Microbial compositions comprising ellagitannin and methods of use

JP2025093935A5Pending Publication Date: 2025-11-04MARVELBIOME INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025024892
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2019-10-02
Filing Date
2025-02-19
Publication Date
2025-11-04

AI Technical Summary

Technical Problem

Metabolites of ellagitannins, such as urolithin, have low bioavailability, limiting their health benefits in mammals.

Method used

Combining microorganisms expressing ellagitannin enzymes, such as tannin acyl hydrolase and gallic acid decarboxylase, with an ellagitannin composition to enhance the bioavailability of urolithin metabolites.

Benefits of technology

The combination significantly increases the production and bioavailability of urolithin metabolites, potentially improving mitochondrial function and antioxidant levels.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000054_0000
    Figure 00000054_0000
  • Figure 00000054_0001
    Figure 00000054_0001
  • Figure 00000054_0002
    Figure 00000054_0002
Patent Text Reader

Abstract

To provide compositions and methods of use for enhancing the bioavailability of metabolites of ellagitannins.SOLUTION: A combination of an ellagitannin composition and an enzymatic composition comprising one or more ellagitannin enzymes is provided, wherein the one or more ellagitannin enzymes comprise a tannin acyl hydrolase enzyme, a gallate decarboxylase enzyme, or a combination thereof. A method is also provided comprising administering to a subject the ellagitannin composition, the enzymatic composition comprising the one or more ellagitannin enzymes, or the combination, wherein the subject receives the combination.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Cross - Reference to Related Applications This application claims the benefit of U.S. Provisional Application No. 62 / 909,736, filed Oct. 2, 2019, and U.S. Provisional Application No. 62 / 755,880, filed Nov. 5, 2018, the entire contents of both of which are hereby incorporated by reference in their entirety.

Background Art

[0002] Plant polyphenol compounds are dietary sources of antioxidants associated with many health benefits such as antioxidant and anticancer effects.

Summary of the Invention

[0003] The present disclosure recognizes that metabolites of ellagitannins containing urolithin (e.g., urolithin A, urolithin B, urolithin C, urolithin D, and / or isourolithin A) can be beneficial to the health of mammals, e.g., humans. However, it is generally understood in the art that metabolites of ellagitannins have low bioavailability. The present disclosure provides the insight that certain microorganisms, e.g., microorganisms expressing one or more ellagitannin enzymes, can be provided in combination with an ellagitannin composition. In particular, the present disclosure provides that a combination of a microorganism expressing one or more ellagitannin enzymes and an ellagitannin composition can enhance the bioavailability of metabolites of ellagitannins containing urolithin (e.g., urolithin A, urolithin B, urolithin C, urolithin D and / or isourolithin A).

[0004] In some embodiments, the combination provided herein may include an ellagitannin composition and an enzyme composition. In some embodiments, the enzyme composition may include one or more ellagitannin enzymes.

[0005] In some embodiments, one or more ellagitannin enzymes may include a tannin acyl hydrolase enzyme, a gallic acid decarboxylase enzyme, or a combination thereof. In some embodiments, one or more ellagitannin enzymes may include a tannin acyl hydrolase enzyme. In some embodiments, the tannin acyl hydrolase enzyme is, or includes, a tanB tannase enzyme. In some embodiments, one or more ellagitannin enzymes may include a gallic acid decarboxylase enzyme. In some embodiments, the gallic acid decarboxylase enzyme is, or includes, an lpdB gallic acid decarboxylase enzyme. In some embodiments, the gallic acid decarboxylase enzyme is, or includes, an lpdC gallic acid decarboxylase enzyme. In some embodiments, one or more ellagitannin enzymes include an lpdB gallic acid decarboxylase enzyme and an lpdC gallic acid decarboxylase enzyme. In some embodiments, one or more ellagitannin enzymes include a tanB tannase enzyme, an lpdB gallic acid decarboxylase enzyme, and an lpdC gallic acid decarboxylase enzyme.

[0006] In some embodiments, the enzyme composition includes an ellagitannin enzyme synthesis (EES) microorganism or an extract thereof. In some embodiments, the EES microorganism is found in nature. In some embodiments, the EES microorganism is an engineered EES microorganism. In some embodiments, the engineered EES microorganism includes a genetic modification compared to an otherwise equivalent reference microorganism such that the engineered EES microorganism produces one or more ellagitannin enzymes at an absolute or relative level different from that of the reference microorganism.

[0007] In some embodiments, the EES microorganism is a member of the family Lactobacillaceae. In some embodiments, the member of the family Lactobacillaceae is the species L. plantarum.

[0008] In some embodiments, the EES microorganisms are viable or living. In some embodiments, the EES microorganisms are lyophilized.

[0009] In some embodiments, the combination comprises an amount of EES microorganisms sufficient to form colonies in the microbiota of a subject.

[0010] In some embodiments, the ellagitannin composition comprises a plant extract of pomegranate, strawberry, raspberry, cranberry, blackberry, cloudberry, artic blackberry, muscadine grape, guava, fruits of the Myrtaceae family, walnut, pecan, chestnut, cashew, almond, pistachio, hazelnut, brazil nut, macadamia red wine aged in oak barrels, muscadine grape juice, pomegranate juice, tea, cognac, Indian gooseberry, Ganoderma lucidum, or a combination thereof. In some embodiments, the combination comprises an amount of ellagitannin composition sufficient to induce the expression, activity, or both of one or more ellagitannin enzymes in the EES microorganisms.

[0011] In some embodiments, the ellagitannin composition and one or more ellagitannin enzymes are present in an amount effective to promote urolithin production in a subject.

[0012] In some embodiments, the combination comprises prebiotics. In some embodiments, the combination comprises fructooligosaccharides, inulin, isomaltooligosaccharides, lactitol, lactosucrose, lactulose, soybean oligosaccharides, transgalactooligosaccharides, xylooligosaccharides, or a combination thereof.

[0013] In some embodiments, the ellagitannin composition, the enzyme composition, or both can be formulated for oral administration. In some embodiments, the ellagitannin composition, the enzyme composition, or both can be a food, a beverage, a feed composition, or a dietary supplement. In some embodiments, the ellagitannin composition, the enzyme composition, or both can be a liquid, a syrup, a tablet, a troche, a gummy, a capsule, a powder, a gel, or a film.

[0014] In some embodiments, the combination is formulated for oral administration. In some embodiments, the combination is a food, a beverage, a feed composition, or a dietary supplement. In some embodiments, the combination is a liquid, a syrup, a tablet, a troche, a gummy, a capsule, a powder, a gel, or a film.

[0015] In some embodiments, the combination comprises a pharmaceutically acceptable carrier. In some embodiments, the combination is an enteric-coated formulation.

[0016] The present disclosure provides a method comprising administering to a subject a combination disclosed herein.

[0017] The present disclosure provides a method comprising administering to a subject an ellagitannin composition, an enzyme composition comprising one or more ellagitannin enzymes, or a combination disclosed herein, such that the subject receives the combination disclosed herein.

[0018] In some embodiments, the method is a method of reducing the formation of polypeptide aggregates in a cell or tissue. In some embodiments, the method is a method of reducing the amount of polypeptide aggregates in a cell or tissue. In some embodiments, the polypeptide aggregate is an aggregate of a polypeptide containing a polyQ region (i.e., a polyQ aggregate). In some embodiments, the polyQ region contains at least 10, at least 20, at least 30, at least 40, or at least 50 glutamines. In some embodiments, the cell is a neuron or contains neurons. In some embodiments, the cell is or contains central nervous system tissue.

[0019] In some embodiments, the method includes determining the level of polypeptide aggregate formation in a cell or tissue. In some embodiments, the method includes comparing the level of polypeptide aggregate formation in a cell or tissue to a reference level of polypeptide aggregate formation in the cell or tissue. In some embodiments, the reference level is determined in a cell or tissue of a subject not administered an ellagitannin composition, an enzyme composition containing one or more ellagitannin enzymes, or a combination disclosed herein. In some embodiments, the method includes determining the level of polypeptide aggregate formation in a cell or tissue prior to administration. In some embodiments, the method includes determining the level of polypeptide aggregate formation in a cell or tissue after administration. In some embodiments, the method includes comparing the level of polypeptide aggregate formation in a cell or tissue determined prior to administration to the level of polypeptide aggregate formation in a cell or tissue determined after administration.

[0020] In some embodiments, the method comprises determining the level of polypeptide aggregates in a cell or tissue. In some embodiments, the method comprises comparing the level of polypeptide aggregates in a cell or tissue to a reference level of polypeptide aggregates in the cell or tissue. In some embodiments, the reference level is determined in a cell or tissue of a subject not administered an ellagitannin composition, an enzyme composition comprising one or more ellagitannin enzymes, or a combination disclosed herein. In some embodiments, the method comprises determining the level of polypeptide aggregates in a cell or tissue prior to administration. In some embodiments, the method comprises determining the level of polypeptide aggregates in a cell or tissue after administration. In some embodiments, the method comprises comparing the level of polypeptide aggregates in a cell or tissue determined prior to administration to the level of polypeptide aggregates in a cell or tissue determined after administration.

[0021] In some embodiments, the method is a method of altering the level of one or more urolithins produced in the gastrointestinal tract of a subject.

[0022] In some embodiments, the method comprises determining the level of one or more urolithins produced in the gastrointestinal tract of a subject. In some embodiments, the method comprises comparing the respective levels of one or more urolithins produced in the gastrointestinal tract of a subject to corresponding reference levels.

[0023] In some embodiments, the method comprises determining the level of one or more urolithins produced in the plasma of a subject. In some embodiments, the method comprises comparing the level of one or more urolithins in the plasma of the subject to a reference level. In some embodiments, the reference level is the concentration of urolithin in plasma, e.g., 0.2 - 20 μM (incorporated herein by reference, (Espin JC, Larrosa M, Garcia-Conesa MT, Tomas-Barberan F. Biological significance of urolithins, the gut microbial ellagic Acid-derived metabolites: the evidence so far. Evid Based Complement Alternat Med. 2013;2013:270418. doi:10.1155 / 2013 / 270418)). In some embodiments, the reference level is a concentration of urolithin in plasma of at least 0.1 μM, at least 0.2 μM, at least 0.5 μM, at least 1 μM, at least 5 μM, at least 10 μM, or at least 15 μM. In some embodiments, the reference level is a concentration of urolithin in plasma of at least 0.5 μM, up to 1 μM, up to 5 μM, up to 10 μM, up to 15 μM, up to 20 μM, or up to 25 μM.

[0024] In some embodiments, the reference level is a past reference level of urolithin, the level of urolithin in the digestive tract of the subject prior to receiving the combination, whether in the digestive tract or in the plasma, or the level of urolithin in the digestive tract of an equivalent subject not receiving the combination.

[0025] In some embodiments, the method is a method of increasing the amount of urolithin produced in the digestive tract of a subject. In some embodiments, the urolithin is urolithin A (3,8-dihydroxyurolithin), urolithin C (3,8,9-trihydroxyurolithin), isourolithin A (3,9-dihydroxyurolithin), urolithin B (3-hydroxyurolithin), urolithin D (3,4,8,9-tetrahydroxyurolithin) or a combination thereof.

[0026] In some embodiments, the method includes determining an indicator of mitochondrial function in a subject. In some embodiments, the method includes determining the level of mitophagy in a subject.

[0027] In some embodiments, the method is a method of altering the expression level or activity level of Nrf2 in a cell or tissue of a subject. In some embodiments, the method is a method of increasing the expression level or activity level of Nrf2 in a cell or tissue of a subject.

[0028] In some embodiments, the method includes determining the expression level or activity level of nuclear respiratory factor-2 (Nrf2) in a cell or tissue of a subject. In some embodiments, the method includes comparing the expression level or activity level of Nrf2 in a cell or tissue to a reference level. In some embodiments, the reference level is the past expression or activity level of Nrf2, the expression level or activity level of nuclear respiratory factor-2 (Nrf2) in equivalent cells or tissues of the subject prior to receiving the combination, or the expression level or activity level of nuclear respiratory factor-2 (Nrf2) in equivalent cells or tissues of an equivalent subject that has not received the combination. In some embodiments, the method includes determining the expression level or activity level of a gene regulated by Nrf2 expression in a cell or tissue of a subject.

[0029] In some embodiments, the method includes determining the level of one or more antioxidants in a target cell or tissue. In some embodiments, the target cell or tissue includes hepatocytes or liver tissue. In some embodiments, the method includes measuring an indicator of liver health or function in a subject.

[0030] In some embodiments, the method is a method of increasing the bioavailability of an ellagitannin composition to a subject. In some embodiments, the method includes determining the level of ellagitannin bioavailability of the ellagitannin composition in the digestive tract of the subject. In some embodiments, the method includes comparing the level of ellagitannin bioavailability of the ellagitannin composition in the digestive tract of the subject to a reference level. In some embodiments, the reference level is a past reference level of ellagitannin bioavailability, the level of ellagitannin bioavailability in the digestive tract of the subject before receiving the combination, or the level of ellagitannin bioavailability in the digestive tract of an equivalent subject not receiving the combination.

[0031] In some embodiments, the method is a method of treating a condition or disorder associated with mitochondrial dysfunction in a subject.

[0032] In some embodiments, the method is a method of treating a condition, disease, or disorder of the liver of a subject.

[0033] In some embodiments, the method is a method of extending the shelf life of a probiotic product comprising an EES microorganism, the method including adding an ellagitannin composition to the probiotic product when the EES microorganism expresses one or more ellagitannin enzymes.

[0034] In some embodiments, one or more ellagitannin enzymes can include a tannin acyl hydrolase enzyme, a gallic acid decarboxylase enzyme, or a combination thereof. In some embodiments, one or more ellagitannin enzymes can include a tannin acyl hydrolase enzyme. In some embodiments, the tannin acyl hydrolase enzyme is, or includes, a tanB tannase enzyme. In some embodiments, one or more ellagitannin enzymes can include a gallic acid decarboxylase enzyme. In some embodiments, the gallic acid decarboxylase enzyme is, or includes, an lpdB gallic acid decarboxylase enzyme. In some embodiments, the gallic acid decarboxylase enzyme is, or includes, an lpdC gallic acid decarboxylase enzyme. In some embodiments, one or more ellagitannin enzymes include an lpdB gallic acid decarboxylase enzyme and an lpdC gallic acid decarboxylase enzyme. In some embodiments, one or more ellagitannin enzymes include a tanB tannase enzyme, an lpdB gallic acid decarboxylase enzyme, and an lpdC gallic acid decarboxylase enzyme.

[0035] In some embodiments, the enzyme composition includes an ellagitannin enzyme synthesis (EES) microorganism or an extract thereof. In some embodiments, the EES microorganism is found in nature. In some embodiments, the EES microorganism is an engineered EES microorganism. In some embodiments, the engineered EES microorganism includes a genetic modification relative to an otherwise equivalent reference microorganism such that the engineered EES microorganism produces one or more ellagitannin enzymes at an absolute or relative level that is different from the level of the reference microorganism.

[0036] In some embodiments, the EES microorganism is a member of the family Lactobacillaceae. In some embodiments, the member of the family Lactobacillaceae is the species L. plantarum.

[0037] In some embodiments, the EES microorganisms are viable or living. In some embodiments, the EES microorganisms are lyophilized.

[0038] In some embodiments, the engineered EES microorganisms contain genetic modifications relative to otherwise equivalent reference microorganisms, such that they produce one or more ellagitannin enzymes at an absolute or relative level that is different from that of the reference microorganisms.

[0039] In some embodiments, the ellagitannin composition comprises plant extracts of pomegranate, strawberry, raspberry, cranberry, blackberry, cloudberry, Arctic blackberry, muscadine grape, guava, fruits of the Myrtaceae family, walnut, pecan, chestnut, cashew, almond, pistachio, hazelnut, Brazil nut, macadamia aged in oak barrels, red wine, muscadine grape juice, pomegranate juice, tea, cognac, Indian gooseberry, Ganoderma lucidum, or combinations thereof. In some embodiments, the ellagitannin composition comprises supplements containing one or more ellagitannins or ellagic acid. In some embodiments, the combination comprises an ellagitannin composition in an amount sufficient to induce the expression, activity, or both of one or more ellagitannin enzymes in the EES microorganisms.

[0040] In some embodiments, the ellagitannin composition and one or more ellagitannin enzymes are present in an amount effective to promote urolithin production in a subject.

[0041] In some embodiments, the method comprises adding prebiotics. In some embodiments, the prebiotics comprise fructooligosaccharides, inulin, isomaltooligosaccharides, lactitol, lactosucrose, lactulose, soybean oligosaccharides, transgalactooligosaccharides, xylooligosaccharides, or combinations thereof.

[0042] In some embodiments, the probiotic composition can be formulated for oral administration. In some embodiments, the probiotic composition can be a food, beverage, feed composition, or dietary supplement. In some embodiments, the ellagitannin composition, enzyme composition, or both can be a liquid, syrup, tablet, troche, gummy, capsule, powder, gel, or film. In some embodiments, the probiotic composition is an enteric-coated formulation.

[0043] The present disclosure provides a probiotic product comprising an EES microorganism that expresses one or more ellagitannin enzymes. In some embodiments, the one or more ellagitannin enzymes can include tannin acyl hydrolase enzymes. In some embodiments, the tannin acyl hydrolase enzyme is, or includes, a tanB tannase enzyme. In some embodiments, the one or more ellagitannin enzymes can include gallic acid decarboxylase enzymes. In some embodiments, the gallic acid decarboxylase enzyme is, or includes, an lpdB gallic acid decarboxylase enzyme. In some embodiments, the gallic acid decarboxylase enzyme is, or includes, an lpdC gallic acid decarboxylase enzyme. In some embodiments, the one or more ellagitannin enzymes include an lpdB gallic acid decarboxylase enzyme and an lpdC gallic acid decarboxylase enzyme. In some embodiments, the one or more ellagitannin enzymes include a tanB tannase enzyme, an lpdB gallic acid decarboxylase enzyme, and an lpdC gallic acid decarboxylase enzyme.

[0044] In some embodiments, the EES microorganism is found in nature. In some embodiments, the EES microorganism is an engineered EES microorganism. In some embodiments, the engineered EES microorganism comprises a genetic modification relative to an otherwise equivalent reference microorganism such that the engineered EES microorganism produces one or more ellagitannin enzymes at an absolute or relative level different from that of the reference microorganism.

[0045] In some embodiments, the EES microorganism is a member of the family Lactobacillaceae. In some embodiments, the member of the family Lactobacillaceae is the species L. plantarum.

[0046] In some embodiments, the EES microorganism is viable or living. In some embodiments, the EES microorganism is lyophilized.

[0047] In some embodiments, the engineered EES microorganism comprises a genetic modification relative to an otherwise equivalent reference microorganism such that the engineered EES microorganism produces one or more ellagitannin enzymes at an absolute or relative level different from that of the reference microorganism.

[0048] In some embodiments, the probiotics comprise prebiotics. In some embodiments, the prebiotics comprise fructooligosaccharides, inulin, isomaltooligosaccharides, lactitol, lactosucrose, lactulose, soy oligosaccharides, transgalactooligosaccharides, xylooligosaccharides, or combinations thereof.

[0049] In some embodiments, the probiotic product is formulated for oral administration. In some embodiments, the probiotic product is a food, beverage, feed composition, or dietary supplement. In some embodiments, the probiotic product is a liquid, syrup, tablet, troche, gummy, capsule, powder, gel, or film.

[0050] In some embodiments, the probiotic product is an enteric-coated formulation.

[0051] The present disclosure provides a method for manufacturing a probiotic product comprising an EES microorganism, which comprises adding an ellagitannin composition to the probiotic product when the EES microorganism expresses one or more ellagitannin enzymes.

[0052] In some embodiments, the method comprises adding prebiotics. In some embodiments, the prebiotics comprise fructooligosaccharides, inulin, isomaltooligosaccharides, lactitol, lactosucrose, lactulose, soy oligosaccharides, transgalactooligosaccharides, xylooligosaccharides, or combinations thereof.

[0053] The present disclosure provides the use of the combinations disclosed herein for regulating the level of urolithin produced in the digestive tract of a subject.

[0054] The present disclosure provides the use of the combinations disclosed herein for regulating mitochondrial function in a subject.

[0055] The present disclosure provides the use of the combinations disclosed herein for regulating the level of mitophagy in a subject.

[0056] The present disclosure provides the use of the combinations disclosed herein for regulating the expression level or activity level of Nrf2 in a cell or tissue of a subject.

[0057] The present disclosure provides the use of the combinations disclosed herein for regulating the expression level or activity level of a gene regulated by Nrf2 expression in a cell or tissue of a subject.

[0058] The present disclosure provides the use of the combinations disclosed herein for modulating the level of one or more antioxidants in a target cell or tissue. In some embodiments, the target cell or tissue comprises hepatocytes or liver tissue. The present disclosure provides the use of the combinations disclosed herein for improving liver health or function in a subject.

[0059] The present disclosure provides the use of the combinations disclosed herein for increasing the bioavailability level of ellagitannins in the digestive tract of a subject.

[0060] These and other aspects of the present disclosure are described in more detail below and in the claims.

[0061] Definitions The scope of the present invention is defined by the claims appended hereto and is not limited by the specific embodiments described herein. Those skilled in the art upon reading this specification will recognize various modifications that may be equivalent to the described embodiments or that may fall within the scope of the claims. In general, the terms used herein will follow the meanings understood in the art, unless otherwise clearly indicated. Specific definitions of certain terms are provided below, and the meaning of these and other terms in specific instances throughout this specification will be apparent to those skilled in the art from the context.

[0062] The use of ordinal terms such as "first," "second," "third," etc. in a claim to modify a claim element does not by itself mean any priority, precedence, or order with respect to the temporal order in which one claim element is executed with respect to another claim element or the operations of a method, but is used only as a label to distinguish one claim element having a particular name from another element having the same name (except that ordinal terms are used).

[0063] As used herein, the articles "a" and "an" should be understood to include plural referents unless expressly stated to the contrary. A claim or specification that includes "or" between one or more members of a group is, unless specified to the contrary or otherwise apparent from the context, satisfied when one, two or more, or all of the group members are present in, used in, or otherwise related to a particular product or process. In some embodiments, exactly one member of the group is present in, used in, or otherwise related to a given product or process. In some embodiments, two or more, or all of the group members are present in, used in, or otherwise related to a given product or process. It should be understood that the present invention encompasses all variations, combinations, and permutations in which one or more limitations, elements, clauses, descriptive terms, etc. from one or more of the recited claims are introduced into another claim that depends from the same basic claim (or, if relevant, any other claim) unless there is no indication of a step or it is apparent to one of ordinary skill in the art that there would be a contradiction or inconsistency. When elements are presented as a list (e.g., in a Markush group or similar format), it should be understood that each sub-group of the elements is also disclosed and that any element(s) can be removed from the group. Generally, when an embodiment or aspect is referred to as "comprising" a particular element, feature, etc., it should be understood that the particular embodiment or aspect may "consist of" or "consist essentially of" such particular element, feature, etc. For the sake of brevity, these embodiments are not specifically described in as many words in every case herein. It should also be understood that any embodiment or aspect can be expressly excluded from the claims regardless of whether a particular exclusion is recited in the specification.

[0064] Administration: As used herein, the term "administration" typically refers to the administration of a composition to a subject or system to achieve delivery of an agent to the subject or system. In some embodiments, the agent is a composition or is included in a composition, and in some embodiments, the agent is produced through metabolism of the composition or one or more of its components. One of ordinary skill in the art will know the various routes that can be utilized for administration to a subject, e.g., a human, in appropriate circumstances. For example, in some embodiments, administration can be ocular, oral, parenteral, topical, etc. In some particular embodiments, administration is bronchial (e.g., by bronchial instillation), buccal, percutaneous (e.g., one or more of, or including, topical to the dermis, intradermal, interdermal, transdermal, etc.), enteral, intraarterial, intradermal, intragastric, intramedullary, intramuscular, intranasal, intraperitoneal, intrathecal, intravenous, intraventricular, within a particular organ (e.g., within the liver), mucosal, nasal, oral, rectal, subcutaneous, sublingual, topical, tracheal (e.g., by tracheal instillation), vaginal, vitreous, etc. In many embodiments provided by the present disclosure, administration is oral administration. In some embodiments, administration can include only a single administration. In some embodiments, administration can include the application of a defined number of doses. In some embodiments, administration can include intermittent (e.g., multiple doses separated in time) and / or periodic (e.g., individual doses separated by a common period) administration. In some embodiments, administration can include continuous dosing (e.g., perfusion) for at least a selected period of time. Administration of cells can be by any suitable route that results in delivery of the delivered cells or at least a portion of the cell components to the desired location in the subject where at least some of them continue to survive. The survival period of the cells after administration to the subject can be short, on the order of hours, e.g., 24 hours, to long, on the order of days, years, i.e., long-term engraftment. In some embodiments, administration includes delivery of a bacterial extract or preparation that includes one or more bacterial metabolites and / or by-products but lacks fully viable bacterial cells.

[0065] Analog: As used herein, the term "analog" refers to a substance that shares one or more specific structural features, elements, components, or parts with a reference substance. Typically, an "analog" exhibits a significant structural similarity to the reference substance, such as sharing a core or consensus structure, but may differ in specific individual ways. In some embodiments, an analog is a substance that can be generated from a reference substance, for example, by chemical manipulation of the reference substance. In some embodiments, an analog is a substance that can be generated through the execution of a synthetic process that is substantially similar to (e.g., shares multiple steps with) the one that generates the reference substance. In some embodiments, an analog is generated or can be generated through the execution of a synthetic process that is different from the one used to generate the reference substance.

[0066] Approximately: When applied to one or more values of interest, includes values similar to the recited reference values. In certain embodiments, the term "approximately" or "about" refers to a range of values within ±10% (greater or less) of the recited reference value, unless otherwise specified or clear from the context (except when such a number exceeds 100% of the possible values).

[0067] Bioavailability of ellagitannins: As used herein, the term "bioavailability of ellagitannins" means the amount of ellagitannin or its hydrolysis products absorbed into the systemic circulation from an ellagitannin composition. The amount of ellagitannin can be determined by measuring the amount of ellagitannin hydrolysis products present in a sample of blood, plasma, or urine. Additionally, the bioavailable ellagitannin can be metabolized, for example, to urolithin in a subject. Thus, the bioavailability of ellagitannin can be indirectly determined by assessing the amount of urolithin excreted by the systemic circulation (e.g., blood, plasma, etc.) or the kidneys (e.g., urine). Accordingly, a change (e.g., an increase) in the bioavailability of a given ellagitannin composition can be determined by assessing the level of urolithin in the presence of the ellagitannin composition or combination described herein. In some embodiments, the level of urolithin can be compared, for example, to the level of the subject prior to initiation of treatment with the composition.

[0068] Equivalent: As used herein, the term "equivalent" refers to two or more agents, entities, situations, sets of conditions, subjects, etc. that may not be identical to each other, but are similar enough to enable a comparison between them such that a person of ordinary skill in the art can reasonably draw conclusions based on the observed differences or similarities. In some embodiments, comparable sets of conditions, situations, individuals, or groups are characterized by a plurality of substantially identical features and one or a few different features. A person of ordinary skill in the art will understand, in context, what degree of identity is required in any given situation for two or more such agents, entities, situations, sets of conditions, etc. to be considered equivalent. For example, a person of ordinary skill in the art will understand that a series of situations, individuals, or groups are comparable to each other if the differences in the results obtained or the phenomena observed under or with different situations, individuals, or groups of individuals are characterized by a sufficient number and type of substantially identical features to warrant a reasonable conclusion that they are caused by or indicative of variations in those features.

[0069] Conservative: When used herein, refers to an example of describing a conservative amino acid substitution that involves substitution of an amino acid residue with another amino acid residue having a side chain R group with similar chemical properties (e.g., charge or hydrophobicity). Generally, a conservative amino acid substitution will not substantially alter a functional property of interest for a protein, e.g., the ability of a receptor to bind a ligand. Examples of groups of amino acids having side chains with similar chemical properties include aliphatic side chains such as glycine (Gly, G), alanine (Ala, A), valine (Val, V), leucine (Leu, L), and isoleucine (Ile, I); aliphatic hydroxyl side chains such as serine (Ser, S) and threonine (Thr, T); amide-containing side chains such as asparagine (Asn, N) and glutamine (Gln, Q); aromatic side chains such as phenylalanine (Phe, F), tyrosine (Tyr, Y), and tryptophan (Trp, W); basic side chains such as lysine (Lys, K), arginine (Arg, R), and histidine (His, H); acidic side chains such as aspartic acid (Asp, D) and glutamic acid (Glu, E); and sulfur-containing side chains such as cysteine (Cys, C) and methionine (Met, M). Conservative amino acid substituents include, for example, valine / leucine / isoleucine (Val / Leu / Ile, V / L / I), phenylalanine / tyrosine (Phe / Tyr, F / Y), lysine / arginine (Lys / Arg, K / R), alanine / valine (Ala / Val, A / V), glutamic acid / aspartic acid (Glu / Asp, E / D), and asparagine / glutamine (Asn / Gln, N / Q). In some embodiments, a conservative amino acid substitution can be a substitution of any native residue in a protein with alanine, as used, for example, in alanine scanning mutagenesis. In some embodiments, conservative substitutions are made that have a positive value in the PAM250 log-likelihood matrix disclosed in Gonnet, G.H. et al., 1992, Science 256:1443-1445, which is incorporated herein by reference in its entirety. In some embodiments, the substitution is a moderately conservative substitution, and the substitution has a non-negative value in the PAM250 log-likelihood matrix.

[0070] [Table 1] [Table 2]

[0071] Control: As used herein, refers to the meaning of "control", which is a standard to which results are compared and is understood in the art. Typically, a control is used to enhance the consistency of an experiment by separating variables in order to draw conclusions about such variables. In some embodiments, the control is a reaction or assay that is performed simultaneously with the test reaction or assay to provide a comparison. "Control" also includes "control animal". A "control animal" may have the modifications as described herein, may have modifications different from those described herein, or may have no modification (i.e., a wild-type animal). In one experiment, a "test" (i.e., the variable being tested) is applied. In a second experiment, the variable being tested is not applied to the "control". In some embodiments, the control is a past control (i.e., a previously performed test or assay, or a previously known amount or result). In some embodiments, the control is or includes a printed or otherwise stored record. The control can be a positive control or a negative control.

[0072] Determination, measurement, evaluation (evaluating), assessment (assessing), assay, analysis and analyze: Determination, measurement, evaluation (evaluating), assessment (assessing), assay and analysis are used interchangeably herein to refer to any form of measurement and include the determination of whether an element is present. These terms include both quantitative and / or qualitative determinations. An assay can be relative or absolute. "Assaying for the presence of" can be determining the amount of something present and / or determining whether it is present or absent.

[0073] Dosage form: One of ordinary skill in the art will understand that the term "dosage form" can be used to refer to physically distinct units of a medicament (e.g., a therapeutic agent) for administration to a subject. Typically, each such unit contains a predetermined amount of the medicament. In some embodiments, such an amount is the unit dosage amount (or a whole fraction thereof) appropriate for administration according to a dosage regimen determined to correlate with a desired or beneficial result when administered to the relevant population (i.e., a therapeutic dosage regimen). One of ordinary skill in the art understands that the total amount of a therapeutic composition or medicament administered to a particular subject is determined by one or more attending physicians and can include administration of multiple dosage forms.

[0074] Dosage regimen: One of ordinary skill in the art will understand that the term "dosage regimen" can be used to refer to a series of unit doses (usually multiple), administered individually to a subject and usually separated by a period of time. In some embodiments, a given medicament has a recommended dosage regimen, which can include one or more doses. In some embodiments, the dosage regimen includes multiple doses, each separated from the other doses by a period of time. In some embodiments, the individual doses are separated from each other by periods of the same length, and in some embodiments, the dosage regimen includes multiple doses and at least two different periods separating the individual doses. In some embodiments, all of the doses within a dosage regimen are the same unit dosage amount. In some embodiments, the different doses within a dosage regimen are different amounts. In some embodiments, the dosage regimen includes a first dose at a first dosage amount and one or more additional doses at a second dosage amount different from the first dosage amount. In some embodiments, the dosage regimen correlates with a desired or beneficial result when administered across the relevant population.

[0075] Ellagitannin enrichment: As used herein, the term "ellagitannin enrichment" refers to a material obtained by processing one or more plant materials, wherein the proportion of one or more ellagitannins is increased relative to the proportion of one or more ellagitannins in the plant material(s) before processing. The enrichment can be, for example, at least 2-fold, at least 5-fold, at least 10-fold, at least 20-fold, or more.

[0076] Ellagitannin composition: As used herein, "ellagitannin composition" refers to a composition comprising one or more ellagitannin compounds. In some embodiments, the ellagitannin composition refers to an ellagitannin-enriched substance. In some embodiments, the ellagitannin composition comprises a pome extract. In some embodiments, the ellagitannin composition is produced by the treatment of one or more plant materials containing one or more ellagitannin compounds produced by one or more plants. In some embodiments, the ellagitannin composition comprises the fruit juice of a fruit that produces an ellagitannin compound, a homogenate of the fruit or other material (e.g., skin, peel, shell, etc.) of a plant that produces an ellagitannin compound, an extract of a material from a plant that produces an ellagitannin compound, or an ellagitannin-enriched fraction of the fruit juice, a homogenate or extract of a plant that produces an ellagitannin compound. In some embodiments, the ellagitannin composition comprises a supplement containing one or more ellagitannins or ellagic acid.

[0077] Ellagitannin compound: As used herein, "ellagitannin compound" refers to compounds that are members of various classes of polyphenols, and structural analogs thereof. In nature, ellagitannin is hydrolyzed to ellagic acid, which is metabolized to produce various types of urolithins. Ellagitannin includes various classes of complex hydrolyzable plant tannin polyphenols composed of a hexahydroxybenzoyl moiety esterified to a sugar, i.e., hexahydroxybenzoyl-glucose ester, which are found in, for example, fruits of the Myrtaceae family including but not limited to strawberry (Fragaria vesca), raspberry, blackberry, cloudberry (Rubus chamaemorus), jaboticaba, cambuci, Surinam cherry, camu camu, red guava, white guava, pomegranate, walnut, pecan, beefsteak fungus (Fistulina hepatica), cranberry. Other ellagitannins include, for example, pedunculagin, rosacin, filanembruinin, and sanguiin H6.

[0078] Ellagitannin enzyme: As used herein, "ellagitannin enzyme" refers to an enzyme involved in the metabolism of ellagitannin to urolithin. Ellagitannin enzymes include, but are not limited to, tannin acyl hydrolase enzymes (e.g., tanB tannase enzyme), and gallic acid decarboxylase enzymes (e.g., lpdB gallic acid decarboxylase enzyme, lpdC gallic acid decarboxylase enzyme).

[0079] Ellagitannin enzyme-synthesizing microorganism: As used herein, the phrase "ellagitannin enzyme-synthesizing microorganism" or "EES microorganism" refers to a microorganism (e.g., an alga, a fungus, a bacterium) that expresses one or more ellagitannin enzymes. In some embodiments, the EES microorganism may naturally express one or more ellagitannin enzymes. In some embodiments, the EES microorganism includes ellagitannin enzyme modification. In some embodiments, the EES microorganism may be genetically modified (e.g., have one or more genetic modifications), whereby one or more ellagitannin enzymes are expressed at an absolute or relative level different from that of other equivalent reference microorganisms that are not so genetically modified (i.e., do not include the genetic modification(s)). For example, in some embodiments, the EES microorganism has been genetically engineered to express one or more ellagitannin enzymes that are not expressed by the microorganism when not genetically engineered. Alternatively, in some embodiments, the EES microorganism may have been genetically engineered such that the expression of one or more ellagitannin enzymes can be at a higher level compared to a microorganism without genetic engineering. In some embodiments, the higher level may be evaluated with reference to a threshold level, and in some embodiments, the higher level can be evaluated with reference to another compound (e.g., another ellagitannin enzyme) also produced by the microorganism (prior to genetic engineering). In some particular embodiments, the EES microorganism may have been genetically modified to add or increase the expression of one or more genes encoding one or more ellagitannin enzymes.

[0080] Ellagitannin enzyme modification: As used herein, the term "ellagitannin enzyme modification" refers to the modification of a microorganism that modulates the production of one or more ellagitannin enzymes, as described herein. For example, ellagitannin enzyme modification can increase the production level of one or more ellagitannin enzymes and / or change the relative production levels of different ellagitannin enzymes. In principle, ellagitannin enzyme modification can be any chemical, physiological, genetic, or other modification that appropriately changes the production of one or more ellagitannin enzymes produced by a microorganism compared to the level produced by the same microorganism that has not undergone the same modification but is otherwise identical. However, in most embodiments, ellagitannin enzyme modification involves genetic modification and typically results in an increase in the production of one or more selected ellagitannin enzymes. In some embodiments, the ellagitannin enzyme comprises a tannin acyl hydrolase enzyme (e.g., the tanB tannase enzyme), a gallic acid decarboxylase enzyme (e.g., the lpdB gallic acid decarboxylase enzyme, the lpdC gallic acid decarboxylase enzyme), or a combination thereof.

[0081] Engineering: Generally, the term "engineered" refers to the manner of being manipulated by human hands. For example, a cell or organism is considered "engineered" when its genetic information is changed (e.g., by transformation, mating, somatic hybridization, transfection, transduction, or other mechanisms, or when previously existing genetic material is modified or removed, such as by substitution or deletion mutations, or when new genetic material that did not previously exist is introduced by mating protocols, or when previously existing genetic material is changed or removed, etc.). As is understood by those of ordinary skill in the art in a common manner, the progeny of an engineered polynucleotide or cell are typically still referred to as "engineered" even though the actual manipulation was performed on a previous entity.

[0082] Excipient: As used herein, refers to an inert (e.g., non-therapeutic) agent that can be included in a pharmaceutical composition to provide or contribute to, for example, a desired viscosity or stabilizing effect. In some embodiments, suitable pharmaceutical excipients can include, for example, starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene glycol, water, ethanol, and the like.

[0083] Functional: As used herein, a "functional" biomolecule is a biomolecule in a form that exhibits the properties and / or activities by which it is characterized. A biomolecule can have two functions (i.e., bifunctional) or many functions (i.e., multifunctional).

[0084] Gene: As used herein, refers to a DNA sequence in a chromosome that encodes a product (e.g., an RNA product and / or a polypeptide product). In some embodiments, a gene includes a coding sequence (i.e., a sequence that encodes a particular product). In some embodiments, a gene includes non-coding sequences. In some particular embodiments, a gene can include both coding (e.g., exon) and non-coding (e.g., intron) sequences. In some embodiments, a gene can include one or more regulatory sequences (e.g., a promoter, an enhancer, etc.) and / or intron sequences that can control or affect, for example, one or more aspects of gene expression (e.g., cell-type specific expression, inducible expression, etc.). For clarity, as used in this disclosure, the term "gene" generally refers to a portion of a nucleic acid that encodes a polypeptide or a fragment thereof, and it should be noted that this term can optionally include regulatory sequences as will be apparent to those skilled in the art from the context. This definition is not intended to exclude the application of the term "gene" to non-protein-coding expression units, but rather is intended to clarify that in many cases, the term used in this document refers to a nucleic acid encoding a polypeptide.

[0085] Improve, increase, enhance, inhibit, or reduce: As used herein, the terms “improve,” “increase,” “enhance,” “inhibit,” “reduce,” or their grammatical equivalents, indicate a value relative to a baseline or other reference measurement. In some embodiments, the value is statistically significantly different from the baseline or other reference measurement value. In some embodiments, an appropriate reference measurement is a measurement in or including a particular system (e.g., a single individual) under equivalent conditions except for the absence (e.g., before and / or after) of a particular agent or treatment, or in the presence of an appropriate equivalent reference agent. In some embodiments, an appropriate reference measurement can be or include a measurement in an equivalent system known or expected to respond in a particular manner in the presence of the relevant agent or treatment. In some embodiments, an appropriate reference is a negative reference, and in some embodiments, an appropriate reference is a positive reference.

[0086] Isolated: As used herein, refers to a substance and / or entity that has been separated (whether in a natural and / or experimental setting) from at least some of the components it was associated with when first produced and / or that has been designed, generated, prepared, and / or manufactured by human hand. In some embodiments, an isolated substance or entity can be enriched, and in some embodiments, an isolated substance or entity can be pure. In some embodiments, an isolated substance and / or entity is separated from about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% of the other components it was originally associated with. In some embodiments, an isolated agent is of a purity of about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99%. As used herein, a substance is "pure" if it is substantially free of other components. In some embodiments, as would be understood by one of ordinary skill in the art, a substance can still be considered "enriched," "isolated," or even "pure" after being combined with certain other components, such as one or more carriers or excipients (e.g., buffers, solvents, water, etc.), and in such embodiments, the percent isolation or purity of the substance is calculated without including such carriers or excipients. One of ordinary skill in the art knows various techniques for isolating (e.g., enriching or purifying) a substance or agent (e.g., using one or more of fractionation, extraction, precipitation, or other separation).

[0087] Pharmaceutical Composition: As used herein, the term "pharmaceutical composition" refers to a composition in which an active agent is formulated together with one or more pharmaceutically acceptable carriers. In some embodiments, the active agent is present in a unit dosage amount appropriate for administration in a treatment regimen that exhibits a statistically significant probability of achieving a predetermined therapeutic effect when administered to the relevant population. In some embodiments, the pharmaceutical composition is adapted for oral administration, such as a syrup (aqueous solution or non-aqueous solution or suspension), tablets, such as those targeted for buccal, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue, capsules, powders, etc., and can be specially formulated for administration in solid or liquid form. In some embodiments, the active agent can be or include a cell or a population of cells (e.g., a culture, such as an EES microorganism), and in some embodiments, the active agent can be or include an extract or component of a cell or a population of cells (e.g., a culture). In some embodiments, the active agent can be or include an isolated, purified, or pure compound. In some embodiments, the active agent can be synthesized in vitro (e.g., via chemical and / or enzymatic synthesis). In some embodiments, the active agent is or can include a natural product (isolated from a natural source or synthesized in vitro).

[0088] Pharmaceutically Acceptable: As used herein, the term "pharmaceutically acceptable," for example, as used with respect to a carrier, diluent, or excipient used to formulate a pharmaceutical composition disclosed herein, means a carrier, diluent, or excipient that is compatible with the other components of the composition and not harmful to its recipient.

[0089] Pharmaceutically acceptable carrier: As used herein, the term "pharmaceutically acceptable carrier" means a pharmaceutically acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material, involved in the delivery or transport of the subject compound from one organ or part of the body to another. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject. Some examples of materials that can serve as pharmaceutically acceptable carriers include the following: sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethyl cellulose, ethyl cellulose, and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols such as propylene glycol; polyols such as glycerin, sorbitol, mannitol, and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffering agents such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; pH buffering solutions; polyesters, polycarbonates, and / or polyanhydrides; and other non-toxic compatible substances used in pharmaceutical formulations.

[0090] Prebiotics: As used herein, "prebiotics" refers to a constituent that enables or promotes a specific change in both the composition and / or activity of the gastrointestinal microbiota that confers (or does not confer) a benefit to the host. In some embodiments, the prebiotics can include one or more of the following: The prebiotics include pear fruit extract, berry extract, and walnut extract.

[0091] Prevention: As used herein, the term "prevention" refers to the delay in the onset of one or more symptoms of a particular disease, disorder, or condition, and / or a decrease in the frequency and / or severity thereof. In some embodiments, prevention is evaluated on a population basis such that a drug is considered to "prevent" a particular disease, disorder, or condition if a statistically significant decrease in the onset, frequency, and / or intensity of one or more of the disease, disorder, or symptoms is observed in a population predisposed to the disease, disorder, or condition. In some embodiments, prevention may be considered complete, for example, if the onset of a disease, disorder, or condition is delayed for a predetermined period.

[0092] Reference: As used herein, describes the criteria or control against which a comparison is made. For example, in some embodiments, a subject agent, animal, individual, population, sample, sequence, or value is compared to a reference or control agent, animal, individual, population, sample, sequence, or value. In some embodiments, the reference or control is substantially tested and / or determined concurrently with the subject test or determination. In some embodiments, the reference or control is a past reference or control and is optionally embodied in a tangible medium. Usually, as understood by one of ordinary skill in the art, the reference or control is determined or characterized under conditions or circumstances equivalent to those being evaluated. One of ordinary skill in the art will understand when there is sufficient similarity to justify reliance on and / or comparison to a particular possible reference or control. In some embodiments, the reference is a negative control reference, and in some embodiments, the reference is a positive control reference.

[0093] Risk: As understood in context, the "risk" of a disease, disorder, and / or condition refers to the likelihood that a particular individual will develop the disease, disorder, and / or condition. In some embodiments, the risk is expressed as a percentage. In some embodiments, the risk is from 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90 to 100%. In some embodiments, the risk is expressed as a risk compared to a risk associated with a reference sample or group of reference samples. In some embodiments, the reference sample or group of reference samples has a known risk of a disease, disorder, condition, and / or event. In some embodiments, the reference sample or group of reference samples is from an individual comparable to a particular individual. In some embodiments, the relative risk is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more.

[0094] Sample: As used herein, the term "sample" generally refers to an aliquot of material obtained or derived from a source of interest. In some embodiments, the source of interest is a biological or environmental source. In some embodiments, the source of interest can be or include cells or organisms such as microorganisms, plants, or animals (e.g., humans). In some embodiments, the source of interest is or includes a biological tissue or fluid. In some embodiments, the biological tissue or body fluid can be or include amniotic fluid, aqueous humor, ascites, bile, bone marrow, blood, breast milk, cerebrospinal fluid, cerumen, chyle, semen, endolymph, exudate, feces, gastric acid, gastric juice, lymph, mucus, pericardial fluid, lymph, ascites, pleural fluid, pus, rheum, saliva, serum, semen, serum, smegma, saliva, synovial fluid, sweat, tears, urine, vaginal secretion, vitreous humor, vomitus, and / or combinations or components thereof. In some embodiments, the body fluid can be or include intracellular fluid, extracellular fluid, intravascular fluid (plasma), interstitial fluid, lymph, and / or transcellular fluid. In some embodiments, the body fluid can be or include a plant exudate. In some embodiments, the biological tissue or sample can be obtained, for example, by aspiration, biopsy (e.g., fine needle or tissue biopsy), swab (e.g., oral, nasal, skin, or vaginal swab), scraping, surgery, washing, or perfusion (e.g., bronchoalveolar, ductal, nasal, ocular, oral, uterine, vaginal, or other washing or perfusion). In some embodiments, the biological sample is or includes cells obtained from an individual. In some embodiments, the sample is a "primary sample" obtained directly from the source of interest by any suitable means. In some embodiments, as is apparent from the context, the term "sample" refers to a preparation obtained by processing a primary sample (e.g., by removing one or more components and / or adding one or more agents). For example, filtering using a semipermeable membrane.Such "processed samples" can include, for example, nucleic acids or proteins extracted from a sample or obtained by subjecting a primary sample to one or more techniques such as nucleic acid amplification or reverse transcription, isolation and / or purification of specific components.

[0095] Storage life: As used herein, the term "storage life" or "viable storage life" refers to the amount of time (expressed in days, months, or years) that a given composition contains an amount of viable microorganisms (e.g., bacteria) that exceeds the minimum threshold required to produce a biological effect in a subject or group of subjects. The survival rate can be evaluated, for example, by using an appropriate culture assay to determine the ratio of live cells:dead cells in the composition at a given time. In other embodiments, the survival rate can be functionally evaluated using a cell-based assay to measure the rate and / or maximum amount of hydrolysis of ellagitannins by cells in the composition, formulation, or preparation. As will be understood by those skilled in the art, the survival rate of a given composition is compared to an appropriate reference such as the survival rate of the composition on the day it was packaged or the threshold rate / maximum amount of hydrolysis of ellagitannins desired in the composition. The term "increased storage life" or "increased viable storage life" as used herein refers to an increase in the storage life of an ellagitannin composition (or composition or combination containing an ellagitannin composition) of at least one day compared to an equivalent composition. In other embodiments, the increase in storage life refers to an increase of at least 2 days, at least 5 days, at least 7 days, at least 10 days, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 1 month, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 7 months, at least 8 months, at least 9 months, at least 10 months, at least 11 months, at least 12 months or more in an ellagitannin composition (or composition or combination containing an ellagitannin composition) compared to an equivalent composition. In some embodiments, the equivalent composition is lacking in ellagitannin.

[0096] Small molecule: As used herein, the term "small molecule" refers to a small organic or inorganic molecule having a molecular weight of less than about 3000 Daltons. Generally, a small molecule can have a molecular weight of less than about 3000 Daltons (Da). A small molecule can be, for example, at least about 100 Da to about 3000 Da (e.g., about 100 to about 3000 Da, about 100 to about 2500 Da, about 100 to about 2000 Da, about 100 to about 1,750 Da, about 100 to about 1,500 Da, about 100 to about 1,250 Da, about 100 to about 1,000 Da, about 100 to about 750 Da, about 100 to about 500 Da, about 200 to about 1500, about 500 to about 1000, about 300 to about 1000 Da, or about 100 to about 250 Da).

[0097] Subject: As used herein, the term "subject" refers to an individual to whom the provided treatment is administered. In some embodiments, the subject is an animal. In some embodiments, the subject is a mammal, e.g., a mammal that experiences or is susceptible to a disease, disorder, or condition described herein. In some embodiments, the animal is a vertebrate, e.g., a mammal such as a non-human primate (especially a higher primate), sheep, dog, rodent (e.g., mouse or rat), guinea pig, goat, pig, cat, rabbit, or cow. In some embodiments, the animal is a non-mammal such as a chicken, amphibian, reptile, or invertebrate model C. elegans. In some embodiments, the subject is a human. In some embodiments, the patient has or is susceptible to one or more diseases, disorders, or conditions as described herein. In some embodiments, the patient exhibits one or more symptoms of one or more diseases, disorders, or conditions as described herein. In some embodiments, the patient is diagnosed with one or more diseases, disorders, or conditions as described herein. In some embodiments, the subject has received or is receiving a particular treatment for diagnosing and / or treating a disease, disorder, or condition. In another embodiment, the subject is an experimental animal or animal substitute as a disease model.

[0098] Substantially: As used herein, refers to a qualitative condition indicating the overall or almost overall range or degree of a feature or property of interest. One of ordinary skill in the biotechnology arts will understand that biological and chemical phenomena rarely, if ever, proceed completely and / or reach completion, or achieve or avoid absolute results. Thus, the term "substantially" is used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena.

[0099] Symptoms are alleviated: According to the present invention, "symptoms are alleviated" when the magnitude (e.g., intensity, severity, etc.) and / or frequency of one or more symptoms of a particular disease, disorder, or condition is reduced. For clarity, a delay in the onset of a particular symptom is considered one form of reducing the frequency of that symptom.

[0100] Treatment regimen: As the term is used herein, "treatment regimen" refers to a dosing regimen the administration of which, across the relevant population, may correlate with a desired or beneficial treatment outcome.

[0101] Therapeutically effective amount: As used herein, it means an amount that produces the desired effect in a subject to which it is administered. In some embodiments, this term refers to an amount sufficient to treat a disease, disorder, and / or condition when administered to a population that has or is susceptible to having the disease, disorder, and / or condition, according to a therapeutic dosing regimen. In some embodiments, a therapeutically effective amount is an amount that reduces the incidence and / or severity of one or more symptoms of a disease, disorder, and / or condition and / or delays onset. It has been reported that the term "therapeutically effective amount" does not actually require that successful treatment be achieved in a particular subject. Rather, a therapeutically effective amount can be an amount that provides a particular desired pharmacological response in a significant number of subjects when administered to subjects in need of such treatment. In some embodiments, reference to a therapeutically effective amount is reference to an amount measured in one or more specific tissues (e.g., tissues affected by a disease, disorder or condition) or body fluids (e.g., blood, saliva, serum, sweat, tears, urine, etc.). In some embodiments, it has been reported that a particular agent or therapy of a therapeutically effective amount can be formulated and / or administered in a single dose. In some embodiments, a therapeutically effective agent can be formulated and / or administered in multiple doses, for example, as part of a dosing regimen.

[0102] Treatment: As used herein, the term "treatment" (or "treating" or "treat") refers to the application of any treatment that partially or completely alleviates, ameliorates, restores, inhibits, delays the onset of, reduces the severity of, and / or reduces the incidence of one or more symptoms, features, and / or causes of a particular disease, disorder, and / or condition. In some embodiments, such treatment can be for a subject that does not exhibit signs of the associated disease, disorder, and / or condition, and / or for a subject that exhibits only initial signs of the disease, disorder, and / or condition. Alternatively, or in addition, such treatment can be for a subject that exhibits one or more established signs of the associated disease, disorder, and / or condition. In some embodiments, the treatment can be for a subject diagnosed as having the associated disease, disorder, and / or condition. In some embodiments, the treatment can be for a subject known to have one or more susceptibility factors that are statistically correlated with an increased risk of developing the associated disease, disorder, and / or condition. BRIEF DESCRIPTION OF THE DRAWINGS

[0103]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

DETAILED DESCRIPTION OF THE INVENTION

[0104] The present disclosure acknowledges that ellagitannin metabolites have biological properties that may include beneficial biological activities in some cases. For example, urolithins resulting from ellagitannin metabolism (e.g., urolithin A, urolithin B, urolithin C, urolithin D, and / or isourolithin A) can improve mitochondrial function, for example, by increasing mitophagy (e.g., recycling of mitochondria by autophagy). Although ellagitannin metabolites (e.g., urolithins) may affect biological activity, such metabolites have been reported to have low bioavailability. Thus, there is a need in the art for approaches that can enhance the bioavailability of ellagitannin metabolites.

[0105] The present disclosure provides the insight that the biological availability of urolithin resulting from the processing of ellagitannin can be enhanced by utilizing an enzyme composition comprising one or more ellagitannin enzymes (e.g., tannin acyl hydrolase enzyme, gallic acid decarboxylase enzyme, or a combination thereof). Accordingly, in particular, the present disclosure provides a technique in which one or more ellagitannin enzymes are included in an ellagitannin composition. Such a technique results in an increase in the production of urolithin (e.g., urolithin A, urolithin B, urolithin C, urolithin D, and / or isourolithin A) and / or an increase in the bioavailability of urolithin (e.g., urolithin A, urolithin B, urolithin C, urolithin D, and / or isourolithin A), and thus provides a solution to the needs in the art. In some embodiments, the techniques herein may be useful for altering (e.g., improving) mitochondrial function (e.g., by reducing mitochondrial dysfunction) and / or for altering antioxidant levels.

[0106] The present disclosure provides further insight that microorganisms, such as natural or genetically modified variants of microbial strains found in the microbiota (e.g., of mammals, such as humans), can contain and / or express one or more ellagitannin enzymes (e.g., ellagitannin enzyme-producing microorganisms). Accordingly, the present disclosure provides techniques for using such microorganisms, alone or in combination with an ellagitannin composition, to increase the production and / or bioavailability of urolithin. One advantage of using a microbial strain that contains and / or expresses one or more ellagitannin enzymes is that microbial strains, such as those found in the microbiota, are generally safe for administration or consumption by a subject (e.g., a mammal, such as a human). Another advantage of using such a microbial strain can be that the microbial strain can colonize the gastrointestinal tract of the subject to which the strain is administered, which can reduce the number of administrations required and increase the time that the ellagitannin enzyme is present in the subject's gastrointestinal tract. Further, the microbial strain can be easily administered to a subject via several probiotic forms, as discussed herein.

[0107] Ellagitannin composition Ellagitannins are a diverse class of complex hydrolyzable plant tannin polyphenols composed of a hexahydroxydiphenoyl moiety esterified to a sugar, i.e., hexahydroxydiphenoyl - glucose ester. Ellagitannins are found in various foods such as fruits of the Myrtaceae family including, but not limited to, strawberry (Fragaria vesca), raspberry, blackberry, cloudberry (Rubus chamaemorus), jaboticaba, cambuci, Surinam cherry, camu camu, red guava, white guava, pomegranate, walnut, pecan, beefsteak fungus (Fistulina hepatica), and cranberry. Ellagitannin hexahydroxydiphenoyl - glucose esters can contain varying numbers of hexahydroxydiphenoyl (HHDP) units and galloyl and / or sangui - sorboyl units attached to the sugar and can be produced mainly in dicotyledonous angiosperm species including, but not limited to, species of the Myrtales order.

[0108] Following consumption by a subject (e.g., a mammal, e.g., a human), ellagitannin (ET) can be metabolized in the subject to ellagitannin metabolites such as ellagic acid (EA) metabolites, and the metabolites can be, but are not limited to, urolithin A, urolithin B, urolithin C, urolithin D, isourolithin A, methylurolithin A, hydroxylurolithin A, and / or derivatives thereof. These metabolites may be derived from ellagitannins present in certain foods (such as pomegranates), but when these foods are ingested, the bioavailability of these beneficial bioactive metabolites is often insufficient. Specifically, certain subjects may not be able to produce detectable amounts of these metabolites after ingesting an ET-containing food (e.g., pomegranate juice). In some cases, a subject may be able to increase the bioavailability of ellagitannins in food and / or co-administer as part of the compositions described herein and benefit from the compositions and methods described herein. Subjects who produce very low or undetectable levels of ellagitannin metabolites after ingestion may be able to benefit from the techniques disclosed herein. However, subjects who can produce detectable levels of ellagitannin metabolites may also be able to benefit from the techniques disclosed herein because an increase in the levels of such metabolites may be desirable.

[0109] In certain embodiments, ellagitannin compositions are used as components of the compositions described herein or are administered by the methods described herein. Non-limiting examples of ellagitannins useful in the methods and compositions described herein include numerous pomegranate ellagitannins, including, in particular, punicalagin, which contains punicalin and gallagic acid, each of which can be hydrolyzed to ellagic acid (EA), which is further hydrolyzed by gut microbiota to urolithins A and B. Other ellagitannins include, for example, pedunculagin, rosavin (incorporated herein by reference in its entirety, Fukiu et al., Tetrahedron 62:9661-9670 (2006)), phyllanemblinin (incorporated herein by reference, Zhang et al., J. Nat. Prod. 64:1527-1532 (2001)) and sanguiin H6.

[0110] Ellagitannin compositions that may be useful in the methods and compositions described herein can include, for example, fruit juices or homogenates of plant materials that include, but are not limited to, fruits of plants that produce ellagitannins, or their peels and / or husks. For example, it may be preferable to use fruit juices or homogenates enriched in ellagitannins by extraction. A variety of plant materials can be extracted by a variety of methods. For example, in certain embodiments, the material can be extracted by solvent extraction of freeze-dried, pulverized plant material. Some examples will be described below.

[0111] The extraction of pomegranate husk or peel that can enrich ellagitannin while removing anthocyanin is described in Adams et al., J Agric. Food Chem. 54:980 - 985(2006), Seeram et al., Sep. Purif. Technol. 41:49 - 55, and Sharma et al., J. Agric. Food Chem. 58:3965 - 3969(2010), each of which is hereby incorporated by reference in its entirety. The purity and concentration of ellagitannin in such extracts can be determined by HPLC and liquid chromatography electrospray ionization mass spectrometry (LC - ESI / MS). Pomegranate extracts are commercially available. For example, an extract containing 37.5% punicalagin and punicalin and 2.7% ellagic acid, which is the major pomegranate ellagitannin gallic acid, is available from Verdure Sciences, Noblesville IN. The extract is prepared by the method described by Pacheco - Palencia et al. Food Chem. 56:8434 - 8441(2008), which is also hereby incorporated by reference in its entirety.

[0112] The extracts of strawberry ellagitannins can be prepared as described in Zhang et al., J. Agric. Food Chem. 56:670 - 675 (2008), which is also incorporated herein by reference. Briefly, freeze - dried whole - fruit strawberry powder can be extracted by cold percolation with methanol to produce an extract, which can be partitioned into chloroform and then ethyl acetate. The remaining aqueous portion can be further purified by adsorption chromatography on an XAD - 16 (Amberlite Resin, Sigma, Louis, MO) column and eluted with water and then acidic methanol. After drying the methanol eluate under vacuum, it can be suspended in distilled water and filtered to produce a water - insoluble fraction enriched in ellagitannins and ellagic acid, thereby further increasing the ellagitannin content. The extract can be standardized to 5.0% ellagic acid by HPLC. Generally, the resulting extract may contain about 20.5% phenols measured as gallic acid equivalents (GAE).

[0113] The jamun seed extraction process is described in Sharma et al., J. Agric. Food Chem. 58:3965 - 3969 (2010), which is also incorporated herein by reference. Indian jamun (Eugenia jambolana) berries contain ellagitannins in their fleshy pulp, but their seeds may be a richer source that contains less anthocyanin. In some cases, the anthocyanins can be removed. In some embodiments, the compositions described herein are essentially free of or do not contain anthocyanins. The extraction of jamun seeds can include, for example, extraction of seed powder in acetone followed by vacuum drying. The resulting extract can be standardized to about 4.2% ellagic acid by HPLC and contains 20.5% phenols as GAE. Similar approaches or other previously known approaches can be applied to prepare ellagitannin - containing preparations from other sources for use in the methods and compositions described herein.

[0114] The ellagitannin composition disclosed in this specification can be formulated for oral administration. In some embodiments, the ellagitannin composition can be a food, beverage, feed composition, or dietary supplement. In some embodiments, the ellagitannin composition can be a liquid, syrup, tablet, troche, gummy, capsule, powder, gel, or film.

[0115] In some embodiments, the ellagitannin composition can be mixed with a pharmaceutically acceptable carrier. In some embodiments, the ellagitannin composition can be included in an enteric-coated formulation.

[0116] When consumed, ellagitannin can be hydrolyzed to release ellagic acid. Ellagic acid can be detected in human plasma and has been proposed to act directly on methyltransferases involved in histone methylation, among other activities. However, ellagitannin metabolites, including but not limited to urolithin A (3,8-dihydroxyurolithin), urolithin C (3,8,9-trihydroxyurolithin), isourolithin A (3,9-dihydroxyurolithin), urolithin B (3-hydroxyurolithin), urolithin D (3,4,8,9-tetrahydroxyurolithin), or combinations thereof, require the action of the gut microbiota on ellagitannin.

[0117] The concentration of urolithin A can reach up to the maximum micromolar (μM) level without any apparent toxic effects in vivo in plasma. For example, upon human intake of pomegranate juice, the peak plasma level of urolithin A can reach 14 - 40 μM. However, due to inter-individual ellagitannin processing, there can be wide variations in urolithin levels (see, e.g., Cerda et al., Eur. J. Nut. 43:205 - 220, which is incorporated herein by reference). Selma et al. identified single-cultured bacteria (Gordonibacter urolithinfaciens and Gordonibacter pamelaeae DSM19378T) that metabolize ellagic acid to produce urolithin M-5, urolithin M-6, and urolithin C, which are urolithins. However, these cultured bacteria were unable to produce the downstream products urolithin A and urolithin B (see Selma et al., Food & Nut. 5:1779 - 1784 (2014), which is incorporated herein by reference). The present disclosure provides the recognition that wide inter-individual variations may be due to differences in the microbiota.

[0118] The study of tissue properties reveals that urolithin may be enriched in the prostate, intestine, and colon tissues of mice. Urolithin A can inhibit the proliferation of colon cancer cells, induce cell cycle arrest, and regulate important cellular processes related to colon cancer development, such as MAPK signaling in vitro (Larossa et al, J.Agric.Fool Chem., 54:1611 - 1620(2006), Gonzalez - Sarrias et al., Mol.Nut.Food Res.53:686 - 698(2009), each of which is incorporated herein by reference). In a rat colitis model, urolithin A can reduce inflammatory markers such as inducible nitric oxide synthase, cyclooxygenase - 2 (COX - 2), prostaglandin E synthase, and prostaglandin E2 in the colon mucosa. Urolithin B has been found to be a regulator of skeletal muscle mass in some embodiments (e.g., Rodriguez et al., J.Cachexia Sarcopenia Muscle 8:583 - 597(2017), incorporated herein by reference). When urolithin is directly biologically available, treatments that promote urolithin production as described herein can increase the bioavailability of ellagitannin metabolites.

[0119] Urolithin has a distinct UV spectrum that allows for its detection and measurement by HPLC, for example, in combination with a UV photodiode array detector. Correlations between structural properties including conjugation and the UV spectrum and retention time have been reported (see, e.g., Gonzalez - Barrio et al., J.Agric.Food Chem.59:1152 - 1162(2011), incorporated herein by reference). Thus, HPLC and UHPLC can be used to assay and identify the levels of urolithin in urine obtained from a subject (see Piwowarski, JP et al.Drug Metabolism and Disposition 45(6):657 - 665(2017), incorporated herein in its entirety by reference).

[0120] Ellagitannin Enzyme Tannin acylhydrolase enzyme Embodiments of the compositions and methods described herein include the use of microorganisms expressing ellagitannins or enzymes that act in the ellagitannin metabolic pathway. Exemplary enzymes include tannin acyl hydrolase enzymes that can catalyze the hydrolysis of the galloyl ester bond of hydrolyzable tannins, including ellagitannins, to release gallic acid. The tannin acyl hydrolases described herein can catalyze the reaction characteristic of EC 3.1.1.20. Fungi, such as Aspergillus species, and bacteria, such as members of the Lactobacillaceae family, can naturally produce tannase enzymes suitable for use in the compositions and methods described herein. Although tannase enzymes encoded by fungi may share little structural similarity with those encoded by bacteria, they can share a similar range of substrate specificity. Thus, for embodiments in which the tannase enzyme can be administered or used as a preparation derived from, but not including, a living microorganism, tannase can be isolated or prepared from fungal as well as bacterial sources. Tannases produced by yeast and methods for producing them are described, for example, in Boer et al., Yeast 26:323-337 (2009), and the secretion, purification and characterization of Aspergillus tannase in Pichjia pastoris yeast in Zhong et al., Protein Expression and Purif. 36:165-169 (2004), both of which are incorporated herein by reference.

[0121] Tannases acting on ellagitannins can selectively hydrolyze the galloyl moieties to produce gallic acid and degalloylated ellagitannins. See, for example, Rodriguez-Duran et al., Enzyme Res. 2011:823619 (2011), which includes a description of the hydrolysis products of tannase digestion of various ellagitannins and is incorporated herein by reference. In one embodiment, the tannin acyl hydrolase is a tannase B or tanB tannase enzyme. Examples include, but are not limited to, the tanB enzyme encoded and expressed by members of the Lactobacillaceae family, including but not limited to the species L. plantarum. Tannase B encoded and expressed by other species capable of catalyzing the same reactions as in various embodiments of the compositions and methods described herein may be useful, as well as naturally occurring or artificially generated variants that retain the ability to catalyze the reactions.

[0122] Methods for producing and isolating recombinant tannase, e.g., L. plantarum tannase, are described, for example, in Curiel et al., J. Agric. Food Chem. 57:6224-6230 (2009), which is incorporated herein by reference. The crystal structure of the tannase B polypeptide encoded and expressed by L. plantarum has been determined (see Ren et al., J. Mol. Biol. 425:2737-2751 (2013), which is incorporated herein by reference). As reported, tannase B exhibits an α / β structure characterized by a large cap domain inserted into the serine hydrolase fold. Structural studies of the enzyme complexed with multiple substrates have shown that interactions at the galloyl binding site are determinative of substrate binding. The galloyl binding site is responsible for the esterase and depsidase activities of the enzyme. A catalytic triad consisting of Ser163, His451, and Asp419 has been identified. Mutagenesis studies have shown that during the binding of gallic acid, the carboxyl group of the molecule forms hydrogen-bonding interactions with the catalytic triad of the enzyme, and the three hydroxyl groups contact Asp421, Lys343, and Glu357 to form another hydrogen-bonding network, and that these residues are necessary for enzyme activity. Thus, modifications to tannin acyl hydrolase or tannase B polypeptides that change the identity of one or more of these residues or their equivalents in homologous proteins would likely not be tolerated. Similarly, changes that disrupt the positions of these residues or their equivalents in other homologs relative to each other would also be expected to disrupt the hydrogen-bonding network and interfere with enzyme function. On the other hand, changes that do not affect the identity or relative positions of the described residues would be more likely to be tolerated. In one embodiment, the tannase B polypeptide described herein is at least 85% identical to the L. plantarum tannase B enzyme encoded by strain WCFS1 and retains the above-mentioned amino acids Ser163, His451 and Asp419, as well as the tannin hydroxyl contact amino acids Asp421, Lys343 and Glu357, or their equivalents located in homologous polypeptides.In another embodiment, the tannase B polypeptides described herein have at least 90% or at least 95% or more identity to the L. plantarum tannase B enzyme encoded by strain WCFS1 and retain the catalytic triad amino acids Ser163, His451 and Asp419 and the tannin hydroxyl contacting amino acids Asp421, Lys343 and Glu357 described above, or their equivalents located in homologous polypeptides.

[0123] Many L. plantarum strains encode and express similar tannase B polypeptides. Non-limiting examples include L. plantarum WCFS1 (see nucleic acid and amino acid sequences below), as well as, for example, L. plantarum 5-2, L. plantarum LP3, L. plantarum BLS41, L. plantarum LQ80, L. plantarum A3, L. plantarum FBR6, and L. plantarum RI-51.

[0124] L. plantarum WCFS1 tannase B nucleic acid sequence (NCBI accession number NC_004567.2): atgagtaacc gattgatttt tgatgctgac tggctggtgc cggaacaggt ccaagttgcc gggcaggcta ttcaatatta tgctgcccgt aatattcagt acgttcagca tccagtcgca gcgattcagg tcctaaacgt ttttgtacca gccgcatact tgcatggcag ttcagtcaat ggttatcagc gggcaacggc gccaattctg atgccgaata cggtcggcgg ttatttgcca ggaccggcgg atgatccgca acgtgtcact tggccgacga atgcagggac gattcaacag gcacttaaac gcggttacgt tgtggtggcc gctggaattc gcggtcgtac gacggttgat aagtctgggc aacgggtcgg gcaagcgccg gcttttatcg tagatatgaa ggcggcaatc cgttacgtta agtataatca gggccggctg ccaggtgaca cgaaccggat catcacgaat ggaacgagtg ctgggggtgc cacttcggct ttagcgggtg cgagtggcaa ttcggcttat tttgaaccag ccttaactgc gctcggggca gcaccggcga ctgacgatat ctttgcggtg tcagcttact gcccgattca taatctggaa cacgcagaca tggcctacga gtggcagttt aatggtatta atgactggca ccgttatcag cctgttgcgg ggacgaccaa gaatgggcga ccaaaatttg aaccggttag tggtcagctc acagttgaag aacaggccct ttcgttggcg ttaaaagccc agttcagtac ctacttgaac cagttgaaac tcacggccag tgacgggacg cacttgacgc ttaatgaggc gggaatgggt tcatttcgtg atgttgttcg ccaattattg atatcatctgctcagacggc attcgatcaa gggacggata ttcataagta cgcaggcttt gtcgttactg gaaatcaggt gacggacttg gatttatcag cttattgaa gtcgttaact cgcatgaaag ccgtcccggc gtttgaccaa ttagatttga cgagtccaga gaataatttg tttggcgatg caacggcgaa agccaagcac tttacggcct tggcacagac gcgaagtacg gtgacggcac aactagcgga cgctgagctg attcaggcga ttaatccgct cagttactta acgacaactt cgtcacgagt tgctaagcac tggcggattc gccacggtgc ggccgaccga gatacgagtt ttgcaatccc gattattcta gcaataatgt tagaaaatca tggttatggc attgattttg cgctaccgtg ggatattccc cacagtggtg actatgattt aggcgattta ttttcctgga ttgatggctt gtgccaatga

[0125] L. plantarum WCFS1 tannase B amino acid sequence, NCBI accession number WP_011101979.1: [Table 3] Amino acids Ser163, His451, Asp419, Asp421, Lys343, and Glu357 are shown in bold.

[0126] Methods for detecting or measuring tannin acyl hydrolase activity are described in Beverini & Metche, Sci. Aliments. 10:807-816 (1990), which describes an HPLC assay; Haslam et al. J. Chem. Soc. 1829-1835 (1961), which describes an unbuffered titration assay; Yamada et al. Agr. Biol. Chem. 45:233-240 (1967), which describes a buffered titration assay; Skene & Booker, Anareobe 1:321-327 (1995), which describes a single-wavelength spectrophotometric assay; Bajpai & Patil, World J. Microbiol. Biotechnol. 12:217-220 (1996), which describes a dual-wavelength spectrophotometric assay; and Aguilar et al. Exemplary methods include those described in, for example, ... Based on this comparison, either of these methods can be used, but the HPLC assay described by Beverini and Metche has the lowest coefficient of variation and is more reliable than the other methods. When precision in the measurement of tannin acyl hydrolase enzyme activity is important, the HPLC method may be preferred.To determine whether a given bacterium expresses tannin acyl hydrolase activity, any of the assays provided above can be used, among others, but HPLC approaches are preferred when it is necessary or desired to measure the amount of such activity. The presence of tannin acyl hydrolase enzyme genes can be detected in bacteria via PCR using primers based on available tannin acyl hydrolase enzyme nucleic acid sequences, or if the bacterial genome has been sequenced, the presence of sequences encoding tannin acyl hydrolase enzymes can be determined based on homology or identity with known tannin acyl hydrolase enzymes.

[0127] Gallic acid decarboxylase enzyme Embodiments of the compositions and methods described herein include the use of microorganisms that encode and express a gallate decarboxylase enzyme. This enzyme can catalyze the conversion of 3,4,5-trihydroxybenzoic acid (gallic acid) to pyrogallol and carbon dioxide, which is a characteristic of EC 4.1.1.59. Although microbial gallate decarboxylase genes can be encoded in an operon arrangement of three separate protein-coding sequences, referred to as "subunits" C, B, and D, the active enzyme is not a complex of the three subunits. Rather, for species with this arrangement, the C subunit appears to be the catalytic subunit. In Lactobacillus plantarum WCFS1, based on gene knockout experiments, it has been proposed that the B subunit, but not the D subunit, is required together with the C subunit for gallate decarboxylase activity, and that the B subunit plays a role, for example, in establishing the correct folding of the C subunit. See, e.g., Jimenez et al., Appl. Environ. Microbiol. 79:4253-4263 (2013), which is incorporated by reference herein. For the gallate decarboxylase expressed by L. plantarum WCFS1 (also known as ATCC deposited strain BAA-793), the C subunit lpdC is identified in GenBank Accession No. F9US27-1: atggcagaac aaccatggga tttgcgtcgc gtgcttgatg agatcaagga tgatccaaag aactatcatg aaactgacgt cgaagttgat ccaaatgcgg aactttctgg tgtttatcgg tatatcggtg ctggtgggac cgttcaacgg ccaacgcaag aggcgtcc agattcgtc agattcgtc agattcgt tgatacgcgg gtcttgactg gattgatggc gagtcgccgg cgcgttggta agatgttcca ccacgattat cagacgttag ggcaatactt gaacgaagca gtctctaatc cagtggcgcc agaaacggtt gctgaagcgg atgcgccagc tcacgatgtc gtttataatat cgactttaggat aggcttagatt tagtggcagc accaacgaat acgccccaag atgctggacc atatattacg gtcggtgtgg tgtttggctc aagcatggac aagtctaaga gtgatgtgac gattcaccga atggtccttg aagataagga taagttaggg atttatatca tgcctggcgg tcggcacatt ggtgcgagt cggacagta cggacagta agacagcact tgccaattac aattaatatt ggtttggatc cagccattac gattggtgca actttcgaac caccgaccac gccattcggt tataacgaat taggtgttgc tggtgcgatt cggaaccaag ctgttcaatt agttgacggg gtgaccgtcg atgaaaggc gattgcggtc gctgactatgtatgtagtag cctaacgaac gtattcagga agatatcaat acgcatacgg gcaaggcgat gcctgaattc ccgggttatg atggtgacgc caacccagct ttacaagtgattaaggtgac ggcggtgact catcggaaga atgccatcat gcaaagcgtg attggaccat ccgaagaaca tgtcagcatg gcgggaattc caactgaagc tagtatctta caattggtta accgtgccat tcctggtaaa gtgacgaatg tttataatcc gccgggct ggtcaggt tgcagatccat cacaaggata atgaagcgga tgaaggaatt caacggcaag ctgccttgct tgcgttctca gcctttaagg aattgaagac tgttatcctg gttgatgaag atgttgatat ttttgatatg aatgatgtga tttggacgat gaatacccgt ttccaagccg atcaggactt gatggtcgtta gcagcatt tcggaacgcc cacaatatga tccaaagtcg attcgtttcc gtgggatgag ttctaaacta gtgattgatg gcaccgtacc attcgatatg aaggaccaat ttgaacgggc ccaattcatg aaagtggctg actgggagaa gtatttgaag taa lpdC: F9US27-1(UniprotKB;L.plantarum ATCCBAA-793) MAEQPWDLRR VLDEIKDDPK NYHETDVEVD PNAELSGVYR YIGAGGTVQR PTQEGPAMMF NNVKGFPDTR VLTGLMASRR RVGKMFHHDY QTLGQYLNEA VSNPVAPETV AEADAPAHDV VYKATDEGFD IRKLVAAPTN TPQDAGPYIT VGVVFGSSMD KSKSDVTIHR MVLEDKDKLG IYFAEEGRKAYEPGYEKA NKPMPITINI GLDPAITIGA TFEPPTTPFG YNELGVAGAI RNQAVQLVDG VTVDEKAIAR SEYTLEGYIM PNERIQEDIN THTGKAMPEF PGYDGDANPA LQVIKVTAVT HRKNAIMQSV IGPSEEHVSM AGIPTEASIL QLVNRAIPGK VTNVYNPPAG GGKLMTIMQI HKDNEADEGI QRQAALLAFS AFKELKTVIL VDEDVDIFDM NDVIWTMNTR FQADQDLMVL SGMRNHPLDP SERPQYDPKS IRFRGMSSKL VIDGTVPFDM KDQFERAQFM KVADWEKYLK

[0128] The B subunit of L. plantarum WCFS1 gallate decarboxylase (lpdB) is identified under GenBank accession number F9UT67: atgaaacgaa ttgttgtggg aatcacggga gcgtccggta cgatttacgc ggtcgactta ttagaaaagt tacatcagcg gccagatgtt gaagttcatc tggtaatgag tgcgtgggct aaaaaaaact tggagttaga gactgattac tcgctcgcgc agctgacggc gctcgcggat gctacttatc gggctaatga ccaaggcgca gcgattgcca gcggttcgtt tttgaatgac ggaatggtca ttgtcccagc tagtatgaag acggtagcag ggattgcgta cggcttcggt gataatttaa tatcgcgggc tgctgatgtc actataag aacaacgtaa acttgtgatt gttccacgtg aaacaccgtt aagcgtgatt catttagaaa atctaacgaa gttggcaaaa ctcggtgccc aaattattcc accgattccc gcgttttata atcatccgca atccattcag gatctggtca atcatcaaac catgaaaatt ttagatgcgt ttcatattca taatgaaact gatcgccgtt gggaggggga ttaa MKRIVVGITG ASGTIYAVDL LEKLHQRPDV EVHLVMSAWA KKNLELETDY SLAQLTALAD ATYRANDQGA AIASGSFLND GMVIVPASMK TVAGIAYGFG DNLISRAADV TIKEQRKLVI VPRETPLSVI HLENLTKLAK LGAQIIPPIP AFYNHPQSIQ DLVNHQTMKI LDAFHIHNET DRRWEGD

[0129] The D fragment of L. plantarum potent pneumococcal dyes (lpdD) is GenBank accession number F9UT68: atggcaactt ttacgactga gcaggccggg tatcaaatgc aagcaatact ccaagtgatt ggatatgact tgttgatcgt cgttaccggt gggaccaatc cccatattgg tgacgtgacc acactaactg ccagcacggt tcccgaaacg gttaagtttc ccagccatga tggtcgcttc cacaaagata actttatttc ggaacgaatg gccaagcgga ttcagcgtta tctagctgga agctgtacaa ttactgcggg aattcatgtc aaccaaatta ctaaagcaca aatagcagct gcggcaccaa tgacggatga cctcagccgc cagattatta gctggttaca ggcccatccc gtccaggctg aaaagccgga atattatgga caagacgagc aaccgcggta g MATFTTEQAG YQMQAILQVI GYDLLIVVTG GTNPHIGDVT TLTASTVPET VKFPSHDGRF HKDNFISERM AKRIQRYLAG SCTITAGIHV NQITKAQIAA AAPMTDDLSR QIISWLQAHP VQAEKPEYYG QDEQPR

[0130] Gallic acid decarboxylase-expressing L. plantarum species, and other species expressing gallic acid decarboxylase, such as Streptococcus galloylyticus, can decarboxylate gallic acid released from tannins, for example by the action of tannin acyl hydrolase enzymes, to pyrogallol, but these species lack the ability to further degrade this product. Gallic acid decarboxylase enzymes from many microbial sources are known, including, but not limited to, Lactobacillus plantarum, e.g., L. plantarum WCFS1. Gallic acid decarboxylase activity is present in a wide range of lactic acid bacteria, such as L. brevis, L. casei, and L. fermentum.

[0131] In one embodiment, the gallic acid decarboxylase comprises a gallic acid decarboxylase C polypeptide, such as, but not limited to, the L. plantarum lpdC polypeptide. In another embodiment, the microorganisms useful in the methods and compositions described herein encode and express gallic acid decarboxylase C and B polypeptides. In such microorganisms or compositions made therefrom or including them, the B polypeptide is not necessarily linked to the C polypeptide, but appears to be important for producing a highly active gallic acid decarboxylase enzyme. Examples include, but are not limited to, the lpdC and lpdB polypeptides of L. plantarum species, particularly, but not limited to, L. plantarum WCFS1. Gallic acid decarboxylases encoded and expressed by other species that catalyze the same reaction may also be useful in various embodiments of the compositions and methods described herein, as well as naturally occurring or artificially created variants that retain the ability to catalyze the same reaction.

[0132] Methods for expressing or producing recombinant gallic acid decarboxylase are similar to those for producing recombinant tannin acyl hydrolase enzymes or other recombinant enzyme preparations. See, for example, Jimenez et al., Appl. Environ. Microbiol. 79:4253-4263 (2013), incorporated herein by reference. Gallic acid decarboxylase activity can also be assayed as described therein, and the authors further describe PCR primers and PCR amplification to identify species encoding the enzyme activity and to prepare nucleic acids encoding the enzyme polypeptide for cloning into an expression vector, e.g., for overexpression.

[0133] In one embodiment, the gallate decarboxylase enzyme has at least 80% sequence identity to the catalytic gallate decarboxylase C polypeptide of L. plantarum lpdC of strain WCFS1 described herein and retains at least 50% of the gallate decarboxylase activity of the lpdC polypeptide when expressed in the presence of the lpdB polypeptide. Contemplated variations in the gallate decarboxylase enzyme molecule include, for example, conservative amino acid substitutions, as that term is defined herein.

[0134] Thus, in one embodiment, the gallic acid decarboxylase enzyme has 50 or fewer, such as 40 or fewer, 30 or fewer, 20 or fewer, 15 or fewer, 10 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer, or 1 or fewer conservative amino acid substitutions compared to the wild-type gallic acid decarboxylase enzyme or compared to the gallic acid decarboxylase enzyme encoded and expressed by L. plantarum WCFS1, and retains at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more activity compared to the wild-type enzyme or the enzyme encoded by L. plantarum WCFS1. In another embodiment, the gallic acid decarboxylase enzyme has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more sequence identity with the catalytic gallic acid decarboxylase C polypeptide of L. plantarum lpdC of strain WCFS1 described herein, and when expressed in the presence of the lpdB polypeptide, retains at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more of the gallic acid decarboxylase activity of the lpdC polypeptide. It is contemplated that some mutations may have the potential to improve the activity associated such that the gallic acid decarboxylase variant has an activity greater than 100% of the wild-type or native polypeptide, such as 110%, 125%, 150%, 175%, 200%, 500%, 1000% or more.

[0135] Ellagitannin enzyme synthesis (EES) microorganism Many microbial species are known that encode and can produce the tannase enzymes described herein, as well as the gallic acid decarboxylase described herein, similar to the species that can be produced. In one embodiment, a single microbial species or strain can express both tannase and gallic acid decarboxylase enzymes. In another embodiment, each enzyme is encoded and can be expressed by different species or strains, and in such cases, it is generally beneficial to administer both species or strains in order to provide the best benefits with respect to ellagitannin metabolism and urolithin production. In addition to microorganisms that can naturally express tannase and / or gallic acid decarboxylase enzymes, the microorganisms can be engineered to recombinantly express the enzyme of interest. In one embodiment, a microbial species or strain can be engineered such that both tannase and gallic acid decarboxylase enzymes can be included in polynucleotides encoding the enzymes and thus can be modified to be recombinantly expressed. In another embodiment, a microbial species or strain can be modified such that either tannase or gallic acid decarboxylase enzyme is encoded and can be recombinantly expressed.

[0136] For example, genome sequencing can be used to identify the species or strain of microorganism that encodes a given enzyme or enzyme gene cluster. Once a species or strain is identified as encoding a given enzyme or enzyme gene cluster, transcriptomics, RT-PCR, or Western blot or other antibody-based analysis of expressed proteins can be used, or the enzyme activity assay known previously can be used to determine whether the bacteria actually produce the enzyme(s).

[0137] Lactobacillus plantarum is an exemplary species that can encode and express tannase and gallic acid decarboxylase enzymes. In some embodiments, Streptococcus gallolyticus is used (Genetic and biochemical approaches towards unravelling the degradation of gallotannins by Streptococcus gallolyticus, Microb Cell Fact. 2014 Oct 31;13:154.doi:10.1186 / s12934-014-0154-8, which is incorporated herein by reference).

[0138] Combination Considering that certain factors can affect the effective amount of the ellagitannin composition and the effective amount of the microorganism capable of encoding and expressing tannin acyl hydrolase and gallic acid decarboxylase enzymes, it should also be understood that, as described herein, various combinations of ellagitannin amounts and microorganism amounts can provide an effective amount that promotes urolithin production in the gastrointestinal tract. Thus, for example, the combination can include an ellagitannin composition and an enzyme composition comprising one or more ellagitannin enzymes. In some embodiments, the one or more ellagitannin enzymes include a tannin acyl hydrolase enzyme, a gallic acid decarboxylase enzyme, or a combination thereof. In some embodiments, the enzyme composition can be an EES microorganism.

[0139] In some embodiments, the combination may comprise an ellagitannin composition of about 10 mg to about 10 g, about 10 mg to about 5 g, 10 mg to about 2500 mg, about 100 mg to about 10 g, about 100 mg to about 5 g, or 100 mg to about 2500 mg. In some embodiments, the combination may comprise at least 10 mg, at least 50 mg, at least 100 mg, at least 150 mg, at least 200 mg, at least 250 mg, at least 300 mg, at least 350 mg, at least 400 mg, at least 450 mg, at least 500 mg, at least 550 mg, at least 600 mg, at least 650 mg, at least 700 mg, at least 800 mg, at least 850 mg, at least 900 mg, at least 950 mg, at least 1000 mg (1 g), at least 1250 mg, at least 1500 mg, at least 2000 mg, at least 2500 mg, at least 3000 mg, at least 3500 mg, at least 4000 mg, at least 4500 mg, at least 5000 mg, or more of an ellagitannin composition. In some embodiments, the combination may comprise a maximum of 50 mg, a maximum of 100 mg, a maximum of 150 mg, a maximum of 200 mg, a maximum of 250 mg, a maximum of 300 mg, a maximum of 350 mg, a maximum of 400 mg, a maximum of 450 mg, a maximum of 500 mg, a maximum of 550 mg, a maximum of 600 mg, a maximum of 650 mg, a maximum of 700 mg, a maximum of 800 mg, a maximum of 850 mg, a maximum of 900 mg, a maximum of 950 mg, a maximum of 1000 mg (1 g), a maximum of 1250 mg, a maximum of 1500 mg, a maximum of 2000 mg, a maximum of 2500 mg, a maximum of 3000 mg, a maximum of 3500 mg, a maximum of 4000 mg, a maximum of 4500 mg, a maximum of 5000 mg, a maximum of 5500 mg, a maximum of 6000 mg, a maximum of 6500 mg, a maximum of 7000 mg, a maximum of 7500 mg, a maximum of 8000 mg, a maximum of 8500 mg, a maximum of 9000 mg, a maximum of 9500 mg, or a maximum of 10 g of an ellagitannin composition.

[0140] In some embodiments, the composition is about 10 5 CFU to 10 12 CFU, about 10 5 CFU to 10 10 CFU, or about 108 CFU ~ 10 12 may contain one or more EES microorganisms of CFU. In some embodiments, the composition is at least 10 5 , 5 × 10 5 , 10 6 , 5 × 10 6 , 10 7 , 5 × 10 7 , 10 8 , 5 × 10 8 , 10 9 , 5 × 10 9 , 10 10 , 5 × 10 10 , 10 11 , 5 × 10 11 , 10 12 , or may contain one or more EES microorganisms of more than that.

[0141] The amount of ellagitannin composition effective to promote urolithin production will vary, for example, depending on the amount and / or activity of microorganisms in the digestive tract that can metabolize ellagitannins. Thus, when an ellagitannin composition is consumed or administered with a preparation or formulation comprising microorganisms that encode and express tannin acyl hydrolase and / or gallic acid decarboxylase enzymes, the amount of ellagitannin composition effective to promote urolithin production will generally be less than when ellagitannin is consumed or administered without such microorganisms. It should be understood that where the level of enzyme expression from microorganisms that encode and express tannin acyl hydrolase and / or gallic acid decarboxylase enzymes can vary, the amount of microorganisms required to promote urolithin production will vary with such expression levels, i.e., the amount of a given microbial strain can be adjusted for effect depending on the relative levels of tannin acyl hydrolase and / or gallic acid decarboxylase enzymes produced. It should be noted that the presence of ellagitannins can induce the expression of enzymes necessary to metabolize them in microorganisms that can encode such enzymes, see, for example, Example 2. Thus, although microorganisms have been or recently been exposed to ellagitannins, the amount of microorganisms required to promote urolithin production may be less than the amount required when the microorganisms have not been so exposed prior to administration or consumption.

[0142] In one embodiment, effective treatment is determined by an increase in the urolithin concentration in the excreted urine of at least 10%, at least 20%, at least 30%, at least 40%, or at least 50% compared to the level of urolithin in the urine before treatment with a composition comprising an ellagitannin composition or a microbial ellagitannin composition that encodes and expresses the tannin acyl hydrolase and / or gallic acid decarboxylase described herein. In some embodiments, efficacy can be evaluated by measuring the degree of oxidative stress in cells in a biological sample before and after administration of the composition described herein. The degree of oxidative stress in cells can be evaluated, for example, by measuring the expression of an oxidative stress biomarker such as high-sensitivity C-reactive protein (hs-CRP), or by determining the ratio of oxidized to reduced glutathione. Since high levels of oxidative stress can be cytotoxic, the degree of oxidative stress can be measured by evaluating the concentration of intracellular proteins present in the systemic circulation from inflammatory or lysed cells. For example, the oxidative stress in cardiomyocytes can be determined by evaluating the level of troponin-I in the blood. Hepatic oxidative stress can be determined by an increase in the levels of hepatic enzymes in the bloodstream, including but not limited to alanine transaminase (ALT), aspartate transaminase (AST), alkaline phosphatase (ALP), and γ-glutamyl transpeptidase (GGT).

[0143] In some embodiments, effective treatment can be determined by an increase in the level of urolithin in the gastrointestinal tract of a subject of at least 10%, at least 20%, at least 30%, at least 40%, or at least 50% compared to the urolithin concentration in the gastrointestinal tract before treatment with a composition comprising an ellagitannin composition described herein or an ellagitannin composition in combination with a microorganism encoding and expressing tannin acyl hydrolase and / or gallic acid decarboxylase. In some embodiments, effective treatment can be determined by an increase in the level of urolithin in the gastrointestinal tract of a subject of at least 10%, at least 20%, at least 30%, at least 40%, or at least 50% compared to the plasma level of urolithin before treatment with a composition comprising an ellagitannin composition described herein or an ellagitannin composition in combination with a microorganism encoding and expressing tannin acyl hydrolase and / or gallic acid decarboxylase.

[0144] In some embodiments, a subject is evaluated using one or more additional diagnostic procedures, such as, for example, medical imaging, physical examination, clinical tests, medical history, family history, and genetic testing. Medical imaging techniques are well-documented methods. Thus, medical imaging can be selected from any known imaging method, including but not limited to ultrasound, computed tomography scan, positron emission tomography, photon emission computed tomography, and magnetic resonance imaging.

[0145] Bioavailability of ellagitannin compositions Phenolic compounds constitute a substantial and important group of phenylpropanoids produced by plants as secondary metabolites for the purpose of chemical defense against predators and for purposes related to reproduction and interference between plants. Structurally, phenolic compounds have an aromatic ring to which several hydroxyl groups are attached. Phenolic compounds are classified into various groups based on their functional groups, the number of phenolic rings contained, and the radicals that link these rings to another ring. Important factors in determining the antioxidant activity of a given phenolic compound are both the number and position of the hydroxyl groups. For example, flavonoids have more hydroxyl groups than other phenolic compounds, and this structure is associated with higher antioxidant activity. In addition to providing antioxidant activity, the structure of phenolic compounds can affect the solubility of phenols and / or provide a steric effect with respect to interactions with other molecules.

[0146] It has been reported that the structure of such compounds can play a role in their bioavailability. Whether a compound is bioavailable depends on formulation, absorption characteristics, gastric emptying rate, route of administration, metabolism and excretion kinetics in a given subject. Thus, the bioavailability of a compound can vary from individual to individual. Bioavailability can be evaluated using assays for measuring the levels of a given compound in the systemic circulation, particularly in blood, plasma, and / or urine.

[0147] Another important determinant of bioavailability is "bioaccessibility", which relates to the amount of food components, nutrients (e.g., polyphenols), etc. released from the food matrix into the gastrointestinal tract and absorbed through the gastrointestinal barrier. Bioaccessibility is related to the degree to which the food is chewed, whether the food is cooked or raw, gastric emptying time, gastrointestinal transit time, the amount of fiber or fat in the food, what is consumed with the food, cofactors required for absorption, the presence of specific microorganisms, and the complexity of the food matrix structure.

[0148] Biologically available compounds may not be bioactive just because they are absorbed. For example, some nutrients are not directly active and require metabolism to bioactive metabolites. Additionally, some polyphenols are high molecular weight compounds that are mainly bound to dietary fibers or proteins that remain insoluble in normal solvents and require an additional step of hydrolysis during extraction to make them soluble and biologically available.

[0149] Phenolic compounds can have varying degrees of bioavailability, depending, inter alia, on their structure, food processing, matrix properties, and the host. For example, the bioavailability of phenols varies widely, from an estimated 0.3% for anthocyanins to 43% in the case of isoflavones.

[0150] Hydrolyzable tannins and proanthocyanidins are polyphenols that are highly extractable from foods and thus have bioavailability to the host. The bioactivity of tannins is thought to depend on the degree of polymerization and solubility in the gastrointestinal tract. For example, highly polymerized tannins have low bioaccessibility in the small intestine and are not readily fermented by the colonic microbiota. A slow fermentation rate results in a decrease in the bioavailability of downstream metabolites, such as urolithin. In some embodiments, the present disclosure describes compositions that are administered to alter or increase the bioavailability of urolithin in the gastrointestinal tract.

[0151] In some embodiments, the method is a method of increasing the bioavailability of an ellagitannin composition in a subject. In some embodiments, the method includes determining the level of ellagitannin bioavailability of the ellagitannin composition in the subject's gastrointestinal tract. In some embodiments, the method includes comparing the level of ellagitannin bioavailability of the ellagitannin composition in the subject's gastrointestinal tract to a reference level. In some embodiments, the reference level is a past reference level of ellagitannin bioavailability, the level of ellagitannin bioavailability in the subject's gastrointestinal tract prior to receiving the combination, or the level of ellagitannin bioavailability in the gastrointestinal tract of an equivalent subject who has not received the combination.

[0152] In some embodiments, the method includes determining the level of urolithin produced in the subject's plasma. In some embodiments, the method includes comparing the level of urolithin in the subject's plasma to a reference level. In some embodiments, the reference level is the concentration of urolithin in plasma, e.g., 0.2 - 20 μM (Espin JC, Larrosa M, Garcia-Conesa MT, Tomas-Barberan F. Biological significance of urolithins, the gut microbial ellagic Acid-derived metabolites: the evidence so far. Evid Based Complement Alternat Med. 2013;2013:270418. doi:10.1155 / 2013 / 270418, which is incorporated herein by reference). In some embodiments, the reference level is a plasma urolithin concentration of at least 0.1 μM, at least 0.2 μM, at least 0.5 μM, at least 1 μM, at least 5 μM, at least 10 μM, or at least 15 μM. In some embodiments, the reference level is a plasma urolithin concentration of at least 0.5 μM, up to 1 μM, up to 5 μM, up to 10 μM, up to 15 μM, up to 20 μM, or up to 25 μM.

[0153] In some embodiments, the reference level is the past reference level of urolithin, whether in the gastrointestinal tract or in plasma, the level of urolithin in the gastrointestinal tract of the subject before receiving the combination, or the level of urolithin in the gastrointestinal tract of an equivalent subject not receiving the combination.

[0154] The concentration of urolithin A can reach micromolar (μM) levels in plasma without an apparent toxic effect in vivo. For example, upon consumption of pomegranate juice by humans, the peak plasma level of UA can reach 40 - 14 μM, but there can be wide inter - individual variability (see, e.g., Cerda et al., Eur. J. Nut. 43:205 - 220, which is incorporated herein by reference). The large inter - individual variability may be due to differences in the microbiota. Selma et al. identified single - culture bacteria (Gordonibacter urolithinfaciens and Gordonibacter pamelaeae DSM 19378T) that metabolize ellagic acid to produce urolithin M - 5, urolithin M - 6, and urolithin C, which are urolithins. However, these cultured bacteria were unable to produce the downstream products urolithin A and urolithin B (see Selma et al., Food & Nut. 5:1779 - 1784 (2014), which is incorporated herein by reference).

[0155] Therapeutic methods The present disclosure recognizes that the compositions described herein may be useful for treating a subject. The methods provided by the present disclosure include methods for treating certain diseases, disorders, and conditions. In some embodiments, the related diseases, disorders, and conditions can be or include diseases and conditions of the liver or disorders associated with mitochondrial dysfunction.

[0156] In general, the treatment methods provided by the present disclosure involve administering a therapeutically effective amount of probiotics alone or in combination with the ellagitannin compositions described herein to a subject in need of or determined to be in need of such treatment.

[0157] In some embodiments, the treatment methods provided herein are therapeutic and can be administered to a subject, for example, after the onset of a major symptom of a disease or disorder associated with mitochondrial dysfunction.

[0158] In some embodiments, the treatment methods provided are administered to a subject that is a mammal, for example, a mammal experiencing a disease, disorder, or condition described herein, and in some embodiments, the subject is a human or non-human veterinary subject, such as a primate, canine, feline, simian, or porcine.

[0159] In many embodiments, "treatment" includes improving at least one symptom of a disease, disorder, or condition associated with a disease or disorder associated with mitochondrial dysfunction. In some embodiments, the treatment method can be prophylactic.

[0160] In some embodiments, the method can include administering a therapeutically effective amount of probiotics and / or an ellagitannin composition before, during (e.g., concurrently), or after administration of a therapeutic agent expected to be associated with a liver disease or related disorder or mitochondrial dysfunction.

[0161] In some embodiments, the compositions described herein can be administered in a form that includes one or more pharmaceutically acceptable carriers. Suitable carriers have been described previously and vary depending on the desired form and mode of administration of the composition. For example, pharmaceutically acceptable carriers can include diluents or excipients such as fillers, binders, wetting agents, disintegrants, surfactants, glidants, and lubricants. Typically, the carrier can be a solid (including powders), a liquid, or any combination thereof. Each carrier is preferably "acceptable" in the sense that it is compatible with the other components in the composition and not harmful to the subject. The carrier can be biologically acceptable and inert (e.g., enabling the viability of biological materials to be maintained until the composition is delivered to the appropriate site).

[0162] The oral composition may contain an inert diluent or an edible carrier. For the purpose of oral therapeutic administration, the active compound can be combined with an excipient and used in the form of tablets, lozenges, incense tablets, troches, or capsules, such as gelatin capsules. The oral composition can also be prepared by combining the composition of the present disclosure with food. In some embodiments, the microorganism can be incorporated into food. Some non-limiting examples of foods used in the methods and compositions described herein include ice candy, cheese, cream, chocolate, milk, meat, beverages, pickles, kefir, miso, sour workout, and the like. In other embodiments, the food is fruit juice, soft drink, tea beverage, drink preparation, jelly drink, functional drink; alcoholic beverage such as beer; carbohydrate-containing foods such as rice foods, noodles, bread, pasta; paste products such as fish, ham, sausage, paste products of seafood; retort pouch products such as curry, foods with a thick starch sauce, Chinese soup; soup; dairy products such as milk, milk drink, ice cream, yogurt; fermented products such as fermented soybean paste, fermented beverage, pickles; soybean products; various confectionery products including biscuits, cookies, etc., candies, chewing gum, gummies, jelly, jelly, cream caramel, frozen desserts; instant foods such as instant soup and instant soybean soup, etc. In order not to kill the microorganism, it is preferable that the food preparation does not require cooking after being mixed with the microorganism strain.

[0163] In one embodiment, the food used for administration is cooled, for example, frozen flavored water. In certain embodiments, the food is not a potentially allergenic food (e.g., not soy, wheat, peanuts, nuts, dairy products, eggs, crustaceans or fish). Pharmaceutically compatible binders and / or adjuvant materials can be included as part of the composition. Tablets, pills, capsules, lozenges, etc. can contain any of the following ingredients, or compounds of similar nature: binders such as microcrystalline cellulose, tragacanth gum or gelatin; excipients such as starch or lactose, disintegrants such as alginic acid, primogel, or corn starch; lubricants such as magnesium stearate and steroids; glidants such as colloidal silicon dioxide; sweeteners such as sucrose or saccharin; or flavoring agents such as peppermint, methyl salicylate, orange flavor, or other suitable flavors. These are for illustrative purposes only and are not intended to be limiting.

[0164] In related embodiments, the compositions described herein are contemplated to include one or more of the microorganisms described herein in combination with viable lactic acid bacteria combined with any material to be absorbed, including but not limited to nutrient supplements, foods, vitamins, minerals, pharmaceuticals, therapeutic compositions, antibiotics, hormones, steroids, etc. and similar compounds, where it is desirable to ensure efficient and healthy absorption of the material from the gastrointestinal tract into the blood. The compositions should not be considered limiting as the amount of material included in the composition can vary widely depending on the material and its intended purpose of absorption.

[0165] Pharmaceutical composition Compositions are provided herein that include a probiotic microorganism or a combination of a probiotic microorganism and an ellagitannin composition. In some embodiments, such compositions are used to treat liver diseases or disorders associated with mitochondrial dysfunction in a subject. In some embodiments, the compositions for use according to the present disclosure are, for example, pharmaceutical compositions for administration (e.g., oral administration) to a mammal (e.g., a human). The pharmaceutical composition typically may include an active agent (e.g., an individual microbial strain or a combination of a microbial strain and an ellagitannin composition), and a pharmaceutically acceptable carrier. Specific exemplary pharmaceutically acceptable carriers include, for example, saline, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic agents, and absorption delaying agents, etc., which are compatible with pharmaceutical administration.

[0166] In some embodiments, the pharmaceutical composition for use according to the present disclosure may include one or more supplementary active compounds and / or may be administered in combination therewith. In certain embodiments, such supplementary active compounds include ginger, curcumin, probiotics (e.g., one or more probiotic strains of the following genera, Lactobacillus, Bifidobacterium, Saccharomyces, Enterococcus, Streptococcus, Pediococcus, Leuconostoc, Bacillus, and / or Escherichia coli (see Fijan, Int J Environ Res Public Health. 2014 May;11(5):4745 - 4767, which is incorporated herein by reference)), prebiotics (non - digestible food components that support the growth of probiotic microorganisms, such as fructans like fructooligosaccharides (FOS) and inulin, galactans like galactooligosaccharides (GOS), dietary fibers such as resistant starch, pectin, beta - glucan, and xylooligosaccharides (see Hutkins et al., Curr Opin Biotechnol. 2016 Feb;37:1 - 7)), and combinations thereof.

[0167] Pharmaceutical compositions are usually formulated to be compatible with their intended route of administration. Examples of routes of administration include oral administration. Methods of formulating suitable pharmaceutical compositions have been reported, see, for example, Remington: The Science and Practice of Pharmacy, 21st ed., 2005, and the books in the Drugs and the Pharmaceutical Sciences: a Series of Textbooks and Monographs (Dekker, NY) series. Oral compositions generally include an inert diluent or an edible carrier. By way of just a few examples, in some embodiments, oral formulations can be or can include syrups, liquids, tablets, troches, gums, capsules, such as gelatin capsules, powders, gels, films, etc.

[0168] In some embodiments, pharmaceutically compatible binders and / or adjuvant materials can be included as part of the pharmaceutical composition. In some specific embodiments, the pharmaceutical composition can include, for example, any one or more of the following inert ingredients, or compounds of similar nature: binders such as microcrystalline cellulose, tragacanth gum or gelatin; excipients such as starch or lactose, disintegrants such as alginic acid, Primogel, or corn starch; lubricants such as magnesium stearate or Sterotes; glidants such as colloidal silicon dioxide; sweeteners such as sucrose or saccharin; or flavoring agents such as peppermint, methyl salicylate, orange flavor. In some embodiments, the composition can be ingested as is, sprinkled on food or a liquid (such as water), or mixed. In some embodiments, the compositions described herein that can be administered to mammals can be or can include ingestible articles (such as foods or beverages) that contain (e.g., added) mammalian microbiota, extracts thereof, and / or individual microbial strains or combinations of microbial strains from its components.

[0169] In some embodiments, the food can be or can include one or more of bars, candies, baked goods, cereals, salty snacks, pasta, chocolate, and other solid foods, as well as liquid or semi-solid foods including yogurt, soups and stews, and beverages such as smoothies, shakes, fruit juices, and other carbonated or non-carbonated drinks. In some embodiments, the food is prepared by mixing mammalian microbiota, extracts thereof, and / or individual microbial strains or combinations of microbial strains from their components, by a subject.

[0170] The composition can be included in a kit, container, pack, or dispenser, together with instructions for administration or use by the methods described herein.

[0171] One of ordinary skill in the art reading the present disclosure will understand that in some embodiments, the compositions (e.g., pharmaceutical compositions) described herein can be or can include one or more cells, tissues, or organisms (e.g., plants or microbial cells, tissues, or organisms) that produce (e.g., have produced and / or are producing) the relevant compounds.

[0172] In some embodiments, individual microbial strains or combinations of microbial strains from killed (e.g., heat-killed) mammalian microbiota. Alternatively, in some embodiments, individual microbial strains or combinations of microbial strains from mammalian microbiota can include viable or living cells.

[0173] In some embodiments, the methods of treatment described herein include administering viable or living individual microbial strains or combinations of microbial strains from mammalian microbiota. In some such embodiments, the viable or living individual microbial strains or combinations of microbial strains from mammalian microbiota are administered according to a regimen that achieves a population of the subject's microbiota with the administered cells.

[0174] In some embodiments, the viable or living individual microbial strains or combinations of microbial strains from the mammalian microbiota described herein are formulated through the inclusion of and / or use of one or more cell cultures and / or their supernatants or pellets, and / or powders formed therefrom.

[0175] In some embodiments, the pharmaceutical compositions provided herein promote the colony formation of individual microbial strains or combinations of microbial strains from the mammalian microbiota, particularly those identified, characterized, or evaluated to reduce the severity or incidence of a mammalian disease or condition in a mammalian subject suffering from or at risk of a mammalian disease or condition. In some embodiments, the pharmaceutical compositions provided herein can attenuate the colony formation of microbial strain(s) identified, characterized, or evaluated to increase the severity or incidence of a mammalian disease or condition in a mammalian subject suffering from or at risk of a mammalian disease or condition. In some embodiments, the pharmaceutical compositions provided herein promote the colony formation of microbial strain(s) identified, characterized, or evaluated to overcome one or more microbial strains identified, characterized, or evaluated to have no effect on the severity or incidence of a mammalian disease or condition but to increase the severity or incidence of a disease or condition in a mammalian subject suffering from or at risk thereof.

[0176] In some embodiments, the pharmaceutical composition is tailored to a particular mammal (e.g., a particular human subject) based on the mammal's (e.g., human's) microbiota. In some embodiments, the pharmaceutical composition is specific to the microbiota of a mammalian subject (e.g., a human). In some embodiments, the pharmaceutical composition is specific to the microbiota of a population of mammals (e.g., humans). The population of mammals can include, but is not limited to, mammals in a family, mammals in the same geographical location (e.g., neighborhood, city, state, or country), mammals with the same disease or condition, mammals of a particular age or age range, or mammals that consume a particular diet (e.g., food, food source, or calorie intake).

[0177] Treatment of disorders associated with mitochondrial dysfunction Mitochondrial dysfunction is the inability of mitochondria to perform processes associated with normal function, and as a result, problems such as electron transport and ATP synthesis, lack of essential substrates, or a decrease in the number of mitochondria within a cell may occur. Some mitochondrial diseases are associated with mitochondrial dysfunction, such as mitochondrial myopathy, diabetes and deafness (DAD), Leber's hereditary optic neuropathy, Leigh syndrome, myoneurogenic gastrointestinal encephalopathy, myoclonic epilepsy with ragged red fibers, mitochondrial DNA depletion syndrome, Alzheimer's dementia, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis (ALS), mental retardation, deafness and blindness, diabetes, obesity, cardiovascular disease, stroke, autoimmune disease, multiple sclerosis, Sjogren's syndrome, lupus, or rheumatoid arthritis.

[0178] Mitophagy is an autophagy process that specifically targets dysfunctional or malfunctioning mitochondria and is important for maintaining mitochondrial homeostasis. Nutrient levels and nutritional stress factors can lead to changes in mitochondrial metabolic turnover related to mitophagy and potentially affect overall mitochondrial function. Urolithin A induces mitophagy in muscle and intestinal tissues while promoting mitochondrial biogenesis, leading to improved mitochondrial function. In some embodiments, the present disclosure describes methods of treating mitochondrial disorders and compositions designed for the treatment of mitochondrial disorders.

[0179] Many human diseases are known to be associated with dysfunctional mitochondria, including but not limited to various cancers, neurodegenerative diseases, and metabolic disorders. In some embodiments, the present disclosure can bring about changes in mitochondrial function to improve overall health. For example, in certain embodiments, the present disclosure describes the improvement of mitochondrial function by increasing the bioavailability of various nutrients including but not limited to ellagitannins and their related metabolites.

[0180] Treatment of polyglutamine (polyQ) diseases Elongated polyglutamine (polyQ) proteins can aggregate intracellularly in age-related neurodegenerative diseases such as, for example, Huntington's disease. Generally, polyQ diseases are characterized by a genetic mutation of cytosine-adenine-guanine trinucleotide repeat expansions. The mutation leads to an expanded repeat element of the protein that causes the polyQ expansion. These diseases are characterized by cognitive impairment due to the progressive loss of nerve function. The exact details of the mechanism underlying the toxicity of the expanded polyQ are not fully understood. A prominent phenotype is the aggregation of the expanded polyQ protein. Various cellular pathways such as the lysosomal degradation pathway, autophagy, and proteasomal degradation are known to promote the clearance of polyQ proteins. In some embodiments, the present disclosure describes the discovery of our product formulations (fig extract and L. plantarum MBT501) that reduce polyQ aggregates in transgenic worms expressing the polyQ repeat.

[0181] The methods provided herein can include administering to a subject an ellagitannin composition, an enzyme composition comprising one or more ellagitannin enzymes, or a combination disclosed herein, such that the subject receives the combination disclosed herein. In some embodiments, the method is a method of reducing the formation of polypeptide aggregates in a cell or tissue. In some embodiments, the method is a method of reducing the amount of polypeptide aggregates in a cell or tissue. In some embodiments, the polypeptide aggregate is an aggregate of a polypeptide comprising a polyQ region (i.e., a polyQ aggregate). In some embodiments, the polyQ region comprises at least 10, at least 20, at least 30, at least 40, or at least 50 glutamines. In some embodiments, the cell is a neuron or comprises a neuron. In some embodiments, the cell is or comprises a central nervous system tissue.

[0182] In some embodiments, the method comprises determining the level of polypeptide aggregate formation in a cell or tissue. In some embodiments, the method comprises determining the level of polypeptide aggregate formation in a cell or tissue. In some embodiments, the method comprises comparing the level of polypeptide aggregate formation in a cell or tissue to a reference level of polypeptide aggregate formation in the cell or tissue. In some embodiments, the reference level is determined in a cell or tissue of a subject not administered an ellagitannin composition, an enzyme composition comprising one or more ellagitannin enzymes, or a combination disclosed herein. In some embodiments, the method comprises determining the level of polypeptide aggregate formation in a cell or tissue prior to administration. In some embodiments, the method comprises determining the level of polypeptide aggregate formation in a cell or tissue after administration. In some embodiments, the method comprises comparing the level of polypeptide aggregate formation in a cell or tissue determined prior to administration to the level of polypeptide aggregate formation in a cell or tissue determined after administration.

[0183] In some embodiments, the method comprises determining the level of polypeptide aggregates in a cell or tissue. In some embodiments, the method comprises determining the level of polypeptide aggregates in a cell or tissue. In some embodiments, the method comprises comparing the level of polypeptide aggregates in a cell or tissue to a reference level of polypeptide aggregates in the cell or tissue. In some embodiments, the reference level is determined in a cell or tissue of a subject not administered an ellagitannin composition, an enzyme composition comprising one or more ellagitannin enzymes, or a combination disclosed herein. In some embodiments, the method comprises determining the level of polypeptide aggregates in a cell or tissue prior to administration. In some embodiments, the method comprises determining the level of polypeptide aggregates in a cell or tissue after administration. In some embodiments, the method comprises comparing the level of polypeptide aggregates in a cell or tissue determined prior to administration to the level of polypeptide aggregates in the cell or tissue determined after administration.

[0184] Treatment of liver diseases Antioxidant therapy is considered beneficial for use in the treatment of various diseases, including liver diseases. The levels of antioxidant compounds in the body can be affected by the Nrf2 protein, which has been shown to play a role in liver diseases such as non-alcoholic steatohepatitis, acute hepatotoxicity, non-alcoholic fatty liver disease, alcoholic liver disease, viral hepatitis, liver fibrosis, liver IRI, and some liver cancers. Low levels of Nrf2 expression have been reported to be associated with a decrease in intracellular antioxidant activity. Administration of ellagitannin can have a positive effect on liver health, for example, by reducing oxidative damage by protecting hepatocytes from ethanol-induced cell damage through an increase in Nrf2 expression to reduce oxidative stress. In some embodiments, the present disclosure describes methods of treating various liver diseases by administration of ellagitannin and / or probiotic compositions alone or in combination. In some embodiments, the treatment increases the expression of Nrf2 in hepatocytes, promotes antioxidant activity in the cells, thereby promoting liver health or function.

[0185] Nuclear factor (erythroid-derived 2)-like 2 (NRF2) is a transcription factor that regulates the expression of antioxidant proteins that protect against oxidative damage caused by injury or inflammation. When cells are not in a stressed state, NRF2 is retained in the cytoplasm by the cytoplasmic inhibitor KEAP (kelch-like ECH-associated protein 1) and rapidly degraded. However, when cells are under oxidative stress, NRF2 is not degraded and localizes to the nucleus to induce the expression of antioxidant gene products. Nuclear localization of NRF2 can be used as an indirect measure of NRF2 activity. However, as reported, an easier way to determine NRF2 activity is to evaluate the expression levels of genes that are positively regulated by NRF2. Such genes include, but are not limited to, NAD(P)H quinone oxidoreductase 1 (Nqo1), glutamate cysteine ligase, sulfiredoxin 1 (SRXN1), thioredoxin reductase 1 (TXNRD1), heme oxygenase-1 (HMOX1, HO01), glutathione S-transferase (GST), UDP-glucuronosyltransferase (UGT), and multidrug resistance-associated protein (Mrps).

[0186] The present disclosure provides a method comprising administering to a subject an ellagitannin composition, an enzyme composition comprising one or more ellagitannin enzymes, or a combination disclosed herein, such that the subject receives the combination disclosed herein. In some embodiments, the method is a method of altering the expression level or activity level of Nrf2 in a cell or tissue of the subject. In some embodiments, the method is a method of increasing the expression level or activity level of Nrf2 in a cell or tissue of the subject.

[0187] In some embodiments, the method includes determining the expression level or activity level of nuclear respiratory factor-2 (Nrf2) in a target cell or tissue. In some embodiments, the method includes comparing the expression level or activity level of Nrf2 in the cell or tissue to a reference level. In some embodiments, the reference level is the past expression or activity level of Nrf2, the expression level or activity level of nuclear respiratory factor-2 (Nrf2) in equivalent cells or tissues of the target prior to receiving the combination, or the expression level or activity level of nuclear respiratory factor-2 (Nrf2) in equivalent cells or tissues of an equivalent target that has not received the combination. In some embodiments, the method includes determining the expression level or activity level of a gene regulated by Nrf2 expression in a target cell or tissue.

[0188] Antioxidant compounds in the body can protect organisms from reaction processes involving reactive oxygen and reactive nitrogen species (ROS, RNS). These compounds can protect the human body from oxidative stress associated with human diseases including, but not limited to, atherosclerosis, diabetes, chronic inflammation, neurodegenerative disorders, and certain cancers. In some embodiments, the present disclosure describes compositions and methods of administration for altering antioxidant levels in the body. In some embodiments, the method includes determining the level of one or more antioxidants in a target cell or tissue. In some embodiments, the target cell or tissue includes hepatocytes or liver tissue. In some embodiments, the method includes measuring an indicator of liver health or function in a target.

[0189] Method for extending shelf life Storage methods for improving the shelf life of prebiotics and / or probiotics vary depending on the organisms involved. In many cases, probiotic formulations, including dairy products, can be difficult to store stably and still taste good. In some embodiments, the present disclosure describes a method for extending the shelf life of a probiotic composition through the use of one or more fruit extracts. In some embodiments, a method for extending the viable shelf life of a probiotic product containing the EES microorganisms described herein includes adding the ellagitannin composition described herein to the probiotic product, wherein the EES microorganisms express one or more of the ellagitannin enzymes described herein.

Example

[0190] The following examples are provided to illustrate to those skilled in the art how to make and use the methods and compositions described herein and are not intended to limit the scope of the present disclosure.

[0191] Example 1 In this example, the identification of bacteria, Lactobacillus planetarium, that induce the expression of gst-4 in the C.elegans transcriptional fusion reporter CL2166 dvIs19[pAF15(gst-4::gfp-nls)]III using qualitative visual screening is demonstrated. gst-4 encodes glutathione-S-transferase (GST), an antioxidant gene regulated by skn-1, a homolog of the transcription factor Nrf2, and plays an important role in the human antioxidant pathway. The transcription factor skn-1 has been reported in the regulation of various antioxidant genes, including the antioxidant gene gst-4. 1,2 3

[0192] The transgenic strain CL2166 that expresses GFP only in subcutaneous cells was used when given only E. coli OP50 and pear-shaped fruit extract. Since E. coli OP50 is a standard microbial strain in which Caenorhabditis elegans normally grows in the laboratory, it was used as a control. Only the bacterium L. plantarum induced some expression in the intestine of the worm. Treatment with L. plantarum and pear-shaped fruit extract in the transgenic strain CL2166 expressing GFP induced GFP expression in the intestine and the whole body of the worm (Figure 1).

[0193] Example 2 It was tested to determine whether the genes encoding the enzymes tannase (tanB), gallic acid decarboxylase (lpdB), and gallic acid decarboxylase (lpdC) are involved in ellagitannin metabolism. 4,5 L. plantarum has decarboxylase enzymes involved in the degradation of polyphenol compounds such as pear-shaped fruit extract, berry extract, and walnut extract. 6,7 (Figure 2a). The effect of pear-shaped fruit extract or polyphenol compounds on the expression of the genes encoding the enzymes tannase (tanB), gallic acid decarboxylase (lpdB), and gallic acid decarboxylase (lpdC) was observed by qPCR. Treatment with the prebiotic pear-shaped fruit extract significantly induced the expression of tannase (tanB), gallic acid decarboxylase (lpdB), and gallic acid decarboxylase (lpdC) (more than 3-fold) (Figure 2b).

[0194] Example 3 In this method, the prebiotic pear-shaped fruit extract was tested to determine whether it is useful for maintaining L. plantarum, for example, whether it can extend the storage life of the bacteria. To maintain the number of the bacterium L. plantarum in a beneficial way, it was found that the pear-shaped fruit extract extended the storage life of L. plantarum. L. plantarum treated with the pear-shaped fruit extract showed the same number (10 billion CFU) for 4 weeks. In contrast, bacteria alone showed slightly more than half of the initial count (Figures 3a and b).

[0195] Example 4 Using the human hepatocyte cell line (HepG), the Nrf2-luciferase reporter gene was stably expressed to observe the induction of Nrf2. This cell line showed an increase in luciferase activity in response to the treatment of L. plantarum with pear fruit extract. The luciferase activity increased three-fold within 24 hours after treatment compared to bacteria and pear fruit extract alone (Figure 4a).

[0196] Also, Nrf2 induction was confirmed by Western blot analysis of cell lysates. In whole cell extracts, an increase in Nrf2 protein expression by treating L. plantarum with pear fruit was demonstrated. Since there was no change in actin expression, this increase was specific to Nrf2. In contrast, there was no change in Nrf2 expression in cell lysates prepared with L. plantarum and pear fruit extract alone (Figure 4b).

[0197] Example 5 This example demonstrates that the combination of the bacterium L. plantarium MBT501 and pear-shaped fruit extract reduces polyQ aggregates of C. elegans rmls133 (unc_54p::Q40::YFP) using qualitative visual screening. Young adult worms have been shown to form aggregates of up to 140 PolyQ40 repeats, which correlates directly with observations of human disease. Such aggregates can contribute to cytotoxicity and neurodegenerative diseases (Morley JF, Brignull HR, Weyers JJ, Morimoto RI. The thresholds of polyglutamine-expanded protein aggregation and cytotoxicity are dynamic and influenced by aging in Caenorhabditis elegans. Proc Natl Acad Sci USA. 2002 Aug 6;99(16):10417-22. doi:10.1073 / pnas.152161099. Epub 2002 Jul 16. PMID:12122205, PMCID:PMC124929; Kailiang Jia, Anne C. Hart & Beth Levine (2007) Autophagy Genes Protect Against Disease Caused by Polyglutamine Expansion Proteins in Caenorhabditis elegans, Autophagy, 3:1, 21-25, DOI:10.4161 / auto.3528, Kokona B, May CA, Cunningham NR, et al. Studying polyglutamine aggregation in Caenorhabditis elegans using an analytical ultracentrifuge equipped with fluorescence detection. Protein Sci. 2016;25(3):605-617, doi:10.1002 / pro.2854. Each is incorporated herein by reference).

[0198] The PolyQ40 repeat fused with YFP was expressed in the cytoplasm of the body wall muscle of the worm (transgenic strain unc_54p::Q40::YFP). The worms were fed (1) E. coli OP50, apple extract, (2) L. plantarum (MBT501), or (3) L. plantarum (MBT501) and apple extract. E. coli OP50 was used as a control because it is the standard microbial strain in which C. elegans normally grows in the laboratory. As shown, the formation of PolyQ40 aggregates was alleviated to some extent by the bacterium L. plantarum alone. Treatment with L. plantarum and apple extract was shown to reduce the expression of PolyQ40 aggregates (Figure 5).

[0199] Other embodiments It should be understood by those skilled in the art that various changes, modifications, and improvements to the present disclosure can be readily made by those skilled in the art. Such changes, modifications, and improvements are intended to be part of the present disclosure and are intended to be within the spirit and scope of the present invention. Accordingly, the foregoing description and drawings are by way of example only and are any invention described in the present disclosure when more particularly described by the following claims.

[0200] Those skilled in the art will understand the typical criteria for deviations or errors resulting from the values obtained in the assays or other processes described herein. Publications, websites, and other references cited herein to explain the background of the invention and to provide additional details regarding its implementation are hereby incorporated by reference in their entirety.

[0201] Embodiments of the present invention have been described in conjunction with its detailed description, but it should be understood that the foregoing description is intended to illustrate and not limit the scope of the present invention as defined by the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

1. 1. A pharmaceutical composition for treating liver disease, comprising a plant extract of pomegranate, administered in combination with an enzyme composition containing an ellagitannin enzyme-synthesizing (EES) microorganism or an extract thereof; wherein the EES microorganism is Lactobacillus plantarum and the enzyme composition comprises one or more ellagitannin enzymes.

2. 1. A pharmaceutical composition for treating liver disease, comprising an ellagitannin enzyme synthesizing (EES) microorganism or an extract thereof, wherein the EES microorganism is Lactobacillus plantarum and the composition comprises one or more ellagitannin enzymes; A pharmaceutical composition administered in combination with a composition comprising a plant extract of pomegranate.

3. 3. The pharmaceutical composition according to claim 1 or 2, comprising a plant extract of pomegranate and an ellagitannin enzyme synthesizing (EES) microorganism or an extract thereof.

4. 4. The pharmaceutical composition of claim 1, wherein the one or more ellagitannin enzymes comprise one or more enzymes selected from the group consisting of tannin acyl hydrolase enzymes, gallic acid decarboxylase enzymes, and combinations thereof.

5. 5. The pharmaceutical composition of claim 1, wherein the one or more ellagitannin enzymes comprises a tannin acyl hydrolase enzyme.

6. 6. The pharmaceutical composition of claim 5, wherein the tannin acyl hydrolase enzyme is a tanB tannase enzyme.

7. 7. The pharmaceutical composition of claim 1, wherein the one or more ellagitannin enzymes comprises a gallic acid decarboxylase enzyme.

8. 8. The pharmaceutical composition of claim 7, wherein the gallate decarboxylase enzyme is an lpdB gallate decarboxylase enzyme.

9. 8. The pharmaceutical composition of claim 7, wherein the gallate decarboxylase enzyme is an lpdC gallate decarboxylase enzyme.

10. 10. The pharmaceutical composition of claim 1, wherein the one or more ellagitannin enzymes comprise an lpdB gallate decarboxylase enzyme and an lpdC gallate decarboxylase enzyme.

11. 11. The pharmaceutical composition of any one of claims 1 to 10, wherein the one or more ellagitannin enzymes comprise a tanB tannase enzyme, an lpdB gallate decarboxylase enzyme, and an lpdC gallate decarboxylase enzyme.

12. 12. The pharmaceutical composition of claim 1, wherein the EES microorganism is found in nature.

13. 13. The pharmaceutical composition of any one of claims 1 to 12, wherein the EES microorganism is viable or living.

14. 14. The pharmaceutical composition of any one of claims 1 to 13, wherein the EES microorganism is lyophilized.

15. 15. The pharmaceutical composition of claim 1, further comprising a prebiotic.

16. 16. The pharmaceutical composition of claim 15, wherein the prebiotic is a fructooligosaccharide, inulin, isomaltooligosaccharide, lactylol, lactosucrose, lactulose, soybean oligosaccharide, transgalactooligosaccharide, xylooligosaccharide, or a combination thereof.

17. 17. The pharmaceutical composition of claim 1, wherein the composition comprising the pomegranate plant extract, the enzyme composition, or both, are formulated for oral administration.

18. 18. The pharmaceutical composition of any one of claims 1 to 17, which is a food, beverage, feed composition, or dietary supplement.

19. 19. The pharmaceutical composition of any one of claims 1 to 18, which is a liquid, syrup, tablet, troche, gummy, capsule, powder, gel, or film.

20. 20. The pharmaceutical composition of any one of claims 1 to 19, further comprising a pharmaceutically acceptable carrier.

21. 21. The pharmaceutical composition of claim 20, which is an enteric coated formulation.

22. At least 10 5 22. The pharmaceutical composition of any one of claims 1 to 21, comprising CFU of an EES microorganism.

23. 23. The pharmaceutical composition of any one of claims 1 to 22, formulated for oral administration and being a dairy product.