in which the binding of a reference antibody or its antigen-binding portion to a given antigen reduces or decreases the binding of the extracellular antigen-binding domain of the CAR of the present disclosure to the same antigen. In certain embodiments, the "cross-competing" or "competing" extracellular antigen-binding domain binds to the same or substantially the same epitope, overlapping epitope, or adjacent epitope as the reference antibody or its antigen-binding portion.

[0061] As used herein, the term "analog" refers to a structurally related polypeptide or nucleic acid molecule that has the function of a reference polypeptide or nucleic acid molecule.

[0062] As used herein, the term "ligand" refers to a molecule that binds to a receptor. In particular, a ligand binds to a receptor on another cell, allowing cell-to-cell recognition and / or interaction.

[0063] As used herein, the term "disease" refers to any condition or disorder that damages or interferes with the normal function of a cell, tissue or organ. Examples of diseases include neoplasms or pathogenic infection of cells.

[0064] An "effective amount" (or "therapeutically effective amount") is an amount sufficient to affect beneficial or desired clinical results during treatment. An effective amount can be administered to a subject in one or more doses. From a treatment perspective, an effective amount is an amount sufficient to palliate, improve, stabilize, reverse, or slow the progression of a disease (e.g., neoplasm), or otherwise reduce the pathological consequences of a disease (e.g., neoplasm). An effective amount is generally determined by a physician on a case-by-case basis and is within the skill of the art. When determining the appropriate dosage to achieve an effective amount, several factors are usually taken into consideration. These factors include the age, sex, and weight of the subject, the condition being treated, the severity of the condition, and the form and effective concentration of the immunoresponsive cells to be administered.

[0065] As used herein, the term "neoplasm" refers to a disease characterized by the pathological proliferation of cells or tissues and their subsequent migration to or invasion of other tissues or organs. Neoplastic growth is usually uncontrolled and progressive, occurring under conditions that do not induce or cause the cessation of proliferation of normal cells. Neoplasms can affect a variety of cell types, tissues or organs, including, but not limited to, organs or tissues or cell types thereof selected from the group consisting of bladder, colon, bone, brain, breast, cartilage, glia, esophagus, fallopian tube, gallbladder, heart, intestine, kidney, liver, lung, lymph node, nervous tissue, ovary, pleura, pancreas, prostate, skeletal muscle, skin, spinal cord, spleen, stomach, testes, thymus, thyroid, trachea, genitourinary tract, ureter, urethra, uterus and vagina. Neoplasms include cancers, such as sarcomas, carcinomas or plasmacytomas (malignant tumors of plasma cells).

[0066] As used herein, the term "heterologous nucleic acid molecule or polypeptide" refers to a nucleic acid molecule (e.g., a cDNA, DNA or RNA molecule) or polypeptide that is not normally present in a cell or a sample obtained from a cell. The nucleic acid may be from another organism, for example, an mRNA molecule that is not normally expressed in the cell or sample.

[0067] As used herein, the term "immunoresponsive cell" refers to a cell or its precursor or progeny that functions in an immune response.

[0068] The term "modulate" as used herein refers to altering, either positively or negatively. Exemplary modulations include changes of about 1%, about 2%, about 5%, about 10%, about 25%, about 50%, about 75% or about 100%.

[0069] As used herein, the term "increase" refers to a positive alteration of at least about 5%, including but not limited to, a positive alteration of about 5%, about 10%, about 25%, about 30%, about 50%, about 75% or about 100%.

[0070] As used herein, the term "reduce" refers to a negative alteration of at least about 5%, including but not limited to a negative alteration of about 5%, about 10%, about 25%, about 30%, about 50%, about 75% or about 100%.

[0071] As used herein, the term "isolated cell" refers to a cell that has been separated from the molecular and / or cellular components that naturally associate with the cell.

[0072] As used herein, the terms "isolated," "purified," or "biologically pure" refer to material that is more or less free from components that normally accompany it as found in its native state. "Isolate" indicates a degree of separation from the original source or surroundings. "Purify" indicates a degree of separation greater than isolation. A "purified" or "biologically pure" protein is sufficiently free from other materials such that any impurities do not substantially affect the biological properties of the protein or cause other adverse effects. That is, a nucleic acid or polypeptide of the subject matter of the present disclosure is purified when it is substantially free of cellular material, viral material, or culture medium when produced by recombinant DNA technology, or chemical precursors or other chemicals when chemically synthesized. Purity and homogeneity are usually determined using analytical chemistry techniques, such as polyacrylamide gel electrophoresis or high performance liquid chromatography. The term "purified" may indicate that the nucleic acid or protein gives rise to essentially one band in an electrophoretic gel. For proteins that may be subject to modifications, such as phosphorylation or glycosylation, the different modifications may give rise to different isolated proteins, which can be purified separately.

[0073] As used herein, the term "secreted" refers to a polypeptide that is released from a cell via the secretory pathway as vesicles that pass through the endoplasmic reticulum, the Golgi apparatus, and fuse transiently with the cell plasma membrane, releasing the protein outside the cell.

[0074] As used herein, the term "specifically binds" or "specifically binds to" or "specifically targets" refers to a polypeptide or fragment thereof that recognizes and binds to a biomolecule of interest (e.g., a polypeptide) in a sample, e.g., a biological sample that contains or expresses human Sialyl Lewis A, but does not substantially recognize or bind other molecules. For example, in some embodiments, an extracellular antigen-binding domain of a CAR described herein that interacts with a particular target (e.g., Sialyl Lewis A) in the presence of other potential targets is said to "specifically bind" to the interacting target (e.g., Sialyl Lewis A). In some embodiments, specific binding is assessed by detecting or determining the extent of association between the target binding moiety and its partner, in some embodiments, specific binding is assessed by detecting or determining the extent of dissociation of the target binding moiety-partner complex, and in some embodiments, specific binding is assessed by detecting or determining the ability of the target binding moiety to compete with an alternative interaction between its partner and another entity. In some embodiments, specific binding is assessed by performing such detection or determination over a range of concentrations.

[0075] As used herein, the term "treating" or "treatment" refers to clinical intervention that seeks to change the disease course of the individual or cell being treated, and can be performed either for prevention or during the course of clinical pathology. The therapeutic effects of treatment include, but are not limited to, prevention of disease occurrence or recurrence, alleviation of symptoms, reduction of direct or indirect pathological consequences of disease, prevention of metastasis, slowing the rate of disease progression, remission or alleviation of disease state, and remission or improvement of prognosis. By preventing the progression of disease or disorder, treatment can not only prevent the deterioration of the disorder in affected or diagnosed subjects or subjects suspected of having the disorder, but also may prevent the onset of the disorder or symptoms of the disorder in subjects at risk of the disorder or subjects suspected of having the disorder.

[0076] As used herein, the term "subject" refers to any animal (e.g., a mammal), including but not limited to humans, non-human primates, rodents, etc. (e.g., the recipient of a particular treatment or from which cells have been collected).

[0077] II. Sialyl Lewis A Sialyl Lewis A A , Sialyl Le A and SLe A , also known as CAS number 92448-22-1, is a tetrasaccharide that includes the sugar sequence NeuAc(a2-3)Gal(b1-3)[Fuc(a1-4)]GlcNAc. In certain embodiments, Le A includes the following formula: [ka]

[0078] Le A Le is present on the surface of certain cells and is involved in the cell-cell recognition process. A is a surface antigen that is expressed in 75-90% of tumors, for example pancreatic tumors, but its expression in normal human tissues is relatively low.

[0079] III. Chimeric Antigen Receptors (CARs) The present disclosure provides chimeric antigen receptors (CARs) that target cancer antigens. In many embodiments, the present disclosure provides CARs that target pancreatic cancer antigens, such as sialyl Lewis A.

[0080] CAR is an engineered receptor that transfers or confers a specificity of interest to immune effector cells. CAR can be used to transfer the specificity of monoclonal antibodies to T cells, with the transfer of its coding sequence facilitated by retroviral vectors.

[0081] There are three generations of CARs. "First generation" CARs are usually composed of an extracellular antigen-binding domain (e.g., single-chain variable fragment (scFv)) fused to a transmembrane domain, which is fused to the cytoplasmic / intracellular domain of a T cell receptor chain. "First generation" CARs usually have an intracellular domain derived from the CD3 ξ chain, which is the main transmitter of signals from the endogenous TCR. "First generation" CARs provide de novo antigen recognition and signal CD4 ζ through its CD3 ζ chain signaling domain in a single fusion molecule, independent of HLA-mediated antigen presentation. + and CD8 + "Second generation" CARs can induce both activation of T cells and activation of T cells. "Second generation" CARs add intracellular domains derived from various costimulatory molecules (e.g., CD28, 4-1BB, ICOS, OX40) to the cytoplasmic tail of the CAR to provide additional signals to T cells. "Second generation" CARs include those that provide both costimulation (e.g., CD28 or 4-1BB) and activation (CD3ζ). Preclinical studies have shown that "second generation" CARs can improve the antitumor activity of T cells. For example, robust efficacy of T cells modified by "second generation" CARs was demonstrated in clinical trials targeting the CD19 molecule in patients with chronic lymphoblastic leukemia (CLL) and acute lymphoblastic leukemia (ALL). "Third generation" CARs include those that provide multiple costimulation (e.g., CD28 and 4-1BB) and activation (CD3ζ). A person of skill in the art reading this disclosure will recognize that the CAR constructs provided herein can be first, second or third generation construct(s).

[0082] In certain non-limiting embodiments, the extracellular antigen-binding domain of the CAR of the present disclosure has high binding specificity as well as high binding affinity to human sialyl Lewis A. For example, in such embodiments, the extracellular antigen-binding domain of the CAR (e.g., embodied in a human scFv or analog thereof) has a binding specificity of about 2×10 to human sialyl Lewis A. -7 M or less dissociation constant (K d In certain embodiments, K dis about 2 x 10 -7 M or less, approximately 1 x 10 -7 M or less, about 5 x 10 -8 M or less, approximately 2 x 10 -8 M or less, approximately 1 x 10 -8 M or less, approx. 9 x 10 -9 or less, about 8 x 10 -9 or less, about 7 x 10 -9 or less, about 6 x 10 -9 or less, about 5 x 10 -9 or less, about 4 x 10 -9 or less, about 3 x 10 -9 or less, about 2 × 10 -9 or less or about 1 × 10 -9 In certain non-limiting embodiments, K d is about 2 x 10 -8 In certain non-limiting embodiments, K d is about 1 x 10 -8 M ~ approx. 2×10 -8 In certain non-limiting embodiments, K d is about 1.3 x 10 -8 In certain non-limiting embodiments, K d is about 1.8 x 10 -8 In certain non-limiting embodiments, K d is about 1 x 10 -9 M ~ approx. 1×10 -8 It's M.

[0083] Binding of the extracellular antigen-binding domain of the sialyl Lewis A-targeted CAR of the present disclosure (e.g., embodiments of a human scFv or analog thereof) can be confirmed, for example, by enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), FACS analysis, bioassay (e.g., growth inhibition), or Western blot assay. Each of these assays generally detects the presence of a protein-antibody complex of particular interest by using a labeled reagent (e.g., antibody or scFv) specific for the complex of interest. For example, scFvs can be radioactively labeled and used in a radioimmunoassay (RIA) (see, for example, Weintraub, B., Principles of Antibody-Specific Antibodies, 1997, 11:131-135, incorporated herein by reference). (See, for example, "Radioimmunoassays of Radioimmunoassays, Seventh Training Course on Radioligand Assay Techniques, The Endocrine Society, March, 1986"). Radioisotopes can be detected by means such as the use of a gamma counter or a scintillation counter, or by autoradiography. In certain embodiments, the extracellular antigen-binding domain of the sialyl Lewis A-targeted CAR is labeled with a fluorescent marker. Non-limiting examples of fluorescent markers include green fluorescent protein (GFP), blue fluorescent protein (e.g., EBFP, EBFP2, Azurite, and mKalama1), cyan fluorescent protein (e.g., ECFP, Cerulean, and CyPet), and yellow fluorescent protein (e.g., YFP, Citrine, Venus, and YPet). In certain embodiments, the human scFv of the sialyl Lewis A-targeted CAR of the present disclosure is labeled with GFP.

[0084] According to the subject matter of the present disclosure, the CAR comprises an extracellular antigen-binding domain, a transmembrane domain, and an intracellular domain, and the extracellular antigen-binding domain specifically binds to sialyl Lewis A (e.g., human sialyl Lewis A). In certain embodiments, the extracellular antigen-binding domain is an scFv. In certain embodiments, the extracellular antigen-binding domain is an optionally cross-linked Fab. In certain embodiments, the extracellular binding domain is an F(ab) 2 In certain embodiments, any of the above molecules may be included in a fusion protein with a heterologous sequence to form an extracellular antigen-binding domain. In certain embodiments, the extracellular antigen-binding domain comprises a human scFv that specifically binds to human sialyl Lewis A. In certain embodiments, the scFv is identified by screening an scFv phage library.

[0085] Extracellular antigen-binding domain of CAR In certain embodiments, the extracellular antigen-binding domain of a CAR described herein comprises a heavy variable region comprising one, two or three CDRs (e.g., CDR1, CDR2 and / or CDR3) of an anti-sialyl Lewis A antibody or antibody-binding fragment thereof, as disclosed in U.S. Patent No. 9,475,874 ("'874 patent"), the contents of which are incorporated by reference in their entirety for the purposes described herein. Additionally or alternatively, in certain embodiments, the extracellular antigen-binding domain of a CAR described herein comprises a light variable region comprising one, two or three CDRs (e.g., CDR1, CDR2 and / or CDR3) of an anti-sialyl Lewis A antibody or antibody-binding fragment thereof, as disclosed in the '874 patent, the contents of which are incorporated by reference in their entirety for the purposes described herein. For example, Table 2 of the '874 patent shows the amino acid and nucleic acid sequences of the CDRs in the heavy and light chains of such anti-sialyl Lewis A antibodies or antibody-binding fragments thereof. One of skill in the art reading this disclosure will understand that any such sequences may be used in accordance with the present disclosure.

[0086] In certain embodiments, the extracellular antigen-binding domain of a CAR described herein comprises (i) a heavy chain variable region of an anti-sialyl Lewis A antibody or antibody-binding fragment thereof as disclosed in the '874 patent, the contents of which are incorporated by reference in their entirety for the purposes described herein, and / or (ii) a light chain variable region of an anti-sialyl Lewis A antibody or antibody-binding fragment thereof as disclosed in the '874 patent. For example, Figures 1-10 of the '874 patent show the V and VF of such an anti-sialyl Lewis A antibody or antibody-binding fragment thereof. H and V L The amino acid sequence of is shown in Figure 1. It will be understood by one of skill in the art upon reading this disclosure that any such sequence may be used in accordance with the present disclosure. It will also be understood by one of skill in the art that suitable substitutions (e.g., conservative substitutions), deletions, insertions and / or modifications may also be made to such sequences, so long as the resulting sequence is at least 70% or more (e.g., at least 80%, at least 90%, at least 95%, at least 98%, at least 99% or more) identical to the corresponding parent sequence and retains the ability to specifically bind to sialyl Lewis A.

[0087] In certain embodiments, the extracellular antigen-binding domain (e.g., a human scFv) comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 7. An exemplary nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 7 is set forth in SEQ ID NO: 9. In certain embodiments, the extracellular antigen-binding domain (e.g., a human scFv) comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 8. An exemplary nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 8 is set forth in SEQ ID NO: 10. The sequences of SEQ ID NOs: 1-10 are set forth in Table 1 below.

[0088] In certain embodiments, the extracellular antigen-binding domain is a human scFv that specifically binds sialyl Lewis A (e.g., human sialyl Lewis A) and is designated scFv 5B1.

[0089] In certain embodiments, the extracellular antigen-binding domain is a human scFv. In certain embodiments, the extracellular antigen-binding domain comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 7, a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 8, and optionally has (iii) a linker sequence, e.g., a linker peptide, between the heavy chain variable region and the light chain variable region. In certain embodiments, the linker comprises the amino acid sequence set forth in SEQ ID NO: 11. In certain embodiments, the extracellular antigen-binding domain comprises a V H and V L The antibody is a human scFv-Fc fusion protein or a full-length human IgG having a region or CDR selected from Table 1.

[0090] In certain embodiments, the extracellular antigen-binding domain comprises an amino acid sequence that is at least about 80% (e.g., at least about 85%, at least about 90% or at least about 95%) homologous (e.g., identical) to the amino acid sequence set forth in SEQ ID NO:7, as shown in Table 1. H For example, the extracellular antigen-binding domain may comprise a V that comprises an amino acid sequence that is about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous (e.g., identical) to the amino acid sequence set forth in SEQ ID NO:7. H In certain embodiments, the extracellular antigen-binding domain comprises a V H In certain embodiments, the extracellular antigen-binding domain comprises a V that comprises an amino acid sequence that is at least about 80% (e.g., at least about 85%, at least about 90% or at least about 95%) homologous (e.g., identical) to the amino acid sequence set forth in SEQ ID NO:8, as shown in Table 1. LFor example, the extracellular antigen-binding domain comprises a V that comprises an amino acid sequence that is about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% homologous (e.g., identical) to the amino acid sequence set forth in SEQ ID NO:8. L In certain embodiments, the extracellular antigen-binding domain comprises a V L In certain embodiments, the extracellular antigen-binding domain comprises a V that comprises an amino acid sequence that is at least about 80% (e.g., at least about 85%, at least about 90% or at least about 95%) homologous (e.g., identical) to the amino acid sequence set forth in SEQ ID NO:7. H and V comprising an amino acid sequence that is at least about 80% (e.g., at least about 85%, at least about 90% or at least about 95%) homologous (e.g., identical) to the amino acid sequence set forth in SEQ ID NO:8. L In certain embodiments, the extracellular antigen-binding domain comprises a V H and V comprising the amino acid sequence shown in SEQ ID NO:8 L Includes.

[0091] In certain embodiments, the extracellular antigen-binding domain of a CAR described herein comprises at least one or more (e.g., one, two, or three) heavy chain variable regions (V) that specifically target Sialyl Lewis A. H For example, in some embodiments, the extracellular antigen-binding domain of a CAR described herein comprises at least one or more (e.g., one, two, or three) of the following: (i) a V CDR comprising the amino acid sequence set forth in SEQ ID NO:1, as shown in Table 1. H CDR1 or a conservative modification thereof, (ii) a V comprising the amino acid sequence shown in SEQ ID NO:2 H CDR2 or a conservative modification thereof and (iii) a V comprising the amino acid sequence shown in SEQ ID NO:3 HCDR3 or conservative modifications thereof. In certain embodiments, the extracellular antigen-binding domain comprises a V CDR3 comprising the amino acid sequence set forth in SEQ ID NO:1, as shown in Table 1. H CDR1 or a conservative modification thereof, V comprising the amino acid sequence shown in SEQ ID NO:2 H CDR2 or a conservative modification thereof and a V comprising the amino acid sequence shown in SEQ ID NO:3 H In certain embodiments, the extracellular antigen-binding domain comprises a V CDR3 or a conservative modification thereof. H CDR1, V comprising the amino acid sequence shown in SEQ ID NO:2 H CDR2 and V comprising the amino acid sequence shown in SEQ ID NO:3 H Includes CDR3.

[0092] In certain embodiments, the extracellular antigen-binding domain of a CAR described herein comprises at least one or more (e.g., one, two, or three) light chain variable regions (V) that specifically target sialyl Lewis A. L For example, in some embodiments, the extracellular antigen-binding domain of a CAR described herein comprises at least one or more (e.g., one, two, or three) of the following: (i) a V CDR comprising the amino acid sequence set forth in SEQ ID NO:4, as shown in Table 1. L CDR1 or a conservative modification thereof, (ii) a V comprising the amino acid sequence shown in SEQ ID NO:5 L CDR2 or a conservative modification thereof and (iii) a V comprising the amino acid sequence shown in SEQ ID NO:6 L CDR3 or conservative modifications thereof. In certain embodiments, the extracellular antigen-binding domain comprises a V CDR3 comprising the amino acid sequence set forth in SEQ ID NO:4, as shown in Table 1. L CDR1 or a conservative modification thereof, V comprising the amino acid sequence shown in SEQ ID NO:5 L CDR2 or a conservative modification thereof and V comprising the amino acid sequence shown in SEQ ID NO:6 L In certain embodiments, the extracellular antigen-binding domain comprises a V CDR3 or a conservative modification thereof. LCDR1, V comprising the amino acid sequence shown in SEQ ID NO:5 L CDR2 and V comprising the amino acid sequence shown in SEQ ID NO:6 L Includes CDR3.

[0093] In certain embodiments, the extracellular antigen-binding domain of the CAR described herein comprises the amino acid sequence set forth in SEQ ID NO:1. H CDR1 or a conservative modification thereof and a V comprising the amino acid sequence shown in SEQ ID NO:4 L In certain embodiments, the extracellular antigen-binding domain of the CAR described herein comprises a V CDR1 or a conservative modification thereof. H CDR2 or a conservative modification thereof and a V comprising the amino acid sequence shown in SEQ ID NO:5 L In certain embodiments, the extracellular antigen-binding domain of the CAR described herein comprises a V CDR2 or a conservative modification thereof. H CDR3 or a conservative modification thereof and a V comprising the amino acid sequence shown in SEQ ID NO:6 L CDR3 or conservative modifications thereof.

[0094] In certain embodiments, the extracellular antigen-binding domain of the CAR described herein comprises the amino acid sequence set forth in SEQ ID NO:1. H CDR1 or a conservative modification thereof, V comprising the amino acid sequence shown in SEQ ID NO:2 H CDR2 or a conservative modification thereof, V comprising the amino acid sequence shown in SEQ ID NO:3 H CDR3 or a conservative modification thereof, V comprising the amino acid sequence shown in SEQ ID NO:4 L CDR1 or a conservative modification thereof, V comprising the amino acid sequence shown in SEQ ID NO:5 L CDR2 or a conservative modification thereof and V comprising the amino acid sequence shown in SEQ ID NO:6 L CDR3 or conservative modifications thereof.

[0095] In certain embodiments, the extracellular antigen-binding domain comprises the amino acid sequence set forth in SEQ ID NO:1. H CDR1, V comprising the amino acid sequence shown in SEQ ID NO:2 H CDR2, comprising the amino acid sequence shown in SEQ ID NO:3 H CDR3, V comprising the amino acid sequence shown in SEQ ID NO:4 L CDR1, V comprising the amino acid sequence shown in SEQ ID NO:5 L CDR2 and V comprising the amino acid sequence shown in SEQ ID NO:6 L Includes CDR3.

[0096] In certain embodiments, the CDRs are presented below (eg, according to Kabat numbering): [Table 1]

[0097] As used herein, the term "conservative modification" or "conservative sequence modification" refers to an amino acid modification that does not significantly affect or alter the binding characteristics (e.g., specificity and / or affinity) of a CAR of the present disclosure (e.g., the extracellular antigen-binding domain of a CAR) that contains the amino acid sequence. Conservative modifications can include amino acid substitutions, additions, and deletions. Modifications can be introduced into the human scFv of a CAR of the present disclosure by standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. Amino acids can be classified into groups according to their physicochemical properties, such as charge and polarity. Conservative amino acid substitutions are those in which an amino acid residue is replaced with an amino acid within the same group. For example, amino acids can be classified by charge: positively charged amino acids include lysine, arginine, histidine, negatively charged amino acids include aspartic acid, glutamic acid, neutrally charged amino acids include alanine, asparagine, cysteine, glutamine, glycine, isoleucine, leucine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. Additionally, amino acids can be classified by polarity: polar amino acids include arginine (basic polar), asparagine, aspartic acid (acidic polar), glutamic acid (acidic polar), glutamine, histidine (basic polar), lysine (basic polar), serine, threonine, and tyrosine, and non-polar amino acids include alanine, cysteine, glycine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan, and valine. Thus, one or more amino acid residues in the CDR regions can be replaced with other amino acid residues from the same group, and the altered antibodies can be tested for retained function (i.e., the functions set forth in (c) through (l) above) using the functional assays described herein. In certain embodiments, no more than 1, no more than 2, no more than 3, no more than 4, no more than 5 residues in a given sequence or CDR region are altered.

[0098] For example, in some embodiments, the V Hand / or V L Conservative modifications of an amino acid sequence (e.g., SEQ ID NOs: 1-10 as shown in Table 1) are amino acid sequences that contain at least one or more (e.g., at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10 or more) substitutions (e.g., conservative substitutions), insertions and / or deletions relative to the specified sequence(s), but retain the ability to bind to Sialyl Lewis A (e.g., human Sialyl Lewis A) and have at least about 80%, at least about 85%, at least about 90% or at least about 95% (e.g., about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99%) homology or identity to the specified sequence. In some embodiments, the V H and / or V L Such conservative modifications of amino acid sequences (e.g., SEQ ID NOs: 1-10 as shown in Table 1) are equivalent to the corresponding unmodified V H and / or V L The extracellular antigen-binding domain retains at least 70% or more, including, for example, at least 80%, at least 90%, at least 95% or more, up to 100%, of the binding affinity of the amino acid sequence to Sialyl Lewis A. For example, in certain embodiments, the extracellular antigen-binding domain has a binding affinity to Sialyl Lewis A (e.g., human Sialyl Lewis A) of about 3×10 -8 or less binding affinity (K d In certain embodiments, the extracellular antigen-binding domain specifically binds to sialyl Lewis A (e.g., human sialyl Lewis A) at about 2×10 -8 or less binding affinity (K d In certain embodiments, the extracellular antigen-binding domain specifically binds to sialyl Lewis A (e.g., human sialyl Lewis A) at about 1.3×10 -8 or less binding affinity (K dIn certain embodiments, the extracellular antigen-binding domain specifically binds to sialyl Lewis A (e.g., human sialyl Lewis A) at about 1.8×10 -8 or less binding affinity (K d In certain embodiments, the extracellular antigen-binding domain specifically binds to sialyl Lewis A (e.g., human sialyl Lewis A) at about 1×10 -9 ~Approx. 1×10 -7 Binding affinity (K d In certain embodiments, the extracellular antigen-binding domain binds to sialyl Lewis A (e.g., human sialyl Lewis A) at about 1×10 -8 ~about 2×10 -8 Binding affinity (K d ) is bound to the extracellular antigen-binding domain. In certain embodiments, a total of 1 to 10 amino acids are substituted, inserted and / or deleted in SEQ ID NO: 7 or 8. In certain embodiments, the substitutions, insertions or deletions occur in regions outside the CDRs of the extracellular antigen-binding domain (e.g., in the FRs). A person skilled in the art reading Table 1 presented herein can identify and determine the amino acid and / or nucleic acid sequences of the framework regions (FRs) based on the sequence information provided. In certain embodiments, the extracellular antigen-binding domain is a V-type nucleotide sequence selected from the group consisting of SEQ ID NO: 7 and 8, including post-translational modifications of the sequence (SEQ ID NO: 7 or 8). H and / or V L Contains arrays.

[0099] As used herein, the percentage of homology between two amino acid sequences is equivalent to the percentage of identity between two sequences.The percentage of identity between two sequences is a function of the number of identical positions shared by sequences, taking into account the number of gaps that need to be introduced for optimal alignment of two sequences and the length of each gap (i.e., homology%=number of identical positions / total number of positions×100).Comparing sequences between two sequences and determining the percentage of identity can be achieved using mathematical algorithms.

[0100] The percent identity between two amino acid sequences was determined using the algorithm of E. Meyers and W. Miller (Comput. Appl. Biosci., 4:11-17 (1988)) implemented in the ALIGN program (version 2.0), using the PAM120 weight residue table, 1 A gap length penalty of 2 and a gap penalty of 4. Additionally, percent homology between two amino acid sequences can be determined using either a Blossum62 matrix or a PAM250 matrix and gap weights of 16, 14, 12, 10, 8, 6, or 4 and length weights of 1, 2, 3, 4, 5, or 6 using the Needleman and Wunsch (J. Mol. Biol. 48:444-453 (1970)) algorithm incorporated into the GAP program in the GCG software package (available at www.gcg.com).

[0101] Additionally, or alternatively, the amino acid sequences of the presently disclosed subject matter can be further used as a "query sequence" to perform a search against public databases, for example, to identify related sequences. Such searches can be performed using the XBLAST program (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403-10. BLAST protein searches can be performed with the XBLAST program, score=50, wordlength=3 to obtain amino acid sequences homologous to the specified sequences disclosed herein (e.g., the heavy and light chain variable region sequences of scFv m903, m904, m905, m906 and m900). To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res. 25(17):3389-3402. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used.

[0102] In certain embodiments, the extracellular antigen-binding domain of a CAR of the disclosure is selected from the group consisting of the V of any one of the scFvs of the disclosure for binding to sialyl Lewis A (e.g., human sialyl Lewis A). H CDR1, CDR2 and CDR3 sequences and V L In certain embodiments, the extracellular antigen-binding domain of a CAR of the present disclosure cross-competes with a reference antibody or an antigen-binding portion thereof comprising the CDR1, CDR2 and CDR3 sequences. H and V L The antibody or antigen-binding portion thereof cross-competes with a reference antibody or antigen-binding portion thereof comprising the sequence.

[0103] In certain embodiments, the extracellular antigen-binding domain of a CAR of the disclosure is selected from the V of scFv 5B1 for binding to sialyl Lewis A (e.g., human sialyl Lewis A). H CDR1, CDR2 and CDR3 sequences and V L It cross-competes with a reference antibody or an antigen-binding portion thereof comprising the CDR1, CDR2 and CDR3 sequences. For example, the extracellular antigen-binding domain of the CAR of the present disclosure comprises a V 1 -V 2 -V 3 -V 4 ​​-V 5 -V 6 -V 7 -V 8 -V 9 -V 10 -V 11 -V 12 -V 13 -V 14 -V 15 -V 16 -V 17 -V 18 -V 19 -V 20 -V 21 -V 22 -V 23 -V 24 -V 25 -V 26 -V 27 -V 28 -V 29 -V 30 -V 31 -V 32 -V 33 -V 29 -V 34 -V 35 -V 36 -V 37 -V 40 -V 41 -V 42 -V 43 -V H CDR1, V comprising the amino acid sequence shown in SEQ ID NO:2 H CDR2, comprising the amino acid sequence shown in SEQ ID NO:3 H CDR3, V comprising the amino acid sequence shown in SEQ ID NO:4 L CDR1, V comprising the amino acid sequence shown in SEQ ID NO:5 L CDR2 and V comprising the amino acid sequence shown in SEQ ID NO:6 L In certain embodiments, the extracellular antigen-binding domain of the CAR of the present disclosure cross-competes with the V of scFv 5B1 for binding to sialyl Lewis A. H and V LFor example, the extracellular antigen-binding domain of the CAR of the present disclosure may be a V antibody having the amino acid sequence shown in SEQ ID NO: 7 for binding to sialyl Lewis A. H and V comprising the amino acid sequence shown in SEQ ID NO:8 L or an antigen-binding portion thereof.

[0104] In certain embodiments, the extracellular antigen-binding domain binds to an epitope on sialyl Lewis A (e.g., human sialyl Lewis A) that is identical to or overlaps with a reference antibody or antigen-binding portion thereof. For example, the extracellular antigen-binding domain of a CAR of the present disclosure can be, for example, the V of any one of the scFvs of the present disclosure. H CDR1, CDR2 and CDR3 sequences and V L The CAR binds to an epitope on sialyl Lewis A (e.g., human sialyl Lewis A) that is identical to or overlaps with a reference antibody or antigen-binding portion thereof comprising CDR1, CDR2 and CDR3 sequences. In certain embodiments, the extracellular antigen-binding domain of a CAR of the present disclosure is, for example, the V of any one of the scFvs of the present disclosure. H and V L It binds to an epitope on Sialyl Lewis A (eg, human Sialyl Lewis A) that is identical to or overlaps with a reference antibody or antigen-binding portion thereof that comprises a sequence.

[0105] In certain embodiments, the extracellular antigen-binding domain of the CAR of the present disclosure is the V H CDR1, CDR2 and CDR3 sequences and V L It binds to an epitope on sialyl Lewis A (e.g., human sialyl Lewis A) that is identical to or overlaps with a reference antibody or antigen-binding portion thereof that comprises CDR1, CDR2 and CDR3 sequences. For example, the extracellular antigen-binding domain of the CAR of the present disclosure comprises a V H CDR1, V comprising the amino acid sequence shown in SEQ ID NO:2 H CDR2, comprising the amino acid sequence shown in SEQ ID NO:3 HCDR3, V comprising the amino acid sequence shown in SEQ ID NO:4 L CDR1, V comprising the amino acid sequence shown in SEQ ID NO:5 L CDR2 and V comprising the amino acid sequence shown in SEQ ID NO:6 L It binds to an epitope on sialyl Lewis A (e.g., human sialyl Lewis A) that is identical to or overlaps with a reference antibody or antigen-binding portion thereof that comprises a CDR3. In certain embodiments, the extracellular antigen-binding domain of the CAR of the present disclosure is the V H and V L The CAR of the present disclosure binds to an epitope on Sialyl Lewis A (e.g., human Sialyl Lewis A) that is identical or substantially identical to an epitope on Sialyl Lewis A (e.g., human Sialyl Lewis A) that is ... H and V comprising the amino acid sequence shown in SEQ ID NO:8 L The antibody or antigen-binding portion thereof comprises a reference antibody, comprising:

[0106] Extracellular antigen-binding domains that cross-compete or compete with a reference antibody or antigen-binding portion thereof for binding to sialyl Lewis A (e.g., human sialyl Lewis A) can be identified by using routine methods known in the art, including but not limited to ELISA, radioimmunoassay (RIA), Biacore, flow cytometry, Western blotting and any other suitable quantitative or qualitative antibody-binding assay. Competitive ELISA is described in Morris, "Epitope Mapping of Protein Antigens by Competition ELISA", The Protein Protocols Handbook (1996), pp 595-600, edited by J. Walker, which is incorporated by reference in its entirety. In certain embodiments, the antibody binding assay comprises measuring the initial binding of a reference antibody to sialyl Lewis A, mixing the reference antibody with a test extracellular antigen-binding domain, measuring the second binding of the reference antibody to sialyl Lewis A in the presence of the test extracellular antigen-binding domain, and comparing the initial binding of the reference antibody to the second binding, where a reduced second binding of the reference antibody to sialyl Lewis A compared to the initial binding indicates that the test extracellular antigen-binding domain cross-competes with the reference antibody for binding to sialyl Lewis A, e.g., recognizes the same or substantially the same epitope, an overlapping epitope, or an adjacent epitope. In certain embodiments, the reference antibody is labeled, e.g., with a fluorescent dye, biotin, or peroxidase. In certain embodiments, the sialyl Lewis A is expressed in cells, e.g., in flow cytometry tests. In certain embodiments, the sialyl Lewis A is immobilized on a surface that includes a Biacore ship (e.g., in a Biacore test) or other medium suitable for surface plasmon resonance analysis. Binding of the reference antibody in the presence of a completely unrelated antibody (that does not bind Sialyl Lewis A) can serve as a high control value. A low control value can be obtained by incubating a labeled reference antibody with an unlabeled reference antibody, resulting in competition and reduced binding of the labeled reference antibody.In certain embodiments, a test extracellular antigen-binding domain that reduces binding of the reference antibody to Sialyl Lewis A by at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or at least about 95% is considered to be an extracellular antigen-binding domain that cross-competes with the reference antibody for binding to Sialyl Lewis A. In certain embodiments, the assay is performed at room temperature.

[0107] In certain embodiments, the antibody-binding assay comprises measuring the initial binding of the test extracellular antigen-binding domain to sialyl Lewis A, mixing the test extracellular antigen-binding domain with a reference antibody, measuring the second binding of the test extracellular antigen-binding domain to a sialyl Lewis A polypeptide in the presence of the reference antibody, and comparing the initial binding of the test extracellular antigen-binding domain to the second binding, where a decreased second binding of the test extracellular antigen-binding domain to sialyl Lewis A compared to the initial binding indicates that the test extracellular antigen-binding domain cross-competes with the reference antibody for binding to sialyl Lewis A, e.g., recognizes the same or substantially the same epitope, overlapping epitope, or adjacent epitope. In certain embodiments, the test extracellular antigen-binding domain is labeled, e.g., with a fluorescent dye, biotin, or peroxidase. In certain embodiments, the sialyl Lewis A is expressed in cells, e.g., in a flow cytometry assay. In certain embodiments, sialyl Lewis A is immobilized on a surface, including a Biacore ship (e.g., in a Biacore test) or other medium suitable for surface plasmon resonance analysis. Binding of the test extracellular antigen-binding domain in the presence of a completely unrelated antibody (that does not bind to sialyl Lewis A) can serve as a high control value. A low control value can be obtained by incubating a labeled test extracellular antigen-binding domain with an unlabeled test extracellular antigen-binding domain, resulting in competition and reduced binding of the labeled test extracellular antigen-binding domain. In certain embodiments, a test extracellular antigen-binding domain whose binding to sialyl Lewis A is reduced by at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or at least about 95% in the presence of a reference antibody is considered to be an extracellular antigen-binding domain that cross-competes with the reference antibody for binding to sialyl Lewis A. In certain embodiments, the assay is performed at room temperature.

[0108] It is well known in the art that the CDR3 domain alone, independent of the CDR1 and / or CDR2 domain(s), can determine the binding specificity of an antibody or antigen-binding portion thereof to a cognate antigen, and that multiple antibodies with identical binding specificity can be predictably generated based on a common CDR3 sequence. See, for example, Klimka et al., British J. of Cancer 83(2):252-260 (2000) (describing the generation of a humanized anti-CD30 antibody using only the heavy chain variable domain CDR3 of the murine anti-CD30 antibody Ki-4), Beiboer et al., J. Mol. Bioi. 296:833-849 (2000) (describing the generation of a humanized anti-CD30 antibody using only the heavy chain variable domain CDR3 of the parent murine MOC-31 anti-EGFR antibody), and the CDR3 domain(s) can be used to generate a humanized anti-EGFR antibody. (describes a recombinant epithelial glycoprotein-2 (EGP-2) antibody that uses only the heavy chain CDR3 sequence of the P-2 antibody), Rader et al., Proc. Natl. Acad Sci. USA 95:8910-8915 (1998) (mouse anti-integrin α v β 3 Humanized anti-integrin alpha using the heavy and light chain variable CDR3 domains of the antibody LM609 v β 3 describes a panel of antibodies, each member antibody containing distinct sequences outside the CDR3 domain, capable of binding to the same epitope as the parent murine antibody, with affinity as high or higher than that of the parent murine antibody; Barbas et al., J. Am. Chem. Soc. 116:2161-2162 (1994) Natl. Acad Sci. USA 92:2529-2533 (1995) (disclosing that the DR3 domain provides the most significant contribution to antigen binding), Barbas et al., Proc. Natl. Acad Sci. USA 92:2529-2533 (1995) (describes the grafting of heavy chain CDR3 sequences of three Fabs against human germinal disc DNA (SI-1, SI-40 and SI-32) onto the heavy chain of an anti-tetanus toxoid Fab, thereby replacing the existing heavy chain CDR3 and demonstrating that the CDR3 domain alone conferred binding specificity), and Ditzel et al., J. Immunol. 157:739-749 (1996) (disclosing a single specific CDR3 domain that conferred binding specificity). (describes grafting studies in which transfer of only the heavy chain CDR3 of the parental polyspecific Fab LNA3 onto the heavy chain of the isomeric IgG tetanus toxoid-binding Fab p313 antibody was sufficient to retain the binding specificity of the parental Fab. Each of these references is hereby incorporated by reference in its entirety.

[0109] In certain embodiments, the extracellular antigen-binding domain of a CAR described herein comprises a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 3, a conservative modification of SEQ ID NO: 3, and / or a light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 6, or a conservative modification thereof. In some such embodiments, the extracellular antigen-binding domain may also comprise (i) a heavy chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 2, or a conservative modification thereof, and a light chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 5, or a conservative modification thereof, and / or (ii) a heavy chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 1, or a conservative modification thereof, and a light chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 4, or a conservative modification thereof.

[0110] In certain embodiments, the extracellular antigen-binding domain comprises the amino acid sequence set forth in SEQ ID NO:1. H CDR1, V comprising the amino acid sequence shown in SEQ ID NO:2 H CDR2, comprising the amino acid sequence shown in SEQ ID NO:3H CDR3, V comprising the amino acid sequence shown in SEQ ID NO:4 L CDR1, V comprising the amino acid sequence shown in SEQ ID NO:5 L CDR2, and V comprising the amino acid sequence shown in SEQ ID NO:6 L Includes CDR3.

[0111] Furthermore, in certain embodiments, the extracellular antigen-binding domain comprises a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO:3, or a conservative modification thereof, and a light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO:6, or a conservative modification thereof.

[0112] In certain embodiments, the extracellular antigen-binding domain comprises a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO:3, or a conservative modification thereof, and a light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO:6, or a conservative modification thereof.

[0113] The extracellular antigen-binding domain may further comprise a heavy chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO:2, or a conservative modification thereof, and a light chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO:5, or a conservative modification thereof.

[0114] In certain embodiments, the extracellular antigen-binding domain comprises a heavy chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO:2, or a conservative modification thereof, and a light chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO:5, or a conservative modification thereof.

[0115] The extracellular antigen-binding domain may further comprise a heavy chain variable region CDR1 comprising the amino acid sequence shown in SEQ ID NO:1, or a conservative modification thereof, and a light chain variable region CDR1 comprising the amino acid sequence shown in SEQ ID NO:4, or a conservative modification thereof.

[0116] In certain embodiments, the extracellular antigen-binding domain comprises a heavy chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO:1, or a conservative modification thereof, and a light chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO:4, or a conservative modification thereof.

[0117] In certain non-limiting embodiments, the extracellular antigen-binding domain of the CAR of the present disclosure may include a linker that connects the heavy chain variable region and the light chain variable region of the extracellular antigen-binding domain. As used herein, the term "linker" refers to a functional group (e.g., a chemical or polypeptide) that covalently attaches two or more polypeptides or nucleic acids so that they are connected to each other. As used herein, a "peptide linker" refers to a peptide linker that is used to link two proteins together (e.g., V H and V L Linker refers to one or more amino acids used to link (connect) domains. In certain embodiments, the linker comprises amino acids having a sequence set forth in SEQ ID NO:11. In certain embodiments, the nucleotide sequence encoding the amino acid sequence of SEQ ID NO:11 is set forth in SEQ ID NO:12.

[0118] In addition, the extracellular antigen-binding domain may contain a leader or signal peptide that directs the nascent protein to the endoplasmic reticulum. The signal peptide or leader may be essential if the CAR is glycosylated and anchored to the cell membrane. The signal sequence or leader may be a peptide sequence (about 5, about 10, about 15, about 20, about 25 or about 30 amino acids long) present at the N-terminus of the newly synthesized protein that directs its entry into the secretory pathway. In certain embodiments, the signal peptide is covalently linked to the 5' end of the extracellular antigen-binding domain. In certain embodiments, the signal peptide comprises a CD8 polypeptide comprising the amino acid sequence shown in SEQ ID NO: 13 as provided below. TAMALPVTALLLPLALLLHAARP [SEQ ID NO: 13]

[0119] An exemplary nucleotide sequence encoding the amino acid sequence of SEQ ID NO:13 is shown in SEQ ID NO:14, provided below: ACTGCCATGGCCCTGCCAGTAACGGCTCTGCTGCTGCCACTTGCTCTGCTCCTCCATGCAGCCAGGCCT[SEQ ID NO. 74]

[0120] Transmembrane domain of CAR In certain non-limiting embodiments, the transmembrane domain of the CAR comprises a hydrophobic alpha helix that spans at least a portion of the membrane. Different transmembrane domains result in different receptor stabilities. After antigen recognition, the receptors cluster and a signal is transmitted to the cell. In accordance with the subject matter of the present disclosure, the transmembrane domain of the CAR may comprise a natural or modified transmembrane domain of a CD8 polypeptide, a CD28 polypeptide, a CD3ζ polypeptide, a CD40 polypeptide, a 4-1BB polypeptide, an OX40 polypeptide, a CD84 polypeptide, a CD166 polypeptide, a CD8a polypeptide, a CD8b polypeptide, an ICOS polypeptide, an ICAM-1 polypeptide, a CTLA-4 polypeptide, a CD27 polypeptide, a CD40 / My88 polypeptide, an NKGD2 polypeptide, a synthetic polypeptide (not based on a protein associated with an immune response), or a combination thereof.

[0121] In certain embodiments, the transmembrane domain of a CAR of the present disclosure comprises a CD28 polypeptide. In certain embodiments, the transmembrane domain of a CAR of the present disclosure comprises a human CD28 polypeptide (e.g., a transmembrane domain of human CD28 or a portion thereof). The CD28 polypeptide may have an amino acid sequence that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99% or 100% homologous (e.g., identical) to a sequence having NCBI reference number P10747 or NP_006130 (SEQ ID NO: 15) or a fragment thereof, and / or may optionally include up to one or up to two or up to three conservative amino acid substitutions. In certain embodiments, the CD28 polypeptide may have an amino acid sequence that is a contiguous portion of SEQ ID NO: 15 that is at least 20 or at least 30 or at least 40 or at least 50 and up to 220 amino acids in length. Alternatively or additionally, in various non-limiting embodiments, the CD28 polypeptide has an amino acid sequence of amino acids 1-220, 1-50, 50-100, 100-150, 114-220, 150-200, or 200-220 of SEQ ID NO: 15. In certain embodiments, a CAR of the present disclosure comprises a transmembrane domain comprising a CD28 polypeptide, an intracellular domain comprising a costimulatory signaling region comprising a CD28 polypeptide. In certain embodiments, the CD28 polypeptide contained in the transmembrane domain and the intracellular domain comprises or has amino acids 114-220 of SEQ ID NO: 15.

[0122] SEQ ID NO:15 is provided below: [ka]

[0123] In accordance with the subject matter of this disclosure, a "CD28 nucleic acid molecule" refers to a polynucleotide that encodes a CD28 polypeptide. An exemplary nucleotide sequence encoding amino acids 114-220 of SEQ ID NO: 15 is set forth in SEQ ID NO: 16, provided below. [ka]

[0124] In certain embodiments, the transmembrane domain comprises a CD8 polypeptide (e.g., the transmembrane domain of CD28 or a portion thereof). The CD8 polypeptide may have an amino acid sequence that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% homologous to SEQ ID NO: 17 or a fragment thereof, and / or may optionally include up to one or up to two or up to three conservative amino acid substitutions. In certain embodiments, the CD8 polypeptide may have an amino acid sequence that is a contiguous portion of SEQ ID NO: 17 that is at least 20 or at least 30 or at least 40 or at least 50 and up to 235 amino acids in length. Alternatively or additionally, in various non-limiting embodiments, the CD8 polypeptide comprises or has amino acids 1-235, 1-50, 50-100, 100-150, 150-200 or 200-235 of SEQ ID NO: 17. [ka] [ka]

[0125] In accordance with the subject matter of this disclosure, a "CD8 nucleic acid molecule" refers to a polynucleotide that encodes a CD8 polypeptide.

[0126] In certain embodiments, the transmembrane domain of the CAR of the present disclosure comprises a native or modified transmembrane domain of a CD166 polypeptide. The CD166 polypeptide may have an amino acid sequence that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99% or 100% homologous to the sequence having NCBI reference number NP_001618.2 (SEQ ID NO: 18) or a fragment thereof, and / or may optionally include up to one or up to two or up to three conservative amino acid substitutions. In certain non-limiting embodiments, the CD166 polypeptide comprises or has an amino acid sequence that is a continuous portion of SEQ ID NO: 18 that is at least 20 or at least 30 or at least 40 or at least 50 and up to 583 amino acids in length. Alternatively or additionally, in various non-limiting embodiments, a CD166 polypeptide comprises or has an amino acid sequence of amino acids 1-583, 1-50, 50-100, 100-150, 150-200, 150-200, 200-250, 250-300, 300-350, 350-400, 400-450, 450-500, 528-553, 500-550, or 550-583 of SEQ ID NO: 18. In certain embodiments, a CD166 polypeptide comprised in a transmembrane domain of a CAR of the present disclosure comprises or has amino acids 528-553 of SEQ ID NO: 18.

[0127] SEQ ID NO:18 is provided below: [ka]

[0128] In accordance with the subject matter of this disclosure, a "CD166 nucleic acid molecule" refers to a polynucleotide that encodes a CD166 polypeptide. An exemplary nucleotide sequence encoding amino acids 528-553 of SEQ ID NO: 18 is set forth in SEQ ID NO: 19, provided below. CTAATTGTGGGAATCGTTGTTGGTCTCCTCCTTGCTGCCCTTGTTGCTGGTGTCGTCTACTGGCTGTACATGAAGAAG [SEQ ID NO: 19]

[0129] Hinge / Spacer Area In certain non-limiting embodiments, the CAR may also include a hinge / spacer region that links the extracellular antigen-binding domain to the transmembrane domain. The hinge / spacer region may be sufficiently flexible to allow the antigen-binding domain to be oriented in various directions to facilitate antigen recognition while retaining the activation activity of the CAR. In certain non-limiting embodiments, the hinge / spacer region may be a hinge region derived from IgG1, a CH of immunoglobulin, or a CAR-derived hinge region. 2 CH 3 The hinge / spacer region may be a portion of a CD3, a portion of a CD28 polypeptide (e.g., SEQ ID NO: 15), a portion of a CD8 polypeptide (e.g., SEQ ID NO: 17), a portion of a CD166 polypeptide (e.g., SEQ ID NO: 18), a variant of any of the foregoing that is at least about 80%, at least about 85%, at least about 90%, or at least about 95% homologous thereto, or a synthetic spacer sequence. In certain non-limiting embodiments, the hinge / spacer region may have a length of between about 1-50 (e.g., 5-25, 10-30, or 30-50) amino acids.

[0130] In certain embodiments, the hinge / spacer region of a CAR of the disclosure comprises a native or modified (e.g., with conservative modifications) hinge region of a CD166 polypeptide as described herein. In certain embodiments, the CD166 polypeptide comprised in the hinge / spacer region of a CAR of the disclosure comprises or has the amino acid sequence of amino acids 489-527 of SEQ ID NO: 18. An exemplary nucleotide sequence encoding amino acids 489-527 of SEQ ID NO: 18 is set forth in SEQ ID NO: 20, provided below. ACCAACTGGAGAGAACAGTAAACTCCTTGAATGTCTCTGCTATAAGTATTCCAGAACACGATGAGGCAGACGAGATAAGTGATGAAAACAGAGAAAAGGTGAATGACCAGGCAAAA [SEQ ID NO: 20]

[0131] CAR intracellular domain In certain non-limiting embodiments, the intracellular signaling domain of the CAR described herein comprises a CD3ζ polypeptide that can activate or stimulate a cell (e.g., a cell of lymphoid lineage, e.g., a T cell). Wild-type ("natural") CD3ζ comprises three immunoreceptor tyrosine-based activation motifs ("ITAMs") (e.g., ITAM1, ITAM2 and ITAM3), three basic-rich stretch (BRS) regions (BRS1, BRS2 and BRS3), and transmits an activation signal to a cell (e.g., a cell of lymphoid lineage, e.g., a T cell) after antigen binding. The intracellular signaling domain of the native CD3ζ chain is the main transmitter of signals from endogenous TCR. When used in the embodiments herein, CD3ζ is not a native CD3ζ but a modified CD3ζ. In certain embodiments, the intracellular signaling domain of a CAR of the present disclosure comprises a CD3ζ polypeptide disclosed in International Patent Application No. PCT / US2018 / 068134, filed December 31, 2018 (corresponding to International Publication No. WO2019 / 133969), the contents of which are incorporated by reference in their entirety for the purposes described herein.

[0132] In certain embodiments, the modified CD3ζ polypeptide comprises or has an amino acid sequence that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98% or about 99% homologous to the sequence having NCBI reference number NP_932170 (SEQ ID NO:21) or a fragment thereof. In certain non-limiting embodiments, the modified CD3ζ polypeptide comprises or has an amino acid sequence that is a contiguous portion of SEQ ID NO:21 that is at least 20 or at least 30 or at least 40 or at least 50 or at least 100 or at least 110 or at least 113 and up to 163 amino acids in length. Alternatively or additionally, in various non-limiting embodiments, the modified CD3ζ polypeptide comprises or has an amino acid sequence of amino acids 1-50, 50-100, 100-150, 50-164, 55-164 or 150-164 of SEQ ID NO:21. In certain embodiments, the modified CD3ζ polypeptide comprises or has the amino acid sequence of amino acids 52 to 164 of SEQ ID NO:21.

[0133] SEQ ID NO:21 is provided below: [ka]

[0134] In certain embodiments, the intracellular signaling domain of the CAR comprises a modified human CD3ζ polypeptide. The modified human CD3ζ polypeptide may comprise or have an amino acid sequence that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, or about 99% or about 100% homologous (e.g., identical) to SEQ ID NO: 22 or a fragment thereof, and / or may optionally include up to one or up to two or up to three conservative amino acid substitutions. SEQ ID NO: 22 is provided below: RVKFSRSADA PAYQQGQNQL YNELNLGRRE EYDVLDKRRG RDPEMGGKPR RKNPQEGLYN ELQKDKMAEA YSEIGMKGER RRGKGHDGLY QGLSTATKDT YDALHMQALP PR [SEQ ID NO: 22]

[0135] An exemplary nucleic acid sequence that encodes the amino acid sequence of SEQ ID NO:22 is shown in SEQ ID NO:23, provided below. [ka] [ka]

[0136] In certain embodiments, the intracellular signaling domain of the CAR comprises a modified CD3ζ polypeptide. In certain embodiments, the intracellular signaling domain of the CAR comprises a modified human CD3ζ polypeptide. In certain embodiments, the modified CD3ζ polypeptide comprises or has an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, at least about 100% homologous (e.g., identical) to SEQ ID NO:24 or a fragment thereof, and / or may optionally include up to one or up to two or up to three conservative amino acid substitutions. SEQ ID NO:24 is provided below: RVKFSRSADA PAYQQGQNQL YNELNLGRRE EYDVLDKRRG RDPEMGGKPR RKNPQEGLFN ELQKDKMAEA FSEIGMKGER RRGKGHDGLF QGLSTATKDT FDALHMQALP PR [SEQ ID NO: 24]

[0137] An exemplary nucleic acid sequence that encodes the amino acid sequence of SEQ ID NO:24 is shown in SEQ ID NO:25, provided below. [ka]

[0138] Immunoreceptor tyrosine-based activation motifs (ITAMs) In certain non-limiting embodiments, the intracellular signaling domain of the CAR comprises a modified CD3ζ polypeptide comprising one, two or three ITAMs. In certain embodiments, the modified CD3ζ polypeptide comprises a native ITAM1 comprising the amino acid sequence set forth in SEQ ID NO:26. QNQLYNELNLGRREEYDVLDKR [SEQ ID NO: 26]

[0139] An exemplary nucleic acid sequence that encodes the amino acid sequence of SEQ ID NO:26 is shown in SEQ ID NO:27, provided below. cagaaccagctctataacgagctcaatctagga cgaagagaggagtacgatgttttggacaagaga [SEQ ID NO: 27]

[0140] In certain embodiments, the modified CD3ζ polypeptide comprises an ITAM1 variant comprising one or more loss-of-function mutations. In certain embodiments, the modified CD3ζ polypeptide has an ITAM1 variant comprising two loss-of-function mutations. In certain embodiments, the loss-of-function mutation comprises a mutation of a tyrosine residue in ITAM1. In certain embodiments, the ITAM1 variant comprising two loss-of-function mutations comprises the amino acid sequence shown in SEQ ID NO: 28 provided below. QNQLFNELNLGRREEFDVLDKR [SEQ ID NO: 28]

[0141] An exemplary nucleic acid sequence that encodes the amino acid sequence of SEQ ID NO:28 is shown in SEQ ID NO:29, provided below. cagaaccagctctTtaacgagctcaatctagga cgaagagaggagtTcgatgttttggacaagaga [SEQ ID NO: 29]

[0142] In certain embodiments, the modified CD3ζ polypeptide comprises a native ITAM2 comprising the amino acid sequence set forth in SEQ ID NO:30, provided below. QEGLYNELQKDKMAEAYSEIGMK [SEQ ID NO: 30]

[0143] An exemplary nucleic acid sequence that encodes the amino acid sequence of SEQ ID NO:30 is shown in SEQ ID NO:31, provided below. caggaaggcctgtacaatgaactgcagaaagataagatggcggaggcctacagtgagattgggatgaaa [SEQ ID NO: 31]

[0144] In certain embodiments, the modified CD3ζ polypeptide comprises an ITAM2 variant comprising one or more loss-of-function mutations. In certain embodiments, the modified CD3ζ polypeptide has an ITAM2 variant comprising two loss-of-function mutations. In certain embodiments, the loss-of-function mutation comprises a mutation of a tyrosine residue in ITAM2. In certain embodiments, the ITAM2 variant comprising two loss-of-function mutations comprises the amino acid sequence shown in SEQ ID NO: 32 provided below. QEGLFNELQKDKMAEAFSEIGMK [SEQ ID NO: 32]

[0145] An exemplary nucleic acid sequence that encodes the amino acid sequence of SEQ ID NO:32 is shown in SEQ ID NO:33, provided below. caggaaggcctgtTcaatgaactgcagaaagataagatggcggaggcctTcagtgagattgggatgaaa [SEQ ID NO: 33]

[0146] In certain embodiments, the modified CD3ζ polypeptide comprises a native ITAM3 comprising the amino acid sequence set forth in SEQ ID NO:34, provided below. HDGLYQGLSTATKDTYDALHMQ [SEQ ID NO: 34]

[0147] An exemplary nucleic acid sequence that encodes the amino acid sequence of SEQ ID NO:34 is shown in SEQ ID NO:35, provided below. cacgatggcctttaccagggtctcagtacagccaccaaggacacctacgacgcccttcacatgcag [SEQ ID NO: 35]

[0148] In certain embodiments, the modified CD3ζ polypeptide comprises an ITAM3 variant comprising one or more loss-of-function mutations. In certain embodiments, the modified CD3ζ polypeptide has an ITAM3 variant comprising two loss-of-function mutations. In certain embodiments, the loss-of-function mutation comprises a mutation of a tyrosine residue in ITAM3. In certain embodiments, the ITAM3 variant comprising two loss-of-function mutations comprises the amino acid sequence shown in SEQ ID NO: 36 provided below. HDGLFQGLSTATKDTFDALHMQ [SEQ ID NO: 36]

[0149] An exemplary nucleic acid sequence that encodes the amino acid sequence of SEQ ID NO:36 is shown in SEQ ID NO:37, provided below. cacgatggccttTccaggggctcagtacagccaccaaggacacctTcgacgcccttcacatgcag[SEQ ID NO: 37]

[0150] In certain embodiments, the intracellular signaling domain of the CAR comprises a modified CD3ζ polypeptide that comprises, consists essentially of, or consists of an ITAM1 variant with one or more loss-of-function mutations, an ITAM2 variant with one or more loss-of-function mutations, an ITAM3 variant with one or more loss-of-function mutations, or a combination thereof. In certain embodiments, the intracellular signaling domain of the CAR comprises a modified CD3ζ polypeptide that comprises an ITAM2 variant with one or more (e.g., two) loss-of-function mutations and an ITAM3 variant with one or more (e.g., two) loss-of-function mutations. In certain embodiments, the intracellular signaling domain of the CAR comprises a modified CD3ζ polypeptide that comprises a native ITAM1, an ITAM2 variant that comprises or has two loss-of-function mutations, and an ITAM3 variant that comprises or has two loss-of-function mutations. In certain embodiments, the intracellular signaling domain of the CAR comprises a modified CD3ζ polypeptide comprising a native ITAM1 having the amino acid sequence set forth in SEQ ID NO: 26, an ITAM2 variant having the amino acid sequence set forth in SEQ ID NO: 32, and an ITAM3 variant having the amino acid sequence set forth in SEQ ID NO: 36. In certain embodiments, the modified CD3ζ polypeptide comprises or has the amino acid sequence set forth in SEQ ID NO: 24.

[0151] In certain embodiments, the intracellular signaling domain of the CAR comprises a modified CD3ζ polypeptide comprising an ITAM1 variant comprising one or more (e.g., two) loss-of-function mutations and an ITAM3 variant comprising one or more (e.g., two) loss-of-function mutations. In certain embodiments, the intracellular signaling domain of the CAR comprises a modified CD3ζ polypeptide comprising an ITAM1 variant comprising two loss-of-function mutations, a native ITAM2 and an ITAM3 variant comprising two loss-of-function mutations. In certain embodiments, the intracellular signaling domain of the CAR comprises a modified CD3ζ polypeptide comprising an ITAM1 variant having the amino acid sequence set forth in SEQ ID NO:28, a native ITAM2 having the amino acid sequence set forth in SEQ ID NO:30, and an ITAM3 variant having the amino acid sequence set forth in SEQ ID NO:36.

[0152] In certain embodiments, the intracellular signaling domain of the CAR comprises a modified CD3ζ polypeptide comprising an ITAM1 variant comprising one or more (e.g., two) loss-of-function mutations and an ITAM2 variant comprising one or more (e.g., two) loss-of-function mutations. In certain embodiments, the intracellular signaling domain of the CAR comprises a modified CD3ζ polypeptide comprising an ITAM1 variant comprising two loss-of-function mutations, an ITAM2 variant comprising two loss-of-function mutations, and a native ITAM3. In certain embodiments, the intracellular signaling domain of the CAR comprises a modified CD3ζ polypeptide comprising an ITAM1 variant having the amino acid sequence set forth in SEQ ID NO:28, an ITAM2 variant having the amino acid sequence set forth in SEQ ID NO:32, and a native ITAM3 having the amino acid sequence set forth in SEQ ID NO:34.

[0153] In certain embodiments, the intracellular signaling domain of the CAR comprises a modified CD3ζ polypeptide comprising an ITAM1 variant comprising one or more (e.g., two) loss-of-function mutations. In certain embodiments, the intracellular signaling domain of the CAR comprises a modified CD3ζ polypeptide comprising an ITAM1 variant comprising two loss-of-function mutations, a native ITAM2, and a native ITAM3. In certain embodiments, the intracellular signaling domain of the CAR comprises a modified CD3ζ polypeptide comprising an ITAM1 variant having the amino acid sequence set forth in SEQ ID NO:28, a native ITAM2 having the amino acid sequence set forth in SEQ ID NO:30, and a native ITAM3 having the amino acid sequence set forth in SEQ ID NO:34.

[0154] In certain embodiments, the intracellular signaling domain of the CAR comprises a modified CD3ζ polypeptide comprising a native ITAM1, a native ITAM2, and an ITAM3 variant comprising one or more (e.g., two) loss-of-function mutations. In certain embodiments, the intracellular signaling domain of the CAR comprises a modified CD3ζ polypeptide comprising a native ITAM1, a native ITAM2, and an ITAM1 variant comprising two loss-of-function mutations. In certain embodiments, the intracellular signaling domain of the CAR comprises a modified CD3ζ polypeptide comprising a native ITAM1 having the amino acid sequence set forth in SEQ ID NO:26, a native ITAM2 having the amino acid sequence set forth in SEQ ID NO:30, and an ITAM3 variant having the amino acid sequence set forth in SEQ ID NO:36.

[0155] In certain embodiments, the intracellular signaling domain of the CAR comprises a modified CD3ζ polypeptide comprising a native ITAM1, an ITAM2 variant comprising one or more (e.g., two) loss-of-function mutations, and a native ITAM3. In certain embodiments, the intracellular signaling domain of the CAR comprises a modified CD3ζ polypeptide comprising a native ITAM1, an ITAM2 variant comprising two loss-of-function mutations, and a native ITAM3. In certain embodiments, the intracellular signaling domain of the CAR comprises a modified CD3ζ polypeptide comprising a native ITAM1 having the amino acid sequence set forth in SEQ ID NO:26, an ITAM2 variant having the amino acid sequence set forth in SEQ ID NO:32, and a native ITAM3 having the amino acid sequence set forth in SEQ ID NO:34.

[0156] In certain embodiments, the intracellular signaling domain of CAR comprises a modified CD3ζ polypeptide comprising one or two deletions of ITAM. In certain embodiments, the modified CD3ζ polypeptide comprises deletions of ITAM1 and ITAM2, for example, the modified CD3ζ polypeptide comprises native ITAM3 or ITAM3 variant, and does not comprise ITAM1 and ITAM2. In certain embodiments, the modified CD3ζ polypeptide comprises native ITAM3 having the amino acid sequence shown in SEQ ID NO: 34, and does not comprise ITAM1 (native or modified) and ITAM2 (native or modified).

[0157] In certain embodiments, the modified CD3ζ polypeptide comprises a deletion of ITAM2 and ITAM3, for example, the modified CD3ζ polypeptide comprises a native ITAM1 or an ITAM1 variant, and does not comprise ITAM2 and ITAM3. In certain embodiments, the modified CD3ζ polypeptide comprises a native ITAM1 having the amino acid sequence set forth in SEQ ID NO:26, and does not comprise ITAM2 (native or modified) and ITAM3 (native or modified).

[0158] In certain embodiments, the modified CD3ζ polypeptide comprises a deletion of ITAM1 and ITAM3, for example, the modified CD3ζ polypeptide comprises a native ITAM2 or an ITAM2 variant, and does not comprise ITAM1 and ITAM3. In certain embodiments, the modified CD3ζ polypeptide comprises a native ITAM2 having the amino acid sequence set forth in SEQ ID NO: 30, and does not comprise ITAM1 (native or modified) and ITAM3 (native or modified).

[0159] In certain embodiments, the modified CD3ζ polypeptide comprises a deletion of ITAM1, for example, the modified CD3ζ polypeptide comprises a natural ITAM2 or ITAM2 variant and a natural ITAM3 or ITAM3 variant, and does not comprise ITAM1 (natural or modified). In certain embodiments, the modified CD3ζ polypeptide comprises a deletion of ITAM2, for example, the modified CD3ζ polypeptide comprises a natural ITAM1 or ITAM1 variant and a natural ITAM3 or ITAM3 variant, and does not comprise ITAM2 (natural or modified). In certain embodiments, the modified CD3ζ polypeptide comprises a deletion of ITAM3, for example, the modified CD3ζ polypeptide comprises a natural ITAM1 or ITAM1 variant and a natural ITAM2 or ITAM2 variant, and does not comprise ITAM3 (natural or modified).

[0160] Basic-rich stretch (BRS) region In certain non-limiting embodiments, the intracellular signaling domain of the CAR comprises a modified CD3ζ polypeptide comprising one, two or three BRS regions (i.e., BRS1, BRS2 and BRS3). The BRS regions can be native BRS or modified BRS (e.g., BRS variants). In certain embodiments, the modified CD3ζ polypeptide comprises a native BRS1 region comprising the amino acid sequence shown in SEQ ID NO:38 provided below. KRRGR [SEQ ID NO: 38]

[0161] An exemplary nucleic acid sequence that encodes the amino acid sequence of SEQ ID NO:38 is shown in SEQ ID NO:39, provided below. aagagacgtggccgg [SEQ ID NO: 39]

[0162] In certain embodiments, the modified CD3ζ polypeptide comprises a BRS1 variant that includes one or more loss-of-function mutations.

[0163] In certain embodiments, the modified CD3ζ polypeptide comprises a native BRS2 comprising the amino acid sequence set forth in SEQ ID NO:40. KPRRK [SEQ ID NO: 40]

[0164] An exemplary nucleic acid sequence that encodes the amino acid sequence of SEQ ID NO:40 is shown in SEQ ID NO:41, provided below. aagccgagaaggaag [SEQ ID NO: 41]

[0165] In certain embodiments, the modified CD3ζ polypeptide comprises a BRS2 variant that includes one or more loss-of-function mutations.

[0166] In certain embodiments, the modified CD3ζ polypeptide comprises a native BRS3 comprising the amino acid sequence set forth in SEQ ID NO:42. KGERRRGK [SEQ ID NO: 42]

[0167] An exemplary nucleic acid sequence that encodes the amino acid sequence of SEQ ID NO:42 is shown in SEQ ID NO:43, provided below. aaaggcgagcgccggaggggcaag [SEQ ID NO: 43]

[0168] In certain embodiments, the modified CD3 zeta polypeptide comprises a BRS3 variant that includes one or more loss-of-function mutations.

[0169] In certain embodiments, the intracellular signaling domain of the CAR comprises a modified CD3ζ polypeptide that includes all three BRS regions, i.e., the BRS1 region, the BRS2 region, and the BRS3 region. In certain embodiments, the intracellular signaling domain of the CAR comprises a modified CD3ζ polypeptide that includes native BRS1, native BRS2, ​​and native BRS3.

[0170] In certain embodiments, the intracellular signaling domain of CAR comprises a modified CD3ζ polypeptide comprising one or two but not all three BRS regions.In certain embodiments, the modified CD3ζ polypeptide comprises a BRS1 region and a BRS2 region, but does not comprise a BRS3 region.In certain embodiments, the modified CD3ζ polypeptide comprises a BRS1 region and a BRS3 region, but does not comprise a BRS2 region.In certain embodiments, the modified CD3ζ polypeptide comprises a BRS2 region and a BRS3 region, but does not comprise a BRS1 region.

[0171] In certain embodiments, the modified CD3ζ polypeptide comprises the BRS1 region and does not comprise the BRS2 region and the BRS3 region. In certain embodiments, the modified CD3ζ polypeptide comprises the BRS2 region and does not comprise the BRS1 region and the BRS3 region. In certain embodiments, the modified CD3ζ polypeptide comprises the BRS3 region and does not comprise the BRS1 region and the BRS2 region.

[0172] In certain embodiments, the modified CD3ζ polypeptide, e.g., the modified CD3ζ polypeptide contained in construct D12, does not contain a BRS region (natural or modified BRS1, BRS2 and BRS3), e.g., all three BRSs are deleted.

[0173] In certain non-limiting embodiments, the CAR comprises an extracellular antigen-binding domain, a transmembrane domain, and an intracellular signaling domain comprising a modified CD3ζ polypeptide, wherein the modified CD3ζ polypeptide lacks all or a portion of an immunoreceptor tyrosine-based activation motif (ITAM), and the ITAM is ITAM1, ITAM2, and ITAM3. In certain embodiments, the modified CD3ζ polypeptide lacks ITAM2 or a portion thereof. In certain embodiments, the modified CD3ζ polypeptide further lacks ITAM3 or a portion thereof. In certain embodiments, the modified CD3ζ polypeptide further lacks ITAM1 or a portion thereof. In certain embodiments, the modified CD3ζ polypeptide lacks ITAM1 or a portion thereof. In certain embodiments, the modified CD3ζ polypeptide further lacks ITAM3 or a portion thereof. In certain embodiments, the modified CD3ζ polypeptide lacks ITAM3 or a portion thereof. In certain embodiments, the modified CD3ζ polypeptide lacks all or part of the basic-rich stretch (BRS) region, the BRS region being BRS1, BRS2 and BRS3. In certain embodiments, the modified CD3ζ polypeptide lacks BRS2 or a portion thereof. In certain embodiments, the modified CD3ζ polypeptide further lacks BRS3 or a portion thereof. In certain embodiments, the modified CD3ζ polypeptide further lacks BRS1 or a portion thereof. In certain embodiments, the modified CD3ζ polypeptide lacks BRS1 or a portion thereof. In certain embodiments, the modified CD3ζ polypeptide further lacks BRS3 or a portion thereof. In certain embodiments, the modified CD3ζ polypeptide lacks BRS3 or a portion thereof. In certain embodiments, the modified CD3ζ polypeptide lacks BRS1 or a portion thereof, BRS2 or a portion thereof and BRS3 or a portion thereof. In certain embodiments, the modified CD3ζ polypeptide lacks ITAM2, ITAM3, BRS2 and BRS3.In certain embodiments, the CAR comprises an extracellular antigen-binding domain, a transmembrane domain, and an intracellular signaling domain comprising a modified CD3ζ polypeptide, wherein the modified CD3ζ polypeptide lacks all or a portion of a basic-rich stretch (BRS) region, and the BRS region is BRS1, BRS2, ​​and BRS3. In certain embodiments, the CAR comprises an extracellular antigen-binding domain, a transmembrane domain, and an intracellular signaling domain comprising a modified CD3ζ polypeptide, wherein the modified CD3ζ polypeptide comprises a BRS variant selected from a BRS1 variant, a BRS2 variant, and a BRS3 variant, and the BRS variant comprises one or more loss-of-function mutations.

[0174] Costimulatory domain In certain non-limiting embodiments, the intracellular domain of the CAR further comprises at least one costimulatory signaling region. In certain embodiments, the costimulatory signaling region comprises at least one costimulatory molecule or a portion thereof, which can provide optimal lymphocyte activation. As used herein, "costimulatory molecule" refers to a cell surface molecule other than an antigen receptor or its ligand, which is necessary for an efficient response of lymphocytes to antigens. The at least one costimulatory signaling region can include a CD28 polypeptide (e.g., an intracellular domain of CD28 or a portion thereof), a 4-1BB polypeptide (e.g., an intracellular domain of 4-1BB or a portion thereof), an OX40 polypeptide (e.g., an intracellular domain of OX40 or a portion thereof), an ICOS polypeptide (e.g., an intracellular domain of ICOS or a portion thereof), a DAP-10 polypeptide (e.g., an intracellular domain of DAP-10 or a portion thereof), or a combination thereof. A costimulatory molecule can bind to a costimulatory ligand, which is a protein expressed on the cell surface, which upon binding to its receptor, results in a costimulatory response, i.e., an intracellular response that causes stimulation when an antigen binds to its CAR molecule. Costimulatory ligands include, but are not limited to, CD80, CD86, CD70, OX40L, 4-1BBL, CD48, TNFRSF14, and PD-L1. As an example, 4-1BB ligand (i.e., 4-1BBL) can be used in combination with a CAR signal to stimulate CAR +It can bind to 4-1BB (also known as "CD137") to provide an intracellular signal that induces effector cell function of T cells. A CAR comprising an intracellular domain comprising a costimulatory signaling region comprising 4-1BB, ICOS or DAP-10 is disclosed in US 7,446,190, the entirety of which is incorporated herein by reference (e.g., in US 7,446,190, the nucleotide sequence encoding 4-1BB is set forth in SEQ ID NO: 15, the nucleotide sequence encoding ICOS is set forth in SEQ ID NO: 16, and the nucleotide sequence encoding DAP-10 is set forth in SEQ ID NO: 17). In certain embodiments, the intracellular domain of the CAR comprises a costimulatory signaling region comprising a CD28 polypeptide. In certain embodiments, the intracellular domain of the CAR comprises a costimulatory signaling region comprising two costimulatory molecules: CD28 and 4-1BB or CD28 and OX40.

[0175] 4-1BB may act as a tumor necrosis factor (TNF) ligand and have stimulatory activity. The 4-1BB polypeptide may have an amino acid sequence that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99% or 100% homologous (e.g., identical) to the sequence having NCBI reference number P41273 or NP_001552 (SEQ ID NO: 44) or a fragment thereof, and / or may optionally include up to one or up to two or up to three conservative amino acid substitutions.

[0176] SEQ ID NO:44 is provided below: [ka]

[0177] In accordance with the subject matter of this disclosure, a "4-1BB nucleic acid molecule" refers to a polynucleotide that encodes a 4-1BB polypeptide.

[0178] The OX40 polypeptide may have an amino acid sequence that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99% or 100% homologous (e.g., identical) to a sequence having NCBI reference number P43489 or NP_003318 (SEQ ID NO:45) or a fragment thereof, and / or may optionally include up to one or up to two or up to three conservative amino acid substitutions.

[0179] SEQ ID NO:45 is provided below: [ka]

[0180] In accordance with the subject matter of this disclosure, an "OX40 nucleic acid molecule" refers to a polynucleotide that encodes an OX40 polypeptide.

[0181] An ICOS polypeptide may have an amino acid sequence that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99% or 100% homologous (e.g., identical) to a sequence having NCBI reference number NP_036224 (SEQ ID NO:46) or a fragment thereof, and / or may optionally include up to one or up to two or up to three conservative amino acid substitutions.

[0182] SEQ ID NO:46 is provided below: [ka]

[0183] In accordance with the subject matter of this disclosure, an "ICOS nucleic acid molecule" refers to a polynucleotide that encodes an ICOS polypeptide.

[0184] In certain embodiments, the intracellular signaling domain of the CAR comprises a costimulatory signaling region comprising a CD28 polypeptide. In certain embodiments, the intracellular signaling domain of the CAR comprises the intracellular domain of human CD28 or a portion thereof. The CD28 polypeptide may comprise or have an amino acid sequence that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99% or 100% homologous (e.g., identical) to the amino acid sequence shown in SEQ ID NO: 15 or a fragment thereof, and / or may optionally comprise up to one or up to two or up to three conservative amino acid substitutions. In certain non-limiting embodiments, the CD28 polypeptide comprises or has an amino acid sequence that is a contiguous portion of SEQ ID NO: 15 that is at least 20 or at least 30 or at least 40 or at least 50 and up to 220 amino acids in length. Alternatively or additionally, in various non-limiting embodiments, the CD28 polypeptide comprises or has the amino acid sequence of amino acids 1-220, 1-50, 50-100, 100-150, 114-220, 150-200, or 200-220 of SEQ ID NO: 15. In certain embodiments, the intracellular signaling domain of the CAR comprises a costimulatory signaling region that comprises a CD28 polypeptide that comprises or has the amino acid sequence of amino acids 180-220 of SEQ ID NO: 15.

[0185] In certain embodiments, the intracellular signaling domain of the CAR comprises the intracellular domain of mouse CD28 or a portion thereof. In certain embodiments, the CD28 polypeptide comprises or has an amino acid sequence that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% homologous to the sequence having NCBI reference number NP_031668.3 (SEQ ID NO: 47) or a fragment thereof, and / or may optionally comprise up to one or up to two or up to three conservative amino acid substitutions. In certain non-limiting embodiments, the CD28 polypeptide comprises or has an amino acid sequence that is a continuous portion of SEQ ID NO: 47 that is at least about 20 or at least about 30 or at least about 40 or at least about 50 and up to 218 amino acids in length. Alternatively or additionally, in various non-limiting embodiments, a CD28 polypeptide comprises or has an amino acid sequence of amino acids 1-218, 1-50, 50-100, 100-150, 114-220, 150-200, 178-218, or 200-220 of SEQ ID NO: 47. In certain embodiments, a costimulatory signaling region of a CAR of the disclosure comprises a CD28 polypeptide that comprises or has amino acids 178-218 of SEQ ID NO:47.

[0186] SEQ ID NO:47, provided below: [ka]

[0187] In accordance with the subject matter of this disclosure, a "CD28 nucleic acid molecule" refers to a polynucleotide that encodes a CD28 polypeptide. An exemplary nucleotide sequence encoding amino acids 178-218 of SEQ ID NO:47 is set forth in SEQ ID NO:48, provided below. [ka]

[0188] In certain embodiments, the intracellular signaling domain of the CAR comprises the intracellular domain of mouse CD28 or a portion thereof. The intracellular domain of mouse CD28 may comprise or have an amino acid sequence that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% homologous (e.g., identical) to SEQ ID NO: 49 or a fragment thereof, and / or may optionally include up to one or up to two or up to three conservative amino acid substitutions. SEQ ID NO: 49 is provided below: NSRRNRLLQS DYMNMTPRRP GLTRKPYQPY APARDFAAYR P [SEQ ID NO: 49]

[0189] An exemplary nucleic acid sequence that encodes the amino acid sequence of SEQ ID NO:49 is shown in SEQ ID NO:50, provided below. AATAGTAGAAGGAACAGACTCCTTCAAAGTGACTACATGAACATGACTCCCCGGAGGCCTGGGCTCACTCGAAAGCCTTACCAGCCCTACGCCCCTGCCAGAGACTTTGCAGCGTACCGCCCC [SEQ ID NO: 50]

[0190] In certain embodiments, the intracellular signaling domain of the CAR comprises the intracellular domain of human CD28 or a portion thereof. The intracellular domain of human CD28 may comprise or have an amino acid sequence that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% homologous (e.g., identical) to SEQ ID NO: 51 or a fragment thereof, and / or may optionally include up to one or up to two or up to three conservative amino acid substitutions. SEQ ID NO: 51 is provided below; RSKRSRLLHS DYMNMTPRRP GPTRKHYQPY APPRDFAAYR S [SEQ ID NO: 51]

[0191] An exemplary nucleic acid sequence that encodes the amino acid sequence of SEQ ID NO:51 is shown in SEQ ID NO:52, provided below. AGGAGTAAGAGGAGCAGGCTCCTGCACAGTGACTACATGAACATGACTCCCCGCCGCCCCGGGCCCACCCGCAAGCATTACCAGCCCTATGCCCCACCACGCGACTTCGCAGCCTATCGCTCC [SEQ ID NO: 52]

[0192] In certain embodiments, mutation sites and / or junctions between domains / motifs / regions of CARs derived from different proteins are deimmunized. The immunogenicity of the junctions between different CAR parts can be predicted using the NetMHC4.0 server. For each peptide that contains at least one amino acid from the following parts, the binding affinity to HLA A, B and C can be predicted for all alleles. For each peptide, a score of immunogenicity of each peptide can be assigned. The immunogenicity score is calculated according to the formula: Immunogenicity score = [(50-binding affinity) * HLA frequency] n where n is the expected number of each peptide.

[0193] In certain embodiments, the CAR comprises an extracellular antigen-binding region comprising a human scFv that specifically binds human sialyl Lewis A, a transmembrane domain comprising a CD28 polypeptide, a CD8 polypeptide or a CD166 polypeptide, and an intracellular domain comprising a costimulatory signaling region comprising a wild-type or modified CD3ζ polypeptide and a CD28 polypeptide or a 4-1BB polypeptide. The CAR also comprises a signal peptide or leader covalently linked to the 5' end of the extracellular antigen-binding domain. The signal peptide comprises an amino acid having a sequence as set forth in SEQ ID NO: 13. In certain embodiments, the human scFv is scFv 5B1, the variable region sequence of which is provided in Table 1.

[0194] In some embodiments, the CAR of the present disclosure further comprises an inducible promoter for expressing the nucleic acid sequence in human cells. The promoter for use in expressing the CAR gene can be a constitutive promoter, such as the ubiquitin C (UbiC) promoter.

[0195] The subject matter of the present disclosure also provides a nucleic acid molecule encoding a sialyl Lewis A-targeted CAR or a functional portion thereof described herein. In certain embodiments, the nucleic acid molecule encodes a sialyl Lewis A-targeted CAR of the present disclosure comprising a human scFv that specifically binds to human sialyl Lewis A, a transmembrane domain comprising a CD28 polypeptide, a CD8 polypeptide, or a CD166 polypeptide, and an intracellular domain comprising a wild-type or modified CD3ζ polypeptide and a costimulatory signaling region comprising a CD28 polypeptide or a 4-1BB polypeptide.

[0196] In certain embodiments, the nucleic acid molecule encodes a sialyl Lewis A targeted CAR comprising a human scFv comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:7, a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:8, and a linker having the amino acid sequence set forth in SEQ ID NO:11 positioned between the heavy chain variable region and the light chain variable region, a transmembrane domain comprising a CD28 polypeptide, a CD8 polypeptide, or a CD166 polypeptide, and an intracellular domain comprising a costimulatory signaling region comprising a wild-type or modified CD3ζ polypeptide and a CD28 polypeptide or a 4-1BB polypeptide.

[0197] In certain embodiments, the nucleic acid molecule encodes a functional portion of the sialyl Lewis A-targeted CAR of the present disclosure. As used herein, the term "functional portion" refers to any portion, part, or fragment of the sialyl Lewis A-targeted CAR of the present disclosure that retains the biological activity of the sialyl Lewis A-targeted CAR (parent CAR). For example, a functional portion encompasses a portion, part, or fragment of the sialyl Lewis A-targeted CAR of the present disclosure that retains the ability to recognize target cells and treat disease to the same or even greater extent than the parent CAR. In certain embodiments, an isolated nucleic acid molecule encoding a functional portion of the sialyl Lewis A-targeted CAR of the present disclosure may encode a protein that comprises, for example, about 10%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90% and about 95% or more of the parent CAR.

[0198] V. Immunoresponsive Cells The subject matter of the present disclosure provides a cell comprising the sialyl Lewis A targeting CAR of the present disclosure and a method of using such a cell to treat malignant growth, for example, to treat cancer, for example, pancreatic cancer.For example, in some embodiments, a T cell comprising the chimeric antigen receptor that recognizes the sialyl Lewis A disclosed herein is provided herein.Such a cell is administered to a human subject in need thereof to treat and / or prevent the malignant growth of tumor, for example, solid tumor, for example, pancreatic cancer.

[0199] In some embodiments, the CAR described herein can be delivered to an immunoresponsive cell by suitable means known to those skilled in the art. For example, in some embodiments, the CAR described herein can be delivered to an immunoresponsive cell by a vector or other delivery vehicle. In some embodiments, the CAR described herein can be delivered to an immunoresponsive cell in the form of an RNA (e.g., mRNA) construct. In some embodiments, an immunoresponsive cell can be transduced with a CAR of the present disclosure by a viral vector (e.g., a retroviral vector) so that the cell expresses the CAR. The subject matter of the present disclosure also provides a method of using such cells for the treatment of tumors or solid tumors, such as pancreatic cancer.

[0200] The immunoresponsive cells of the presently disclosed subject matter can be cells of the lymphoid lineage. The lymphoid lineage, including B, T and natural killer (NK) cells, provide for the production of antibodies, regulation of the cell-mediated immune system, detection of foreign substances in the blood, detection of cells foreign to the host, and the like. Non-limiting examples of immunoresponsive cells of the lymphoid lineage include T cells, natural killer (NK) cells, embryonic stem cells and pluripotent stem cells (e.g., from which lymphoid cells can be differentiated). T cells can be lymphocytes that mature in the thymus and are primarily responsible for cell-mediated immunity. T cells are involved in the adaptive immune system. T cells of the presently disclosed subject matter can be, but are not limited to, helper T cells, cytotoxic T cells, memory T cells (central memory T cells, Stem cell-like memory T cells (or stem-like memory T cells) and two types of effector memory T cells: e.g., T EM Cells and T EMRA The T cells may be of any type, including T cells, regulatory T cells (also known as suppressor T cells), natural killer T cells, mucosal-associated invariant T cells, and γδ T cells. Cytotoxic T cells (CTL or killer T cells) are a subset of T lymphocytes that can induce the death of infected somatic or tumor cells. The patient's own T cells may be genetically modified to target specific antigens by introduction of any of the polypeptides or systems disclosed herein. T cells may be CD4+ T cells or CD8 + In certain embodiments, the T cells are CD4 + In certain embodiments, the T cells are CD8 + T cells.

[0201] In certain embodiments, T cells expressing a CAR express Foxp3 to achieve and maintain a T regulatory phenotype.

[0202] In certain embodiments, the cell is a natural killer cell. Natural killer (NK) cells can be lymphocytes that are part of cell-mediated immunity and act during natural immune response. NK cells do not require prior activation to exert their cytotoxic effect on target cells.

[0203] The immunoresponsive cells of the presently disclosed subject matter include an extracellular antigen-binding domain (e.g., a human scFV, optionally cross-linked Fab or F(ab)) that specifically binds sialyl Lewis A (e.g., human sialyl Lewis A) for the treatment of cancer, e.g., pancreatic cancer. 2 ). Such immunoresponsive cells can be administered to a subject (e.g., a human subject) in need thereof for the treatment of cancer. In certain embodiments, the immunoresponsive cells are T cells. T cells can express CD4 + T cells or CD8 + In certain embodiments, the T cells are CD4 + In certain embodiments, the T cells are CD8 + T cells.

[0204] The immunoresponsive cells of the present disclosure may further comprise at least one recombinant or exogenous costimulatory ligand. For example, the immunoresponsive cells of the present disclosure may be further transduced with at least one costimulatory ligand, so that the immunoresponsive cells co-express or are induced to co-express the sialyl Lewis A-targeted CAR and at least one costimulatory ligand. The interaction between the sialyl Lewis A-targeted CAR and at least one costimulatory ligand provides a non-antigen-specific signal that is important for the full activation of the immunoresponsive cells (e.g., T cells). Costimulatory ligands include, but are not limited to, members of the tumor necrosis factor (TNF) superfamily and immunoglobulin (Ig) superfamily ligands. TNF is a cytokine involved in systemic inflammation and stimulates the acute phase response. Its main role is in regulating immune cells. Members of the TNF superfamily share several common characteristics. The majority of TNF superfamily members are synthesized as type II transmembrane proteins (extracellular C-terminus) that contain a short cytoplasmic segment and a relatively long extracellular region. TNF superfamily members include, but are not limited to, nerve growth factor (NGF), CD40L (CD40L) / CD154, CD137L / 4-1BBL, TNF-α, CD134L / OX40L / CD252, CD27L / CD70, Fas Ligand (FasL), CD30L / CD153, tumor necrosis factor beta (TNFβ) / lymphotoxin-alpha (LTα), lymphotoxin-beta (LTβ), CD257 / B cell activating factor (BAFF) / Blys / THANK / Tall-1, glucocorticoid-inducible TNF receptor ligand (GITRL) and TNF-related apoptosis-inducing ligand (TRAIL), LIGHT (TNFSF14). The immunoglobulin (Ig) superfamily is a large group of cell surface and soluble proteins involved in cell recognition, binding or adhesion processes. These proteins share structural features with immunoglobulins--they have immunoglobulin domains (folds).Immunoglobulin superfamily ligands include, but are not limited to, CD80 and CD86, both of which are ligands for CD28, and PD-L1 / (B7-H1), which is a ligand for PD-1. In certain embodiments, the at least one costimulatory ligand is selected from the group consisting of 4-1BBL, CD80, CD86, CD70, OX40L, CD48, TNFRSF14, PD-L1, and combinations thereof. In certain embodiments, the immunoresponsive cell comprises one recombinant costimulatory ligand, which is 4-1BBL. In certain embodiments, the immunoresponsive cell comprises two recombinant costimulatory ligands, which are 4-1BBL and CD80. Immunoresponsive cells comprising a CAR and at least one recombinant costimulatory ligand are described in U.S. Patent No. 8,389,282 and U.S. Patent Publication No. 2016 / 0045551, both of which are incorporated by reference in their entirety. In certain embodiments, the immunoresponsive cell comprises a sialyl Lewis A-targeted CAR of the present disclosure and a recombinant cytokine (e.g., IL-12). In certain embodiments, the immunoresponsive cell comprises a sialyl Lewis A-targeted CAR of the present disclosure and a recombinant CD40L polypeptide.

[0205] In addition, the immunoresponsive cells of the present disclosure may further comprise at least one exogenous cytokine. For example, the immunoresponsive cells of the present disclosure may further be transduced with at least one cytokine, so that the immunoresponsive cells secrete at least one cytokine and express sialyl Lewis A targeting CAR. In certain embodiments, the at least one cytokine is selected from the group consisting of IL-2, IL-3, IL-6, IL-7, IL-11, IL-12, IL-15, IL-17 and IL-21. In certain embodiments, the cytokine is IL-12.

[0206] Sialyl Lewis A-specific or sialyl Lewis A-targeted human lymphocytes can be used in peripheral donor lymphocytes, e.g., Sadelain, M., et al. 2003 Nat Rev Cancer 3:35-45 (Peripheral donor lymphoma genetically engineered to express CAR (discloses lymphocytes), as disclosed in Morgan, RA, et al. 2006 Science 314:126-129 (disclosing peripheral donor lymphocytes genetically modified to express a full-length tumor antigen-recognizing T cell receptor complex containing α and β heterodimers), Panelli, MC, et al. 2000 J Immunol 164:495-504, Panelli, MC, et al. 2000 J Immunol 164:4382-4392 (disclosing lymphocyte cultures derived from tumor infiltrating lymphocytes (TILs) in tumor biopsies) and those disclosed in Dupont, J., et al. 2005 Cancer Res 65:5417-5427, Papanicolaou, GA, et al. 2003 Blood 102:2498-2505. (discloses selectively in vitro expanded antigen-specific peripheral blood leukocytes using artificial antigen presenting cells (AAPCs) or pulsed dendritic cells). The immunoresponsive cells (e.g., T cells) can be autologous, non-autologous (e.g., allogeneic), or derived in vitro from engineered precursor or stem cells.

[0207] In certain embodiments, immunoresponsive cells (e.g., T cells) of the disclosure express about 1 to about 5, about 1 to about 4, about 2 to about 5, about 2 to about 4, about 3 to about 5, about 3 to about 4, about 4 to about 5, about 1 to about 2, about 2 to about 3, about 3 to about 4, or about 4 to about 5 vector copy numbers / cell of a Sialyl Lewis A-targeted CAR of the disclosure.

[0208] Additionally, the immunoresponsive cell may contain and express (e.g., naturally express or be engineered to express) an antigen-recognizing receptor that binds to a second antigen different from sialyl Lewis A (e.g., human sialyl Lewis A). By including an antigen-recognizing receptor in addition to the CAR of the present disclosure on the immunoresponsive cell, the avidity of the CAR or the immunoresponsive cell that includes it on the targeted cell may be increased, particularly if the CAR has a low binding affinity for sialyl Lewis A (e.g., human sialyl Lewis A), e.g., about 2×10 -8 M or larger, approximately 5 x 10 -8 M or larger, approximately 8 x 10 -8 M or larger, approx. 9 x 10 -8 M or larger, approximately 1×10 -7 M or larger, approximately 2 x 10 -7 M or larger, or about 5 x 10 -7 M or larger K d It has the following characteristics.

[0209] In certain embodiments, the antigen-recognizing receptor is a chimeric costimulatory receptor (CCR). As used herein, the term "chimeric costimulatory receptor" or "CCR" refers to a chimeric receptor that binds to an antigen and provides a costimulatory signal but does not provide a T cell activation signal. CCRs are described in Krause, et al., J. Exp. Med. (1998);188(4):619-626 and US20020018783, the contents of which are incorporated by reference in their entirety. CCRs mimic costimulatory signals, but unlike CARs, do not provide T cell activation signals, e.g., CCRs lack the CD3ζ polypeptide. CCRs provide costimulation, e.g., CD28-like signals, in the absence of natural costimulatory ligands on antigen-presenting cells. Combinatorial antigen recognition, i.e., the use of CCRs in combination with CARs, can enhance T cell reactivity to dual antigen-expressing T cells, thereby improving selective tumor targeting. Kloss et al. describe a strategy that integrates the balanced forces of combinatorial antigen recognition, split signaling, and importantly, T cell activation and costimulation to generate T cells that eliminate target cells expressing combinations of antigens while sparing cells expressing each antigen individually (Kloss et al., Nature Biotechnololgy (2013);31(1):71-75, the contents of which are incorporated by reference in their entirety). Using this approach, In some cases, T cell activation requires CAR-mediated recognition of one antigen (e.g., sialyl Lewis A), while costimulation is independently mediated by a CCR specific for a second antigen. To achieve tumor selectivity, combinatorial antigen recognition approaches reduce the efficiency of T cell activation to a level that is ineffective without the rescue provided by simultaneous CCR recognition of a second antigen. In certain embodiments, the CCR comprises an extracellular antigen-binding domain that binds to an antigen different from sialyl Lewis A, a transmembrane domain, and a costimulatory signaling region that comprises at least one costimulatory molecule, including but not limited to CD28, 4-1BB, OX40, ICOS, PD-1, CTLA-4, LAG-3, 2B4, and BTLA. In certain embodiments, the costimulatory signaling region of the CCR comprises one costimulatory signaling molecule. In certain embodiments, one costimulatory signaling molecule is CD28. In certain embodiments, one costimulatory signaling molecule is 4-1BB. In certain embodiments, the costimulatory signaling region of the CCR comprises two costimulatory signaling molecules. In certain embodiments, the two costimulatory signaling molecules are CD28 and 4-1BB. The second antigen is selected such that the expression of both sialyl Lewis A and the second antigen is restricted to the targeted cells (e.g., cancerous tissues or cells). As with CARs, the extracellular antigen binding domain can be an scFv, Fab, F(ab) or IgG. 2 or a fusion protein with a heterologous sequence that forms an extracellular antigen-binding domain. In certain embodiments, the CCR binds to a pancreatic cancer-specific antigen.

[0210] In certain embodiments, the antigen-recognizing receptor is a truncated CAR. A "truncated CAR" differs from a CAR by lacking an intracellular signaling domain. For example, a truncated CAR comprises an extracellular antigen-binding domain and a transmembrane domain, and lacks an intracellular signaling domain. In accordance with the subject matter of the present disclosure, the truncated CAR has high binding affinity to a second antigen, e.g., a pancreatic cancer-specific antigen, expressed in a targeted cell (e.g., a pancreatic cancer cell). The truncated CAR functions as an adhesion molecule that enhances the avidity of the CAR of the present disclosure, particularly a CAR that has low binding affinity to sialyl Lewis A, thereby improving the efficacy of the CAR of the present disclosure or an immunoresponsive cell (e.g., a T cell) that comprises it. In certain embodiments, the T cell of the present disclosure comprises or is transduced to express a CAR of the present disclosure that targets sialyl Lewis A and a truncated CAR that targets a pancreatic cancer-specific antigen.

[0211] VI. Nucleic Acid Compositions and Vectors The presently disclosed subject matter provides nucleic acid compositions comprising a polynucleotide encoding a CAR disclosed herein. Also provided are cells comprising such nucleic acid compositions.

[0212] Genetic modification of immunoresponsive cells (e.g., T cells, NK cells) can be achieved by delivering a recombinant DNA or RNA construct encoding a CAR to target cells of a substantially homogeneous cellular composition. In some embodiments, such recombinant DNA or RNA constructs can be delivered into the immunoresponsive cells using a vector. In some embodiments, such vectors can be retroviral vectors (e.g., gamma retroviral) used for the introduction of DNA or RNA constructs into the host cell genome. For example, a polynucleotide encoding a sialyl Lewis A-targeted CAR can be cloned into a retroviral vector and expression can be driven from its endogenous promoter, from the retroviral long terminal repeat, or from an alternative internal promoter.

[0213] Non-viral vectors or RNA can also be used. Random chromosomal integration or targeted integration (e.g., using nucleases, transcription activator-like effector nucleases (TALENs), zinc finger nucleases (ZFNs), and / or clustered regularly interspaced short palindromic repeats (CRISPR) or transgene expression (e.g., using natural or chemically modified RNA) can be used.

[0214] For the initial genetic modification of cells to provide cells expressing sialyl Lewis A targeting CAR, retroviral vectors are generally used for transduction, but any other suitable viral vectors or non-viral delivery systems can also be used.For the subsequent genetic modification of cells to provide cells containing an antigen presenting complex that includes at least two costimulatory ligands, retroviral gene transfer (transduction) proves to be effective as well.If the capsid protein is functional to infect human cells, the combination of retroviral vectors and suitable packaging lines is also suitable. A variety of amphotropic virus producing cell lines are known, including, but not limited to, PA12 (Miller, et al. (1985) Mol. Cell. Biol. 5:431-437), PA317 (Miller, et al. (1986) Mol. Cell. Biol. 6:2895-2902), and CRIP (Danos, et al. (1988) Proc. Natl. Acad. Sci. USA 85:6460-6464). For example, particles pseudotyped with VSVG, RD114 or GALV envelopes, as well as any others known in the art, are suitable.

[0215] Possible transduction methods also include direct co-culture of cells with producer cells, e.g., by the method of Bregni, et al. (1992) Blood 80:1418-1422, or by the method of Xu, et al. (1994) Exp. Hemat. 22:223-230, and Hughes, et al. (1992) J. Clin. Invest. 89:1817, or with viral supernatant alone or concentrated vector stocks with or without appropriate growth factors and polycations.

[0216] Transducing viral vectors can be used to express costimulatory ligands and / or secrete cytokines (e.g., 4-1BBL and / or IL-12) in immunoresponsive cells. Preferably, the selected vector exhibits high infection efficiency and stable integration and expression (see, e.g., Cayouette et al., Human Gene Therapy 8:423-430, (see, e.g., Kido et al., Current Eye Research 15:833-844, 1996; Bloomer et al., Journal of Virology 71:6641-6649, 1997; Naldini et al., Science 272:263 267, 1996; and Miyoshi et al., Proc. Natl. Acad. Sci. USA 94:10319, 1997). Other viral vectors that can be used include, for example, adenovirus, lentivirus and adeno-associated virus vectors, vaccinia virus, bovine papilloma virus or herpes viruses such as Epstein-Barr virus (see, for example, Miller, Human Gene Therapy 15-14, 1990; Friedman, Science 244:1275-1281, 1989; Eglitis et al., BioTechniques 6:608-614, 1988; Tolstoshev et al., Current Opinion in Biotechnology 1:55-61, 1990; Sharp, The Lancet 337:1277-1278, 1991; Cornetta et al., Nucleic Acid Research and Molecular Biology 36:311-322, 1987; Anderson, Science 226:401-409, 1984, Moen, Blood Cells 17:407-416, 1991, Miller et al., Biotechnology 7:980-990, 1989, Le Gal La Salle et al., Science 259:988-990, 1993, and Johnson, Chest 107:77S- 83S, 1995). The rus vector has been particularly well developed and has been used in clinical practice (Rosenberg et al., N. Engl. J. Med 323:370, 1990; Anderson et al., US Engl. J. Med 323:370, 1990). No. 5,399,346).

[0217] In certain non-limiting embodiments, the vector expressing the sialyl Lewis A-targeted CAR of the present disclosure is a retroviral vector, e.g., an oncoretroviral vector.

[0218] Non-viral approaches can also be used to express proteins in cells. For example, nucleic acid molecules can be introduced into cells using lipofection (Feigner et al., Proc. Nat'l. Acad. Sci. USA 84:7413, 1987; Ono et al., Neuroscience Letters 17:259, 1990; Brigham et al., Am. J. Med. Sci. 298:278, 1989; Staubinger et al., Methods in Enzymology 101:512, 1983), asialoorosomucoid-polylysine conjugate (Wu et al., Journal of Biological Chemistry 263:14621, 1988, Wu et al., Journal of Biological Chemistry 264:16985, 1989) The gene can be introduced into cells by administration of a nucleotide sequence or by microinjection under surgical conditions (Wolff et al., Science 247:1465, 1990). Other non-viral means for this include in vitro transfection using calcium phosphate, DEAE dextran, electroporation and protoplast fusion. Liposomes can also be potentially useful for the delivery of DNA to cells. Transplantation of normal genes into diseased tissues of a subject can also be achieved by transferring normal nucleic acids into ex vivo culturable cell types (e.g., autologous or heterologous primary cells or their progeny) and then injecting the cells (or their progeny) into targeted tissues or systemically. Recombinant receptors can also be induced or obtained using transposases or targeted nucleases (e.g., zinc finger nucleases, meganucleases or TALE nucleases). Transient expression can be obtained by RNA electroporation.

[0219] cDNA expression for use in polynucleotide therapy methods can be directed from any suitable promoter (e.g., human cytomegalovirus (CMV), simian virus 40 (SV40) or metallothionein promoter) and regulated by any appropriate mammalian regulatory element or intron (e.g., elongation factor 1 alpha enhancer / promoter / intron structure). For example, enhancers known to selectively direct gene expression in specific cell types can be used to direct expression of the nucleic acid, if desired. Enhancers used can include, but are not limited to, those characterized as tissue- or cell-specific enhancers. Alternatively, in cases where a genomic clone is used as a therapeutic construct, regulation can be mediated by cognate regulatory sequences, if desired, by regulatory sequences derived from a heterologous source that includes any of the promoters or regulatory elements described above. The resulting cells can be grown under conditions similar to those of the unmodified cells, thereby expanding the modified cells and allowing them to be used for a variety of purposes.

[0220] VII. Genomic integration into immunocompetent cells In certain embodiments, the sialyl Lewis A-targeted CAR of the present disclosure can be integrated into a selected locus in the genome of an immunoresponsive cell. Any targeted genome editing method can be used to integrate the CAR into a selected locus in the genome of an immunoresponsive cell. In certain embodiments, the expression of the sialyl Lewis A-targeted CAR of the present disclosure is driven by an endogenous promoter / enhancer in or near the locus. In certain embodiments, the expression of the sialyl Lewis A-targeted CAR of the present disclosure is driven by an exogenous promoter integrated into the locus. The locus into which the sialyl Lewis A-targeted CAR of the present disclosure is integrated is selected based on the expression level of the gene in the locus and the timing of gene expression of the gene in the locus. The expression level and timing may change at different stages of cell differentiation and under mitogen / cytokine microenvironment, which are among the factors to be considered when making the selection.

[0221] In certain embodiments, the CRISPR system is used to integrate the sialyl Lewis A targeting CAR of the present disclosure into the selected locus of the genome of an immunoresponsive cell. The clustered regularly interspaced short palindromic repeats (CRISPR) system is a genome editing tool found in prokaryotic cells. When used for genome editing, this system includes Cas9 (a protein that can modify DNA using crRNA as its guide), CRISPR RNA (crRNA contains the RNA used by Cas9 to guide it to the modified section of the host DNA, along with a region (usually in a hairpin loop form) that binds to tracrRNA, which forms an active complex with Cas9), transactivating crRNA (tracrRNA binds to crRNA and forms an active complex with Cas9), and an optimal section of DNA repair template (DNA that guides the cellular repair process to allow the insertion of a specific DNA sequence). CRISPR / Cas9 is often used to transfect plasmids into target cells. The crRNA is the sequence used by Cas9 to identify and directly bind to the target DNA in the cell, and therefore needs to be designed for each application. The repair template carrying the CAR expression cassette must also be designed for each application, since it must overlap the sequences on either side of the cut and code for the insertion sequence.Multiple crRNAs and tracrRNAs can be packaged together to form a single guide RNA (sgRNA).This sgRNA can be combined with Cas9 gene, made into a plasmid, and transfected into cells.Methods of using the CRISPR system are described, for example, in WO2014093661A2, WO2015123339A1 and WO2015089354A1, which are incorporated herein by reference in their entirety.

[0222] In certain embodiments, zinc finger nucleases are used to integrate the sialyl Lewis A-targeted CAR of the present disclosure into the genome of an immunoresponsive cell at a selected locus. Zinc finger nucleases (ZFNs) are artificial restriction enzymes that are generated by combining zinc finger DNA binding domains with DNA cleavage domains. The zinc finger domains can be engineered to target specific DNA sequences, allowing the zinc finger nucleases to target desired sequences in the genome. The DNA binding domains of individual ZFNs usually contain multiple individual zinc finger repeats, each capable of recognizing multiple base pairs. The most common method of generating novel zinc finger domains is to combine zinc finger "modules" of known less specificity. The most common cleavage domain in ZFNs is the non-specific cleavage domain derived from the type IIs restriction endonuclease FokI. Using endogenous homologous recombination (HR) machinery and a homologous DNA template carrying the CAR expression cassette, ZFNs can be used to insert the CAR expression cassette into the genome. When the targeted sequence is cut by ZFN, HR mechanism searches for the homology between damaged chromosome and homologous DNA template, then copies the sequence of the template between the two broken ends of chromosome, thereby integrating the homologous DNA template into genome.The method of using ZFN system is described in, for example, WO2009146179A1, WO2008060510A2 and CN102174576A, which are incorporated herein by reference in their entirety.

[0223] In certain embodiments, the TALEN system is used to integrate the sialyl Lewis A-targeted CAR of the present disclosure into a selected locus of the genome of an immunoresponsive cell. Transcription activator-like effector nucleases (TALENs) are restriction enzymes that can be engineered to cleave specific sequences of DNA. TALEN systems operate on almost the same principle as ZFNs. They are generated by combining transcription activator-like effector DNA binding domains with DNA cleavage domains. Transcription activator-like effectors (TALEs) are composed of 33-34 amino acid repeat motifs with two variable positions that have strong recognition for specific nucleotides. By assembling an array of these TALEs, the TALE DNA binding domains can be engineered to bind to the desired DNA sequence, thereby guiding the nuclease to cleave at a specific location in the genome. Methods for using TALEN system are described in, for example, WO2014134412A1, WO2013163628A2 and WO2014040370A1, which are incorporated by reference in their entirety. Methods for delivering genome editing materials can vary as required. In certain embodiments, components of selected genome editing methods are delivered as DNA constructs in one or more plasmids. In certain embodiments, components are delivered via viral vectors. Common delivery methods include, but are not limited to, electroporation, microinjection, gene gun, impalefection, hydrostatic pressure, continuous injection, sonication, magnetofection, adeno-associated virus, envelope protein pseudotyping of viral vectors, replication-competent vector cis- and trans-acting elements, herpes simplex virus and chemical vehicles (e.g., oligonucleotides, lipoplexes, polymersomes, polyplexes, dendrimers, inorganic nanoparticles and cell-penetrating peptides).

[0224] The modification can be made anywhere within the selected locus or anywhere that can affect the gene expression of the integrated sialyl Lewis A-targeted CAR. In certain embodiments, the modification is introduced upstream of the transcription start site of the integrated sialyl Lewis A-targeted CAR. In certain embodiments, the modification is introduced between the transcription start site and the protein coding region of the integrated sialyl Lewis A-targeted CAR. In certain embodiments, the modification is introduced downstream of the protein coding region of the integrated sialyl Lewis A-targeted CAR of the present disclosure.

[0225] VIII. Polypeptides and Analogs and Polynucleotides Sialyl Lewis A (e.g., scFv (e.g., human scFv), Fab or (Fab) 2 The subject matter of the present disclosure also includes extracellular antigen-binding domains that specifically bind to CD3, CD4, CD5, CD6, CD7, CD8, CD28, and the like. The polypeptide or fragment thereof and the polynucleotide encoding it are modified in a manner that enhances its anti-tumor activity when expressed in an immunoresponsive cell. The subject matter of the present disclosure provides a method for optimizing an amino acid sequence or a nucleic acid sequence by introducing changes in the sequence. Such changes may include certain mutations, deletions, insertions, or post-translational modifications. The subject matter of the present disclosure further includes analogs of any naturally occurring polypeptide of the subject matter of the present disclosure. Analogs may differ from naturally occurring polypeptides of the subject matter of the present disclosure by amino acid sequence differences, by post-translational modifications, or both. Analogs of the subject matter of the present disclosure may generally exhibit at least about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or more identity or homology with all or a portion of the naturally occurring amino acid sequence of the subject matter of the present disclosure. The length of sequence comparison is at least about 5, about 10, about 15, about 20, about 25, about 50, about 75, about 100 or more amino acid residues. Again, in an exemplary approach to determine the degree of identity, the BLAST program may be used, e.g. -3 From e -100A probability score between indicates a closely related sequence. Modifications include in vivo and in vitro chemical derivatization of the polypeptide, such as acetylation, carboxylation, phosphorylation, or glycosylation, which may occur during polypeptide synthesis or processing or following treatment with isolated modifying enzymes. Analogs may also differ from the naturally occurring polypeptides of the subject matter of the present disclosure by changes in the primary sequence. These include both natural and induced genetic variants (e.g., resulting from random mutagenesis by exposure to irradiation or ethane methyl sulfate, or by site-directed mutagenesis, as described in Sambrook, Fritsch and Maniatis, Molecular Cloning: A Laboratory Manual (2d ed.), CSH Press, 1989, or Ausubel et al., supra). Also, L-amino acids and other amino acids may be used. Also included are cyclized peptides, molecules and analogs that contain other residues, such as D-amino acids or non-naturally occurring or synthetic amino acids, such as beta (β) or gamma (γ) amino acids.

[0226] In addition to full-length polypeptides, the subject matter of the present disclosure also provides fragments of any one of the polypeptides or peptide domains of the subject matter of the present disclosure. The fragments can be at least about 5, about 10, about 13, or about 15 amino acids. In some embodiments, the fragments are at least about 20 contiguous amino acids, at least about 30 contiguous amino acids, or at least about 50 contiguous amino acids. In some embodiments, the fragments are at least about 60 to about 80, about 100, about 200, about 300, or more contiguous amino acids. Fragments of the subject matter of the present disclosure can be generated by methods known to those of skill in the art, or can result from normal protein processing (e.g., removal of amino acids from a nascent polypeptide that are not required for biological activity or removal of amino acids by alternative mRNA splicing or alternative protein processing events).

[0227] Non-protein analogs have chemical structures designed to mimic the functional activity of the protein of the present invention. Such analogs are administered according to the method of the subject of the present disclosure. Such analogs may exceed the physiological activity of the original polypeptide. Methods for designing analogs are well known in the art, and the synthesis of analogs can be carried out according to such methods by modifying chemical structures, so that the resulting analogs increase the antineoplastic activity of the original polypeptide when expressed in immunoresponsive cells. These chemical modifications include, but are not limited to, substituting alternative R groups and changing the degree of saturation at certain carbon atoms of the reference polypeptide. Protein analogs can be relatively resistant to in vivo degradation, resulting in a longer therapeutic effect upon administration. Assays for measuring functional activity include, but are not limited to, those described in the following examples.

[0228] In accordance with the presently disclosed subject matter, sialyl Lewis A (e.g., human sialyl Lewis A) (e.g., scFv (e.g., human scFv), Fab or (Fab) 2 Polynucleotides encoding extracellular antigen-binding domains that specifically bind to CD3, CD4, CD5, CD6, CD7, CD8, CD28) can be modified by codon optimization. Codon optimization can modify both naturally occurring and recombinant gene sequences to achieve the highest possible productivity in any given expression system. Factors involved in different stages of protein expression include codon adaptability in transcription and translation, mRNA structure, and various cis elements. Any suitable codon optimization method or technique known to those skilled in the art can be used to modify the polynucleotides of the subject matter of the present disclosure, including but not limited to OptimumGene™, Encor optimization, and Blue Heron.

[0229] IX. Administration The subject sialyl Lewis A-targeted CAR and the immunoresponsive cells comprising it may be provided to a subject systemically or directly for the treatment or prevention of neoplasm. In certain embodiments, the sialyl Lewis A-targeted CAR and the immunoresponsive cells comprising it are directly injected into a target organ (e.g., an organ affected by a neoplasm). Alternatively or additionally, the sialyl Lewis A-targeted CAR and the immunoresponsive cells comprising it are indirectly provided to a target organ, for example, by administration to the circulatory system (e.g., tumor vasculature). To increase the generation of T cells in vitro or in vivo, an expansion and differentiation agent may be provided before, during, or after the administration of the cells and compositions.

[0230] The sialyl Lewis A-targeted CARs and immunoresponsive cells comprising same of the subject matter of the present disclosure can be administered in any physiologically acceptable vehicle, usually intravascularly, but they can also be introduced into bone or other convenient sites where the cells may find suitable sites for regeneration and differentiation (e.g., the thymus). In certain embodiments, at least 1×10 5 cells may be administered, ultimately resulting in a total of 1 x 10 10 or more cells. In certain embodiments, at least 1×10 6A single cell may be administered. The cell population comprising immunoresponsive cells comprising a sialyl Lewis A-targeted CAR of the present disclosure may comprise a purified population of cells. One of skill in the art can readily determine the percentage of immunoresponsive cells in a cell population using a variety of well-known methods, for example, fluorescence-activated cell sorting (FACS). The range of purity in a cell population comprising immunoresponsive cells comprising an anti-sialyl Lewis A-specific CAR of the present disclosure may be about 50% to about 55%, about 55% to about 60%, about 65% to about 70%, about 70% to about 75%, about 75% to about 80%, about 80% to about 85%, about 85% to about 90%, about 90% to about 95%, or about 95 to about 100%. The dosage may be readily adjusted by one of skill in the art (e.g., a decrease in purity may require an increase in dosage). The immunoresponsive cells may be introduced by injection, catheter, or the like. If necessary, factors including, but not limited to, interleukins, such as IL-2, IL-3, IL 6, IL-11, IL-7, IL-12, IL-15, IL-21 and other interleukins, colony stimulating factors, such as G-CSF, M-CSF and GM-CSF, interferons, such as gamma interferon, may also be included.

[0231] In certain embodiments, the compositions of the presently disclosed subject matter include pharmaceutical compositions comprising immunoresponsive cells comprising the presently disclosed sialyl Lewis A-targeted CAR and a pharma- ceutically acceptable carrier. Administration can be autologous or non-autologous. For example, the immunoresponsive cells comprising the presently disclosed sialyl Lewis A-targeted CAR and compositions comprising the same can be obtained from a subject and administered to the same subject or to a different, compatible subject. The presently disclosed subject matter peripheral blood-derived T cells or their progeny (e.g., derived in vivo, ex vivo or in vitro) can be administered by local injection, including catheter administration, systemic injection, local injection, intravenous injection or parenteral administration. When administering the presently disclosed subject matter pharmaceutical compositions (e.g., pharmaceutical compositions comprising the presently disclosed sialyl Lewis A-targeted CAR) may be formulated into a unit dosage form for injection (solution, suspension, emulsion).

[0232] In certain embodiments, the compositions of the presently disclosed subject matter may comprise one or more antigen-binding proteins, such as an anti-sialyl Lewis A antibody or antigen-binding fragment thereof disclosed herein, and a pharma- ceutically acceptable carrier.

[0233] XI. Preparations The immunoresponsive cells and compositions comprising the sialyl Lewis A-targeted CAR of the subject of the present disclosure can be conveniently provided as a sterile liquid preparation, such as an isotonic aqueous solution, suspension, emulsion, dispersion, or viscous composition, which can be buffered to a selected pH. Liquid preparations are usually easier to prepare than gels, other viscous compositions, and solid compositions. In addition, liquid compositions are somewhat more convenient to administer, especially by injection. On the other hand, viscous compositions can be formulated within a suitable viscosity range to provide a longer contact period with specific tissues. Liquid or viscous compositions can include a carrier, which can be a solvent or dispersion medium, including, for example, water, saline, phosphate buffered saline, polyol (e.g., glycerol, propylene glycol, liquid polyethylene glycol, etc.), and suitable mixtures thereof.

[0234] Sterile injectable solutions can be prepared by incorporating the subject compositions of the present disclosure, for example, compositions comprising immunoresponsive cells expressing sialyl Lewis A-targeted CAR of the present disclosure, into a required amount of an appropriate solvent with various amounts of other ingredients as required. Such compositions can be a mixture with a suitable carrier, diluent or excipient, for example, sterile water, saline, glucose, dextrose, etc. The compositions can also be lyophilized. Depending on the route of administration and the preparation desired, the compositions can contain auxiliary substances, for example, wetting agents, dispersing or emulsifying agents (e.g., methylcellulose), pH buffering agents, gelling or viscosity enhancing additives, preservatives, flavoring agents, coloring agents, etc. Standard textbooks, for example, "REMINGTON'S PHARMACEUTICAL SCIENCE", 17th edition, 1985, which is incorporated herein by reference, can be consulted to prepare suitable preparations without undue experimentation.

[0235] Various additives which enhance the stability and sterility of the compositions may be added, including antimicrobial preservatives, antioxidants, chelating agents, and buffers. Prevention of the action of microorganisms can be ensured by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, and the like. Prolonged absorption of the injectable pharmaceutical form can be achieved by the use of agents delaying absorption, for example, aluminum monostearate and gelatin. However, in accordance with the presently disclosed subject matter, any vehicle, diluent or additive used must generally be compatible with the immunoresponsive cells expressing the sialyl Lewis A-targeted CAR of the presently disclosed subject matter.

[0236] The composition can be isotonic, i.e., have the same osmotic pressure as blood and tear fluid.The desired isotonicity of the composition of the subject matter of the present disclosure can be achieved using sodium chloride or other pharma- ceutically acceptable agents, such as dextrose, boric acid, sodium tartrate, propylene glycol, or other inorganic or organic solutes.For buffers containing sodium ions, sodium chloride is particularly preferred.

[0237] The viscosity of the composition can be maintained at a selected level using a pharma- ceutically acceptable thickening agent, if necessary. Methylcellulose can be used because it is readily and economically available and easy to work with. Other suitable thickening agents include, for example, xanthan gum, carboxymethylcellulose, hydroxypropylcellulose, carbomer, etc. The concentration of the thickening agent can vary depending on the agent selected. The important point is to use an amount that achieves the selected viscosity. It is clear that the selection of suitable carriers and other additives will vary depending on the exact route of administration and the nature of the particular dosage form, for example, the liquid dosage form (for example, whether the composition is formulated into a solution, suspension, gel, or another liquid form, for example, a sustained release form or a liquid-filled form).

[0238] As described in the subject matter of this disclosure, one skilled in the art will recognize that the components of the composition should be selected to be chemically inert and not affect the viability or effectiveness of the immunoresponsive cells. This is not a problem for those familiar with the principles of chemistry and pharmacology, or problems can be easily avoided from this disclosure and the documents cited herein, by reference to standard textbooks, or by simple experimentation (without undue experimentation).

[0239] One consideration regarding therapeutic use of the immunoresponsive cells of the presently disclosed subject matter is the amount of cells necessary to achieve optimal effect. The amount of cells to be administered will vary depending on the subject being treated. In certain embodiments, about 10% of the immunoresponsive cells of the presently disclosed subject matter are administered. 4 ~about 10 10 , about 10 5 ~about 10 9 or about 10 6 ~about 10 8 immunoresponsive cells are administered to a subject. More effective cells may be administered in even lower numbers. In some embodiments, at least about 1 x 10 8 , about 2×10 8 , about 3×10 8 , about 4×10 8 and about 5 × 10 8 The subject immunoresponsive cells of the present disclosure are administered to a human subject. The exact determination of what is considered to be an effective dose may be based on factors specific to each subject, including the size, age, sex, weight and condition of the particular subject. The dosage can be easily ascertained by those skilled in the art from the present disclosure and knowledge in the art.

[0240] One of ordinary skill in the art can readily determine the amount of cells and optimal additives, vehicles and / or carriers in the composition to be administered in the methods of the presently disclosed subject matter. Typically, any additives (in addition to the active cell(s) and / or agent(s)) are present in the solution in phosphate buffered saline in an amount of about 0.001% to about 50% by weight, with the active ingredient being present in the order of micrograms to milligrams, e.g., about 0.0001% to about 5% by weight, about 0.0001% to about 1% by weight, about 0.0001% to about 0.05% by weight, about 0.001% to about 20% by weight, about 0.01% to about 10% by weight, or about 0.05% to about 5% by weight. For any composition to be administered to animals or humans, for any particular method of administration, toxicity should be determined by determining the lethal dose (LD) and LD50 in a suitable animal model, e.g., rodents, e.g., mice, the dosage of the composition(s) that induces a suitable response, the concentration of the components therein, and the timing of administering the composition(s). Such determination does not require undue experimentation from the knowledge of the skilled artisan, this disclosure, and the documents cited herein. Also, the time of sequential administration can be ascertained without undue experimentation.

[0241] XII. Methods of Treatment Provided herein is a method for treating malignant growth in a subject.The method comprises administering the cells of the present disclosure, which comprise one or more CARs as described herein, in an amount effective to achieve the desired effect, which is the alleviation of existing condition or the prevention of recurrence.For treatment, the amount administered is an amount effective to bring about the desired effect.An effective amount may be provided in one or a series of administrations.An effective amount may be provided in a bolus or by continuous perfusion.

[0242] For adoptive immunotherapy using antigen-specific T cells, approximately 6 ~about 10 10 (e.g., about 10 9 or about 10 6Cell doses ranging from 100 to 1500 cells are typically injected. Upon administration of the immunoresponsive cells to a subject and subsequent differentiation, immunoresponsive cells specifically directed against one specific antigen (e.g., sialyl Lewis A) are induced. "Induction" of T cells can include inactivation of antigen-specific T cells, such as by deletion or anergy. Inactivation is particularly useful for establishing or re-establishing tolerance, such as in autoimmune disorders. The immunoresponsive cells of the subject matter of the present disclosure can be administered by any method known in the art, including, but not limited to, pleural administration, intravenous administration, subcutaneous administration, intranodal administration, intratumoral administration, intrathecal administration, intrapleural administration, intraperitoneal administration, and direct administration to the thymus. In certain embodiments, the immunoresponsive cells and compositions comprising the same are administered intravenously to a subject in need thereof.

[0243] The subject matter of the present disclosure provides various methods of using immunoresponsive cells (e.g., T cells) comprising the sialyl Lewis A targeting CAR of the present disclosure.For example, the subject matter of the present disclosure provides a method of reducing tumor burden in a subject.In one specific, non-limiting example, the method of reducing tumor burden comprises administering an effective amount of the immunoresponsive cells of the present disclosure to a subject.The immunoresponsive cells of the present disclosure can reduce the number of tumor cells, reduce tumor size, and / or eradicate tumors in a subject.

[0244] The subject matter of the present disclosure also provides a method for increasing or prolonging the survival of a subject with a neoplasm. In certain non-limiting examples, the method for increasing or prolonging the survival of a subject with a neoplasm comprises administering to the subject an effective amount of an immunoresponsive cell of the present disclosure. The method can reduce or eradicate the tumor burden in the subject.

[0245] The presently disclosed subject matter further provides methods of treating and / or preventing a neoplasm in a subject. In certain embodiments, the methods comprise administering to a subject an effective amount of an immunoresponsive cell of the present disclosure.

[0246] Cancers whose growth may be inhibited using the immunoresponsive cells of the presently disclosed subject matter include cancers that are normally responsive to immunotherapy. Non-limiting examples of neoplasms, cancers and / or tumors for treatment include pancreatic cancer.

[0247] Furthermore, the subject matter of the present disclosure provides a method for increasing immune-activating cytokine production in response to cancer cells in a subject. In certain embodiments, the method includes administering an immune-activating cell of the present disclosure to a subject. The immune-activating cytokine can be granulocyte-macrophage colony-stimulating factor (GM-CSF), IFN-α, IFN-β, IFN-γ, TNF-α, IL-2, IL-3, IL-6, IL-11, IL-7, IL-12, IL-15, IL-21, interferon regulatory factor 7 (IRF7), and combinations thereof. In certain embodiments, the immune-activating cell comprising the sialyl Lewis A-specific CAR of the subject matter of the present disclosure increases the production of GM-CSF, IFN-γ, and / or TNF-α.

[0248] Suitable human subjects for therapy usually include two treatment groups that can be distinguished by clinical criteria. Subjects with "advanced disease" or "high tumor burden" are those with clinically measurable tumors. Clinically measurable tumors are those that can be detected based on tumor burden (e.g., by palpation, CAT scan, ultrasound image, mammogram or X-ray; positive biochemical or histopathological markers are insufficient to identify this population by themselves). The pharmaceutical compositions embodied in the subject matter of the present disclosure are administered to these subjects to induce an anti-tumor response with the aim of alleviating the condition. Ideally, a reduction in tumor burden results, but any clinical improvement constitutes a benefit. Clinical improvement includes a reduction in risk or progression rate or a reduction in the pathological consequences of tumors.

[0249] The second group of suitable subjects is known in the art as the "adjuvant group". These are individuals who have had a history of neoplasms but have been responsive to other treatment modalities. Previous therapy may include, but is not limited to, surgical resection, radiation therapy, and conventional chemotherapy. As a result, these individuals have tumors that are not clinically measurable. However, they are suspected to be at risk for disease progression near the original tumor site or through metastasis. This group can be further subdivided into high-risk and low-risk individuals. Subdivision is based on characteristics observed before or after the initial treatment. These characteristics are known in the clinical arts and are defined accordingly for each different neoplasm. Characteristics unique to the high-risk subgroup include tumors that have invaded adjacent tissues or that show lymph node involvement. Another group has a genetic predisposition to neoplasms but has not yet demonstrated clinical signs of neoplasms. For example, a woman who has tested positive for a genetic mutation associated with breast cancer, but is still of childbearing age, may wish to receive one or more of the antigen-binding fragments described herein in a treatment to prophylactically prevent the emergence of a neoplasm until it is appropriate to perform prophylactic surgery.

[0250] The subject may have an advanced form of the disease, in which case the treatment objectives may include reducing or reversing disease progression and / or ameliorating side effects. The subject may have a history of a condition that has already been treated, in which case the treatment objectives will usually include reducing or delaying the risk of recurrence.

[0251] To prevent or minimize the risk of immunological complications (known as "malignant T cell transformation"), such as graft-versus-host disease (GvHD), or where healthy tissue expresses the same target antigen as tumor cells, leading to a similar outcome to GvHD, further modifications may be introduced into the immunoresponsive cells (e.g., T cells) expressing the sialyl Lewis A-targeted CAR. A potential solution to this problem is to engineer a suicide gene into the T cells expressing the sialyl Lewis A-targeted CAR. Suitable suicide genes include, but are not limited to, herpes simplex virus thymidine kinase (hsv-tk), inducible caspase 9 suicide gene (iCasp-9), and truncated human epidermal growth factor receptor (EGFRt) polypeptide. In certain embodiments, the suicide gene is an EGFRt polypeptide. The EGFRt polypeptide can allow T cell elimination by administering an anti-EGFR monoclonal antibody (e.g., cetuximab). EGFRt can be covalently tethered to the 3' end of the intracellular domain of the sialyl Lewis A targeted CAR. The suicide gene can be included in a vector containing a nucleic acid encoding the sialyl Lewis A targeted CAR of the present disclosure. In this way, administration of a prodrug (e.g., a prodrug (e.g., AP1903 that can activate iCasp-9) designed to activate the suicide gene upon malignant T cell transformation (e.g., GVHD) causes apoptosis in T cells expressing the CAR activated by the suicide gene. Incorporating a suicide gene into the sialyl Lewis A targeted CAR of the present disclosure provides an added level of safety with the ability to eliminate the majority of CAR T cells within a very short period of time. The immunoresponsive cells (e.g., T cells) of the present disclosure that have been incorporated with a suicide gene can be preemptively eliminated at a given time point after CAR T cell infusion or eradicated at the earliest sign of toxicity.

[0252] XIII. Kit The subject matter of the present disclosure provides a kit for treating or preventing neoplasms.In certain embodiments, the kit comprises a therapeutic or prophylactic composition comprising an effective amount of immunoresponsive cells comprising the sialyl Lewis A targeting CAR of the present disclosure in a unit dosage form.In certain embodiments, the cells further express at least one costimulatory ligand.In some embodiments, the kit comprises a sterile container containing the therapeutic or prophylactic vaccine, and such container can be a box, an ampoule, a bottle, a vial, a tube, a bag, a pouch, a blister pack or other suitable container form known in the art.Such container can be made of plastic, glass, laminated paper, metal foil or other material suitable for holding medicine.

[0253] If necessary, the immunoresponsive cells may be provided with instructions for administering the cells to a subject having or at risk of developing a neoplasm. The instructions generally include information regarding the use of the composition for the treatment and / or prevention of a neoplasm. In other embodiments, the instructions include at least one of the following: description of the therapeutic agent, dosage schedule and administration for the treatment or prevention of a neoplasm or its symptoms, warnings, indications, contraindications, overdose information, adverse reactions, animal pharmacology, clinical studies, and / or references. The instructions may be printed directly on the container (if present), printed as a label affixed to the container, or printed as a separate sheet, pamphlet, card, or holder provided in or with the container. EXAMPLES

[0254] The practice of the present invention employs, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are well within the skill of the art. Such techniques are described in "Molecular Cloning: A Laboratory Manual", second edition, 1996. edition (Sambrook, 1989), "Oligonucleotide Synthesis" (Gait, 1984), "Animal Cell Culture" (Freshney, 1987), "Methods in Enzymology" "Handbook of This has been thoroughly documented in such publications as "Experimental Immunology" (Weir, 1996), "Gene Transfer Vectors for Mammalian Cells" (Miller and Calos, 1987), "Current Protocols in Molecular Biology" (Ausubel, 1987), "PCR: The Polymerase Chain Reaction", (Mullis, 1994), and "Current Protocols in Immunology" (Coligan, 1991). These techniques are applicable to the production of the polynucleotides and polypeptides of the invention and may therefore be considered in making and practicing the invention. Techniques that are particularly useful for certain embodiments are discussed in the sections that follow.

[0255] The following examples are put forth to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the compositions, and assay, screening and treatment methods of the present invention, and are not intended to limit the scope of what the inventors regard as their invention.

[0256] Example 1 Introduction Strategies to improve antigen presentation induce epitope spreading or perpetuate existing antitumor T cell responses to hold the promise of fighting tumor antigen escape. For example, cancer vaccines and "immunogenic" radiation (RT) activate antigen-presenting cells (APCs) to improve tumor neoantigen presentation to endogenous T cells (Spiotto et al., Sci Immunol (2016); 1). However, the same neoantigen must still be expressed and presented on most, if not all, tumor cells to achieve a complete response. In patients with pre-existing tumor-reactive T cells that correlate with gene mutation burden, immune checkpoint inhibitors can alleviate T cell exhaustion and achieve sustained responses. However, checkpoint blockade cannot restore T cell responses against tumor cells that do not present the recognized antigen, just as CARs cannot direct responses against tumor cells that lack the CAR target.

[0257] Improved tumor recognition that can occur after exposure to ionizing radiation, mediated by increased APC activation, improved T cell infiltration, and enhanced HLA or CAR target expression in tumors (Spiotto et al., Sci Immunol (2016); 1; Weiss et al., Cancer Res (2018); 78:1031-1043), faces the same challenge of antigen escape due to antigen loss. However, tumors exposed to low doses of radiation were found to be more susceptible to CAR T cell activity, including tumor cells lacking CAR targets. Understanding this mechanism is particularly valuable in overcoming solid tumor antigen escape.

[0258] We characterized this alternative mechanism by which radiation conditioning enhances tumor sensitivity to CAR T cell-mediated elimination and exploits this to expand the scope of CAR T cell coverage beyond the targeted antigen. Pancreatic cancer has been associated with poor prognosis over the past decades with little improvement, has not established uniformly expressed therapeutic target antigens, and is experiencing increasing morbidity. Combining low-dose radiation with CAR therapy in a partially antigen-negative orthotopic pancreatic cancer model provides a novel means to address the challenge of clonal antigen heterogeneity.

[0259] result Sialyl Lewis A A )-specific CAR T cells are active against pancreatic tumor cells in vitro Identifying solid tumor targets that are expressed on 100% of tumor cells and not on key normal tissues is challenging. Pancreatic cancer is a good example of this problem, with several attractive targets, none of which are clearly expressed on all tumor cells (Zhao et al., Cancer Cell (2015); 28:415-428). Sialyltransferase, a surface antigen expressed on 75-90% of pancreatic tumors (Viola-Villegas et al., J Nucl Med (2013); 54:1876-1882) and low expression on normal human tissues (Viola-Villegas et al., J Nucl Med (2013); 54:1876-1882), is a promising candidate for targeting solid tumors. Lil Louis A A ) is a validated antibody target in clinical trials (NCT03118349, NCT02672917, NCT02687230). A The human monoclonal 5B1 antibody targets pancreatic cancer in vitro and in vivo (Viola-Villegas et al., J Nucl Med (2013); 54:1876-1882) , as well as safety and tolerability in patients with pancreatic cancer at biologically active doses (O'Reilly et al., Journal of Clinical Oncology (2017); 35:4110-4110). A A specific scFv was used to construct an advanced pancreatic ductal adenocarcinoma (APDAC)-targeting CAR. A The specific LBBz CAR is A showed effective cytotoxicity against multiple pancreatic cancer tumor lines expressing Le A Negative PC3 prostate cancer cells showed no change (Figures 6A-6C). Capan2 PDAC showed intermediate levels of Le A (Figures 6A-6C) and were selected for further experiments.

[0260] Low-dose radiation sensitizes tumor cells to killing by CAR T cells without inducing target antigen expression To test the initial hypothesis that radiation therapy (RT) could induce LeA expression and improve the ability of CAR T cells to eliminate tumors with heterologous target antigen expression, tumor cells were irradiated with 2 Gy RT and 2 days later, cytotoxic T lymphocyte (CTL) assays on remaining viable cells and FACS analysis of surface target antigen expression were performed. Higher RT doses induced small but significant tumor cell death, whereas 2 Gy was chosen because it did not produce a detectable difference in tumor viability (Figure 1A). It was found that 2 Gy (hereafter referred to as "low dose RT") increased the susceptibility of tumor cells to CAR T cell killing at all effector:target ratios (Figure 1B), but surprisingly did not increase target antigen expression (Figure 1C).

[0261] Low-dose radiation affects gene sets associated with susceptibility to TRAIL-mediated death To gain insight into the potential mechanisms by which low-dose RT sensitizes tumor cells to killing by CAR T cells, RNAseq analysis was performed on tumor cells before and after low-dose RT. Although RT itself was sublethal, gene set analysis revealed that many apoptotic pathways were significantly affected by low-dose RT (Figure 1D). In particular, gene sets that distinguished tumor cells that were sensitive to TRAIL-mediated death from those that were not (Hamai et al., Oncogene (2006); 25:7618-7634). 1 were found to have the lowest false discovery rate (FDR<0.0000001 for each; 429 of 492 positive pathway members were induced and 114 of 128 negative pathway members were downregulated) (Figure 1D).

[0262] CAR T cells produce TRAIL upon target antigen encounter TRAIL is a trimeric protein that induces death through two distinct receptors and several downstream signaling molecules that affect sensitivity; tumor cells are generally more sensitive to TRAIL-induced apoptosis than normal cells, but to varying degrees (Walczak et al., Nat Med (1999); 5:157-163). Gene set analysis has demonstrated that low-dose RT reduces tumor Our results suggest that LeA-specific CAR T cells may transcriptionally prime tumor cells for TRAIL-mediated death, but this was only relevant when death ligands were present locally at sufficient levels. We analyzed TRAIL production from LeA-specific CAR T cells and found that CAR T cells produced low levels of TRAIL at baseline but significantly induced TRAIL mRNA and protein upon target antigen encounter (Figure 1E). In contrast, TRAIL was not induced following tumor recognition by T cells expressing a truncated CAR lacking the signaling domain (Ldel), establishing the dependency of TRAIL induction on CAR signaling (Figure 1F).

[0263] Antigen-negative tumor cells exposed to low-dose RT are susceptible to CAR T cell TRAIL-mediated killing To test the functional significance of TRAIL produced by activated CAR T cells on antigen-negative tumors exposed to low-dose RT, tumor cells were transformed into antigen-positive (Ag + ) and antigen negative (Ag - ) population. - Cells were transduced with firefly luciferase (Luc) and expressed Ag - The cells remained stably antigen-negative over time (Figure 7). 75% of Ag + Tumor cells and 25% Ag - Luc + Tumor cells were mixed and incubated with TRAIL-CRISPR-disrupted CAR T cells exposed to low-dose RT or not exposed to RT (Figures 2A-2B and 7). wt or knockout CAR T cells were resting or stimulated with target antigen for 3 days before inducing TRAIL production.- Cell killing was monitored and the highest levels of Ag expression were observed in pre-stimulated wt CAR T cells on RT-exposed tumor cells. - This Ag causes tumor cell death. - We found that tumor cell death was significantly reduced by the absence of TRAIL in CAR T cells or the absence of sensitizing RT to tumors (Figure 2B). L(del)CAR T cells, which recognize target cells but do not induce TRAIL, expressed significantly more RT-sensitizing Ags when constitutively expressed TRAIL. - induced tumor cell death (Figure 2C).

[0264] TRAIL exerts several context-dependent effects, including apoptosis and necroptosis of both tumor and T cells, or recruitment of myeloid-derived suppressor cells via tumor cell NFkB activation (Hartwig et al., Mol Cell (2017); 65:730-742 e735) or intratumoral Ra TRAIL exerts tumor-promoting effects including survival, invasion and metastasis via TRAIL and Akt activation (von Karstedt et al., Cancer Cell (2015); 27:561-573). To better understand how RT-sensitized tumors may respond to increased TRAIL stimulation provided by CAR T cells, known mediators of various downstream TRAIL signaling pathways were investigated. While many pathway mediators are regulated via transcription, cleavage, phosphorylation, ubiquitination or other events, gene expression analysis can provide general information on the overall pathway activation status. Notably, gene expression changes from RNAseq data before and after sensitizing RT revealed that the majority of individual members of both tumor-promoting and antitumor mediators downstream of TRAIL were significantly altered by sensitizing RT (Figure 3A; red or green represent significant changes, gray represents non-significant changes). Pro-survival, migration, metastasis and tumor-supportive inflammatory TRAIL pathway members were almost uniformly downregulated, whereas pro-apoptotic molecules were overwhelmingly induced, suggesting that sensitizing RT may predispose tumor cells to TRAIL-mediated apoptosis (Figure 3A and Figure 9). Because apoptosis and necroptosis levels can be monitored by phosphatidylserine (PS) expression at the cell membrane, live video microscopy of cultures containing fluorescent annexin V antibody was used to demonstrate that TRAIL produced by CAR T cells was associated with the expression of CAR T cells in the Ag / T cells. - We tested whether RT-sensitizing Ag induces detectable membrane PS changes in cells over time. - Tumor cells were labeled with CellTrace Violet (CTV) and then incubated with unlabeled Ag. + Tumor cells and TRAIL wt or TRAIL - / - Mixed with CAR T cells. Ag undergoing apoptosis - Automated quantification of tumor cells using TRAIL - / - CAR T cells are Ag - TRAIL is unable to induce tumor apoptosis over time wt CAR T cells consistently and significantly increased -It was demonstrated that this treatment resulted in tumor cell apoptosis (p<0.0001, FIG. 3B).

[0265] Resistant Ag - Pancreatic tumors containing the IL-16 population can be eliminated by CAR T cells in vivo after sensitizing RT We then established a mouse model for the challenging but common clinical scenario of xenogeneic solid tumors that partially lack the target antigen. - PDAC cells were established in the mouse pancreas and treated with CAR T cells 9 days later (Figure 4A). + CAR T cells, which consistently eliminated orthotopic PDAC, were unable to completely eliminate any xenogeneic tumors (Figures 4B-4E). We next tested whether sensitizing RT provided any meaningful benefit to xenogeneic tumors treated with CAR T cells in vivo. Mice bearing established xenogeneic PDAC treated with sensitizing RT followed by CAR T cells achieved more CRs and PRs by imaging, necropsy examination and pathology (Figures 4B and 4F). Since the primary known mechanism of CAR-independent T-cell killing is via the T cell receptor (TCR) and RT can induce HLA expression on target cells, we tested whether TCR-dependent tumor killing plays a significant role after sensitizing RT. Mice lacking TCR (TCR - / - ) CAR T cells (Figure 10) maintained their ability to eliminate RT-sensitized xenogeneic tumors (Figure 4G). RT initially led to modestly increased T cell accumulation within the tumor over the first 2 weeks (Figures 4I-4K). Despite significant tumor influx (Figure 11), TRAIL - / - CAR T cells were unable to consistently achieve complete responses in RT-sensitized tumor-bearing mice, as demonstrated by both waterfall plots of responses at the time of death (resulting from either GVHD or tumor progression) (Figure 4B) and weekly bioluminescence imaging (Figure 4H). Mice with recurrent / progressed tumors still possessed CAR T cells in the blood, spleen, and tumors as assessed by FACS and exhibited significant T cell infiltrating tumors by IHC, but did not express Ag -The outgrowth of tumor cells was demonstrated (FIG. 4L and FIGS. 12A-12B).

[0266] To dissociate the effects of TRAIL from those of CAR, RT-sensitized mice were treated with L(del)CAR T cells, which bind tumors but induce neither CAR cytotoxicity nor TRAIL upon recognition, and L(del)-TRAIL CAR T cells, which bind tumors and constitutively express TRAIL but do not exert CAR-mediated cytotoxicity. While the first strategy produced no response despite local T cell accumulation (Figure 4M), targeting constitutive TRAIL-expressing T cells to tumors using the external CAR domain modestly increased response rates (Figure 4M).

[0267] Local RT effectively preconditions tumors for subsequent CAR T cell administration To determine whether systemic RT is required for sensitization by CAR T cells or whether local RT to the tumor is sufficient, mice bearing orthotopic PDAC were treated with RT either systemically or to the pancreatic tumor alone, followed by CAR T cell administration (Figure 5A). Although total body RT-treated mice tended to have more T cell tumor infiltration at early time points (Figure 13), both strategies resulted in similar tumor responses (Figure 5B-5D). Thus, despite potentially different host effects between systemic and local low-dose RT, either approach effectively sensitizes heterologous tumors to killing by CAR T cells.

[0268] RT and CAR T cell treatment in a patient with heterogeneous tumors: A case report There is limited experience combining RT with CAR T cells. Just as tumor cells transcriptionally primed by RT for TRAIL-mediated killing exhibited significantly more death in response to CAR T cells in cell culture and mouse studies, it is conceivable that a similar sensitization may occur in nearby antigen-negative normal tissue cells after RT. A large proportion of CD19 -A patient with refractory diffuse large B-cell lymphoma (DLBCL) harboring tumor cells (Figure 5E-5F) presented for CD19 CAR therapy (NCT02631044). The patient had painful disease penetrating the skin of the lower legs, especially the right lower leg. Palliative RT was given to the patient's right lower leg (4 Gy × 5 fractions), and then the patient received CD19 CAR T cells as planned. Days and weeks after CAR T cell therapy, the patient had no signs or symptoms of toxicity within the irradiated area. The patient presented with grade 2 CRS without neurological symptoms. One month after CAR T cells, the patient had an excellent response based on PET-CT imaging (Figure 5G). Two months after CAR T cell infusion, the tumor rebounded with CD19 low / negative expression in previous and new locations, except in the affected area that received palliative RT followed by CAR T cells. Now, one year after treatment, areas of antigen-heterogeneous tumor subjected to palliative RT followed by CAR T cells remain in CR (Figure 5G).

[0269] Consideration The initial choice to target CD19 in B cell malignancies was driven primarily by the elevated and relatively homogenous expression of CD19 in leukemias and lymphomas, and the restriction of its expression in normal tissues to the B cell lineage (Brentjens et al., Nat Med (2003); 9:279-286; Maher et al., Nat Biotechnol (2002); 20:70-75). Based on the remarkable complete remission rates of 70-90% among patients in Phase I ALL trials (Sadelain, J Clin Invest (2015); 125:3392-3400), the prospect of expanding CAR therapy to a broad range of cancers is looming. CAR therapy has only recently begun to address solid tumors (Zhao et al., Cancer Cell (2015); 28:415-428; Morello et al., Cancer Discov (2016); 6:133-146; Jindal et al., Med Oncol (2018); 35:87), but results have so far been modest, with few major responses (Louis et al., Blood (2011); 118:6050-6056; Brown et al., N Engl J Med (2016); 375:2561-2569). Because escape and regrowth of antigen-negative tumor cells is now a well-documented mechanism of resistance to CAR therapy (Brown et al., N Engl J Med (2016); 375:2561-2569; Gardner et al., Blood (2016); 127:2406-2410; Jackson and Brentjiens, Cancer Discov (2015); 5:1238-1240), a novel method that enables CAR T cells to effectively prevent antigen escape A more appropriate approach is needed.

[0270] An early approach to overcome antigen escape from CAR T cells is to target two different antigens (Hegde et al., J Clin Invest (2016); 126:3036-3052). Another approach is to target the secretion of activating cytokines such as IL-18 (Avanzi et al., Cell Rep (2018); 23: 2130-2141) or co-stimulatory ligand expression (Zhao et al., Cancer Cell (2015); 28:415-428) to recruit endogenous T cells. Subsequently, checkpoint inhibitor therapy was added to CAR T cells with the aim of reactivating both CAR T cells and endogenous tumor-reactive T cells (Suarez et al. al., Oncotarget (2016); 7:34341-34355; Cherkassky et al., J Clin Invest (2016); 126:3130-3144). However, all of these approaches have not been These approaches rely on tumor cells expressing tumor-specific antigens that are recognized by either the CAR or the TCR. None of these approaches provide a mechanism by which tumor cells that lack both the CAR target and an immunogenic TCR epitope can be eliminated by T cells.

[0271] The approach reported here delineates a mechanism by which tumor cells can be conventionally eliminated in trans by CAR T cells independent of immunogenicity, and thus may be particularly beneficial in low mutational burden tumors, which are associated with acquired antigen escape and have a low probability of neoantigen presentation and recognition.

[0272] The spatial and temporal specificity achieved here relies on the physiological response of CAR T cells and radiosensitization of tumor cells independent of target expression. The observation that TRAIL is induced in CAR T cells after tumor encounter ensures active and maximal production within the tumor microenvironment. Ag via targeted RT + and Ag -The ability to induce TRAIL receptors on tumor cells offers a unique opportunity to enhance site-specific CAR T cell efficacy against heterologous tumors. The effect of this interaction has multiple implications. Both systemic and local RT have been found to sensitize tumors to killing by CAR T cells. Most importantly, in antigen-heterogeneous pancreatic cancer, other In some cases, Ag escapes from CAR recognition - It has been shown that tumor cells can be eliminated by CAR T cells in vivo after low-dose RT. In the case of systemic disease, low-dose total body irradiation may effectively sensitize tumor cells, resulting in elimination at lower CAR T cell doses, enhancing efficacy while potentially reducing the risk of cytokine release syndrome.

[0273] The early observation that tumor cells are highly sensitive to TRAIL-induced apoptosis compared with normal cells (Walczak et al., Nat Med (1999); 5:157-163) was supported by the use of recombinant This has generated intense interest in therapies based on TRAIL or agonistic TRAIL receptors. Unfortunately, this therapy faces multiple limitations, including the short half-life of TRAIL protein (Ichikawa et al., Nat Med (2001); 7: 954-960), the reduced apoptotic potential of bivalent antibodies (Wajant, Cell Death Differ (2015); 22:1727-1741), limited local tumor penetration when administered systemically, and resistance to downstream apoptosis due to altered tumor gene expression (Ichikawa et al., Nat Med (2001); 7: 954-960). CAR T cells as a source of TRAIL offer several potential advantages, such as concentrated TRAIL synthesis within the tumor, continuous production as long as tumor and T cells are present, and the provision of natural trimeric protein rather than potentially less apoptotic bivalent antibodies (Wajant, Cell Death Differ (2015); 22:1727-1741). TRAIL is a death receptor Although CAR T cells can exert a proapoptotic effect via IL-5 (Tschumi et al., J Immunother Cancer (2018); 6:71), this activity was not observed prior to CAR T cell infusion. The effect is not increased by pre-radiation treatment.

[0274] Several other forms of immunotherapy are commonly combined with RT under certain circumstances. “Immunogenic” ablative high-dose radiation induces tumor death and, in some contexts, results in increased antigen presentation, subsequent T-cell activation, and potentially, “abscopal” or secondary immune responses against the non-irradiated tumor (Spiotto et al., Sci Immunol (2016); 1). Due to the low frequency of the abscopal effect in clinical practice, predictably harnessing this phenomenon remains an active area of ​​investigation. Unlike endogenous T cells, CAR T cells are not dependent on antigen presentation and radiation does not induce immune responses to CAR T cell therapy unless radiation induces the expression of specific CAR targeting molecules (Weiss et al., Cancer Res (2018); 78:1031-1043). It is not intuitive whether sensitizing radiation has an immunogenic, immunosuppressive, or unrelated effect. We have described a fundamentally different kind of "immunogenic radiation" in the context of CAR T cell therapy, namely, sublethal, low doses of radiation that locally transsensitize tumors to killing by CAR T cells. Unlike its ablative counterpart, sensitizing radiation is limited both by location and size of disease. Given that RT is not required and the much lower doses, it may be applied more widely for patients with diffuse metastases due to less concern regarding RT-related side effects.

[0275] Patients with xenogeneic tumors treated with palliative (non-curative) RT prior to CAR T-cell therapy showed results consistent with the mouse data, without any signs of excessive toxicity. This clinical correlation is consistent with the animal findings, but does not test the hypothesis. In particular, the effect of RT alone on the durable complete response of the patient's xenogeneic tumor cannot be ignored. However, the administered radiation dose was not able to eliminate the patient's tumor ex vivo, and was roughly consistent with half the standard locally curative dose of >45 Gy for gross disease in this type of aggressive lymphoma (Ng et al., International journal of radiation oncology, biology, physics (2018); 100:652-669). Furthermore, although no toxicity was observed in the RT areas of the lower extremities, it is possible that other normal tissues, such as the GI system, may exhibit enhanced RT sensitivity to activated CAR T cell-produced TRAIL (Finnberg et al., Cancer Res (2016); 76:700-712). Clinical trials incorporating RT with CAR T cells are planned to evaluate the effect on clonal antigen heterogeneity, the safety of RT conditioning, and the systemic effect of local RT on CAR T cell-mediated disease responses.

[0276] RT is currently used at some point for palliation in the treatment of approximately half of metastatic cancer patients and is commonly utilized as an alternative to or in addition to surgery to improve local control in almost all non-metastatic cancer types (Miller et al., CA Cancer J Clin (2016); 66:271-289). Implementing CAR therapy into current RT regimens may further improve local and systemic tumor control. Findings suggest that integrated delivery of these two types of therapy would ensure coordination between disease management teams.

[0277] The findings support the notion that multimodality CAR therapy with RT conditioning can improve responses in solid tumors. Most importantly, we have realized a mechanistic platform that can further enhance engineered T cells to clonally eliminate heterogeneous solid tumors.

[0278] material and method cell culture Tumor cells expressing firefly luciferase-GFP were previously described (Zhao et al., Cancer Cell (2015); 28:415-428). 293T cell lines, H29 and retrovirus The rus packaging cell line was cultured in DMEM supplemented with 10% FCS (Zhao et al. al., Cancer Cell (2015); 28:415-428). Capan-2 cells were The cells were kindly provided by .Lewis (MSKCC) and were grown in RPMI supplemented with 10% FCS. Cells were tested for mycoplasma using the MycoAlert mycoplasma detection kit (Lonza) before being injected into animals.

[0279] Buffy coats from healthy volunteer donors were obtained from the New York Blood Center. Peripheral blood mononuclear cells were isolated by density gradient centrifugation, and the cells were then stimulated with PHA (Sigma) and cultured as previously described (Zhao et al., Cancer Cell (2015); 28:415-428).

[0280] radiation Radiation dose: All experiments with PDAC used 2 Gy unless otherwise specified. For in vitro RT studies, all RT sensitization experiments were performed with RT administered to tumor cells 2 days prior to tumor analysis or coculture with T cells unless otherwise specified.

[0281] Irradiation Methods: Focal RT to the pancreas was performed by identifying the pancreatic tumor using intraperitoneal contrast-enhanced cone-beam CT imaging in an X-Rad 225Cx system that combines high-precision cone-beam CT imaging with 3D image-guided radiation treatment under general anesthesia. Focal RT was delivered using either an anterior-posterior beam or an anteroposterior and lateral beams. Experiments requiring lower target precision (total body RT) were delivered using an open jaw in the AP orientation. The experiments were carried out using a small animal irradiation device equipped with a 3-way jaw.

[0282] Flow cytometry CD3 (UCHT1), CD4 (S3.5), CD8 (3B5), DR5 (DJR2-4, PE conjugated, BioLegend), CD95 (DX2, PE-Cy7 conjugated, BD Biosciences), LeA (7LE, AF405 conjugated, Novus), CD19 (SJ25C1), 41BBL (5F4 ) and fluorochrome-conjugated antibodies against granzyme B (FGB12, Invitrogen) were used. Alexa647-conjugated goat anti-human F(ab) 2 (ThermoFisher) was used to detect CAR. Flow cytometry was performed on a BD LSRII and data was analyzed using FlowJo software version 9.5.2 (TreeStar). Human Fc receptor binding inhibitor antibody (eBioscience) was used to block Fc receptors. In some cases, CountBright beads (Invitrogen) were added to the samples to count the number of cells.

[0283] TRAIL measurement For RNA and ELISA experiments, CAR T cells were exposed to Capan2 expressing the target antigen for 4 hours, followed by removal and monoculture of T cells and reseeding in fresh medium every day. Cells were removed and analyzed for TRAIL mRNA expression at given time points, and medium was collected at the end of each day for TRAIL ELISA (MyBiosource MBS335491). qPCR was performed using the TaqMan system (ThermoFisher) using primers Hs00921974 (TRAIL), Hs00366278 (DR5) and Hs04194366 (RPL13A housekeeping).

[0284] RNA extraction and real-time quantitative PCR Total RNA was extracted from cells by using the RNeasy kit (QIAGEN) according to the manufacturer's instructions. RNA concentration and quality were assessed by UV spectroscopy using a NanoDrop spectrophotometer (Themo Fisher Scientific). cDNA was prepared using 100-200 ng of total RNA using SuperScript III First-Strand Synthesis SuperMix (Invitrogen) with a 1:1 volume ratio of random hexamers and oligo dT. Completed cDNA synthesis reactions were treated with 2U of RNase H for 20 min at 37°C. Quantitative PCR was performed using ABsolute Blue qPCR SYBR Green Low ROX Mix. PCR assays were performed in a QuantStudio™ 7 Flex system and were run at 37°C for 20 min. t Values ​​were obtained using QuantStudio real-time PCR software. Relative changes in gene expression were calculated using the 2 ΔΔCt The analysis was carried out using the method.

[0285] Vector constructs The 1928ζ and 19BBζ CARs containing the SJ25C1 CD19-specific scFv have been previously described (Maher et al., Nat Biotechnol (2002); 20:70-75). BBz and L28z express CD19-specific scFv as Le A The L(del) mutant was constructed by replacing the L(del) mutant with human 5B1 scFv targeting the L(del) mutant. All constructs were designed to express Gaussia luciferase for T cell imaging as previously described (Santos et al., Nat Med (2009); 15:338-344). Constructs were generated by removing the intracellular costimulatory and signaling domains from the designated constructs while retaining the extracellular and transmembrane portions. Constructs expressing TRAIL were generated by adding the TRAIL cDNA sequence followed by the designated CAR and P2A sequences.

[0286] Retrovirus production and transduction A plasmid encoding the SFG γ-retroviral (RV) vector (Riviere et al., Proc Natl Acad Sci USA (1995); 92:6733-6737) was prepared as previously described (Maher et al., Nat Biotechnol (2002); 20:70-75). Stable retrovirus-producing cell lines were constructed as previously described using VSV-G pseudotyped retroviral supernatants derived from gpg29 fibroblasts (H29) (Gallardo et al., Blood (1997); 90:952-957). T cells were transfected with RetroNectin (Takara ) coated plates and transduced by centrifugation. For T cell knockout studies, CAR transduction was performed immediately after Cas9 / gRNA electroporation as described (Eyquem et al., Nature (2017); 543, 113-117).

[0287] Cytotoxic T lymphocyte assay (CTL) Cytotoxicity of CTL:CAR-transduced T cells using 100% Ag+ tumor cells was determined by standard luciferase-based assay. For luciferase-based assay, tumor cells expressing firefly luciferase-GFP served as target cells. Effector and tumor cells were co-cultured in triplicate in black-walled 96- or 384-well plates at the indicated E / T ratios. Target cells alone were seeded at the same cell density to determine baseline luciferase expression (no T cell control). After 18 hours, luciferase substrate (Bright-Glo, Promega) was added directly to each well. Emitted light was measured by a luminescence plate reader or a Xenogen IVIS imaging system (Xenogen) with Living Image software (Xenogen) for acquisition of imaging data sets. Lysis was determined as [1-(RLUsample) / (RLUmax)]×100. Assays were performed using CAR T cells transduced within the previous week.

[0288] CTLs using 75% Ag+, 25% Ag- tumor cells: In experiments involving prestimulated CAR T cells, all CAR T cells were grown at a constant concentration of 1 million cells / ml in the presence of 20 U / ml IL-2 for 10-12 days and reconstituted every other day. Cells were transferred to adherent cells (Leu cells) containing the target antigen one day before the experiment. A + Capan2), and on the day of the experiment, the T cells were removed by aspiration. The CAR T cells were then stimulated with RT-sensitized 75% Ag + LBBz CAR T cell cultures were co-cultured with Capan2 PDAC at an E:T ratio of 1:3 in 48-well plates. The relative numbers of remaining Ag+ and Ag- tumor cells, as well as the percent killing compared to untreated controls, were determined at predefined time points of 4 days for LBBz CAR T cell cultures and 5 days for L(del)CAR T cell cultures. In experiments that specifically quantified Ag- cell killing, only Ag- cells expressed luciferase.

[0289] For all cytotoxicity assays using RT, tumor cells (Capan2) were given RT and grown in culture for 2 days, and then live cells were incubated with CAR T cells.

[0290] Video microscopy Ag labeled with CTV (CellTrace Violet, Fisher C34571) - Cells were incubated with CAR T cells in 8-well microscopy slides and unlabeled Ag in addition to Annexin V595 (Fisher A13203). + Cells and 75% LeA + The mixture was mixed at a ratio of 0.1:1. Confocal images were acquired every 7 min for 18 h in culture at optimal imaging parameters using an LSM880 confocal microscope (Carl Zeiss). Data were 3D rendered and visualized using Imaris (Bitplane). - The percentage of cell killing was calculated based on the total Ag - Cells (blue cells) and dead / dying Ag - All time points were determined using a custom macro written in ImageJ / FIJI (NIH) that automatically quantified cells (red and blue double positive).

[0291] Gene disruption Forty-eight hours after initiating T cell activation, cells were transfected by electrophoretic transcription of Cas9 mRNA and gRNA using the AgilePulse MAX system (Harvard Apparatus). 6 The cells were mixed with 5 μg of Cas9 and 5 μg of gRNA and placed in a 0.2 cm cuvette. After electroporation, the cells were diluted in culture medium and incubated at 37 °C, 5% CO 2The cells were incubated with 5% CO. To obtain TCR-negative T cells, TCR-positive T cells were depleted using magnetic biotin anti-TCRαβ and anti-biotin microbeads and LS columns (Miltenyi Biotech) 3–5 days after gRNA transfection. To obtain TRAIL-negative cells, TRAIL-positive T cells were depleted using magnetic PE-anti-TRAIL (R&D, FAB687P) and anti-PE microbeads in an LS column (Miltenyi Biotech). To obtain DR5-negative cells, FACS sorting was performed using PE-anti-DR5 staining.

[0292] For TCR knockout, gRNAs targeting a sequence in the first exon of the constant chain (TRAC) of the TCR alpha gene, which is required for TCR alpha and beta to assemble and localize to the cell surface, were used as previously described. 42 TRAIL was performed using a synthetic modified gRNA kit (Synthego). Guide RNA was diluted to 1 μg μl in cytoporation T buffer (Harvard Apparatus). -1 Cas9 mRNA was synthesized by TriLink Biotechnologies.

[0293] Pancreatic cancer tumor model 8-12 week old NOD / SCID / IL-2Rγ-null (NSG) male mice (Jackson Laboratory) were used according to a protocol approved by the MSKCC Animal Care and Use Committee. A defined ratio of LeA+ and LeA- FACS sorted Capan2 PDAC tumor cells were injected into the pancreas of NSG mice after surgically dissecting the mice and exposing the pancreas according to an IRB approved mouse protocol. 75,000 tumor cells in 50% Matrigel were injected per mouse. Mice were randomized to treatment and treatment groups were blinded to the personnel performing the treatment and tumor assessment. Tumors were allowed to establish in the pancreas for 9 days and then mice were treated with RT followed by T cells. Tumor volumes were measured by bioluminescence imaging (BLI) using retro-orbital D-luciferin injection followed by IVIS imaging. Tumor burden of each mouse was expressed over time relative to that mouse's baseline tumor BLI at the start of treatment.

[0294] T cell imaging CAR T cells containing Gaussia luciferase were imaged using retro-orbitally injected coelenterazine (3031-10 Coelenterazine-SOL in vivo, Nanolight).

[0295] Transcriptome analysis Cells were lysed in Trizol LS (Invitrogen) and then submitted to the Integrated Genomics Operation at MSKCC for RNA extraction. After ribogreen quantification and quality control on a bioanalyzer, 500ng of total RNA underwent library preparation by 6 cycles of PCR using Truseq Stranded Total RNA library prep chemistry (Illumina). Samples were barcoded and run on a Hiseq2500 1T in a 50bp / 50bp paired-end run using the TruSeq SBS kit v3 (Illumina). An average of 51 million paired reads were generated per sample, and the percent mRNA bases averaged 58%.

[0296] The output FASTQ data files were mapped to the target genome using the rnaStar aligner, which maps the reads to the genome to resolve reads spanning splice junctions. A two-pass mapping method was used, where the reads were mapped twice. The first mapping pass uses a list of known annotated junctions from Ensemble. The new junctions found in the first pass are then added to the known junctions and a second mapping pass is performed (using the RemoveNoncanoncial flag for the second pass). After mapping, the output SAM files were post-processed using PICARD tools, such as a tool to add read groups, AddOrReplaceReadGroups, which further sorts the file and converts it to a compressed BAM format. Expression count matrices from the mapped reads were calculated using HTSeq (www-huber.embl.de) and one of several possible gene model databases. The raw count matrix generated by HTSeq is then processed using the R / Bioconductor package DESeq (www-huber.embl.de), which is used both to normalize the complete dataset and to analyze differential expression between sample groups.

[0297] For GSA we used the Bioconductor package PIANO (bioconductor.org). The exact call was gsa.res<-runGSA(fc, geneSetStat="mean", gsc=gsc, gsSizeLim=c(min.gns, max.gns), nPerm=nPerm), where fc==fold change, min.gns==5, max.gns==1000, nPerm==1e4. For gene sets we used MSigDb from Broad (software.broadinstitute.org). The following collections were used: "c1.all.v4.0.symbols.gmt", "c2.all.v4.0.symbols.gmt", "c3.all.v4.0.symbols.gmt", "c5-1.all.v4.0.symbols.gmt", "c6-1.all.v4.0.symbols.gmt", "c7.all.v4.0.symbols.gmt".

[0298] statistics All experimental data are expressed as mean ± sem. No statistical methods were used to predetermine sample size. Groups were compared using unpaired two-tailed t-tests. Statistical analysis was performed in GraphPad Prism7 software.

[0299] Embodiments of the Subject Matter of the Disclosure From the foregoing description, it is apparent that variations and modifications can be made to the subject matter of the present disclosure to adapt it to various usages and conditions, such embodiments also falling within the scope of the following claims.

[0300] The recitation of a list of elements in any definition of a variable herein includes that definition of the variable as any single element or combination (or subcombination) of the listed elements. The recitation of an embodiment herein includes that embodiment as any single embodiment or combination with any other embodiment or portion thereof.

[0301] All patents and publications mentioned in this specification are herein incorporated by reference to the same extent as if each individual patent and publication was specifically and individually indicated to be incorporated by reference. In certain embodiments, for example, the following items are provided: (Item 1) A chimeric antigen receptor (CAR) comprising an extracellular antigen-binding domain, a transmembrane domain, and an intracellular domain, wherein the extracellular antigen-binding domain cross-competes with a reference antibody, or antigen-binding portion thereof, for binding to Sialyl Lewis A, and the reference antibody, or antigen-binding portion thereof, A chimeric antigen receptor (CAR) comprising a heavy chain variable region CDR1 having the amino acid sequence shown in SEQ ID NO:1, a heavy chain variable region CDR2 having the amino acid sequence shown in SEQ ID NO:2, a heavy chain variable region CDR3 having the amino acid sequence shown in SEQ ID NO:3, a light chain variable region CDR1 having the amino acid sequence shown in SEQ ID NO:4, a light chain variable region CDR2 having the amino acid sequence shown in SEQ ID NO:5, and a light chain variable region CDR3 having the amino acid sequence shown in SEQ ID NO:6. (Item 2) A chimeric antigen receptor (CAR) comprising an extracellular antigen-binding domain, a transmembrane domain, and an intracellular domain, wherein the extracellular antigen-binding domain binds to the same epitope on Sialyl Lewis A as a reference antibody, or antigen-binding portion thereof, and the reference antibody, or antigen-binding portion thereof, A chimeric antigen receptor (CAR) comprising a heavy chain variable region CDR1 having the amino acid sequence shown in SEQ ID NO:1, a heavy chain variable region CDR2 having the amino acid sequence shown in SEQ ID NO:2, a heavy chain variable region CDR3 having the amino acid sequence shown in SEQ ID NO:3, a light chain variable region CDR1 having the amino acid sequence shown in SEQ ID NO:4, a light chain variable region CDR2 having the amino acid sequence shown in SEQ ID NO:5, and a light chain variable region CDR3 having the amino acid sequence shown in SEQ ID NO:6. (Item 3) A chimeric antigen receptor (CAR) comprising an extracellular antigen-binding domain, a transmembrane domain and an intracellular domain, wherein the extracellular antigen-binding domain specifically binds to sialyl Lewis A, and comprises a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 3 or a conservative modification thereof, and a light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 6 or a conservative modification thereof. (Item 4) The CAR of item 3, wherein the extracellular antigen-binding domain comprises a heavy chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 2, or a conservative modification thereof, and a light chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 5, or a conservative modification thereof. (Item 5) 5. The CAR of item 3 or 4, wherein the extracellular antigen-binding domain comprises a heavy chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 1, or a conservative modification thereof, and a light chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 4, or a conservative modification thereof. (Item 6) A chimeric antigen receptor (CAR) comprising an extracellular antigen-binding domain, a transmembrane domain and an intracellular domain, wherein the extracellular antigen-binding domain specifically binds to sialyl Lewis A, and comprises a heavy chain variable region CDR1 comprising the amino acid sequence shown in SEQ ID NO:1, a heavy chain variable region CDR2 comprising the amino acid sequence shown in SEQ ID NO:2, and a heavy chain variable region CDR3 comprising the amino acid sequence shown in SEQ ID NO:3. (Item 7) A chimeric antigen receptor (CAR) comprising an extracellular antigen-binding domain, a transmembrane domain and an intracellular domain, wherein the extracellular antigen-binding domain specifically binds to sialyl Lewis A and comprises a light chain variable region CDR1 comprising the amino acid sequence shown in SEQ ID NO: 4, a light chain variable region CDR2 comprising the amino acid sequence shown in SEQ ID NO: 5, and a light chain variable region CDR3 comprising the amino acid sequence shown in SEQ ID NO:6. (Item 8) The CAR of any one of items 3 to 7, wherein the extracellular antigen-binding domain comprises a heavy chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 1, a heavy chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 2, a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 3, a light chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 4, a light chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 5, and a light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 6. (Item 9) A chimeric antigen receptor (CAR) comprising an extracellular antigen-binding domain, a transmembrane domain, and an intracellular domain, wherein the extracellular antigen-binding domain specifically binds to sialyl Lewis A, and comprises a heavy chain variable region comprising an amino acid sequence that is at least about 80% homologous (e.g., at least about 80% identical) to the amino acid sequence set forth in SEQ ID NO:7. (Item 10) The CAR of item 9, wherein the extracellular antigen-binding domain comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:7. (Item 11) A chimeric antigen receptor (CAR) comprising an extracellular antigen-binding domain, a transmembrane domain, and an intracellular domain, wherein the extracellular antigen-binding domain specifically binds to sialyl Lewis A, and comprises a light chain variable region comprising an amino acid sequence that is at least about 80% homologous (e.g., at least about 80% identical) to the amino acid sequence set forth in SEQ ID NO:8. (Item 12) The CAR of item 13, wherein the extracellular antigen-binding domain comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:8. (Item 13) A chimeric antigen receptor (CAR) comprising an extracellular antigen-binding domain, a transmembrane domain, and an intracellular domain, wherein the extracellular antigen-binding domain specifically binds to sialyl Lewis A; a) a heavy chain variable region comprising an amino acid sequence that is at least about 80% homologous (e.g., at least about 80% identical) to the amino acid sequence set forth in SEQ ID NO:7, and b) a light chain variable region comprising an amino acid sequence that is at least about 80% homologous (e.g., at least about 80% identical) to the amino acid sequence set forth in SEQ ID NO:8. and a chimeric antigen receptor (CAR). (Item 14) The CAR of item 13, wherein the extracellular antigen-binding domain comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 7 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 8. (Item 15) 15. The CAR of item 13 or 14, wherein the extracellular antigen-binding domain comprises a heavy chain variable region comprising an amino acid sequence that is at least about 80% homologous (e.g., at least about 80% identical) to the amino acid sequence set forth in SEQ ID NO: 7 and a light chain variable region comprising an amino acid sequence that is at least about 80% homologous (e.g., at least about 80% identical) to the amino acid sequence set forth in SEQ ID NO: 8. (Item 16) 16. The CAR of any one of items 13 to 15, wherein the extracellular antigen-binding domain comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 7 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 8. (Item 17) 17. The CAR of any one of items 1 to 16, wherein the extracellular antigen-binding domain comprises a single chain variable fragment (scFv). (Item 18) 18. The CAR of any one of items 1 to 17, wherein the extracellular antigen-binding domain comprises a human scFv. (Item 19) 17. The CAR of any one of items 1 to 16, wherein the extracellular antigen-binding domain comprises a Fab, optionally cross-linked. (Item 20) The extracellular antigen-binding domain is an F(ab) 2 17. The CAR of any one of items 1 to 16, comprising: (Item 21) The scFv, Fab and F(ab) 221. The CAR of any one of items 17 to 20, wherein one or more of the following are included in a fusion protein with a heterologous sequence to form the extracellular antigen-binding domain. (Item 22) 22. The CAR of any one of items 1 to 21, wherein the extracellular antigen-binding domain comprises a linker between the heavy chain variable region and the light chain variable region of the extracellular antigen-binding domain. (Item 23) 23. The CAR of any one of items 1 to 22, wherein the extracellular antigen binding domain comprises a signal peptide covalently linked to the 5' end of the extracellular antigen binding domain. (Item 24) 24. The CAR of any one of items 1 to 23, wherein the transmembrane domain comprises a CD8 polypeptide, a CD28 polypeptide, a CD3zeta polypeptide, a CD4 polypeptide, a 4-1BB polypeptide, an OX40 polypeptide, an ICOS polypeptide, a CTLA-4 polypeptide, a PD-1 polypeptide, a LAG-3 polypeptide, a 2B4 polypeptide, a BTLA polypeptide, a synthetic peptide (not based on a protein associated with an immune response), or a combination thereof. (Item 25) 25. The CAR of any one of paragraphs 1 to 24, wherein the intracellular domain further comprises at least one costimulatory signaling region. (Item 26) 26. The CAR of item 25, wherein the at least one costimulatory signaling region comprises a CD28 polypeptide, a 4-1BB polypeptide, an OX40 polypeptide, an ICOS polypeptide, a DAP-10 polypeptide, or a combination thereof. (Item 27) 27. The CAR of paragraph 26, wherein the at least one costimulatory signaling region comprises a CD28 polypeptide. (Item 28) 28. The CAR of any one of items 1 to 27, wherein the intracellular signaling domain comprises a wild-type CD3ζ polypeptide or a modified CD3ζ polypeptide, wherein the modified CD3ζ polypeptide a) lacks all or a portion of an immunoreceptor tyrosine-based activation motif (ITAM), wherein the ITAM is ITAM1, ITAM2, and ITAM3, and / or a) lacks all or a portion of a basic-rich stretch (BRS) region, wherein the BRS region is BRS1, BRS2, ​​and BRS3. (Item 29) The modified CD3ζ polypeptide is a) lacking ITAM2 or a portion thereof, and, optionally, i) lacking ITAM3 or a portion thereof and / or ii) further lacking ITAM1 or a portion thereof, b) lacking ITAM1 or a portion thereof, and optionally further lacking ITAM3 or a portion thereof; c) lacking ITAM3 or a portion thereof; d) a deletion of ITAM2 or a portion thereof, and optionally further comprising i) a deletion of ITAM3 or a portion thereof and / or ii) a deletion of ITAM1 or a portion thereof; e) comprising a deletion of ITAM1 or a portion thereof, and optionally further comprising a deletion of ITAM3 or a portion thereof; and / or f) The CAR of item 28, comprising a deletion of ITAM3 or a part thereof. (Item 30) The modified CD3ζ polypeptide is a) lacking BRS2 or a portion thereof, and optionally further lacking i) BRS3 or a portion thereof and / or ii) BRS1 or a portion thereof; b) lacking BRS1 or a portion thereof, and optionally further lacking BRS3 or a portion thereof; c) lacking BRS3 or a portion thereof; and / or d) lacking BRS1 or a portion thereof, BRS2 or a portion thereof, and BRS3 or a portion thereof; e) comprising a deletion of BRS2 or a portion thereof, and optionally further comprising i) a deletion of BRS3 or a portion thereof and / or ii) a deletion of BRS1 or a portion thereof; f) comprising a deletion of BRS1 or a portion thereof, and optionally further comprising a deletion of BRS3 or a portion thereof; g) comprises a deletion of BRS3 or a portion thereof, and / or h) The CAR of item 28 or 29, which comprises a deletion of BRS1 or a part thereof, BRS2 or a part thereof, and BRS3 or a part thereof. (Item 31) 31. The CAR of any one of items 28 to 30, wherein the modified CD3ζ polypeptide lacks ITAM2, ITAM3, BRS2 and BRS3 or comprises a deletion of ITAM2, ITAM3, BRS2 and BRS3. (Item 32) and further comprising a hinge / spacer region, said hinge / spacer region optionally being a native or modified hinge / spacer of a molecule selected from the group consisting of a CD8 polypeptide, a CD28 polypeptide, a CD3ζ polypeptide, a CD4 polypeptide, a 4-1BB polypeptide, an OX40 polypeptide, a CD166 polypeptide, a CD166 polypeptide, a CD8a polypeptide, a CD8b polypeptide, an ICOS polypeptide, an ICAM-1 polypeptide, a CTLA-4 polypeptide, a CD27 polypeptide, a CD40 / My88 peptide, an NKGD2 peptide, or a combination thereof. 32. The CAR of any one of items 1 to 31, wherein the transmembrane domain is a native or modified transmembrane domain of a molecule selected from the group consisting of a CD8 polypeptide, a CD28 polypeptide, a CD3ζ polypeptide, a CD4 polypeptide, a 4-1BB polypeptide, an OX40 polypeptide, a CD166 polypeptide, a CD166 polypeptide, a CD8a polypeptide, a CD8b polypeptide, an ICOS polypeptide, an ICAM-1 polypeptide, a CTLA-4 polypeptide, a CD27 polypeptide, a CD40 / My88 peptide, an NKGD2 peptide, or a combination thereof. (Item 33) 33. The CAR of item 32, wherein the hinge / spacer region is derived from the same molecule from which the transmembrane domain is derived. (Item 34) a) The hinge / spacer region of the CD28 polypeptide and the membrane of the CD28 polypeptide Threading domain, b) the hinge / spacer region of the CD84 polypeptide and the transmembrane domain of the CD84 polypeptide; c) the hinge / spacer region of the CD166 polypeptide and the transmembrane domain of the CD166 polypeptide; d) the hinge / spacer region of a CD8a polypeptide and the transmembrane domain of a CD8a polypeptide; or e) the hinge / spacer region of the CD8b polypeptide and the transmembrane domain of the CD8b polypeptide 34. The CAR of item 33, comprising: (Item 35) 35. The CAR of item 34, comprising a hinge / spacer region of a CD166 polypeptide and a transmembrane domain of a CD166 polypeptide. (Item 36) 36. The CAR of claim 35, wherein the transmembrane domain and the hinge / spacer region are derived from different molecules. (Item 37) 37. The CAR of item 36, comprising a hinge / spacer region of a CD28 polypeptide and a transmembrane domain of an ICOS polypeptide. (Item 38) 38. The CAR of any one of items 1 to 37, which is recombinantly expressed or expressed from a vector. (Item 39) 39. The CAR of claim 38, wherein the vector is a retroviral vector (e.g., a gamma-retroviral vector). (Item 40) An immunoresponsive cell comprising the CAR of any one of the preceding items. (Item 41) The immunoresponsive cell of item 40, which is modified using a composition (e.g., a vector) comprising the CAR. (Item 42) 42. The immunoresponsive cell of item 40 or 41, wherein the CAR is constitutively expressed on the surface of the immunoresponsive cell. (Item 43) 43. The immunoresponsive cell of any one of items 40 to 42, selected from the group consisting of T cells, natural killer (NK) cells, human embryonic stem cells, lymphoid progenitor cells, T cell precursor cells and pluripotent stem cells from which lymphoid cells can be differentiated. (Item 44) 44. The immunoresponsive cell of item 43, which is a T cell. (Item 45) 45. The immunoresponsive cell of item 44, wherein the T cell is selected from the group consisting of a cytotoxic T lymphocyte (CTL), a regulatory T cell, and a central memory T cell. (Item 46) 40. A nucleic acid molecule comprising a nucleic acid sequence encoding the chimeric antigen receptor (CAR) of any one of items 1 to 39. (Item 47) 47. A vector comprising the nucleic acid molecule of item 46. (Item 48) 48. The vector according to item 47, which is a retroviral vector (e.g., a gamma-retroviral vector). (Item 49) A host cell comprising the vector of item 47 or 48 or expressing the nucleic acid molecule of item 46. (Item 50) 50. The host cell of item 49, which is a T cell. (Item 51) 40. A method for generating an immunoresponsive cell that binds to sialyl Lewis A, comprising introducing into the immunoresponsive cell a nucleic acid molecule comprising a nucleic acid sequence encoding a CAR of any one of paragraphs 1 to 39. (Item 52) 46. ​​A composition comprising an immunoresponsive cell according to any one of items 40 to 45. (Item 53) 53. The composition according to item 52, which is a pharmaceutical composition and further comprises a pharma- ceutically acceptable carrier. (Item 54) A method for treating or preventing malignant growth in a subject, comprising administering to the subject an effective amount of an immunoresponsive cell according to any one of items 40 to 45 or a composition according to item 52 or 53. (Item 55) 55. The method of claim 54, wherein the malignant growth is pancreatic cancer. (Item 56) 56. The method of item 54 or 55, wherein the method reduces or eradicates tumor burden in the subject. (Item 57) 57. The method of any one of items 54 to 56, wherein the subject is a human. (Item 58) 58. The method of any one of items 54 to 57, further comprising exposing the subject to a low dose of irradiation prior to said administering. (Item 59) 46. ​​A kit for treating or preventing malignant growth, comprising the immunoresponsive cell of any one of items 40 to 45, and optionally further comprising instructions for using said immunoresponsive cell to treat a subject having a neoplasm. (Item 60) 60. The kit of claim 59, wherein the malignant growth is pancreatic cancer.

Claims

[Claim 1] The invention described in the specification.

Images