RNAi AGENTS AND COMPOSITIONS FOR INHIBITING EXPRESSION OF ANGIOPOIETIN-LIKE 3 (ANGPTL3), AND METHODS OF USE

Abstract

To provide RNAi agents and compositions for inhibiting expression of angiopoietin-like 3 (ANGPTL3), and to provide methods of use thereof.SOLUTION: The present disclosure relates to RNAi agents, e.g., double stranded RNAi agents, able to inhibit Angiopoietin-like 3 (also called ANGPTL3, ANGPL3, angiopoietin-like protein 3) gene expression, and compositions that include ANGPTL3 RNAi agents. Also disclosed are methods of use of ANGPTL3 RNAi agents and compositions. The ANGPTL3 RNAi agents disclosed herein may be conjugated to targeting ligands to facilitate the delivery to cells, including to hepatocytes. Pharmaceutical compositions that include one or more ANGPTL3 RNAi agents, optionally with one or more additional therapeutics, are described.SELECTED DRAWING: None

Description

Technical Field

[0001] Cross - Reference to Related Applications This application claims priority based on U.S. Provisional Patent Application No. 62 / 694,976, filed on July 7, 2018; U.S. Provisional Patent Application No. 62 / 651,284, filed on April 2, 2018; U.S. Provisional Patent Application No. 62 / 583,919, filed on November 9, 2017; and U.S. Provisional Patent Application No. 62 / 558,819, filed on September 14, 2017, the entire contents of each of which are incorporated herein by reference.

[0002] Sequence Listing This application contains a sequence listing submitted in ASCII format, the entire contents of which are incorporated herein by reference. The ASCII copy has the name 30658_SequenceListing and is 111 kb in size.

[0003] Field of the Invention The present disclosure relates to RNA interference (RNAi) agents for inhibiting angiopoietin - like 3 gene expression, such as double - stranded RNAi agents, compositions comprising angiopoietin - like 3 RNAi agents, and methods of using the same.

Background Art

[0004] Background Angiopoietin-like 3 (ANGPTL3, ANGPL3, ANG3, or also called angiopoietin-like protein 3) is an angiopoietin protein encoded by the human angiopoietin-like 3 gene, which has been reported to be involved in the regulation of lipid metabolism. ANGPTL3 is a 460-amino acid polypeptide consisting of a signal peptide, an N-terminal coiled-coil domain, and a C-terminal fibrinogen (FBN)-like domain. ANGPTL3 is known to be mainly produced in hepatocytes in humans and is secreted into the circulation after synthesis. ANGPTL3 acts as an inhibitor of lipoprotein lipase, which catalyzes the hydrolysis of triglycerides, and as an inhibitor of endothelial lipase, which hydrolyzes lipoprotein phospholipids. Inhibition of these enzymes can cause an increase in plasma triglyceride, high-density lipoprotein (HDL), and phospholipid levels. Furthermore, loss-of-function mutations in ANGPTL3 cause familial hypobetalipoproteinemia, which is characterized by low levels of plasma triglycerides and low-density lipoprotein (LDL-C). In humans, loss-of-function mutations in ANGPTL3 are also correlated with a decreased risk of atherosclerotic cardiovascular disease. Effective therapeutic agents targeting ANGPTL3 can provide beneficial effects in the treatment (including prophylactic treatment) of cardiometabolic diseases such as hypertriglyceridemia, obesity, hyperlipidemia, abnormal lipid and / or cholesterol metabolism, atherosclerosis, type II diabetes, cardiovascular disease, coronary artery disease, non-alcoholic steatohepatitis, non-alcoholic fatty liver disease, homozygous and heterozygous familial hypercholesterolemia, statin-resistant hypercholesterolemia, and other metabolic-related disorders and diseases. Although certain double-stranded RNA-based compounds have been identified as capable of inhibiting the expression of the ANGPTL3 gene (see, for example, International Patent Application Publication Nos. WO2012 / 177784, WO2016 / 168286, and WO2016 / 154127), the ANGPTL3 RNAi agents disclosed herein have not been previously disclosed, are not known, and provide a very strong and very efficient ANGPTL3-specific inhibition of the expression of the ANGTPL3 gene.

Prior Art Documents

Patent Documents

[0005]

Patent Document 1

Patent Document 2

Patent Document 3

Summary of the Invention

Means for Solving the Problems

[0006] There is a need for a novel ANGPTL3-specific RNA interference (RNAi) agent (also referred to herein as an RNAi agent, an RNAi trigger, or a trigger) that can selectively and efficiently inhibit the expression of the ANGPTL3 gene, for example, a double-stranded RNAi agent. Further, in particular, there is a need for a composition comprising a novel ANGPTL3-specific RNAi agent for the treatment of diseases associated with an increase in triglyceride (TG) levels.

[0007] Generally, the present disclosure features methods for inhibiting the expression of the ANGPTL3 gene in vitro and / or in vivo using an ANGPTL3 gene-specific RNAi agent, a composition comprising an ANGPTL3 RNAi agent, and a composition comprising an ANGPTL3 RNAi agent and an ANGPTL3 RNAi agent described herein. The ANGPTL3 RNAi agents described herein selectively and efficiently reduce or inhibit the expression of the ANGPTL3 gene, thereby reducing TG levels and / or cholesterol levels in a subject, such as a human or animal subject.

[0008] The described ANGPTL3 RNAi agents can be used in methods for the therapeutic treatment (including prophylactic and preventive treatment) of conditions and diseases associated with elevated TG levels and / or elevated cholesterol levels, including but not limited to hypertriglyceridemia, obesity, hyperlipidemia, abnormal lipid and / or cholesterol metabolism, atherosclerosis, type II diabetes, cardiovascular disease, coronary artery disease, non-alcoholic steatohepatitis, non-alcoholic fatty liver disease, homozygous and heterozygous familial hypercholesterolemia, statin-resistant hypercholesterolemia, and other metabolic-related disorders and diseases. The ANGPTL3 RNAi agents disclosed herein can selectively reduce ANGPTL3 gene expression, thereby particularly resulting in a reduction of TG levels and / or cholesterol levels in a subject. The methods disclosed herein include the administration of one or more ANGPTL3 RNAi agents to a subject, such as a human or animal subject, using any suitable method known in the art, such as subcutaneous injection or intravenous administration.

[0009] In one aspect, the present disclosure features an RNAi agent for inhibiting the expression of the human ANGPTL3 gene, the RNAi agent comprising a sense strand and an antisense strand.

[0010] Also provided herein is a composition comprising or consisting of an RNAi agent capable of inhibiting the expression of the ANGPTL3 gene, wherein the RNAi agent comprises or consists of a sense strand and an antisense strand, and the composition further comprises at least one pharmaceutically acceptable excipient. The compositions described herein comprising one or more of the disclosed ANGPTL3 RNAi agents can selectively and efficiently reduce the expression of the ANGPTL3 gene. Compositions comprising one or more ANGPTL3 RNAi agents can be administered to a subject, such as a human or animal subject, for the treatment (including prophylactic treatment or inhibition) of conditions and diseases associated with elevated TG, elevated cholesterol, and / or enhanced ANGPTL3 expression.

[0011] The ANGPTL3 RNAi agents described herein comprise a sense strand (also referred to as the passenger strand) and an antisense strand (also referred to as the guide strand). The sense strand and the antisense strand may be partially, substantially, or completely complementary to each other. The lengths of the sense and antisense strands of the RNAi agents described herein may each be 16-30 nucleotides in length. In some embodiments, the sense and antisense strands are independently 17-26 nucleotides in length. The sense and antisense strands may be of the same length or of different lengths. In some embodiments, the sense and antisense strands are independently 21-26 nucleotides in length. In some embodiments, the sense and antisense strands are independently 21-24 nucleotides in length. In some embodiments, both the sense strand and the antisense strand are 21 nucleotides in length. In some embodiments, the sense and / or antisense strands are independently 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. The RNAi agents described herein inhibit the expression of one or more ANGPTL3 genes in vivo or in vitro upon delivery to cells expressing ANGPTL3.

[0012] The sense strand of the ANGPTL3 RNAi agent described herein comprises at least 16 consecutive nucleotides having at least 85% identity to a core stretch sequence (also referred to herein as the "core stretch" or "core sequence") of the same number of nucleotides in ANGPTL3 mRNA. In some embodiments, this sense strand core stretch is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, this sense strand core stretch is 17 nucleotides in length. In some embodiments, this sense strand core stretch is 19 nucleotides in length.

[0013] The antisense strand of the ANGPTL3 RNAi agent described herein comprises at least 16 consecutive nucleotides having at least 85% complementarity to a core stretch of the same number of nucleotides in ANGPTL3 mRNA and to a core stretch of the same number of nucleotides in the corresponding sense strand. In some embodiments, this antisense strand core stretch is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, this antisense strand core stretch is 19 nucleotides in length. In some embodiments, this antisense strand core stretch is 17 nucleotides in length.

[0014] In some embodiments, the ANGPTL3 RNAi agents disclosed herein target a portion of the ANGPTL3 gene having any of the sequences disclosed in Table 1.

[0015] Examples of ANGPTL3 RNAi agent sense and antisense strands that may be included in the ANGPTL3 RNAi agents disclosed herein are provided in Tables 3 and 4. Examples of ANGPTL3 RNAi agent double strands are provided in Table 5. Examples of 19-nucleotide core stretch sequences consisting of or included in the sense and antisense strands of the ANGPTL3 RNAi agents disclosed herein are provided in Table 2.

[0016] In another aspect, the present disclosure features a method for in vivo delivery of an ANGPTL3 RNAi agent to cells of the liver in a subject, such as a mammal. Also described herein are compositions for use in such methods. One or more ANGPTL3 RNAi agents can be delivered to target cells or tissues using any oligonucleotide delivery technology known in the art. Nucleic acid delivery methods include, but are not limited to, encapsulation in liposomes, iontophoresis, or incorporation into other vehicles such as hydrogels, cyclodextrins, biodegradable nanocapsules, and bioadhesive microspheres, proteinaceous vectors, or Dynamic Polyconjugate™ (DPC) (see, e.g., WO2000 / 053722, WO2008 / 0022309, WO2011 / 104169, and WO2012 / 083185, each of which is incorporated herein by reference).

[0017] In some embodiments, the ANGPTL3 RNAi agent is delivered to target cells or tissues by covalently linking the RNAi agent to a targeting moiety such as an asialoglycoprotein receptor ligand (i.e., a ligand comprising a compound having an affinity for the asialoglycoprotein receptor), or by conjugating the targeting moiety thereto. In some embodiments, the asialoglycoprotein receptor ligand comprises, consists of, or consists essentially of a cluster of galactose or galactose derivatives. In some embodiments, the ANGPTL3 RNAi agent is linked to a targeting ligand comprising galactose derivative N-acetyl-galactosamine. In some embodiments, the cluster of galactose derivatives comprises an N-acetyl-galactosamine trimer or an N-acetyl-galactosamine tetramer. In some embodiments, the cluster of galactose derivatives is an N-acetyl-galactosamine trimer or an N-acetyl-galactosamine tetramer. In some embodiments, the ANGPTL3 RNAi agent conjugated to a targeting ligand comprising N-acetyl-galactosamine is selectively internalized by cells of the liver, particularly hepatocytes, by either receptor-mediated endocytosis or some other means. Examples of targeting moieties useful for delivering RNAi agents are disclosed, for example, in International Patent Application Publication Nos. WO2018 / 044350 and WO2017 / 156012, the contents of each of which are hereby incorporated by reference in their entireties.

[0018] The targeting moiety can be linked to the 3' or 5' end of the sense or antisense strand of the ANGPTL3 RNAi agent. In some embodiments, the targeting moiety is linked to the 3' or 5' end of the sense strand. In some embodiments, the targeting moiety is linked to the 5' end of the sense strand. In some embodiments, the targeting moiety is internally linked to nucleotides on the sense and / or antisense strands of the RNAi agent. In some embodiments, the targeting moiety is linked to the RNAi agent via a linker.

[0019] A targeting group, with or without a linker, can be linked to the 5' or 3' end of either the sense and / or antisense strand disclosed in Tables 2, 3, and 4. A linker, with or without a targeting group, can be attached to the 5' or 3' end of either the sense and / or antisense strand disclosed in Tables 2, 3, and 4.

[0020] In some embodiments, compositions are described herein that include one or more ANGPTL3 RNAi agents having the double-stranded structures disclosed in Table 5.

[0021] In a further aspect, pharmaceutical compositions are described herein that include one or more of the described ANGPTL3 RNAi agents, optionally in combination with one or more additional (i.e., second, third, etc.) therapeutic agents. In some embodiments, pharmaceutical compositions that include one or more of the described ANGPTL3 RNAi agents, optionally in combination with one or more additional (i.e., second, third, etc.) therapeutic agents, can be formulated in a pharmaceutically acceptable carrier or diluent. In some embodiments, these compositions can be administered to a subject such as a mammal. In some embodiments, the mammal is a human.

[0022] In some embodiments, compositions are described herein that include a combination or cocktail of at least two ANGPTL3 RNAi agents having different nucleotide sequences. In some embodiments, two or more different ANGPTL3 RNAi agents are each separately and independently linked to a targeting group. In some embodiments, two or more different ANGPTL3 RNAi agents are each linked to a targeting group that comprises or consists of a targeting ligand that includes one or more moieties that target the asialoglycoprotein receptor. In some embodiments, two or more different ANGPTL3 RNAi agents are each linked to a targeting group that comprises or consists of a targeting ligand that includes one or more galactose derivatives. In some embodiments, two or more different ANGPTL3 RNAi agents are each linked to a targeting group that comprises or consists of a targeting ligand that includes one or more N-acetyl-galactosamine.

[0023] In another aspect, the disclosure provides a method for inhibiting the expression of the ANGPTL3 gene, the method comprising administering to a subject or a cell of the subject an amount of an ANGPTL3 RNAi agent capable of inhibiting the expression of the ANGPTL3 gene, wherein the ANGPTL3 RNAi agent comprises a sense strand and an antisense strand, and the antisense strand comprises one of the antisense strand nucleotide sequences of Table 2 or Table 3. In some embodiments, a method for inhibiting the expression of the ANGPTL3 gene is disclosed herein, the method comprising administering to a subject or a cell an amount of an ANGPTL3 RNAi agent capable of inhibiting the expression of the ANGPTL3 gene, wherein the ANGPTL3 RNAi agent comprises a sense strand and an antisense strand, and the sense strand comprises one of the sense strand nucleotide sequences of Table 2 or Table 4. Also described herein are compositions for use in such methods.

[0024] In a further aspect, the present disclosure is a method of treating (including prophylactic or preventive treatment) a disease or condition caused by an elevated TG level and / or an elevated cholesterol level, the method comprising administering to a subject in need thereof an ANGPTL3 RNAi agent having an antisense strand comprising any of the sequences in Table 2 or 3. In some embodiments, a method of treating (including prophylactic treatment) a disease or condition caused by an elevated TG level and / or an elevated cholesterol level, the method comprising administering to a subject in need thereof an ANGPTL3 RNAi agent having a sense strand comprising any of the sequences in Table 2 or 4, is described herein. Also described herein are compositions for use in such methods.

[0025] Also described is a method of treating a human subject having or at risk of developing a pathological condition (e.g., a condition or disease) that is at least partially mediated by ANGPTL3 gene expression, the method comprising administering to the subject a therapeutically effective amount of an ANGPTL3 RNAi agent and / or an ANGPTL3 RNAi agent-containing composition. The method of treating the subject with the ANGPTL3 RNAi agent and / or the ANGPTL3 RNAi agent-containing composition can be combined, optionally, with one or more additional (i.e., second, third, etc.) steps of administering one or more additional therapeutic agents or treatments. The additional therapeutic agent can be another ANGPTL3 RNAi agent (e.g., an ANGPTL3 RNAi agent targeting a different sequence within the ANGPTL3 gene). The additional therapeutic agent can be a small molecule drug, an antibody, an antibody fragment, and / or an aptamer. In some embodiments, the one or more additional therapeutic agents are statins such as atorvastatin, fluvastatin, pravastatin, pitavastatin, rosuvastatin, or simvastatin.

[0026] In some embodiments, the described ANGPTL3 RNAi agent is combined, as needed, with one or more additional therapeutic agents. The ANGPTL3 RNAi agent and the additional therapeutic agents can be administered in a single composition or they can be administered separately. In some embodiments, the one or more additional therapeutic agents are administered separately in a dosage form distinct from the RNAi agent (e.g., the ANGPTL3 RNAi agent is administered by subcutaneous injection, while an additional therapeutic agent related to the dosing regimen of the treatment is administered orally). In some embodiments, the described ANGPTL3 RNAi agent is administered to a subject in need thereof via subcutaneous injection, and one or more optional additional therapeutic agents are administered orally, and together they provide a treatment regimen for diseases and conditions associated with elevated TG and / or cholesterol levels. In some embodiments, the described ANGPTL3 RNAi agent is administered to a subject in need thereof via subcutaneous injection, and one or more optional additional therapeutic agents are administered via a separate subcutaneous injection. In some embodiments, the ANGPTL3 RNAi agent and one or more additional therapeutic agents are combined in a single dosage form (e.g., a "cocktail" formulated in a single composition for subcutaneous injection). An ANGPTL3 RNAi agent, with or without one or more additional therapeutic agents, can be combined with one or more excipients to form a pharmaceutical composition.

[0027] In some embodiments, provided herein is a method for inhibiting the expression of the ANGPTL3 gene in a cell or subject, the method comprising administering to the cell or subject an ANGPTL3 RNAi agent having a sense strand comprising any of the sequences in Table 4 and an antisense strand comprising any of the sequences in Table 3.

[0028] ​In some embodiments, a composition for delivering an ANGPTL3 RNAi agent to cells in the liver, particularly hepatocytes, in vivo is described, which composition comprises an ANGPTL3 RNAi agent conjugated to a targeting group. In some embodiments, the targeting group is an asialoglycoprotein receptor ligand.

[0029] In some embodiments, a method for inhibiting the expression of the ANGPTL3 gene in cells is disclosed herein, which method comprises administering one or more ANGPTL3 RNAi agents having the double-stranded structure described in Table 5.

[0030] In some embodiments, a method for treating (including prophylactic or preventive treatment) a disease, disorder, or condition caused by an elevated TG level and / or an elevated cholesterol level is disclosed herein, which method comprises administering to a subject in need thereof a therapeutically effective amount of an ANGPTL3 RNAi agent comprising an antisense strand that is at least partially complementary to a portion of ANGPTL3 mRNA having the sequence in Table 1. In some embodiments, a method for treating (including prophylactic or preventive treatment) a disease or condition caused by an elevated TG level and / or an elevated cholesterol level is disclosed herein, which method comprises administering to a subject in need thereof a therapeutically effective amount of an ANGPTL3 RNAi agent comprising an antisense strand comprising any of the sequences in Table 2 or 3, and a sense strand comprising any of the sequences in Table 2 or 4 that is at least partially complementary to the antisense strand. In some embodiments, a method for treating (including prophylactic or preventive treatment) a disease or condition caused by an elevated TG level and / or an elevated cholesterol level is disclosed herein, which method comprises administering to a subject in need thereof a therapeutically effective amount of an ANGPTL3 RNAi agent comprising a sense strand comprising any of the sequences in Table 2 or 4, and an antisense strand comprising any of the sequences in Table 2 or 3 that is at least partially complementary to the sense strand.

[0031] In some embodiments, a method for inhibiting the expression of the ANGPTL3 gene in a cell, the method comprising administering to the cell an ANGPTL3 RNAi agent comprising an antisense strand that is at least partially complementary to a portion of ANGPTL3 mRNA having the sequence in Table 1, is disclosed herein. In some embodiments, a method for inhibiting the expression of the ANGPTL3 gene in a cell, the method comprising administering to the cell an ANGPTL3 RNAi agent comprising an antisense strand comprising any of the sequences in Table 2 or 3, and a sense strand comprising any of the sequences in Table 2 or 4 that is at least partially complementary to the antisense strand, is disclosed herein. In some embodiments, a method for inhibiting the expression of the ANGPTL3 gene in a cell, the method comprising administering to the cell an ANGPTL3 RNAi agent comprising a sense strand comprising any of the sequences in Table 2 or 4, and an antisense strand comprising any of the sequences in Table 2 or 3 that is at least partially complementary to the sense strand, is disclosed herein.

[0032] In some embodiments, a composition for inhibiting the expression of the ANGPTL3 gene in a cell, the method comprising administering a composition comprising an ANGPTL3 RNAi agent having a double-stranded structure as set forth in Table 5, is disclosed herein.

[0033] In some embodiments, a composition for delivering an ANGPTL3 RNAi agent to liver cells in vivo, the composition comprising an ANGPTL3 RNAi agent conjugated or linked to a targeting moiety, is disclosed herein. In some embodiments, the targeting moiety is an asialoglycoprotein receptor ligand. In some embodiments, a composition for delivering an ANGPTL3 RNAi agent to liver cells in vivo, the composition comprising an ANGPTL3 RNAi agent linked to an N-acetyl-galactosamine targeting ligand, is described.

[0034] The ANGPTL3 RNAi agent disclosed in this specification is designed to target a specific position (SEQ ID NO: 1) on the ANGPTL3 gene. As defined herein, an antisense strand sequence is designed to target the ANGPTL3 gene at a given position on the gene when the 5'-terminal nucleobase of the antisense strand is aligned with a position 19 nucleotides downstream (towards the 3'-end) from the position on the gene when base pairing with the gene. For example, as exemplified in Tables 1 and 2 of this specification, an antisense strand sequence designed to target the ANGPTL3 gene at position 304 needs to have the 5'-terminal nucleobase of the antisense strand aligned with position 322 of the ANGPTL3 gene when base pairing with the gene.

[0035] When provided herein, the ANGPTL3 RNAi agent does not require that the nucleobase at the 1-position (5’→3’) of the antisense strand be complementary to the gene, provided that there is at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) between the antisense strand and the gene over a core stretch sequence of at least 16 contiguous nucleotides. For example, for the ANGPTL3 RNAi agents disclosed herein that are designed to target position 304 of the ANGPTL3 gene, the 5’-terminal nucleobase of the antisense strand of the ANGPTL3 RNAi agent must align with position 322 of the gene; however, the 5’-terminal nucleobase of the antisense strand may or may not be complementary to position 322 of the ANGPTL3 gene, provided that there is at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) between the antisense strand and the gene over a core stretch sequence of at least 16 contiguous nucleotides. In particular, as shown by the various examples disclosed herein, the specific binding site of the gene by the antisense strand of the ANGPTL3 RNAi agent (e.g., whether the ANGPTL3 RNAi agent is designed to target the ANGPTL3 gene at position 304, 921, 922, or other positions) is an important factor for the level of inhibition achieved by the ANGPTL3 RNAi agent.

[0036] The use of an ANGPTL3 RNAi agent provides a method for the therapeutic (including prophylactic) treatment of diseases / disorders associated with an increase in TG and / or cholesterol levels and / or an enhancement or increase in ANGPTL3 expression. The ANGPTL3 RNAi agents described mediate RNA interference and inhibit the expression of one or more genes required for the production of ANGPTL3. The ANGPTL3 RNAi agents can also be used to treat or prevent various diseases or disorders including hypertriglyceridemia, obesity, hyperlipidemia, abnormal lipid and / or cholesterol metabolism, atherosclerosis, diabetes, cardiovascular disease, coronary artery disease, and other metabolic-related disorders and diseases. Further described are compositions for in vivo delivery of an ANGPTL3 RNAi agent to cells of the liver.

[0037] A pharmaceutical composition comprising one or more ANGPTL3 RNAi agents can be administered in several ways depending on whether local or systemic treatment is desired. Administration may be, but is not limited to, intravenous, intraarterial, subcutaneous, intraperitoneal, subdermal (e.g., by an implant device), and intrasubstantial administration. In some embodiments, the pharmaceutical compositions described herein are administered by subcutaneous injection.

[0038] In some embodiments, compositions for delivering an ANGPTL3 RNAi agent to cells of the liver in vivo are disclosed, which compositions comprise an ANGPTL3 RNAi agent conjugated or linked to a targeting moiety. In some embodiments, the targeting moiety is an asialoglycoprotein receptor ligand. In some embodiments, compositions for delivering an ANGPTL3 RNAi agent to cells of the liver in vivo are described, which compositions comprise an ANGPTL3 RNAi agent linked to a targeting ligand comprising N-acetyl-galactosamine.

[0039] In some embodiments, the ANGPTL3 RNAi agents described herein may each comprise one or more targeting groups having the structure of (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s as defined in Table 6 herein.

[0040] In some embodiments, the ANGPTL3 RNAi agents described herein comprise one targeting group at the 5' end of the sense strand having the structure of (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s as defined in Table 6 herein.

[0041] The ANGPTL3 RNAi agents and / or compositions comprising the ANGPTL3 RNAi agents described herein can be used in methods for the therapeutic treatment of diseases or conditions caused by elevated TG and / or cholesterol levels. Such methods include administration of the ANGPTL3 RNAi agents described herein to a subject, such as a human or animal subject.

[0042] In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand consisting of a nucleotide sequence that differs from the nucleotide sequence (5’→3’) UACUGAUCAAAUAUGUUGAGC (SEQ ID NO: 3) by 0 or 1 nucleobase. In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand consisting of a nucleotide sequence that differs from the nucleotide sequence (5’→3’) UACUGAUCAAAUAUGUUGAGC (SEQ ID NO: 3) by 1 or fewer nucleotides, wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand consisting of a nucleotide sequence that differs from the nucleotide sequence (5’→3’) UACUGAUCAAAUAUGUUGAGC (SEQ ID NO: 3) by 0 or 1 nucleobase, and SEQ ID NO: 3 is located at positions 1 to 21 (5’→3’) of the antisense strand.

[0043] In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand consisting of a modified nucleotide sequence that differs from the nucleotide sequence (5’→3’) usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO: 2) (wherein a, c, g, and u represent 2’-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2’-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate bond) by one or fewer nucleotides, and the sense strand is at least substantially complementary to the antisense strand. As will be clearly understood by those skilled in the art, the inclusion of phosphorothioate bonds shown in the modified nucleotide sequences disclosed herein replaces the phosphodiester bonds typically present in oligonucleotides (see, for example, FIGS. 5A-5K showing all internucleoside linkages). In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand consisting of the nucleotide sequence (5’→3’) usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO: 2) (wherein a, c, g, and u represent 2’-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2’-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate bond), and the sense strand is at least substantially complementary to the antisense strand.

[0044] In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand consisting of a modified nucleotide sequence that differs from the nucleotide sequence (5’→3’) usAfscUfgAfuCfaAfaUfaUfgUfuGfasGfsc (SEQ ID NO: 4) (wherein a, c, g, and u each represent 2’-O-methyladenosine, cytidine, guanosine, or uridine; Af, Cf, Gf, and Uf each represent 2’-fluoroadenosine, cytidine, guanosine, or uridine; and s represents a phosphorothioate bond) by one or fewer nucleotides, and the sense strand is at least substantially complementary to the antisense strand. As will be clearly understood by those skilled in the art, the inclusion of phosphorothioate bonds shown in the modified nucleotide sequences disclosed herein replaces the phosphodiester bonds typically present in oligonucleotides (see, e.g., FIGS. 5A - 5K showing all internucleoside linkages). In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand consisting of the nucleotide sequence (5’→3’) usAfscUfgAfuCfaAfaUfaUfgUfuGfasGfsc (SEQ ID NO: 4) (wherein a, c, g, and u each represent 2’-O-methyladenosine, cytidine, guanosine, or uridine; Af, Cf, Gf, and Uf each represent 2’-fluoroadenosine, cytidine, guanosine, or uridine; and s represents a phosphorothioate bond), and the sense strand is at least substantially complementary to the antisense strand.

[0045] In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand consisting of a nucleotide sequence that differs from the nucleotide sequence (5’→3’) UACUGAUCAAAUAUGUUGAGU (SEQ ID NO: 6) by 0 or 1 nucleobase. In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand consisting of a nucleotide sequence that differs from the nucleotide sequence (5’→3’) UACUGAUCAAAUAUGUUGAGU (SEQ ID NO: 6) by 1 or fewer nucleotides, wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand consisting of a nucleotide sequence that differs from the nucleotide sequence (5’→3’) UACUGAUCAAAUAUGUUGAGU (SEQ ID NO: 6) by 0 or 1 nucleobase, and SEQ ID NO: 5 is located at positions 1 to 21 (5’→3’) of the antisense strand.

[0046] In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand comprising a modified nucleotide sequence that differs from the nucleotide sequence (5’→3’) usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsu (SEQ ID NO: 5) (wherein a, c, g, and u each represent 2’-O-methyladenosine, cytidine, guanosine, or uridine; Af, Cf, Gf, and Uf each represent 2’-fluoroadenosine, cytidine, guanosine, or uridine; and s represents a phosphorothioate bond) by one or fewer nucleotides, and the sense strand is at least substantially complementary to the antisense strand. As will be clearly understood by those skilled in the art, the inclusion of phosphorothioate bonds shown in the modified nucleotide sequences disclosed herein replaces the phosphodiester bonds typically present in oligonucleotides (see, e.g., FIGS. 5A-5K showing all internucleoside linkages). In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand comprising the nucleotide sequence (5’→3’) usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsu (SEQ ID NO: 5) (wherein a, c, g, and u each represent 2’-O-methyladenosine, cytidine, guanosine, or uridine; Af, Cf, Gf, and Uf each represent 2’-fluoroadenosine, cytidine, guanosine, or uridine; and s represents a phosphorothioate bond), and the sense strand is at least substantially complementary to the antisense strand.

[0047] In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand consisting of a nucleotide sequence that differs from the nucleotide sequence (5’→3’) UUUGAAUUAAUGUCCAUGGGC (SEQ ID NO: 8) by 0 or 1 nucleobase. In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand consisting of a nucleotide sequence that differs from the nucleotide sequence (5’→3’) UUUGAAUUAAUGUCCAUGGGC (SEQ ID NO: 8) by 1 or fewer nucleotides, wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand consisting of a nucleotide sequence that differs from the nucleotide sequence (5’→3’) UUUGAAUUAAUGUCCAUGGGC (SEQ ID NO: 8) by 0 or 1 nucleobase, and SEQ ID NO: 8 is located at positions 1 to 21 (5’→3’) of the antisense strand.

[0048] In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand comprising a modified nucleotide sequence that differs from the nucleotide sequence (5’→3’) usUfsusGfaAfuUfaAfuGfuCfcAfuGfggsc (SEQ ID NO: 7) (wherein a, c, g, and u represent 2’-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2’-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate bond) by one or fewer nucleotides, and the sense strand is at least substantially complementary to the antisense strand. In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand comprising the nucleotide sequence (5’→3’) usUfsusGfaAfuUfaAfuGfuCfcAfuGfggsc (SEQ ID NO: 7) (wherein a, c, g, and u represent 2’-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2’-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate bond), and the sense strand is at least substantially complementary to the antisense strand.

[0049] In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand consisting of a nucleotide sequence that differs from the nucleotide sequence (5’→3’) UUUGAAUUAAUGUCCAUGGGU (SEQ ID NO: 10) by 0 or 1 nucleotide base. In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand consisting of a nucleotide sequence that differs from the nucleotide sequence (5’→3’) UUUGAAUUAAUGUCCAUGGGU (SEQ ID NO: 10) by 1 or fewer nucleotides, wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand consisting of a nucleotide sequence that differs from the nucleotide sequence (5’→3’) UUUGAAUUAAUGUCCAUGGGU (SEQ ID NO: 10) by 0 or 1 nucleotide base, and SEQ ID NO: 10 is located at positions 1 to 21 (5’→3’) of the antisense strand.

[0050] In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand consisting of a modified nucleotide sequence that differs from the nucleotide sequence (5’→3’) usUfsusGfaAfuUfaAfuGfuCfcAfuGfgGfsu (SEQ ID NO: 9) (wherein a, c, g, and u represent 2’-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2’-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate bond) by one or fewer nucleotides, and the sense strand is at least substantially complementary to the antisense strand. In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand consisting of the nucleotide sequence (5’→3’) usUfsusGfaAfuUfaAfuGfuCfcAfuGfgGfsu (SEQ ID NO: 9) (wherein a, c, g, and u represent 2’-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2’-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate bond), and the sense strand is at least substantially complementary to the antisense strand.

[0051] In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand consisting of a nucleotide sequence that differs from the nucleotide sequence (5’→3’) UGUUGAAUUAAUGUCCAUGGA (SEQ ID NO: 12) by 0 or 1 nucleobase. In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand consisting of a nucleotide sequence that differs from the nucleotide sequence (5’→3’) UGUUGAAUUAAUGUCCAUGGA (SEQ ID NO: 12) by 1 or fewer nucleotides, wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand consisting of a nucleotide sequence that differs from the nucleotide sequence (5’→3’) UGUUGAAUUAAUGUCCAUGGA (SEQ ID NO: 12) by 0 or 1 nucleobase, and SEQ ID NO: 12 is located at positions 1 to 21 (5’→3’) of the antisense strand.

[0052] In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand consisting of a modified nucleotide sequence that differs from the nucleotide sequence (5’→3’) usGfsusugaauuaaUfgUfcCfaUfgGfsa (SEQ ID NO: 11) (wherein a, c, g, and u represent 2’-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2’-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate bond) by one or fewer nucleotides, and the sense strand is at least substantially complementary to the antisense strand. In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand consisting of the nucleotide sequence (5’→3’) usGfsusugaauuaaUfgUfcCfaUfgGfsa (SEQ ID NO: 11) (wherein a, c, g, and u represent 2’-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2’-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate bond), and the sense strand is at least substantially complementary to the antisense strand.

[0053] In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand comprising a modified nucleotide sequence that differs from the nucleotide sequence (5’→3’) usGfsusUfgAfaUfuAfaUfgUfcCfaUfgGfsa (SEQ ID NO: 13) (wherein a, c, g, and u represent 2’-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2’-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate bond) by one or fewer nucleotides, and the sense strand is at least substantially complementary to the antisense strand. In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand comprising the nucleotide sequence (5’→3’) usGfsusUfgAfaUfuAfaUfgUfcCfaUfgGfsa (SEQ ID NO: 13) (wherein a, c, g, and u represent 2’-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2’-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate bond), and the sense strand is at least substantially complementary to the antisense strand.

[0054] In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand consisting of a nucleobase sequence that differs from the nucleotide sequence (5’→3’) ACAUCGUCUAACAUAGCAACC (SEQ ID NO: 15) by 0 or 1 nucleobase. In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand consisting of a nucleotide sequence that differs from the nucleotide sequence (5’→3’) ACAUCGUCUAACAUAGCAACC (SEQ ID NO: 15) by 1 or fewer nucleotides, wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand consisting of a nucleobase sequence that differs from the nucleotide sequence (5’→3’) ACAUCGUCUAACAUAGCAACC (SEQ ID NO: 15) by 0 or 1 nucleobase, and SEQ ID NO: 14 is located at positions 1 to 21 (5’→3’) of the antisense strand.

[0055] In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand comprising a modified nucleotide sequence that differs from the nucleotide sequence (5’→3’) asCfsasUfcGfucuaaCfaUfaGfcAfaCfsc (SEQ ID NO: 14) (wherein a, c, g, and u represent 2’-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2’-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate bond) by one or fewer nucleotides, and the sense strand is at least substantially complementary to the antisense strand. In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand comprising the nucleotide sequence (5’→3’) asCfsasUfcGfucuaaCfaUfaGfcAfaCfsc (SEQ ID NO: 14) (wherein a, c, g, and u represent 2’-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2’-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate bond), and the sense strand is at least substantially complementary to the antisense strand.

[0056] In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5’→3’) UACUGAUCAAAUAUGUUGAGC (SEQ ID NO: 3) by 0 or 1 nucleobase, and a sense strand consisting of, consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5’→3’) GCUCAACAUAUUUGAUCAGUA (SEQ ID NO: 17) by 0 or 1 nucleobase. In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs from the nucleotide sequence (5’→3’) UACUGAUCAAAUAUGUUGAGC (SEQ ID NO: 3) by 1 or fewer nucleotides, wherein all or substantially all of the nucleotides are modified nucleotides, and a sense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs from the nucleotide sequence (5’→3’) GCUCAACAUAUUUGAUCAGUA (SEQ ID NO: 17) by 1 or fewer nucleotides, wherein all or substantially all of the nucleotides are modified nucleotides.

[0057] In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5’→3’) UACUGAUCAAAUAUGUUGAGC (SEQ ID NO: 3) by 0 or 1 nucleobase, and a sense strand consisting of, consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5’→3’) GCUCAACAU(A 2N )UUUGAUCAGUA (SEQ ID NO: 19) by 0 or 1 nucleobase, and wherein all or substantially all of the nucleotides are modified nucleotides. 2N) represents 2-aminoadenine nucleotide. In some embodiments, the ANGPTL3 RNAi agents disclosed herein comprise, consist essentially of, or contain an antisense strand consisting of a nucleotide sequence that differs from the nucleotide sequence (5’→3’) UACUGAUCAAAUAUGUUGAGC (SEQ ID NO: 3) by 1 or fewer nucleotides, wherein all or substantially all of the nucleotides are modified nucleotides, and the nucleotide sequence (5’→3’) GCUCAACAU(A 2N )UUUGAUCAGUA (SEQ ID NO: 19) by 1 or fewer nucleotides, wherein all or substantially all of the nucleotides are modified nucleotides, and (A 2N ) represents 2-aminoadenine nucleotide, and all or substantially all of the nucleotides are modified nucleotides.

[0058] In some embodiments, the ANGPTL3 RNAi agents disclosed herein comprise, consist essentially of, or contain an antisense strand consisting of a nucleobase sequence that differs from the nucleotide sequence (5’→3’) UACUGAUCAAAUAUGUUGAGC (SEQ ID NO: 3) by 0 or 1 nucleobases, and a sense strand consisting of a nucleobase sequence that differs from the nucleotide sequence (5’→3’) GCUCAAC(A 2N )U(A 2N )UUUGAUCAGUA (SEQ ID NO: 21) by 0 or 1 nucleobases, wherein (A 2N ) represents 2-aminoadenine nucleotide. In some embodiments, the ANGPTL3 RNAi agents disclosed herein comprise, consist essentially of, or contain an antisense strand consisting of a nucleotide sequence that differs from the nucleotide sequence (5’→3’) UACUGAUCAAAUAUGUUGAGC (SEQ ID NO: 3) by 1 or fewer nucleotides, wherein all or substantially all of the nucleotides are modified nucleotides, and the nucleotide sequence (5’→3’) GCUCAAC(A 2N )U(A 2N)a sense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs from UUUGAUCAGUA (SEQ ID NO: 21) by one or fewer nucleotides, wherein (A 2N ) represents a 2-aminoadenine nucleotide, and comprising a sense strand in which all or substantially all of the nucleotides are modified nucleotides.

[0059] In some embodiments, the ANGPTL3 RNAi agents disclosed herein comprise an antisense strand consisting of, consisting essentially of, or comprising a nucleic acid base sequence that differs from the nucleotide sequence (5′→3′) UACUGAUCAAAUAUGUUGAGU (SEQ ID NO: 6) by 0 or 1 nucleobase, and a sense strand consisting of, consisting essentially of, or comprising a nucleic acid base sequence that differs from the nucleotide sequence (5′→3′) ACUCAACAUAUUUGAUCAGUA (SEQ ID NO: 24) by 0 or 1 nucleobase. In some embodiments, the ANGPTL3 RNAi agents disclosed herein comprise an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs from the nucleotide sequence (5′→3′) UACUGAUCAAAUAUGUUGAGU (SEQ ID NO: 6) by one or fewer nucleotides, wherein all or substantially all of the nucleotides are modified nucleotides, and a sense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs from the nucleotide sequence (5′→3′) ACUCAACAUAUUUGAUCAGUA (SEQ ID NO: 24) by one or fewer nucleotides, wherein all or substantially all of the nucleotides are modified nucleotides.

[0060] In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs from the nucleotide sequence (5’→3’) UUUGAAUUAAUGUCCAUGGGC (SEQ ID NO: 8) by 0 or 1 nucleobase and a sense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs from the nucleotide sequence (5’→3’) GCCCAUGGACAUUAAUUCAAA (SEQ ID NO: 26) by 0 or 1 nucleobase. In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs from the nucleotide sequence (5’→3’) UUUGAAUUAAUGUCCAUGGGC (SEQ ID NO: 8) by 1 or fewer nucleotides, wherein all or substantially all of the nucleotides are modified nucleotides, and a sense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs from the nucleotide sequence (5’→3’) GCCCAUGGACAUUAAUUCAAA (SEQ ID NO: 26) by 1 or fewer nucleotides, wherein all or substantially all of the nucleotides are modified nucleotides.

[0061] In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs from the nucleotide sequence (5’→3’) UUUGAAUUAAUGUCCAUGGGU (SEQ ID NO: 10) by 0 or 1 nucleotide base, and a sense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs from the nucleotide sequence (5’→3’) ACCCAUGGACAUUAAUUCAAA (SEQ ID NO: 28) by 0 or 1 nucleotide base. In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs from the nucleotide sequence (5’→3’) UUUGAAUUAAUGUCCAUGGGU (SEQ ID NO: 10) by 1 or fewer nucleotides, wherein all or substantially all of the nucleotides are modified nucleotides, and a sense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs from the nucleotide sequence (5’→3’) ACCCAUGGACAUUAAUUCAAA (SEQ ID NO: 28) by 1 or fewer nucleotides, wherein all or substantially all of the nucleotides are modified nucleotides.

[0062] In some embodiments, the ANGPTL3 RNAi agents disclosed herein comprise an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs from the nucleotide sequence (5’→3’) UGUUGAAUUAAUGUCCAUGGA (SEQ ID NO: 12) by 0 or 1 nucleobase and a sense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs from the nucleotide sequence (5’→3’) UCCAUGGACAUUAAUUCAACA (SEQ ID NO: 30) by 0 or 1 nucleobase. In some embodiments, the ANGPTL3 RNAi agents disclosed herein comprise an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs from the nucleotide sequence (5’→3’) UGUUGAAUUAAUGUCCAUGGA (SEQ ID NO: 12) by 1 or fewer nucleotides, wherein all or substantially all of the nucleotides are modified nucleotides, and a sense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs from the nucleotide sequence (5’→3’) UCCAUGGACAUUAAUUCAACA (SEQ ID NO: 30) by 1 or fewer nucleotides, wherein all or substantially all of the nucleotides are modified nucleotides.

[0063] In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5’→3’) ACAUCGUCUAACAUAGCAACC (SEQ ID NO: 15) by 0 or 1 nucleobase and a sense strand consisting of, consisting essentially of, or comprising a nucleobase sequence that differs from the nucleotide sequence (5’→3’) GGUUGCUAUGUUAGACGAUGU (SEQ ID NO: 32) by 0 or 1 nucleobase. In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs from the nucleotide sequence (5’→3’) ACAUCGUCUAACAUAGCAACC (SEQ ID NO: 15) by 1 or fewer nucleotides, wherein all or substantially all of the nucleotides are modified nucleotides, and a sense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs from the nucleotide sequence (5’→3’) GGUUGCUAUGUUAGACGAUGU (SEQ ID NO: 32) by 1 or fewer nucleotides, wherein all or substantially all of the nucleotides are modified nucleotides.

[0064] In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand consisting of the modified nucleotide sequence (5’→3’) usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO: 2), and a sense strand consisting of, consisting essentially of, or containing the modified nucleotide sequence (5’→3’) gcucaacaUfAfUfuugaucagua (SEQ ID NO: 16), wherein a, c, g, and u represent 2’-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2’-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate bond. In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand consisting of the modified nucleotide sequence (5’→3’) usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO: 2), and a sense strand consisting of, consisting essentially of, or containing the modified nucleotide sequence (5’→3’) gcucaacaUfAfUfuugaucagua (SEQ ID NO: 16), the sense strand further comprising inverted deoxyabasic residues at the 3’ and 5’ termini of the nucleotide sequence, the sense strand also containing a targeting ligand covalently linked to the 5’ terminus, the targeting ligand containing N-acetyl-galactosamine.

[0065] In some embodiments, the ANGPTL3 RNAi agents disclosed herein comprise an antisense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence (5’→3’) usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO: 2), and a sense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence (5’→3’) gcucaacaUfa_2NUfuugaucagua (SEQ ID NO: 18), wherein a, c, g, and u represent 2’-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; a_2N represents 2’-O-methyl-2-amino adenosine (see Table 6); Af, Cf, Gf, and Uf represent 2’-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate bond. In some embodiments, the ANGPTL3 RNAi agents disclosed herein comprise an antisense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence (5’→3’) usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO: 2), and a sense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence (5’→3’) gcucaacaUfa_2NUfuugaucagua (SEQ ID NO: 18), the sense strand further comprising inverted deoxyabasic residues at the 3’ and 5’ termini of the nucleotide sequence, the sense strand also comprising a targeting ligand covalently linked to the 5’ terminus, the targeting ligand comprising N-acetyl-galactosamine.

[0066] In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence (5’→3’) usAfscUfgAfuCfaAfaUfaUfgUfuGfasGfsc (SEQ ID NO: 4), and a sense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence (5’→3’) gcucaacaUfAfUfuugaucagua (SEQ ID NO: 16), wherein a, c, g, and u represent 2’-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2’-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate bond. In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence (5’→3’) usAfscUfgAfuCfaAfaUfaUfgUfuGfasGfsc (SEQ ID NO: 4), and a sense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence (5’→3’) gcucaacaUfAfUfuugaucagua (SEQ ID NO: 16), the sense strand further comprising inverted deoxyribonucleotide residues at the 3’ and 5’ termini of the nucleotide sequence, the sense strand also comprising a targeting ligand covalently linked to the 5’ terminus, the targeting ligand comprising N-acetyl-galactosamine.

[0067] In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence (5’→3’) usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO: 2), and a sense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence (5’→3’) gcucaaca_2NUfa_2NUfuugaucagua (SEQ ID NO: 20), where a, c, g, and u represent 2’-O-methyladenosine, cytidine, guanosine, or uridine, respectively; a_2N represents 2’-O-methyl-2-aminoadenosine (see Table 6); Af, Cf, Gf, and Uf represent 2’-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate bond. In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence (5’→3’) usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO: 2), and a sense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence (5’→3’) gcucaaca_2NUfa_2NUfuugaucagua (SEQ ID NO: 20), the sense strand further comprising inverted deoxyribonucleotide residues at the 3’ and 5’ termini of the nucleotide sequence, the sense strand also comprising a targeting ligand covalently linked to the 5’ terminus, the targeting ligand comprising N-acetyl-galactosamine.

[0068] In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence (5’→3’) usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO: 2), and a sense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence (5’→3’) gcUfcAfaCfaUfAfUfuugaucagua (SEQ ID NO: 22), wherein a, c, g, and u represent 2’-O-methyladenosine, cytidine, guanosine, or uridine, respectively; a_2N represents 2’-O-methyl-2-aminoadenosine (see Table 6); Af, Cf, Gf, and Uf represent 2’-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate bond. In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence (5’→3’) usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO: 2), and a sense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence (5’→3’) gcUfcAfaCfaUfAfUfuugaucagua (SEQ ID NO: 22), the sense strand further comprising inverted deoxyribonucleotide residues at the 3’ and 5’ termini of the nucleotide sequence, the sense strand also comprising a targeting ligand covalently linked to the 5’ terminus, the targeting ligand comprising N-acetyl-galactosamine.

[0069] In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand consisting of the modified nucleotide sequence (5’→3’) usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsu (SEQ ID NO: 5), and a sense strand consisting of, consisting essentially of, or containing the modified nucleotide sequence (5’→3’) acucaacaUfAfUfuugaucagua (SEQ ID NO: 23), wherein a, c, g, and u represent 2’-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2’-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate bond. In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand consisting of the modified nucleotide sequence (5’→3’) usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsu (SEQ ID NO: 5), and a sense strand consisting of, consisting essentially of, or containing the modified nucleotide sequence (5’→3’) acucaacaUfAfUfuugaucagua (SEQ ID NO: 23), the sense strand further comprising inverted deoxyribose residues at the 3’ and 5’ termini of the nucleotide sequence, and the sense strand also containing a targeting ligand covalently linked to the 5’ terminus, the targeting ligand comprising N-acetyl-galactosamine.

[0070] In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand consisting of the modified nucleotide sequence (5’→3’) usUfsusGfaAfuUfaAfuGfuCfcAfuGfggsc (SEQ ID NO: 7), and a sense strand consisting of, consisting essentially of, or containing the modified nucleotide sequence (5’→3’) gcccauggAfCfAfuuaauucaaa (SEQ ID NO: 25), where a, c, g, and u represent 2’-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2’-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate bond. In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand consisting of the modified nucleotide sequence (5’→3’) usUfsusGfaAfuUfaAfuGfuCfcAfuGfggsc (SEQ ID NO: 7), and a sense strand consisting of, consisting essentially of, or containing the modified nucleotide sequence (5’→3’) gcccauggAfCfAfuuaauucaaa (SEQ ID NO: 25), the sense strand further comprising inverted deoxyabasic residues at the 3’ and 5’ ends of the nucleotide sequence, the sense strand also comprising a targeting ligand covalently linked to the 5’ end, the targeting ligand comprising N-acetyl-galactosamine.

[0071] In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand consisting of the modified nucleotide sequence (5’→3’) usUfsusGfaAfuUfaAfuGfuCfcAfuGfgGfsu (SEQ ID NO: 9), and a sense strand consisting of, consisting essentially of, or containing the modified nucleotide sequence (5’→3’) acccauggAfCfAfuuaauucaaa (SEQ ID NO: 27), where a, c, g, and u represent 2’-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2’-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate bond. In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand consisting of the modified nucleotide sequence (5’→3’) usUfsusGfaAfuUfaAfuGfuCfcAfuGfgGfsu (SEQ ID NO: 9), and a sense strand consisting of, consisting essentially of, or containing the modified nucleotide sequence (5’→3’) acccauggAfCfAfuuaauucaaa (SEQ ID NO: 27), the sense strand further comprises inverted deoxyabasic residues at the 3’ and 5’ ends of the nucleotide sequence, and the sense strand also contains a targeting ligand covalently linked to the 5’ end, the targeting ligand containing N-acetyl-galactosamine.

[0072] In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence (5’→3’) usGfsusugaauuaaUfgUfcCfaUfgGfsa (SEQ ID NO: 11), and a sense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence (5’→3’) uccauggaCfAfUfuaauucaaca (SEQ ID NO: 29), wherein a, c, g, and u represent 2’-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2’-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate bond. In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises an antisense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence (5’→3’) usGfsusugaauuaaUfgUfcCfaUfgGfsa (SEQ ID NO: 11), and a sense strand consisting of, consisting essentially of, or comprising a modified nucleotide sequence (5’→3’) uccauggaCfAfUfuaauucaaca (SEQ ID NO: 29), the sense strand further comprising inverted deoxyabasic residues at the 3’ and 5’ termini of the nucleotide sequence, the sense strand also comprising a targeting ligand covalently linked to the 5’ terminus, the targeting ligand comprising N-acetyl-galactosamine.

[0073] In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand consisting of the modified nucleotide sequence (5’→3’) usGfsusUfgAfaUfuAfaUfgUfcCfaUfgGfsa (SEQ ID NO: 13), and a sense strand consisting of, consisting essentially of, or containing the modified nucleotide sequence (5’→3’) uccauggaCfAfUfuaauucaaca (SEQ ID NO: 29), where a, c, g, and u represent 2’-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2’-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate bond. In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand consisting of the modified nucleotide sequence (5’→3’) usGfsusUfgAfaUfuAfaUfgUfcCfaUfgGfsa (SEQ ID NO: 13), and a sense strand consisting of, consisting essentially of, or containing the modified nucleotide sequence (5’→3’) uccauggaCfAfUfuaauucaaca (SEQ ID NO: 29), the sense strand further comprising inverted deoxyribose residues at the 3’ and 5’ termini of the nucleotide sequence, and the sense strand also containing a targeting ligand covalently linked to the 5’ terminus, the targeting ligand comprising N-acetyl-galactosamine.

[0074] In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand consisting of a modified nucleotide sequence (5’→3’) asCfsasUfcGfucuaaCfaUfaGfcAfaCfsc (SEQ ID NO: 14), and a sense strand consisting of a modified nucleotide sequence (5’→3’) gguugcuaUfGfUfuagacgaugu (SEQ ID NO: 31), wherein a, c, g, and u represent 2’-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2’-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate bond. In some embodiments, the ANGPTL3 RNAi agent disclosed herein comprises, consists essentially of, or contains an antisense strand consisting of a modified nucleotide sequence (5’→3’) asCfsasUfcGfucuaaCfaUfaGfcAfaCfsc (SEQ ID NO: 14), and a sense strand consisting of a modified nucleotide sequence (5’→3’) cccuaaaaGfGfGfacaguauucu (SEQ ID NO: 31), the sense strand further comprising inverted deoxyribonucleotide residues at the 3’ and 5’ termini of the nucleotide sequence, and the sense strand also comprising a targeting ligand covalently linked to the 5’ terminus, the targeting ligand comprising N-acetyl-galactosamine.

[0075] In some embodiments, the ANGPTL3 RNAi agent disclosed herein has the following nucleotide sequences (5’→3’): UACUGAUCAAAUAUGUUGAGC (SEQ ID NO: 3); UACUGAUCAAAUAUGUUGAGU (SEQ ID NO: 6); UUUGAAUUAAUGUCCAUGGGC (SEQ ID NO: 8); UUUGAAUUAAUGUCCAUGGGU (SEQ ID NO: 10); UGUUGAAUUAAUGUCCAUGGA (SEQ ID NO: 12); or ACAUCGUCUAACAUAGCAACC (SEQ ID NO: 15) comprising, consisting essentially of, or containing an antisense strand consisting of a nucleotide sequence that differs from one of the following by 0 or 1 nucleotide, wherein the ANGPTL3 RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand; and all or substantially all of the nucleotides of both the antisense strand and the sense strand are modified nucleotides.

[0076] In some embodiments, the ANGPTL3 RNAi agents disclosed herein have the following nucleotide sequences (5’→3’): UACUGAUCAAAUAUGUUGAGC (SEQ ID NO: 3); UACUGAUCAAAUAUGUUGAGU (SEQ ID NO: 6); UUUGAAUUAAUGUCCAUGGGC (SEQ ID NO: 8); UUUGAAUUAAUGUCCAUGGGU (SEQ ID NO: 10); UGUUGAAUUAAUGUCCAUGGA (SEQ ID NO: 12); or ACAUCGUCUAACAUAGCAACC (SEQ ID NO: 15) comprising, consisting essentially of, or containing an antisense strand consisting of a nucleotide sequence that differs from one of the following by 0 or 1 nucleotide, wherein the ANGPTL3 RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand; all or substantially all of the nucleotides of both the antisense strand and the sense strand are modified nucleotides; the sense strand further comprises inverted deoxyabasic residues at the 3’ and 5’ termini of the nucleotide sequence; the sense strand also comprises a targeting ligand covalently linked to the 5’ terminus; and the targeting ligand comprises N-acetyl-galactosamine.

[0077] In some embodiments, the ANGPTL3 RNAi agents disclosed herein have the following nucleotide sequences (5’→3’): UACUGAUCAAAUAUGUUGAGC (SEQ ID NO: 3); UACUGAUCAAAUAUGUUGAGU (SEQ ID NO: 6); UUUGAAUUAAUGUCCAUGGGC (SEQ ID NO: 8); UUUGAAUUAAUGUCCAUGGGU (SEQ ID NO: 10); UGUUGAAUUAAUGUCCAUGGA (SEQ ID NO: 12); or ACAUCGUCUAACAUAGCAACC (SEQ ID NO: 15) comprising, consisting essentially of, or containing an antisense strand consisting of a nucleotide sequence that is different from one of the following by 0 or 1 nucleotide: UUUGAAUUAAUGUCCAUGGGU (SEQ ID NO: 10); UGUUGAAUUAAUGUCCAUGGA (SEQ ID NO: 12); or ACAUCGUCUAACAUAGCAACC (SEQ ID NO: 15), wherein the ANGPTL3 RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand; all or substantially all of the nucleotides of both the antisense strand and the sense strand are modified nucleotides; the sense strand further comprises inverted deoxyribose residues at the 3' and 5' termini of the nucleotide sequence; the sense strand also comprises a targeting ligand covalently linked to the 5' terminus; the targeting ligand comprises N-acetyl-galactosamine, and each antisense strand sequence is located at positions 1 to 21 of the antisense strand.

[0078] In some embodiments, the ANGPTL3 RNAi agents disclosed herein comprise an antisense strand and a sense strand, and the antisense strand and the sense strand are the following nucleotide sequence (5'→3') pairs: UACUGAUCAAAUAUGUUGAGC (SEQ ID NO: 3) and GCUCAACAUAUUUGAUCAGUA (SEQ ID NO: 17); UACUGAUCAAAUAUGUUGAGC (SEQ ID NO: 3) and GCUCAACAU(A 2N )UUUGAUCAGUA (SEQ ID NO: 19) (where (A 2N ) represents a 2-aminoadenine nucleotide); UACUGAUCAAAUAUGUUGAGC (SEQ ID NO: 3) and GCUCAAC(A 2N )U(A 2N )UUUGAUCAGUA (SEQ ID NO: 21) (where (A 2N ) represents a 2-aminoadenine nucleotide); UACUGAUCAAAUAUGUUGAGU (SEQ ID NO: 6) and ACUCAACAUAUUUGAUCAGUA (SEQ ID NO: 24); UUUGAAUUAAUGUCCAUGGGC (SEQ ID NO: 8) and GCCCAUGGACAUUAAUUCAAA (SEQ ID NO: 26); UUUGAAUUAAUGUCCAUGGGU (SEQ ID NO: 10) and ACCCAUGGACAUUAAUUCAAA (SEQ ID NO: 28); UGUUGAAUUAAUGUCCAUGGA (SEQ ID NO: 12) and UCCAUGGACAUUAAUUCAACA (SEQ ID NO: 30); or ACAUCGUCUAACAUAGCAACC (SEQ ID NO: 15) and GGUUGCUAUGUUAGACGAUGU (SEQ ID NO: 32) consisting of, consisting essentially of, or comprising a nucleotide sequence that is different from one of the following by 0 or 1 nucleotide, wherein all or substantially all of the nucleotides of both the antisense strand and the sense strand are modified nucleotides.

[0079] In some embodiments, the ANGPTL3 RNAi agents disclosed herein comprise an antisense strand and a sense strand, the antisense strand and the sense strand having the following nucleotide sequence (5’→3’) pair: UACUGAUCAAAUAUGUUGAGC (SEQ ID NO: 3) and GCUCAACAUAUUUGAUCAGUA (SEQ ID NO: 17); UACUGAUCAAAUAUGUUGAGC (SEQ ID NO: 3) and GCUCAACAU(A 2N )UUUGAUCAGUA (SEQ ID NO: 19) (wherein (A 2N ) represents a 2-aminoadenine nucleotide); UACUGAUCAAAUAUGUUGAGC (SEQ ID NO: 3) and GCUCAAC(A 2N )U(A 2N )UUUGAUCAGUA (SEQ ID NO: 21) (where (A 2N ) represents a 2-aminoadenine nucleotide); UACUGAUCAAAUAUGUUGAGU (SEQ ID NO: 6) and ACUCAACAUAUUUGAUCAGUA (SEQ ID NO: 24); UUUGAAUUAAUGUCCAUGGGC (SEQ ID NO: 8) and GCCCAUGGACAUUAAUUCAAA (SEQ ID NO: 26); UUUGAAUUAAUGUCCAUGGGU (SEQ ID NO: 10) and ACCCAUGGACAUUAAUUCAAA (SEQ ID NO: 28); UGUUGAAUUAAUGUCCAUGGA (SEQ ID NO: 12) and UCCAUGGACAUUAAUUCAACA (SEQ ID NO: 30); or ACAUCGUCUAACAUAGCAACC (SEQ ID NO: 15) and GGUUGCUAUGUUAGACGAUGU (SEQ ID NO: 32) consisting of, consisting essentially of, or containing a nucleotide sequence that is different from one of the following by 0 or 1 nucleotide, wherein all or substantially all of the nucleotides of both the antisense strand and the sense strand are modified nucleotides; the sense strand further comprises inverted deoxyribose residues at the 3' and 5' ends of the nucleotide sequence; the sense strand also comprises a targeting ligand covalently linked to the 5' end; and the targeting ligand comprises N-acetyl-galactosamine.

[0080] In some embodiments, the ANGPTL3 RNAi agents disclosed herein have the following nucleotide sequences (5'→3'): usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO: 2); usAfscUfgAfuCfaAfaUfaUfgUfuGfasGfsc (SEQ ID NO: 4); usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsu (SEQ ID NO: 5); usUfsusGfaAfuUfaAfuGfuCfcAfuGfggsc (SEQ ID NO: 7); usUfsusGfaAfuUfaAfuGfuCfcAfuGfgGfsu (SEQ ID NO: 9); usGfsusugaauuaaUfgUfcCfaUfgGfsa (SEQ ID NO: 11); usGfsusUfgAfaUfuAfaUfgUfcCfaUfgGfsa (SEQ ID NO: 13); asCfsasUfcGfucuaaCfaUfaGfcAfaCfsc (SEQ ID NO: 14) (Wherein, a, c, g, and u each represent 2'-O-methyladenosine, cytidine, guanosine, or uridine; Af, Cf, Gf, and Uf each represent 2'-fluoroadenosine, cytidine, guanosine, or uridine; s represents a phosphorothioate bond), comprising, consisting essentially of, or containing an antisense strand consisting of a modified nucleotide sequence in which one and zero or one nucleotide is different, wherein the ANGPTL3 RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand, and all or substantially all of the nucleotides on the sense strand are modified nucleotides.)

[0081] In some embodiments, the ANGPTL3 RNAi agents disclosed herein have the following nucleotide sequences (5'→3'): usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO: 2); usAfscUfgAfuCfaAfaUfaUfgUfuGfasGfsc (SEQ ID NO: 4); usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsu (SEQ ID NO: 5); usUfsusGfaAfuUfaAfuGfuCfcAfuGfggsc (SEQ ID NO: 7); usUfsusGfaAfuUfaAfuGfuCfcAfuGfgGfsu (SEQ ID NO: 9); usGfsusugaauuaaUfgUfcCfaUfgGfsa (SEQ ID NO: 11); usGfsusUfgAfaUfuAfaUfgUfcCfaUfgGfsa (SEQ ID NO: 13); asCfsasUfcGfucuaaCfaUfaGfcAfaCfsc (SEQ ID NO: 14) comprising, consisting essentially of, or containing an antisense strand consisting of a modified nucleotide sequence that differs from that of one of SEQ ID NOs: 1 and 0 or 1 nucleotide, wherein the ANGPTL3 RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand; all or substantially all of the nucleotides of the sense strand are modified nucleotides; all or substantially all of the nucleotides of both the antisense strand and the sense strand are modified nucleotides; the sense strand further comprises inverted deoxyribonucleotide residues at the 3' and 5' termini of the nucleotide sequence; the sense strand also comprises a targeting ligand covalently linked to the 5' terminus; and the targeting ligand comprises N-acetyl-galactosamine.

[0082] In some embodiments, the ANGPTL3 RNAi agents disclosed herein have the following nucleotide sequence pairs (5'→3'): usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO: 2) and gcucaacaUfAfUfuugaucagua (SEQ ID NO: 16); usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO: 2) and gcucaacaUfa_2NUfuugaucagua (SEQ ID NO: 18); usAfscUfgAfuCfaAfaUfaUfgUfuGfasGfsc (SEQ ID NO: 4) and gcucaacaUfAfUfuugaucagua (SEQ ID NO: 16); usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO: 2) and gcucaaca_2NUfa_2NUfuugaucagua (SEQ ID NO: 20); usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO: 2) and gcUfcAfaCfaUfAfUfuugaucagua (SEQ ID NO: 22); usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsu (SEQ ID NO: 5) and acucaacaUfAfUfuugaucagua (SEQ ID NO: 23); usUfsusGfaAfuUfaAfuGfuCfcAfuGfggsc (SEQ ID NO: 7) and gcccauggAfCfAfuuaauucaaa (SEQ ID NO: 25); usUfsusGfaAfuUfaAfuGfuCfcAfuGfgGfsu (SEQ ID NO: 9) and acccauggAfCfAfuuaauucaaa (SEQ ID NO: 27); usGfsusugaauuaaUfgUfcCfaUfgGfsa (SEQ ID NO: 11) and uccauggaCfAfUfuaauucaaca (SEQ ID NO: 29); usGfsusUfgAfaUfuAfaUfgUfcCfaUfgGfsa (SEQ ID NO: 13) and uccauggaCfAfUfuaauucaaca (SEQ ID NO: 29); or asCfsasUfcGfucuaaCfaUfaGfcAfaCfsc (SEQ ID NO: 14) and gguugcuaUfGfUfuagacgaugu (SEQ ID NO: 31) (wherein a, c, g, and u each represent 2'-O-methyladenosine, cytidine, guanosine, or uridine; Af, Cf, Gf, and Uf each represent 2'-fluoroadenosine, cytidine, guanosine, or uridine; a_2N represents 2'-O-methyl-2-aminoadenosine (see Table 6); s represents a phosphorothioate bond) consisting of, consisting essentially of, or containing an antisense strand and a sense strand that differ by one and zero or one nucleotide from a modified nucleotide sequence

[0083] In some embodiments, the ANGPTL3 RNAi agents disclosed herein are the following nucleotide sequence pairs (5'→3'): usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO: 2) and gcucaacaUfAfUfuugaucagua (SEQ ID NO: 16); usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO: 2) and gcucaacaUfa_2NUfuugaucagua (SEQ ID NO: 18); usAfscUfgAfuCfaAfaUfaUfgUfuGfasGfsc (SEQ ID NO: 4) and gcucaacaUfAfUfuugaucagua (SEQ ID NO: 16); usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO: 2) and gcucaaca_2NUfa_2NUfuugaucagua (SEQ ID NO: 20); usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO: 2) and gcUfcAfaCfaUfAfUfuugaucagua (SEQ ID NO: 22); usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsu (SEQ ID NO: 5) and acucaacaUfAfUfuugaucagua (SEQ ID NO: 23); usUfsusGfaAfuUfaAfuGfuCfcAfuGfggsc (SEQ ID NO: 7) and gcccauggAfCfAfuuaauucaaa (SEQ ID NO: 25); usUfsusGfaAfuUfaAfuGfuCfcAfuGfgGfsu (SEQ ID NO: 9) and acccauggAfCfAfuuaauucaaa (SEQ ID NO: 27); usGfsusugaauuaaUfgUfcCfaUfgGfsa (SEQ ID NO: 11) and uccauggaCfAfUfuaauucaaca (SEQ ID NO: 29); usGfsusUfgAfaUfuAfaUfgUfcCfaUfgGfsa (SEQ ID NO: 13) and uccauggaCfAfUfuaauucaaca (SEQ ID NO: 29); or asCfsasUfcGfucuaaCfaUfaGfcAfaCfsc (SEQ ID NO: 14) and gguugcuaUfGfUfuagacgaugu (SEQ ID NO: 31) (wherein a, c, g, and u each represent 2'-O-methyladenosine, cytidine, guanosine, or uridine; Af, Cf, Gf, and Uf each represent 2'-fluoroadenosine, cytidine, guanosine, or uridine; a_2N represents 2'-O-methyl-2-aminoadenosine (see Table 6); s represents a phosphorothioate bond), comprising, consisting essentially of, or containing an antisense strand and a sense strand, wherein the sense strand further comprises inverted deoxyribonucleotide residues at the 3'- and 5'-ends of the nucleotide sequence, and the sense strand also contains a targeting ligand covalently linked to the 5'-end, and the targeting ligand contains N-acetyl-galactosamine.

[0084] In some embodiments, the ANGPTL3 RNAi agent disclosed herein is (5'→3'): UACUGAUCAAAUAUGUUGA (SEQ ID NO: 50); UGUUGAAUUAAUGUCCAUG (SEQ ID NO: 55); UUUGAAUUAAUGUCCAUGG (SEQ ID NO: 60); or ACAUCGUCUAACAUAGCAA (SEQ ID NO: 64) and comprises an antisense strand having a nucleotide sequence that differs from the nucleotide sequence selected from the group consisting of by 0 or 1 nucleobase.

[0085] In some embodiments, the ANGPTL3 RNAi agent disclosed herein is (5'→3'): UACUGAUCAAAUAUGUUGA (SEQ ID NO: 50); UGUUGAAUUAAUGUCCAUG (SEQ ID NO: 55); UUUGAAUUAAUGUCCAUGG (SEQ ID NO: 60); or ACAUCGUCUAACAUAGCAA (SEQ ID NO: 64) An antisense strand comprising a nucleotide sequence selected from the group consisting of and having a nucleic acid base sequence that differs from the nucleotide sequence by 0 or 1 nucleic acid base, wherein all or substantially all of the nucleotides are modified nucleotides.

[0086] In some embodiments, the ANGPTL3 RNAi agents disclosed herein are (5’→3’): UACUGAUCAAAUAUGUUGA (SEQ ID NO: 50); UGUUGAAUUAAUGUCCAUG (SEQ ID NO: 55); UUUGAAUUAAUGUCCAUGG (SEQ ID NO: 60); or ACAUCGUCUAACAUAGCAA (SEQ ID NO: 64) An antisense strand comprising a nucleic acid base sequence that differs from the nucleotide sequence selected from the group consisting of by 0 or 1 nucleic acid base, wherein all or substantially all of the nucleotides are modified nucleotides, and SEQ ID NO: 50, SEQ ID NO: 55, SEQ ID NO: 60, or SEQ ID NO: 64 is located at positions 1 to 19 (5’→3’) of the nucleotides of the antisense strand, respectively.

[0087] In some embodiments, the ANGPTL3 RNAi agents disclosed herein each are (5’→3’): UACUGAUCAAAUAUGUUGA (SEQ ID NO: 50) and UCAACAUAUUUGAUCAGUA (SEQ ID NO: 130); UACUGAUCAAAUAUGUUGA (SEQ ID NO: 50) and UCAACAU(A 2N )UUUGAUCAGUA (SEQ ID NO: 131) (where (A 2N ) represents a 2-aminoadenine nucleotide); UACUGAUCAAAUAUGUUGA (SEQ ID NO: 50) and UCAAC(A 2N )U(A 2N )UUUGAUCAGUA (SEQ ID NO: 132) (where (A 2N ) represents a 2-aminoadenine nucleotide); UGUUGAAUUAAUGUCCAUG (SEQ ID NO: 55) and CAUGGACAUUAAUUCAACA (SEQ ID NO: 145); UUUGAAUUAAUGUCCAUGG (SEQ ID NO: 60) and CCAUGGACAUUAAUUCAAA (SEQ ID NO: 150); ACAUCGUCUAACAUAGCAA (SEQ ID NO: 64) and UUGCUAUGUUAGACGAUGU (SEQ ID NO: 154) An antisense strand and a sense strand containing a nucleotide sequence pair selected from the group consisting of and a nucleic acid base sequence that differs by 0 or 1 nucleic acid base are included.

[0088] In some embodiments, the ANGPTL3 RNAi agents disclosed herein each have, (5'→3'): UACUGAUCAAAUAUGUUGA (SEQ ID NO: 50) and UCAACAUAUUUGAUCAGUA (SEQ ID NO: 130); UACUGAUCAAAUAUGUUGA (SEQ ID NO: 50) and UCAACAU(A 2N )UUUGAUCAGUA (SEQ ID NO: 131) (where (A 2N ) represents a 2-aminoadenine nucleotide); UACUGAUCAAAUAUGUUGA (SEQ ID NO: 50) and UCAAC(A 2N )U(A 2N )UUUGAUCAGUA (SEQ ID NO: 132) (where (A 2N ) represents a 2-aminoadenine nucleotide); UGUUGAAUUAAUGUCCAUG (SEQ ID NO: 55) and CAUGGACAUUAAUUCAACA (SEQ ID NO: 145); UUUGAAUUAAUGUCCAUGG (SEQ ID NO: 60) and CCAUGGACAUUAAUUCAAA (SEQ ID NO: 150); ACAUCGUCUAACAUAGCAA (SEQ ID NO: 64) and UUGCUAUGUUAGACGAUGU (SEQ ID NO: 154) An antisense strand and a sense strand comprising a nucleotide sequence pair selected from the group consisting of and having a nucleic acid base sequence that differs by 0 or 1 nucleic acid base, wherein all or substantially all of the nucleotides are modified nucleotides.

[0089] In some embodiments, the compositions described herein comprising one or more ANGPTL3 RNAi agents are packaged in a kit, container, pack, dispenser, pre-filled syringe, or vial. In some embodiments, the compositions described herein are administered parenterally.

[0090] As used herein, the terms "oligonucleotide" and "polynucleotide" each independently mean a polymer of linked nucleosides, which may or may not be modified.

[0091] As used herein, an "RNAi agent" (also referred to as an "RNAi trigger") refers to a composition containing an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that can degrade or inhibit (e.g., degrade or inhibit under appropriate conditions) the translation product of a messenger RNA (mRNA) transcript of a target mRNA in a sequence-specific manner. As used herein, an RNAi agent can operate by an RNA interference mechanism (i.e., inducing RNA interference by interaction with the RNA interference pathway mechanism (RNA-induced silencing complex or RISC) of mammalian cells), or by any alternative mechanism or pathway. Although an RNAi agent is considered to operate primarily by an RNA interference mechanism when the term is used herein, the disclosed RNAi agents are not bound by, and are not limited to, any particular pathway or mechanism of action. The RNAi agents disclosed herein include a sense strand and an antisense strand, and include, but are not limited to, short (or small) interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), and dicer substrates. The antisense strand of the RNAi agent described herein is at least partially complementary to the targeted mRNA (i.e., ANGPTL3 mRNA). The RNAi agent may contain one or more modified nucleotides and / or one or more non-phosphodiester bonds.

[0092] As used herein, the terms "silencing," "decreasing," "inhibiting," "downregulating," or "knocking down" when referring to the expression of a given gene mean that the expression of the gene is decreased in a cell, cell population, tissue, organ, or subject in which the gene is transcribed, as measured by the level of RNA transcribed from the gene or the level of polypeptide, protein, or protein subunit translated from the mRNA, compared to a second cell, cell population, tissue, organ, or subject that has not been so treated when the cell, cell population, tissue, organ, or subject is treated with the RNAi agent described herein.

[0093] As used herein, the terms "sequence" and "nucleotide sequence" mean a contiguous or ordered series of nucleobases or nucleotides, described with a sequence of letters using standard nomenclature.

[0094] As used herein, "base", "nucleotide base" or "nucleobase" is a heterocyclic pyrimidine or purine compound that is a component of a nucleotide, including the primary purine bases adenine and guanine, and the primary pyrimidine bases cytosine, thymine, and uracil. Nucleobases can be further modified to include, but are not limited to, universal bases, hydrophobic bases, degenerate bases, size-expanded bases, and fluorinated bases (see, e.g., Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008). The synthesis of such modified nucleobases (including phosphoramidite compounds containing modified nucleobases) is known in the art.

[0095] As used herein, unless otherwise indicated, the term "complementary" when used to describe a first nucleic acid base or nucleotide sequence (e.g., an RNAi agent sense strand or target mRNA) in relation to a second nucleic acid base or nucleotide sequence (e.g., an RNAi agent antisense strand or single-stranded antisense oligonucleotide) means that an oligonucleotide or polynucleotide containing the first nucleotide sequence hybridizes with an oligonucleotide or polynucleotide containing the second nucleotide sequence (forms base pair hydrogen bonds under mammalian physiological conditions (or similar in vitro conditions)) and has the ability to form a double-stranded or double helix structure. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and include natural or modified nucleotides or nucleotide mimics to the extent that at least the above hybridization requirements are met. Sequence identity or complementarity is independent of modifications. For example, as defined herein, a and Af are complementary to U (or T) and identical to A for the purpose of determining identity or complementarity.

[0096] As used herein, "perfectly complementary" or "fully complementary" means that in a hybridized pair of nucleic acid base or nucleotide sequence molecules, all (100%) of the bases in the continuous sequence of the first oligonucleotide hybridize with the same number of bases in the continuous sequence of the second oligonucleotide. The continuous sequence may include all or part of the first or second nucleotide sequence.

[0097] As used herein, "partially complementary" means that in a hybridized pair of nucleic acid base or nucleotide sequence molecules, not all but at least 70% of the bases in the continuous sequence of the first oligonucleotide hybridize with the same number of bases in the continuous sequence of the second oligonucleotide. The continuous sequence may include all or part of the first or second nucleotide sequence.

[0098] As used herein, "substantially complementary" means that in a hybridized pair of nucleobases or nucleotide sequence molecules, not all of the bases in a continuous sequence of a first oligonucleotide hybridize with the same number of bases in a continuous sequence of a second oligonucleotide, but at least 85% do. The continuous sequence may include all or part of the first or second nucleotide sequence.

[0099] As used herein, the terms "complementary", "fully complementary", "partially complementary" and "substantially complementary" are used with respect to the nucleic acid base or nucleotide match between the sense strand and the antisense strand of an RNAi agent, or between the antisense strand of an RNAi agent and the sequence of ANGPTL3 mRNA.

[0100] As used herein, the term "substantially identical" or "substantial identity" as applied to a nucleic acid sequence means that a nucleotide sequence (or a portion of a nucleotide sequence) has at least about 85% sequence identity or higher, for example, at least 90%, at least 95%, or at least 99% identity as compared to a reference sequence. The percentage of sequence identity is determined by comparing two optimally aligned sequences over a comparison window. The percentage is calculated by determining the number of positions where the same type of nucleic acid base is present in both sequences, obtaining the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. The inventions disclosed herein include nucleotide sequences that are substantially identical to those disclosed herein.

[0101] As used herein, the terms "treating," "treatment," etc. mean a method or step taken to provide alleviation or reduction from the number, severity, and / or frequency of one or more symptoms of a disease in a subject. As used herein, "treating" and "treatment" may include prophylactic treatment, management, preventive treatment, and / or inhibition or reduction of the number, severity, and / or frequency of one or more symptoms of a disease in a subject.

[0102] As used herein, the phrase "introducing into a cell" when referring to an RNAi agent means functionally delivering the RNAi agent into the cell. The phrase "functional delivery" means delivering the RNAi agent into the cell in a manner that enables the RNAi agent to have the expected biological activity, such as sequence-specific inhibition of gene expression.

[0103] Unless otherwise specified, the symbols used herein [Chemical formula] are used to mean that any group or groups can be linked thereto in accordance with the scope of the invention described herein.

[0104] As used herein, the term "isomer" refers to a compound having the same molecular formula but different in properties or the sequence of its atomic bonds or the arrangement of its atoms in space. Isomers that differ in the arrangement of their atoms in space are called "stereoisomers." Stereoisomers that are not mirror images of each other are called "diastereoisomers," and stereoisomers that are non-superimposable mirror images are called "enantiomers" or sometimes optical isomers. A carbon atom bonded to four non-identical substituents is called a "chiral center."

[0105] As used herein, unless specifically identified in the structure as having a particular conformation, asymmetric centers are present, and thus, for each structure that gives rise to enantiomers, diastereomers, or other stereoisomeric arrangements, each structure disclosed herein is intended to represent all such possible isomers, including its optically pure forms and racemic forms. For example, the structures disclosed herein are intended to encompass mixtures of diastereomers and single stereoisomers.

[0106] As used in the claims of this specification, the phrase "consisting of" excludes any element, step, or ingredient not specified in the claim. As used in the claims of this specification, the phrase "consisting essentially of" limits the claim to the specified materials or steps and those that do not materially affect the basic and novel characteristics of the claimed invention.

[0107] One of ordinary skill in the art will readily understand and recognize that the compounds and compositions disclosed herein may have certain atoms (e.g., N, O, or S atoms) in a protonated or deprotonated state depending on the environment in which the compound or composition is placed. Accordingly, as used herein, the structures disclosed herein are assumed to be such that certain functional groups, such as OH, SH, or NH, may be protonated or deprotonated. The disclosure herein is intended to encompass the disclosed compounds and compositions, regardless of their protonation state based on the environment (such as pH), as will be readily understood by one of ordinary skill in the art.

[0108] As used herein, the terms "linked" or "conjugated" when referring to a connection between two compounds or molecules mean that the two compounds or molecules are connected by a covalent bond. Unless otherwise described, the terms "linked" and "conjugated" as used herein may refer to a connection between a first compound and a second compound, with or without any intervening atom or group of atoms.

[0109] As used herein, the term "including" is used herein to mean the phrase "including but not limited to" and is used interchangeably therewith. The term "or" is used herein to mean the term "and / or" unless the context clearly indicates otherwise and is used interchangeably therewith.

[0110] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, but the preferred methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. Furthermore, the materials, methods, and examples are illustrative only and not intended to be limiting.

[0111] Other objects, features, aspects, and advantages of the present invention will become apparent from the following detailed description, the accompanying drawings, and the claims.

Brief Description of the Drawings

[0112]

Figure 1A

Figure 1B

Figure 1C

Figure 1D

[0113]

Figure 2A

Figure 2B

Figure 2C

Figure 2D

[0114]

Figure 3A

Figure 3B

Figure 3C

Figure 3D

[0115]

Figure 4A

Figure 4B

Figure 4C

Figure 4D

[0116]

Figure 5A

[0117]

Figure 5B

[0118]

Figure 5C

[0119]

Figure 5D

[0120]

Figure 5E

[0121]

Figure 5F

[0122]

Figure 5G

[0123]

Figure 5H

[0124]

Figure 5I

[0125]

Figure 5J

[0126]

Figure 5K

Mode for Carrying Out the Invention

[0127] Detailed Description RNAi Agent RNAi agents for inhibiting the expression of the ANGPTL3 gene (referred to herein as ANGPTL3 RNAi agents or ANGPTL3 RNAi triggers) are described herein. Each ANGPTL3 RNAi agent comprises a sense strand and an antisense strand. The sense strand and the antisense strand may each be 16 to 30 nucleotides in length. The sense and antisense strands may be of the same length or of different lengths. In some embodiments, the sense and antisense strands are each independently 17 to 27 nucleotides in length. In some embodiments, the sense and antisense strands are each independently 17 to 21 nucleotides in length. In some embodiments, both the sense strand and the antisense strand are each 21 to 26 nucleotides in length. In some embodiments, the sense and antisense strands are each 21 to 24 nucleotides in length. In some embodiments, the sense strand is about 19 nucleotides in length, while the antisense strand is about 21 nucleotides in length. In some embodiments, the sense strand is about 21 nucleotides in length, while the antisense strand is about 23 nucleotides in length. In some embodiments, the sense strand is 23 nucleotides in length and the antisense strand is 21 nucleotides in length. In some embodiments, both the sense strand and the antisense strand are each 21 nucleotides in length. In some embodiments, the sense and antisense strands of the RNAi agent are each independently 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, or 27 nucleotides in length. In some embodiments, the double-stranded RNAi agent has a double-stranded length of about 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides.

[0128] In some embodiments, the region of perfect, substantial, or partial complementarity between the sense strand and the antisense strand is 16 to 26 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) nucleotides in length and is present at or near the 5' end of the antisense strand (e.g., this region may be separated from the 5' end of the antisense strand by 0, 1, 2, 3, or 4 nucleotides that are not perfectly, substantially, or partially complementary).

[0129] The sense strand and the antisense strand each contain a core stretch (also referred to herein as the "core sequence" or "core stretch sequence") that is 16 to 23 nucleotides in length. The antisense strand core stretch is 100% (perfectly) complementary or at least about 85% (substantially) complementary to a nucleotide sequence (e.g., sometimes referred to as the target sequence) present in the ANGPTL3 mRNA target. The sense strand core stretch sequence is 100% (perfectly) complementary or at least about 85% (substantially) complementary to the core stretch sequence in the antisense strand, and thus the sense strand core stretch sequence is typically perfectly identical or at least about 85% identical to the nucleotide sequence (target sequence) present in the ANGPTL3 mRNA target. The sense strand core stretch sequence may be the same length as or a different length from the corresponding antisense core sequence. In some embodiments, the antisense strand core stretch sequence is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the sense strand core stretch sequence is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length.

[0130] Examples of nucleotide sequences used in forming ANGPTL3 RNAi agents are provided in Tables 2, 3, and 4. Examples of RNAi agent duplexes containing the sense and antisense strand sequences in Tables 2, 3, and 4 are shown in Table 5.

[0131] The sense and antisense strands of the ANGPTL3 RNAi agent anneal to form a double strand. The sense and antisense strands of the ANGPTL3 RNAi agent may be partially, substantially, or completely complementary to each other. Within the complementary double-stranded region, the sense strand core stretch sequence is at least 85% complementary or 100% complementary to the antisense strand core stretch sequence. In some embodiments, the sense strand core stretch sequence is at least 85% or 100% complementary to the sequence of 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides corresponding to the antisense strand core stretch sequence, and contains a sequence of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides (i.e., the sense and antisense core stretch sequences of the ANGPTL3 RNAi agent have a region of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that base pairs at least 85% or 100%).

[0132] In some embodiments, the antisense strand of the ANGPTL3 RNAi agent disclosed herein differs from any of the antisense strand sequences in Table 2 or Table 3 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the ANGPTL3 RNAi agent disclosed herein differs from any of the sense strand sequences in Table 2 or Table 4 by 0, 1, 2, or 3 nucleotides.

[0133] The sense strand and / or the antisense strand may, if necessary and independently, contain additional 1, 2, 3, 4, 5, or 6 nucleotides (extensions) at the 3'-end, 5'-end, or both the 3'- and 5'-ends of the core stretch sequence. If present, the additional nucleotides of the antisense strand may or may not be complementary to the corresponding sequence in the ANGPTL3 mRNA. If present, the additional nucleotides of the antisense strand may or may not be identical to the corresponding sequence in the ANGPTL3 mRNA. If present, the additional nucleotides of the antisense strand may or may not be complementary to the additional nucleotides of the corresponding sense strand, if present.

[0134] As used herein, an extension comprises 1, 2, 3, 4, 5, or 6 nucleotides at the 5' and / or 3' end of a sense strand core stretch array and / or an antisense strand core stretch array. Extension nucleotides on the sense strand may or may not be complementary to nucleotides of either the core stretch array nucleotides or the extension nucleotides in the corresponding antisense strand. Conversely, extension nucleotides on the antisense strand may or may not be complementary to nucleotides of either the core stretch nucleotides or the extension nucleotides in the corresponding sense strand. In some embodiments, both the sense strand and the antisense strand of the RNAi agent contain 3' and 5' extensions. In some embodiments, one or more of the 3' extension nucleotides of one strand base pair with one or more of the 5' extension nucleotides of the other strand. In other embodiments, one or more of the 3' extension nucleotides of one strand do not base pair with one or more of the 5' extension nucleotides of the other strand. In some embodiments, the ANGPTL3 RNAi agent has an antisense strand with a 3' extension and a sense strand with a 5' extension. In some embodiments, the extension nucleotides do not base pair and form overhangs. As used herein, an "overhang" refers to a stretch of one or more non-base pairing nucleotides located at the end of a sense strand or antisense strand that does not form part of the hybridized or double-stranded portion of the RNAi agents disclosed herein.

[0135] In some embodiments, the ANGPTL3 RNAi agent comprises an antisense strand having a 3' extension that is 1, 2, 3, 4, 5, or 6 nucleotides in length. In other embodiments, the ANGPTL3 RNAi agent comprises an antisense strand having a 3' extension that is 1, 2, or 3 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides comprise uracil or thymidine nucleotides or nucleotides that are complementary to the corresponding ANGPTL3 mRNA sequence.

[0136] In some embodiments, the 3' end of the antisense strand contains an abasic residue (Ab), which can also be referred to as an "abasic site" or "abasic nucleotide". An abasic residue (Ab) is a nucleotide or nucleoside lacking a nucleobase at the 1' position of the sugar moiety (see, e.g., U.S. Patent No. 5,998,203). In some embodiments, Ab or AbAb can be added to the 3' end of the antisense strand.

[0137] In some embodiments, the sense strand or antisense strand, as used herein, is a non-nucleotide compound or other moiety that can be incorporated into one or more ends of the strands of the RNAi agents disclosed herein, and in some examples, can include a "terminal cap" that provides certain beneficial properties such as, for example, protection against exonuclease degradation. In some embodiments, an inverted abasic residue (invAb) is added to the terminal cap (see Table 6). (See, e.g., F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16). Terminal caps are generally known in the art and include, for example, inverted abasic residues and carbon chains such as terminal C3, C6, or C12 groups. In some embodiments, the terminal cap is present at the 5' end, 3' end, or both the 5' and 3' ends of the sense strand.

[0138] In some embodiments, the ANGPTL3 RNAi agent includes a sense strand having a 3' extension that is 1, 2, 3, 4, or 5 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides include adenosine, uracil, or thymidine nucleotides, AT dinucleotides, or nucleotides corresponding to nucleotides in the ANGPTL3 mRNA sequence. In some embodiments, the 3' sense strand extension includes, or consists of, one of the following sequences: T, UT, TT, UU, UUT, TTT, or TTTT (enumerated 5' to 3' respectively).

[0139] In some embodiments, the 3' end of the sense strand may include additional abasic residues or an inverted abasic terminal cap. In some embodiments, UUAb, UAb, or Ab is added to the 3' end of the sense strand.

[0140] In some embodiments, one or more inverted abasic residues (invAb) are added to the 3' end of the sense strand. In some embodiments, one or more inverted abasic residues (invAb) are added to the 5' end of the sense strand. In some embodiments, one or more inverted abasic residues or inverted abasic sites are inserted between the targeting ligand and the nucleobase sequence of the sense strand of the RNAi agent. In some embodiments, the inclusion of one or more inverted abasic residues or inverted abasic sites at or near the end or ends of the sense strand of the RNAi agent enables enhancement of the activity or other desirable properties of the RNAi agent.

[0141] In some embodiments, the ANGPTL3 RNAi agent comprises a sense strand having a 5' extension that is 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprise nucleotides corresponding to uracil or adenosine nucleotides or nucleotides in the ANGPTL3 mRNA sequence. In some embodiments, the sense strand 5' extension is, but is not limited to, one of the following sequences: CA, AUAGGC, AUAGG, AUAG, AUA, A, AA, AC, GCA, GGCA, GGC, UAUCA, UAUC, UCA, UAU, U, UU (listed 5' to 3'). The sense strand may have a 3' extension and / or a 5' extension.

[0142] In some embodiments, the 5' end of the sense strand may include one or more additional abasic residues (e.g., (Ab) or (AbAb)). In some embodiments, one or more inverted abasic residues (invAb) are added to the 5' end of the sense strand. In some embodiments, one or more inverted abasic residues can be inserted between the targeting ligand and the nucleobase sequence of the sense strand of the RNAi agent. In some embodiments, the inclusion of one or more inverted abasic residues at or near the end or ends of the sense strand of the RNAi agent can enable enhancement of the activity or other desirable properties of the RNAi agent. In some embodiments, the abasic (deoxyribose) residue can be replaced with a ribitol (abasic ribose) residue.

[0143] In some embodiments, the 3' end of the antisense strand core stretch sequence or the 3' end of the antisense strand may include an inverted abasic residue (invAb (see Table 6)).

[0144] Examples of sequences used in forming ANGPTL3 RNAi agents are provided in Tables 2, 3, and 4. In some embodiments, the antisense strand of the ANGPTL3 RNAi agent includes a sequence of any of the sequences in Table 2 or 3. In certain embodiments, ANGPTL3 The antisense strand of the RNAi agent comprises, or consists of, any one of the modified sequences in Table 3. In some embodiments, the antisense strand of the ANGPTL3 RNAi agent comprises the nucleotides (in the 5'-terminal to 3'-terminal direction) 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24 of any of the sequences in Table 2 or 3. In some embodiments, the sense strand of the ANGPTL3 RNAi agent comprises any of the sequences in Table 2 or 4. In some embodiments, the sense strand of the ANGPTL3 RNAi agent comprises the nucleotides (in the 5'-terminal to 3'-terminal direction) 1-18, 1-19, 1-20, 1-21, 1-22, 1-23, 1-24, 1-25, 1-26, 2-19, 2-20, 2-21, 2-22, 2-23, 2-24, 3-20, 3-21, 3-22, 3-23, 3-24, 4-21, 4-22, 4-23, 4-24, 5-22, 5-23 or 5-24 of any of the sequences in Table 2 or 4. In certain embodiments, the sense strand of the ANGPTL3 RNAi agent comprises, or consists of, any one of the modified sequences in Table 4.

[0145] In some embodiments, the sense and antisense strands of the RNAi agents described herein contain the same number of nucleotides. In some embodiments, the sense and antisense strands of the RNAi agents described herein contain different numbers of nucleotides. In some embodiments, the 5'-end of the sense strand and the 3'-end of the antisense strand of the RNAi agent form blunt ends. In some embodiments, the 3'-end of the sense strand and the 5'-end of the antisense strand of the RNAi agent form blunt ends. In some embodiments, both ends of the RNAi agent form blunt ends. In some embodiments, neither end of the RNAi agent is a blunt end. As used herein, "blunt end" refers to the ends of a double-stranded RNAi agent where the terminal nucleotides of the two annealed strands are complementary (form complementary base pairs).

[0146] In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of the RNAi agent form frayed ends. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of the RNAi agent form frayed ends. In some embodiments, both ends of the RNAi agent form frayed ends. In some embodiments, neither end of the RNAi agent is a frayed end. As used herein, a frayed end refers to the end of a double-stranded RNAi agent where the terminal nucleotides of the two annealed strands pair (i.e., do not form overhangs), but are not complementary (i.e., form non-complementary pairs). In some embodiments, one or more non-pairing nucleotides at the end of one strand of the double-stranded RNAi agent form an overhang. The non-pairing nucleotides are in the sense strand or the antisense strand and may create a 3' or 5' overhang. In some embodiments, the RNAi agent contains blunt ends and frayed ends, blunt ends and 5' overhanging ends, blunt ends and 3' overhanging ends, frayed ends and 5' overhanging ends, frayed ends and 3' overhanging ends, two 5' overhanging ends, two 3' overhanging ends, 5' overhanging ends and 3' overhanging ends, two frayed ends, or two blunt ends. Typically, when present, the overhangs are located at the 3' end of the sense strand, the antisense strand, or both the sense strand and the antisense strand.

[0147] Modified nucleotides, when used in various polynucleotide or oligonucleotide constructs, can retain the activity of these compounds while simultaneously increasing the serum stability of the compounds in cells, and can also minimize the potential to activate interferon activity in humans upon administration of the polynucleotide or oligonucleotide construct.

[0148] In some embodiments, the ANGPTL3 RNAi agent is prepared or provided as a salt, mixed salt, or free acid. In some embodiments, the ANGPTL3 RNAi agent is prepared as a sodium salt. Such forms, well known in the art, are within the scope of the invention disclosed herein.

[0149] Modified nucleotide In some embodiments, the ANGPTL3 RNAi agent contains one or more modified nucleotides. As used herein, a "modified nucleotide" is a nucleotide other than a ribonucleotide (2'-hydroxyl nucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides include, but are not limited to, deoxyribonucleotides, nucleotide mimics, abasic nucleotides (represented herein as Ab), 2'-modified nucleotides, 3'-3' linked (inverted) nucleotides (represented herein as invdN, invN, invn), nucleotides containing modified nucleobases, bridged nucleotides, peptide nucleic acids (PNA), 2',3'-seco nucleotide mimics (unlocked nucleic acid base analogs, represented herein as N UNA or NUNA), locked nucleotides (represented herein as N LNA or NLNA), 3'-O-methoxy (2' nucleoside internucleotide linkage) nucleotides (represented herein as 3'-OMen), 2'-F-arabinonucleotides (represented herein as NfANA or Nf ANArepresented by), 5'-Me, 2'-fluoro nucleotides (referred to herein as 5Me-Nf), morpholino nucleotides, vinyl phosphonic acid deoxyribonucleotides (referred to herein as vpdN), vinyl phosphonic acid-containing nucleotides, and cyclopropyl phosphonic acid-containing nucleotides (cPrpN). 2'-Modified nucleotides (i.e., nucleotides having a group other than a hydroxyl group at the 2'-position of the five-membered sugar ring) include, but are not limited to, 2'-O-methyl nucleotides (referred to herein as lowercase "n" in the nucleotide sequence), 2'-deoxy-2'-fluoro nucleotides (also referred to herein as 2'-fluoro nucleotides and referred to herein as Nf), 2'-deoxy nucleotides (referred to herein as dN), 2'-methoxyethyl (2'-O-2-methoxylethyl) nucleotides (also referred to herein as 2'-MOE and referred to herein as NM), 2'-amino nucleotides, and 2'-alkyl nucleotides. Not all positions in a given compound need to be uniformly modified. Conversely, more than one modification can be incorporated into a single ANGPTL3 RNAi agent or even into a single nucleotide thereof. The sense and antisense strands of the ANGPTL3 RNAi agent can be synthesized and / or modified by methods known in the art. Modifications at one nucleotide are independent of modifications at another nucleotide.

[0150] Modified nucleobases include synthetic and natural nucleobases such as 5-substituted pyrimidines, 6-azapyrimidines as well as N-2, N-6 and O-6 substituted purines (e.g., 2-aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, cytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-sulfhydryl, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo (e.g., 5-bromo), 5-trifluoromethyl, and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azadenine, 7-deazaguanine, 7-deazadenine, 3-deazaguanine, and 3-deazadenine.

[0151] In some embodiments, all or substantially all of the nucleotides of the RNAi agent are modified nucleotides. As used herein, an RNAi agent in which substantially all of the nucleotides present are modified nucleotides is an RNAi agent having four or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides in both the sense and antisense strands that are ribonucleotides (i.e., unmodified). As used herein, a sense strand in which substantially all of the nucleotides present are modified nucleotides is a sense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand that are unmodified ribonucleotides. As used herein, an antisense strand in which substantially all of the nucleotides present are modified nucleotides is an antisense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand that are unmodified ribonucleotides. In some embodiments, one or more nucleotides of the RNAi agent are unmodified ribonucleotides.

[0152] Modified nucleoside linkage In some embodiments, one or more nucleotides of the ANGPTL3 RNAi agent are linked by non-standard linkages or backbones (i.e., modified internucleoside linkages or modified backbones). Modified internucleoside linkages or backbones include, but are not limited to, phosphorothioate groups (represented herein by the lower case letter “s”), chiral phosphorothioates, thiophosphonates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, alkylphosphonic acids (e.g., methylphosphonic acid or 3′-alkylene phosphonic acid), chiral phosphonic acids, phosphinic acids, phosphoramidates (e.g., 3′-aminophosphoramidate, aminoalkylphosphoramidate, or thionophosphoramidate), thionoalkyl-phosphonic acids, thionoalkylphosphotriesters, morpholino linkages, boranophosphates having the normal 3′-5′ linkage, 2′-5′ linkage analogs of boranophosphates, or boranophosphates having an inverted polarity in which adjacent pairs of nucleoside units are linked 3′-5′ to 5′-3′ or 2′-5′ to 5′-2′. In some embodiments, the modified internucleoside linkage or backbone lacks a phosphorus atom. Modified internucleoside linkages lacking a phosphorus atom include, but are not limited to, short chain alkyl or cycloalkyl sugar linkages, mixed heteroatom and alkyl or cycloalkyl sugar linkages, or one or more short chain heteroatom or heterocyclic sugar linkages. In some embodiments, modified internucleoside backbones include, but are not limited to, siloxane backbones, sulfide backbones, sulfoxide backbones, sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamic acid backbones, methyleneimino and methylenehydrazino backbones, sulfonic acid and sulfonamide backbones, amide backbones, and other backbones having mixed N, O, S, and CH2 components.

[0153] In some embodiments, the sense strand of the ANGPTL3 RNAi agent may contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, the antisense strand of the ANGPTL3 RNAi agent may contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, or both the sense strand and the antisense strand may independently contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages. In some embodiments, the sense strand of the ANGPTL3 RNAi agent may contain 1, 2, 3, or 4 phosphorothioate linkages, the antisense strand of the ANGPTL3 RNAi agent may contain 1, 2, 3, or 4 phosphorothioate linkages, or both the sense strand and the antisense strand may independently contain 1, 2, 3, or 4 phosphorothioate linkages.

[0154] In some embodiments, the sense strand of the ANGPTL3 RNAi agent contains at least two phosphorothioate internucleoside linkages. In some embodiments, the at least two phosphorothioate internucleoside linkages are between nucleotides 1 to 3 from the 3'-end of the sense strand. In some embodiments, one phosphorothioate internucleoside linkage is at the 5'-end of the sense strand and another phosphorothioate linkage is at the 3'-end of the sense strand. In some embodiments, two phosphorothioate internucleoside linkages are located at the 5'-end of the sense strand and another phosphorothioate linkage is at the 3'-end of the sense strand. In some embodiments, the sense strand contains no phosphorothioate internucleoside linkages between nucleotides, but contains 1, 2, or 3 phosphorothioate linkages between the terminal nucleotides at both the 5'- and 3'-ends, and optionally an inverted abasic residue terminal cap that may be present. In some embodiments, the targeting ligand is linked to the sense strand via a phosphorothioate linkage.

[0155] In some embodiments, the antisense strand of the ANGPTL3 RNAi agent contains four phosphorothioate internucleotide linkages. In some embodiments, the four phosphorothioate internucleotide linkages are between nucleotides at positions 1 to 3, and between nucleotides at positions 19 to 21, 20 to 22, 21 to 23, 22 to 24, 23 to 25, or 24 to 26 from the 5' end of the antisense strand. In some embodiments, three phosphorothioate internucleotide linkages are located between positions 1 to 4 from the 5' end of the antisense strand, and the fourth phosphorothioate internucleotide linkage is located between positions 20 to 21 from the 5' end of the antisense strand. In some embodiments, the ANGPTL3 RNAi agent contains at least three or four phosphorothioate internucleotide linkages in the antisense strand.

[0156] In some embodiments, the ANGPTL3 RNAi agent contains one or more modified nucleotides and one or more modified internucleotide linkages. In some embodiments, 2'-modified nucleotides are combined with modified internucleotide linkages.

[0157] ANGPTL3 RNAi agent In some embodiments, the ANGPTL3 RNAi agents disclosed herein target the ANGPTL3 gene at or near the positions of the ANGPTL3 sequences shown in Table 1. In some embodiments, the antisense strand of the ANGPTL3 RNAi agents disclosed herein contains a core stretch sequence that is fully, substantially, or at least partially complementary to the 19-mer sequence of the target ANGPTL3 disclosed in Table 1.

Table 1-1

Table 1-2

[0158] In some embodiments, the ANGPTL3 RNAi agent comprises an antisense strand capable of forming a base pair at position 19 of the antisense strand (5’→3’) with position 1 of the 19-mer target sequence disclosed in Table 1. In some embodiments, the ANGPTL3 RNAi agent comprises an antisense strand capable of forming a base pair at position 1 of the antisense strand (5’→3’) with position 19 of the 19-mer target sequence disclosed in Table 1.

[0159] In some embodiments, the ANGPTL3 RNAi agent comprises an antisense strand capable of forming a base pair at position 2 of the antisense strand (5’→3’) with position 18 of the 19-mer target sequence disclosed in Table 1. In some embodiments, the ANGPTL3 RNAi agent comprises an antisense strand capable of forming base pairs with each of the respective complementary bases located at positions 18 to 2 of the 19-mer target sequence disclosed in Table 1 from position 2 to position 18 of the antisense strand (5’→3’).

[0160] For the RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (5’ end → 3’ end) may be perfectly complementary to the ANGPTL3 gene or non-complementary to the ANGPTL3 gene. In some embodiments, the nucleotide at position 1 of the antisense strand (5’ end → 3’ end) is U, A, or dT. In some embodiments, the nucleotide at position 1 of the antisense strand (5’ end → 3’ end) forms an A:U or U:A base pair with the sense strand.

[0161] In some embodiments, the antisense strand of the ANGPTL3 RNAi agent comprises the sequence of 2 to 18 or 2 to 19 nucleotides of any of the antisense strand sequences in Table 2 or Table 3 (5’ end → 3’ end). In some embodiments, the sense strand of the ANGPTL3 RNAi comprises the sequence of 1 to 17, 1 to 18, or 2 to 18 nucleotides of any of the sense strand sequences in Table 2 or Table 4 (5’ end → 3’ end).

[0162] In some embodiments, the ANGPTL3 RNAi agent comprises: (i) an antisense strand comprising a sequence of 2 to 18 or 2 to 19 nucleotides of any of the antisense strand sequences in Table 2 or Table 3 (from 5'-end to 3'-end), and (ii) a sense strand comprising a sequence of 1 to 17 or 1 to 18 nucleotides of any of the sense strand sequences in Table 2 or Table 4 (from 5'-end to 3'-end).

[0163] In some embodiments, the ANGPTL3 RNAi agent comprises the 19-mer core nucleotide sequence shown in Table 2 below.

Table 2-1

Table 2-2

Table 2-3

Table 2-4

[0164] The sense and antisense strands of the ANGPTL3 RNAi agent comprising or consisting of the sequences in Table 2 may be modified or unmodified nucleotides. In some embodiments, the ANGPTL3 RNAi agent having sense and antisense strand sequences comprising or consisting of the sequences in Table 2 is entirely or substantially entirely modified nucleotides.

[0165] In some embodiments, the antisense strand of the ANGPTL3 RNAi agent disclosed herein differs from any of the antisense strand sequences in Table 2 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the ANGPTL3 RNAi agent disclosed herein differs from any of the sense strand sequences in Table 2 by 0, 1, 2, or 3 nucleotides.

[0166] As used herein, each N listed in the sequences disclosed in Table 2 can be independently selected from any nucleobase (including those found in both modified and unmodified nucleotides). In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have nucleobases that are complementary to the N nucleotides at the corresponding positions on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have nucleobases that are not complementary to the N nucleotides at the corresponding positions on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have nucleobases that are the same as the N nucleotides at the corresponding positions on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have nucleobases that are different from the N nucleotides at the corresponding positions on the other strand.

[0167] The antisense strand of a particular modified ANGPTL3 RNAi agent, as well as its underlying unmodified nucleobase sequence, are provided in Table 3. The sense strand of a particular modified ANGPTL3 RNAi agent and its underlying unmodified nucleobase sequence are provided in Table 4. In the formation of the ANGPTL3 RNAi agent, each of the nucleotides in each of the underlying base sequences listed in Tables 3 and 4, and in Table 2 above, may be a modified nucleotide.

[0168] The ANGPTL3 RNAi agents described herein are formed by annealing an antisense strand and a sense strand. A sense strand containing a sequence listed in Table 2 or Table 4 can be hybridized to any antisense strand containing a sequence listed in Table 2 or Table 3, provided that the two sequences have regions that are at least 85% complementary over a sequence of 16, 17, 18, 19, 20, or 21 consecutive nucleotides.

[0169] In some embodiments, the antisense strand of the ANGPTL3 RNAi agent comprises the nucleotide sequence of any of the sequences in Table 2 or Table 3.

[0170] In some embodiments, the ANGPTL3 RNAi agent comprises or consists of a duplex having the nucleobase sequences of the sense and antisense strands of any of the sequences in Table 2, Table 3, or Table 4.

[0171] Examples of antisense strands containing modified nucleotides are provided in Table 3. Examples of sense strands containing modified nucleotides are provided in Table 4.

[0172] When used in Tables 3 and 4, the following notations are used to indicate modified nucleotides, targeting groups, and linking groups: A = adenosine-3'-phosphate C = cytidine-3'-phosphate G = guanosine-3'-phosphate U = uridine-3'-phosphate I = inosine-3'-phosphate n = any 2'-OMe modified nucleotide a = 2'-O-methyladenosine-3'-phosphate as = 2'-O-methyladenosine-3'-phosphorothioate c = 2'-O-methylcytidine-3'-phosphate cs = 2'-O-methylcytidine-3'-phosphorothioate g = 2'-O-methylguanosine-3'-phosphate gs = 2'-O-methylguanosine-3'-phosphorothioate t = 2'-O-methyl-5-methyluridine-3'-phosphate ts = 2'-O-methyl-5-methyluridine-3'-phosphorothioate u = 2'-O-methyluridine-3'-phosphate us = 2'-O-methyluridine-3'-phosphorothioate i = 2'-O-methylinosine-3'-phosphate is = 2'-O-methylinosine-3'-phosphorothioate Nf = any 2'-fluoro modified nucleotide Af = 2'-fluoroadenosine-3'-phosphate Afs = 2'-Fluoroadenosine-3'-Phosphorothioate Cf = 2'-Fluorocytidine-3'-Phosphate Cfs = 2'-Fluorocytidine-3'-Phosphorothioate Gf = 2'-Fluoroguanosine-3'-Phosphate Gfs = 2'-Fluoroguanosine-3'-Phosphorothioate Tf = 2'-Fluoro-5'-methyluridine-3'-Phosphate Tfs = 2'-Fluoro-5'-methyluridine-3'-Phosphorothioate Uf = 2'-Fluorouridine-3'-Phosphate Ufs = 2'-Fluorouridine-3'-Phosphorothioate dN = Any 2'-Deoxyribonucleotide dA = 2'-Deoxyadenosine-3'-Phosphate dAs = 2'-Deoxyadenosine-3'-Phosphorothioate dC = 2'-Deoxycytidine-3'-Phosphate dCs = 2'-Deoxycytidine-3'-Phosphorothioate dG = 2'-Deoxyguanosine-3'-Phosphate dGs = 2'-Deoxyguanosine-3'-Phosphorothioate dT = 2'-Deoxythymidine-3'-Phosphate dTs = 2'-Deoxythymidine-3'-Phosphorothioate dU = 2'-Deoxyuridine-3'-Phosphate dUs = 2'-Deoxyuridine-3'-Phosphorothioate N UNA = 2',3'-seco Nucleotide Mimic (Unlocked Nucleic Acid Base Analogue)-3'-Phosphate N UNA s = 2',3'-seco Nucleotide Mimic (Unlocked Nucleic Acid Base Analogue)-3'-Phosphorothioate A UNA = 2',3'-seco-Adenosine-3'-Phosphate A UNAs = 2’,3’-seco-adenosine-3’-phosphorothioate C UNA = 2’,3’-seco-cytidine-3’-phosphate C UNA s = 2’,3’-seco-cytidine-3’-phosphorothioate G UNA = 2’,3’-seco-guanosine-3’-phosphate G UNA s = 2’,3’-seco-guanosine-3’-phosphorothioate U UNA = 2’,3’-seco-uridine-3’-phosphate U UNA s = 2’,3’-seco-uridine-3’-phosphorothioate a_2N = See Table 6 a_2Ns = See Table 6 pu_2N = See Table 6 pu_2Ns = See Table 6 N LNA = Locked nucleotide Nf ANA = 2’-F-arabinonucleotide NM = 2’-O-methoxyethyl nucleotide AM = 2’-O-methoxyethyl adenosine-3’-phosphate AMs = 2’-O-methoxyethyl adenosine-3’-phosphorothioate GM = 2’-O-methoxyethyl guanosine-3’-phosphate GMs = 2’-O-methoxyethyl guanosine-3’-phosphorothioate TM = 2’-O-methoxyethyl thymidine-3’-phosphate TMs = 2’-O-methoxyethyl thymidine-3’-phosphorothioate mCM = See Table 6 mCMs = See Table 6 R = Ribitol (invdN) = Any inverted deoxyribonucleotide (3'-3' linked nucleotide) (invAb) = Inverted (3'-3' linked) abasic deoxyribonucleotide, see Table 6 (invAb)s = Inverted (3'-3' linked) abasic deoxyribonucleotide-5'-phosphorothioate, see Table 6 (invn) = Any inverted 2'-OMe nucleotide (3'-3' linked nucleotide) s = Phosphorothioate linkage sp = See Table 6 D2u = See Table 6 pD2u = See Table 6 vpdN = Vinylphosphonic acid deoxyribonucleotide (5Me-Nf) = 5'-Me, 2'-fluoronucleotide cPrp = Cyclopropylphosphonic acid, see Table 6 epTcPr = See Table 6 epTM = See Table 6

[0173] One of ordinary skill in the art will readily understand that, unless otherwise indicated by the sequence (e.g., such as by a phosphorothioate linkage "s"), nucleotide monomers are linked to each other by 5'-3'-phosphodiester linkages when present in an oligonucleotide. As will be clearly understood by one of ordinary skill in the art, the inclusion of phosphorothioate linkages shown in the modified nucleotide sequences disclosed herein replaces the phosphodiester linkages that are typically present in an oligonucleotide (see, e.g., FIGS. 5A-5K showing all internucleoside linkages). Further, one of ordinary skill in the art will readily understand that the terminal nucleotide at the 3' end of a given oligonucleotide sequence typically has a hydroxyl (-OH) group at the 3' position of each given monomer in place of a phosphate moiety ex vivo. Further, as will be readily understood and recognized by one of ordinary skill in the art, the phosphorothioate chemical structures shown herein typically show an anion on the sulfur atom, but the inventions disclosed herein include all phosphorothioate tautomers and / or diastereomers (e.g., where the sulfur atom has a double bond and the anion is an oxygen atom). Unless otherwise expressly indicated herein, such understanding by one of ordinary skill in the art is used when describing the ANGPTL3 RNAi agents and compositions of ANGPTL3 RNAi agents disclosed herein.

[0174] Certain examples of targeting groups and linking groups used in conjunction with the ANGPTL3 RNAi agents disclosed herein are provided in Table 6 below. More specifically, the targeting groups and linking groups are as follows: (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s, and their chemical structures are provided in Table 6 below. Each sense strand and / or antisense strand may have any targeting group or linking group listed herein, as well as other targeting or linking groups conjugated to the 5' and / or 3' ends of the sequence.

Table 3-1

Table 3-2

Table 3-3

[0175]

Table 4-1

Table 4-2

Table 4-3

Table 4-4

Table 4-5

[0176] The ANGPTL3 RNAi agent described in this specification is formed by annealing an antisense strand and a sense strand. Under the condition that two sequences have regions that are at least 85% complementary over a sequence of 16, 17, 18, 19, 20, or 21 consecutive nucleotides, the sense strand containing the sequence listed in Table 2 or Table 4 can be hybridized to any antisense strand containing the sequence listed in Table 2 or Table 3.

[0177] In some embodiments, the antisense strand of the ANGPTL3 RNAi agent disclosed herein differs from any of the antisense strand sequences in Table 3 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the ANGPTL3 RNAi agent disclosed herein differs from any of the sense strand sequences in Table 4 by 0, 1, 2, or 3 nucleotides.

[0178] In some embodiments, the antisense strand of the ANGPTL3 RNAi agent comprises the nucleotide sequence of any of the sequences in Table 2 or Table 3. In some embodiments, the ANGPTL3 RNAi agent's antisense strand comprises the sequence of nucleotides 1 - 17, 2 - 17, 1 - 18, 2 - 18, 1 - 19, 2 - 19, 1 - 20, 2 - 20, 1 - 21, 2 - 21, 1 - 22, 2 - 22, 1 - 23, 2 - 23, 1 - 24, or 2 - 24 (from 5' end to 3' end) of any of the sequences in Table 2 or Table 3. In certain embodiments, the antisense strand of the ANGPTL3 RNAi agent comprises, or consists of, any one of the modified sequences in Table 3.

[0179] In some embodiments, the sense strand of the ANGPTL3 RNAi agent comprises the nucleotide sequence of any of the sequences in Table 2 or Table 4. In some embodiments, the sense strand of the ANGPTL3 RNAi agent comprises the sequence of nucleotides 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, 4-21, 1-22, 2-22, 3-22, 4-22, 1-23, 2-23, 3-23, 4-23, 1-24, 2-24, 3-24, or 4-24 of any of the sequences in Table 2 or Table 4 (in the 5' to 3' direction). In certain embodiments, the sense strand of the ANGPTL3 RNAi agent comprises, or consists of, any one of the modified sequences in Table 4.

[0180] For the ANGPTL3 RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (in the 5' to 3' direction) may be perfectly complementary to the ANGPTL3 gene or non-complementary to the ANGPTL3 gene. In some embodiments, the nucleotide at position 1 of the antisense strand (in the 5' to 3' direction) is U, A, or dT (or a modified version thereof). In some embodiments, the nucleotide at position 1 of the antisense strand (in the 5' to 3' direction) forms an A:U or U:A base pair with the sense strand.

[0181] In some embodiments, the antisense strand of the ANGPTL3 RNAi agent comprises the sequence of 2-18 or 2-19 nucleotides of any of the antisense strand sequences in Table 2 or Table 3 (in the 5' to 3' direction). In some embodiments, the sense strand of the ANGPTL3 RNAi comprises the sequence of 1-17 or 1-18 nucleotides of any of the sense strand sequences in Table 2 or Table 4 (in the 5' to 3' direction).

[0182] In some embodiments, the ANGPTL3 RNAi agent comprises (i) an antisense strand comprising a sequence of 2 to 18 or 2 to 19 nucleotides of any of the antisense strand sequences in Table 2 or Table 3 (from 5' end to 3' end), and (ii) a sense strand comprising a sequence of 1 to 17 or 1 to 18 nucleotides of any of the sense strand sequences in Table 2 or Table 4 (from 5' end to 3' end).

[0183] A sense strand containing a sequence listed in Table 2 or Table 4 can be hybridized to any antisense strand containing a sequence listed in Table 2 or Table 3, provided that the two sequences have regions that are at least 85% complementary over a sequence of 16, 17, 18, 19, 20, or 21 consecutive nucleotides. In some embodiments, the ANGPTL3 RNAi agent has a sense strand consisting of any of the modified sequences in Table 4 and an antisense strand consisting of any of the modified sequences in Table 3. Certain representative sequence pairs are exemplified by the duplex ID numbers shown in Table 5.

[0184] In some embodiments, the ANGPTL3 RNAi agent comprises, consists of, or consists essentially of a double-strand represented by any one of the double-strand ID numbers presented herein. In some embodiments, the ANGPTL3 RNAi agent comprises the nucleotide sequences of either the sense strand and the antisense strand of any one of the double-strands represented by any of the double-strand ID numbers presented herein. In some embodiments, the ANGPTL3 RNAi agent comprises the nucleotide sequences of either the sense strand and the antisense strand of any one of the double-strands represented by any of the double-strand ID numbers presented herein, as well as targeting groups and / or linking groups, wherein the targeting groups and / or linking groups are covalently linked (i.e., conjugated) to the sense strand or the antisense strand. In some embodiments, the ANGPTL3 RNAi agent comprises the modified nucleotide sequences of either the sense strand and the antisense strand of any one of the double-strands represented by any of the double-strand ID numbers presented herein. In some embodiments, the ANGPTL3 RNAi agent comprises the modified nucleotide sequences of either the sense strand and the antisense strand of any one of the double-strands represented by any of the double-strand ID numbers presented herein, as well as targeting groups and / or linking groups, wherein the targeting groups and / or linking groups are covalently linked to the sense strand or the antisense strand.

[0185] In some embodiments, the ANGPTL3 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of either the antisense strand / sense strand double-strand of Table 2 or Table 5, and further comprises a targeting group. In some embodiments, the ANGPTL3 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of either the antisense strand / sense strand double-strand of Table 2 or Table 5, and further comprises an asialoglycoprotein receptor ligand targeting group.

[0186] In some embodiments, the ANGPTL3 RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of either the antisense strand / sense strand duplex of Table 2 or Table 5, and further comprises a targeting group selected from the group consisting of (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s as defined in Table 6 respectively. In some embodiments, the targeting group is (NAG25) or (NAG25)s as defined in Table 6. In other embodiments, the targeting group is (NAG37) or (NAG37)s as defined in Table 6.

[0187] In some embodiments, the ANGPTL3 RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of either the antisense strand and / or sense strand nucleotide sequence of Table 3 or Table 4.

[0188] In some embodiments, the ANGPTL3 RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of either the antisense strand and / or sense strand nucleotide sequence of any of the duplexes of Table 5, and further comprises an asialoglycoprotein receptor ligand targeting group.

[0189] In some embodiments, the ANGPTL3 RNAi agent comprises, consists of, or consists essentially of any of the duplexes of Table 5.

Table 5-1

Table 5-2

[0190] In some embodiments, the ANGPTL3 RNAi agent is prepared or provided as a salt, mixed salt, or free acid. The RNAi agents described herein inhibit or knockdown the expression of one or more ANGPTL3 genes in vivo and / or in vitro upon delivery to cells expressing the ANGPTL3 gene.

[0191] Targeting groups, linking groups, and delivery vehicles In some embodiments, the ANGPTL3 RNAi agent is conjugated to one or more non-nucleotide groups including, but not limited to, targeting groups, linking groups, delivery polymers, or delivery vehicles. The non-nucleotide groups can enhance the targeting, delivery, or binding of the RNAi agent. Examples of targeting groups and linking groups are provided in Table 6. The non-nucleotide groups may be covalently linked to either the 3' and / or 5' end of either the sense strand and / or the antisense strand. In some embodiments, the ANGPTL3 RNAi agent contains non-nucleotide groups linked to the 3' and / or 5' end of the sense strand. In some embodiments, the non-nucleotide group is linked to the 5' end of the sense strand of the ANGPTL3 RNAi agent. The non-nucleotide group may be directly or indirectly linked to the RNAi agent via a linker / linking group. In some embodiments, the non-nucleotide group is linked to the RNAi agent via a labile, cleavable, or reversible bond or linker.

[0192] In some embodiments, the non-nucleotide group enhances the pharmacokinetic or biodistribution properties of the RNAi agent or conjugate to which it is attached, improving the cell- or tissue-specific distribution and cellular uptake of the RNAi agent or conjugate. In some embodiments, the non-nucleotide group enhances the endocytosis of the RNAi agent.

[0193] The targeting group or targeting moiety enhances the pharmacokinetic or biodistribution properties of the conjugate or RNAi agent to which it is attached, improving the cell-specific (in some cases, including organ-specific) distribution and cell-specific (or organ-specific) uptake of the conjugate or RNAi agent. The targeting group can be monovalent, divalent, trivalent, tetravalent, or have a higher valence with respect to the target it is directed against. Representative targeting groups include, but are not limited to, compounds having an affinity for cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, and antibody mimetics having an affinity for cell surface molecules. In some embodiments, the targeting group is linked to the RNAi agent using a PEG linker, or in some instances, a linker such as one, two, or three abasic and / or ribitol (abasic ribose) residues that can act as a linker. In some embodiments, the targeting group comprises a cluster of galactose derivatives.

[0194] The ANGPTL3 RNAi agents described herein can be synthesized to have a reactive group, such as an amino group (also referred to herein as an amine), at the 5' end and / or 3' end. The reactive group can then be used to couple to the targeting moiety using methods typical in the art.

[0195] In some embodiments, the targeting moiety comprises an asialoglycoprotein receptor ligand. As used herein, an asialoglycoprotein receptor ligand is a ligand that contains a compound having an affinity for an asialoglycoprotein receptor. As noted herein, the asialoglycoprotein receptor is highly expressed in hepatocytes. In some embodiments, the asialoglycoprotein receptor ligand comprises or consists of one or more galactose derivatives. As used herein, the term galactose derivative includes both galactose and derivatives of galactose having an affinity for an asialoglycoprotein receptor that is equal to or higher than the affinity of galactose. Galactose derivatives include, but are not limited to, galactose, galactosamine, N-formylgalactosamine, N-acetyl-galactosamine, N-propionyl-galactosamine, N-n-butanoyl-galactosamine, and N-iso-butanoylgalactosamine (see, e.g., S.T. Iobst and K. Drickamer, J.B.C., 1996, 271, 6686). Galactose derivatives and clusters of galactose derivatives useful for in vivo targeting of oligonucleotides and other molecules to the liver are known in the art (see, e.g., Baenziger and Fiete, 1980, Cell, 22, 611-620; Connolly et al., 1982, J. Biol. Chem., 257, 939-945).

[0196] Galactose derivatives are used to target molecules to hepatocytes in vivo through their binding to the asialoglycoprotein receptor expressed on the surface of hepatocytes. The binding of an asialoglycoprotein receptor ligand to the asialoglycoprotein receptor facilitates cell-specific targeting to hepatocytes and endocytosis of the molecule into hepatocytes. The asialoglycoprotein receptor ligand can be a monomer (e.g., having a single galactose derivative) or a multimer (e.g., having multiple galactose derivatives). A galactose derivative or a cluster of galactose derivatives can be attached to the 3' or 5' end of the sense or antisense strand of an RNAi agent using methods known in the art. The preparation of targeting groups such as clusters of galactose derivatives is described, for example, in International Patent Application Publication No. WO2018 / 044350 to Arrowhead Pharmaceuticals, Inc. and International Patent Application Publication No. WO2017 / 156012 to Arrowhead Pharmaceuticals, Inc., the entire contents of both of which are incorporated herein by reference.

[0197] As used herein, a cluster of galactose derivatives includes a molecule having from 2 to 4 terminal galactose derivatives. The terminal galactose derivative is attached to the molecule through its C-1 carbon. In some embodiments, the cluster of galactose derivatives is a galactose derivative trimer (also referred to as a 3-antennary galactose derivative or a trivalent galactose derivative). In some embodiments, the cluster of galactose derivatives includes N-acetyl-galactosamine. In some embodiments, the cluster of galactose derivatives includes 3 N-acetyl-galactosamine. In some embodiments, the cluster of galactose derivatives is a galactose derivative tetramer (also referred to as a 4-antennary galactose derivative or a tetravalent galactose derivative). In some embodiments, the cluster of galactose derivatives includes 4 N-acetyl-galactosamine.

[0198] As used herein, a galactose derivative trimer contains three galactose derivatives each linked to a central branching point. As used herein, a galactose derivative tetramer contains four galactose derivatives each linked to a central branching point. A galactose derivative can be attached to the central branching point through the C-1 carbon of the saccharide. In some embodiments, the galactose derivative is linked to the branching point via a linker or spacer. In some embodiments, the linker or spacer is a flexible hydrophilic spacer such as a PEG group (see, e.g., U.S. Patent No. 5,885,968; Biessen et al. J. Med. Chem. 1995 Vol. 39 p. 1538-1546). In some embodiments, the PEG spacer is a PEG3 spacer. The branching point can be any small molecule that allows for the attachment of three galactose derivatives and further allows for the attachment of the branching point to an RNAi agent. Examples of branching point groups are dilysine or diglutamate. Attachment of the branching point to the RNAi agent can occur through a linker or spacer. In some embodiments, the linker or spacer includes, but is not limited to, a flexible hydrophilic spacer such as a PEG spacer. In some embodiments, the linker includes a rigid linker such as a cyclic group. In some embodiments, the galactose derivative comprises or consists of N-acetyl-galactosamine. In some embodiments, the galactose derivative cluster includes a galactose derivative tetramer, which can be, for example, an N-acetyl-galactosamine tetramer.

[0199] Embodiments of the present disclosure include pharmaceutical compositions for delivering an ANGPTL3 RNAi agent in vivo to cells of the liver. Such pharmaceutical compositions can include, for example, an ANGPTL3 RNAi agent conjugated to a galactose derivative cluster. In some embodiments, the galactose derivative cluster includes a galactose derivative trimer, which can be, for example, an N-acetyl-galactosamine trimer, or a galactose derivative tetramer, which can be, for example, an N-acetyl-galactosamine tetramer.

[0200] Targeting groups include, but are not limited to, (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), and (NAG39)s as defined in Table 6. Other targeting groups comprising galactose cluster targeting ligands are known in the art.

[0201] In some embodiments, a linking group is conjugated to the RNAi agent. The linking group facilitates covalent attachment of the agent to a targeting group, delivery polymer, or delivery vehicle. The linking group can be attached to the 3' and / or 5' end of the sense or antisense strand of the RNAi agent. In some embodiments, the linking group is attached to the sense strand of the RNAi agent. In some embodiments, the linking group is conjugated to the 5' or 3' end of the sense strand of the RNAi agent. In some embodiments, the linking group is conjugated to the 5' end of the sense strand of the RNAi agent. Examples of linking groups include, but are not limited to, reactive groups such as primary amines and alkynes, alkyl groups, abasic nucleotides, ribitol (abasic ribose), and / or PEG groups.

[0202] A linker or linking group is a connection between two atoms that links one chemical group (such as an RNAi agent) or segment of interest to another chemical group (such as a targeting group or delivery polymer) or segment of interest via one or more covalent bonds. A labile linkage contains a labile bond. The linkage may optionally include a spacer that increases the distance between the two atoms being joined. The spacer can further add flexibility and / or length to the linkage. Spacers include, but are not limited to, alkyl groups, alkenyl groups, alkynyl groups, aryl groups, aralkyl groups, aralkenyl groups, and aralkynyl groups, each of which may contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and saccharides. Spacer groups are well known in the art and the foregoing list is not intended to limit the scope of the description.

[0203] In some embodiments, when two or more RNAi agents are included in a single composition, each of the RNAi agents can be linked to the same targeting group or two different targeting groups (i.e., targeting groups having different chemical structures). In some embodiments, the targeting group is linked to the ANGPTL3 RNAi agents disclosed herein without using an additional linker. In some embodiments, the targeting group itself is designed to have a linker or other moiety to facilitate the presence of conjugation. In some embodiments, when two or more ANGPTL3 RNAi agents are included in a single composition, each of the RNAi agents may utilize the same linker or different linkers (i.e., linkers having different chemical structures).

[0204] Any of the ANGPTL3 RNAi agent nucleotide sequences listed in Tables 2, 3, or 4 may contain 3' and / or 5' targeting groups or linking groups, whether modified or unmodified. Any of the ANGPTL3 RNAi agent sequences listed in Table 3 or 4, or otherwise described herein, that contain a 3' or 5' targeting group, or a linking group, may alternatively contain different 3' or 5' targeting groups, or linking groups, that do not contain a 3' or 5' targeting group or a linking group, or are not limited to, but include, those shown in Table 6. Any of the ANGPTL3 RNAi agent double strands listed in Table 5 may further contain a targeting group or a linking group, whether modified or unmodified, that is not limited to, but includes, those shown in Table 6, and the targeting group or the linking group can be attached to the 3' or 5' end of either the sense strand or the antisense strand of the ANGPTL3 RNAi agent double strand.

[0205] Examples of targeting groups and linking groups are provided in Table 6. Table 4 provides some embodiments of ANGPTL3 RNAi agent sense strands having a targeting group or a linking group linked to the 5' or 3' end.

Table 6-1

Table 6-2

Table 6-3

Table 6-4

Table 6-5

Table 6-6

Table 6-7

Table 6-8

Table 6-9

Table 6-10

Table 6-11

Table 6-12

Table 6-13

Table 6-14

Table 6-15

Table 6-16

Table 6-17

[0206] In each of the above structures of Table 6, NAG includes N-acetyl-galactosamine or another galactose derivative that would be understood by one of ordinary skill in the art upon combination, considering the above structure and the description provided herein. For example, in some embodiments, NAG in the structure provided in Table 6 has the following structure

Chemical formula

[0207] Each (NAGx) may be attached to the ANGPTL3 RNAi agent via a phosphate group (in the case of (NAG25), (NAG30), and (NAG31)), or a phosphorothioate group (in the case of (NAG25)s, (NAG29)s, (NAG30)s, (NAG31)s, or (NAG37)s), or another linking group.

Chemical formula

[0208] Other linking groups known in the art may be used.

[0209] In some embodiments, a delivery vehicle can be used to deliver the RNAi agent to a cell or tissue. A delivery vehicle is a compound that improves the delivery of the RNAi agent to a cell or tissue. The delivery vehicle may include, but is not limited to, polymers such as amphiphilic polymers, membrane-active polymers, peptides, melittin peptides, melittin-like peptides (MLPs), lipids, reversibly modified polymers or peptides, or reversibly modified membrane-active polyamines, or may consist of them.

[0210] In some embodiments, the RNAi agent can be combined with a lipid, nanoparticle, polymer, liposome, micelle, DPC, or other delivery systems available in the art. The RNAi agent can also be chemically conjugated to a targeting group, a lipid (including, but not limited to, cholesterol and cholesteryl derivatives), a nanoparticle, a polymer, a liposome, a micelle, DPC (see, for example, WO2000 / 053722, WO2008 / 0022309, WO2011 / 104169, and WO2012 / 083185, WO2013 / 032829, WO2013 / 158141, each incorporated herein by reference), or other delivery systems available in the art.

[0211] Pharmaceutical Compositions and Formulations The ANGPTL3 RNAi agents disclosed herein can be formulated as pharmaceutical compositions or formulations (also referred to herein as "medicaments"). In some embodiments, the pharmaceutical composition comprises at least one ANGPTL3 RNAi agent. These pharmaceutical compositions are particularly useful in inhibiting the expression of target mRNA in target cells, cell populations, tissues, or organisms. The pharmaceutical compositions can be used to treat subjects having a disease, disorder, or condition that would benefit from a decrease in the level of target mRNA or inhibition of the expression of the target gene. The pharmaceutical compositions can be used to treat subjects at risk of developing a disease, disorder, or condition that would benefit from a decrease in the level of target mRNA or inhibition of the expression of the target gene. In one embodiment, the method comprises administering to a subject to be treated an ANGPTL3 RNAi agent linked to a targeting ligand described herein. In some embodiments, one or more pharmaceutically acceptable excipients (including vehicles, carriers, diluents, and / or delivery polymers) are added to the pharmaceutical composition comprising the ANGPTL3 RNAi agent to form a pharmaceutical formulation or medicament suitable for in vivo delivery to a subject, including a human.

[0212] The pharmaceutical compositions comprising an ANGPTL3 RNAi agent and the methods disclosed herein reduce the level of a target mRNA in a cell, cell population, tissue, organ, or subject, including by inhibiting the expression of ANGPTL3 mRNA in the subject by administering a therapeutically effective amount of the ANGPTL3 RNAi agent described herein. In some embodiments, the subject has been previously identified or diagnosed as having an upregulation of the pathogenicity of the target gene in the target cell or tissue. In some embodiments, the subject has been previously identified or diagnosed as having an elevated triglyceride (TG) level and / or an elevated cholesterol level or some other lipid abnormality. In some embodiments, the subject has been previously diagnosed as having one or more cardiometabolic diseases such as hypertriglyceridemia, obesity, hyperlipidemia, abnormal lipid and / or cholesterol metabolism, atherosclerosis, atherosclerotic cardiovascular disease, type II diabetes, cardiovascular disease, coronary artery disease, non-alcoholic steatohepatitis, non-alcoholic fatty liver disease, homozygous and heterozygous familial hypercholesterolemia, statin-resistant hypercholesterolemia, and other metabolic-related disorders and diseases. In some embodiments, the subject has suffered from symptoms associated with one or more cardiometabolic diseases associated with or caused by an elevated or increased TG level, an elevated or increased cholesterol level, or fatty liver.

[0213] In some embodiments, the described pharmaceutical compositions comprising an ANGPTL3 RNAi agent are used to treat or manage clinical findings associated with elevated TG levels, elevated cholesterol levels, fatty liver, and / or overexpression of ANGPTL3 mRNA in a subject. In some embodiments, one or more therapeutically (including prophylactically) effective amounts of the pharmaceutical composition are administered to a subject in need of such treatment. In some embodiments, any administration of the disclosed ANGPTL3 RNAi agents can be used to reduce the number, severity, and / or frequency of symptoms of a disease in a subject.

[0214] Using the pharmaceutical composition described herein that comprises an ANGPTL3 RNAi agent, at least one symptom in a subject having a disease or disorder that would benefit from a decrease or inhibition in the expression of ANGPTL3 mRNA can be treated. In some embodiments, the symptom is treated by administering to the subject a therapeutically effective amount of one or more pharmaceutical compositions comprising an ANGPTL3 RNAi agent. In other embodiments, at least one symptom is prevented or inhibited by administering to the subject a prophylactically effective amount of one or more ANGPTL3 RNAi agents.

[0215] The route of administration is a route by which the ANGPTL3 RNAi agent contacts the body. Generally, methods for administering drugs and oligonucleotides and nucleic acids for the treatment of mammals are well known in the art and can be applied to the administration of the compositions described herein. The ANGPTL3 RNAi agents disclosed herein can be administered by any suitable route in a formulation appropriately adapted for the particular route. Thus, the pharmaceutical compositions described herein can be administered by injection, for example, intravenously, intramuscularly, intradermally, subcutaneously, intra-articularly, or intraperitoneally. In some embodiments, the pharmaceutical compositions described herein are administered via subcutaneous injection.

[0216] The pharmaceutical compositions comprising an ANGPTL3 RNAi agent described herein can be delivered to cells, cell populations, tissues, or subjects using oligonucleotide delivery techniques known in the art. Generally, any suitable method recognized in the art for delivering nucleic acid molecules (in vitro or in vivo) can be adapted for use with the compositions described herein. For example, delivery can be by local administration (e.g., direct injection, implantation, or topical application), systemic administration, or intracranial (e.g., intraventricular, intrenchymal, and intrathecal), intramuscular, transdermal, airway (aerosol), nasal, oral, rectal, or local (including buccal and sublingual) administration, and can be by subcutaneous, intravenous, intraperitoneal, or parenteral routes. In some embodiments, the composition is administered via subcutaneous or intravenous infusion or injection.

[0217] In some embodiments, the pharmaceutical compositions described herein include one or more pharmaceutically acceptable excipients. The pharmaceutical compositions described herein are formulated for administration to a subject.

[0218] As used herein, a pharmaceutical composition or medicament includes at least one pharmacologically effective amount of at least one of the described therapeutic compounds, and one or more pharmaceutically acceptable excipients. A pharmaceutically acceptable excipient (excipient) is a substance other than the active pharmaceutical ingredient (API, therapeutic product, e.g., an ANGPTL3 RNAi agent) intentionally included in the drug delivery system. An excipient does not exert, or is not intended to exert, a therapeutic effect at the intended dosage. An excipient can act to a) assist in the processing of the drug delivery system during manufacture, b) protect, support, or enhance the stability, bioavailability, or patient acceptability of the API, c) aid in the identification of the product, and / or d) enhance any other attribute of the overall safety and effectiveness of the delivery of the API during storage or use. A pharmaceutically acceptable excipient may or may not be an inert substance.

[0219] Excipients include, but are not limited to, absorption enhancers, anti-adhesion agents, anti-foaming agents, antioxidants, binders, buffers, carriers, coating agents, colorants, delivery enhancers, delivery polymers, detergents, dextran, dextrose, diluents, disintegrants, emulsifiers, extenders, fillers, flavorants, flow promoters, humectants, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, surfactants, suspending agents, sustained release matrices, sweeteners, thickeners, tonicity agents, vehicles, water repellents, and wetting agents.

[0220] Suitable pharmaceutical compositions for possible injection include sterile aqueous solutions (in the case of water solubility) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor® ELTM (BASF, Parsippany, NJ), or phosphate buffered saline (PBS). Suitable carriers should be stable under the conditions of manufacture and storage and should preserve against the contaminating action of microorganisms such as bacteria and fungi. The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyols (such as glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. For example, the use of coatings such as lecithin, the maintenance of the required particle size in the case of dispersions, and the use of surfactants can maintain appropriate fluidity. In many cases, it is preferable to include in the composition isotonic agents such as sugars, polyalcohols such as mannitol and sorbitol, and sodium chloride. The long-term absorption of injectable compositions can be brought about by including in the composition agents that delay absorption, such as aluminum monostearate and gelatin.

[0221] Optionally, a sterile injectable solution can be prepared by incorporating the required amount of the active compound in a suitable solvent, with one or a combination of the ingredients listed above, followed by sterile filtration. Generally, dispersions are prepared by incorporating the active compound in a sterile vehicle containing the basic dispersion medium and the required other ingredients derived from those listed above. In the case of sterile powders for the preparation of sterile injectable solutions, the methods of preparation include vacuum drying and freeze drying, which produce a powder of the active ingredient and any additional desired ingredients derived from its previously sterile filtered solution.

[0222] Formulations suitable for intra-articular administration may be in the form of a sterile aqueous preparation of the drug, which may be in microcrystalline form, for example, in the form of an aqueous microcrystalline suspension. Liposomal formulations or biodegradable polymer systems can also be used to provide drugs for both intra-articular and intra-ocular administration.

[0223] Active compounds can be formulated using carriers that protect the compound against rapid removal from the body, such as controlled-release formulations, including implants and microcapsule delivery systems. Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. Methods for preparing such formulations will be apparent to those skilled in the art. Liposomal suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Patent No. 4,522,811.

[0224] The ANGPTL3 RNAi agent can be formulated into a composition in unit dosage form for ease of administration and uniformity of dosage. A unit dosage form refers to physically discrete units suitable as a single dosage for a subject to be treated; each unit contains a predetermined amount of the active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specifications for the unit dosage forms of the present disclosure are determined by and directly depend on the unique characteristics of the active compound and the therapeutic effect to be achieved, as well as the inherent limitations in the art of combining such active compounds for the treatment of individuals.

[0225] The pharmaceutical composition may contain other additional components commonly found in pharmaceutical compositions. Such additional components include, but are not limited to, antipruritics, astringents, local anesthetics, analgesics, antihistamines, or anti-inflammatory agents (e.g., acetaminophen, NSAIDs, diphenhydramine, etc.). It is also contemplated that cells, tissues, or isolated organs that express or contain an RNAi agent as defined herein can be used as a "pharmaceutical composition". As used herein, "pharmacologically effective amount", "therapeutically effective amount" or simply "effective amount" refers to the amount of the RNAi agent that produces a pharmacological, therapeutic, or prophylactic result.

[0226] In some embodiments, the methods disclosed herein further comprise administering a second therapeutic agent or treatment in addition to the step of administering the RNAi agent disclosed herein. In some embodiments, the second therapeutic agent is another ANGPTL3 RNAi agent (e.g., an ANGPTL3 RNAi agent that targets a different sequence within the ANGPTL3 target). In other embodiments, the second therapeutic agent may be a small molecule drug, an antibody, an antibody fragment, or an aptamer.

[0227] Generally, the effective amount of the active compound is in the range of about 0.1 to about 100 mg / kg body weight / day, for example, about 1.0 to about 50 mg / kg body weight / day. In some embodiments, the effective amount of the active compound is in the range of about 0.25 to about 5 mg / kg body weight / dose. In some embodiments, the effective amount of the active ingredient is in the range of about 0.5 to about 4 mg / kg body weight / dose. The amount administered may also depend on variables such as the overall health of the patient, the relative biological efficacy of the compound being delivered, the formulation of the drug, the presence and type of excipients in the formulation, and the route of administration. Also, the initial dosage administered may be increased above the upper limit level to rapidly achieve the desired blood or tissue level, or the initial dosage may be less than the optimal dosage.

[0228] For treating a disease or for forming a medicament or composition for treating a disease, the pharmaceutical composition described herein comprising an ANGPTL3 RNAi agent can be combined with an excipient and / or with a second therapeutic agent or treatment including, but not limited to, a second or other RNAi agent, small molecule drug, antibody, antibody fragment, peptide, and / or aptamer.

[0229] When added to a pharmaceutically acceptable excipient or adjuvant, the described ANGPTL3 RNAi agent can be packaged in a kit, container, pack, or dispenser. The pharmaceutical composition described herein may be packaged in a pre-filled syringe or vial.

[0230] Methods of Treatment and Inhibition of Expression The ANGPTL3 RNAi agents disclosed herein can be used to treat a subject (e.g., a human or other mammal) having a disease or disorder that would benefit from administration of an RNAi agent. In some embodiments, the RNAi agents disclosed herein are used to treat a subject (e.g., a human) that would benefit from a decrease and / or inhibition of the expression of ANGPTL3 mRNA and / or ANGPTL3 protein levels, e.g., a subject diagnosed with hypertriglyceridemia, obesity, hyperlipidemia, abnormal lipid and / or cholesterol metabolism, atherosclerosis, type II diabetes, cardiovascular disease, coronary artery disease, non-alcoholic steatohepatitis, non-alcoholic fatty liver disease, homozygous and heterozygous familial hypercholesterolemia, statin-resistant hypercholesterolemia, and other metabolism-related disorders and diseases.

[0231] In some embodiments, a subject is administered a therapeutically effective amount of any one or more ANGPTL3 RNAi agents. Treatment of the subject may include therapeutic and / or prophylactic treatment. The subject is administered a therapeutically effective amount of any one or more ANGPTL3 RNAi agents described herein. The subject may be a human, a patient, or a human patient. The subject may be an adult, an adolescent, a child, or an infant. Administration of the pharmaceutical compositions described herein may be to a human or an animal.

[0232] Using the ANGPTL3 RNAi agents described herein, at least one symptom in a subject having an ANGPTL3-related disease or disorder or a disease or disorder mediated at least in part by ANGPTL3 gene expression can be treated. In some embodiments, the ANGPTL3 RNAi agents are used to treat or manage the clinical findings of a subject having an ANGPTL3-related disease or disorder. The subject is administered a therapeutically effective amount of one or more of the ANGPTL3 RNAi agents or ANGPTL3 RNAi agent-containing compositions described herein. In some embodiments, the methods disclosed herein include administering to a subject in need thereof a composition comprising an ANGPTL3 RNAi agent described herein. In some embodiments, a subject is treated by preventing or inhibiting at least one symptom by administering a prophylactically effective amount of any one or more of the described ANGPTL3 RNAi agents.

[0233] In certain embodiments, the present disclosure provides a method for the treatment of a disease, disorder, condition, or medical condition mediated at least in part by ANGPTL3 gene expression in a patient in need thereof, the method comprising administering to the patient any of the ANGPTL3 RNAi agents described herein.

[0234] In some embodiments, the gene expression level and / or mRNA level of the ANGPTL3 gene of the subject to whom the described ANGPTL3 RNAi agent is administered is ANGPTL3 Compared to a subject before administration of an RNAi agent or a subject not receiving an ANGPTL3 RNAi agent, it is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 95%, 96%, 97%, 98%, 99%, or more than 99%. In some embodiments, the level of ENaC or the level of ENaC channel activity in certain epithelial cells of a subject to whom the described ANGPTL3 RNAi agent is administered is at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more than 99% lower compared to a subject before administration of the ANGPTL3 RNAi agent or a subject not receiving the ANGPTL3 RNAi agent. Gene expression levels, protein levels, and / or mRNA levels in a subject can be reduced in the cells, cell populations, and / or tissues of the subject.

[0235] In some embodiments, the ANGPTL3 protein level in a subject to whom the described ANGPTL3 RNAi agent has been administered is at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more than 99% lower compared to a subject before administration of the ANGPTL3 RNAi agent or a subject not receiving the ANGPTL3 RNAi agent. Protein levels in a subject can be reduced in the cells, cell populations, tissues, blood, and / or other body fluids of the subject.

[0236] In some embodiments, the triglyceride (TG) level in a subject administered the described ANGPTL3 RNAi agent is reduced by at least about 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more than 99% compared to the subject before administration of the ANGPTL3 RNAi agent or a subject not administered the ANGPTL3 RNAi agent. The TG level in the subject can be reduced in the subject's cells, cell populations, tissues, blood, and / or other body fluids.

[0237] In some embodiments, the total cholesterol level in a subject administered the described ANGPTL3 RNAi agent is reduced by at least about 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more than 99% compared to the subject before administration of the ANGPTL3 RNAi agent or a subject not administered the ANGPTL3 RNAi agent. In some embodiments, the low density lipoprotein (LDL) cholesterol level in a subject administered the described ANGPTL3 RNAi agent is reduced by at least about 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more than 99% compared to the subject before administration of the ANGPTL3 RNAi agent or a subject not administered the ANGPTL3 RNAi agent. The total cholesterol level and / or the LDL cholesterol level in the subject can be reduced in the subject's cells, cell populations, tissues, blood, and / or other body fluids.

[0238] Reductions in ANGPTL3 mRNA level, ANGPTL3 protein level, TG level, cholesterol level, and LDL cholesterol level can be evaluated by any method known in the art. As used herein, a reduction or decrease in ANGPTL3 mRNA level and / or protein level is collectively referred to herein as a reduction or decrease in ANGPTL3, or an inhibition or decrease in the expression of ANGPTL3. The examples described herein illustrate known methods for evaluating the inhibition of ANGPTL3 gene expression.

[0239] Cells, tissues, organs, and non-human organisms Cells, tissues, organs, and non-human organisms comprising at least one of the ANGPTL3 RNAi agents described herein are contemplated. A cell, tissue, organ, or non-human organism is produced by delivering the RNAi agent to the cell, tissue, organ or non-human organism.

[0240] The embodiments and items provided above are now illustrated using the following non-limiting examples.

Example

[0241] (Example 1) Synthesis of ANGPTL3 RNAi agent The double-stranded ANGPTL3 RNAi agent shown in Table 5 above was synthesized according to the following general procedure.

[0242] A. Synthesis. The sense and antisense strands of the RNAi agent were synthesized according to the phosphoramidite technology on a solid phase used in oligonucleotide synthesis. Depending on the scale, either MerMade96E® (Bioautomation), MerMade12® (Bioautomation), or OP Pilot 100 (GE Healthcare) was used. The synthesis was carried out on a solid phase support made of controlled pore glass (CPG, 500 Å or 600 Å, obtained from Prime Synthesis, Aston, PA, USA). All RNAs and 2'-modified RNA phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, WI, USA) or Hongene Biotech (Shanghai, PRC). The 2'-O-methyl phosphoramidites were the following: (5'-O-dimethoxytrityl-N 6 -(benzoyl)-2'-O-methyl-adenosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, 5'-O-dimethoxy-trityl-N 4 -(acetyl)-2'-O-methyl-cytidine-3'-O-(2-cyanoethyl-N,N-diisopropyl-amino) phosphoramidite, (5'-O-dimethoxytrityl-N 2-(Isobutyryl)-2'-O-methyl-guanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, and 5'-O-dimethoxytrityl-2'-O-methyl-uridine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite were included. 2'-Deoxy-2'-fluoro-phosphoramidite carried the same protecting groups as 2'-O-methylamidite. 5'-(4,4'-Dimethoxytrityl)-2',3'-seco-uridine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite was also purchased from Thermo Fisher Scientific or Hongene Biotech. 5'-Dimethoxytrityl-2'-O-methyl-inosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite was purchased from Glen Research (Virginia) or Hongene Biotech. Depurinated (3'-O-dimethoxytrityl-2'-deoxyribose-5'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite was purchased from ChemGenes (Wilmington, MA, USA) or SAFC (St Louis, MO, USA). 5'-O-dimethoxytrityl-N 2 ,N 6 -(phenoxyacetate)-2'-O-methyl-diaminopurine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite was purchased from ChemGenes or Hongene Biotech.

[0243] The target ligand-containing phosphoramidite was dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM), and all other amidites were dissolved in anhydrous acetonitrile (50 mM) or anhydrous dimethylformamide, and a molecular sieve (3 Å) was added. 5-Benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as the activator solution. The coupling times were 12 minutes (RNA), 15 minutes (target ligand), 90 seconds (2′OMe), and 60 seconds (2′F). A 100 mM solution of 3-phenyl-1,2,4-dithiazol-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was used to introduce phosphorothioate linkages. Except where specifically identified as a "naked" RNAi agent without a target ligand, each of the ANGPTL3 RNAi agent duplexes synthesized and tested in the following examples utilized N-acetyl-galactosamine as "NAG" in the target ligand chemical structure shown in Table 6.

[0244] B. Cleavage and deprotection of oligomers attached to the support. After completion of solid-phase synthesis, the dried solid support was treated with a 1:1 volume solution of 40 wt% methylamine in water and 28% ammonium hydroxide solution (Aldrich) at 30 °C for 1.5 hours. The solution was evaporated and the solid residue was resuspended in water (see below).

[0245] C. Purification. The crude oligomers were purified by anion-exchange HPLC using a TSKgel SuperQ-5PW, 13-μm column and a Shimadzu LC-8 system. Buffer A was 20 mM Tris, 5 mM EDTA, pH 9.0, containing 20% acetonitrile, and buffer B was the same as buffer A with 1.5 M sodium chloride added. A UV trace at 260 nm was recorded. After pooling the appropriate fractions, they were run on size-exclusion HPLC using a GE Healthcare XK 26 / 40 column packed with Sephadex G-25 fine in filtered DI water or in running buffer of 100 mM ammonium bicarbonate, pH 6.7, and 20% acetonitrile.

[0246] D. Annealing. Complementary strands were mixed by combining equimolar RNA solutions (sense and antisense) in 1× phosphate-buffered saline (Corning, Cellgro) to form the RNAi agent. Some of the RNAi agents were lyophilized and stored at -15 to -25 °C. The double-stranded concentration was determined by measuring the absorbance of the solution on a UV-Vis spectrophotometer in 1× phosphate-buffered saline. Then, the absorbance of the solution at 260 nm was multiplied by the conversion factor and the dilution factor to determine the double-stranded concentration. The conversion factor used was 0.037 mg / (mL·cm) or was calculated from the absorption coefficient determined experimentally.

[0247] (Example 2) In Vivo Testing of ANGPTL3 RNAi Agent in Mice To evaluate the in vivo activity of ANGPTL3 RNAi agents designed to target different positions on the ANGPTL3 gene, 6- to 8-week-old female C57bl / 6 mice were used. Pre-dose serum samples were collected on day -1 after a 4-hour fast. On day 1, each mouse received a single subcutaneous injection of 200 μl containing either 3 mg / kg (mpk) of the ANGPTL3 RNAi agent in D5W (5% dextrose aqueous solution) or a control without the RNAi agent (D5W) according to the dosing groups described in Table 7.

Table 7-1

Table 7-2

[0248] Each of the RNAi agents included a modified sequence and an N-acetyl-galactosamine-containing targeting ligand conjugated to the 5'-end of the sense strand (see Tables 3, 4, and 5 for the modified sequence and the targeting ligand structure). Injections were performed between the skin and muscle of the relaxed skin in the neck and shoulder regions (i.e., subcutaneous injection). Three mice in each group were tested (n = 3). Serum was collected on days 8, 13, 22, 29, and 36 (groups 1 and 5-11 only). Before each collection, the mice were fasted for 4 hours. The ANGPTL3 protein level in the serum was measured by ELISA assay (R&D Systems) according to the manufacturer's recommendations. Triglycerides, high-density lipoprotein (HDL), and total cholesterol in the serum were measured in Cobas® Integra 400 (Roche Diagnostics) according to the manufacturer's recommendations.

[0249] The ANGPTL3 protein level, triglyceride level, HDL level, and total cholesterol level of each animal were normalized. For normalization, the levels of ANGPTL3 protein, triglycerides, HDL, and total cholesterol for each animal at a certain time point were divided by the expression level before treatment (in this case, day -1) in that animal, and the expression ratio "normalized relative to before treatment" was determined. Then, the ratio "normalized relative to before treatment" for each individual animal was divided by the average ratio "normalized relative to before treatment" of all mice in the D5W control group, thereby normalizing the expression at a specific time point relative to the D5W control group. This resulted in the expression at each time point normalized relative to the expression in the control group. Data from the tests described in this example are shown in Tables 8-11 below.

Table 8

Table 9

Table 10

Table 11

[0250] The ANGPTL3 RNAi agents AD05342 and AD05343 (Groups 2 and 3) contained nucleotide sequences designed to inhibit the expression of the ANGPTL3 gene at position 743 of the gene; the ANGPTL3 RNAi agent AD05344 (Group 4) contained a nucleotide sequence designed to inhibit the expression of the ANGPTL3 gene at position 744 of the gene; the ANGPTL3 RNAi agents AD05306 and AD05307 (Groups 5 and 6) contained nucleotide sequences designed to inhibit the expression of the ANGPTL3 gene at position 921 of the gene; the ANGPTL3 RNAi agents AD05308 and AD05309 (Groups 7 and 8) contained nucleotide sequences designed to inhibit the expression of the ANGPTL3 gene at position 922 of the gene; the ANGPTL3 RNAi agents AD05310 and AD05311 (Groups 9 and 10) contained nucleotide sequences designed to inhibit the expression of the ANGPTL3 gene at position 1302 of the gene; and the ANGPTL3 RNAi agent AD05312 (Group 11) contained a nucleotide sequence designed to inhibit the expression of the ANGPTL3 gene at position 1304 of the gene (see SEQ ID NO: 1 for the ANGPTL3 gene sequence referred to).

[0251] As shown in Table 8 above, each of the RNAi agents of at least groups 5, 6, 7, 8, 9, 10, and 11 showed ANGPTL3 inhibition. For example, on day 29, group 7 (ANGPTL3 RNAi agent AD05308) containing a nucleotide sequence designed to target position 922 of the ANGPTL3 gene showed an approximately 91% percent decrease (0.088) in ANGPTL3 protein compared to the control. Similarly, both group 5 (ANGPTL3 RNAi agent AD05306) and group 6 (ANGPTL3 RNAi agent AD05307), which were designed to target position 921 of the ANGPTL3 gene, showed a decrease greater than 75% (i.e., 0.240 and 0.206) in ANGPTL3 protein on day 29.

[0252] (Example 3) In vivo test of ANGPTL3 RNAi agent in mice To evaluate the in vivo activity of ANGPTL3 RNAi agents designed to target positions 921 and 922 on the ANGPTL3 gene, 6 - 8 week - old female C57bl / 6 mice were used. Pre - dosing serum samples were collected on day - 1 after a 4 - hour fast. On day 1, each mouse received a single subcutaneous injection of 200 μl containing either 1 mg / kg (mpk) of the ANGPTL3 RNAi agent in D5W (5% dextrose aqueous solution) or a control without the RNAi agent (D5W) according to the dosing groups described in Table 12.

Table 12

[0253] Each of the RNAi agents contained a modified sequence and an N-acetyl-galactosamine-containing targeting ligand conjugated to the 5'-end of the sense strand (see Tables 3, 4, and 5 for the modified sequences and targeting ligand structures). Injections were performed between the skin and muscle of the relaxed skin in the neck and shoulder regions (i.e., subcutaneous injection). Three mice per group were tested (n = 3). Serum was collected on days 9, 15, 22, and 29. Before each collection, the mice were fasted for 4 hours. The ANGPTL3 protein levels in the serum were measured by ELISA assay (R&D Systems) according to the manufacturer's recommendations. Triglycerides, high-density lipoprotein (HDL), and total cholesterol in the serum were measured on a Cobas® Integra 400 (Roche Diagnostics) according to the manufacturer's recommendations.

[0254] The ANGPTL3 protein levels, triglyceride levels, HDL levels, and total cholesterol levels of each animal were normalized. For normalization, the levels of ANGPTL3 protein, triglycerides, HDL, and total cholesterol for each animal at a given time point were each divided by the pre-treatment expression level (in this case, day -1) in that animal to determine the expression ratio "normalized relative to pre-treatment". Then, the "normalized relative to pre-treatment" ratio for each individual animal was divided by the average "normalized relative to pre-treatment" ratio of all mice in the D5W control group to normalize the expression at a specific time point relative to the D5W control group. This resulted in the expression at each time point normalized relative to the expression in the control group. Data from the tests described in this example are shown in Tables 13 - 16 below.

Table 13-1

Table 13-2

Table 14-1

Table 14-2

Table 14-3

Table 15-1

Table 15-2

Table 15-3

Table 16-1

Table 16-2

Table 16-3

[0255] The ANGPTL3 RNAi agents of groups 2 to 11 have different sequences and modification patterns, and each contains a nucleotide sequence designed to inhibit the expression of the ANGPTL3 gene at position 921 of the gene. In addition, the ANGPTL3 RNAi agents of groups 12 to 19 each contain a nucleotide sequence designed to inhibit the expression of the ANGPTL3 gene at position 922 of the gene (see SEQ ID NO: 1 of the ANGPTL3 gene sequence referred to). As shown in Table 12 above, each of the RNAi agents achieved inhibition of ANGPTL3 compared to the control. For example, group 12 (ANGPTL3 RNAi agent AD05308) achieved a nearly 80% decrease in ANGPTL3 protein level compared to the control (0.209) on day 22.

[0256] (Example 4) In vivo test of ANGPTL3 RNAi agent in mice To evaluate the in vivo activity of an ANGPTL3 RNAi agent designed to target additional positions on the ANGPTL3 gene, female C57bl / 6 mice, 6 - 8 weeks old, were used. Pre - dosing serum samples were collected on day - 1 after a 4 - hour fast. On day 1, each mouse received a single subcutaneous injection of 200 μl containing either 1 mg / kg (mpk) or 0.5 mg / kg (mpk) of the ANGPTL3 RNAi agent in D5W (5% dextrose aqueous solution), or a control without the RNAi agent (D5W), according to the dosing groups described in Table 17.

Table 17 - 1

Table 17 - 2

[0257] Each of the RNAi agents contained a modified sequence and an N - acetyl - galactosamine - containing targeting ligand conjugated to the 5' end of the sense strand (see Tables 3, 4, and 5 for the modified sequences and targeting ligand structures). Injections were performed between the skin and muscle of the loose skin in the neck and shoulder regions (i.e., subcutaneous injection). Three mice per group were tested (n = 3). Serum was collected on days 8, 15, 22, 29, and 43 (groups 1 - 3, 9, and 11 - 13 only). Mice were fasted for 4 hours before each collection. ANGPTL3 protein levels in serum were measured by ELISA assay (R&D Systems) according to the manufacturer's recommendations. Triglycerides, high - density lipoprotein (HDL), and total cholesterol in serum were measured on a Cobas® Integra 400 (Roche Diagnostics) according to the manufacturer's recommendations.

[0258] The ANGPTL3 protein levels, triglyceride levels, HDL levels, and total cholesterol levels of each animal were normalized. For normalization, at a certain time point, the levels of ANGPTL3 protein, triglyceride, HDL, and total cholesterol for each animal were divided by their respective pre-treatment expression levels (in this case, day -1) in that animal, and the "expression ratio normalized to pre-treatment" was determined. Subsequently, the "expression ratio normalized to pre-treatment" for each individual animal was divided by the average "expression ratio normalized to pre-treatment" of all mice in the D5W control group, thereby normalizing the expression at a specific time point relative to the D5W control group. As a result, the expression at each time point normalized to the expression of the control group was obtained. The data from the tests described in this example are shown in Tables 18 - 22 below.

Table 18 - 1

Table 18 - 2

Table 19 - 1

Table 19 - 2

Table 20 - 1

Table 20 - 2

Table 21 - 1

Table 21 - 2

Table 22 - 1

Table 22 - 2

[0259] The ANGPTL3 RNAi agents AD05487 and AD05488 (Groups 2 and 3) contained nucleotide sequences designed to inhibit the expression of the ANGPTL3 gene at position 304 of the gene; the ANGPTL3 RNAi agents AD05489 and AD05490 (Groups 4 and 5) contained nucleotide sequences designed to inhibit the expression of the ANGPTL3 gene at position 172 of the gene; the ANGPTL3 RNAi agents AD05491 and AD05492 (Groups 6 and 7) contained nucleotide sequences designed to inhibit the expression of the ANGPTL3 gene at position 1008 of the gene; the ANGPTL3 RNAi agent AD0593 (Group 8) contained a nucleotide sequence designed to inhibit the expression of the ANGPTL3 gene at position 1009 of the gene; the ANGPTL3 RNAi agents AD05494, AD05495, and AD05308 (Groups 9, 10, 11, and 12) contained nucleotide sequences designed to inhibit the expression of the ANGPTL3 gene at position 1302 of the gene; and the ANGPTL3 RNAi agent AD05418 (Group 13) contained a nucleotide sequence designed to inhibit the expression of the ANGPTL3 gene at position 921 of the gene (see SEQ ID NO: 1 with respect to the ANGPTL3 gene sequence referenced).

[0260] As shown in Table 18 above, most of the RNAi agents achieved a decrease in ANGPTL3 protein levels at almost all time points measured, but the ANGPTL3 RNAi agents of Group 2 (AD05487) and Group 3 (AD05488), each containing a nucleotide sequence designed to inhibit ANGPTL3 gene expression at position 304 of the gene, were superior to the other groups in this test. For example, on days 15 and 22, the ANGPTL3 RNAi agent AD05488 (Group 3) achieved more than 90% knockdown of ANGPTL3 protein (i.e., 0.070 on day 15 and 0.092 on day 22). Similarly, the ANGPTL3 RNAi agent AD05487 (Group 2) achieved almost 75% knockdown on days 15 and 22 (i.e., 0.170 on day 15 and 0.138 on day 22). Moreover, the same trend was observed for additional measured parameters including TG, total cholesterol, and LDL, and both Group 2 (AD05487) and Group 3 (AD05488) were generally superior to the other RNAi agents tested (see Tables 19 - 22). For example, for Groups 2 and 3, on day 29, the triglyceride levels decreased by at least 28% (i.e., 0.556 or 0.721), the total cholesterol decreased by at least 31% (i.e., 0.560 or 0.683), and the LDL levels decreased by almost 20% (0.744 or 0.801).

[0261] (Example 5) In Vivo Test of ANGPTL3 RNAi Agent in Cynomolgus Monkeys The ANGPTL3 RNAi agent was evaluated in cynomolgus monkeys. On day 1, cynomolgus monkeys (Macaca fascicularis, also referred to herein as "cynos") were administered a single subcutaneous injection of 0.3 mL / kg (volume approximately 2 - 3 mL, depending on the animal's body weight) containing 3.0 mg / kg of the ANGPTL3 RNAi agent AD05308 or AD05418 formulated in saline. Each of the ANGPTL3 RNAi agents contained modified nucleotides and an N - acetyl - galactosamine targeting ligand conjugated to the 5' end of the sense strand, as shown in Tables 3, 4, and 5.

[0262] Two cynomolgus monkeys per group were tested (n = 2). Blood samples were collected and serum samples were analyzed on days - 37 (before dosing), - 15 (before dosing), and - 1 (before dosing), 8, 16, 23, 30, and 37. Prior to each collection, the cynomolgus monkeys were fasted overnight. ANGPTL3 protein levels in the serum were measured by ELISA assay (R&D Systems) according to the manufacturer's recommendations. The ANGPTL3 protein levels were normalized. For normalization, the ANGPTL3 protein level for each animal at a given time point was divided by the mean expression level before treatment (in this case, days - 37, - 15, and - 1) in that animal to determine the "normalized to pre - treatment" expression ratio.

[0263] Data from the tests described in this example are shown in Tables 23 and 24 below.

Table 23

Table 24

[0264] Each of the cynomolgus monkeys administered either AD05308 or AD05418 showed a decrease in ANGPTL3 protein at all measured time points compared to the pre-treatment measurement values. For example, for individual animals, on day 16, cynomolgus monkeys administered AD05418 showed either a decrease of approximately 64% (0.358 normalized protein level) or 69% (0.309 normalized protein level) of ANGPTL3 protein. Further, on day 37, the cynomolgus monkeys in group 2 (AD05418) also showed an average decrease of approximately 73% (0.270) in ANGPTL protein level.

[0265] (Example 6) In Vivo Testing of ANGPTL3 RNAi Agent in Mice To evaluate the in vivo activity of an additional ANGPTL3 RNAi agent designed to target position 304 on the ANGPTL3 gene, 6 - 8 week-old female C57bl / 6 mice were used. Pre-dose serum samples were collected on day - 1 after a 4-hour fast. On day 1, each mouse received a single subcutaneous injection of 200 μl containing 0.5 mg / kg (mpk) of the ANGPTL3 RNAi agent in D5W (5% aqueous dextrose solution) or a control without the RNAi agent (D5W) according to the dosing groups described in Table 25.

Table 25

[0266] Each of the RNAi agents included a modified sequence and an N-acetyl-galactosamine-containing targeting ligand conjugated to the 5'-end of the sense strand (see Tables 3, 4, and 5 for the modified sequences and targeting ligand structures). Injections were performed between the skin and muscle of the relaxed skin of the neck and shoulder regions (i.e., subcutaneous injection). Three mice per group were tested (n = 3). Serum was collected on days 8, 15, 22, 30, and in specific groups (i.e., only groups 1, 2, 5, and 10) on day 43. Mice were fasted for 4 hours before each collection. ANGPTL3 protein levels in serum were measured by ELISA assay (R&D Systems) according to the manufacturer's recommendations. Triglycerides, total cholesterol, high-density lipoprotein (HDL), and low-density lipoprotein (LDL) in serum were measured in Cobas® Integra 400 (Roche Diagnostics) according to the manufacturer's recommendations.

[0267] The ANGPTL3 protein levels, triglyceride levels, total cholesterol levels, HDL levels, and LDL levels of each animal were normalized. For normalization, the levels of ANGPTL3 protein, triglycerides, HDL, and total cholesterol for each animal at a given time point were each divided by the pre-treatment expression level (in this case, day -1) in that animal, and an expression ratio "normalized relative to pre-treatment" was determined. Next, the "normalized relative to pre-treatment" ratio for each individual animal was divided by the average "normalized relative to pre-treatment" ratio of all mice in the D5W control group to normalize the expression at a specific time point relative to the D5W control group. This yielded the expression at each time point normalized relative to the expression in the control group.

[0268] Data from the tests described in this example are shown in the following table.

Table 26-1

Table 26-2

Table 27

Table 28-1

Table 28-2

Table 29

Table 30

[0269] ANGPTL3 RNAi agents (i.e., AD05488, AD05652, AD05653, AD05654, AD05655, AD05656, AD05657, AD05658, AD05660, AD05661, and AD05662) containing nucleotide sequences designed to target the ANGPTL3 gene at position 304 each (see, for example, SEQ ID NO: 1) were tested. As shown above, each of the RNAi agents showed a substantial decrease in ANGPTL3 protein levels up to at least day 22. A decrease in TG levels and total cholesterol was also observed.

[0270] (Example 7) In vivo testing of ANGPTL3 RNAi agents in mice To further evaluate the in vivo activity of additional ANGPTL3 RNAi agents designed to target position 304 on the ANGPTL3 gene, 6- to 8-week-old female C57bl / 6 mice were used. Pre-dose serum samples were collected on day -1 after a 4-hour fast. On day 1, each mouse was given a single subcutaneous injection of 200 μl containing 0.5 mg / kg (mpk) of the ANGPTL3 RNAi agent in D5W (5% dextrose aqueous solution), or a control without the RNAi agent (D5W), according to the dosing groups described in Table 31.

Table 31

[0271] Each of the RNAi agents contained a modified sequence and an N-acetyl-galactosamine-containing targeting ligand conjugated to the 5'-end of the sense strand (see Tables 3, 4, and 5 for the modified sequences and targeting ligand structures). Injections were performed between the skin and muscle of the relaxed skin in the neck and shoulder regions (i.e., subcutaneous injection). Three mice per group were tested (n = 3). Serum was collected on days 8, 15, 22, and 29. Before each collection, the mice were fasted for 4 hours. The ANGPTL3 protein levels in the serum were measured by ELISA assay (R&D Systems) according to the manufacturer's recommendations. Triglycerides, total cholesterol, high-density lipoprotein (HDL), and low-density lipoprotein (LDL) in the serum were measured on a Cobas® Integra 400 (Roche Diagnostics) according to the manufacturer's recommendations.

[0272] The ANGPTL3 protein levels, triglyceride levels, total cholesterol levels, HDL levels, and LDL levels of each animal were normalized. For normalization, the levels of ANGPTL3 protein, triglycerides, HDL, and total cholesterol for each animal at a certain time point were divided by the pre-treatment expression levels (in this case, day -1) in that animal, and the "expression ratio normalized to pre-treatment" was determined. Then, the "expression ratio normalized to pre-treatment" for each individual animal was divided by the average "expression ratio normalized to pre-treatment" of all mice in the D5W control group to normalize the expression at a specific time point to the D5W control group. This resulted in the expression at each time point normalized to the expression in the control group.

[0273] The data from the tests described in this example are shown in Tables 32 - 36 below.

Table 32

Table 33 - 1

Table 33 - 2

Table 34

Table 35-1

Table 35-2

Table 36

[0274] (Example 8) In vivo test of ANGPTL3 RNAi agent in cynomolgus monkeys Additional ANGPTL3 RNAi agents were evaluated in cynomolgus monkeys. On day 1, cynomolgus monkeys (Macaca fascicularis), a primate species (also referred to herein as "cynos"), were each administered a single subcutaneous injection of 0.3 mL / kg (volume approximately 1 - 2 mL, depending on the animal's body weight) containing 3.0 mg / kg of one of the ANGPTL3 RNAi agents AD05577, AD05307, AD05488, AD05654, or AD05659 formulated in saline. Each of the ANGPTL3 RNAi agents contained modified nucleotides and an N-acetyl-galactosamine targeting ligand conjugated to the 5' end of the sense strand, as shown in Tables 3, 4, and 5.

[0275] Cynomolgus monkeys were tested in groups of two (n = 2). Blood samples were collected and serum samples were analyzed on days -8 (before dosing), 1 (before dosing), 8, 15, 22, 29, and 36. Before each collection, the cynomolgus monkeys were fasted overnight. ANGPTL3 protein levels in serum were measured by ELISA assay (R&D Systems) according to the manufacturer's recommendations. Triglycerides, total cholesterol, high-density lipoprotein (HDL), and low-density lipoprotein (LDL) in serum were measured on a Cobas® Integra 400 (Roche Diagnostics) according to the manufacturer's recommendations.

[0276] The ANGPTL3 protein levels, triglyceride levels, total cholesterol levels, HDL levels, and LDL levels of each animal were normalized. For normalization, at a certain time point, the levels of ANGPTL3 protein, triglycerides, HDL, and total cholesterol for each animal were divided by the mean expression level before treatment (in this case days -8 and 1 (before dosing)) in that animal, and the "expression ratio normalized to before treatment" was determined.

[0277] The data from the tests described in this example are shown in Tables 37 - 41 below.

Table 37

Table 38 - 1

Table 38 - 2

Table 39

Table 40

Table 41

[0278] Each of the cynomolgus monkeys administered with any one of AD05577, AD05307, AD05488, AD05654, or AD05659 showed a decrease in ANGPTL3 protein at all measured time points compared to the pre-treatment measurement values.

[0279] (Example 9) In vivo test of ANGPTL3 RNAi agent in cynomolgus monkeys Additional ANGPTL3 RNAi agents were evaluated in cynomolgus monkeys. On day 1, cynomolgus monkeys (Macaca fascicularis), primates (also referred to herein as "cynos"), were administered a single subcutaneous injection of 0.3 mL / kg (volume approximately 2 - 3 mL, depending on the animal's body weight) containing 2.0 mg / kg of an ANGPTL3 RNAi agent, each containing either AD05488, AD05743, AD05775, or AD05841 formulated in saline. Each of the ANGPTL3 RNAi agents contained modified nucleotides and an N-acetyl-galactosamine targeting ligand conjugated to the 5' end of the sense strand, as shown in Tables 3, 4, and 5. The ANGPTL3 RNAi agents AD05488, AD05743, and AD05775 contained nucleotide sequences designed to target position 304 of the ANGPTL3 gene. The ANGPTL3 RNAi agent AD05841 contained a nucleotide sequence designed to target position 1035 of the ANGPTL3 gene.

[0280] Three cynomolgus monkeys per group were tested (n = 3). Blood samples were collected and serum samples were analyzed on days -14 (before dosing), -7 (before dosing), 1 (before dosing), 8, 15, 22, 29, and 35. Prior to each collection, the cynomolgus monkeys were fasted overnight. ANGPTL3 protein levels in serum were measured by ELISA assay (R&D Systems) according to the manufacturer's recommendations. Triglycerides, total cholesterol, high density lipoprotein (HDL), and low density lipoprotein (LDL) in serum were measured on a Cobas® Integra 400 (Roche Diagnostics) according to the manufacturer's recommendations.

[0281] The ANGPTL3 protein levels, triglyceride levels, total cholesterol levels, HDL levels, and LDL levels of each animal were normalized. For normalization, at a certain point in time, the levels of ANGPTL3 protein, triglyceride, HDL, and total cholesterol for each animal were divided by the average expression levels before treatment in that animal (in this case, on days -14, -7, and 1), respectively, to determine the expression ratio "normalized relative to before treatment".

[0282] Data from the tests described in this example are shown in Tables 42 to 45 below. [Table 42] [Table 43-1] [Table 43-2] [Table 44] [Table 45] [Table 46]

[0283] Each of the cynomolgus monkeys administered any one of AD05488, AD05743, AD05775, and AD05841 at a dosing level of 2.0 mg / kg showed a decrease in ANGPTL3 protein compared to the pre-treatment measurement value at each time point measured.

[0284] (Example 10) Further in vivo tests of ANGPTL3 RNAi agents in mice To evaluate the in vivo activity of additional ANGPTL3 RNAi agents designed to target position 304 on the ANGPTL3 gene, female C57bl / 6 mice, 6 - 8 weeks old, were used. Serum samples before dosing were collected on day - 1 after a 4 - hour fast. On day 1, each mouse received a single subcutaneous injection of 200 μl containing 0.5 mg / kg (mpk) of the ANGPTL3 RNAi agent in D5W (5% dextrose aqueous solution) or a control without the RNAi agent (D5W) according to the dosing groups described in Table 47.

Table 47

[0285] Each of the RNAi agents contained a modified sequence and an N - acetyl - galactosamine - containing targeting ligand conjugated to the 5' end of the sense strand (see Tables 3, 4, and 5 for the modified sequences and targeting ligand structures). As pointed out above, each of the ANGPTL3 RNAi agents administered in this study contained a nucleotide sequence designed to target the ANGPTL3 gene at position 304. Injections were performed between the skin and muscle of the relaxed skin in the neck and shoulder region (i.e., subcutaneous injection). Three mice per group were tested (n = 3). Serum was collected on days 8, 15, 22, 29, and, in some groups (i.e., groups 1, 2, and 9 - 13 only), on day 36. Before each collection, the mice were fasted for 4 hours. ANGPTL3 protein levels in the serum were measured by ELISA assay (R&D Systems) according to the manufacturer's recommendations. Triglycerides, total cholesterol, high - density lipoprotein (HDL), and low - density lipoprotein (LDL) in the serum were measured on a Cobas® Integra 400 (Roche Diagnostics) according to the manufacturer's recommendations.

[0286] The ANGPTL3 protein levels, triglyceride levels, total cholesterol levels, HDL levels, and LDL levels of each animal were normalized. For normalization, at a certain time point, the levels of ANGPTL3 protein, triglycerides, HDL, and total cholesterol for each animal were divided by their respective pre-treatment expression levels (in this case, day -1) in that animal to determine the "normalized relative to pre-treatment" expression ratio. Subsequently, the "normalized relative to pre-treatment" ratio for each individual animal was divided by the average "normalized relative to pre-treatment" ratio of all mice in the D5W control group to normalize the expression at a specific time point relative to the D5W control group. This resulted in the expression at each time point normalized relative to the expression in the control group.

[0287] Data from the tests described in this example are shown in Tables 48 - 52 below.

Table 48 - 1

Table 48 - 2

Table 49 - 1

Table 49 - 2

Table 50 - 1

Table 50 - 2

Table 51 - 1

Table 51 - 2

Table 52

[0288] As shown in Table 48 above, each of the tested ANGPTL3 RNAi agents showed a significant decrease in ANGPTL3 protein at all time points, and a similar trend was observed for the decrease in TG level, total cholesterol level, and LDL level.

[0289] (Example 11) In vivo test of ANGPTL3 RNAi agent in mice To evaluate the dose response of the ANGPTL3 RNAi agent AD05488, female C57bl / 6 mice at 6 - 8 weeks of age were used. Serum samples before administration were collected on day - 1 after 4 hours of fasting. On day 1, each mouse was given a single subcutaneous injection of 200 μl containing each mg / kg dose of the ANGPTL3 RNAi agent in D5W (5% dextrose aqueous solution) or a control without the RNAi agent (D5W) according to the dosing groups described in Table 53.

Table 53

[0290] The tested RNAi agent (AD05488) contained a modified sequence and a targeting ligand containing N - acetyl - galactosamine conjugated to the 5' end of the sense strand (see Tables 3, 4, and 5 for the modified sequence and targeting ligand structure). Injections were performed between the skin and muscle of the relaxed skin in the neck and shoulder region (i.e., subcutaneous injection). Four mice per group were tested (n = 4). Serum was collected on days 8, 15, 22, and 29. Before each collection, the mice were fasted for 4 hours. ANGPTL3 protein levels in serum were measured by ELISA assay (R&D Systems) according to the manufacturer's recommendations. Triglycerides, total cholesterol, high - density lipoprotein (HDL), and low - density lipoprotein (LDL) in serum were measured in Cobas® Integra 400 (Roche Diagnostics) according to the manufacturer's recommendations.

[0291] The ANGPTL3 protein levels, triglyceride levels, total cholesterol levels, HDL levels, and LDL levels of each animal were normalized. For normalization, at a certain time point, the levels of ANGPTL3 protein, triglyceride, HDL, and total cholesterol for each animal were divided by their respective pre-treatment expression levels (in this case, day -1) in that animal, and the expression ratio "normalized relative to pre-treatment" was determined. Subsequently, the ratio "normalized relative to pre-treatment" for each individual animal was divided by the average ratio "normalized relative to pre-treatment" of all mice in the D5W control group, thereby normalizing the expression at a specific time point relative to the D5W control group. As a result, the expression at each time point normalized relative to the expression in the control group was obtained.

[0292] Data from the tests described in this example are shown in Tables 54 - 58 below.

Table 54

Table 55 - 1

Table 55 - 2

Table 56

Table 57 - 1

Table 57 - 2

Table 58

[0293] Furthermore, ANGPTL3 mRNA levels were also evaluated. All mice in each group were sacrificed on day 29 after serum collection, the liver was harvested, and approximately 100 mg of liver samples were collected and snap-frozen in liquid nitrogen for RNA isolation. Subsequently, the levels of ANGPTL3 mRNA in mouse liver were measured by RT-qPCR, and the results are shown in Table 59 below: [Table 59]

[0294] In particular, as shown in Tables 54 and 59, administration of the ANGPTL3 RNAi agent AD05488 showed a decrease in both ANGPTL3 protein and ANGPTL3 mRNA.

[0295] (Example 12) In Vivo Test of ANGPTL3 RNAi Agent in LDL Receptor (LDLR) Knockout Mice To evaluate the effect of RNAi agent administration in a disease model, mice with a genetic mutation in the LDL receptor (referred to herein as LDLR KO mice) were purchased (The Jackson Laboratory). LDLR KO mice have a mutation in Ldlr tm1HerHomozygous for a mutation and having elevated serum cholesterol levels, particularly when fed a high-fat diet. Thirty-nine LDLR KO mice were fed a high-fat diet (Teklad Custom Diets TD.88137) for 3 weeks prior to the start of the study. Additionally, eight LDLR KO mice were fed a chow diet for the same 3-week period. Serum samples were collected prior to dosing on days -15 and -1, after a 4-hour fast. On day 1, each mouse received a single subcutaneous injection of 200 μl per 30 g of body weight of the respective mg / kg dose of the ANGPTL3 RNAi agent in D5W (5% dextrose aqueous solution), a control without the RNAi agent (D5W), or a control RNAi agent containing a nucleotide sequence designed to target the hepatitis B virus (HBV) genome. A second injection of the same formulation was administered to the animals on day 29. The dosing regimen for the study is described in Table 60 below.

Table 60

[0296] Each mouse was maintained on its respective diet throughout the study period. The RNAi agent tested (AD05488) contained a modified sequence and a targeting ligand containing N-acetyl-galactosamine conjugated to the 5' end of the sense strand (see Tables 3, 4, and 5 for the modified sequence and targeting ligand structure). Injections were performed between the skin and muscle of the loose skin in the neck and shoulder region (i.e., subcutaneous injection). Serum was collected on days 8, 15, 22, 29 (prior to the second dose), 36, 43, 50, and 57. Prior to each collection, the LDLR KO mice were fasted for 4 hours. On day 15, four LDLR KO mice from groups 1, 2, and 3 (i.e., the groups fed the high-fat "Western-type" diet) were sacrificed after serum collection, and on day 29, an additional four LDLR KO mice from groups 1, 2, and 3 were sacrificed after serum collection for the purpose of performing mRNA evaluation.

[0297] ANGPTL3 protein levels in serum were measured by ELISA assay (R&D Systems) according to the manufacturer's recommendations. Serum triglycerides, total cholesterol, high-density lipoprotein (HDL), and low-density lipoprotein (LDL) were measured in a Cobas® Integra 400 (Roche Diagnostics) according to the manufacturer's recommendations.

[0298] ANGPTL3 protein levels, triglyceride levels, total cholesterol levels, HDL levels, and LDL levels for each animal were normalized. For normalization, at a given time point, each level of ANGPTL3 protein, TG, total cholesterol, HDL, or LDL for an animal was divided by the mean expression level before treatment in that animal (in this case, the mean of days -15 and -1), and an expression ratio "normalized relative to pre-treatment" was determined.

[0299] Next, the "normalized relative to pre-treatment" ratios for individual animals were divided by the mean "normalized relative to pre-treatment" ratio of all mice in the D5W control group fed the respective same diet, thereby normalizing the expression at a given time point relative to the D5W control group fed the same diet (i.e., either a high-fat "Western-type" diet or a normal chow-fed diet), and thereby obtaining the expression at each time point normalized relative to the expression in the control group.

[0300] Data from the tests described in this example are shown in Tables 61 - 65 below.

Table 61

Table 62

Table 63

Table 64

Table 65-1

Table 65-2

[0301] As shown in Tables 61 to 65, the groups administered with 3.0 mg / kg of the ANGPTL3 RNAi agent AD05488 (i.e., groups 2 and 5) showed a significant decrease in ANGPTL3 protein level, TG level, and total cholesterol in this model. LDLR KO mice fed a high-fat "Western-type" diet showed particularly low levels compared to the control after two administrations of the 3 mg / kg dose of the ANGPTL3 RNAi agent AD05488, and the ANGPTL3 protein level decreased by approximately 99% (0.007) on day 57. HBV It is also pointed out that group 3, which included an RNAi agent control containing a nucleotide sequence designed to target HBV mRNA, showed the expected results and essentially no inhibition of ANGPTL3.

[0302] Furthermore, ANGPTL3 mRNA levels were also evaluated. On day 15, four mice were sacrificed from each of groups 1, 2, and 3. On day 29, another four mice were sacrificed from each of groups 1, 2, and 3. On day 57, all remaining animals in all groups were sacrificed. At the time of sacrifice, the liver was collected, and approximately 100 mg of liver samples from the middle lobe were collected and immediately frozen in liquid nitrogen for RNA isolation. Subsequently, the levels of ANGPTL3 mRNA in mouse liver were measured by RT-qPCR, normalized to the mRNA levels of mice in group 1 (high-fat "Western-type" diet, D5W administration, sacrificed on day 15), and the results are presented in Table 66 below.

Table 66-1

Table 66-2

[0303] Administration of the ANGPTL3 RNAi agent AD05488 showed a significant decrease in ANGPTL3 mRNA levels in both animals fed a high-fat "Western-type" diet and animals fed a normal chow-fed diet.

[0304] (Example 13) In Vivo Testing of an ANGPTL3 RNAi Agent in Rhesus Monkeys Fed a High-Fructose Corn Syrup (HFCS) Diet The ANGPTL3 RNAi agent AD05488 was further evaluated in rhesus monkeys fed a high-fructose corn syrup (HFCS) diet. The rhesus monkeys were fed an HFCS diet for 37 days prior to dosing. These animals were known to produce an increase in plasma triglycerides of more than 180 mg / dL with the HFCS diet. On day 1 and again on day 29, four rhesus monkeys were administered a subcutaneous injection containing 4.0 mg / kg of the ANGPTL3 RNAi agent AD05488 formulated in saline (n = 4). Additionally, two rhesus monkeys were administered a normal saline control. The ANGPTL3 RNAi agent AD05488 contained modified nucleotides and included an N-acetyl-galactosamine targeting ligand conjugated to the 5' end of the sense strand, as shown in Tables 3, 4, and 5.

[0305] Blood samples were collected after fasting for analysis, and serum samples were analyzed on days -8 (prior to dosing), 8, 15, 21, 29, and 36. ANGPTL3 expression levels, triglycerides, total cholesterol, high-density lipoprotein (HDL), and low-density lipoprotein (LDL) in the serum were measured in a Cobas® Integra 400 (Roche Diagnostics) according to the manufacturer's recommendations.

[0306] The ANGPTL3 protein levels, triglyceride levels, total cholesterol levels, HDL levels, and LDL levels of each animal were normalized. For normalization, at a certain point in time, the levels of ANGPTL3 protein, triglycerides, HDL, and total cholesterol for each animal were divided by their pre-treatment expression levels (in this case, day -8) in that animal, and the expression ratio "normalized relative to pre-treatment" was determined.

[0307] Data from the tests described in this example are shown in Tables 67 - 71 below. [Table 67] [Table 68] [Table 69 - 1] [Table 69 - 2] [Table 70] [Table 71]

[0308] Rhesus monkeys administered AD05488 at a dosing level of 4.0 mg / kg showed a significant decrease in ANGPTL3 protein compared to pre-treatment measurements at each time point measured. Furthermore, decreases in triglyceride and total cholesterol levels were evident.

[0309] (Example 14) In vivo test of ANGPTL3 RNAi agent and statin in LDL receptor (LDLR) knockout mice To evaluate the effect of co - administration of an RNAi agent and a statin in a disease model, LDLR KO mice were purchased (The Jackson Laboratory). Three weeks before the start of the test, 41 male 7 - 8 - week - old LDLR KO mice were fed a high - fat (“Western - type”) diet (Teklad Custom Diets TD.88137) and maintained on that diet throughout the test period. Pre - dosing serum was collected on the first day of the test after a 4 - hour fast. The dosing regimen for the test is described in Table 72 below.

Table 72

[0310] The vehicle used for forced oral administration in the test was a 1:1 mixture of purchased Ora - Plus®:Ora - Sweet® solution. For the preparation of atorvastatin forced oral administration, each desired dose of atorvastatin was first dissolved in sterile water (0.3 mL of water per 1 mL of the desired formulation), vortexed until smooth, and then a 1:1 mixture of Ora - Plus®:Ora - Sweet® solution (0.7 mL of vehicle per 1 mL of the desired formulation) was added and vortexed. On day 1 and each subsequent day, the forced oral administration dose was administered to each of the groups except group 2. On day 23, groups 1, 2, 3, and 4 received a single subcutaneous injection of a 2.5 mg / kg dose (31.25 μg / mL solution) of the ANGPTL3 RNAi agent in D5W (5% dextrose in water) or a vehicle control (D5W) without the RNAi agent.

[0311] The RNAi agent tested (AD05488) contained a modified sequence and an N - acetyl - galactosamine - containing targeting ligand conjugated to the 5’ end of the sense strand (see Tables 3, 4, and 5 for the modified sequence and targeting ligand structure). Injections were performed between the skin and muscle of the relaxed skin in the neck and shoulder region (i.e., subcutaneous injection). Serum was collected on days 8, 15, 22 (before RNAi agent injection), 29, 36, 43, and 50. Before each collection, the LDLR KO mice were fasted for 4 hours.

[0312] The ANGPTL3 protein levels in serum were measured by ELISA assay (R&D Systems) according to the manufacturer's recommendations. Among other biomarkers, triglycerides, total cholesterol, and low-density lipoprotein (LDL) in serum were measured on a Cobas® Integra 400 (Roche Diagnostics) according to the manufacturer's recommendations.

[0313] The ANGPTL3 protein levels, triglyceride levels, total cholesterol levels, HDL levels, and LDL levels of each animal were normalized. For normalization, at a certain time point, the respective levels of ANGPTL3 protein, TG, total cholesterol, or LDL for each animal were divided by the pre-treatment expression level (in this case, the pre-dose level on day 1) in that animal, and the expression ratio "normalized relative to pre-treatment" was determined. The data from the tests described in this example are shown in Tables 73 - 76 below.

Table 73-1

Table 73-2

Table 74-1

Table 74-2

Table 75-1

Table 75-2

Table 75-3

Table 76-1

Table 76-2

[0314] Mice administered atorvastatin daily showed a decrease of about 40 - 60% in triglycerides, about 23 - 40% in total cholesterol, and about 30 - 45% in LDL, respectively. Mice treated with higher doses of atorvastatin typically resulted in greater decreases.

[0315] When the ANGPTL3 RNAi agent AD05488 was administered by co - administration with atorvastatin (i.e., groups 3 and 4), it showed an additive effect on lipid parameters. For example, in the groups including co - administration of atorvastatin and the RNAi agent, the overall decreases in triglycerides, total cholesterol, and LDL were about 95%, about 70%, and about 80%, respectively. The overall lipid parameter profile by co - administration of atorvastatin was slightly better than that of the administration of the ANGPTL3 RNAi agent AD05488 alone. Furthermore, the groups of the ANGPTL3 RNAi agent AD05488 showed a clear decrease in ANGPTL3 protein levels, while no decrease in ANGPTL3 protein was observed in the groups without the administration of the ANGPTL3 RNAi agent.

[0316] Other embodiments Although the present invention has been described with its detailed description, it should be understood that the description is intended to illustrate the scope of the present invention as defined by the appended claims and not to limit it. Other aspects, advantages, and modifications are within the scope of the following claims. The present invention provides, for example, the following items. (Item 1) An RNAi agent for inhibiting the expression of the ANGPTL3 gene, an antisense strand comprising at least 17 consecutive nucleotides that differ from any one of the sequences provided in Table 2 or Table 3 by 0 or 1 nucleotide; and a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand An RNAi agent comprising (Item 2) The RNAi agent according to Item 1, wherein the antisense strand contains nucleotides 2 to 18 of any one of the sequences provided in Table 2 or Table 3. (Item 3) The RNAi agent according to Item 1 or Item 2, wherein the sense strand contains a nucleotide sequence of at least 17 consecutive nucleotides that differs from any one of the sense strand sequences provided in Table 2 or Table 4 by 0 or 1 nucleotide, and the sense strand has a region of at least 85% complementarity over 17 consecutive nucleotides of the antisense strand. (Item 4) The RNAi agent according to any one of Items 1 to 3, wherein at least one nucleotide of the RNAi agent is a modified nucleotide or contains a modified internucleoside linkage. (Item 5) The RNAi agent according to any one of Items 1 to 3, wherein all or substantially all of the nucleotides of the sense and / or antisense strands of the RNAi agent are modified nucleotides. (Item 6) The RNAi agent according to Item 4 or 5, wherein the modified nucleotide is selected from the group consisting of 2'-O-methyl nucleotide, 2'-fluoro nucleotide, 2'-deoxy nucleotide, 2',3'-seco nucleotide mimetic, locked nucleotide, 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, abasic nucleotide, ribitol, inverted nucleotide, inverted 2'-O-methyl nucleotide, inverted 2'-deoxy nucleotide, 2'-amino modified nucleotide, 2'-alkyl modified nucleotide, morpholino nucleotide, vinyl phosphonic acid deoxyribonucleotide, and 3'-O-methyl nucleotide. (Item 7) The RNAi agent according to Item 5, wherein all or substantially all of the modified nucleotides are 2'-O-methyl nucleotides and 2'-fluoro nucleotides. (Item 8) The RNAi agent according to any one of items 1 to 7, wherein the antisense strand comprises the nucleotide sequence of any one of the modified antisense strand sequences provided in Table 3. (Item 9) The RNAi agent according to any one of items 1 to 8, wherein the sense strand comprises the nucleotide sequence of any one of the modified sense strand sequences provided in Table 4. (Item 10) The RNAi agent according to item 1, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 3, and the sense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 4. (Item 11) The RNAi agent according to any one of items 1 to 10, which is linked to a targeting ligand. (Item 12) The RNAi agent according to item 11, wherein the targeting ligand comprises N-acetyl-galactosamine. (Item 13) The RNAi agent according to item 11 or item 12, wherein the targeting ligand comprises a structure selected from the group consisting of (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s. (Item 14) The RNAi agent according to item 13, wherein the targeting ligand comprises the structure of (NAG37) or (NAG37)s. (Item 15) The RNAi agent according to any one of items 11 to 14, wherein the targeting ligand is linked to the sense strand. (Item 16) The RNAi agent according to item 15, wherein the targeting ligand is linked to the 5' end of the sense strand. (Item 17) The RNAi agent according to any one of items 1 to 16, wherein the sense strand is 18 to 30 nucleotides in length and the antisense strand is 18 to 30 nucleotides in length. (Item 18) The RNAi agent according to item 17, wherein the sense strand and the antisense strand are each 18 to 27 nucleotides in length. (Item 19) The RNAi agent according to item 18, wherein the sense strand and the antisense strand are each 18 to 24 nucleotides in length. (Item 20) The RNAi agent according to item 19, wherein the sense strand and the antisense strand are each 21 nucleotides in length. (Item 21) The RNAi agent according to any one of items 17 to 20, having two blunt ends. (Item 22) The RNAi agent according to any one of items 1 to 21, wherein the sense strand contains one or two terminal caps. (Item 23) The RNAi agent according to any one of items 1 to 22, wherein the sense strand contains one or two inverted deoxyribonucleotide residues. (Item 24) The RNAi agent according to item 1, comprising a sense strand and an antisense strand that form a double strand having the structure of any one of the double strands in Table 5. (Item 25) The following nucleotide sequence (5'→3') UACUGAUCAAAUAUGUUGAGC (SEQ ID NO: 3); UACUGAUCAAAUAUGUUGAGU (SEQ ID NO: 6); UUUGAAUUAAUGUCCAUGGGC (SEQ ID NO: 8); UUUGAAUUAAUGUCCAUGGGU (SEQ ID NO: 10); UGUUGAAUUAAUGUCCAUGGA (SEQ ID NO: 12); or ACAUCGUCUAACAUAGCAACC (SEQ ID NO: 15) The RNAi agent according to item 1, comprising, consisting essentially of, or containing an antisense strand consisting of a nucleotide sequence in which one of the following nucleotides is different from 0 or 1 nucleotide. (Item 26) The sense strand is the following nucleotide sequence (5’→3’) GCUCAACAUAUUUGAUCAGUA (SEQ ID NO: 17); GCUCAACAU(A 2N )UUUGAUCAGUA (SEQ ID NO: 19) (where (A 2N ) represents a 2-aminoadenosine nucleotide) GCUCAAC(A 2N )U(A 2N )UUUGAUCAGUA (SEQ ID NO: 21) (where (A 2N ) represents a 2-aminoadenosine nucleotide) ACUCAACAUAUUUGAUCAGUA (SEQ ID NO: 24); GCCCAUGGACAUUAAUUCAAA (SEQ ID NO: 26); ACCCAUGGACAUUAAUUCAAA (SEQ ID NO: 28); UCCAUGGACAUUAAUUCAACA (SEQ ID NO: 30); or GGUUGCUAUGUUAGACGAUGU (SEQ ID NO: 32) The RNAi agent according to item 25, consisting of, consisting essentially of, or containing a nucleotide sequence in which one of the following nucleotides is different from 0 or 1 nucleotide. (Item 27) The RNAi agent according to item 25 or 26, wherein all or substantially all of the nucleotides are modified nucleotides. (Item 28) The RNAi agent according to item 25 or 26, wherein the sense strand further contains inverted abasic residues at the 3’ end of the nucleotide sequence, the 5’ end of the nucleotide sequence, or both. (Item 29) The following nucleotide sequences (5’→3’): usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsc (SEQ ID NO: 2); usAfscUfgAfuCfaAfaUfaUfgUfuGfasGfsc (SEQ ID NO: 4); usAfscsUfgAfuCfaAfaUfaUfgUfuGfaGfsu (SEQ ID NO: 5); usUfsusGfaAfuUfaAfuGfuCfcAfuGfggsc (SEQ ID NO: 7); usUfsusGfaAfuUfaAfuGfuCfcAfuGfgGfsu (SEQ ID NO: 9); usGfsusugaauuaaUfgUfcCfaUfgGfsa (SEQ ID NO: 11); usGfsusUfgAfaUfuAfaUfgUfcCfaUfgGfsa (SEQ ID NO: 13); or asCfsasUfcGfucuaaCfaUfaGfcAfaCfsc (SEQ ID NO: 14) (wherein a, c, g, and u represent 2’-O-methyladenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2’-fluoroadenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate bond) An antisense strand comprising, consisting of, or consisting essentially of a modified nucleotide sequence that differs from one of the following by 0 or 1 nucleotide, wherein all or substantially all of the nucleotides on the sense strand are modified nucleotides: The RNAi agent according to item 1. (Item 30) The sense strand has the following nucleotide sequence (5’→3’): gcucaacaUfAfUfuugaucagua (SEQ ID NO: 16); gcucaacaUfa_2NUfuugaucagua (SEQ ID NO: 18); gcucaaca_2NUfa_2NUfuugaucagua (SEQ ID NO: 20); gcUfcAfaCfaUfAfUfuugaucagua (SEQ ID NO: 22); acucaacaUfAfUfuugaucagua (SEQ ID NO: 23); gcccauggAfCfAfuuaauucaaa (SEQ ID NO: 25); acccauggAfCfAfuuaauucaaa (SEQ ID NO: 27); uccauggaCfAfUfuaauucaaca (SEQ ID NO: 29); or gguugcuaUfGfUfuagacgaugu (SEQ ID NO: 31) (wherein a, c, g, and u each represent 2'-O-methyladenosine, cytidine, guanosine, or uridine; Af, Cf, Gf, and Uf each represent 2'-fluoroadenosine, cytidine, guanosine, or uridine; s represents a phosphorothioate bond; a_2N represents 2'-O-methyl-2-aminoadenosine), and contains a modified nucleotide sequence that differs from one of them by 0 or 1 nucleotide, consists of, or consists essentially of, and all or substantially all of the nucleotides on the sense strand are modified nucleotides, the RNAi agent according to item 32. (item 31) The RNAi agent according to any one of items 25 to 30, wherein the sense strand further contains inverted deoxyribonucleotide residues at the 3'-end, 5'-end, or both ends of the nucleotide sequence. (item 32) The RNAi agent according to any one of items 25 to 31, wherein the sense strand of the RNAi agent is linked to a targeting ligand. (item 33) The RNAi agent according to item 32, wherein the targeting ligand has an affinity for an asialoglycoprotein receptor. (item 34) The RNAi agent according to item 33, wherein the targeting ligand contains N-acetyl-galactosamine. (item 35) The RNAi agent according to item 1, having a double-stranded structure selected from the group consisting of AD05488 (SEQ ID NO: 2 and 300) and AD05775 (SEQ ID NO: 2 and 334); AD05791 (SEQ ID NO: 4 and 300); AD05777 (SEQ ID NO: 2 and 336); AD05743 (SEQ ID NO: 2 and 326); AD05487 (SEQ ID NO: 5 and 299); AD05307 (SEQ ID NO: 7 and 278); AD05418 (SEQ ID NO: 9 and 292); AD05577 (SEQ ID NO: 11 and 279); AD05308 (SEQ ID NO: 13 and 279); and AD05840 (SEQ ID NO: 15 and 357). (Item 36) The RNAi agent according to item 35, having a double-stranded structure selected from the group consisting of AD05488 (SEQ ID NO: 2 and 300) and AD05775 (SEQ ID NO: 2 and 334). (Item 37) A composition comprising the RNAi agent according to any one of items 1 to 36, comprising a pharmaceutically acceptable excipient. (Item 38) The composition according to item 37, further comprising a second RNAi agent for inhibiting the expression of ANGPTL3. (Item 39) The composition according to item 37 or 38, further comprising one or more additional therapeutic agents. (Item 40) A method for inhibiting the expression of the ANGPTL3 gene in a cell, comprising the step of introducing an effective amount of the RNAi agent according to any one of items 1 to 36 or the composition according to any one of items 37 to 39 into the cell. (Item 41) The method according to item 40, wherein the cell is within a subject. (Item 42) The method according to item 41, wherein the subject is a human subject. (Item 43) The method according to any one of items 40 to 42, wherein the ANGPTL3 gene expression is inhibited by at least about 30%. (Item 44) A method for treating an ANGPTL3-related disease or disorder, comprising administering to a human subject in need thereof a therapeutically effective amount of the composition according to any one of items 37 to 39. (Item 45) The method according to item 44, wherein the disease is a cardiometabolic disease. (Item 46) The method according to item 44, wherein the disease is hypertriglyceridemia, obesity, hyperlipidemia, abnormal lipid and / or cholesterol metabolism, atherosclerosis, type II diabetes, cardiovascular disease, coronary artery disease, non-alcoholic steatohepatitis, non-alcoholic fatty liver disease, homozygous and heterozygous familial hypercholesterolemia, or statin-resistant hypercholesterolemia. (Item 47) The method according to any one of items 40 to 46, wherein the RNAi agent is administered at a dose of about 0.05 mg / kg human subject body weight to about 5.0 mg / kg human subject body weight. (Item 48) The method according to any one of items 40 to 47, wherein the RNAi agent is administered in two or more doses. (Item 49) A method for reducing triglyceride levels in a subject, comprising administering to the subject an effective amount of the composition according to any one of items 37 to 39. (Item 50) A method for reducing cholesterol levels in a subject, comprising administering to the subject an effective amount of the composition according to any one of items 37 to 39. (Item 51) A method for reducing low density lipoprotein (LDL) levels in a subject, comprising administering to the subject an effective amount of the composition according to any one of items 37 to 39. (Item 52) The method according to any one of items 44 to 51, further comprising administering a statin. (Item 53) The method according to item 52, wherein the statin is selected from the group consisting of atorvastatin, fluvastatin, pravastatin, pitavastatin, rosuvastatin, and simvastatin. (Item 54) Use of an RNAi agent according to any one of items 1 to 36 or a composition according to any one of items 37 to 39 for the treatment of a disease, disorder, or condition that is at least partially mediated by ANGPTL3 gene expression. (Item 55) The use according to item 54, wherein the condition is an elevated triglyceride level and / or an elevated cholesterol level. (Item 56) Use of an RNAi agent according to any one of items 1 to 36 or a composition according to any one of items 37 to 39 for the preparation of a pharmaceutical composition for treating a disease, disorder, or condition that is at least partially mediated by ANGPTL3 gene expression. (Item 57) The use according to any one of items 54 to 56, wherein the disease is hypertriglyceridemia, obesity, hyperlipidemia, abnormal lipid and / or cholesterol metabolism, atherosclerosis, type II diabetes, cardiovascular disease, coronary artery disease, non-alcoholic steatohepatitis, non-alcoholic fatty liver disease, homozygous and heterozygous familial hypercholesterolemia, or statin-resistant hypercholesterolemia. (Item 58) The use according to any one of items 54 to 56, wherein the disease is a cardiometabolic disease. (Item 59) The use according to any one of items 54 to 58, wherein the RNAi agent is administered at a dose of about 0.05 mg / kg human subject body weight to about 5.0 mg / kg human subject body weight. (Item 60) The use according to any one of items 54 to 59, wherein the triglyceride level, cholesterol level, and / or low density lipoprotein (LDL) level in the subject is decreased.

Claims

[Claim 1] The invention as depicted in the drawings.

Images