PCR solution for nucleic acid detection

The composition of DNA polymerase, primers, urea, and RNase inhibitors enables direct nucleic acid amplification from biological samples without purification, addressing the time-consuming separation steps in current PCR methods and achieving efficient and accurate amplification.

JP2025085926APending Publication Date: 2025-06-06KYORIN PHARMACEUTICAL CO LTD
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
JP2023199638
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2023-11-27
Publication Date
2025-06-06

AI Technical Summary

Technical Problem

Current PCR methods require time-consuming separation and purification steps to isolate nucleic acid components from biological samples, which increases the time and labor required for nucleic acid amplification.

Method used

A composition comprising DNA polymerase, forward and reverse primers, urea, and RNase inhibitors, which allows for direct nucleic acid amplification from biological samples without the need for purification, using a reciprocal flow type nucleic acid amplifier.

Benefits of technology

This approach enables rapid and efficient nucleic acid amplification, reducing the time and labor required by eliminating the need for separation and purification steps, while maintaining accurate detection performance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025085926000001_ABST
    Figure 2025085926000001_ABST
Patent Text Reader

Abstract

To provide a nucleic acid amplification composition enabling direct amplification of nucleic acids without the need to separate or purify nucleic acid components from a biological sample.SOLUTION: A nucleic acid amplification composition is characterized by amplifying nucleic acids without isolating or purifying nucleic acid components from a biological sample, the nucleic acid amplification composition containing the following components (A) to (D): (A) DNA polymerase, (B) a forward primer and a reverse primer, (C) urea, and (D) an RNase inhibitor.SELECTED DRAWING: Figure 3
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] The present invention relates to a composition that enables direct gene detection without a purification step of nucleic acid components from a biological sample in the field of real-time PCR for detecting infections such as viruses and bacteria, as well as various genetic diseases. All of the documents described in this specification, including those listed below as prior art documents (patent documents and non-patent documents), are incorporated herein by reference in their entirety. [Background technology]

[0002] The detection of nucleic acids is central to various fields, such as pharmaceutical research and development, forensic medicine, clinical testing, and identification of types of agricultural crops and pathogenic microorganisms. PCR (polymerase chain reaction) is widely used to detect such nucleic acids. PCR is a technique for selectively amplifying a specific region of DNA. Specifically, DNA is amplified by sequentially repeating the individual reactions of denaturation of DNA into a single strand, annealing of the denatured single strand of DNA with a primer, and extension of the primer by a thermostable DNA polymerase enzyme, by repeating three-phase or two-phase temperature conditions called thermal cycles.

[0003] In addition, real-time PCR has been developed to facilitate detection of DNA amplified by PCR.

[0004] PCR can selectively amplify the target DNA, but in order to confirm the amplified DNA, a separate confirmation step such as gel electrophoresis was required after the PCR was completed. With real-time PCR, the presence or absence of the target DNA in a sample can be easily confirmed by generating or quenching fluorescence according to the amount of amplified target DNA.

[0005] In addition, in conventional PCR, when the amount of template DNA in a sample before PCR exceeds a certain amount, the amount of amplified DNA after PCR often reaches a plateau, making it impossible to quantify the amount of template DNA before PCR. However, in real-time PCR, the amount of amplified DNA during PCR can be detected in real time before the plateau is reached, making it possible to quantify the amount of template DNA before PCR from the state of DNA amplification. For this reason, real-time PCR is also called quantitative PCR.

[0006] General-purpose thermal cyclers used in PCR have slow temperature control due to the huge heat capacity of the aluminum block that acts as the heater, and traditionally it takes 1-2 hours, or even longer in some cases, to perform 30-40 PCR cycles. As a result, even with the latest genetic testing equipment, a total analysis usually takes more than an hour, and speeding up PCR operations has been a major challenge since the technology was introduced.

[0007] As a method for increasing the speed of PCR, a reciprocal flow type nucleic acid amplifier has been proposed (Patent Document 1).

[0008] In PCR using a reciprocal flow-type nucleic acid amplification device, a liquid delivery mechanism such as a microblower is used to move sample liquid back and forth between a flow path maintained at a denaturation temperature range and a flow path maintained at an extension and annealing temperature range, which are connected via an intermediate flow path, enabling DNA amplification in a short period of time.

[0009] However, PCR can be inhibited by proteins, sugars, and unknown contaminants, and the activity of many DNA polymerases is known to be strongly inhibited when biological contaminants are present in the PCR reaction solution.

[0010] For this reason, DNA amplification by PCR requires the separation of bacteria, viruses, etc. (hereafter referred to as gene inclusion bodies) from the test specimen, and further the extraction of nucleic acid from the gene inclusion bodies. The separation and extraction method involves decomposing the gene inclusion bodies with enzymes, surfactants, etc., and then extracting nucleic acid from the decomposition product of the gene inclusion bodies using phenol, etc. In addition, ion exchange resins, glass filters, glass beads, or reagents with protein coagulation properties are used in the nucleic acid extraction process.

[0011] However, these separation and purification steps require complicated operations, and therefore if these operations could be eliminated, the time and labor required could be significantly reduced. [Prior art documents] [Patent documents]

[0012] [Patent Document 1] International Publication No. 2016 / 006612 [Patent Document 2] International Publication No. 2020 / 189581 [Patent Document 3] International Publication No. 2022 / 153999 [Patent Document 4] US Patent 2005 / 042627 Summary of the Invention [Problem to be solved by the invention]

[0013] An object of the present invention is to provide a composition for nucleic acid amplification that is capable of directly amplifying nucleic acids from a biological sample without separating and purifying the nucleic acid components. [Means for solving the problem]

[0014] 1) A composition for amplifying nucleic acid, comprising the following components (A) to (D), and amplifying nucleic acid from a biological sample without isolating and purifying the nucleic acid component: (A) DNA polymerase (B) Forward and reverse primers (C)Urea (D)RNase inhibitors 2) The composition for amplifying nucleic acid according to 1), characterized in that a reciprocal flow type nucleic acid amplifier is used. 3) The composition for amplifying nucleic acid according to 1) or 2), further comprising at least one selected from the group consisting of (E) a probe labeled with a fluorescent dye, (F) a nonionic surfactant, and (G) an inorganic salt. 4) A kit for amplifying nucleic acid from a biological sample without isolating and purifying the nucleic acid component, comprising the following components (A) to (D): (A) DNA polymerase (B) Forward and reverse primers (C)Urea (D)RNase inhibitors 5) The kit according to 4), characterized in that a reciprocal flow type nucleic acid amplification device is used. 6) The kit according to 4) or 5), further comprising at least one selected from the group consisting of (C) a probe labeled with a fluorescent dye, (F) a nonionic surfactant, and (G) an inorganic salt. 7) A method for amplifying a nucleic acid, comprising the following steps (I) to (II): (I) preparing a composition comprising the composition according to 1) and a nucleic acid molecule serving as a template; and (II) reacting the composition obtained in step (I) under appropriate conditions to amplify nucleic acid 8) The nucleic acid amplification method according to 7), characterized in that a reciprocal flow type nucleic acid amplification device is used. 9) The nucleic acid amplification method according to 7) or 8), further comprising at least one selected from the group consisting of (E) a probe labeled with a fluorescent dye, (F) a nonionic surfactant, and (G) an inorganic salt. Effect of the Invention

[0015] According to the present invention, it is possible to provide a composition for nucleic acid amplification that can directly amplify nucleic acids without separating and purifying nucleic acid components from a biological sample. [Brief description of the drawings]

[0016] [Figure 1] FIG. 1 is a diagram showing an example of a flow path for a reciprocal flow type nucleic acid amplification device, the flow path having a flow path (high) that is maintained at a temperature suitable for DNA denaturation, and a flow path (low) that is maintained at a temperature suitable for extension and annealing. [Diagram 2] FIG. 1 is a diagram showing an example of a flow path for a reciprocal flow type nucleic acid amplification device, the flow path having a flow path (R) maintained at a temperature suitable for a reverse transcription reaction, a flow path (high) maintained at a temperature suitable for DNA denaturation, and a flow path (low) maintained at a temperature suitable for extension and annealing. [Diagram 3] This is a graph showing the results of real-time PCR without isolating and purifying nucleic acid components from biological samples. By adding an RNase inhibitor, the Ct value was shortened and the final fluorescence intensity was improved. [Figure 4] 1 is a graph showing the results of real-time PCR when a heat block type nucleic acid amplifier and a reciprocal flow type nucleic acid amplifier are used. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0017] The composition for amplifying nucleic acid of this embodiment contains components (A) to (D). The "DNA polymerase" of component (A) used in the composition of this embodiment is an enzyme that catalyzes the polymerization of a DNA chain of the base sequence of a template DNA using four types of deoxyribonucleoside triphosphates as substrates. A heat-resistant DNA polymerase that is resistant to heat is preferred, and known ones can be used. Examples include Taq DNA polymerase and Tth DNA polymerase belonging to family A (PolI type), KOD DNA polymerase, Pfu DNA polymerase, Pwo DNA polymerase, Ultima DNA polymerase, PrimeSTAR (registered trademark) DNA polymerase series (HS, GXL, Max), and mutants thereof, which belong to family B (α type). The "DNA polymerase" of component (A) is preferably a polymerase bound to an anti-DNA polymerase antibody. "Polymerase bound to anti-DNA polymerase antibody" refers to a polymerase with hot start properties in which DNA polymerase activity is inhibited by the binding of a specific antibody, and the bound antibody is released in the initial high-temperature denaturation step (e.g., 95°C), activating the DNA polymerase. The "forward primer and reverse primer" of component (B) used in the composition of this embodiment uses one type of forward primer and one type of reverse primer corresponding to one target gene region. However, it is sufficient that a pair is formed between the forward primer and the reverse primer, and it is not necessary that the number of types of forward primers and reverse primers in the solution is the same. For example, the solution of this embodiment may contain one type of forward primer and two types of reverse primers.

[0018] The content of component (B) in the composition of this embodiment is preferably a final concentration of 0.5 to 4 μM. The component (C) "urea" used in the composition of this embodiment has the effect of breaking hydrogen bonds in proteins, and is known as a denaturant for proteins and nucleic acids. The content of "urea" as component (C) in the composition of this embodiment is preferably 50 to 1500 mM as a final concentration, more preferably 100 mM to 1200 mM, and particularly preferably 150 mM to 1000 mM. The "RNase inhibitor" of component (D) used in the composition of this embodiment means any agent capable of preventing the degradation of RNA by enzymes having RNase activity, such as RNase A and RNase H. The term includes, but is not limited to, proteins, cross-linking reagents, and compounds that block the active site of an RNAse molecule. Examples include RNase Inhibitor (manufactured by Toyobo), Recombinant RNase Inhibitor (manufactured by Takara Bio), and RNasin (registered trademark) Ribonuclease Inhibitor (manufactured by Promega). The concentration of the "RNase inhibitor" of component (D) when used can be a known concentration applied to inhibit RNase activity. The concentration of the RNase inhibitor in the aqueous solution containing the RNase inhibitor of the present invention is preferably 0.01 to 200 U / μl, more preferably 0.1 to 60 U / μl, even more preferably 1 to 50 U / μl, and most preferably 2.5 to 40 U / μl, but is not particularly limited. Here, 1 U is the amount of RNase inhibitor required to inhibit the activity of 5 ng of RNase by 50%. The "fluorochrome-labeled probe" of component (E) used in the composition of this embodiment is an oligonucleotide bound to a fluorescent dye, and is intended to detect a target sequence by hybridizing with a complementary sequence. Examples of the fluorescent dye of the "probe labeled with a fluorescent dye" according to this embodiment include ABY, acridine, Alexa Fluor 488, Alexa Fluor 532, Alexa Fluor 594, Alexa Fluor 633, Alexa Fluor 647, ATTO (ATTO-TEC fluorescent dye), BioSearch Blue, Cy3, Cy3.5, Cy5, Cy5.5, coumarin, DANSYL, FAM (e.g., 5-FAM, 6-FAM), FITC, GP F, 5-HEX, 6-HEX, JOE, JUN, Marina Blue, NED, Oregon Green 488, Oregon Green 500, Oregon Green 514, Pacific Blue, PET, Pulsar, Quasar 570, Quasar 670, Quasar 705, Rhodamine Green, Rhodamine Red, 5-ROX, 6-ROX, 5-TAMRA, 6-TAMRA, 5-TET, 6-TET, Texas Red, TRITC, and VIC. Furthermore, the probe labeled with a fluorescent dye is preferably an oligonucleotide further bound to a quencher dye. The quencher dye is not particularly limited as long as it can quench the fluorescence emitted by the fluorescent dye, and examples of the quencher dye include TAMRA, BHQ (BHQ-1 to 3), and NFQ. The "nonionic surfactant" of component (F) used in the composition of this embodiment is a surfactant that does not have a group that dissociates into ions in an aqueous solution, and examples thereof include propylene oxide-ethylene oxide block copolymers, alkyl glycosides, nonylphenyl ethoxylates, polyethylene glycol trimethyl nonyl ethers, polyoxyethylene pt-octylphenyl ethers (Triton X100, Triton X45, Triton X114 (manufactured by The Dow Chemical Company), etc.), polyethylene alkyl ethers (Bridge 30), sorbitan fatty acid esters (Span type surfactants, Arlacel type surfactants), polyoxyethylene sorbitan fatty acid esters (Tween type surfactants, e.g. Tween 20), polyoxyethylene alkyl ethers (Bridge type surfactants), and glycerin fatty acid esters. The content of the (E) nonionic surfactant is preferably such that the final concentration in the composition of this embodiment is 0.001 to 0.5 w / w %.

[0019] The composition of this embodiment preferably further contains a component (G) inorganic salt. The coexistence of an inorganic salt enables PCR to be performed more efficiently. Examples of the component (G) inorganic salt that can be used in the present invention include salts that generate divalent cations, and magnesium salts are preferred. The content of the "inorganic salt" of component (G) is preferably 0.1 mM to 5 mM, more preferably 1 mM to 3 mM, in a final concentration relative to the composition of this embodiment.

[0020] The other components are not particularly limited as long as they do not impair the effects of the present invention and can be appropriately selected depending on the purpose. Examples of the other components include a buffer such as TE (10 mM Tris-HCl (pH 8.0), 1 mM EDTA), deoxynucleotide triphosphates (dNTPs), and fluorescent dyes such as SYBR Green dye. Fig. 1 is a schematic diagram showing the flow paths of a reciprocal flow type nucleic acid amplifier when the template is DNA, and Fig. 2 is a schematic diagram showing the flow paths of a reciprocal flow type nucleic acid amplifier when the template is RNA. The reciprocal flow type nucleic acid amplification device can be the device described in Patent Documents 1, 2, and 3. A sample liquid is introduced into a nucleic acid amplification chip in which a flow path is formed, and a liquid delivery mechanism is connected to both ends of the flow path. By using a microblower or an air blower as the liquid delivery mechanism, it becomes possible to perform reciprocating motion (liquid delivery, stop) between the temperature zone required for DNA denaturation in the thermal cycler and the temperature zone required for DNA elongation and annealing reaction.

[0021] The biological sample can be collected using a biological sample collection tool. The biological sample collection tool is used to collect a sample from a living body, and is not particularly limited. For example, it can be a swab, a spatula, a dropper, etc., and can be appropriately selected depending on the tissue or organ of the living body to be collected. A preferred biological sample collection tool is a swab.

[0022] The swab in the present invention is a swab capable of collecting a biological sample, and is preferably a flocked swab.

[0023] The biological sample collected by the biological sample collection tool is crushed as necessary, and the supernatant or filtrate is used as a sample. For crushing, BioMasher (registered trademark) series (Biomasher I, BioMasher II, BioMasher III, BioMasher V, BioMasher SP, manufactured by Nippi Corporation) can be used.

[0024] In FIG. 1, the flow path indicated as high is a flow path maintained at a temperature range required for DNA denaturation reaction in PCR (e.g., 90 to 100°C). The flow path indicated as low is a flow path maintained at a temperature range required for DNA elongation and annealing reaction in PCR (e.g., 40 to 75°C). The flow path indicated as high and the flow path indicated as low are connected via an intermediate flow path a. In a reciprocal flow type nucleic acid amplification device, a sample solution introduced into the flow path is passed back and forth between the flow path indicated as high and the flow path indicated as low, thereby performing thermal cycling related to PCR and amplifying DNA. The protocol related to PCR is not particularly limited, and for example, a known protocol can be used.

[0025] As in Fig. 1, the flow path indicated as high in Fig. 2 is a flow path maintained in a temperature range required for the DNA denaturation reaction in PCR, and the flow path indicated as low is a flow path maintained in a temperature range required for the DNA elongation and annealing reaction in PCR. The flow path indicated as R is a flow path where the reverse transcription reaction by reverse transcriptase is carried out, and is a flow path maintained in a temperature range required for the reverse transcription reaction (e.g., 37 to 45°C). The flow path indicated as high and the flow path indicated as low are connected via intermediate flow path a, and the flow path indicated as low and the flow path indicated as R are connected via flow path b.

[0026] When the template is RNA, the sample solution is first introduced into the channel shown as R, where a reverse transcription reaction is carried out by reverse transcriptase to produce DNA (cDNA) complementary to the RNA. The sample solution is then sent to the channel shown as high and the channel shown as low, and the sample solution is moved back and forth between the channel shown as high and the channel shown as low to carry out thermal cycling related to PCR and amplify the DNA.

[0027] The time for which the sample liquid is held in the denaturation temperature zone and the time for which the sample liquid is held in the extension / annealing temperature zone can each be appropriately set according to the target gene region (type of gene, length of region, etc.) For example, the time for which the sample liquid is held in the denaturation temperature zone can be about 2 to 10 seconds, and the time for which the sample liquid is held in the extension / annealing temperature zone can be about 2 to 60 seconds.

[0028] Experimental Example (Test Method) Heat-inactivated SARS-CoV-2 treatment solution was prepared by suspending 10^5 copies of heat-inactivated SARS-CoV-2 (ATCC) in 1 mL of 800 mM urea / 10 mM magnesium chloride aqueous solution. RT-PCR Master Mix (Kyorin Pharmaceutical Co., Ltd., containing reverse transcriptase / DNA polymerase / reverse transcriptase / buffer solution, etc.), HotStart TTx DNA polymerase (Toyobo Co., Ltd.), RNase Inhibitor (Toyobo Co., Ltd.) diluted to the required concentration, primer / probe / IC mix, RNase-Free Water, and heat-inactivated SARS-CoV-2 treatment solution were mixed in the following ratio per reaction: 12 μL:0.25 μL:1 μL:2 μL:0.75 μL:3 μL. Furthermore, 1 μL of concentrated swab pool solution suspended in 0.3 mL of RNase-free water (Takara Bio Co., Ltd.) was added per reaction per nasopharyngeal swab, and real-time PCR was performed with N=3 using GeneSoC mini (Kyorin Pharmaceutical Co., Ltd.) and its dedicated chip. The PCR conditions were reverse transcription reaction: 42°C, 60 seconds, activation reaction: 96°C, 10 seconds, thermal denaturation reaction (DN): 96°C, 4 seconds, annealing and extension reaction (AE): 58°C, 8 seconds. 50 cycles of DN and AE were performed, and the presence or absence of amplification was determined by visually observing the amplification curve displayed on the screen of the GeneSoC mini (Kyorin Pharmaceutical Co., Ltd.). Forward primer: AAATTTTGGGGACCAGGAAC Reverse primer: TGGCAGCTGTGTAGGTCAAC Probe: FAM-ATGTCGCGCATTGGCATGGA-TAMRA

[0029] (Test Results) The Ct value was shortened and the final fluorescence intensity was increased depending on the amount of RNase inhibitor added. These results demonstrate that RNase inhibitors are useful for improving the detection performance of direct RT-PCR using biological samples containing virus particles in a reciprocal flow nucleic acid amplification device.

[0030] Reference example (Test Method) 100 μM forward primer (SEQ ID NO: 1), 100 μM reverse primer (SEQ ID NO: 2), 100 μM probe (SEQ ID NO: 3), 2×Buffer for rTth / TTx (DNA) (Toyobo Co., Ltd.), Hot Start TTx DNA polymerase (Toyobo Co., Ltd.), and positive control DNA pUC57-N2 prepared at 250 copies / μL were mixed at the following ratio per reaction: 0.48 μL: 0.64 μL: 0.08 μL: 10.0 μL: 0.25 μL: 2.0 μL. The positive control DNA pUC57-N2 was linearized by inserting a sequence containing N2 (SEQ ID NO: 4) into the EcoRV site of the pUC57 vector. Furthermore, 1 μL of a solution containing 2.4 μM Cy5-Azide (Sigma), 0.24 μM DMSO (Fujifilm Wako Pure Chemical), 4 x ROX Reference Dye (Toyobo, prepared by diluting 50x), and 2 vol% Tween 20 (Fujifilm Wako Pure Chemical) was added. Next, to examine the effect of urea solution, 2 μL of 2 M, 4 M, and 8 M urea solutions or 4 μL of 8 M urea solution were added. RNase-free water was added to the above mixture so that the volume of the PCR reaction solution became 20 μL, and PCR reaction solutions with urea concentrations of 200 mM, 400 mM, 800 mM, and 1600 mM were prepared. These PCR reaction solutions were subjected to real-time PCR using GeneSoC mini (Kyorin Pharmaceutical) and LightCycler96 (Roche). The PCR conditions for the GeneSoC mini (Kyorin Pharmaceutical Co., Ltd.) were as follows: activation reaction: 96°C, 10 seconds; thermal denaturation reaction (DN): 96°C, 4 seconds; annealing and extension reaction (AE): 58°C, 8 seconds. 50 cycles of DN and AE were performed, and the presence or absence of amplification was determined from the displayed amplification curve. The PCR conditions for the LightCycler96 (Roche) were as follows: activation reaction: 95°C, 5 minutes; thermal denaturation reaction (DN): 95°C, 15 seconds; annealing and extension reaction (AE): 60°C, 60 seconds. 45 cycles of DN and AE were performed, and the presence or absence of amplification was determined from the displayed amplification curve. Forward primer: AAATTTTGGGGACCAGGAAC Reverse primer: TGGCAGCTGTGTAGGTCAAC Probe: FAM-ATGTCGCGCATTGGCATGGA-TAMRA

[0031] (Test Results) The amplification curve of the PCR reaction solution in GeneSoC mini (Kyorin Pharmaceutical Co., Ltd.) was clear at urea concentrations of 0, 200, 400, and 800 mM, but the rise was weak at a urea concentration of 1600 mM, and PCR reaction inhibition was observed. On the other hand, the amplification curve of the PCR reaction solution in LightCycler96 (Roche) was clear only at a urea concentration of 0 mM, but no rise was observed at urea concentrations of 200, 400, 800, and 1600 mM, and PCR reaction inhibition was clearly observed. From the above results, it was revealed that the reciprocal flow type nucleic acid amplification device is less susceptible to the inhibition of PCR reaction by urea, even when the PCR reaction solution has the same reaction composition.

Claims

1. A composition for amplifying nucleic acid, comprising the following components (A) to (D), and capable of amplifying nucleic acid from a biological sample without isolating and purifying the nucleic acid component: (A) DNA polymerase (B) Forward primer and reverse primer (C) Urea (D) RNase inhibitor

2. 1) A composition for amplifying nucleic acid according to 1), characterized in that a reciprocal flow type nucleic acid amplifier is used.

3. The composition for nucleic acid amplification according to 1) or 2), further comprising at least one selected from the group consisting of (E) a probe labeled with a fluorescent dye, (F) a nonionic surfactant, and (G) an inorganic salt.

4. A kit for amplifying nucleic acid from a biological sample without isolating and purifying the nucleic acid component, comprising the following components (A) to (D): (A) DNA polymerase (B) Forward primer and reverse primer (C) Urea (D) RNase inhibitor

5. The kit according to 4), characterized in that a reciprocal flow type nucleic acid amplification device is used.

6. The kit according to 4) or 5), further comprising at least one selected from the group consisting of (C) a probe labeled with a fluorescent dye, (F) a nonionic surfactant, and (G) an inorganic salt.

7. A method for amplifying a nucleic acid, comprising the following steps (I) to (II): (I) preparing a composition comprising the composition according to 1) and a nucleic acid molecule serving as a template; and (II) reacting the composition obtained in step (I) under appropriate conditions to amplify nucleic acid.

8. 8) The method for amplifying nucleic acid according to 7), characterized in that a reciprocal flow type nucleic acid amplifier is used.

9. The method for amplifying nucleic acid according to 7) or 8), further comprising at least one selected from the group consisting of (E) a probe labeled with a fluorescent dye, (F) a nonionic surfactant, and (G) an inorganic salt.

Citation Information

Patent Citations

  • Methods and compositions for polynucleotide amplification

    US20050042627A1

  • Nucleic acid amplification device, nucleic acid amplification method, and chip for nucleic acid amplification

    WO2016006612A1

  • Nucleic acid amplification method

    WO2020189581A1

  • Reaction treatment container and reaction treatment device

    WO2022153999A1