Methods relating to pluripotent cells

By exposing somatic cells to stress to induce pluripotency without foreign factors, the method efficiently generates pluripotent cells that can differentiate into all three germ layers and form live embryos or chimeric mice, addressing the limitations of current cell production methods.

JP2025094131AInactive Publication Date: 2025-06-24VCELL THERAPEUTICS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025045517
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2014-08-28
Filing Date
2025-03-19
Publication Date
2025-06-24
Estimated Expiration
Not applicable · inactive patent

AI Technical Summary

Technical Problem

Current methods for obtaining pluripotent cells rely on tissues with limited availability or the addition of foreign reprogramming factors, which introduce complications, and there is no direct evidence of converting healthy adult somatic cells into pluripotent cells without specific manipulation.

Method used

A method to generate pluripotent cells, such as STAP cells, by exposing somatic cells to stress, which induces a dedifferentiation process without the need for foreign nucleic acids or reprogramming factors, involving stress treatments that reduce cytoplasm and mitochondria to trigger pluripotency.

Benefits of technology

The method enhances the efficiency, yield, and quality of pluripotent cell production, allowing for the generation of pluripotent cells that can differentiate into all three germ layers and form live embryos or chimeric mice.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025094131000001_ABST
    Figure 2025094131000001_ABST
Patent Text Reader

Abstract

To provide methods for generating pluripotent cells with improved efficiency, yield and / or quality.SOLUTION: The invention relates to the production or generation of pluripotent cells from a cell. The invention is based on the inventors' finding that stress can induce the production of pluripotent stem cells from a cell without the need to introduce an exogenous gene, a transcript, a protein, a nuclear component or cytoplasm to the cell, or without the need of cell fusion. In some embodiments, the stress induces a reduction in the amount of cytoplasm and / or mitochondria in the cell, triggers a dedifferentiation process and results in pluripotent cells.SELECTED DRAWING: Figure 5A
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] (Cross - reference to related applications) This application claims the benefit of U.S. Provisional Patent Application Nos. 61 / 955,362, filed on March 19, 2014; 61 / 955,358, filed on March 19, 2014; and 62 / 043,042, filed on August 28, 2014, under 35 U.S.C. § 119(e), the entire disclosures of which are incorporated herein by reference.

[0002] The technology described herein relates to the production of pluripotent cells.

Background Art

[0003] Currently used methods for obtaining pluripotent cells mainly rely on tissues with limited availability (e.g., embryonic tissues or umbilical cord blood) or the addition of reprogramming factors that introduce foreign nucleic acids (Hanna, J. et al., Cell 2008 133, 250 - 264; Hockemeyer, D. et al., Cell stem cell 2008 3,346 - 353; Kim, D. et al., Cell stem cell 2009 4, 472 - 476; Kim, J.B. Nature 2009 461, 649 - 643; Okabe, M. et al., Blood 2009 114, 1764 - 1767). If there were a method for easily producing stem cells, especially autologous stem cells, without complications caused by the addition of foreign reprogramming factors, it would be expected to accelerate the research on cell differentiation and the development of stem - cell - based therapies. When cells are damaged by exposure to stimuli such as burns, chemical injuries, trauma, and radiation, there is a hypothesis that normal somatic cells may change into cancer cells. However, there is no direct evidence showing that healthy adult somatic cells can be converted into other states without specifically manipulating reprogramming factors.

[0004] Previously, researchers have reported the discovery of "adult stem cells" in adult tissues (Reynolds, B.A. and Weiss, S. Science 1992 255, 1707-1710; Megeney, L.A. et al., Genes & development 1996 10, 1173-1183; Caplan, A.I. Journal of orthopaedic research 1991 9, 641-650; Lavker, R.M. and Sun, T.T. The Journal of investigative dermatology 1983 81, 121s-127s). There is still room for discussion in such reports. For example, there are researchers who are searching for cells that express the stem cell marker Oct4, and who have not yet found Oct4-expressing cells in adult bone marrow with normal homeostasis (Lengner, C.J. et al., Cell Cycle 2008 7, 725-728; Berg, J.S. and Goodell, M.A. Cel stem cell 2007 1, 359-360). On the other hand, there are also researchers who have reported that it is possible to isolate Oct4-expressing cells from various adult tissues (Jiang, Y. et al., Nature 2010 418, 41-49; D’Ippolito, G. et al., Journal of cell science 2004 117, 2971-2981; Johnson, J. et al., Cell 2005 122, 303-315; Kucia, M. et al., Leukemia 2006 20, 857-869; Kuroda, Y. et al., PNAS 2011 107, 8639-8643; Obokata, H. et al., Tissue engineering.2011 Part A 17,607-615; Rahnemai-Azar, A. et al., Cytotherapy 2011 13, 179-192; Huang, Y. et al., Transplantation 2010 89, 677-685; Zuba-Surma, E.K. et al., Journal of cellular and molecular medicine 2011 15, 1319-1328; Paczkowska, E. et al., Annals of transplantation 2011 16, 59-71). These cells have been hypothesized to be either a population of adult stem cells or simply an artifact of the technique used. In either case, such cells are rare and do not provide a sufficient source of pluripotent cells for research and therapy.

Summary of the Invention

[0005] Described herein are methods for generating pluripotent cells, such as STAP cells, that are improved to have enhanced efficiency, yield, and / or quality compared to the methods disclosed in International Publication No. 2013 / 163296 and Obokata et al., Nature 2014 505:641-647 (each incorporated herein by reference). Also described herein are methods and uses related to cells generated by the methods of the invention.

Brief Description of the Drawings

[0006]

Figure 1A

Figure 1B

Figure 1C

Figure 1D

Figure 2A

Figure 2B

Figure 3-1

Figure 3-2

Figure 4A

Figure 4B

Figure 5A

Figure 5B

Figure 5C

Figure 6

Figure 7A

Figure 7B

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12-1

Figure 12-2

Figure 12-3

Figure 13

Figure 14

Figure 15

Figure 16A

Figure 16B

Figure 16C

Figure 17

Figure 18A

Figure 18B

Figure 19

Figure 20

Figure 21

Figure 22

Figure 23

Figure 24-1

Figure 24-2

Figure 25

Figure 26

Figure 27

Figure 28

Figure 29

Mode for Carrying Out the Invention

[0007] (Detailed Description) Aspects of the technology described herein relate to the production or generation of pluripotent cells from cells. Aspects of the technology described herein are based on the inventors' discovery that stress can induce the production of pluripotent stem cells from cells without the need to introduce foreign genes, transcripts, proteins, nuclear components, or cytoplasm into the cells, nor the need for cell fusion. In some embodiments, stress induces a decrease in the amount of cytoplasm and / or mitochondria in the cells, triggering a dedifferentiation process that results in the generation of pluripotent cells. In some embodiments, stress causes disruption of the cell membrane, for example, in at least 10% of the cells exposed to stress. These pluripotent cells are characterized by one or more of the ability to differentiate into each of the three germ layers (in vitro and / or in vivo), the formation of teratoma-like cell masses in vivo, and the ability to generate live embryos and / or chimeric mice.

[0008] Described herein are experiments showing that treating cells with certain environmental stresses, including but not limited to stress that reduces the amount of cytoplasm and / or mitochondria in the cells, results in a decrease in mitochondrial activity, demethylation of genomic regions associated with dedifferentiation, and the cells can exhibit markers of known dedifferentiation pathways. Accordingly, in some embodiments, provided herein is a method of generating pluripotent cells from cells, the method comprising removing at least about 40% of the cytoplasm and / or mitochondria from the cells and selecting pluripotent cells or cells that exhibit pluripotent markers, wherein the cells are not present in a tissue. Also described herein are other stress treatments that can generate pluripotent cells from cells.

[0009] For the sake of convenience, the specific terms used in the specification, examples and appended claims of this application are summarized here. Unless otherwise specified or apparent from the context, the following terms and phrases include the meanings described below. Unless otherwise specified or not apparent from the context, the following terms and phrases do not exclude the meanings given in the relevant technical field. The definitions are described to assist in the explanation of specific embodiments and are not intended to limit the claimed invention, as the scope of the present invention is limited only by the claims. Unless otherwise specified, all technical and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the technical field to which the present invention pertains.

[0010] As used herein, the term "comprising" is used to refer to a composition, method, and each component (one or more) essential to that method or composition, and may include elements not specified, whether essential or not.

[0011] As used herein, the term "consisting essentially of" refers to the elements necessary for a given embodiment. This term allows for the presence of elements that do not substantially affect the novel or functional feature(s) (one or more) underlying that embodiment.

[0012] The term "consisting of" refers to the compositions, methods, and each component thereof described herein, and excludes any element not mentioned in the description of the embodiment.

[0013] As used in this specification and the appended claims, the singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "the method" includes one or more methods and / or steps of the kind described herein and / or apparent to one of ordinary skill in the art reading the present disclosure. The word "or" is also to be construed to include "and" unless the context clearly dictates otherwise. Suitable methods and materials are described below, but in practicing or testing the present disclosure, other methods and materials similar or equivalent to those described herein may be used. The abbreviation "e.g." is derived from the Latin "exempli gratia" and is used herein to indicate non-limiting examples. Thus, the abbreviation "e.g." is synonymous with the term "for example".

[0014] For the definitions of terms commonly used in cell biology and molecular biology, see "The Merck Manual of Diagnosis and Therapy", 19th Edition (ISBN 0-911910-19-0), Robert S. Porter et al. (eds.); published by Merck Research Laboratories in 2006; and The Encyclopedia of Molecular Biology (ISBN 0-632-02182-9) published by Blackwell Science in 1994. Definitions of terms commonly used in molecular biology can also be found in Benjamin Lewin, Genes X (ISBN-10: 0763766321) published by Jones & Bartlett Publishing in 2009; Molecular Biology and Biotechnology: a Comprehensive Desk Reference (ISBN 1-56081-569-8), Kendrew et al. (eds.), published by VCH Publishers in 1995; and Current Protocols in Protein Sciences 2009, Coligan et al. (eds.), Wiley Intersciences.

[0015] Unless otherwise specified, the present invention was carried out using standard methods described, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual (3rd ed.), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA (2001); Davis et al., Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA (1995); Current Protocols in Cell Biology (CPCB) (edited by Juan S. Bonifacino et al., John Wiley and Sons, Inc.) and Culture of Animal Cells: A Manual of Basic Technique by R. Ian Freshney, Publisher: Wiley-Liss; 5th ed. (2005), Animal Cell Culture Methods (Methods in Cell Biology, Vol. 57, edited by Jennie P. Mather and David Barnes, Academic Press, 1st ed., 1998) (all of which are incorporated herein by reference in their entirety).

[0016] The terms "decrease, reduce, reduced, and reduction" are generally used herein to mean a statistically significant decrease compared to a reference. However, to avoid ambiguity, "reduce, reduction, or decrease" typically means at least a 10% decrease compared to not performing a given process, for example, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99% decrease, and in addition, up to, for example, a complete absence of a given entity or parameter compared to not performing a given process or any decrease from 10 - 99% compared to not performing a given process.

[0017] The terms "increased, increase, or enhance" are generally used herein to mean a statically significant increase. To avoid ambiguity, the term "increased, increase, or enhance" means at least a 10% increase compared to a reference level, for example, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% increase or an increase up to 100% inclusive or any increase from 10 - 100% compared to a reference level or at least about 2 - fold, at least about 3 - fold, at least about 4 - fold, at least about 5 - fold, at least about 10 - fold increase or any increase from 2 - 10 - fold or more compared to a reference level.

[0018] As used herein, the terms "treat", "treatment", and "treating", when used in connection with a disease, disorder, or medical condition, refer to a therapeutic treatment of a condition, the purpose of which is to reverse, alleviate, improve, suppress, delay, or stop the progression or severity of the symptoms or condition. The term "treating" includes reducing or alleviating at least one adverse effect or symptom of a condition. Treatment is generally considered "effective" if one or more symptoms or clinical markers are reduced. Alternatively, treatment is considered "effective" if the progression of a condition is reduced or stopped. That is, "treatment" includes not only improvement of symptoms or markers, but also stopping or at least delaying the progression or worsening of symptoms that would be expected in the absence of treatment. Beneficial or desired clinical outcomes include, but are not limited to, alleviation of one or more symptoms, reduction in the degree of a disorder, stabilization of a health state (i.e., not getting worse), delay or decrease in the rate of disease progression, and improvement or remission of symptoms. Treatment may also include, among other things, the subject surviving when death is statistically predicted.

[0019] As used herein, the term "administer" refers to introducing into the body of a subject a pluripotent cell made according to the methods described herein and / or a progeny of such a pluripotent cell in which at least a portion thereof has differentiated, by a method or route that localizes at least a portion of the cell to a desired site. A pharmaceutical composition comprising a pluripotent cell made according to the methods described herein and / or a progeny of such a pluripotent cell in which at least a portion thereof has differentiated can be administered by any suitable route that provides an effective treatment to the subject.

[0020] As used herein, "subject" means a human or an animal. Usually, an animal refers to a vertebrate such as a primate, a rodent, a domestic animal or a game animal. Examples of primates include chimpanzees, cynomolgus monkeys, rhesus monkeys and macaques, such as Japanese macaques. Examples of rodents include mice, rats, woodchucks, ferrets, rabbits and hamsters. Examples of domestic animals and game animals include cows, horses, pigs, deer, bison, guinea pigs, cats, such as domestic cats, dogs, such as dogs, foxes, wolves, birds, such as chickens, emus, ostriches and fish, such as salmon, catfish and trout. Patients or subjects include any combination of the above animals, for example, all of the above animals. In certain embodiments, the subject is a mammal, such as a primate, such as a human.

[0021] Preferably, the subject is a mammal. The mammal can be, but is not limited to, a human, non-human primate, mouse, rat, dog, cat, horse or cow. Non-human mammals can be advantageously used as subjects for animal models of diseases due to a defect, dysfunction and / or decline of a given cell or tissue or a defect, dysfunction or decline of the stem cell compartment. Further, the methods described herein can be used for the treatment of livestock and / or pets. The subject can be male or female. The subject has or is pre-diagnosed or confirmed to have one or more diseases or conditions due to a defect, dysfunction and / or decline of a cell type, tissue or stem cell compartment or such a condition, and optionally, but not necessarily, is a subject who has already been treated for such a condition. Alternatively, the subject can be a subject who has not been previously diagnosed as having such a condition. For example, the subject can be a subject showing one or more risk factors for such a condition or a subject not showing a risk factor for such a condition.

[0022] As used herein, the term "select" when used with respect to a cell or cell population refers to selecting, separating, isolating and / or selectively expanding one or more cells having a desired characteristic. The term "select" as used herein does not necessarily mean that cells without the desired characteristic cannot propagate under the given conditions.

[0023] As used herein, "maintain" refers to sustaining the viability of a cell or cell population. The maintained population contains a large number of metabolically active cells. The number of such cells can be generally stable for at least one day or can increase.

[0024] As used herein, "detectable level" refers to a level of a substance or activity in a sample that enables a quantity distinguishable from a reference level, e.g., the level of the substance or activity of cells not exposed to stress. In some embodiments, the detectable level can be at least 10% higher than the reference level, e.g., 10%, 20%, 50%, 100%, 200% or 300% or more higher than the reference level.

[0025] The terms "statistically significant" or "significantly" refer to statistical significance and generally mean a difference of two standard deviations (2SD) above and below the concentration or amount of a reference, e.g., a marker, e.g., a stem cell marker or a differentiation marker. This term refers to the statistical evidence that a difference is observed. This is defined as the probability of making a decision to reject the null hypothesis when the null hypothesis is actually true. This decision is often made using a p-value.

[0026] Unless otherwise indicated in an operating example or specified separately, any numerical values representing amounts of components or reaction conditions used herein should be understood to be modified in every case by the term "about". When the term "about" is used in relation to a percentage, it can mean ±1% of the average.

[0027] For other terms, they are defined in the description of various aspects of the technologies described herein.

[0028] The aspects of the technologies described herein relate to methods for generating pluripotent cells from cells and to the use and methods of use of such pluripotent cells. Existing methods for generating pluripotent cells (i.e., induced pluripotent stem cells or iPS cells), for example, rely on increasing the expression of reprogramming factors, e.g., by introduction of a nucleic acid construct encoding one or more reprogramming factors (e.g., Oct4), whereas the methods described herein expose cells to stress but do not require the introduction of exogenous reprogramming actors.

[0029] In some embodiments, stress reduces the volume of the cytoplasm of a cell and / or the number of mitochondria in the cell. A decrease in the volume of the cytoplasm of a cell or the number of mitochondria in the cell induces a stress response in which the cell acquires at least pluripotency. In one aspect, a method of generating pluripotent cells is described herein that includes removing at least about 40% of the cytoplasm from a cell and selecting cells that exhibit pluripotency, wherein the cells are not present in a tissue. In one aspect, the invention described herein is a method of generating pluripotent cells that includes removing at least about 40% of the mitochondria from a cell and selecting cells that exhibit pluripotency, wherein the cells are not present in a tissue.

[0030] The cells used in the methods, assays and compositions described herein can be any type of cell, such as adult cells, embryonic cells, differentiated cells, stem cells, progenitor cells and / or somatic cells. The cells can be those represented by a combination of the above terms, for example, the cells can be embryonic stem cells or differentiated somatic cells. The cells used in the methods, assays and compositions described herein can be obtained from a subject. In some embodiments, the cells are mammalian cells. In some embodiments, the cells are human cells. In some embodiments, the cells are adult cells. In some embodiments, the cells are neonatal cells. In some embodiments, the cells are fetal cells. In some embodiments, the cells are amniotic cells. In some embodiments, the cells are cord blood cells.

[0031] "Adult" refers to tissues and cells derived from or present in an animal subject at any point after birth. "Embryo(nic)" refers to tissues and cells derived from or present in an animal subject at any point before birth.

[0032] As used herein, the term "somatic cell" refers to any cell other than a germ cell, a cell present in or obtained from a preimplantation embryo, or a cell resulting from the in vitro proliferation of such cells. In other words, somatic cells refer to any cells that form an organism, as opposed to germ line cells. In mammals, germ line cells (also known as "gametes") are sperm and eggs, which fuse at fertilization to form a cell called a zygote, from which the entire mammalian embryo develops. All cell types within a mammalian body, except for sperm, eggs, the cells from which they arise (germ cells), and undifferentiated stem cells, are somatic cells. That is, internal organs, skin, bone, blood, and connective tissue are all composed of somatic cells. In some embodiments, somatic cells are "non-embryonic somatic cells" that do not exist in or are not obtained from an embryo, nor do they result from the in vitro proliferation of such cells. In some embodiments, somatic cells are "adult somatic cells" that exist in or are obtained from an organism other than an embryo or fetus, or cells resulting from the in vitro proliferation of such cells. It is noted that adult cells can be distinguished from neonatal or embryonic cells by structural differences, such as epigenetic mechanisms like methylation patterns. In some embodiments, somatic cells are mammalian somatic cells. In some embodiments, somatic cells are human somatic cells. In some embodiments, somatic cells are adult somatic cells. In some embodiments, somatic cells are neonatal somatic cells.

[0033] As used herein, the term "differentiated cell" refers to a cell whose fate or function is more specialized than at an earlier point in its developmental process, and includes both terminally differentiated cells and cells that have not differentiated to the end but are more specialized than at an earlier point in their developmental process. The development of a cell from an uncommitted cell (e.g., a stem cell) into a cell with increased commitment to a particular differentiated cell type and ultimately into a terminally differentiated cell is known as forward differentiation or forward commitment. In the context of cell ontogeny, the adjectives "differentiated" or "differentiating" are relative terms. A "differentiated cell" is a cell that has advanced further along a developmental pathway than the cell being compared. Thus, a stem cell can differentiate into a lineage-committed progenitor cell (such as a mesodermal stem cell), and at the next stage can further progress along the pathway to differentiate into other types of progenitor cells (such as a cardiac muscle progenitor cell), and then into a differentiated cell at the final stage that plays a characteristic role in a particular tissue type, which may or may not retain the ability to further proliferate.

[0034] As used herein, the term "stem cell" refers to a cell that is in an undifferentiated or partially differentiated state, has the property of self-renewal, and has the developmental potential to naturally differentiate into more differentiated cell types, where the developmental potential does not represent a specific meaning (i.e., totipotency, pluripotency, multipotency, etc.). Self-renewal means that a stem cell can proliferate while maintaining its developmental potential and give rise to such stem cells. Thus, the term "stem cell" refers to any population of cells that has the developmental potential to differentiate into a more specialized or differentiated phenotype under certain circumstances and retains the ability to proliferate without substantial differentiation under certain circumstances. The term "somatic stem cell" is used to refer to any stem cell derived from non-embryonic tissues, including fetal, juvenile, and adult tissues. Natural somatic stem cells have been isolated from a variety of adult tissues, including blood, bone marrow, brain, olfactory epithelium, skin, pancreas, skeletal muscle, and cardiac muscle. Exemplary naturally occurring somatic stem cells include, but are not limited to, mesenchymal stem cells and hematopoietic stem cells. In some embodiments, the stem cells or progenitor cells can be embryonic stem cells. As used herein, "embryonic stem cell" refers to a stem cell derived from a tissue formed between fertilization and the end of pregnancy, including pre-embryonic tissue (e.g., blastocyst, etc.), embryonic tissue, or fetal tissue taken at any time prior to, but not necessarily, around weeks 10 - 12 of pregnancy. Embryonic stem cells are most often totipotent cells derived from the early embryo or blastocyst. Embryonic stem cells can be obtained directly from suitable tissues, including human tissues, or established embryonic cell lines, without particular limitation. In one embodiment, embryonic stem cells are obtained as described by Thomson et al. (U.S. Pat. Nos. 5,843,780 and 6,200,806; Science 282:1145, 1998; Curr. Top. Dev. Biol. 38:133 ff, 1998; Proc. Natl. Acad. Sci. U.S.A. 92:7844, 1995 (incorporated herein by reference in its entirety)).

[0035] Exemplary stem cells include embryonic stem cells, adult stem cells, pluripotent stem cells, neural stem cells, hepatic stem cells, muscle stem cells, muscle progenitor stem cells, endothelial progenitor cells, bone marrow stem cells, chondrogenic stem cells, lymphoid stem cells, mesenchymal stem cells, hematopoietic stem cells, central nervous system stem cells, peripheral nervous system stem cells, and the like. Descriptions of stem cells, including methods for isolating and culturing stem cells, can be found, inter alia, in Embryonic Stem Cells, Methods and Protocols, edited by Turksen, Humana Press, 2002; Weisman et al., Annu. Rev. Cell. Dev. Biol. 17:387-403; Pittinger et al., Science, 284:143-47, 1999; Animal Cell Culture, edited by Masters, Oxford University Press, 2000; Jackson et al., PNAS 96(25):14482-86, 1999; Zuk et al., Tissue Engineering, 7:211-228, 2001 (“Zuk et al.”); Atala et al., particularly Chapters 33-41; and U.S. Patent Nos. 5,559,022, 5,672,346, and 5,827,735. Descriptions of stromal cells, including methods for isolating stromal cells, can be found, inter alia, in Prockop, Science, 276:71-74, 1997; Theise et al., Hepatology, 31:235-40, 2000; Current Protocols in Cell Biology, edited by Bonifacino et al., John Wiley & Sons, 2000 (including the latest version in March 2002); and U.S. Patent No. 4,963,489.

[0036] As used herein, the term "progenitor cell" refers to a cell that is in an undifferentiated or partially differentiated state, has the ability to differentiate into at least one more differentiated phenotype, and has the property of self-renewal. In this case, the developmental potential does not represent a specific meaning (i.e., totipotency, pluripotency, multipotency, etc.). Thus, the term "progenitor cell" refers to any set of cells that have the ability to differentiate into a more specialized or differentiated phenotype under certain circumstances. In some embodiments, the stem cells or progenitor cells are pluripotent stem cells. In some embodiments, the stem cells or progenitor cells are totipotent stem cells.

[0037] The term "totipotency" refers to stem cells that can give rise to any tissue or cell type in the body. "Pluripotent" stem cells are those that can give rise to any cell type other than germ line cells in the body. Stem cells that can give rise to a fewer number or a limited number of different cell types are generally referred to as "multipotent". Thus, totipotent cells differentiate into pluripotent cells that can give rise to most, but not all, of the tissues required for fetal development. Pluripotent cells further differentiate into multipotent cells that are restricted to giving rise to cells with specific functions. For example, multipotent hematopoietic stem cells give rise to red blood cells, white blood cells, and platelets in the blood.

[0038] As used herein, the term "pluripotency" refers to a cell that has the ability to differentiate into any of the cell types characteristic of the three germ cell layers (i.e., endoderm (e.g., gastrointestinal tissue), mesoderm (e.g., blood, muscle, and blood vessels), and ectoderm (e.g., skin and nerve)) under various conditions. Pluripotent cells are characterized primarily by their ability to differentiate into all three germ layers, for example, using the nude mouse teratoma formation assay. Pluripotency is also indicated by the expression of embryonic stem (ES) cell markers, although it is preferable to demonstrate the ability to differentiate into cells of each of the three germ layers to examine pluripotency.

[0039] The "ACC" cells and "STAP" cells described in the examples of this specification are non-limiting examples of pluripotent cells. The "STAP stem cells" are non-limiting examples of pluripotent stem cells. Since the terms "pluripotent cells" and "pluripotent stem cells" can both be used in a form suitable for the purposes of the present invention, they may be used interchangeably in this specification.

[0040] As used herein, the term "pluripotent" or "pluripotent state" refers to cells that have the ability to differentiate into any of the three germ layers: endoderm (gut tissue), mesoderm (including blood, muscle, and blood vessels), and ectoderm (such as skin and nerves).

[0041] The term "multipotent" as used in relation to "multipotent cells" refers to cells that can differentiate into some, but not all, of the cells derived from all three germ layers. Thus, multipotent cells are partially differentiated cells. Multipotent cells are well known in the art, and non-limiting examples of multipotent cells may include adult stem cells, such as hematopoietic stem cells and neural stem cells. Multipotency means that a stem cell can form a number of cell types of a given lineage, but not the cells of other lineages. For example, multipotent hematopoietic stem cells can form a number of different types of blood cells (red blood cells, white blood cells, platelets, etc.), but cannot form neurons. The term "multipotent" refers to cells whose developmental potency does not reach totipotency and pluripotency.

[0042] The term "totipotent" refers to cells that are differentiated to such an extent that they have the ability to form all cells of extraembryonic tissues including the placenta, in addition to adult cells. A fertilized egg (zygote) is totipotent, and early cleavage cells (blastomeres) are also totipotent.

[0043] The cells used in the methods described herein can be cells that do not exist in a tissue. As used herein, "tissue" refers to a biological material (e.g., a group, layer, or aggregate) in which cells that are similarly specialized to perform at least one specific function are assembled and organized together. When a cell is removed from an organized higher structure that exists in vivo or otherwise separated from the higher structure, that cell does not exist in a tissue. For example, when a blood sample is separated into two or more different fractions, or when a spleen is minced and mechanically dissociated with a Pasteur pipette, the cells do not exist in a tissue. In some embodiments, the cells that do not exist in a tissue are isolated cells. As used herein, the term "isolated" when used in connection with a cell refers to a cell that has been mechanically or physically separated from another group of cells that are normally associated in vivo. Methods for isolating one or more cells from another group of cells are well known in the art. See, for example, Culture of Animal Cells: a manual of basic techniques (3rd edition), 1994, R.I. Freshney (ed.), Wiley-Liss, Inc.; Cells: a laboratory manual (Volume 1), 1998, D.L. Spector, R.D. Goldman, L.A. Leinwand (eds.), Cold Spring Harbor Laboratory Press; Animal Cells: culture and media, 1994, D.C. Darling, S.J. Morgan, John Wiley and Sons, Ltd. The isolated cells are optionally cultured in vitro, for example, in the presence of other cells.

[0044] In some embodiments, the cells are not present in a tissue but are present within a cell population. In some embodiments, the cell population is a cell population. As used herein, "cell population" refers to a group consisting of at least two cells, such as two cells, three cells, four cells, ten cells, one hundred cells, one thousand cells, ten thousand cells, one hundred thousand cells or any number or greater number of cells between these numbers. Optionally, the cell population may be cells of the same origin. For example, the cells may be descendants of the same parent cell, clones, cells isolated from the same tissue or their descendants, or cells isolated from the same tissue sample or their descendants. The cell population may comprise one or more cell types, such as one or more cell types, two or more cell types, three or more cell types, four or more cell types or more cell types. The cell population may be heterogeneous or homogeneous. The cell population may be substantially homogeneous if it contains at least 90% of the same cell type, for example, if 90%, 92%, 95%, 98%, 99% or more of the cells in the population are of the same cell type. The cell population may be heterogeneous if less than 90% of the cells present in the population are of the same cell type.

[0045] In some embodiments, the methods described herein can relate to the generation of non-pluripotent cells (e.g., differentiated cells) that exhibit a pluripotent phenotype. In some embodiments, the generation of pluripotent cells can include generating cells with a higher pluripotent phenotype, i.e., causing the cells to exhibit a phenotype with a broader differentiation potential. By way of non-limiting example, very small embryonic-like (VSEL) cells may be unipotent rather than pluripotent and / or may have a limited ability to differentiate into specific differentiated cell types (possibly due to the epigenetic state of VSELs being more similar to differentiated cells than embryonic stem cells). According to the methods described herein, unipotent cells and / or cells with limited differentiation potential can be caused to exhibit a higher pluripotent phenotype. A higher pluripotent phenotype can be a phenotype that can differentiate into a greater number of differentiated cell types. For example, of two unipotent cells, the one that can differentiate into a greater number of differentiated cell types in its lineage is more pluripotent, and / or a pluripotent cell is more pluripotent than a unipotent cell.

[0046] The methods for generating pluripotent cells (or cells with a higher pluripotency) described herein can include, for example, removing a portion of the cytoplasm from the cell and / or removing mitochondria from the cell. In some embodiments, removing a portion of the cytoplasm or mitochondria from the cell partially removes epigenetic regulation of the cell. In some embodiments, at least about 40% of the cytoplasm is removed, e.g., at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or more of the cytoplasm of the cell is removed. In some embodiments, 60% - 80% of the cytoplasm of the cell is removed. In some embodiments, at least about 40% of the mitochondria is removed, e.g., at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or more of the mitochondria of the cell is removed. In some embodiments, 50% - 90% of the mitochondria of the cell is removed.

[0047] Methods of exposing cells to stress and / or removing cytoplasm or mitochondria from cells can be any environmental stimulus that causes pores and / or ruptures in the cell membrane below the lethal threshold. The stress can include non-physiological stress of tissues or cell cultures. Non-limiting examples of suitable environmental stimuli include trauma, mechanical stimulation, chemical exposure, ultrasonic stimulation, oxygen deprivation, nutrient deprivation, radiation exposure, exposure to extreme temperatures, dissociation, trituration, physical stress, high osmotic pressure, low osmotic pressure, membrane damage, toxins, extreme ion concentrations, reactive oxygen species, UV exposure, intense visible light, lack of essential nutrients or non-physiological acidic environment. In some embodiments, one type of environmental stimulus can be applied to the cells. In some embodiments, multiple environmental stimuli can be applied to the cells, for example, two types of stimuli, three types of stimuli, four types of stimuli or more. The multiple environmental stimuli can be applied simultaneously or separately.

[0048] In some embodiments, the stress can be a stress that causes membrane disruption in at least 10% of the exposed cells. As used herein, "membrane disruption" is not particularly limited, but refers to damaging, rupturing, or breaking the membrane such that pores or gaps sufficient to release a detectable amount of organelles and / or intracellular substances, including mitochondria and DNA, into the extracellular environment are formed. Methods for detecting the release of intracellular substances, such as mitochondria, are known in the art and are described elsewhere in this specification. The released intracellular substances can be free, enclosed by a membrane, or surrounded by a membrane.

[0049] The stress can cause membrane disruption in at least 10% of the cells exposed to the stress, such as 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, or 90% or more. In some embodiments, the cells exposed to the stress can be cells of the same type and characteristics as the cells that enhance pluripotency as described herein. For example, a stress suitable for one type of cell may not be suitable for another type of cell.

[0050] The length of time for which the cells are exposed to stress can vary depending on the stimulus used. For example, when stressing cells using nutrient-deprived conditions according to the methods described herein, the cells can be cultured under nutrient-deprived conditions for one week or more, such as one week, two weeks, three weeks or more. In some embodiments, the cells are cultured under nutrient-deprived conditions for about three weeks. In another non-limiting example, cells exposed to low pH or hypoxic conditions according to the methods described herein can be exposed for several minutes or more, including several hours, such as at least 2 minutes, at least 5 minutes, at least 20 minutes, at least 1 hour, at least 2 hours, at least 6 hours or more.

[0051] Mechanical stimuli that induce the generation of pluripotent cells can include contacting a substance or surface with the cell membrane in any form so as to mechanically disrupt the integrity of the membrane. The mechanical stimuli can include exposing the cells to shear stress and / or high pressure. An exemplary form of mechanical stimuli is trituration. Trituration is the process of polishing and / or grinding the surface of particles by friction. A non-limiting example of the process of triturating cells can include passing the cells through a device having an opening smaller than the size of the cells. For example, the cells can be passed through a pipette in which at least a part of the internal space has a diameter smaller than the diameter of the cells by means of suction pressure and / or fluid flow. In some embodiments, the cells are passed through at least one device having an opening smaller than the size of the cells. In some embodiments, the cells are passed through a plurality of devices having successively smaller openings. In some embodiments, the cells can be triturated for 5 minutes or more, such as 5 minutes, 10 minutes, 20 minutes, 30 minutes or 60 minutes. In some embodiments, the cells can be triturated by passing them through a Pasteur pipette with an inner diameter of 50 μm. In some embodiments, the cells can be triturated by passing them through a Pasteur pipette with an inner diameter of 50 μm for 20 minutes.

[0052] Other methods of applying stress necessary to generate pluripotent cells in cells include, for example, exposure to specific chemicals or physicochemical conditions (e.g., high or low pH, osmotic shock, extreme temperatures, oxygen deprivation, etc.). This type of treatment, including those that induce the generation of pluripotent cells, will be further described below. Chemical exposures can include, for example, any combination of pore-forming compounds that disrupt or impair pH, osmotic pressure, and / or cell membrane integrity. Non-limiting examples include exposing cells to a non-physiological acidic environment or low pH, streptolysin O, or distilled water (i.e., osmotic shock).

[0053] The low pH can be, for example, less than 6.8, such as 6.7, 6.5, 6.3, 6.0, 5.8, 5.4, 5.0, 4.5, 4.0 or lower pH. In some embodiments, the low pH is from about 3.0 to about 6.0. In some embodiments, the low pH is from about 4.5 to about 6.0. In some embodiments, the low pH is from 5.4 to 5.8. In some embodiments, the low pH is from 5.4 to 5.6. In some embodiments, the low pH is about 5.6. In some embodiments, the low pH is about 5.7. In some embodiments, the low pH is about 5.5. In some embodiments, the cells can be exposed to the low pH for up to several days, such as within 6 days, within 4 days, within 3 days, within 2 days, within 1 day, within 12 hours, within 6 hours, within 3 hours, within 2 hours, within 1 hour, within 30 minutes, within 20 minutes or less than 10 minutes. In some embodiments, the cells can be exposed to a pH of 5.4 to 5.6 within 3 days. In some embodiments, the cells can be exposed to a pH of about 5.6 to 6.8 within 3 days. In some embodiments, the cells can be exposed to a pH of about 5.6 to 6.8 within 1 hour. In some embodiments, the cells can be exposed to a pH of about 5.6 to 6.8 for about 30 minutes. In some embodiments, the cells can be exposed to a pH of about 5.6 to 6.8 for about 20 minutes. In some embodiments, the cells can be exposed to a pH of about 5.6 to 5.8 within 3 days. In some embodiments, the cells can be exposed to a pH of about 5.6 to 5.8 within 1 hour. In some embodiments, the cells can be exposed to a pH of about 5.6 to 5.8 for about 30 minutes. In some embodiments, the cells can be exposed to a pH of about 5.6 to 5.8 for about 20 minutes.

[0054] In some embodiments, cells can be exposed to ATP to induce the generation of pluripotent cells. In some embodiments, cells can be exposed to ATP at a concentration of about 20 μM to about 200 mM. In some embodiments, cells can be exposed to ATP at a concentration of about 200 μM to about 20 mM. In some embodiments, cells can be exposed to ATP at a concentration of about 2.4 mM. In some embodiments, cells can be exposed to ATP diluted with HBSS. In some embodiments, cells can be exposed to ATP for 1 minute or longer, such as at least 1 minute, at least 2 minutes, at least 5 minutes, at least 15 minutes, at least 30 minutes, at least 45 minutes, at least 1 hour or longer. In some embodiments, cells can be exposed to ATP for about 5 minutes to about 30 minutes. In some embodiments, cells can be exposed to ATP for about 15 minutes. In some embodiments, cells can be exposed to about 2.4 mM ATP for about 15 minutes.

[0055] In some embodiments, cells can be exposed to CaCl2 to induce the generation of pluripotent cells. In some embodiments, cells can be exposed to CaCl2 at a concentration of about 20 μM to about 200 mM. In some embodiments, cells can be exposed to CaCl2 at a concentration of about 200 μM to about 20 mM. In some embodiments, cells can be exposed to CaCl2 at a concentration of about 2 mM. In some embodiments, cells can be exposed to CaCl2 diluted with HBSS. In some embodiments, cells can be exposed to CaCl2 for 1 day or longer, such as at least 1 day, at least 2 days, at least 1 week, at least 2 weeks, at least 3 weeks or longer. In some embodiments, cells can be exposed to CaCl2 for about 1 week to 3 weeks. In some embodiments, cells can be exposed to CaCl2 for about 2 weeks. In some embodiments, cells can be exposed to about 2 mM CaCl2 for about 2 weeks. In some embodiments, cells can be exposed to about 2 mM CaCl2 for about 1 week.

[0056] Examples of pore-forming compounds include streptolysin O (SLO), saponin, digitonin, filipin, Ae I, cytolysin of Physalia physalis, aerolysin, amatoxin, amoebapore, amoebapore homolog derived from Entamoeba dispar, brevinin-1E, brevinin-2E, barbaticardin, cytolysin of Enterococcus faecalis, delta-hemolysin, diphtheria toxin, E1 Tor cytolysin of Vibrio cholerae, equinatoxin, enterotoxin of Aeromonas hydrophila, esculin, granulysin, hemolysin of Vibrio parahaemolyticus, intermedilysin of Streptococcus intermedins, lentiviral lytic peptide, leukotoxin of Actinobacillus actinomycetemcomitans, magainin, melittin, membrane-associated lymphotoxin, Met-enkephalin, neokyotorphin, neokyotorphin fragment 1, neokyotorphin fragment 2, neokyotorphin fragment 3, neokyotorphin fragment 4, NK-lysin, pardaxin, alpha-cytolysin of Staphylococcus aureus, alpha-cytolysin of Clostridium septicum, Bacillus thuringiensis toxin, colicin, complement, defensin, histricin, listeriolysin, magainin, melittin, pneumolysin, yeast killer toxin, valinomycin, Peterson's crown ether, perforin, perfringolysin O, theta-toxin of Clostridium perfringens, phalloidin, phallotoxin and other molecules, for example, Regen et al.,Examples include molecules described in Biochem Biophys Res Commun 1989 159:566-571 (incorporated herein by reference in its entirety). Methods for purifying or synthesizing pore-forming compounds are well known to those skilled in the art. Additionally, pore-forming compounds are commercially available, for example, streptolysin O (catalog number S5265; Sigma-Aldrich: St. Louis, Missouri). By way of non-limiting example, cells can be exposed to SLO for about 5 minutes or more, such as at least 5 minutes, at least 10 minutes, at least 20 minutes, at least 30 minutes, at least 45 minutes, at least 1 hour, at least 2 hours, at least 3 hours or more. In some embodiments, cells are exposed to SLO for about 30 minutes to 2 hours. In some embodiments, cells are exposed to SLO for about 50 minutes. By way of non-limiting example, cells can be exposed to SLO at a concentration of about 10 ng / mL to 1 mg / mL. In some embodiments, cells can be exposed to SLO at a concentration of about 1 μg / mL to 100 μg / mL. In some embodiments, cells can be exposed to SLO at a concentration of about 10 μg / mL. In some embodiments, cells can be exposed to SLO at a concentration of about 10 μg / mL for about 50 minutes.,

[0057] Examples of oxygen deprivation conditions that induce the generation of pluripotent cells can include culturing cells under hypoxic conditions, such as culturing cells under 10% oxygen or less. In some embodiments, cells are cultured under 5% oxygen or less. The culturing period under hypoxic conditions can be 1 hour or more, such as 1 hour, 12 hours, 1 day, 2 days, 1 week, 2 weeks, 3 weeks, 1 month, 2 months or more. In some embodiments, cells can be cultured under hypoxic conditions for 1 week to 1 month. In some embodiments, cells can be cultured under hypoxic conditions for about 3 weeks.,

[0058] Nutrient deprivation conditions that induce the generation of pluripotent cells can include the lack of any factor or nutrient beneficial for cell proliferation. In some embodiments, the nutrient deprivation conditions include culturing cells in a basal medium, such as F12 or DMEM, without additionally adding, for example, FBS or growth factors. The culturing period under nutrient deprivation conditions can be 1 hour or more, for example, 1 hour, 12 hours, 1 day, 2 days, 1 week, 2 weeks, 3 weeks, 1 month, 2 months or longer. In some embodiments, the cells can be cultured under nutrient deprivation conditions for 1 week to 1 month. In some embodiments, the cells can be cultured under nutrient deprivation conditions for about 2 weeks. In some embodiments, the cells can be cultured under nutrient deprivation conditions for about 3 weeks. In some embodiments, examples of nutrient deprivation conditions can include conditions without growth factors or conditions containing less than 50% of the standard concentration of one or more growth factors of a given cell type.

[0059] Exposures to extreme temperatures that induce the generation of pluripotent cells can include exposure to either low temperature or high temperature. In mammalian cells, extreme low temperature can be a temperature below 35°C, for example, 34°C, 33°C, 32°C, 31°C or lower. In some embodiments, extreme low temperature can be a sub-zero temperature. When cells are frozen, ice crystals can cause perforations in the membrane, which can be a means of reducing the cytoplasm. In mammalian cells, extreme high temperature can be a temperature above 42°C, for example, 43°C, 44°C, 45°C, 46°C or higher. In some embodiments, extreme high temperature can be a temperature of about 85°C or higher. The culturing period under extreme temperature can be 20 minutes or more, for example, 20 minutes, 30 minutes, 1 hour, 12 hours, 1 day, 2 days, 1 week, 2 weeks, 3 weeks, 1 month, 2 months or longer. It is obvious that the higher the temperature, the shorter the exposure period generally allowed to generate pluripotent cells.

[0060] Examples of stress that can be used in the methods described herein include, but are not particularly limited to, treatments by ultrasonic stimulation and radiation irradiation.

[0061] In some embodiments, after exposing the cells to stress, the cells can be cultured before selection according to the methods described later herein. The cells can be cultured for at least 1 hour before selection. For example, to remove the stress stimulus, before selection as described herein, the cells can be cultured for at least 1 hour, at least 2 hours, at least 6 hours, at least 12 hours, at least 1 day, at least 2 days, at least 7 days or longer. By way of non-limiting example, after exposing the cells to SLO for about 50 minutes, they can be cultured in SLO-free medium for about 7 days before selection. In some embodiments, the medium used to culture the cells before selection does not contain differentiation factors and does not promote differentiation. In some embodiments, the medium is suitable for culturing stem cells and / or pluripotent cells. Examples of such media are described later herein.

[0062] In some embodiments, the amount of cytoplasm of the cells is decreased. The decrease in the cytoplasm of the cells can be determined by monitoring the size of the cells. Methods for determining the size of cells are well known to those skilled in the art, and non-limiting examples include cell fluorescence quantitative analysis. Briefly, a single cell is stained with propidium iodide and measured, for example, using FLOMAX (trademark) software on a DAKO GALAXY (trademark) analyzer (DAKO) with filtering. Then, cell fluorescence quantitative analysis can be performed to confirm the size of the cells. Microbeads of a predetermined size are resuspended in isotonic phosphate buffered saline (pH 7.2) and used as a reference for comparing the size of the cells contained in the sphere using cell fluorescence quantitative analysis. Both the cells and the beads are analyzed using the same instrument settings (forward scatter indicating the size of the cells and beads and side scatter indicating the particle size of the cells). The size of the cells can be calculated from a curve with the bead diameter on the x-axis and the value of forward scatter on the y-axis.

[0063] In some embodiments, the amount of mitochondria in a cell is decreased. Methods for determining the number of mitochondria in a cell are well known to those skilled in the art, and such methods include staining with a mitochondria-specific dye and counting the number of mitochondria visible per cell under microscopic observation. Mitochondria-specific dyes are commercially available, for example, MITOTRACKER (trademark) (catalog number M7512, Invitrogen; Grand Island, NY). In some embodiments, the number of mitochondria or the intensity of the signal from a mitochondria-specific dye can be reduced by at least 40% by the treatment using the above-described method herein. In some embodiments, cells in which the number of mitochondria or the intensity of the signal from a mitochondria-specific dye is reduced by at least 40% by the treatment using the above-described method herein are selected.

[0064] Alternatively, by measuring the redox activity of the extracellular environment, it is possible to detect the destruction of the amount and / or membrane of mitochondria. When mitochondria are released into the extracellular environment by the stress described herein, the ROS level in the extracellular environment increases, and this can be used to measure the effect of a given stress.

[0065] In some embodiments of any of the aspects described herein, the cells can be exposed to stress under LIF (leukemia inhibitory factor).

[0066] In some embodiments, after removing a portion of the cytoplasm of the cell and / or mitochondria, the method further includes selecting cells that exhibit pluripotency. Pluripotent cells can be selected by selecting cells that exhibit the phenotype or function of pluripotent cells. Selection of the cells can include isolating and expanding cells that exhibit the desired characteristics, or culturing a population of cells with unclear characteristics under conditions where cells having the desired characteristic(s) have a higher survival rate and / or proliferation rate than cells that do not have the desired characteristic(s). Non-limiting examples of markers and characteristics of pluripotent cells are described later herein. In some embodiments, selection of cells based on pluripotency includes at least in part selecting cells that express Oct4. In some embodiments, selection of cells based on pluripotency includes at least in part selecting cells that express Nanog. In some embodiments, selection of cells based on pluripotency includes at least in part selecting cells that express Oct4, Nanog, E-cadherin, and / or SSEA. In some embodiments, pluripotent cells can be selected by using antibodies specific for SSEA-1 and E-cadherin and FACS to select cells that express these markers. In some embodiments, cells can be selected based on size using FACS or other cell sorting devices known in the art and / or described herein. Additionally, cells can be selected by their inability to adhere to a culture dish.

[0067] In addition, cells can be selected based on their size being reduced after exposure to stress. That is, cells that undergo stress and progress to pluripotent cells are smaller than their non-pluripotent somatic progenitor cells. In some embodiments, cells having a diameter of less than 8 μm are selected, such as cells having a diameter of 8 μm or less, 7 μm or less, 6 μm or less, 5 μm or less, or smaller. After stress treatment, cells can be selected based on size after culturing for a short period (e.g., from several minutes to several days) or after allowing them to rest. In some embodiments, cells can be selected based on size immediately after stress treatment. Cells can be selected by any method known in the art, such as using filters or FACS.

[0068] In some embodiments of the methods described herein, the pluripotent cells generated according to the methods described herein can be cultured to expand the pluripotent cells (i.e., proliferation of stem cells). In some embodiments, the pluripotent cells generated according to the methods described herein can be maintained in vitro. In one aspect, the techniques described herein relate to compositions comprising pluripotent cells and / or progeny of at least a portion of them that have differentiated. In some embodiments, the pluripotent cells and / or progeny of at least a portion of them that have differentiated can be maintained in vitro, for example, as a cell line. The cell line can be used for screening and / or testing candidate agents, such as agents for treating a given disease and / or agents that modulate stem cells, as described later herein. In some embodiments, the pluripotent cells and / or progeny of at least a portion of them that have differentiated can be derived from cells obtained from a subject having a disease, such as a disease due to the decline of naturally occurring cell types or tissue types or naturally occurring pluripotent and / or multipotent cells (described later herein) and / or a disease involving cells having a genetic mutation, such as cancer. The compositions described herein can be used, for example, for disease modeling, drug discovery, diagnosis, and personalized medicine.

[0069] Conditions suitable for the proliferation and / or maintenance of stem cells and / or pluripotent cells are known in the art. Proliferation of stem cells enables expansion of the cell number without substantially inducing or differentiating differentiation. Non-limiting examples include, as conditions suitable for the proliferation of pluripotent cells, cells in F12 / DMEM (1:1, v / v) supplemented with 2% B27, 20 ng / mL basic fibroblast growth factor and 10 ng / mL epidermal growth factor at 1×10 6 cells / cm 2 . During the culture period, about 50% of the medium can be replaced every 2 - 3 days. In some embodiments, the conditions suitable for the proliferation of stem cells and / or pluripotent cells are as described in Hitoshi, S et al., Genes & development 2004 18, 1806 - 1811 (incorporated herein by reference in its entirety), B27-LIF (i.e., LIF (1×10 3 units / mL, Chemicon; catalog number ESG1107, EMD Millipore, Billerica, Massachusetts) and B27 supplement (catalog number 0080085-SA; Invitrogen; Grand Island, New York) in serum-free medium). Other media suitable for culturing the cells described herein, such as ES establishment medium, 2i, 3i and ACTH, ES culture conditions, ES-LIF, embryonic neural stem cell culture conditions and EpiSC culture conditions are described in the examples herein. In some embodiments, the conditions for the proliferation or maintenance of pluripotent cells may include culturing the cells in the presence of LIF (leukemia inhibitory factor).

[0070] During proliferation, the pluripotent cells generated according to the methods described herein continue to express the same pluripotent stem cell marker(s). Non-limiting examples of pluripotent stem cell markers include SSEA-1, SSEA-2, SSEA-3, SSEA-4 (collectively referred to herein as SSEA), AP, E-cadherin antigen, Oct4, Nanog, Ecat1, Rex1, Zfp296, GDF3, Dppa3, Dppa4, Dppa5, Sox2, Esrrb, Dnmt3b, Dnmt31, Utf1, Tel1, Bat1, Fgf4, Neo, Cripto, Cdx2, and Slc2a3. Methods for determining whether a cell expresses a pluripotent stem cell marker are well known to those skilled in the art and include, for example, RT-PCR, the use of reporter gene constructs (e.g., combining the expression of the Oct4-GFP construct described herein with FACS or fluorescence microscopy), and FACS or fluorescence microscopy using antibodies specific for the cell surface marker of interest.

[0071] Other pluripotent cell markers include, for example, an elongation of telomeres compared to the cells. Telomere length can be determined, for example, by isolating genomic DNA, digesting the gDNA with restriction enzymes such as Hinf1 and Rsa1, and detecting telomeres with a telomere length assay reagent. Such reagents are known in the art and commercially available, for example, the TELOTAGGG™ TELOMERE LENGTH ASSAY KIT (Catalog No. 12209136001, Roche; Indianapolis, Indiana).

[0072] In some embodiments, cells processed according to the methods described herein can be changed to a state more similar to the epigenetic state of embryonic stem cells than before being processed according to the methods of the present disclosure. The epigenetic state of a cell refers to chemical markings of the genome, rather than changes in the nucleotide sequence of the genome. Epigenetic markings can include, in addition to DNA methylation (imprinting), methylation and acetylation of DNA-binding proteins such as histones. The term “DNA methylation” refers to the addition of a methyl (CH3) group to a specific base of DNA. In mammals, methylation most commonly occurs at the 5 position of cytosine (CpG) when guanine is adjacent. In some embodiments, the epigenetic state can include an epigenetic methylation pattern, such as a DNA methylation pattern. Assays for revealing the presence and location of epigenetic markings are known in the art, and such assays can include, for example, bisulfite sequencing as described in Example 2 herein. Briefly, DNA is treated with the CpGenome™ DNA Modifiation Kit (Chemicon, Temecula, Calif.), the region of interest (e.g., the Nanog gene and the Oct4 gene) is amplified, and the sequence is determined.

[0073] Some aspects of the technology described herein relate to assays using pluripotent stem cells generated by the methods described herein. For example, drugs that regulate the viability, differentiation, or proliferation of pluripotent stem cells can be screened and / or identified using pluripotent stem cells generated by the methods described herein. Such assays can include contacting pluripotent cells generated according to the methods described herein with a candidate drug and determining whether the viability, differentiation, and / or proliferation of the pluripotent cells contacted with the candidate drug differ from the viability, differentiation, and / or proliferation of pluripotent cells not contacted with the candidate drug. In some embodiments, the drug can increase the viability, differentiation, and / or proliferation of pluripotent stem cells. In some embodiments, the drug can decrease the viability, differentiation, and / or proliferation of pluripotent stem cells. In some embodiments, pluripotent stem cells can be contacted with a plurality of candidate drugs to, for example, reveal synergistic or antagonistic effects or screen a pool of candidate drugs.

[0074] If pluripotent cells can survive better in the presence of a candidate agent than in its absence, i.e., the number of viable pluripotent cells is greater or less, then the candidate agent is identified as an agent that regulates the viability of the generated pluripotent cells. Methods for determining cell viability are well known in the art, and non-limiting examples of such methods include determining the number of viable cells at at least two time points by detecting the intensity of signals from live cell markers, or determining the number or proportion of cells stained with a live cell marker. Live cell markers are commercially available, for example, PRESTO BLUE (trademark) (catalog number A-13261; Life Technologies; Grand Island, New York). If the proliferation rate of pluripotent cells changes in the presence of a candidate agent, i.e., an increase or decrease in the number of progeny cells occurring over a given time period is observed, then the candidate agent is identified as an agent that regulates the proliferation of the generated pluripotent cells. Methods for determining cell proliferation rate are known in the art, and non-limiting examples of such methods include determining the increase in the number of live cells over time.

[0075] If an increase or decrease in the rate or characteristics of differentiation of pluripotent cells is observed in the presence of a candidate agent, the candidate agent is identified as an agent that regulates the differentiation of pluripotent cells. Methods for determining the rate or characteristics of cell differentiation are known in the art, and non-limiting examples of such methods include detecting a specific set of markers or morphology and comparing the number and / or rate of appearance of cells having such markers or morphology between a population contacted with the candidate agent and a population not contacted with the candidate agent. Markers and morphological characteristics of various cell fate lineages and mature cell types are known in the art. By way of non-limiting example, mesodermal cells are distinguished from pluripotent cells by the expression of actin, myosin, and desmin. Chondrocytes can be distinguished from their progenitor cell type by staining with safranin-O and / or FASTGREEN (trademark) dye (Fisher; Pittsburgh, Pennsylvania; F99). Osteocytes can be distinguished from their progenitor cells by staining with Alizarin Red S (Sigma; St. Louis, Missouri: catalog number A5533).

[0076] In some embodiments, the candidate agent may be an inhibitor of promising tumor stem cells. For example, the methods described herein can be used for the generation of pluripotent cells from mature tumor cells, and can also be used for screening agents that inhibit the generation and / or viability of tumor cells. The methods described herein can also be used for screening agents that have a cytotoxic effect on mature tumor cells but do not promote the development and / or survival of tumor stem cells.

[0077] In some embodiments, pluripotent cells are contacted with one or more candidate agents and cultured under conditions that promote the differentiation of a specific cell lineage or mature cell type. Conditions suitable for differentiation are known in the art. By way of non-limiting example, conditions suitable for differentiation into the mesodermal lineage include replacing DMEM supplemented with 20% fetal bovine serum (FCS) every three days. Further by way of non-limiting example, conditions suitable for differentiation into the neural lineage include plating cells on chamber slides coated with ornithine in F12 / DMEM (1:1, v / v) supplemented with 2%B27, 10%FCS, 10 ng / mL bFGF and 20 ng / mL EGF. The medium can be replaced every three days.

[0078] As used herein, a "candidate agent" refers to any entity that is not normally present or is not present at the level administered to a cell, tissue or subject. Candidate agents can be selected from the group comprising chemical substances; organic or inorganic small molecules; nucleic acid sequences; nucleic acid analogs; proteins; peptides; aptamers; peptidomimetics, peptide derivatives, peptide analogs, antibodies; intracellular antibodies; extracts made from biological materials such as biopolymers, bacteria, plants, fungi or animal cells or tissues; natural or synthetic compositions or functional fragments thereof. In some embodiments, the candidate agent is any chemical substance or chemical moiety, including without limitation synthetic and natural non-proteinaceous entities. In certain embodiments, the candidate agent is a small molecule having a chemical moiety. For example, chemical moieties include unsubstituted or substituted alkyl moieties, aromatic moieties or heterocyclyl moieties, including macrolides, leptomycins and related natural products or analogs thereof. The candidate agent can be one known to have the desired activity and / or properties or can be selected from a library of diverse compounds.

[0079] Candidate agents can be screened for their ability to regulate the viability, proliferation, and / or differentiation of pluripotent cells. In one embodiment, candidate agents are screened using the viability, differentiation, and / or proliferation assays described hereinabove and in the examples.

[0080] Compounds can generally be tested at any concentration that can regulate cell function, gene expression, or protein activity, over an appropriate time period, compared to a control. In some embodiments, the compounds are tested at concentrations in the range of about 0.1 nM to about 1000 mM. In one embodiment, the compounds are tested in the range of about 0.1 μM to about 20 μM, about 0.1 μM to about 10 μM, or about 0.1 μM to about 5 μM.

[0081] Candidate or test agents can be prepared in free form in solution or bound to a carrier or solid support, such as beads, depending on the specific embodiment to be carried out. There are numerous suitable solid supports that can be used for immobilization of test agents. Examples of suitable solid supports include agarose, cellulose, dextran (e.g., those commercially available as Sephadex, Sepharose), carboxymethyl cellulose, polystyrene, polyethylene glycol (PEG), filter paper, nitrocellulose, ion exchange resins, plastic films, polyaminomethyl vinyl ether maleic acid copolymer, glass beads, amino acid copolymers, ethylene-maleic acid copolymer, nylon, silk, and the like. Further, in the methods described herein, test agents can be screened individually, or in groups or pools. Group screening is particularly useful when the hit rate of effective test agents is expected to be low and it is expected that no more than one positive result will be obtained for a given group.

[0082] Methods for developing libraries based on small molecules, polymers, and genomes are described, for example, in Ding et al., J Am. Chem. Soc. 124:1594-1596 (2002) and Lynn et al., J. Am. Chem. Soc. 123:8155-8156 (2001). Commercially available compound libraries can be obtained, for example, from ArQule, Inc. (Woburn, Massachusetts), Invitrogen (Carlsbad, California), Ryan Scientific (Mount Pleasant, South Carolina), and Enzo Life Sciences (Farmingdale, New York). Members of these libraries can be screened to determine whether they can modulate the viability, proliferation, and / or differentiation of pluripotent stem cells. Candidate agents can be natural proteins or fragments thereof. Such candidate agents can be obtained from natural sources, such as cell or tissue lysates. Additionally, a library of polypeptide agents can be prepared, for example, from commercially available or routinely prepared cDNA libraries. Candidate agents can also be peptides, for example, peptides of about 5 to about 30 amino acids, preferably about 5 to about 20 amino acids, particularly preferably about 7 to about 15 amino acids. The peptides can be digestion products of natural proteins, digestion products of random peptides, or digestion products of "biased" random peptides. In some methods, the candidate agent is a polypeptide or protein. Peptide libraries, such as combinatorial libraries of compounds including peptides, can be fully randomized such that there is no preference or regularity at any position in the sequence. Alternatively, the library can be biased, i.e., some positions within the sequence can be made constant or selected from a limited number of possibilities.For example, in some cases, nucleotides or amino acid residues are randomized within a defined class of residues that are sterically biased (regardless of size) such that, for example, hydrophobic amino acids, hydrophilic residues, cysteines for crosslinking, prolines for SH-3 domains, serines, threonines, tyrosines or histidines or purines for phosphorylation sites result.

[0083] Candidate agents may also be nucleic acids. Nucleic acid candidate agents may be natural nucleic acids, random nucleic acids, or "biased" random nucleic acids. For example, digestion products of prokaryotic or eukaryotic genomes can be used in the same manner as described above for proteins.

[0084] In some embodiments, candidate agents screened according to the methods described herein and identified as modulating the viability, proliferation, and / or differentiation of pluripotent cells can increase the viability, proliferation, and / or differentiation of pluripotent cells by at least 5%, preferably at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 1-fold, 1.1-fold, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 50-fold, 100-fold or more compared to an untreated control. In some embodiments, candidate agents screened according to the methods described herein and identified as modulating the viability, proliferation, and / or differentiation of pluripotent cells can decrease the viability, proliferation, and / or differentiation of pluripotent cells by at least 5%, preferably at least 10%, 20%, 30%, 40%, 50%, 50%, 70%, 80%, 90%, 95%, 97%, 98%, 99% or more compared to an untreated control, and can be decreased maximally to complete reduction (i.e., to zero viability, proliferation or differentiation).

[0085] In some embodiments, the candidate agent functions directly in the form in which it is administered. Alternatively, the candidate agent may be modified to be in a form that modulates the desired activity or may be utilized intracellularly, for example, by introducing a nucleic acid sequence into a cell, which is transcribed intracellularly to produce an inhibitor or activator of gene expression or protein activity.

[0086] It is contemplated that the methods and compositions described herein can be used, for example, in the development of cancer vaccines. Generating at least some differentiated progeny of the pluripotent tumor cells obtained as described herein (e.g., by treating mature tumor cells according to the methods described herein) enables the development of more potent APC (antigen-presenting cell)-based cancer vaccines and provides a diverse and changing antigen profile.

[0087] In some embodiments, the methods described herein relate to enhancing the transformation efficiency of cells. Applying stress to the cells, for example, by inducing pluripotency as described herein, can enhance the receptivity of the cells to genetic modification methods, including, but not limited to, transgene insertion, viral vectors, and / or zinc finger endonucleases. It is contemplated that the methods described herein may enable the genetic modification of cells to a state of genetic receptivity such that it is possible to use naked DNA for the transformation of the resulting pluripotent cells.

[0088] Some aspects of the technology described herein relate to methods of cell therapy that include administering to a subject in need of cell therapy pluripotent cells made by the methods described herein or progeny of such cells in which at least a portion of the cells have differentiated. In some embodiments, a therapeutically effective amount of pluripotent cells or progeny of pluripotent cells in which at least a portion of the cells have differentiated is provided. In some embodiments, the pluripotent cells and / or their progeny are autologous. In some embodiments, the pluripotent cells and / or their progeny are allogeneic. In some embodiments, the pluripotent cells and / or their progeny are autologous. In some embodiments, the pluripotent cells and / or their progeny are HLA-matched allogeneic. In some embodiments, the pluripotent cells and / or their progeny are syngeneic. In some embodiments, the pluripotent cells and / or their progeny are xenogeneic. In some embodiments, the cell therapy may be autologous therapy, for example, using the subject's cells, generating pluripotent cells according to the methods described herein, and administering the pluripotent cells and / or progeny of such pluripotent cells in which at least a portion of the cells have differentiated to the subject. As used herein, a "subject in need of cell therapy" refers to a subject diagnosed with a disease due to the decline of natural cell or tissue types or natural pluripotent cells and / or multipotent cells (e.g., stem cells), or at risk of having or developing such a disease.

[0089] In some embodiments, using the methods described herein, for example, by administering allogeneic pluripotent cells obtained as described herein and / or their progeny, a genetic disorder such as Tay-Sachs disease or hemophilia can be treated.

[0090] In one aspect, a method of preparing cells or tissues that are compatible with cell therapy to be performed on a subject is described herein, the method including generating pluripotent cells (or more pluripotent cells) from cells according to the methods described herein, where the cells are autologous cells or HLA-matched allogeneic cells. In some embodiments, the pluripotent cells (or more pluripotent cells) can be differentiated along a predetermined cell lineage prior to administering the cells or tissues to the subject.

[0091] Pluripotent cells prepared according to the methods described herein, such as pluripotent stem cells, can be used for cancer treatment. For example, adding a hematopoietic stem cell transplant that regenerates the bone marrow hematopoietic system to high-dose chemotherapy can result in benefits from the use of pluripotent cells prepared as described herein.

[0092] Non-limiting examples of diseases due to the decline of natural cell or tissue types or natural pluripotent cells and / or multipotent cells include aplastic anemia, Fanconi anemia, and paroxysmal nocturnal hemoglobinuria (PNH). Other examples include, for example: acute leukemias including acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), acute biphenotypic leukemia, and acute undifferentiated leukemia; chronic leukemias including chronic myeloid leukemia (CML), chronic lymphocytic leukemia (CLL), juvenile chronic myeloid leukemia (JCML), and juvenile myelomonocytic leukemia (JMML); myeloproliferative disorders including acute myelofibrosis, angiogenic myeloid metaplasia (myelofibrosis), polycythemia vera, and essential thrombocythemia; lysosomal storage diseases including mucopolysaccharidosis (MPS), Hurler syndrome (MPS-IH), Scheie syndrome (MPS-IS), Hunter syndrome (MPS-II), Sanfilippo syndrome (MPS-III), Morquio syndrome (MPS-F), Maroteaux-Lamy syndrome (MPS-VI), Sly syndrome, beta-glucuronidase deficiency (MPS-VH), adrenoleukodystrophy, mucolipidosis II (I-cell disease), Krabbe disease, Gaucher disease, Niemann-Pick disease, Wolman disease, and metachromatic leukodystrophy; histiocytic disorders including familial erythrophagocytic lymphohistiocytosis, histiocytosis-X, and hemophagocytosis; phagocytic disorders including Chediak-Higashi syndrome, chronic granulomatous disease, neutrophil actin deficiency, and reticular dysgenesis; congenital platelet abnormalities including amegakaryocytosis / congenital thrombocytopenia; plasma cell disorders including multiple myeloma, plasma cell leukemia, and Waldenström macroglobulinemia. Other malignant diseases treatable by stem cell therapy include, but are not particularly limited to, breast cancer, Ewing sarcoma, neuroblastoma, and renal cell carcinoma.Other conditions treatable by stem cell therapy include lung disorders such as COPD and asthma; congenital immune disorders including ataxia-telangiectasia, Kostmann syndrome, leukocyte adhesion deficiency, DiGeorge syndrome, bare lymphocyte syndrome, Omenn syndrome, severe combined immunodeficiency (SCID), SCID with adenosine deaminase deficiency, SCID with absence of T and B cells, SCID with absent T cells and normal B cells, unclassified immunodeficiency, and X-linked lymphoproliferative disease; other hereditary disorders including Lesch-Nyhan syndrome, cartilage-hair hypoplasia, Glanzmann thrombasthenia, and marble bone disease; neurological conditions including acute and chronic stroke, traumatic brain injury, cerebral palsy, multiple sclerosis, amyotrophic lateral sclerosis, and epilepsy; heart conditions including atherosclerosis, congestive heart failure, and myocardial infarction; metabolic disorders including diabetes; and eye disorders including macular degeneration and optic atrophy. Such diseases or disorders can be treated by administering pluripotent cells themselves, administering agents that promote the desired differentiation, differentiating into the desired cell type in vivo with or without administration, and / or differentiating into the desired cell type in vitro, or administering at least partially differentiated pluripotent cells. Methods for diagnosing the above conditions are well known to physicians of ordinary skill in the art. In some embodiments, the subject may be one that has been treated with a treatment method including radiation therapy and has had a population of cells or stem cells removed, for example, the subject may be one that has cancer and has had its bone marrow removed by radiation therapy.

[0093] In some embodiments, pluripotent cells are administered to the subject. In some embodiments, at least partially differentiated cells are administered to the subject. In some embodiments, the method of cell therapy may further include differentiating the cells along a predetermined cell lineage prior to administering the pluripotent cells. Methods for differentiating stem cells along a desired cell lineage are known in the art and examples thereof are described herein.

[0094] In some embodiments, a composition comprising pluripotent cells obtained according to the methods described herein or at least partially differentiated cells that are progeny of such pluripotent cells is administered to a subject.

[0095] In some embodiments, a composition comprising pluripotent cells obtained according to the methods described herein or at least partially differentiated cells that are progeny of such pluripotent cells may further optionally comprise G-CSF, GM-CSF, and / or M-CSF, and / or may be administered to a subject to whom G-CSF, GM-CSF, and / or M-CSF has already been administered or is scheduled to be administered as a separate composition. Administration of G-CSF, GM-CSF, and / or M-CSF can, for example, induce a favorable inflammatory state for organ regeneration and for the removal of tissue debris, waste, and deposits.

[0096] In some embodiments, after culturing and generating pluripotent cells according to the methods described herein, administration of the pluripotent cells and / or at least partially differentiated progeny thereof can be carried out relatively soon (e.g., 1 hour, 2 hours, 5 hours, 10 hours, 24 hours, or 48 hours after generation). In some embodiments, after culturing and differentiating pluripotent cells according to the methods described herein, administration of at least partially differentiated progeny can be carried out relatively soon (e.g., 1 hour, 2 hours, 5 hours, 10 hours, 24 hours, or 48 hours after generation). In some embodiments, the pluripotent cells and / or at least partially differentiated progeny thereof can be cryopreserved at extremely low temperatures prior to administration.

[0097] In some aspects, the techniques described herein relate to a composition comprising pluripotent cells generated according to the methods described herein and / or at least partially differentiated progeny of such pluripotent cells. In some embodiments, a pharmaceutical composition comprises pluripotent cells generated according to the methods described herein and / or at least partially differentiated progeny of such pluripotent cells, and optionally a pharmaceutically acceptable carrier. The composition may further comprise at least one pharmaceutically acceptable excipient.

[0098] The pharmaceutical composition may contain suitable excipients or stabilizers and may be, for example, a solution, suspension, gel or emulsion. The composition usually contains about 0.01 to 99 percent, preferably about 5 to 95 percent, of cells together with a carrier. When the cells are combined with a pharmaceutically or physiologically acceptable carrier, excipient or stabilizer, it can be administered parenterally, subcutaneously, by implantation or by injection. For most therapeutic purposes, it can be administered by injection as a solution or suspension in a liquid form of cells. The term "pharmaceutically acceptable carrier" refers to a carrier for administering pluripotent cells prepared according to the methods described herein and / or progeny of at least a part of such pluripotent cells that have differentiated. Such carriers include, but are not limited to, physiological saline, buffered physiological saline, glucose, water, glycerol and combinations thereof. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation. For example, the carrier should not reduce the effect of the drug on the subject. In other words, the carrier is pharmaceutically inert and compatible with living cells.

[0099] Other suitable formulations may include aqueous and non-aqueous sterile injection solutions which may contain antioxidants, buffers, bacteriostatic agents, bactericidal antibiotics and solutes that render the formulation isotonic with the body fluids of the intended recipient. Aqueous and non-aqueous sterile suspensions may contain suspending and thickening agents. The formulation may be provided in a single-dose container or in a multi-dose container.

[0100] Examples of parenteral dosage forms include, but are not limited to, injectable solutions, injectable suspensions and emulsions. The parenteral dosage form can be prepared, for example, using a bioabsorbable scaffold material that retains pluripotent cells prepared according to the methods described herein and / or progeny of at least a part of such pluripotent cells that have differentiated.

[0101] The term "epigenetic modification" refers to chemical markings of the genome. Epigenetic markings can include methylation of DNA (imprinting), as well as methylation and acetylation of DNA-binding proteins such as histones. In mammals, parental-origin-specific gene expression (from either the maternal or paternal chromosome) is often observed, which is due to epigenetic modification. In the parental germ line, stable gene silencing or activation can occur due to epigenetic modification.

[0102] As used herein, the terms "administer" or "transplant" refer to placing cells into the body of a subject by a method or route that localizes at least a portion of the cells to a desired site such that a desired effect is achieved.

[0103] The pluripotent stem cells described herein and / or their at least partially differentiated progeny can be administered by any method that the clinician deems appropriate, such as, for example, local administration by injection of a cell suspension or local administration by implantation of a preparation in which the cells are deposited or grown on or within an implantable scaffold or support. Examples of implantable scaffolds can include any of a number of degradable or absorbable polymers or, for example, specifically silk scaffolds. Routes of administration suitable for the administration of pharmaceutical compositions containing the pluripotent stem cells described herein and / or their at least partially differentiated progeny are not particularly limited, but include local administration, such as intraperitoneal, parenteral, intracavitary or subcutaneous administration. As used herein, the phrases "parenteral administration" and "administered parenterally" refer to a mode of administration other than enteral and local administration, usually by injection, and include, but are not limited to, intraperitoneal, intradermal, subcutaneous injection and infusion. For administration, needles, catheters and syringes suitable for injection or surgical implantation can be used. The use of combinations of multiple delivery means and multiple delivery sites is contemplated to achieve the desired clinical effect.

[0104] The term "epigenetic modification" refers to chemical markings of the genome. Epigenetic markings can include methylation of DNA-binding proteins such as histones, as well as DNA methylation (imprinting), in addition to others. In mammals, parental-origin specific gene expression (from either the mother's or father's chromosome) is often observed, which is due to epigenetic modification. In the parental germline, stable gene silencing or activation can occur due to epigenetic modification.

[0105] In one embodiment, a therapeutically effective amount of the pluripotent stem cells described herein and / or at least a partially differentiated progeny thereof is administered to a subject. A "therapeutically effective amount" is an amount of the pluripotent stem cells described herein and / or at least a partially differentiated progeny thereof that is sufficient to bring about a measurable improvement in the symptoms or markers of the condition being treated. The actual level of cell administration in a therapeutic composition can vary such that an amount of cells effective to obtain a desired therapeutic response in a particular subject is administered. The administered level selected is not particularly limited, but is influenced by a variety of factors including, but not limited to, the activity of the therapeutic composition, the formulation, the route of administration, the combination with other drugs or therapies, the severity of the condition being treated, the health status of the subject, the prior history of the subject being treated, as well as the experience and judgment of the clinician or practitioner performing the treatment. The dosage and dosing schedule should generally be such as to retard, preferably inhibit, and more preferably reduce one or more symptoms or markers of the condition, in addition to retarding the progression of the condition. The determination and adjustment of a therapeutically effective amount, as well as the timing and manner of performing such adjustment, are known to those of ordinary skill in the medical arts.

[0106] The amount of pluripotent stem cells described herein and / or their at least partially differentiated progeny administered according to the methods described herein can be determined by the physician and adjusted as appropriate to suit the observed therapeutic effect. With regard to the duration and frequency of treatment, the point at which the treatment yields a therapeutic benefit is determined, and it is typical for a skilled clinician to monitor the subject to determine whether to administer additional cells at the same dosage, increase or decrease the dosage, discontinue the treatment, resume the treatment, or make other changes to the treatment regimen. Repeated administration may be required if the administered cells are expected to engraft and survive in the medium to long term. However, repeated administration may be carried out if the subject is tolerant, as necessary. The dosage should not be so high as to cause substantial adverse side effects. In addition, in the event of any complications, the individual physician may adjust the dosage. However, the dosage is usually in the range of 100 to 1×10 9 cells, for example, 100 to 10,000 cells, 1,000 to 100,000 cells, 10,000 to 1,000,000 cells, or 1,000,000 to ×10 9 cells for adult humans. The effective amount can be extrapolated from a dose-response curve obtained, for example, by a bioassay or system in an animal model test.

[0107] Optionally, a therapeutic composition comprising the pluripotent stem cells described herein and / or at least partially differentiated progeny thereof prepared as described herein is tested in one or more suitable in vitro and / or in vivo disease animal models, such as SCID mouse models, according to methods well known in the art to confirm efficacy, evaluate in vivo proliferation of the transplanted cells, and estimate the dosage. Specifically, initially, the dosage can be determined by appropriate measures, such as activity and stability during treatment compared to untreated in relevant assays (e.g., comparison between treated and untreated animal models), in the treatment animals. When determining the effective amount of the pluripotent stem cells described herein and / or at least partially differentiated progeny thereof, the physician evaluates, among other criteria, the proliferation and volume of the transplanted cells and the progression of the condition being treated. The dosage may vary depending on the dosage form used and the route of administration utilized.

[0108] With respect to the treatment methods described herein, administration of the pluripotent stem cells described herein and / or at least partially differentiated progeny thereof is not limited to a specific mode of administration, dosage, or frequency of administration. All modes of administration are contemplated, including, but not limited to, intramuscular, intravenous, intraperitoneal, intravesical, intra-articular, intralesional, subcutaneous, and any route sufficient to provide a dosage sufficient to treat the condition being treated.

[0109] In some embodiments, the methods described herein can be used to generate pluripotent cells in vivo. For example, cells present in the body of a subject can be exposed to the stresses described herein to acquire a pluripotent phenotype. The method of applying the stresses described herein to cells in vivo will readily become apparent. For example, a weak acid solution may be introduced by injection and / or direct application to a tissue, or the temperature may be changed by a probe or non-invasive method, such as focused beam irradiation, that can heat or cool the surrounding tissue. Pluripotent in vivo regulation can be used to increase, for example, tissue regeneration or wound healing. As a non-limiting example, weak acid can be injected into an arthritic knee joint to induce knee joint cells (e.g., synovial cells or chondrocytes) that exhibit a pluripotent phenotype to generate new tissue. As a further non-limiting example, treatment of a subject with a stroke or central nervous system injury (e.g., spinal cord injury) can be mentioned. After the inflammation has subsided, cells adjacent to the damaged area can be treated with the stresses described herein to generate pluripotent cells that can regrow and / or regenerate or repair the damaged tissue.

[0110] In a further non-limiting example, (e.g., by demethylase treatment) changing the epigenetic state can convert non-insulin secreting cells (e.g., pancreatic alpha glucagon cells) into insulin secreting cells (e.g., beta cells). Thus, by treating non-insulin secreting cells (e.g., pancreatic alpha glucagon cells) according to the methods described herein, cells that become insulin secreting cells, such as beta-like cells, can be generated either in vivo or in vitro.

[0111] Furthermore, the pluripotent cells described herein are contemplated to be capable of fusing with other cells (i.e., "recipient cells"), such as cells not treated according to the methods described herein, non-pluripotent cells, mature cells, malignant cells, and / or damaged cells. Cell fusion may increase the level of expression and / or activity of cell repair enzymes in recipient cells compared to before fusion. This may, for example, improve the health and / or function of recipient cells by increasing the repair of cell damage, mutations, and / or modifications of the epigenetic state in recipient cells.

[0112] In some embodiments, by increasing the pluripotency of cells in vivo, the epigenetic markers (e.g., DNA methylation, demethylation, and / or hydroxymethylation status) of those cells can be regulated. Regulation of epigenetic markers is thought to be involved, for example, in malignant diseases, arthritis, autoimmune diseases, aging, etc., and it is contemplated to treat such epigenetics-related pathologies according to the methods described herein.

[0113] In some embodiments, multiple tissues can be treated simultaneously in vivo. For example, it is considered possible to induce a weakly acidic state in multiple organs, such as continuously or simultaneously (e.g., brain, heart, liver, lung, and / or thyroid), to treat widespread damage or aging.

[0114] Furthermore, it is contemplated to combine the in vivo treatment of the cells described herein with the administration of pluripotent cells prepared as described herein and / or their at least partially differentiated progeny.

[0115] It is contemplated herein that the methods described herein can be used to treat, for example, a fetus or embryo in utero.

[0116] The effectiveness of the treatment can be evaluated, for example, by measuring markers, indicators, symptoms, or incidence rates of the disease state to be treated described herein, or any other measurable and appropriate parameter, such as the number of progeny of pluripotent cells. Monitoring the effectiveness of treatment or prevention by measuring any one or a combination of such parameters is well within the ability of those skilled in the art.

[0117] An effective treatment is revealed when a statistically significant improvement is observed in one or more markers, indicators, or symptoms of the disease state to be treated, or when no worsening or manifestation of symptoms expected in the absence of treatment is observed. By way of example, a favorable change of at least about 10%, preferably at least about 20%, about 30%, about 40%, about 50% or more in a measurable parameter of the disease state can be an indicator of an effective treatment. The effectiveness of pluripotent cells prepared according to the methods described herein and / or progeny differentiated from at least a portion of such pluripotent cells can also be determined using experimental animal models known in the art for the disease states described herein. When using an experimental animal model, a statistically significant change in the number of hematopoietic cells present in a mouse body after removing the bone marrow and treating with the pluripotent cells described herein, for example, indicates the effectiveness of the treatment.

[0118] In one aspect, a method of producing pluripotent cells capable of differentiating into placental cells is described, the method comprising culturing pluripotent cells obtained according to the methods described herein in the presence of FGF4. In some embodiments, the pluripotent cells are capable of differentiating into embryonic stem cells. In some embodiments, the concentration of FGF4 is from about 1 nM to about 1 μM. In some embodiments, the concentration of FGF4 is 1 nM to 1 μM. In some embodiments, the concentration of FGF4 is from about 5 nM to about 500 nM. In some embodiments, the concentration of FGF4 is from about 10 nM to about 100 nM.

[0119] In some aspects, the technology described herein relates to a system for generating pluripotent cells from cells, the system including removing some cytoplasm and / or mitochondria from the cells.

[0120] A system for generating pluripotent cells from cells according to the methods described herein may include a container that exposes the cells to stress. The container may be suitable for culturing somatic cells and / or pluripotent cells, for example, when culturing the cells under hypoxic conditions for several days or more to reduce the amount of cytoplasm and / or mitochondria according to the methods described herein. Alternatively, the container may be suitable for stressing the cells, for example, when milling the cells for a short time, such as less than 1 hour, with a device having a narrow opening, but not suitable for culturing the cells. The container may be, for example, a conduit, a tube, a microfluidic device, a pipette, a bioreactor, or a cell culture dish. The container may be held in an environment that provides conditions suitable for the manipulation and / or culture of somatic cells and / or pluripotent cells (for example, placed in an incubator), or in an environment that causes environmental stress to the cells (for example, placed in an incubator that provides an environment with a low oxygen content). The container may be designed to provide one or more of the environmental stresses described above herein, for example, one, two, three, or more stresses. Containers suitable for the manipulation and / or culture of somatic cells and / or pluripotent cells are well known to those skilled in the art and are commercially available (for example, catalog number CLS430597, Sigma-Aldrich; St. Louis, Missouri). In some embodiments, the container is a microfluidic device. In some embodiments, the container is a dish, flask, or plate for cell culture.

[0121] In some embodiments, the system may further include means for selecting pluripotent cells. For example, the system can select cells that express a pluripotency marker (e.g., Oct4-GFP) or can include a FACS system that selects by size as described above herein. Methods and apparatuses for selecting cells are well known to those skilled in the art. For example, BD FACSARIA SORP (trademark) (catalog number 643629) combined with BD LSRIF (trademark) and BD FACSDIVA (trademark) software, manufactured by BD Biosciences (Franklin Lakes, NJ), is commercially available.

[0122] In some embodiments, cells that are not present in the tissue are supplied to the system. In some embodiments, the tissue is supplied to the system, and the system further includes means for isolating one or more types of cells. By way of non-limiting example, the system can include a cell homogenizer. Cell homogenizers and methods of using them are known in the art and are commercially available (e.g., FASTH21 (trademark), catalog number 21-82041, Omni International; Kennesaw, GA). Alternatively, the system can include a centrifuge for processing blood or body fluid samples.

[0123] In some embodiments, the system can be automated. Methods for automating cell isolation, cell culture, and selection apparatuses are known in the art and are commercially available. For example, there is the FASTH21 (trademark) Tissue Homogenizer (catalog number 21-82041, Omni International; Kennesaw, GA) and BD FACSARIA SORP (trademark).

[0124] In some embodiments, the system can be sterile. For example, the system can be operated in a sterile environment or can be operated as a closed sterile system.

[0125] In one aspect, a method for increasing the self-renewal ability of pluripotent cells is described herein, the method including culturing the cells in the presence of adrenocorticotropic hormone (ACTH), 2i or 3i medium. As used herein, "self-renewal ability" refers to the length of time that cells can be cultured and passaged in vitro, for example, the number of passages that cells and their progeny can continue to produce viable cells. Cells whose self-renewal ability is increased according to the methods described herein can be, for example, totipotent cells and / or cells generated by exposing to stress as described elsewhere herein.

[0126] In some embodiments, culturing in the presence of ACTH can include culturing the cells in a cell culture medium containing from about 0.1 μΜ to about 1,000 μΜ, such as from about 0.1 μΜ to about 100 μΜ, from about 0.1 μΜ to about 10 μΜ or including about 10 μΜ. In some embodiments, culturing in the presence of ACTH can include culturing the cells in LIF medium containing ACTH. LIF, ACTH, 2i and 3i are commercially available and well-known in the art. For example, ACTH can be purchased from Sigma-Aldrich (catalog number A0673; St. Louis, Missouri), LIF medium can be purchased from Millipore (e.g., catalog number ESG1107; Billerica, Massachusetts), and 3i can be purchased from Stem Cells (e.g., as "iSTEM Stem Cell Culture Medium" of catalog number SCS-SF-ES-01; Newark, California).

[0127] In some embodiments, the culturing can be carried out for at least 3 days, such as at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days or more. After the culturing stage, the cells can be maintained under conditions suitable for maintaining pluripotent cells as described elsewhere herein.

[0128] In some embodiments, after the culturing step, the cells may express a detectable and / or increased level of a stem cell marker. Stem cell markers and methods for their detection are described elsewhere in this specification. In some embodiments, the stem cell marker may be selected from the group consisting of Oct3 / 4; Nanog; Rex1; Klf4; Sox2; Klf2; Esrr-beta; Tbx3; and Klf5.

[0129] In one aspect, provided herein is a method for generating pluripotent cells or STAP cells, which is an improved method over the prior methods, for example, a method that results in an improvement in efficiency, quality and / or yield.

[0130] In one embodiment, provided herein is a method for generating pluripotent cells or STAP cells, for example, from cell suspension and / or tissue culture conditions.

[0131] As a first step, the initial cells (e.g., starting material) in the suspension can be pelleted and / or removed from the solution. As just one example, the cells can be pelleted by placing them in a centrifuge tube and centrifuging at about 800 rpm to about 1600 rpm for about 1 minute to about 20 minutes. As just one example, the cells can be pelleted by placing them in a centrifuge tube and centrifuging at about 1200 rpm for 5 minutes. In some embodiments, the cells in the suspension can be contacted with a digestive enzyme such as trypsin before being pelleted and / or removed from the solution. As just one example, about 0.01% to about 0.5% trypsin-EDTA (Gibco: 25300-054) can be added to the tissue culture dish containing the cells for about 1 to about 20 minutes to detach the adherent cells and then added to the centrifuge tube. As just one example, 0.05% trypsin-EDTA (Gibco: 25300-054) can be added to the tissue culture dish containing the cells for about 3 to 5 minutes to detach the adherent cells and then added to the centrifuge tube. In embodiments involving centrifugation, after centrifugation, the supernatant can be aspirated to the height of the cell pellet.

[0132] In some embodiments, the first step is performed on a population consisting of at least one million live cells. In some embodiments, the first step is performed on a population consisting of at least five million live cells. In some embodiments, the first step is performed on a population consisting of at least ten million live cells.

[0133] As a second step, the cells can be resuspended in a physiological saline solution, such as HBSS (Hank's Balanced Salt Solution) (e.g., HBSS Ca + Mg + Free: Gibco, 14170-112). In some embodiments, the cells can be resuspended at a concentration of about 1×10 3 cells / mL to about 1×10 9 cells / mL. In some embodiments, the cells can be resuspended at a concentration of about 1×10 5 cells / mL to about 1×10 7 cells / mL. In some embodiments, the cells can be resuspended at a concentration of about 1×10 6 . In some embodiments, the cells can be resuspended in a 50 mL tube. In some embodiments, the cells can be resuspended in 2-3 mL of HBSS in a 50 mL tube.

[0134] As a third step, the cells in the suspension / solution can be triturated, for example, passed through openings, holes, and / or lumens that are small enough to generate shear stress. In the exemplary embodiments described later herein, the openings, holes, and / or lumens are constituted by a glass pipette having holes of the size described later herein. Trituration can be performed by a number of alternative means. Non-limiting examples include openings, lumens, or flow paths of a microfluidic device, a cell processing device having a pump and tubing, passing a cell suspension through a grid or filter, flowing a cell suspension through a gate or particles, etc. One skilled in the art can experimentally determine the pressure, flow rate, shear stress, etc. suitable for various trituration systems based on the present disclosure. Further discussion of fluid stress and calculations related to such stress can be found, for example, in Foumier "Basic Transport Phenomena in Biomedical Engineering" Taylor & Francis, 1999 (incorporated herein by reference in its entirety).

[0135] In some embodiments, trituration can be continued for about 10 minutes to about 2 hours, such as about 20 minutes to about 1 hour or about 30 minutes. In some embodiments, trituration can be continued for at least 10 minutes, such as 10 minutes or more, 20 minutes or more, 30 minutes or more, 40 minutes or more, 50 minutes or more, or 60 minutes or more. In some embodiments, trituration can be continued until the suspension is easily triturated through the holes or lumens. In some embodiments, trituration at the last opening or lumen can be continued until the suspension easily passes through that opening or lumen. In some embodiments, trituration at each opening or lumen can be continued until the suspension easily passes through that opening or lumen.

[0136] In some embodiments, trituration can include passing through a series of holes or lumens, such as a series of holes or lumens that gradually decrease in size. In some embodiments, the series of holes or lumens can include at least two holes or lumens, such as 2, 3, 4, 5, 10, 20, 50 or more holes or lumens. In some embodiments, one or more holes or lumens can be pre-coated, for example, with HBSS or water.

[0137] As a mere illustrative embodiment, cells can be triturated by passing through a plurality of holes or lumens, such as 3 holes or lumens. In some embodiments, the first hole or lumen can have an inner diameter of about 0.5 mm to about 2.0 mm. In some embodiments, the first hole or lumen can have an inner diameter of about 0.7 mm to about 1.5 mm. In some embodiments, the first hole or lumen can have an inner diameter of about 1.1 mm. In some embodiments, trituration through the first opening or lumen can be performed for about 1 minute to about 10 minutes. In some embodiments, trituration through the first opening or lumen can be performed for about 5 minutes. As a mere illustrative embodiment, the first hole or lumen is constituted by a standard 9-inch (about 23 cm) glass pipette (for example, Fisher brand 9” Disposable Pasteur Pipettes: 13-678-20D), and the cells can be aspirated and discharged with a pipette with a considerable amount of force for 5 minutes to triturate the suspension and dissociate cell aggregates and any bound debris.

[0138] In some embodiments, the last two openings or lumens in the series can have inner diameters of about 90 to about 200 microns and about 25 microns to about 90 microns. In some embodiments, the last two openings or lumens in the series can have inner diameters of about 100 to about 150 microns and about 50 microns to about 70 microns. In some embodiments, trituration can include trituration for about 5 to about 20 minutes up to the second to last opening or lumen and trituration for about 5 to about 20 minutes in the last opening or lumen. In some embodiments, trituration can include trituration for 10 minutes up to the second to last opening or lumen and trituration for about 15 minutes in the last opening or lumen.

[0139] As merely an exemplary embodiment, the last two holes or lumens can be constituted by pipettes modified as follows: Prepare two pipettes with extremely small openings by tip-heating, as follows: Heat a standard 9-inch (about 23 cm) glass pipette, for example, with a Bunsen burner, and then stretch the distal (molten) end of the pipette by pulling until the lumen collapses and the tip breaks off, leaving the glass tip in a sharp, closed-hole state. After waiting for the pipette to cool, break off the closed tip of the hole until an extremely small lumen can be confirmed. Repeat the same process for the second pipette, but break it off at a slightly more proximal location than the first one, making the distal lumen slightly larger. The larger lumen should have a diameter of about 100 - 150 microns, while the lumen of the other pipette should be smaller, about 50 - 70 microns. The cell suspension can be triturated with the pipette having the larger lumen for 10 minutes. Thereafter, it can be further triturated with the pipette having the smaller lumen (50 - 70 microns) for 15 minutes. Continue triturating until the suspension can easily move up and down in the tip-heated pipette with the smaller inner diameter. Each pipette may be pre-coated with the medium. Additionally, when triturating, it is necessary to avoid sucking air and generating bubbles or air pockets in the cell suspension.

[0140] In some embodiments, trituration may be performed at a rate of about 1 to about 200 cycles per minute, for example, passing the entire suspension through the opening, lumen, or hole 1 to 100 times per minute. In some embodiments, trituration may be performed at a rate of about 10 to about 60 cycles per minute. In some embodiments, trituration may be performed at a rate of about 40 cycles per minute. In some embodiments, when using a pipette for trituration, the suspension can be aspirated and discharged with the pipette about 20 times per minute.

[0141] In the next step, the triturated cells can be isolated from the suspension. In some embodiments, about 0 to 50 volumes of HBSS can be added to the triturated suspension, and after centrifuging the suspension at about 800 to 1600 rpm for about 1 minute to about 30 minutes, the supernatant can be aspirated. In some embodiments, about 9 volumes of HBSS can be added to the triturated suspension, and after centrifuging the suspension at about 1200 rpm for about 5 minutes, the supernatant can be aspirated.

[0142] In the next step, the cells can be resuspended in HBSS, and the pH of the resulting suspension can be adjusted to about 5.0 to about 6.0. In some embodiments, the pH of the resulting suspension can be about 5.4 to about 5.8. In some embodiments, the pH of the resulting suspension can be about 5.6 to about 5.7. In some embodiments, the pH of the resulting suspension can be about 5.6. In some embodiments, the pH of the HBSS solution before mixing with the cells can be about 5.0 to about 5.7. In some embodiments, the pH of the HBSS solution before mixing with the cells can be about 5.3 to about 5.6. In some embodiments, the pH of the HBSS solution before mixing with the cells can be about 5.4. In some embodiments, the cells can be resuspended at a concentration of about 2×10 4 cells / mL to about 2×10 8 cells / mL. In some embodiments, the cells can be resuspended at a concentration of 2×10 6 cells / mL.

[0143] Merely as an exemplary specific example, the resuspension step in the previous paragraph can be carried out as follows: When making the solution acidic, immediately after adding an acid to Hank's solution, gently pipette the solution for 10 seconds using a 5 ml pipette. Since HBSS has extremely low buffering capacity, if there is even a small amount of the solution transferred from the supernatant of the previous suspension, the pH of HBSS will be significantly affected. The following instructions show a method for preparing HBSS with a pH of 5.6 to 5.7, which is optimal for STAP cell generation according to the embodiments of this experiment. First, titrate the pH of pre-cooled HBSS (4°C) to pH 5.6 with 12 N HCl. This titration is carried out by gradually adding 11.6 μl of 12 N HCl to 50 ml of HBSS. After confirming this pH, sterilize the solution by passing it through a 0.2 micron syringe filter or a bottle top filter and placing it in a new sterile container for storage. For example, when finishing the first pilot experiment using an appropriate number of cells, it is desired to confirm that the final pH is 5.6 to 5.7. Since the pH of HBSS is extremely important, check the pH of the solution each time before use, titrate again, and sterilize again.

[0144] In the next step, the cells in the HBSS suspension can be incubated near their in vivo temperature. For example, if they are mammalian cells, they can be incubated at about 37°C. In some embodiments, the incubation can be from about 5 minutes to about 3 hours. In some embodiments, the incubation can be from about 10 minutes to about 1 hour. In some embodiments, the incubation can be from about 15 minutes to about 40 minutes. In some embodiments, the incubation can be about 25 minutes.

[0145] In the next step, the cells are isolated from the acidic HBSS solution. Merely as one example, the cells can be pelleted by placing them in a centrifuge tube and centrifuging at about 800 rpm to about 1600 rpm for about 1 minute to about 20 minutes. Merely as one example, the cells can be pelleted by placing them in a centrifuge tube and centrifuging at about 1200 rpm for about 5 minutes. In some embodiments, the supernatant can then be aspirated.

[0146] In the next step, the cells can be resuspended in a medium suitable for the maintenance and / or selection of pluripotent cells. In some embodiments, the medium is a sphere medium. As used herein, "sphere medium" refers to DMEM / F12 supplemented with 1% antibiotic and 2% B27 (Gibco, 12587-010). In some embodiments, the medium may further contain growth factors, such as b-FGF (20 ng / ml), EGF (20 ng / ml), and heparin (0.2%, Stem Cell Technologies, 07980). These factors are adjusted according to the cell type used. For example, in some embodiments, when the cells are mouse cells, LIF (1000 U) can be added. In some embodiments, replenishment such as bFGF, EGF, and heparin may be required. In some embodiments, the cells can be resuspended in the medium at a concentration of 10 5 cells / cc.

[0147] In the next step, the cells can be cultured and / or maintained, for example, cultured at 5% CO2 and 37°C. In some embodiments, the cells can be stirred during culturing / maintaining to prevent them from adhering to the cell culture vessel. In some embodiments, for the first week, the cells can be gently pipetted for 2 minutes twice a day, for example, using a 5 ml pipette, so that the cells do not adhere to the bottom of the dish. In some embodiments, this can promote good sphere formation. In some embodiments, the sphere medium optionally containing supplements can be added every other day. For example, for a 10 cm culture dish, 1 ml is added per day, or for a 6 cm dish, 0.5 ml is added per day.

[0148] In a second embodiment, a method for generating pluripotent cells or STAP cells from soft tissue that may contain, for example, red blood cells (RBC) is provided herein. Such tissues may include, but are not limited to, the liver, spleen, and lung.

[0149] In the first stage, soft tissue (e.g., excised and washed sterile organ tissue) is mechanically sliced thinly, minced, dissected, and / or macerated. In some embodiments, this stage can be carried out in the presence of digestive enzymes and / or enzymes that degrade ECM. In some embodiments, the enzyme can be collagenase. In this specification, based on the ECM of the tissue and the components of the connective tissue, it is considered that the type of collagenase or enzyme suitable for digestion varies depending on the organ tissue. A person skilled in the art can easily determine the enzyme suitable for each tissue type. In some embodiments, the tissue is the spleen and does not require an enzyme. As a mere illustrative example, using a dissecting scalpel and / or forceps, the tissue can be minced and dissected for about 1 minute to about 30 minutes until the tissue appears uniformly gelatinous, increasing the surface area exposed to collagenase. As a mere illustrative example, using a dissecting scalpel and / or forceps, the tissue can be minced and dissected for about 10 minutes. In some embodiments, additional enzymes can be added and the tissue can be incubated with the enzyme while optionally stirring. As a single example, the tissue can be stored in an incubator / shaker at 37°C and 90 RPM for 30 minutes. In some embodiments, after enzyme exposure and / or mechanical disruption, the tissue can be diluted with HBSS.

[0150] In the next stage, the cells in the suspension can be triturated, for example, passed through holes or lumens small enough to cause shear stress, for example. In some embodiments, trituration can be continued for about 10 minutes to about 2 hours, for example, about 20 minutes to about 1 hour or about 30 minutes. In some embodiments, trituration can be continued for at least 10 minutes, for example, 10 minutes or more, 20 minutes or more, 30 minutes or more, 40 minutes or more, 50 minutes or more, or 60 minutes or more. In some embodiments, trituration can be continued until the suspension is easily triturated through the holes or lumens. In some embodiments, trituration at the last opening or lumen can be continued until the suspension easily passes through that opening or lumen. In some embodiments, trituration at each opening or lumen can be continued until the suspension easily passes through that opening or lumen.

[0151] In some embodiments, trituration can include passing through a series of holes or lumens, such as a series of holes or lumens that gradually decrease in size. In some embodiments, the series of holes or lumens can include at least two holes or lumens, such as 2, 3, 4, 5, 10, 20, 50 or more holes or lumens. In some embodiments, one or more holes or lumens can be pre-coated, for example, with HBSS or water.

[0152] As a mere exemplary embodiment, cells can be triturated by passing through three holes or lumens. In some embodiments, the first hole or lumen can have an inner diameter of about 0.5 mm to about 2.0 mm. In some embodiments, the first hole or lumen can have an inner diameter of about 0.7 mm to about 1.5 mm. In some embodiments, the first hole or lumen can have an inner diameter of about 1.1 mm. In some embodiments, trituration through the first opening or lumen can be performed for about 1 minute to about 10 minutes. In some embodiments, trituration through the first opening or lumen can be performed for about 5 minutes. As a mere exemplary embodiment, the first hole or lumen can be constituted by a standard 9-inch (about 23 cm) glass pipette (for example, Fisher brand 9” Disposable Pasteur Pipettes: 13-678-20D), and the cells can be aspirated and discharged with a pipette with a considerable amount of force for 5 minutes to triturate the suspension and dissociate cell aggregates and any attached debris.

[0153] In some embodiments, the last two openings or lumens in the series can have inner diameters of about 90 to about 200 microns and about 25 microns to about 90 microns. In some embodiments, the last two openings or lumens in the series of openings or lumens can have inner diameters of about 100 to about 150 microns and about 50 microns to about 70 microns. In some embodiments, trituration can include trituration for about 5 to about 20 minutes through the second to last openings or lumens and trituration for about 5 to about 20 minutes in the last opening or lumen. In some embodiments, trituration can include trituration for 10 minutes through the second to last openings or lumens and trituration for about 15 minutes in the last opening or lumen.

[0154] As merely exemplary embodiments, the last two holes or lumens can be constituted by pipettes modified as follows: Prepare two pipettes with extremely small openings by tip heat treatment as follows: Heat a standard 9-inch (about 23 cm) glass pipette with a Bunsen burner, then stretch the distal (molten) end of the pipette by pulling until the lumen collapses and the tip breaks off, leaving the glass tip pointed with the hole closed. After waiting for the pipette to cool, break off the closed tip of the hole until an extremely small lumen can be confirmed. Repeat the same process for the second pipette, but break it off at a slightly more proximal location than the first one to make the distal lumen slightly larger. The larger lumen should have a diameter of about 100-150 microns, while the lumen of the other pipette should be smaller, about 50-70 microns. The cell suspension can be triturated through the pipette with the larger lumen for 10 minutes. Thereafter, it can be further triturated through the pipette with the smaller lumen (50-70 microns) for 15 minutes. Continue triturating until the suspension can easily move up and down in the tip heat-treated pipette with the smaller inner diameter. Each pipette may be pre-coated with the medium. Additionally, when triturating, it is necessary to avoid sucking air and generating bubbles or air pockets in the cell suspension.

[0155] In some embodiments, trituration may be performed at a rate of about 1 to about 200 cycles per minute, for example, passing the entire suspension through the opening, lumen, or hole 1 to 100 times per minute. In some embodiments, trituration may be performed at a rate of about 10 to about 60 cycles per minute. In some embodiments, trituration may be performed at a rate of about 40 cycles per minute. In some embodiments, when using a pipette for trituration, the suspension can be aspirated and discharged with the pipette about 20 times per minute.

[0156] In the next step, non-RBC lysed cells can be isolated from red blood cells. In some embodiments, about 0 to 50 volumes of HBSS can be added to the lysed suspension, and then 0.1 to 20 volumes of an RBC isolation solution can be added. Those skilled in the art are aware of solutions for isolating RBCs, such as Lympholyte or beads having RBC-specific antibodies.

[0157] As merely exemplary embodiments, after lysis, HBSS can be added to the cells, and then 1 volume of Lympholyte can be added to the bottom of the tube to form a good bilayer. In some embodiments, the two solutions should not be mixed. This mixture can be centrifuged at 1000 g for 10 minutes. The tube can be rotated 180° and centrifuged again at 1000 g for an additional 10 minutes. This causes the red blood cells to form a pellet at the bottom of the tube. Using a standard 9-inch (about 23 cm) glass pipette, the cell suspension between the HBSS and the Lympholyte is aspirated and placed into a new 50 ml tube. HBSS can be added to this suspension until the total volume of HSBB is 20 ml, and then the suspension can be agitated by pipetting with a 5 ml pipette for 1 minute.

[0158] In the next step, cells are isolated from the HBSS solution. As just one example, the cells can be pelleted by placing them in a centrifuge tube and centrifuging at about 800 rpm to about 1600 rpm for about 1 minute to about 20 minutes. As just one example, the cells can be pelleted by placing them in a centrifuge tube and centrifuging at about 1200 rpm for about 5 minutes. In some embodiments, in the next step, the cells are resuspended in HBSS and the pH of the resulting suspension can be adjusted to about 5.0 to about 6.0. In some embodiments, the pH of the resulting suspension can be about 5.4 to about 5.8. In some embodiments, the pH of the resulting suspension can be about 5.6 to about 5.7. In some embodiments, the pH of the resulting suspension can be about 5.6. In some embodiments, the pH of the HBSS solution before mixing with the cells can be about 5.0 to about 5.7. In some embodiments, the pH of the HBSS solution before mixing with the cells can be about 5.3 to about 5.6. In some embodiments, the pH of the HBSS solution before mixing with the cells can be about 5.4. In some embodiments, the cells can be resuspended at a concentration of about 2×10 4 cells / mL to about 2×10 8 cells / mL. In some embodiments, the cells can be resuspended at a concentration of 2×10 6 .

[0159] As a mere illustrative specific example, the resuspension step of the previous paragraph can be carried out as follows: When making the solution acidic, immediately after adding an acid to Hank's solution, gently pipette the solution with a 5 ml pipette for 10 seconds. Since HBSS has extremely low buffering capacity, if there is even a small amount of the solution transferred from the supernatant of the previous suspension, the pH of HBSS will be significantly affected. The following instructions show a method for preparing HBSS with a pH of 5.6 to 5.7, which is optimal for STAP cell generation according to an embodiment of this experiment. First, titrate the pH of pre-cooled HBSS (4 °C) to pH 5.6 with 12 N HCl. This titration is carried out by gradually adding 11.6 μl of 12 N HCl to 50 ml of HBSS. After confirming this pH, sterilize the solution by passing it through a 0.2 micron syringe filter or a bottle top filter and placing it in a new sterile container for storage. It is desired to confirm that the final pH is 5.6 to 5.7 when finishing the first pilot experiment using an appropriate number of cells. Since the pH of HBSS is extremely important, check the pH of the solution each time before use, titrate it again, and sterilize it again.

[0160] In the next step, the cells in the HBSS suspension can be incubated near their in vivo temperature. For example, if they are mammalian cells, they can be incubated at about 37 °C. In some embodiments, the incubation can be from about 5 minutes to about 3 hours. In some embodiments, the incubation can be from about 10 minutes to about 1 hour. In some embodiments, the incubation can be from about 15 minutes to about 40 minutes. In some embodiments, the incubation can be about 25 minutes.

[0161] In the next step, the cells are isolated from the acidic HBSS solution. As a mere example, the cells can be pelleted by placing them in a centrifuge tube and centrifuging at about 800 rpm to about 1600 rpm for about 1 minute to about 20 minutes. As a mere example, the cells can be pelleted by placing them in a centrifuge tube and centrifuging at about 1200 rpm for about 5 minutes. In some embodiments, the supernatant can then be aspirated.

[0162] In the next step, the cells can be resuspended in a medium suitable for the maintenance and / or selection of pluripotent cells. In some embodiments, the medium is a sphere medium. As used herein, "sphere medium" refers to DMEM / F12 supplemented with 1% antibiotic and 2% B27 (Gibco, 12587-010). In some embodiments, the medium may further contain growth factors such as b-FGF (20 ng / ml), EGF (20 ng / ml), and heparin (0.2%, Stem Cell Technologies, 07980). In some embodiments, when the cells are mouse cells, LIF (1000 U) can be added. In some embodiments, replenishment such as bFGF, EGF, and heparin may be required. In some embodiments, the cells are 10 5 cells / cc concentration can be resuspended in the medium.

[0163] In the next step, the cells can be cultured and / or maintained, for example, at 5% CO2 and 37 °C. In some embodiments, the cells can be agitated to prevent attachment to the cell culture vessel during culturing / maintaining. In some embodiments, for the first week, the cells can be gently pipetted for 2 minutes twice a day using a 5 ml pipette so that the cells do not attach to the bottom of the dish. In some embodiments, this can promote good sphere formation. In some embodiments, the sphere medium optionally containing supplements can be added every other day. For example, 1 ml per day is added for a 10 cm culture dish, or 0.5 ml per day is added for a 6 cm dish.

[0164] In one aspect, a method for treating neurological injury in a vertebrate is described herein, the method comprising administering to a vertebrate in need of treatment for neurological injury a vertebrate pluripotent cell (including the "more pluripotent" cells described herein) or STAP cell as described herein. In some embodiments, the cells to be administered are cells generated by the improved methods described herein, such as the two aspects and / or the method of Example 5 immediately above. In some embodiments, the cells can be administered in the form of a scaffold, hydrogel or sustained release formulation. In some embodiments, the cells can be autologous to the vertebrate. In some embodiments, the cells are generated from neural tissue. In some embodiments, the vertebrate is in need of treatment for neurotoxin exposure, acute nerve injury, chronic nerve injury and / or neurodegenerative disease. In some embodiments, the neurological injury can include injury to the spinal cord, nerves and / or brain. In some embodiments, the vertebrate can be a rodent, such as a mouse or rat. In some embodiments, the vertebrate can be a canine, feline, dog, cat, livestock, horse or primate, such as a human. In some embodiments, the method can include repeated administration, such as administration two or more times, three or more times, four or more times or more. In some embodiments, the cells can be administered to the site of injury, such as surgically implanted and / or injected.

[0165] In one aspect, a kit is provided herein that includes a pipette having a hole diameter of about 90 to about 200 microns and / or a pipette having a hole diameter of about 25 microns to about 90 microns. In some embodiments, the first pipette has a hole diameter of about 100 to about 150 microns and the second pipette has a hole diameter of about 50 microns to about 70 microns.

[0166] In some embodiments, the kit can further include an additional pipette having a hole diameter of about 0.5 mm to about 2.0 mm. In some embodiments, the pipette can have a hole diameter of about 0.7 mm to about 1.5 mm. In some embodiments, the pipette can have a hole diameter of 1.1 mm.

[0167] In some embodiments, alternatively, a kit can be provided that has an apparatus having an opening and / or lumen of the diameter described above with respect to the pipette, e.g., a microfluidic device having an opening or lumen of the described inner diameter.

[0168] In some embodiments, the kit can further include HBSS. In some embodiments, the HBSS can have a pH of from about 5.0 to about 5.7. In some embodiments, the HBSS can have a pH of from about 5.3 to about 5.6. In some embodiments, the HBSS can have a pH of about 5.4. In some embodiments, the kit can further include an acid for titrating the pH of the HBSS. In some embodiments, the acid is HCl. In some embodiments, the kit can further include a sphere medium and, optionally, a growth factor.

[0169] A kit is any product (e.g., a package or container) that includes at least one multi-electrode array according to various embodiments herein, and this product is promoted, distributed, or sold as a unit for performing the methods or assays described herein. The kits described herein include reagents and / or components that enable the generation, culture, and / or selection of pluripotent cells. The kits described herein can optionally include additional components useful for performing the methods and assays described herein. Such reagents can include, for example, cell culture media, growth factors, differentiation factors, buffers, labels, imaging reagents, and the like. Such components are known to those of skill in the art and can vary depending on the specific cells and the method or assay being performed. Further, the kit may include an instruction pamphlet and / or provide information regarding the validity of the results obtained.

[0170] The description of the embodiments of the present disclosure is not intended to be exhaustive or to limit the present disclosure to the exact forms disclosed. Specific embodiments and examples of the present disclosure are described herein for illustrative purposes, but as will be understood by those skilled in the art, various equivalent modifications are possible within the scope of the present disclosure. For example, although the steps or functions of a method are described in a given order, in alternative embodiments, the functions may be performed in a different order or substantially simultaneously. The teachings of the present disclosure provided herein can be applied to other procedures or methods as needed. The various embodiments described herein can be combined or made into another embodiment. Aspects of the present disclosure can be modified as needed using the compositions, functions, and concepts of the above references and applications to form another embodiment of the present disclosure. Modifications such as those described above to the present disclosure can be made based on the "Detailed Description".

[0171] The specific elements of any of the above embodiments can be combined with or replaced by the elements of other embodiments. Further, although the advantages associated with specific embodiments of the present disclosure are described in relation to those embodiments, other embodiments may also exhibit such advantages, and not all embodiments within the scope of the present disclosure necessarily need to exhibit such advantages.

[0172] Any publications, including the patents specified, are hereby expressly incorporated by reference herein for the purpose of, for example, explaining and disclosing methodologies described in such publications and usable in relation to the present invention. These publications are described merely because they were disclosed prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors have no right prior to such disclosure for any reason, such as that such disclosure is a prior invention or for any other reason. Any statements regarding the dates and contents of these documents are based on the information available to the applicant, and no admission is made as to the accuracy of the dates and contents of these documents.

[0173] The present invention will be described by the following examples, which should not be construed as limiting.

[0174] Some embodiments of the technology described in this specification may be defined by any of the following numbered clauses: 1. A method for generating pluripotent cells, comprising exposing cells to stress. 2. The method according to clause 1, wherein no foreign gene, transcript, protein, nuclear component, or cytoplasm is introduced, and cell fusion is not performed to generate pluripotent cells. 3. The method according to any one of clauses 1 to 2, further comprising selecting cells that exhibit pluripotency. 4. The method according to any one of clauses 1 to 3, wherein the cells do not exist as part of a tissue. 5. The method according to any one of clauses 1 to 4, wherein the cells are somatic cells, stem cells, progenitor cells, or embryonic cells. 6. The method according to any one of clauses 1 to 5, wherein the cells are isolated cells. 7. The method according to any one of clauses 1 to 6, wherein the cells are present in a heterogeneous cell population. 8. The method according to any one of clauses 1 to 7, wherein the cells are present in a homogeneous cell population. 9. The method according to any one of clauses 1 to 8, wherein selecting cells that exhibit pluripotency includes selecting cells that express a stem cell marker. 10. The stem cell marker is Oct4; Nanog; E-cadherin and SSEA4 The method according to any one of clause 9, selected from the group consisting of. 11. The method according to any one of clauses 1 to 10, wherein selecting cells that exhibit pluripotency includes selecting non-adherent cells. 12. The method according to any one of clauses 1 to 11, wherein the stress includes non-physiological stress of a tissue or cell culture. 13. The method according to any one of items 1 to 12, comprising exposing the cells to stress by exposing them to at least one environmental stimulus selected from trauma, mechanical stimulation, chemical substance exposure, ultrasonic stimulation, oxygen deficiency, radiation exposure, exposure to extreme temperatures, dissociation, trituration, physical stress, high osmotic pressure, low osmotic pressure, membrane damage, toxins, extreme ion concentrations, reactive oxygen species, UV exposure, intense visible light, lack of essential nutrients, or non-physiological acidic environment. 14. The method according to any one of items 1 to 13, comprising exposing the cells to stress by exposing them to a pH of about 3.0 to about 6.8. 15. The method according to any one of items 1 to 14, comprising exposing the cells to stress by exposing them to a pH of about 4.5 to about 6.0. 16. The method according to item 15, comprising exposing the cells to stress by exposing them to a pH of about 5.4 to about 5.8. 17. The method according to any one of items 12 to 16, wherein the cells are exposed for 2 to 3 days. 18. The method according to any one of items 12 to 17, wherein the cells are exposed for 1 day or less. 19. The method according to any one of items 12 to 18, wherein the cells are exposed for 1 hour or less. 20. The method according to any one of items 12 to 19, wherein the cells are exposed for about 30 minutes. 21. The method according to item 13, wherein exposure to extreme temperatures comprises exposing the cells to a temperature below 35°C or above 42°C. 22. The method according to item 21, wherein exposure to extreme temperatures comprises exposing the cells to a temperature at or below the freezing point or exposing the cells to a temperature of at least about 85°C. 23. The method according to item 13, wherein mechanical stimulation comprises exposing the cells to shear stress and / or high pressure. 24. The method according to item 23, wherein mechanical stimulation comprises passing the cells through at least one device having an opening smaller than the size of the cells. 25. The method according to item 23, wherein mechanical stimulation comprises passing the cells through a plurality of devices having successively smaller openings. 26. The method according to any one of items 1 to 25, further comprising culturing pluripotent cells to proliferate the pluripotent cells. 27. The method according to any one of items 1 to 26, wherein the pluripotent cells express a stem cell marker. 28. The stem cell marker is Oct4; Nanog; E-cadherin and SSEA4 The method according to item 27, which is selected from the group consisting of 29. The method according to any one of items 1 to 28, wherein the cells are mammalian cells. 30. The method according to any one of items 1 to 29, wherein the cells are human cells. 31. The method according to any one of items 1 to 30, wherein the cells are adult cells, neonatal cells, fetal cells, amniotic cells or umbilical cord blood cells. 32. The method according to any one of items 1 to 31, further comprising maintaining the pluripotent cells in vitro. 33. The method according to any one of items 1 to 32, wherein the epigenetic state of the cells is changed to be more similar to the epigenetic state of embryonic stem cells. 34. The method according to item 33, wherein the epigenetic state includes a methylation pattern. 35. The method according to any one of items 1 to 34, wherein the stress includes removing at least about 40% of the cytoplasm from the cells. 36. The method according to item 35, including removing at least about 50% of the cytoplasm from the cells. 37. The method according to item 36, including removing at least about 60% of the cytoplasm from the cells. 38. The method according to item 37, including removing 60 to 80% of the cytoplasm from the cells. 39. The method according to item 37, including removing at least about 80% of the cytoplasm from the cells. 40. The method according to item 39, including removing at least about 90% of the cytoplasm from the cells. 41. The method according to any one of items 1 to 40, wherein the stress includes removing at least about 40% of the mitochondria from the cells. 42. The method according to item 41, wherein at least about 50% of the mitochondria are removed from the cytoplasm by removing a part of the cytoplasm. 43. The method according to item 42, wherein about 50% to 90% of the mitochondria are removed from the cytoplasm by removing the cytoplasm or mitochondria. 44. The method according to item 42, wherein more than 90% of the mitochondria are removed from the cytoplasm by removing the cytoplasm or mitochondria. 45. The method according to any one of items 1 to 44, wherein the stress is sufficient to disrupt at least 10% of the cell membranes of the cells exposed thereto. 46. An assay comprising contacting a pluripotent cell prepared by the method according to any one of items 1 to 45 with a candidate agent. 47. The assay according to item 46, which is used to identify an agent that affects one or more of the viability, differentiation, and proliferation of pluripotent cells. 48. Use of a pluripotent cell prepared by the method according to any one of items 1 to 45 in a method for cell therapy of a subject. 49. A method for preparing cells or tissues suitable for cell therapy to be performed on a subject, comprising generating pluripotent cells from cells according to any one of items 1 to 45, wherein the cells are autologous cells or HLA-compatible allogeneic cells, method. 50. The method according to item 49, further comprising differentiating the pluripotent cells along a predetermined cell lineage before administering the cells or tissues to the subject. 51. A composition comprising pluripotent cells, wherein the pluripotent cells are generated from cells by the method according to any one of items 1 to 45. 52. A method for producing pluripotent stem cells, comprising culturing cells in the presence of adrenocorticotropic hormone (ACTH), 2i or 3i medium. 53. The method according to item 52, wherein the cells are cultured in LIF medium containing ACTH. 54. The method according to item 52 or 53, wherein ACTH is present at a concentration of about 0.1 μM to about 100 μM. 55. The method according to any one of items 52 to 54, wherein the cells are cells generated by the method according to any one of items 1 to 45. 56. The method according to any one of claims 52 to 55, wherein the cell is a totipotent cell. 57. The method according to any one of claims 52 to 56, wherein the cell is cultured in the presence of ACTH, 2i or 3i medium for at least 3 days. 58. The method according to any one of claims 52 to 57, wherein the cell is cultured in the presence of ACTH, 2i or 3i medium for at least 5 days. 59. The method according to any one of claims 52 to 58, wherein the cell is cultured in the presence of ACTH, 2i or 3i medium for at least 7 days. 60. The method according to any one of claims 52 to 59, wherein after the culturing step, the cell expresses a stem cell marker selected from the group consisting of Oct3 / 4; Nanog; Rex1; Klf4; Sox2; Klf2; Esrr-beta; Tbx3; and Klf5 at a detectable level. 61. A method for increasing the self-renewal ability of pluripotent cells, the method comprising culturing the cell in the presence of adrenocorticotropic hormone (ACTH), 2i or 3i medium. 62. The method according to claim 61, comprising culturing the cell in LIF medium containing ACTH. 63. The method according to any one of claims 61 to 62, wherein ACTH is present at a concentration of about 0.1 μM to about 100 μM. 64. The method according to any one of claims 61 to 63, wherein the cell is a cell generated by the method according to any one of claims 1 to 45. 65. The method according to any one of claims 61 to 64, wherein the cell is a totipotent cell. 66. The method according to any one of claims 61 to 65, wherein the cell is cultured in the presence of ACTH, 2i or 3i medium for at least 3 days. 67. The method according to any one of claims 61 to 66, wherein the cell is cultured in the presence of ACTH, 2i or 3i medium for at least 5 days. 68. The method according to any one of claims 61 to 67, wherein the cell is cultured in the presence of ACTH, 2i or 3i medium for at least 7 days. 69. The method according to any one of items 61 - 68, wherein after the culturing step, the cells express a stem cell marker selected from the group consisting of Oct3 / 4; Nanog; Rex1; Klf4; Sox2; Klf2; Esrr-beta; Tbx3; and Klf5 at a detectable level. 70. A method for autologous cell therapy of a subject in need of cell therapy, comprising: a. generating pluripotent cells from cells collected from the subject according to any one of items 1 - 45; b. administering to the subject a composition comprising the pluripotent cells or their differentiated progeny. The method comprising the above steps. 71. The method according to item 70, further comprising differentiating the pluripotent cells along a predetermined cell lineage prior to administering the composition to the subject. 72. A method for generating pluripotent cells capable of differentiating into placental cells, comprising culturing the pluripotent cells produced by the method according to any one of items 1 - 45 in the presence of FGF4. 73. The method according to item 72, wherein the concentration of FGF4 is 1 nM to 1 μM. 74. The method according to item 72 or 73, wherein the pluripotent cells are capable of differentiating into embryonic stem cells.

[0175] Some embodiments of the technology described herein may be defined by any of the following numbered items: 1. A method for generating pluripotent cells, comprising: a. isolating the initial cells from a solution; b. resuspending the cells obtained in step a in Hank's balanced salt solution (HBSS); c. triturating the cell suspension obtained in step b; d. adding about 2 to about 20 volumes of HBSS to the cell suspension; e. isolating cells from the suspension obtained in step d; f. resuspending the cells obtained in step e in HBSS having a pH of about 5.0 to about 6.0; g. incubating the cells near their natural in vivo temperature. h. Isolating cells from the suspension obtained in step g; and i. Resuspending the cell pellet obtained in step h in a medium A method comprising: 2. The method according to claim 1, wherein centrifugation is included in the isolation. 3. The method according to any one of claims 1 to 2, further comprising contacting the first cells with trypsin for about 1 minute to about 10 minutes before step a. 4. The method according to claim 3, further comprising contacting the first cells with trypsin for about 3 minutes to about 5 minutes before step a. 5. The method according to any one of claims 3 to 4, wherein trypsin is inactivated by contacting the cell pellet with Dulbecco's Minimum Essential Medium (DMEM) / F-12 containing 10% heat-inactivated fetal bovine serum (FBS). 6. The method according to any one of claims 1 to 5, wherein the trituration in step c includes triturating the cells through a series of openings or lumens with gradually decreasing diameters. 7. The method according to claim 6, wherein the series includes at least three openings or lumens. 8. The method according to any one of claims 6 to 7, wherein at least the first opening or lumen is pre-coated with HBSS or water. 9. The method according to any one of claims 6 to 8, wherein the inner diameter of the first opening or lumen is about 0.5 mm to about 2.0 mm. 10. The method according to claim 9, wherein the inner diameter of the first opening or lumen is about 0.7 mm to about 1.5 mm. 11. The method according to claim 10, wherein the inner diameter of the first opening or lumen is about 1.1 mm. 12. The method according to any one of claims 6 to 11, wherein the trituration through the first opening or lumen is carried out for about 1 minute to about 10 minutes. 13. The method according to claim 12, wherein the trituration through the first opening or lumen is carried out for about 5 minutes. 14. The method according to any one of claims 6 to 13, wherein the inner diameters of the last two openings or lumens in the series are about 90 to about 200 microns and about 25 microns to about 90 microns. 15. The method according to claim 14, wherein the inner diameters of the last two openings or inner cavities of the series are from about 100 to about 150 microns and from about 50 to about 70 microns. 16. The method according to any one of claims 1 to 15, wherein the trituration includes trituration for about 5 to about 20 minutes from the second opening or inner cavity to the last opening or inner cavity and trituration for about 5 to about 20 minutes in the last opening or inner cavity. 17. The method according to claim 16, wherein the trituration includes trituration for about 10 minutes from the second opening or inner cavity to the last opening or inner cavity and trituration for about 15 minutes in the last opening or inner cavity. 18. The method according to any one of claims 6 to 17, wherein the trituration in the last opening or inner cavity is continued until the suspension can easily pass through the opening or inner cavity. 19. The method according to any one of claims 6 to 18, wherein the trituration in each opening or inner cavity is continued until the suspension can easily pass through the opening or inner cavity. 20. The method according to any one of claims 1 to 19, wherein the total trituration time is about 30 minutes. 21. The method according to any one of claims 1 to 20, wherein about 5 to about 15 volumes of HBSS are added in step d. 22. The method according to any one of claims 1 to 21, wherein about 10 volumes of HBSS are added in step d. 23. The method according to any one of claims 1 to 22, wherein the pH of the HBSS in step f is from about 5.1 to about 5.7. 24. The method according to any one of claims 1 to 23, wherein the pH of the HBSS in step f is about 5.4. 25. The method according to any one of claims 1 to 24, wherein the pH of the HBSS suspension of the cells obtained in step f is from about 5.0 to about 6.0. 26. The method according to any one of claims 1 to 25, wherein the pH of the HBSS suspension of the cells obtained in step f is from about 5.6 to about 5.7. 27. The method according to any one of claims 1 to 26, wherein step f includes resuspending the cells to a concentration of from about 500,000 cells / mL to about 4,000,000 cells / mL. 28. The method according to any one of claims 1 to 27, wherein step f includes resuspending the cells to a concentration of about 2,000,000 cells / mL. 29. The method according to any one of claims 1 to 28, wherein step g comprises incubating the cells at about 37°C for about 25 minutes. 30. The method according to any one of claims 1 to 29, wherein steps g and h are continued together for about 10 minutes to about 1 hour. 31. The method according to any one of claims 1 to 30, wherein steps g and h are continued together for about 30 minutes. 32. The method according to any one of claims 1 to 31, wherein the medium in step i is a sphere medium containing DMEM / F12, about 1% antibiotic, about 2% B27, and optionally one or more growth factors. 33. The method according to claim 32, wherein the growth factors comprise bFGF, EGF, and heparin. 34. A method for generating pluripotent cells, comprising: wherein the initial cells are present in a tissue containing red blood cells, a. mechanically mincing the tissue in the presence of one or more ECM degrading enzymes; b. incubating the sample obtained in step a near the natural in vivo temperature of the tissue while agitating the tissue; c. diluting the cells obtained in step b with HBSS; d. isolating the cells from the suspension obtained in step c; e. resuspending the cells obtained in step d in HBSS; f. triturating the cell suspension obtained in step e; g. adding about 0.1 to about 10 volumes of RBC isolation solution to the cell suspension obtained in step f to form a bilayer; h. separating the HBSS layer obtained in step g from the RBC isolation solution layer; i. isolating the cells from the HBSS suspension obtained in step h; j. resuspending the cells obtained in step i in HBSS having a pH of about 5.0 to about 6.0; k. incubating the cells near the natural in vivo temperature of the tissue; l. isolating the cells from the suspension obtained in step k; and m. resuspending the cells obtained in step l in a medium comprising method. 35. A tissue containing red blood cells is lung; spleen; and liver The method according to claim 34, selected from the group consisting of. 36. The method according to any one of claims 34 to 35, wherein the tissue is the lung and the ECM degrading enzyme is collagenase P. 37. The method according to any one of claims 34 to 36, wherein the mincing in step a is continued for about 10 minutes. 38. The method according to any one of claims 34 to 37, wherein the trituration in step f comprises triturating the cells through a series of apertures or lumens having a gradually decreasing diameter. 39. The method according to claim 38, wherein the series comprises at least 3 apertures or lumens. 40. The method according to any one of claims 38 to 39, wherein at least the first aperture or lumen is pre-coated with HBSS or water. 41. The method according to any one of claims 38 to 40, wherein the inner diameter of the first aperture or lumen is about 0.5 mm to about 2.0 mm. 42. The method according to claim 41, wherein the inner diameter of the first aperture or lumen is about 0.7 mm to about 1.5 mm. 43. The method according to claim 42, wherein the inner diameter of the first aperture or lumen is about 1.1 mm. 44. The method according to any one of claims 38 to 43, wherein the trituration through the first aperture or lumen is carried out for about 1 minute to about 10 minutes. 45. The method according to claim 44, wherein the trituration through the first aperture or lumen is carried out for about 5 minutes. 46. The method according to any one of claims 38 to 45, wherein the inner diameters of the last two apertures or lumens in the series are about 90 to about 200 microns and about 25 microns to about 90 microns. 47. The method according to claim 46, wherein the inner diameters of the last two apertures or lumens in the series are about 100 to about 150 microns and about 50 microns to about 70 microns. 48. The method according to any one of paragraphs 38 to 47, wherein the kneading includes kneading for about 5 to about 20 minutes from the second opening or lumen to the last opening or lumen, and kneading for about 5 to about 20 minutes in the last opening or lumen. 49. The method according to paragraph 48, wherein the kneading includes kneading for about 10 minutes from the second opening or lumen to the last opening or lumen, and kneading for about 15 minutes in the last opening or lumen. 50. The method according to any one of paragraphs 34 to 49, wherein the kneading in the last opening or lumen is continued until the suspension can easily pass through the opening or lumen. 51. The method according to any one of paragraphs 34 to 50, wherein the kneading in each opening or lumen is continued until the suspension can easily pass through the opening or lumen. 52. The method according to any one of paragraphs 34 to 51, wherein the total kneading time is about 30 minutes. 53. The method according to any one of paragraphs 34 to 52, wherein the pH of the HBSS in step j is about 5.1 to about 5.7. 54. The method according to paragraph 53, wherein the pH of the HBSS in step j is about 5.4. 55. The method according to any one of paragraphs 34 to 54, wherein the pH of the HBSS suspension of the cells obtained in step j is about 5.0 to about 6.0. 56. The method according to paragraph 55, wherein the pH of the HBSS suspension of the cells obtained in step j is about 5.6 to about 5.7. 57. The method according to any one of paragraphs 34 to 56, wherein step k includes incubating the cells at about 37°C for about 25 minutes. 58. The method according to any one of paragraphs 34 to 57, wherein steps k and l are continued together for about 10 minutes to about 1 hour. 59. The method according to any one of paragraphs 34 to 58, wherein the medium in step m is a sphere medium containing DMEM / F12, 1% antibiotic, 1% B27, and optionally one or more growth factors. 60. The method according to paragraph 59, wherein the growth factors include bFGF, EGF, and heparin. 61. The method according to any one of paragraphs 1 to 60, wherein the initial cells are mouse cells and the sphere medium contains LIF. Further comprising the step of culturing the obtained cells for at least one week, The culturing is a. Optionally adding a spheroid medium containing a growth factor; b. Agitating the cells so that they do not adhere to the bottom of the dish and comprising The method according to any one of items 1 to 61. 63. The method according to item 62, wherein the spheroid medium is added every 1 to 4 days. 64. The method according to item 63, wherein the spheroid medium is added every 2 days. 65. The method according to any one of items 62 to 64, wherein the agitation comprises pipetting the cells with a pipette. 66. The method according to item 65, wherein the diameter of the hole of the pipette is about 1.1 mm. 67. The method according to any one of items 65 to 66, wherein the pipetting is performed at least once a day. 68. The method according to item 67, wherein the pipetting is performed at least twice a day. 69. Further comprising selecting cells having pluripotency, The selection is selecting cells with low adhesion; selecting cells that are components of spheroids; and selecting cells with a relatively small size and comprising a method selected from the group consisting of The method according to any one of items 1 to 68. 70. The method according to any one of items 1 to 69, further comprising a final step of selecting cells exhibiting pluripotency. 71. The method according to any one of items 1 to 70, wherein the initial cells do not exist as part of a tissue. 72. The method according to any one of items 1 to 71, wherein the initial cells are somatic cells, stem cells, progenitor cells or embryonic cells. 73. The method according to any one of items 1 to 72, wherein the initial cells are isolated cells. 74. The method according to any one of items 1 to 73, wherein the initial cells are present in a heterogeneous cell population. 75. The method according to any one of items 1 to 74, wherein the initial cells are present in a homogeneous cell population. 76. The method according to any one of claims 1 to 75, wherein selecting cells showing pluripotency includes selecting cells expressing a stem cell marker. 77. The stem cell marker is Oct4; Nanog; E-cadherin and SSEA4 The method according to any one of claims 76, wherein the method is selected from the group consisting of. 78. The method according to any one of claims 1 to 77, wherein selecting cells showing pluripotency includes selecting non-adherent cells. 79. The method according to any one of claims 1 to 78, further comprising culturing pluripotent cells to proliferate the pluripotent cells. 80. The method according to any one of claims 1 to 79, wherein the pluripotent cells express a stem cell marker. 81. The stem cell marker is Oct4; Nanog; E-cadherin and SSEA4 The method according to claim 80, wherein the method is selected from the group consisting of. 82. The method according to any one of claims 1 to 81, wherein the first cell is a mammalian cell. 83. The method according to any one of claims 1 to 82, wherein the first cell is a human cell. 84. The method according to any one of claims 1 to 83, wherein the first cell is an adult cell, a neonatal cell, a fetal cell, an amniotic cell or a cord blood cell. 85. The method according to any one of claims 1 to 84, further comprising maintaining the pluripotent cells in vitro. 86. An assay comprising contacting a pluripotent cell prepared by the method according to any one of claims 1 to 85 with a candidate agent. 87. The assay according to claim 86, which is used to identify an agent that affects one or more of the viability, differentiation, and proliferation of pluripotent cells. 88. Use of the pluripotent cells prepared by the method according to any one of claims 1 to 85 in a method for cell therapy of a subject. 89. A method for preparing a cell or tissue compatible with cell therapy to be performed on a subject, comprising generating pluripotent cells from the cells according to any one of claims 1 to 85; A method wherein the cell is an autologous cell or an HLA - matched allogeneic cell. Method. 90. The method according to item 89, further comprising differentiating pluripotent cells along a predetermined cell lineage before administration to a subject of the cell or tissue. 91. A composition comprising pluripotent cells, wherein the pluripotent cells are generated from cells by the method according to any one of items 1 - 85. 92. A method for autologous cell therapy of a subject in need of cell therapy, comprising: a. generating pluripotent cells from cells collected from the subject according to any one of items 1 - 85; b. administering to the subject a composition comprising the pluripotent cells or their differentiated progeny. A method comprising. 93. The method according to item 92, further comprising differentiating pluripotent cells along a predetermined cell lineage before administration of the composition to the subject. 94. A kit comprising two pipettes, wherein the diameter of the hole of the first pipette is about 90 - about 200 microns, and the diameter of the hole of the second pipette is about 25 microns - about 90 microns. 95. The kit according to item 94, wherein the diameter of the hole of the first pipette is about 100 - about 150 microns, and the diameter of the hole of the second pipette is about 50 microns - about 70 microns. 96. The kit according to any one of items 94 - 95, further comprising HBSS. 97. The kit according to any one of items 94 - 96, wherein the pH of the HBSS is about 5.4. 98. The kit according to any one of items 96 - 97, further comprising an acid for titrating the pH of the HBSS. 99. The kit according to item 98, wherein the acid is HC1. 100. The kit according to any one of items 94 - 99, comprising a sphere medium and optionally a growth factor.

[0176] Some embodiments of the techniques described herein may be defined by any of the following numbered clauses: 1. A method for generating pluripotent cells, comprising: a. isolating the first cells from a solution; b. resuspending the cells obtained in step a in a solution of Hank's balanced salt solution (HBSS) with a pH of about 4.0 to about 6.5 and ATP; c. triturating the cell suspension obtained in step b; d. resuspending the cells obtained in step c in HBSS; e. isolating the cells from the suspension obtained in step d; and f. resuspending the cell pellet obtained in step g in a medium A method comprising the above steps. 2. A method for generating pluripotent cells, comprising: a. isolating the initial cells from a solution b. resuspending the cells obtained in step a in a solution of Hank's balanced salt solution (HBSS) with a pH of about 4.0 to about 6.5 and ATP; c. isolating the cells from the suspension obtained in step b; d. resuspending the cells obtained in step c in a solution of HBSS with a pH of about 4.0 to about 6.5 and ATP to form a cell suspension; e. triturating the cell suspension obtained in step d; f. resuspending the cells obtained in step e in HBSS; g. isolating the cells from the suspension obtained in step f; and h. resuspending the cell pellet obtained in step g in a medium A method comprising the above steps. 3. The method according to any one of claims 1 to 2, wherein ATP is present in the solution of HBSS and ATP at a concentration of about 1.5 to about 5 mg / cc. 4. The method according to claim 3, wherein ATP is present in the solution of HBSS and ATP at a concentration of about 2.7 mM to about 9 mM. 5. The method according to any one of claims 1 to 4, wherein a solution of HBSS and ATP with a pH of about 4.0 to about 6.5 is prepared by titrating the HBSS solution with the ATP solution until the desired pH is reached. 6. The method according to claim 5, wherein the concentration of the ATP solution is about 50 mM to about 500 mM. 7. The method according to claim 6, wherein the concentration of the ATP solution is about 200 mM. 8. The method according to any one of claims 1 to 7, wherein the pH of the solution of HBSS and ATP is from about 5.0 to about 5.7. 9. The method according to any one of claims 1 to 8, wherein the pH of the solution of HBSS and ATP is about 5.0. 10. The method according to any one of claims 1 to 9, wherein the HBSS in step f of claim 62 and step d of claim 61 does not contain ATP. 11. The method according to any one of claims 1 to 10, wherein the isolation comprises centrifugation. 12. The method according to any one of claims 1 to 11, further comprising contacting the first cells with trypsin for about 1 minute to about 10 minutes before step a. 13. The method according to claim 12, further comprising contacting the first cells with trypsin for about 3 minutes to about 5 minutes before step a. 14. The method according to any one of claims 12 to 13, wherein trypsin is inactivated by contacting the cell pellet with Dulbecco's Minimum Essential Medium (DMEM) / F-12 containing 10% heat-inactivated fetal bovine serum (FBS). 15. The method according to any one of claims 1 to 14, wherein trituration comprises triturating the cells through a series of apertures or lumens having successively smaller diameters. 16. The method according to claim 15, wherein the series comprises at least 3 apertures or lumens. 17. The method according to any one of claims 15 to 16, wherein at least the first aperture or lumen is pre-coated with HBSS or water. 18. The method according to any one of claims 15 to 17, wherein the inner diameter of the first aperture or lumen is from about 0.5 mm to about 2.0 mm. 19. The method according to claim 18, wherein the inner diameter of the first aperture or lumen is from about 0.7 mm to about 1.5 mm. 20. The method according to claim 19, wherein the inner diameter of the first aperture or lumen is about 1.1 mm. 21. The method according to any one of claims 15 to 20, wherein trituration through the first aperture or lumen is carried out for about 1 minute to about 10 minutes. 22. The method according to claim 21, wherein trituration through the first aperture or lumen is carried out for about 5 minutes. 23. The method according to any one of claims 15 to 22, wherein the inner diameters of the last two openings or lumens in the series are from about 90 to about 200 microns and from about 25 microns to about 90 microns. 24. The method according to claim 23, wherein the inner diameters of the last two openings or lumens in the series are from about 100 to about 150 microns and from about 50 microns to about 70 microns. 25. The method according to any one of claims 1 to 24, wherein the trituration includes trituration for about 5 to about 20 minutes from the second opening or lumen to the last opening or lumen, and trituration for about 5 to about 20 minutes in the last opening or lumen. 26. The method according to claim 25, wherein the trituration includes trituration for about 10 minutes from the second opening or lumen to the last opening or lumen, and trituration for about 15 minutes in the last opening or lumen. 27. The method according to any one of claims 15 to 26, wherein the trituration in the last opening or lumen is continued until the suspension can easily pass through the opening or lumen. 28. The method according to any one of claims 15 to 27, wherein the trituration in each opening or lumen is continued until the suspension can easily pass through the opening or lumen. 29. The method according to any one of claims 1 to 28, wherein the total time of trituration is about 30 minutes. 30. The method according to any one of claims 1 to 29, wherein the volume of HBSS after trituration is from about 5 to about 15 volumes. 31. The method according to any one of claims 1 to 30, wherein the volume of HBSS after trituration is about 10 volumes. 32. The method according to any one of claims 1 to 31, wherein the pH of the HBSS added after trituration is from about 5.1 to about 5.7. 33. The method according to any one of claims 1 to 32, wherein the pH of the HBSS added after trituration is about 5.4. 34. The method according to any one of claims 1 to 33, wherein the pH of the HBSS suspension of the cells obtained in step f of claim 62 or step d of claim 61 is from about 5.0 to about 6.0. 35. The method according to any one of claims 1 to 33, wherein the pH of the HBSS suspension of the cells obtained in step f of claim 62 or step d of claim 61 is from about 5.6 to about 5.7. 36. The method according to any one of claims 1 to 35, wherein after adding HBSS after trituration, the cells are present at a concentration of from about 500,000 cells / mL to about 4,000,000 cells / mL. 37. The method according to any one of claims 1 to 36, wherein after adding HBSS after trituration, the cells are present at a concentration of about 2,000,000 cells / mL. 38. The method according to any one of claims 1 to 37, wherein the medium is a sphere medium comprising DMEM / F12, about 1% antibiotic, about 2% B27, and optionally one or more growth factors. 39. The method according to claim 38, wherein the growth factors comprise bFGF, EGF, and heparin. 40. A method for generating pluripotent cells, wherein the initial cells are present in a tissue containing red blood cells, a. mechanically mincing the tissue in the presence of one or more ECM degrading enzymes; b. incubating the sample obtained in step a at a temperature near the natural in vivo temperature of the tissue while agitating the tissue; c. diluting the cell suspension obtained in step b with a Hank's balanced salt solution (HBSS) having a pH of from about 4.0 to about 6.5 and a solution of ATP; d. triturating the cell suspension obtained in step c; e. resuspending the cells obtained in step d in HBSS; f. isolating the cells from the suspension obtained in step e; and g. resuspending the cell pellet obtained in step g in a medium comprising, the method. 41. A method for generating pluripotent cells, wherein the initial cells are present in a tissue containing red blood cells, a. mechanically mincing the tissue in the presence of M one or more ECM degrading enzymes; b. Incubating the sample obtained in step a near the natural in vivo temperature of the tissue while agitating the tissue; c. Diluting the cell suspension obtained in step b with a Hank's balanced salt solution (HBSS) having a pH of about 4.0 to about 6.5 and a solution of ATP; d. Isolating cells from the suspension obtained in step b; e. Resuspending the cells obtained in step c in a solution of HBSS having a pH of about 4.0 to about 6.5 and ATP to form a cell suspension; f. Homogenizing the cell suspension obtained in step d; g. Resuspending the cells obtained in step e in HBSS; h. Isolating cells from the suspension obtained in step f; and i. Resuspending the cell pellet obtained in step g in a culture medium comprising a method. 42. A method according to any one of claims 40 to 41, wherein the tissue containing red blood cells is selected from the group consisting of the lung; the spleen; and the liver 43. A method according to any one of claims 40 to 42, wherein the tissue is the lung and the ECM degrading enzyme is collagenase P. 44. A method according to any one of claims 40 to 43, wherein the mincing in step a is continued for about 10 minutes. 45. A method according to any one of claims 40 to 44, wherein ATP is present in the solution of HBSS and ATP at a concentration of about 1.5 to about 5 mg / cc. 46. A method according to claim 45, wherein ATP is present in the solution of HBSS and ATP at a concentration of about 2.7 mM to about 9 mM. 47. A method according to any one of claims 40 to 46, wherein a solution of HBSS and ATP having a pH of about 4.0 to about 6.5 is prepared by titrating the HBSS solution with the ATP solution until the desired pH is reached. 48. A method according to claim 47, wherein the concentration of the ATP solution is about 50 mM to about 500 mM. 49. A method according to claim 48, wherein the concentration of the ATP solution is about 200 mM. ​50. The method according to any one of claims 40 to 49, wherein the pH of the solution of HBSS and ATP is from about 5.0 to about 5.7. 51. The method according to any one of claims 40 to 50, wherein the pH of the solution of HBSS and ATP is about 5.0. 52. The method according to any one of claims 40 to 50, wherein the HBSS in step g of claim 101 and step e of claim 100 does not contain ATP. 53. The method according to any one of claims 40 to 50, wherein the isolation comprises centrifugation. 54. The method according to any one of claims 40 to 53, further comprising contacting the first cells with trypsin for about 1 minute to about 10 minutes before step c. 55. The method according to claim 54, further comprising contacting the first cells with trypsin for about 3 minutes to about 5 minutes before step c. 56. The method according to any one of claims 54 to 55, wherein trypsin is inactivated by contacting the cell pellet with Dulbecco's Minimum Essential Medium (DMEM) / F-12 containing 10% heat-inactivated fetal bovine serum (FBS). 57. The method according to any one of claims 40 to 57, wherein trituration comprises triturating the cells through a series of openings or lumens having successively smaller diameters. 58. The method according to claim 57, wherein the series comprises at least three openings or lumens. 59. The method according to any one of claims 40 to 58, wherein at least the first opening or lumen is pre-coated with HBSS or water. 60. The method according to any one of claims 40 to 59, wherein the inner diameter of the first opening or lumen is from about 0.5 mm to about 2.0 mm. 61. The method according to claim 60, wherein the inner diameter of the first opening or lumen is from about 0.7 mm to about 1.5 mm. 62. The method according to claim 61, wherein the inner diameter of the first opening or lumen is about 1.1 mm. 63. The method according to any one of claims 40 to 62, wherein trituration through the first opening or lumen is carried out for about 1 minute to about 10 minutes. The method according to any one of claims 40 to 63, wherein trituration through the 64.1st opening or lumen is carried out for about 5 minutes. 65. The method according to any one of claims 40 to 64, wherein the inner diameters of the last two openings or lumens in the series are about 90 to about 200 microns and about 25 microns to about 90 microns. 66. The method according to claim 65, wherein the inner diameters of the last two openings or lumens in the series are about 100 to about 150 microns and about 50 microns to about 70 microns. 67. The method according to any one of claims 40 to 66, wherein the trituration includes trituration for about 5 to about 20 minutes from the second opening or lumen to the last opening or lumen and trituration for about 5 to about 20 minutes in the last opening or lumen. 68. The method according to claim 67, wherein the trituration includes trituration for about 10 minutes from the second opening or lumen to the last opening or lumen and trituration for about 15 minutes in the last opening or lumen. 69. The method according to any one of claims 40 to 68, wherein the trituration in the last opening or lumen is continued until the suspension can easily pass through the opening or lumen. 70. The method according to any one of claims 40 to 69, wherein the trituration in each opening or lumen is continued until the suspension can easily pass through the opening or lumen. 71. The method according to any one of claims 40 to 70, wherein the total time of trituration is about 30 minutes. 72. The method according to any one of claims 40 to 71, wherein it is about 5 to about 15 volumes of HBSS after trituration. 73. The method according to any one of claims 40 to 72, wherein it is about 10 volumes of HBSS after trituration. 74. The method according to any one of claims 40 to 73, wherein the pH of the HBSS added after trituration is about 5.1 to about 5.7. 75. The method according to any one of claims 40 to 74, wherein the pH of the HBSS added after trituration is about 5.4. 76. The method according to any one of claims 40 to 75, wherein the pH of the HBSS suspension of the cells obtained in step g of claim 101 or step e of claim 100 is about 5.0 to about 6.0. 77. The method according to any one of claims 40 to 76, wherein the pH of the HBSS suspension of the cells obtained in step g of claim 101 or step e of claim 100 is from about 5.6 to about 5.7. 78. The method according to any one of claims 40 to 77, wherein after adding HBSS after trituration, the cells are present at a concentration of from about 500,000 cells / mL to about 4,000,000 cells / mL. 79. The method according to any one of claims 40 to 78, wherein after adding HBSS after trituration, the cells are present at a concentration of about 2,000,000 cells / mL. 80. The method according to any one of claims 40 to 79, wherein the medium is a sphere medium containing DMEM / F12, about 1% antibiotic, about 2% B27, and optionally one or more growth factors. 81. The method according to claim 80, wherein the growth factors include bFGF, EGF, and heparin. 82. The method according to any one of claims 1 to 81, wherein the initial cells are mouse cells and the sphere medium contains LIF. 83. The method further includes a step of culturing the obtained cells for at least one week, and the culturing j. adding a sphere medium optionally containing growth factors; k. agitating the cells so as not to adhere to the bottom of the dish and including The method according to any one of claims 1 to 81. 84. The method according to claim 83, wherein the sphere medium is added every 1 to 4 days. 85. The method according to claim 83, wherein the sphere medium is added every 2 days. 86. The method according to any one of claims 82 to 85, wherein the agitation includes pipetting the cells with a pipette. 87. The method according to claim 86, wherein the diameter of the hole of the pipette is about 1.1 mm. 88. The method according to any one of claims 86 to 87, wherein the pipetting is performed at least once a day. 89. The method according to claim 88, wherein the pipetting is performed at least twice a day. 90. The method further includes selecting cells having pluripotency, selecting selecting cells with low adhesiveness; selecting cells that are components of the spheroid; and selecting cells with a relatively small size comprising a method selected from the group consisting of the method according to any one of claims 1 to 89 91. The method according to any one of claims 1 to 90, further comprising a final step of selecting cells exhibiting pluripotency 92. The method according to any one of claims 1 to 91, wherein the initial cells do not exist as part of a tissue 93. The method according to any one of claims 1 to 92, wherein the initial cells are somatic cells, stem cells, progenitor cells or embryonic cells 94. The method according to any one of claims 1 to 93, wherein the initial cells are isolated cells 95. The method according to any one of claims 1 to 94, wherein the initial cells are present in a heterogeneous cell population 96. The method according to any one of claims 1 to 95, wherein the initial cells are present in a homogeneous cell population 97. The method according to any one of claims 1 to 96, wherein selecting cells exhibiting pluripotency comprises selecting cells expressing a stem cell marker 98. The stem cell marker is Oct4; Nanog; E-cadherin and SSEA4 selected from the group consisting of, the method according to any one of claims 97 99. The method according to any one of claims 1 to 98, wherein selecting cells exhibiting pluripotency comprises selecting non-adherent cells 100. The method according to any one of claims 1 to 99, further comprising culturing the pluripotent cells to expand the pluripotent cells 101. The method according to any one of claims 1 to 100, wherein the pluripotent cells express a stem cell marker 102. The stem cell marker is Oct4; Nanog; E-cadherin and SSEA4 selected from the group consisting of, the method according to claim 101 103. The method according to any one of claims 1 to 102, wherein the initial cell is a mammalian cell. 104. The method according to any one of claims 1 to 103, wherein the initial cell is a human cell. 105. The method according to any one of claims 1 to 104, wherein the initial cell is an adult cell, a neonatal cell, a fetal cell, an amniotic cell or a cord blood cell. 106. The method according to any one of claims 1 to 105, further comprising maintaining the pluripotent cells in vitro. 107. An assay comprising contacting a pluripotent cell prepared by the method according to any one of claims 1 to 106 with a candidate agent. 108. The assay according to claim 107, which is used to identify an agent that affects one or more of the viability, differentiation, and proliferation of pluripotent cells. 109. Use of a pluripotent cell prepared by the method according to any one of claims 1 to 106 in a method for cell therapy of a subject. 110. A method for preparing a cell or tissue suitable for cell therapy to be performed on a subject, comprising: generating pluripotent cells from a cell according to any one of claims 1 to 106; wherein the cell is an autologous cell or an HLA - matched allogeneic cell. The method. 111. The method according to claim 110, further comprising differentiating the pluripotent cells along a predetermined cell lineage before administering the cells or tissue to the subject. 112. A composition comprising pluripotent cells, wherein the pluripotent cells are generated from a cell by the method according to any one of claims 1 to 106. 113. A method for autologous cell therapy of a subject in need of cell therapy, comprising: c. generating pluripotent cells from a cell collected from the subject according to any one of claims 1 to 106; and d. administering to the subject a composition comprising the pluripotent cells or their differentiated progeny. The method comprising. The method according to claim 113, further comprising differentiating the pluripotent cells along a predetermined cell lineage prior to administration to the composition.

[0177] Some embodiments of the techniques described herein may be defined by any of the following numbered clauses: 1. A method of treating a neurological injury, comprising administering pluripotent or STAP cells to a subject in need of treatment of a neurological injury. 2. The method according to claim 1, wherein the pluripotent or STAP cells are generated by the methods described herein, such as the methods of the clauses numbered in paragraphs

[0157] to

[0190] , paragraphs

[0202] to

[0204] , Example 5 or Example 7. 3. The method according to any one of claims 1 to 2, wherein the cells are autologous to the subject. 4. The neurological injury is an acute neurological injury; a chronic neurological injury; a neurodegenerative disease; a nerve injury; or a spinal cord injury The method according to any one of claims 1 to 3, selected from the group consisting of In certain embodiments, the following items are provided: (Item 1) A method of generating pluripotent cells, comprising a. isolating the first cells from a solution, and b. resuspending the cells obtained in step a in Hank's balanced salt solution (HBSS), and c. triturating the cell suspension obtained in step b, and d. adding about 2 to about 20 volumes of HBSS to the cell suspension, and e. isolating the cells from the suspension obtained in step d and f. resuspending the cells obtained in step e in HBSS having a pH of about 5.0 to about 6.0, and g. incubating the cells near their natural in vivo temperature, and h. isolating the cells from the suspension obtained in step g, and i. resuspending the cell pellet obtained in step h in a medium and A method comprising (Item 2) The method according to item 1, wherein isolating comprises centrifugation. (Item 3) The method according to any one of items 1 to 2, further comprising contacting the first cell and trypsin for about 1 minute to about 10 minutes before step a. (Item 4) The method according to item 3, further comprising contacting the first cell and trypsin for about 3 minutes to about 5 minutes before step a. (Item 5) The method according to any one of items 3 to 4, wherein the trypsin is inactivated by contacting the cell pellet with Dulbecco's Minimum Essential Medium (DMEM) / F-12 containing 10% heat-inactivated fetal bovine serum (FBS). (Item 6) The method according to any one of items 1 to 5, wherein the trituration in step c comprises triturating the cells through a series of openings or lumens with gradually decreasing diameters. (Item 7) The method according to item 6, wherein the series comprises at least three openings or lumens. (Item 8) The method according to any one of items 6 to 7, wherein at least the first opening or lumen is pre-coated with HBSS or water. (Item 9) The method according to any one of items 6 to 8, wherein the inner diameter of the first opening or lumen is about 0.5 mm to about 2.0 mm. (Item 10) The method according to item 9, wherein the inner diameter of the first opening or lumen is about 0.7 mm to about 1.5 mm. (Item 11) The method according to item 10, wherein the inner diameter of the first opening or lumen is about 1.1 mm. (Item 12) The method according to any one of items 6 to 11, wherein the trituration through the first opening or lumen is carried out for about 1 minute to about 10 minutes. (Item 13) The method according to item 12, wherein the trituration through the first opening or lumen is carried out for about 5 minutes. (Item 14) The method according to any one of Items 6 to 13, wherein the inner diameters of the last two openings or inner cavities of the series are about 90 to about 200 microns and about 25 microns to about 90 microns. (Item 15) The method according to Item 14, wherein the inner diameters of the last two openings or inner cavities of the series are about 100 to about 150 microns and about 50 microns to about 70 microns. (Item 16) The method according to any one of Items 1 to 15, wherein the trituration includes trituration for about 5 to about 20 minutes from the second opening or inner cavity to the last opening or inner cavity and trituration for about 5 to about 20 minutes in the last opening or inner cavity. (Item 17) The method according to Item 16, wherein the trituration includes trituration for about 10 minutes from the second opening or inner cavity to the last opening or inner cavity and trituration for about 15 minutes in the last opening or inner cavity. (Item 18) The method according to any one of Items 6 to 17, wherein the trituration in the last opening or inner cavity is continued until the suspension can easily pass through the opening or inner cavity. (Item 19) The method according to any one of Items 6 to 18, wherein the trituration in each opening or inner cavity is continued until the suspension can easily pass through the opening or inner cavity. (Item 20) The method according to any one of Items 1 to 19, wherein the total time of trituration is about 30 minutes. (Item 21) The method according to any one of Items 1 to 20, wherein about 5 to about 15 volumes of HBSS are added in step d. (Item 22) The method according to any one of Items 1 to 21, wherein about 10 volumes of HBSS are added in step d. (Item 23) The method according to any one of Items 1 to 22, wherein the pH of the HBSS in step f is about 5.1 to about 5.7. (Item 24) The method according to any one of Items 1 to 23, wherein the pH of the HBSS in step f is about 5.4. (Item 25) The method according to any one of Items 1 to 24, wherein the pH of the HBSS suspension of the cells obtained in step f is from about 5.0 to about 6.0. (Item 26) The method according to any one of Items 1 to 25, wherein the pH of the HBSS suspension of the cells obtained in step f is from about 5.6 to about 5.7. (Item 27) The method according to any one of Items 1 to 26, wherein step f includes resuspending the cells at a concentration of about 500,000 cells / mL to about 4,000,000 cells / mL. (Item 28) The method according to any one of Items 1 to 27, wherein step f includes resuspending the cells at a concentration of about 2,000,000 cells / mL. (Item 29) The method according to any one of Items 1 to 28, wherein step g includes incubating the cells at about 37°C for about 25 minutes. (Item 30) The method according to any one of Items 1 to 29, wherein steps g and h are continued together for about 10 minutes to about 1 hour. (Item 31) The method according to any one of Items 1 to 30, wherein steps g and h are continued together for 30 minutes. (Item 32) The method according to any one of Items 1 to 31, wherein the medium in step i is a sphere medium containing DMEM / F12, about 1% antibiotic, about 2% B27, and optionally one or more growth factors. (Item 33) The method according to Item 32, wherein the growth factors include bFGF, EGF, and heparin. (Item 34) A method for generating pluripotent cells, wherein the initial cells are present in a tissue containing red blood cells, a. mechanically mincing the tissue in the presence of one or more ECM degrading enzymes; and b. incubating the sample obtained in step a near the natural in vivo temperature of the tissue while agitating the tissue; c. Diluting the cell suspension obtained in step b with HBSS, and d. Isolating cells from the suspension obtained in step c, and e. Resuspending the cells obtained in step d in HBSS, and f. Homogenizing the cell suspension obtained in step e, and g. Adding about 0.1 to about 10 volumes of RBC isolation solution to the cell suspension obtained in step f to form a bilayer, and h. Separating the HBSS layer obtained in step g from the RBC isolation solution layer, and i. Isolating cells from the HBSS suspension obtained in step h, and j. Resuspending the cells obtained in step i in HBSS with a pH of about 5.0 to about 6.0, and k. Incubating the cells at a temperature near the natural in vivo temperature of the tissue, and l. Isolating cells from the suspension obtained in step k, and m. Resuspending the cells obtained in step l in a medium comprising a method. (Item 35) The tissue containing the red blood cells is lung; spleen; and liver The method according to item 34, selected from the group consisting of. (Item 36) The method according to any one of items 34 to 35, wherein the tissue is the lung and the ECM degrading enzyme is collagenase P. (Item 37) The method according to any one of items 34 to 36, wherein the mincing in step a is continued for about 10 minutes. (Item 38) The method according to any one of items 34 to 37, wherein the homogenization in step f comprises homogenizing the cells through a series of openings or lumens with gradually decreasing diameters. (Item 39) The method according to item 38, wherein the series comprises at least three openings or lumens. (Item 40) The method according to any one of items 38 to 39, wherein at least the first opening or lumen is pre-coated with HBSS or water. (Item 41) The method according to any one of items 38 to 40, wherein the inner diameter of the first opening or lumen is from about 0.5 mm to about 2.0 mm. (Item 42) The method according to item 41, wherein the inner diameter of the first opening or lumen is from about 0.7 mm to about 1.5 mm. (Item 43) The method according to item 42, wherein the inner diameter of the first opening or lumen is about 1.1 mm. (Item 44) The method according to any one of items 38 to 43, wherein levigation through the first opening or lumen is carried out for about 1 minute to about 10 minutes. (Item 45) The method according to item 44, wherein levigation through the first opening or lumen is carried out for about 5 minutes. (Item 46) The method according to any one of items 38 to 45, wherein the inner diameters of the last two openings or lumens in the series are from about 90 to about 200 microns and from about 25 microns to about 90 microns. (Item 47) The method according to item 46, wherein the inner diameters of the last two openings or lumens in the series are from about 100 to about 150 microns and from about 50 microns to about 70 microns. (Item 48) The method according to any one of items 38 to 47, wherein the levigation includes levigation for about 5 to about 20 minutes through the second opening or lumen to the last opening or lumen, and levigation for about 5 to about 20 minutes in the last opening or lumen. (Item 49) The method according to item 48, wherein the levigation includes levigation for about 10 minutes through the second opening or lumen to the last opening or lumen, and levigation for about 15 minutes in the last opening or lumen. (Item 50) The method according to any one of items 34 to 49, wherein the levigation in the last opening or lumen is continued until the suspension can easily pass through the opening or lumen. (Item 51) The method according to any one of Items 34 to 50, wherein trituration in each opening or lumen is continued until the suspension can easily pass through the opening or lumen thereof. (Item 52) The method according to any one of Items 34 to 51, wherein the total time of trituration is about 30 minutes. (Item 53) The method according to any one of Items 34 to 52, wherein the pH of HBSS in step j is about 5.1 to about 5.7. (Item 54) The method according to Item 53, wherein the pH of HBSS in step j is about 5.4. (Item 55) The method according to any one of Items 34 to 54, wherein the pH of the HBSS suspension of the cells obtained in step j is about 5.0 to about 6.0. (Item 56) The method according to Item 55, wherein the pH of the HBSS suspension of the cells obtained in step j is about 5.6 to about 5.7. (Item 57) The method according to any one of Items 34 to 56, wherein step k includes incubating the cells at about 37 °C for about 25 minutes. (Item 58) The method according to any one of Items 34 to 57, wherein steps k and l are continued together for about 10 minutes to about 1 hour. (Item 59) The method according to any one of Items 34 to 58, wherein the medium in step m is a sphere medium containing DMEM / F12, 1% antibiotic, 1% B27, and optionally one or more growth factors. (Item 60) The method according to Item 59, wherein the growth factor includes bFGF, EGF, and heparin. (Item 61) A method for generating pluripotent cells, comprising: a. isolating the initial cells from a solution; b. resuspending the cells obtained in step a in a Hank's balanced salt solution (HBSS) having a pH of about 4.0 to about 6.5 and a solution of ATP; c. Kneading the cell suspension obtained in step b; d. Resuspending the cells obtained in step c in HBSS; e. Isolating cells from the suspension obtained in step d; f. Resuspending the cell pellet obtained in step g in a medium A method comprising: (Item 62) A method for generating pluripotent cells, comprising: a. Isolating initial cells from a solution; b. Resuspending the cells obtained in step a in a solution of Hanks' balanced salt solution (HBSS) with a pH of about 4.0 to about 6.5 and ATP; c. Isolating cells from the suspension obtained in step b; d. Resuspending the cells obtained in step c in a solution of HBSS with a pH of about 4.0 to about 6.5 and ATP to form a cell suspension; e. Kneading the cell suspension obtained in step d; f. Resuspending the cells obtained in step e in HBSS; g. Isolating cells from the suspension obtained in step f; h. Resuspending the cell pellet obtained in step g in a medium A method comprising: (Item 63) The method according to any one of Items 61 to 62, wherein the ATP is present in the solution of HBSS and ATP at a concentration of about 1.5 to about 5 mg / cc. (Item 64) The method according to Item 63, wherein the ATP is present in the solution of HBSS and ATP at a concentration of about 2.7 mM to about 9 mM. (Item 65) The method according to any one of Items 61 to 64, wherein a solution of HBSS and ATP with a pH of about 4.0 to about 6.5 is prepared by titrating the HBSS solution with the ATP solution until the desired pH is reached. (Item 66) The method according to Item 65, wherein the ATP solution has a concentration of about 50 mM to about 500 mM. (Item 67) The method according to item 66, wherein the ATP solution has a concentration of about 200 mM. (Item 68) The method according to any one of items 61 to 67, wherein the pH of the solution of the HBSS and ATP is from about 5.0 to about 5.7. (Item 69) The method according to any one of items 61 to 68, wherein the pH of the solution of the HBSS and ATP is about 5.0. (Item 70) The method according to any one of items 61 to 69, wherein the HBSS in step f of item 62 and step d of item 61 does not contain ATP. (Item 71) The method according to any one of items 61 to 70, wherein the isolation includes centrifugation. (Item 72) The method according to any one of items 61 to 71, further comprising contacting the first cell and trypsin for about 1 minute to about 10 minutes before step a. (Item 73) The method according to item 72, further comprising contacting the first cell and trypsin for about 3 minutes to about 5 minutes before step a. (Item 74) The method according to any one of items 72 to 73, wherein the trypsin is inactivated by contacting the cell pellet with Dulbecco's Minimum Essential Medium (DMEM) / F-12 containing 10% heat-inactivated fetal bovine serum (FBS). (Item 75) The method according to any one of items 61 to 74, wherein the trituration includes triturating the cells through a series of openings or lumens having successively decreasing diameters. (Item 76) The method according to item 75, wherein the series includes at least three openings or lumens. (Item 77) The method according to any one of items 75 to 76, wherein at least the first opening or lumen is pre-coated with HBSS or water. (Item 78) The method according to any one of items 75 to 77, wherein the inner diameter of the first opening or lumen is from about 0.5 mm to about 2.0 mm. (Item 79) The method according to item 78, wherein the inner diameter of the first opening or lumen is about 0.7 mm to about 1.5 mm. (Item 80) The method according to item 79, wherein the inner diameter of the first opening or lumen is about 1.1 mm. (Item 81) The method according to any one of items 75 to 80, wherein levigation through the first opening or lumen is carried out for about 1 minute to about 10 minutes. (Item 82) The method according to item 81, wherein levigation through the first opening or lumen is carried out for about 5 minutes. (Item 83) The method according to any one of items 75 to 82, wherein the inner diameters of the last two openings or lumens in the series are about 90 to about 200 microns and about 25 microns to about 90 microns. (Item 84) The method according to item 83, wherein the inner diameters of the last two openings or lumens in the series are about 100 to about 150 microns and about 50 microns to about 70 microns. (Item 85) The method according to any one of items 61 to 84, wherein the levigation includes levigation for about 5 to about 20 minutes through the second opening or lumen to the last opening or lumen and levigation for about 5 to about 20 minutes in the last opening or lumen. (Item 86) The method according to item 85, wherein the levigation includes levigation for about 10 minutes through the second opening or lumen to the last opening or lumen and levigation for about 15 minutes in the last opening or lumen. (Item 87) The method according to any one of items 75 to 86, wherein levigation in the last opening or lumen is continued until the suspension can easily pass through the opening or lumen. (Item 88) The method according to any one of items 75 to 87, wherein levigation in each opening or lumen is continued until the suspension can easily pass through the opening or lumen. (Item 89) The method according to any one of items 61 to 88, wherein the total mixing time is about 30 minutes. (Item 90) The method according to any one of items 61 to 89, wherein the HBSS after the mixing is about 5 to about 15 volumes. (Item 91) The method according to any one of items 61 to 90, wherein the HBSS after the mixing is about 10 volumes. (Item 92) The method according to any one of items 61 to 91, wherein the pH of the HBSS added after the mixing is about 5.1 to about 5.7. (Item 93) The method according to any one of items 61 to 92, wherein the pH of the HBSS added after the mixing is about 5.4. (Item 94) The method according to any one of items 61 to 93, wherein the pH of the HBSS suspension of the cells obtained in step f of item 62 and step d of item 61 is about 5.0 to about 6.0. (Item 95) The method according to any one of items 61 to 93, wherein the pH of the HBSS suspension of the cells obtained in step f of item 62 and step d of item 61 is about 5.6 to about 5.7. (Item 96) The method according to any one of items 61 to 94, wherein after adding HBSS after the mixing, the cells are present at a concentration of about 500,000 cells / mL to about 4,000,000 cells / mL. (Item 97) The method according to any one of items 61 to 96, wherein after adding HBSS after the mixing, the cells are present at a concentration of about 2,000,000 cells / mL. (Item 98) The method according to any one of items 61 to 97, wherein the medium is a sphere medium containing DMEM / F12, about 1% antibiotic, about 2% B27, and optionally one or more growth factors. (Item 99) The method according to item 98, wherein the growth factors include bFGF, EGF, and heparin. (Item 100) A method for generating pluripotent cells, wherein the initial cells are present in a tissue containing red blood cells, a. mechanically mincing the tissue in the presence of one or more ECM degrading enzymes; b. incubating the sample obtained in step a near the natural in vivo temperature of the tissue while agitating the tissue; c. diluting the cell suspension obtained in step b with a Hank's balanced salt solution (HBSS) having a pH of about 4.0 to about 6.5 and a solution of ATP; d. triturating the cell suspension obtained in step c; e. resuspending the cells obtained in step d in HBSS; f. isolating cells from the suspension obtained in step e; g. resuspending the cell pellet obtained in step g in a medium comprising a method. (Item 101) A method for generating pluripotent cells, comprising the initial cells being present in a tissue containing red blood cells, a. mechanically mincing the tissue in the presence of one or more ECM degrading enzymes; b. incubating the sample obtained in step a near the natural in vivo temperature of the tissue while agitating the tissue; c. diluting the cell suspension obtained in step b with a Hank's balanced salt solution (HBSS) having a pH of about 4.0 to about 6.5 and a solution of ATP; d. isolating cells from the suspension obtained in step b; e. resuspending the cells obtained in step c in a HBSS having a pH of about 4.0 to about 6.5 and a solution of ATP to form a cell suspension; f. triturating the cell suspension obtained in step d; g. resuspending the cells obtained in step e in HBSS; h. isolating cells from the suspension obtained in step f; i. resuspending the cell pellet obtained in step g in a medium comprising a method. (Item 102) The tissue containing the red blood cells is lung; spleen; and liver The method according to any one of items 100 to 101, selected from the group consisting of (Item 103) The method according to any one of items 100 to 10, wherein the tissue is the lung and the ECM degrading enzyme is collagenase P. (Item 104) The method according to any one of items 100 to 103, wherein the mincing in step a is continued for about 10 minutes. (Item 105) The method according to any one of items 100 to 104, wherein the ATP is present in the solution of the HBSS and ATP at a concentration of about 1.5 to about 5 mg / cc. (Item 106) The method according to item 105, wherein the ATP is present in the solution of the HBSS and ATP at a concentration of about 2.7 mM to about 9 mM. (Item 107) The method according to any one of items 100 to 106, wherein the solution of the HBSS and ATP having a pH of about 4.0 to about 6.5 is prepared by titrating the HBSS solution with the ATP solution until the desired pH is reached. (Item 108) The method according to item 107, wherein the ATP solution has a concentration of about 50 mM to about 500 mM. (Item 109) The method according to item 108, wherein the ATP solution has a concentration of about 200 mM. (Item 110) The method according to any one of items 100 to 109, wherein the pH of the solution of the HBSS and ATP is about 5.0 to about 5.7. (Item 111) The method according to any one of items 100 to 110, wherein the pH of the solution of the HBSS and ATP is about 5.0. (Item 112) The method according to any one of items 100 to 110, wherein the HBSS in step g of item 101 and step e of item 100 does not contain ATP. (Item 113) The method according to any one of items 100 to 110, wherein the isolation includes centrifugation. (Item 114) The method according to any one of Items 100 to 113, further comprising contacting the first cell and trypsin for about 1 minute to about 10 minutes before step c. (Item 115) The method according to Item 114, further comprising contacting the first cell and trypsin for about 3 minutes to about 5 minutes before step c. (Item 116) The method according to any one of Items 114 to 115, wherein the trypsin is inactivated by contacting the cell pellet with Dulbecco's Minimum Essential Medium (DMEM) / F-12 containing 10% heat-inactivated fetal bovine serum (FBS). (Item 117) The method according to any one of Items 100 to 117, wherein the trituration comprises triturating the cells through a series of openings or lumens having gradually decreasing diameters. (Item 118) The method according to Item 117, wherein the series comprises at least three openings or lumens. (Item 119) The method according to any one of Items 100 to 118, wherein at least the first opening or lumen is pre-coated with HBSS or water. (Item 120) The method according to any one of Items 100 to 119, wherein the inner diameter of the first opening or lumen is about 0.5 mm to about 2.0 mm. (Item 121) The method according to Item 120, wherein the inner diameter of the first opening or lumen is about 0.7 mm to about 1.5 mm. (Item 122) The method according to Item 121, wherein the inner diameter of the first opening or lumen is about 1.1 mm. (Item 123) The method according to any one of Items 100 to 122, wherein the trituration through the first opening or lumen is carried out for about 1 minute to about 10 minutes. (Item 124) The method according to any one of Items 100 to 123, wherein the trituration through the first opening or lumen is carried out for about 5 minutes. (Item 125) The method according to any one of Items 100 to 124, wherein the inner diameters of the last two openings or inner cavities of the series are from about 90 to about 200 microns and from about 25 microns to about 90 microns. (Item 126) The method according to Item 125, wherein the inner diameters of the last two openings or inner cavities of the series are from about 100 to about 150 microns and from about 50 microns to about 70 microns. (Item 127) The method according to any one of Items 100 to 126, wherein the kneading includes kneading for about 5 to about 20 minutes from the second opening or inner cavity to the last opening or inner cavity, and kneading for about 5 to about 20 minutes in the last opening or inner cavity. (Item 128) The method according to 127, wherein the kneading includes kneading for about 10 minutes from the second opening or inner cavity to the last opening or inner cavity, and kneading for about 15 minutes in the last opening or inner cavity. (Item 129) The method according to any one of Items 100 to 128, wherein the kneading in the last opening or inner cavity is continued until the suspension can easily pass through the opening or inner cavity. (Item 130) The method according to any one of Items 100 to 129, wherein the kneading in each opening or inner cavity is continued until the suspension can easily pass through the opening or inner cavity. (Item 131) The method according to any one of Items 100 to 130, wherein the total time of kneading is about 30 minutes. (Item 132) The method according to any one of Items 100 to 131, wherein it is about 5 to about 15 volumes of HBSS after the kneading. (Item 133) The method according to any one of Items 100 to 132, wherein it is about 10 volumes of HBSS after the kneading. (Item 134) The method according to any one of Items 100 to 133, wherein the pH of the HBSS added after the kneading is from about 5.1 to about 5.7. (Item 135) The method according to any one of items 100 to 134, wherein the pH of the HBSS added after trituration is about 5.4. (Item 136) The method according to any one of items 100 to 135, wherein the pH of the HBSS suspension of the cells obtained in step g of item 101 or step e of item 100 is about 5.0 to about 6.0. (Item 137) The method according to any one of items 100 to 136, wherein the pH of the HBSS suspension of the cells obtained in step g of item 101 or step e of item 100 is about 5.6 to about 5.7. (Item 138) The method according to any one of items 100 to 137, wherein after adding HBSS after trituration, the cells are present at a concentration of about 500,000 cells / mL to about 4,000,000 cells / mL. (Item 139) The method according to any one of items 100 to 138, wherein after adding HBSS after trituration, the cells are present at a concentration of about 2,000,000 cells / mL. (Item 140) The method according to any one of items 100 to 139, wherein the medium is a sphere medium containing DMEM / F12, about 1% antibiotic, about 2% B27, and optionally one or more growth factors. (Item 141) The method according to item 140, wherein the growth factors include bFGF, EGF, and heparin. (Item 142) The method according to any one of items 1 to 141, wherein the initial cells are mouse cells and the sphere medium contains LIF. (Item 143) Further comprising the step of culturing the obtained cells for at least one week, The culturing is a. adding a sphere medium optionally containing growth factors; and b. stirring the cells so as not to adhere to the bottom of the dish and comprising The method according to any one of items 1 to 141. (Item 144) The method according to item 143, wherein the spherical medium is added every 1 to 4 days. (Item 145) The method according to item 143, wherein the spherical medium is added every 2 days. (Item 146) The method according to any one of items 142 to 145, wherein the stirring includes pipetting the cells with a pipette. (Item 147) The method according to item 146, wherein the diameter of the hole of the pipette is about 1.1 mm. (Item 148) The method according to any one of items 146 to 147, wherein the pipetting is performed at least once a day. (Item 149) The method according to item 148, wherein the pipetting is performed at least twice a day. (Item 150) Further comprising selecting cells having pluripotency, wherein the selecting is selecting cells with low adhesion; selecting cells that are components of the sphere; and selecting cells with a relatively small size including a method selected from the group consisting of the method according to any one of items 1 to 149. (Item 151) The method according to any one of items 1 to 150, further comprising a final step of selecting cells showing pluripotency. (Item 152) The method according to any one of items 1 to 151, wherein the initial cells do not exist as part of a tissue. (Item 153) The method according to any one of items 1 to 152, wherein the initial cells are somatic cells, stem cells, progenitor cells or embryonic cells. (Item 154) The method according to any one of items 1 to 153, wherein the initial cells are isolated cells. (Item 155) The method according to any one of items 1 to 154, wherein the initial cells exist in a heterogeneous cell population. (Item 156) The method according to any one of Items 1 to 155, wherein the initial cells are present in a homogeneous cell population. (Item 157) The method according to any one of Items 1 to 156, wherein selecting the cells exhibiting pluripotency includes selecting cells that express a stem cell marker. (Item 158) The method according to any one of Items 157, wherein the stem cell marker is selected from the group consisting of Oct4; Nanog; E-cadherin and SSEA4. (Item 159) The method according to any one of Items 1 to 158, wherein selecting the cells exhibiting pluripotency includes selecting non-adherent cells. (Item 160) The method according to any one of Items 1 to 159, further comprising culturing the pluripotent cells to proliferate the pluripotent cells. (Item 161) The method according to any one of Items 1 to 160, wherein the pluripotent cells express a stem cell marker. (Item 162) The method according to Item 161, wherein the stem cell marker is selected from the group consisting of Oct4; Nanog; E-cadherin and SSEA4. (Item 163) The method according to any one of Items 1 to 162, wherein the initial cells are mammalian cells. (Item 164) The method according to any one of Items 1 to 163, wherein the initial cells are human cells. (Item 165) The method according to any one of Items 1 to 164, wherein the initial cells are adult cells, neonatal cells, fetal cells, amniotic cells or umbilical cord blood cells. (Item 166) The method according to any one of Items 1 to 165, further comprising maintaining the pluripotent cells in vitro. (Item 167) An assay comprising contacting a pluripotent cell prepared by the method according to any one of Items 1 to 166 with a candidate agent. (Item 168) The assay according to item 167, which is used to identify an agent that affects one or more of the viability, differentiation, and proliferation of the pluripotent cells. (Item 169) Use of the pluripotent cells prepared by the method according to any one of items 1 to 166 in a method of cell therapy for a subject. (Item 170) A method for preparing a cell or tissue suitable for cell therapy to be performed on a subject, including generating pluripotent cells from cells according to any one of items 1 to 166, wherein the cells are autologous cells or HLA-compatible allogeneic cells, Method. (Item 171) The method according to item 170, further including differentiating the pluripotent cells along a predetermined cell lineage before administering the cells or tissue to the subject. (Item 172) A composition containing pluripotent cells, wherein the pluripotent cells are generated from cells by the method according to any one of items 1 to 166. (Item 173) A method for autologous cell therapy of a subject in need of cell therapy, a. Generating pluripotent cells from cells collected from the subject according to any one of items 1 to 166; and b. Administering to the subject a composition containing the pluripotent cells or their differentiated progeny including. (Item 174) The method according to item 173, further including differentiating the pluripotent cells along a predetermined cell lineage before administering the composition to the subject.

Example

[0178] Example 1 All organisms are equipped with primitive survival instincts. When plants are exposed to significant external stress, it causes dedifferentiation of cells and activates a survival mechanism that enables the regeneration of the damaged area or the entire organism. Such a mechanism seems to be essential for lower organisms to survive extreme environmental changes, but it has not yet been reported in mammals.

[0179] The present inventors hypothesized that physical stress might cause mature mammalian cells to return to a stem cell state, similar to what is seen in plants and lower organisms. To test this hypothesis, mature cells obtained from several adult somatic tissues were examined. First, CD45-positive lymphocytes collected from Oct4-GFP mice were examined to narrow down the physical stress that seemed to be most effective in changing mature cells back to a less mature state. In the cells of this mouse, it was found that when the stem cell-specific Oct4 promoter was activated, the cells had returned to a stem cell phenotype. Mature and fully differentiated cells were exposed to several significant external stimuli.

[0180] For example, CD45-positive lymphocytes were exposed to a low pH solution to impose strong chemical stress. GFP-expressing cells were observed within 3 days after the exposure, and spherical colonies composed of GFP-expressing cells were observed by day 5. The cells thus generated are referred to as stress-altered stem cells (SASC or SAC) in this example. Additionally, SACs may be referred to as rejuvenated stem cells (RSC) or animal callus cells (ACC). SACs expressed several markers commonly found in embryonic stem cells. SACs exhibited differentiation potential equivalent to that of ES cells, contributed to the generation of chimeric mice, and were able to form the entire fetus when injected into 4N blastocysts. The cells thus generated initially showed a state commonly observed in the induction of cell-based damage defense mechanisms, including low mitochondrial activity. Subsequently, demethylation of the Oct4 gene and Nanog gene promoter was observed in these cells. The reprogramming of stress-altered cells was thought to be induced via mesenchymal-epithelial transition. This observation is consistent with the description of cells contained in plant callus in response to damage (external stimuli). Plant callus is formed by stress inducing the conversion of cells into pluripotent plant stem cells capable of forming clones. Such spherical colonies generated by mature, fully differentiated mammalian somatic cells in response to significant external stimuli are referred to as animal callus in this specification, and stress-altered cells contained in such colonies or callus are referred to as "animal callus cells" (ACC) or SAC.

[0181] In this way, normal mature adult cells were reprogrammed into pluripotent stem cells capable of embryogenesis by significant physical and chemical stresses. Although not wishing to be bound by theory, the reprogramming mechanism is thought to involve the induction of cell survival and repair processes that are normally seen when responding to injury. This specification shows that mammalian cells have a survival mechanism to return to a reprogrammed state in response to significant stress-like external stimuli that are very similar to those of plants.

[0182] The induction and forced expression of specific genes 1~5 in various types of cells have been reported to reprogram them into a pluripotent stem cell state. Additionally, when cells are damaged by exposure to stimuli such as burns, chemical injuries, trauma, and radiation, normal cells are thought to be able to change into cancer cells.

[0183] Introduction All organisms have a common instinct to adapt to the environment and survive damage caused by stress-like stimuli by regenerating their bodies. In plants, embryogenesis is observed not only in zygotes but also in fully differentiated cells and immature pollen. In vertebrates, newts have the ability to regenerate several anatomical structures and organs including limbs. 1 Of particular note is that the excellent regenerative ability seen in both plants and newts is induced by external stimuli that cause dedifferentiation of already fully differentiated somatic cells. This survival instinct is thought to have been passed down from the common ancestor to modern organisms over billions of years since the emergence of the first living organisms, while various organisms have evolved in their own ways. Although terminally differentiated cells of mammals are usually thought to be unable to reverse the differentiation process, mammals may also possess a program to avoid death in response to dramatic environmental changes that have not been recognized until now.

[0184] Plant callus is a mass of proliferating cells formed in response to external stimuli such as injury and can be cultured and stimulated by plant hormones. 2。Callus contains reprogrammed somatic cells called callus cells, and each of these somatic cells is capable of clonally forming an entire plant. Callus cells do not exist innately in plants but are generated from somatic cells in response to external stimuli. Recent research has revealed that mammalian somatic cells can be reprogrammed by exogenous processes such as gene transfer, but 3~7 , it has not been reported that mammalian somatic cells are reprogrammed in response to exogenous physical and / or chemical stimuli in the same way as in plants. Interestingly, it is thought that normal somatic cells can change into cancer cells due to exposure to extreme external stimuli, such as heat injury, chemical injury, trauma, and exposure to radiation sources, including such stimuli. Such findings seem to indicate that external stimuli bring about changes in mammalian cells.

[0185] In this study, we hypothesized that mammalian cells retain a mechanism to survive exposure to significant external stress, similar to plants. In this report, in addition to demonstrating that reprogramming of mature, fully differentiated mammalian somatic cells obtained from various tissues can occur by applying significant physical and chemical stimuli, we describe evidence that such stress-altered cells can form animal callus containing "animal callus cells" capable of regenerating a clonal body.

[0186] Results Significant physical and chemical stimuli applied to mature somatic cells. Since the embryonic transcription factor Oct4 is considered to be extremely important for regulating the pluripotent state of cells, the first strategy was to identify the most efficient external stimuli for reprogramming mature cells to express Oct4. To avoid contamination with undifferentiated cells, CD45-positive hematopoietic cells were first examined. Oct4-GFP (GOF) mice 8CD45-positive cells isolated from the spleen obtained from 2+ were exposed to various significant physical and chemical stimuli. The exposures included osmotic treatment, treatment by significant mechanical trituration, exposure to low pH, induction of cell membrane damage using streptolysin O (SLO), exposure to low nutrient conditions, and exposure to low oxygen and high Ca concentrations. Next, GFP-expressing cells were identified, sorted, and collected using FACS. Gene expression of Oct4 was confirmed by R-T

[0187] PCR. Exposure to each added stimulus caused mature cells to be reprogrammed to express GFP to some extent (Figure 5A). Exposing mature cells to chemical stress by low pH and physical stress by significant mechanical trituration seemed to be the most effective treatment for changing mature cells to express Oct4. To clarify the optimal pH for inducing conversion to Oct4-expressing cells, CD45-positive cells were exposed to solutions of various acidities from pH 4.0 to pH 6.8. On the third day after exposure to the acidic solution, GFP expression of the cells was analyzed using FACS. The acidic solution with pH 5.4 - 5.6 was the most efficient for changing cells to express GFP (Figure 5B). Therefore, the stress treatment selected for the remaining part of the study was narrowed down to exposure to low pH. 9 and ACTH 10 were examined. Some previously described media including ES establishment medium 3i 11 and ES culture condition ES-LIF 12 were examined. Some previously described media including embryonic neural stem cell culture condition B27-LIF 13 and EpiSC culture condition were considered. Cells were seeded in each medium and GFP-expressing colonies were counted (Figure 5C). Medium B27-LIF seemed to be the most effective for generating GFP-expressing spherical colonies. Therefore, B27-LIF medium was used for culturing the treated cells.

[0188] When stress-treated CD45-positive cells were cultured in B27-LIF medium, GFP-expressing spherical colonies were observed within 5 days, whereas GFP-expressing colonies were not observed in the untreated control (Figure 1A). During the first 7 days, the spherical colonies grew to a diameter of approximately 70 μm and could be maintained under those culture conditions for an additional 7 days. The outer shape of the colonies was somewhat irregular and resembled the shape of callus found in plants rather than a sphere. Therefore, the cell colonies generated by stress treatment were designated as animal callus (AC). After dissociating the cultured cells, population analysis was performed using FACS. The analysis revealed that by applying a specific significant stimulus, stress-altered cells (hereinafter referred to as animal callus cells (ACC)) that had not been present in the CD45-positive cell population until then were generated (Figure 1B). The phenotypic change of CD45-positive cells by stress treatment was observed at the single-cell level. While CD45-positive cells did not express GFP, ACC expressed GFP and the expression of CD45 decreased (data not shown). Examination of single cells revealed that the size of the treated cells appeared larger than that of the untreated cells. Therefore, the cell size of the ACC population was analyzed by FACS. The cell size of ACC was extremely small, and 80% of the cells had a diameter of less than 8 μm (Figure 1C).

[0189] To examine the time-dependent changes in phenotypes related to CD45 reduction and Oct4 expression, stress-treated CD45-positive cells were analyzed on the 1st, 3rd, and 7th days. On the 1st day, CD45 expression was still observed in most cells, but Oct4 expression was not. On the 3rd day, the marker expression changed, and CD45-negative cells or CD45-negative / Oct4-positive (dim) cells became apparent. On the 7th day, CD45 expression disappeared, and Oct4-expressing cells were observed (Figure 1D). It is noteworthy that the number of PI-positive cells (dead cells) gradually increased during the first 7 days of culture (data not shown), suggesting that the properties of the cells gradually changed depending on the stress treatment and culture conditions, and cells that successfully changed to express Oct4 were selected.

[0190] Characterization of ACC. To confirm the reprogramming of somatic cells by exposure to external stimuli, the expression of early embryogenesis marker genes in ACC was examined. ES cells were used in the following experiments as a positive control for early embryogenesis. Marker expression and DNA methylation were characterized as follows: On day 7, immunofluorescence staining showed that the spherical colonies containing ACC uniformly expressed the pluripotent cell markers E-cadherin antigen, Nanog, SSEA-1, PCAM-1, and AP and were Oct4-GFP positive (data not shown). Gene expression analysis revealed that ACC and ES cells, unlike primary CD45-positive cells, expressed the Oct4, Nanog, Sox2, Ecat1, Esg1, Dax1, Fgf5, Klf4, and Rex1 genes at comparable levels (Figure 2A). The expression of ES-specific genes in ACC reached a peak on day 7 (Figure 2A). Bisulfite sequencing was performed to clarify the methylation status of the Oct4 gene and Nanog gene promoters in ACC. In the control samples of natural and cultured lymphocytes, extensive methylation was observed in both promoters, whereas in ACC, extensive demethylation was observed in almost the same regions as in ES cells (Figure 2B). Therefore, it was found that mammalian somatic cells were reprogrammed by external stress.

[0191] To confirm that Oct4 gene expression occurs by stress treatment of mature cells not only in GOF mice but also in wild-type mice, CD45-positive lymphocytes were collected from the spleens obtained from ICR mice. The lymphocytes were then exposed to stress treatment and analyzed over time until day 7 using FACS. A cell population positive for SSEA-1 / E-cadherin was observed in the stress-treated group, whereas SSEA-1 / E-cadherin expression was not observed in the non-stress-treated control group (Figure 6A). It was confirmed by RT-PCR that these double-positive cells expressed the Oct4 gene (Figure 6B). These results indicated that, regardless of the mouse strain, stress treatment resulted in the generation of ACC, which are Oct4-positive pluripotent marker-expressing cells, from CD45-positive cells.

[0192] The above results suggest that mature and fully differentiated adult somatic cells have reverted to "stem cell properties" through stress treatment.

[0193] To evaluate the stem cell properties of ACC, its self-renewal and differentiation abilities were examined. To examine the self-renewal ability of ACC, ACC colonies derived from already mature CD45-positive lymphocytes were separated into single cells, and the cells were seeded at a density of 1 cell per well in a 96-well plate so that a clonally generated population would form. Ten days after seeding, spherical colonies were observed in 4 out of 96 wells. The doubling time of ACC varied depending on the well. Some divided in 12 - 16 hours, while others divided in 30 - 34 hours. Continuous Oct4 expression was observed even after ACC was passaged at least 5 times. Therefore, it was shown that in addition to self-renewal ability, ACC has the ability to differentiate into cells of all three germ layers in vitro.

[0194] Mature GOF lymphocyte-derived ACs were again separated into single cells, sorted so that only a population of cells expressing GFP was included, and then cultured in a differentiation medium. Fourteen to 21 days after seeding, the expression of βIII-tubulin and GFAP, which are ectodermal markers, α-smooth muscle actin, which is a mesodermal marker, and α-fetoprotein and cytokeratin 7, which are endodermal markers, was observed in the cells (data not shown). Therefore, ACC differentiated into representative cells of the three germ layers in vitro.

[0195] Stress changes in mature somatic cells obtained from various adult tissues. To examine whether ACC can be generated not only from mature lymphocytes but also from other types of somatic cells, Oct4-GFP (GOF) mice 8Brain, skin, muscle, fat, bone marrow, lung, and liver were harvested. Cells were isolated from the tissue samples and separated into single cells, and were treated under various physical and chemical stress conditions. Differences were observed in the efficiency of the process of changing cells, depending on both the cell source and the stress condition(s) to which the cells were exposed (Figure 7A). Differences in the ability of stress to change mature cells to express Oct4 were observed depending on the cell source, but mature cells derived from any of the three germ layers could be changed by stress to express Oct4 to some extent (Figure 7A). Expression of pluripotency markers, E-cadherin, Nanog, PCAM-1, and AP (data not shown), and genes of ES-specific markers (Figure 7B) was observed in ACC colonies derived from any mature tissue. Dramatic physical and chemical stress changed mature somatic cells back to stem cells, regardless of the tissue source and the germ layer of origin.

[0196] Regulation of cells at the initial stage of ACC generation. The above results indicate that somatic cell reprogramming occurs by strong physical and chemical stimuli. It was observed that stressed lymphocytes formed AC within 5 days. A hypothesis was proposed that dramatic changes occur in molecular events by exposure to stress. Therefore, the study was focused on the initial stage of reprogramming corresponding to the first 7 days after exposure to the stimulus.

[0197] Since ACC survived even when exposed to significant stress, it was speculated that a survival mechanism that is normally activated to repair cell damage is induced during the ACC generation process. First, on the 1st, 3rd, and 7th days, a number of candidate genes involved in the cell response to stress and DNA repair 14The expression was compared between natural CD45-positive cells and stressed CD45-positive cells. Analysis of a mixture of ACC-producing cells and other cells revealed that the expression of cell response genes was already observed on day 1, and these genes were upregulated over 7 days (Figure 8). Since a correlation was observed between the upregulation of cell response genes and ACC production, ACC was sorted on days 3 and 7, and gene expression was analyzed. All candidate genes except Hif3a were upregulated to varying degrees during the process of ACC production (Figure 3A). It was found that four heat shock genes and one DNA repair gene were upregulated during the process of ACC production. Furthermore, seven of the upregulated genes are known to be directly involved in regulating the redox state of cells. From the above results, it was suggested that self-repair ability or self-defense ability is induced during the process of ACC production.

[0198] Since upregulation of genes related to cellular redox was observed in ACC, the mitochondrial function of ACC was then examined. Mitochondria are organelles involved in the production of most of the ATP through redox reactions using oxygen within eukaryotic cells. When ACC spherical colonies were cultured without subculturing, GFP expression gradually decreased from the cells located at the periphery after 7 days. The ACC on day 10 contained central cells expressing GFP and differentiated peripheral cells not expressing GFP (data not shown). The morphology of mitochondria in ACC and differentiated cells was evaluated by staining with Mito Tracker Red, a mitochondrial-specific dye. The mitochondria of ACC were observed in a punctate form densely packed around the nucleus, and the spherical white differentiated cells contained numerous filamentous mitochondria throughout the cytoplasm. The ATP production amount of ACC was less than that of natural CD45-positive cells (Figure 3B). Also, the reactive oxygen species (ROS) production amount of ACC was less than that of natural CD45-positive cells (Figure 3C). Finally, important factors involved in mtDNA replication, specifically mitochondrial transcription factor A (Tfam), mitochondrial-specific DNA polymerase gamma (Polg), and its accessory subunit (Polg2), were evaluated. The gene expressions of Tfam, Polg, and Polg2 in ACC were lower than those in differentiated cells (Figure 3D). Therefore, the number of mitochondria contained in ACC was small, and the activity of mitochondria in ACC was lower than that in differentiated cells. From the above results, it was suggested that after ACC responded to severe stress, it acquired a different metabolic system from differentiated cells and survived.

[0199] The developmental potential of ACC. Finally, it was evaluated whether ACC has the same developmental potential as plant callus cells. As the first test of developmental potential, ACC transplanted subcutaneously into immunodeficient (SCID) mice was examined. Six weeks after transplantation, ACC generated tissues corresponding to all three germ layers (data not shown).

[0200] ACC differentiated into representatives of all three germ layers both in vivo and in vitro. Therefore, the chimeric contribution ability of ACC was evaluated. ACC used for the chimera formation assay was prepared using CD45-positive cells derived from F1 GFP (C57BL / 6GFP×DBA / 2 or 129 / SvGFP×C57BL / 6GFP) or GOF. Since gene expression analysis revealed that the expression level of the pluripotency marker gene of ACC was highest on day 7, ACC on day 7 was used for the chimera mouse formation assay. First, the conventional chimera formation method was used. AC was separated into single cells by treating with trypsin. Then, ACC was injected into blastocysts (Figure 4A). Using this method, the chimeric contribution rate of the separated ACC was extremely low (Table 1). Therefore, ACC that had not been pre-treated with trypsin, which often causes cell damage, was injected into blastocysts. Under a microscope, AC was cut into small clusters using a microknife. Then, small clusters of AC were injected into blastocysts (Figure 4A). Using this method, the chimeric contribution rate of ACC increased dramatically (data not shown). Chimeric mice formed by ACC grew into healthy individuals (data not shown), and germline transmission was observed. The chimeric contribution rate of each tissue was analyzed by FACS. From the results, it was found that ACC derived from lymphocytes contributed to all tissues (Figure 4B). 15 As shown above, ACC can be generated from various cells derived from all three germ layers (Figures 7A - 7B). To examine whether ACCs derived from various tissues have different differentiation tendencies, ACCs were generated from various tissues derived from F1 GFP mice and injected into ICR blastocysts. Then, FACS was used to analyze the contribution rate of each tissue in the formed chimeric mice. It was found that ACCs derived from any tissue contributed to the formation of chimeric mice (Figure 9). Furthermore, the contribution rates to the skin, brain, muscle, fat, liver, and lung in chimeric mice formed using ACCs derived from various tissues were analyzed. ACCs derived from any tissue contributed to the formation of all representative tissues of all three germ layers, and no differentiation tendency was observed (Figure 9).

[0201]

[0202] Mouse formation by tetraploid complementation, in which pluripotent cells are injected into 4N host blastocysts, is the most stringent test method for developmental potential because the resulting embryos are derived only from the injected donor cells. 16 ACC was generated from lymphocytes derived from DBA×B6GFP F1 mice or 129 / SvGFP×B6GFP F1 mice. When ACC was injected into 4N blastocysts, "total ACC embryos" were formed in the late gastrulation (mid-stage) (data not shown). Genotyping analysis revealed that the "total ACC embryos" had genes specific to the strain used for ACC generation. Therefore, ACC had the ability to form clonal bodies like plant callus cells.

[0203] Discussion Mammalian somatic cells show the ability to form animal callus (AC) by exposure to significant external stimuli, much like in the case of plants. Cells contained in such callus (animal callus cells, ACC) have the ability to form chimeric mice and, in addition, to form new embryos consisting only of cells completely generated from ACC. The results described here indicate that mammalian somatic cells regain the ability to differentiate into any of the three germ layers by external stimuli. This suggests that somatic cells are more plastic than previously thought. Furthermore, this study shows the possibility of reprogramming somatic cells without introducing genes or heterologous proteins, providing new insights into the potential of adult stem cells and serving as an important milestone in the elucidation of stem cell biology.

[0204] Materials and Methods Tissue collection and cell culture. For the isolation of mature lymphocytes, spleens from GOF mice or ICR mice were minced with scissors and mechanically separated using a Pasteur pipette. The separated spleens were filtered through a cell strainer (BD Biosciences, San Jose). The collected cells were resuspended in DMEM medium, the same volume of lympholyte (CEDARLANE® , Ontario, Canada) was added, and then centrifuged at 1000 g for 15 minutes. The lymphocyte layer was removed and obtained together with the CD45 antibody (ab25603, abeam, Cambridge, Massachusetts). CD45-positive cells were sorted by FACS Aria (BD Biosciences). Subsequently, the CD45-positive cells were subjected to stress treatment (for 15 minutes with a solution at pH 5.5) and seeded in B27 medium supplemented with 1000 U of LIF (Sigma) and 10 ng / ml of FGF2 (Sigma).

[0205] Exposure to external stimuli - stress treatment. To apply mechanical stress to mature cells, a Pasteur pipette was heated and then pulled and stretched to form a lumen with a diameter of approximately 50 microns and then folded. Subsequently, mature somatic cells were passed through this pipette and triturated for 20 minutes and cultured for 7 days. To apply a hypoxic stimulus to mature cells, the cells were cultured in an incubator with 5% oxygen for 3 weeks. The mature cells were cultured in basal medium for 3 weeks to apply a low-nutrient state stimulus to the cells. To expose the mature cells to physiological stress, the cells were treated with a low pH (pH 5.5) solution and cultured for 7 days. Additionally, more severe damage was inflicted on the cells. To create pores in the mature cell membrane, the cells were treated with SLO (streptolysin O).

[0206] The SLO-treated cells were incubated in HBSS containing 10 μg / mL SLO at 37 °C for 50 minutes and then cultured in SLO-free medium for 7 days. The cells exposed to low-nutrient stress were cultured in basal medium for 2 - 3 weeks. The cells exposed to "ATP" stress were incubated in HBSS containing 2.4 mM ATP at 37 °C for 15 minutes and then cultured in medium for 7 days. The cells exposed to "Ca" stress were cultured in medium containing 2 mM CaCl2 for 2 weeks.

[0207] Bisulfite sequencing. Cells obtained from GOF mice were separated into single cells. GFP-positive cells were collected using FACS Aria. Genomic DNA was extracted from ACC and examined. Bisulfite treatment of DNA was performed using the CpGenome DNA Modification Kit (Chemicon, Temecula, CA, http: / / www.chemicon.com) according to the manufacturer's instructions. The resulting modified DNA was amplified by nested polymerase chain reaction PCR using two forward (F) primers and one reverse (R) primer: Oct4 (F1, GTTGTTTTGTTTTGGTTTTGGATAT (SEQ ID NO: 1); F2, ATGGGTTGAAATATTGGGTTTATTTA (SEQ ID NO: 2); R, CCACCCTCTAACCTTAACCTCTAAC (SEQ ID NO: 3)) and Nanog (F1, GAGGATGTTTTTTAAGTTTTTTTT (SEQ ID NO: 4); F2, AATGTTTATGGTGGATTTTGTAGGT (SEQ ID NO: 5); R, CCCACACTCATATCAATATAATAAC (SEQ ID NO: 6)) were used. PCR was performed using TaKaRa Ex Taq Hot Start Version (RR030A). DNA sequencing was performed using M13 primers with the assistance of GRAS (Genome Resource Analysis Unit).

[0208] Immunohistochemistry. Cultured cells were fixed with 4% paraformaldehyde and 0.1% Triton After permeabilization with X-100 / PBS, blocking was performed with 1% BSA solution (Life Technology, Tokyo, Japan). The secondary antibody was a goat anti-mouse or anti-rabbit antibody conjugated with Alexa-488 or Alexa-594 (Invitrogen). The cell nuclei were visualized with DAPI (Sigma). The slides were mounted with SlowFade Gold anti-fade reagent (Invitrogen).

[0209] Fluorescence-activated cell sorting and flow cytometry. Cells were prepared according to standard protocols, suspended in 0.1% BSA / PBS on ice, and then FACS was performed. Dead cells were excluded using PI (BD Biosciences). Cells were sorted using a BD FACSAria SORP and analyzed using a BD LSRII (BD Biosciences) equipped with BD FACSDiva Software.

[0210] RNA preparation and RT-PCR analysis. RNA was isolated using the RNeasy Micro kit (QIAGEN). Reverse transcription was performed using the SuperScript III First Strand Synthesis kit (Invitrogen). SYBR Green Mix I (Roche Diagnostics) was used for amplification, and the samples were subjected to a Lightcycler-II Instrument (Roche Diagnostics).

[0211] Animal experiments. For the tumorigenicity test, cells suspended in 100 ml of PBS were subcutaneously injected into the flanks of age-matched immunodeficient SCID mice. After 6 weeks, the mice were sacrificed and dissected.

[0212] ATP and ROS assays. Intracellular ATP levels were measured using the ATP Bioluminescence Assay Kit HS II (Roche) according to the supplier's protocol. Fluorescence intensity was measured using a Gelomax 96 Microplate Luminometer (Promega, Madison, WI), and the fluorescence readings were normalized by the cell count number. For the measurement of ROS levels, cells were incubated at 37 °C for 15 min in the dark in medium containing 2 μM dihydroethidium (Molecular Probes). Cells were then washed with PBS and resuspended in PBS containing 0.5% BSA. Fluorescence intensity of 30,000 cells was recorded using a BD Biosciences LSR II (BD Bioscience, Sparks, MD).

[0213] Chimeric mouse formation and analysis. Generation of diploid and tetraploid chimeras. Diploid embryos were obtained from the mating of ICR females and ICR males, and tetraploid embryos were obtained from the mating of BDF1 females and BDF1 males. Tetraploid embryos were generated by electrofusion of two-cell embryos. 17 . In this experiment, since chimerization was reduced by trypsin treatment, after dissecting ACC globular colonies into small pieces using a microknife under a microscope, small clusters of ACC were injected into blastocysts on day 4.5 using a large pipette. The next day, chimeric blastocysts were transplanted into pseudopregnant females on day 2.5.

[0214] (References) 1. Brockes, J.P. & Kumar, A. Plasticity and reprogramming of differentiated cells in amphibian regeneration. Nature reviews. Molecular cell biology 3, 566 - 574, doi:10.1038 / nrm881 (2002). 2. Sinnott, J.J. & Burklund, C.W. The treatment of carotid insufficiency. The Nebraska state medical journal 45,357-359(1960).3.Hanna,J.et al.Direct reprogramming of terminally differentiated mature B lymphocytes to pluripotency.Cell 133,250-264,doi:10.1016 / j.cell.2008.03.028(2008). 4.Hockemeyer,D.et al.A drug-inducible system for direct reprogramming of human somatic cells to pluripotency.Cell stem cell 3,346-353,doi:10.1016 / j.stem.2008.08.014(2008). 5.Kim,D.et al.Generation of human induced pluripotent stem cells by direct delivery of reprogramming proteins.Cell stem cell 4,472-476,doi:10.1016 / j.stem.2009.05.005(2009). 6.Kim,J.B.et al.Direct reprogramming of human neural stem cells by OCT4.Nature 461,649-643,doi:10.1038 / nature08436(2009). 7.Okabe,M.et al.Definitive proof for direct reprogramming of hematopoietic cells to pluripotency.Blood 1 14,1764-1767,doi:10.1 182 / blood-2009-02-203695(2009). 8. Ohbo, K., et al. Identification and characterization of stem cells in prepubertal spermatogenesis in mice small star, filled. Developmental biology 258, 209 - 225 (2003). 9. Ying, Q.L., et al. The ground state of embryonic stem cell self - renewal. Nature 453, 519 - 523, doi:10.1038 / nature06968 (2008). 10. Ogawa, K., Matsui, F.L., Ohtsuka, S. & Niwa, H. A novel mechanism for regulating clonal propagation of mouse ES cells. Genes to cells: devoted to molecular & cellular mechanisms 9, 471 - 477, doi:10.1 111 / j.l356 - 9597.2004.00736.x (2004). 11. Gough, N.M., et al. LIF: a molecule with divergent actions on myeloid leukaemic cells and embryonic stem cells. Reproduction, fertility, and development 1, 281 - 288 (1989). 12. Hitoshi, S., et al. Primitive neural stem cells from the mammalian epiblast differentiate to definitive neural stem cells under the control of Notch signaling. Genes & development 18, 1806 - 1811, doi:10.110 l / gad.1208404 (2004). 13. Tesar, P. J. et al. New cell lines from mouse epiblast share defining features with human embryonic stem cells. Nature 448, 196 - 199, doi:10.1038 / nature05972 (2007). 14. Saretzki, G., Armstrong, L., Leake, A, Lako, M. & von Zglinicki, T. Stress defense in murine embryonic stem cells is superior to that of various differentiated murine cells. Stem Cells 22, 962 - 971, doi:10.1634 / stemcells.22 - 6 - 962 (2004). 15. Mitalipova, M. M. et al. Preserving the genetic integrity of human embryonic stem cells. Nature biotechnology 23, 19 - 20, doi:10.1038 / nbt0105 - 19 (2005). 16. Nagy, A, Rossant, J., Nagy, R., Abramow - Newerly, W. & Roder, J. C. Derivation of completely cell culture - derived mice from early - passage embryonic stem cells. Proceedings of the National Academy of Sciences of the United States of America 90, 8424 - 8428 (1993). 17. Nagy, A. et al. Embryonic stem cells alone are able to support fetal development in the mouse. Development 110, 815 - 821 (1990).

[0215]

Table 1

[0216]

Table 2

[0217]

Table 3

[0218] Example 2: Conversion of somatic cells into pluripotent cells induced by stimulation Here, without using nuclear transfer or transcription factor introduction, the "Stimulation-triggered pluripotency acquisition" (STAP), which is a nuclear reprogramming phenomenon in which mammalian somatic cells are sufficiently reprogrammed into pluripotent cells by strong external stimulation, will be described. In the presence of LIF, transient low pH stress causes CD45 + to cause dedifferentiation of hematopoietic cells into cells that express pluripotent cell markers such as Oct3 / 4 and have the ability to differentiate into three germ layers. In these STAP cells, a significant amount of demethylation is observed in the oct3 / 4 and nanog promoter regions, similar to ES cells. Gene rearrangement of the T cell receptor is observed in STAP cells derived from hematopoietic cells, indicating that STAP cells are generated from somatic cells whose fate is restricted by lineage conversion. From blastocyst injection, it can be seen that STAP cells efficiently contribute to chimeras even by the tetraploid complementation assay and contribute to offspring through germline transmission. Therefore, the epigenetic state of fate determination can be fundamentally reset situation-dependently by strong environmental factors.

[0219] In the concept of canalization of Waddington's epigenetic landscape, as cells differentiate down the hill, the fate of somatic cells is gradually determined. Generally, to reverse the state of differentiated cells, their nuclear function requires nuclear transfer 1 and introduction of multiple transcription factors 2It is considered that artificial, physical, or genetic manipulation is necessary, for example, by such means. Even without directly manipulating the nucleus in this way, it has not yet been clarified whether somatic cells can simply respond to an external trigger and have their nuclear program initialized. Such a situation is known to occur in plants. Specifically, it is possible to convert the fate of mature somatic cells by significantly changing the culture environment. For example, isolated carrot cells become immature shoot cells, and in the presence of auxin, the entire plant structure including stems and roots develops from them. Whether animal somatic cells can have a similar ability that appears at least under special conditions is an intractable problem. For the past decade, there has been a debate about whether pluripotent cells (or closely related cell types) exist in adult tissues, and various groups have reported conflicting conclusions about this. However, among them, none have shown that such pluripotent cells can arise from differentiated somatic cells.

[0220] Hematopoietic cells that are positive for CD45 (leukocyte common antigen) are typical lineage-restricted somatic cells that are often used as starting cell types in reprogramming research such as the induction of iPS cells. These cells do not express pluripotency-related markers such as Oct3 / 4 unless they are reprogrammed. In particular, CD45 in spleen tissue + cells are thought to be mostly non-leukocyte stem cells (maturing cells or progenitor cells), and the conversion from lymphocytes with genomic rearrangement of the T cell receptor β-chain (tcrβ) gene to iPS cells is considered an unmistakable feature of reprogramming from fate-restricted somatic cells. Therefore, the present inventors became interested in the question of whether spleen CD45 + cells can be converted to acquire pluripotency by a significant change in the external environment, such as a change caused by a simple chemical perturbation.

[0221] Results Treatment with low pH induced the fate conversion of fate-restricted somatic cells. CD45 collected from adult spleen obtained from oct3 / 4::gfp B6 mice 15 +Cells were exposed to various types of strong transient stimuli, including physical and chemical stimuli, and were cultured in suspension for several days using LIF-containing B27 medium, after which the activation of the oct3 / 4 promoter was examined. Among the various disruptions listed above, the disruption caused by low pH was focused on. As shown below, it was found that this type of disruption was the most effective in inducing oct3 / 4.

[0222] When not exposed to the stimulus, no expression of oct3 / 4::GFP was observed in the cells sorted by CD45, regardless of the culture period in the LIF-containing medium in which the sorted cells could survive. In contrast, spleen CD45 + When cells were treated with low pH medium (pH 4.5 - 6.0; Figure 12A) for 30 minutes, a significant number of oct3 / 4::GFP + cells appeared on the 7th day of culture (d7) (Figure 12B; the most effective range was pH 5.4 - 5.8; Figure 16B). These cells continued to express oct3 / 4::GFP for at least another 7 days (total 14 days) without subculture. On d7 of this non-adherent culture, the low pH-induced oct3 / 4::GFP + cells formed spherical (or slightly irregular) clusters (data not shown; consisting of several to dozens of cells) and no longer expressed CD45 (Figure 12C). The size of the low pH-induced oct3 / 4::GFP + cells was significantly smaller than that of untreated CD45 + cells (see immunostaining of single oct3 / 4::GFP cells and CD45 cells; Figure 12C); 80% of the former cells were less than 8 μm in diameter, while the diameter of the control CD45 + cells was in the range of 8 - 10 μm (estimated by forward scatter analysis in FACS, Figure 12D (the left peak indicates Oct3 / 4::GFP+ cells and the right peak indicates CD45+ cells)), which is interesting. The above observation results suggest that there were fundamental changes between the oct3 / 4::GFP + population and the CD45 + population other than the difference in the expression of the two markers.

[0223] In the time-course analysis (Figure 12C), dynamic changes in the cell population were revealed between d1 and d3. Most of the viable cells at d1 (the number of viable cells corresponded to approximately 85% of the population at d0) were still CD45 + and oct3 / 4::GFP - At d2 and d3, a significant proportion of the total viable cells (21% and 34% respectively) became oct3 / 4::GFP + and CD45 became faint (Figure 12C; by that time, approximately 50 - 60% of the seeded cells had disappeared). At d7, a significant number of oct3 / 4::GFP + / CD45 - cells (54% of the total viable cells) formed a population different from the oct3 / 4::GFP - / CD45 - population (Figure 12B, top; the total cell number at d7 was comparable to that at d3). In the culture of untreated CD45 + cells, no obvious oct3 / 4::GFP + / CD45 - population formation was observed (Figure 12B, bottom). Therefore, the number of oct3 / 4::GFP + / CD45 - populations in the low pH-treated group rose to a significant number, corresponding to approximately half of the total viable cells at d7. In fact, when the oct3 / 4::GFP signal first appeared at d2, the number of GFP + cells corresponded to approximately 8% of the initially seeded CD45 + cells. Therefore, it was considered highly unlikely that an extremely minor population (e.g., contaminating CD45 - cells) rapidly proliferated in the first two days after low pH treatment to form such a significant number of oct3 / 4::GFP + populations.

[0224] In live imaging analysis (data not shown), in contrast to untreated cells, low pH-treated CD45 + cells tended to form small clusters, which gradually began to emit GFP signals during the first few days. Then, these small oct3 / 4::GFP +The cluster frequently fused by d5 to form larger spheres, indicating that this cluster is polyclonal. This GFP + cluster is (unlike GFP - cells) extremely motile, and it was interesting that many had protruding cell processes (data not shown).

[0225] Lineage-restricted splenic CD45 + cells, particularly the T cell population, contribute to oct3 / 4::GFP + cells. To examine this, genomic PCR was used to isolate oct3 / 4::GFP + spheres and examine the genomic rearrangement of tcrβ. It was found that each sphere contained cells with only tcrβ gene rearrangement (data not shown). To rule out the possibility of contamination by oct3 / 4::GFP7CD45 + cell rearrangement, oct3 / 4::GFP + / CD45 - cells were sorted by FACS at d7 and subjected to a tcrβ gene rearrangement assay. Again, clear tcrβ gene rearrangement was observed (Figure 12E). These observations indicate that the fate-restricted somatic cell population (at least, T cells) of splenic cells contributes to oct3 / 4::GFP + cells by switching their fate from CD45 + to oct3 / 4::GFP + cells.

[0226] Low pH-induced Oct3 / 4 + cells are pluripotent. Next, it was examined whether the oct3 / 4::GFP + expression of the stimulated cells represents that the cells are pluripotent, or whether it simply represents that specific changes have occurred only in the gene expression pattern (in this case, oct3 / 4 and cd45) without acquiring pluripotency. From immunostaining, oct3 / 4::GFP at d7 +It was revealed that the sphere expressed pluripotency-related markers such as Oct3 / 4, SSEA-1, Nanog, E-cadherin, and AP (data not shown). In gene expression analysis by qPCR, the low pH-induced oct3 / 4::GFP cells at d7 + were different from CD45 + cells. It was revealed that they expressed oct3 / 4, nanog, sox2, ecat1, esg1, dax1, and klf4 genes at the same level as ES cells (Figure 13A (from left to right in each group, representing the expression of oct3 / 4, nanog, sox2, ecat1, esg1, dax1, and klf4); the above markers were already positive at d3). This indicates that the low pH-induced oct3 / 4::GFP + cells expressed a set of marker genes characteristic of true pluripotency that CD45 + cells do not express.

[0227] Next, it was examined whether this dramatic change in gene expression pattern was accompanied by a change in the epigenetic modification of pluripotency-related genes. For this purpose, bisulfite sequencing was performed to examine the methylation status of the oct3 / 4 promoter and nanog promoter regions. CD45 + cells showed a densely methylated pattern in both promoters regardless of the presence or absence of additional culture. In contrast, the low pH-induced oct3 / 4::GFP + cells showed extensive demethylation in these two regions like ES cells (Figure 13B), indicating that the epigenetic states of two important genes representing pluripotency were substantially reprogrammed in the cells.

[0228] Next, it was examined whether the low pH-induced cells had the ability to form three germ layer derivatives, which is a common criterion for pluripotency. Both in vitro differentiation assays (data not shown) and teratoma formation tests (data not shown) showed that ectodermal cells (e.g., β-tubulin III + ) and mesodermal cells (e.g., smooth muscle actin +) and endodermal cells (e.g., alpha-fetoprotein + ) were shown to be able to occur.

[0229] In summary, the above observation results indicate that the differentiation state of a somatic cell lineage fate-restricted by a strong externally given stimulus can be converted into a pluripotent cell state. Hereinafter, the fate conversion of somatic cells into pluripotent cells by a strong external stimulus such as low pH is called "stimulus-induced pluripotency acquisition" (STAP), and the cells generated thereby are called STAP cells.

[0230] STAP cells derived from other tissue sources. Another important question regarding STAP cells is whether the phenomenon of low pH-induced conversion is limited to CD45 + in leukocytes. To solve this question, similar conversion experiments were carried out using somatic cells collected from the brain, skin, muscle, fat, bone marrow, lung and liver tissues of oct3 / 4::gfp mice.

[0231] Cells derived from tissue samples were separated into single cells, transiently exposed to low pH, and cultured in LIF-containing medium. Although the effect of conversion differed depending on the originating tissue, oct3 / 4::GFP + cells were reproducibly observed on culture day 7 (Figure 14A (from left to right in each group represent CD45+ cells, bone marrow, brain, lung, muscle, fat, fibroblasts, liver and chondrocytes)). CD45 + cells, in addition to rare adipose tissue mesenchymal cells (data not shown), it is noteworthy that STAP cells were efficiently induced from primary cultured cells of chondrocytes, indicating that STAP cells can be generated from non-CD45 + cell populations. These oct3 / 4::GFP + cell clusters also expressed pluripotency-related markers (Figure 14B (from left to right in each group represent the expression of Oct3 / 4, Nanog, Sox2, Klf4 and Rex1) and Figure 18B, data not shown) and ES cell-specific marker genes (Figure 14B and Figure 18B).

[0232] Characteristics of STAP cells as pluripotent cells. Therefore, STAP cells express ES cell-specific genes and show a methylation pattern similar to that of the oct3 / 4 and nanog genes. Furthermore, STAP cells could be established in media for mouse ES cells such as LIF-containing media, but could not be established in mouse EpiSC media (data not shown).

[0233] However, although STAP cells showed considerable similarity to mouse ES cells, several different characteristics were also observed. For example, the self-renewal ability of STAP cells was limited. Unlike mouse ES cells (data not shown), when STAP cell spheres were separated into single cells by enzymes for clonal culture in each well of a 96-well plate, even when cultured for 10 days in an additional LIF-containing medium (G-MEM or B27-based), regardless of whether the attachment condition or non-attachment condition, colonies (AP + or oct3 / 4::GFP + ) were not formed at all (data not shown). The frequency of spherical colony formation was low (usually 2 - 4 wells out of 96 wells), but all of the above colonies were AP - and oct3 / 4::GFP - . When STAP cell spheres were partially separated and cultured under high cell density conditions (data not shown; thought to be more suitable for supporting self-renewal), the cell number began to decrease after 2 passages, and oct3 / 4::GFP + cells could not be maintained beyond the 5th passage. Such characteristics regarding proliferation and maintenance suggest that STAP cells are a pluripotent cell population with some different characteristics from mouse ES cells and iPS cells.

[0234] Mouse EpiSC is another type of pluripotent stem cell thought to be at a slightly more advanced differentiation stage. STAP cells seemed to behave differently from EpiSC cells in several aspects. In adherent culture, oct3 / 4::GFP +Unlike the monolayer and flat colonies seen in mouse EpiSCs, the cells formed hemispherical colonies by piling up like mouse ES cells. STAP cells could not be maintained in EpiSC medium, suggesting that STAP cells are not similar to EpiSCs (data not shown). Furthermore, treatment with a ROCK inhibitor (see Ohgushi), which improves the subculture of single EpiSC cells, did not promote colony formation from isolated STAP cells (data not shown).

[0235] Immunostaining revealed that STAP cells were negative for the EpiSC markers claudin 7 and ZO-1 and positive for K1f2 / 4 (data not shown). The expression of the ES cell marker Esrrβ was low in both STAP cells and EpiSCs, whereas the expression of elf5 was particularly low in STAP cells (Figure 15A (from left to right in each group represent ES, EpiSC, STAP, and CD45)), suggesting that the grouping of ES cells, STAP cells, and EpiSCs is not very simple. Genome-wide transcriptome cluster analysis showed that STAP cells were closest to ES cells and the RNA expression was substantially the same as that of blastocysts, whereas they were farthest from the parental CD45 + cells (data not shown). The state of X chromosome inactivation in STAP cells was interesting. Specifically, inactivated chromosomes were observed in approximately 40% of female STAP cells (d7), whereas X chromosome inactivation was canceled out in the remaining cells (approximately 60%) (Figure 15B).

[0236] From the above observations, the possibility has emerged that the differentiation state of STAP cells is a new metastable pluripotent state that is close to but different from ES cells.

[0237] Chimera formation and germline transmission in mice. Finally, the chimera-forming ability of STAP cells was evaluated by blastocyst injection assay. Unlike ES cells, when STAP cells (B6 background) were separated into single cells and injected into ICR blastocysts, no chimeric mice with dark body hair color were born (Table 4). Since it is almost impossible to maintain single STAP cells in vitro, it was speculated that cell separation somewhat altered their ability. Therefore, STAP cell clusters were manually dissected into small pieces using a microknife under a microscope and injected into blastocysts en masse (data not shown). Using such a technique, chimeric mice were born at a considerable rate and all developed normally (data not shown). Next, the tissue contribution rate of STAP cells generated from and injected into CD45 + cells of mice that constantly express GFP (F1 obtained by crossing C57BL / 6GFP with DBA / 2 or 129 / Sv) was examined. High or moderate contribution rates of GFP-expressing cells were observed in chimeric embryos injected with STAP cell clusters (data not shown).

[0238] The contribution rate of GFP + cells in each tissue of the above chimeric embryos was analyzed by FACS. CD45 + cell-derived STAP cells contributed to all tissues examined (data not shown). Furthermore, offspring derived from STAP cells were born in chimeric mice (Table 5). In addition to being genetically and epigenetically normal, since germline transmission is considered a strict criterion for pluripotency 22 , this ability of STAP cells is important and indicates the nature of these truly pluripotent cells. Next, the tetraploid (4N) complementation method was performed by injecting cells into 4N blastocysts (data not shown). The tetraploid (4N) complementation method is considered the most stringent test method for examining the developmental ability of cells because the resulting embryos are derived only from the injected donor cells 23 . When CD45 + cell-derived STAP cells (derived from DBA×B6GFP or 129 / Sv×B6GFP F1 mice) were injected into 4N blastocysts, at E10.5, "all GFP+ The "embryo" was formed (data not shown), and it was shown that only STAP cells were sufficient to construct the entire embryonic structure.

[0239] Taking the above observation results into consideration, it clearly shows that STAP cells have the developmental potential to differentiate into all somatic cells and germ lines in the embryonic environment.

[0240] Discussion From the data described here, it has become clear that somatic cells have surprisingly flexible plasticity potentially. This dynamic plasticity, which even leads to conversion into pluripotent cells, appears when cells are transiently exposed to strong stimuli that are not normally experienced in their living environment.

[0241] CD45 + The conversion from cells to STAP cells was not substantially affected by treatment with at least HDAC inhibitors (e.g., trichostatin A) or treatment with 5-aza-cytidine.

[0242] Here, it was shown that the number of cultured cells was substantially reduced by low pH treatment. However, actually, the decrease in viable cells in the first 24 hours was slight, suggesting that this treatment was unlikely to have an acute lethal effect on most cells. Instead, cell disappearance gradually occurred between d2 and d5. Similarly, from the data, in oct3 / 4::GFP + cells exposed to low pH, unlike control cells cultured in the same medium, a number of genes 21 involved in cell response to stress and DNA repair were strongly induced at d3, suggesting that the cells responded to stimuli such as life-threatening stress or sublethal stress. Interestingly, since the gene expression levels were even higher at d7, it is interesting to consider in the future not only the role of stress-induced genes in cell survival but also, although speculative, their potential involvement in the reprogramming process.

[0243] Another unsolved problem is whether cellular reprogramming is specifically initiated by low pH treatment or by some other types of sublethal stress, such as physical damage, cell membrane perforation, osmotic shock, growth factor deprivation, hypoxia, and high Ca 2+ medium exposure, etc. At least in part, especially by severe grinding-induced physical damage and membrane perforation by streptolysin O, CD45 + cell-derived oct3 / 4::GFP + cell generation was induced, which is worthy of note (Figure 18A). From these observations, it emerges that a specific common regulatory module existing downstream of such weakly related sublethal stress may act as the key to releasing somatic cells from a tightly locked epigenetic differentiation state and cause changes in the overall epigenetic regulation. Considering that some oct3 / 4::GFP + cells appeared by d2, there is a possibility that such a reprogramming mechanism begins to function during the first two days.

[0244] (References) 1 Wakayama,T.,Perry,A.C,Zuccotti,M.,Johnson,K.R.& Yanagimachi,R.Full-term development of mice from enucleated oocytes injected with cumulus cell nuclei.Nature 394,369-374,doi:10.1038 / 28615(1998). 2 Takahashi,K.& Yamanaka,S.Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors.Cell 126,663-676,doi:10.1016 / j.cell.2006.07.024(2006). 3 Jiang, Y., et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature 418, 41 - 49, doi:10.1038 / nature00870 (2002). 4 D’Ippolito, G., et al. Marrow-isolated adult multilineage inducible (MIAMI) cells, a unique population of postnatal young and old human cells with extensive expansion and differentiation potential. Journal of cell science 117, 2971 - 2981, doi:10.1242 / jcs.01103 (2004). 5 Johnson, J., et al. Oocyte generation in adult mammalian ovaries by putative germ cells in bone marrow and peripheral blood. Cell 122, 303 - 315, doi:10.1016 / j.cell.2005.06.031 (2005). 6 Kucia, M., et al. A population of very small embryonic-like (VSEL) CXCR4(+) SSEA-1(+) Oct-4+ stem cells identified in adult bone marrow. Leukemia: official journal of the Leukemia Society of America, Leukemia Research Fund, U.K 20, 857 - 869, doi:10.1038 / sj.leu.2404171 (2006). 7 Kuroda,Y.et al.Unique multipotent cells in adult human mesenchymal cell populations.Proceedings of the National Academy of Sciences of the United States of America 107,8639-8643,doi:10.1073 / pnas.0911647107(2010). 8 Obokata,H.et al.The potential of stem cells in adult tissues representative of the three germ layers.Tissue engineering.Part A 17,607-615,doi:10.1089 / ten.TEA2010.0385(2011). 9 Rahnemai-Azar,A.et al.Human marrow-isolated adult multilineage-inducible(MIAMI)cells protect against peripheral vascular ischemia in a mouse model.Cytotherapy 13,179-192,doi:10.3109 / 14653249.2010.515579(2011 ). 10 Huang,Y.et al.Bone marrow transplantation temporarily improves pancreatic function in streptozotocin-induced diabetes:potential involvement of very small embryonic-like cells.Transplantation 89,677-685,doi:10.1097 / TP.0b013e3181 c9dc7d(2010). 11 Zuba-Surma, E.K. et al. Transplantation of expanded bone marrow-derived very small embryonic-like stem cells (VSEL-SCs) improves left ventricular function and remodelling after myocardial infarction. Journal of cellular and molecular medicine 15, 1319-1328, doi:10.1111 / j.l582-4934.2010.01126.x (2011). 12 Paczkowska, E. et al. Aldehyde dehydrogenase (ALDH)-a promising new candidate for use in preclinical and clinical selection of pluripotent very small embryonic-like stem cells (VSEL SCs) of high long-term repopulating hematopoietic potential. Annals of transplantation: quarterly of the Polish Transplantation Society 16, 59-71 (2011). 13 Lengner, C.J., Welstead, G.G. & Jaenisch, R. The pluripotency regulator Oct4: a role in somatic stem cells? Cell Cycle 7, 725-728 (2008). 14 Berg, J.S. & Goodell, M.A. An argument against a role for Oct4 in somatic stem cells. Cell stem cell 1, 359-360, doi:10.1016 / j.stem.2007.09.007 (2007). 15 Ohbo,K.et al.Identification and characterization of stem cells in prepubertal spermatogenesis in mice small star,filled.Developmental biology 258,209-225(2003). 16 Ying,Q.L.et al.The ground state of embryonic stem cell self-renewal.Nature 453,519-523,doi:10.1038 / nature06968(2008).17 Ogawa,K.,Matsui,H.,Ohtsuka,S.& Niwa,H.A novel mechanism for regulating clonal propagation of mouse ES cells.Genes to cells:devoted to molecular & cellular mechanisms 9,Al l-477,doi:10.11 11 / j.l356-9597.2004.00736.x(2004). 18 Gough,N.M.et al.LIF:a molecule with divergent actions on myeloid leukaemic cells and embryonic stem cells.Reproduction,fertility,and development 1,281-288(1989). 19 Hitoshi,S.et al.Primitive neural stem cells from the mammalian epiblast differentiate to definitive neural stem cells under the control of Notch signaling.Genes & development 18,1806-1811,doi:10.1101 / gad.l208404(2004). 20 Tesar, P. J. et al. New cell lines from mouse epiblast share defining features with human embryonic stem cells. Nature 44%, 196 - 199, doi:10.1038 / nature05972(2007). 21 Saretzki, G., Armstrong, L., Leake, A., Lako, M. & von Zglinicki, T. Stress defense in murine embryonic stem cells is superior to that of various differentiated murine cells. Stem Cells 22, 962 - 971, doi:10.1634 / stemcells.22 - 6 - 962(2004). 22 Surani, M. A. & Barton, S. C. Development of gynogenetic eggs in the mouse: implications for parthenogenetic embryos. Science 222, 1034 - 1036(1983). 23 Nagy, A., Rossant, J., Nagy, R., Abramow - Newerly, W. & Roder, J. C. Derivation of completely cell culture - derived mice from early - passage embryonic stem cells. Proceedings of the National Academy of Sciences of the United States of America 90, 8424 - 8428(1993). 24 A.P. Dyban, V.S.B. Cytogenetics of Mammalian Embryonic Development. Oxford Univ. Press, New York(1987). 25 Gropp,A.,Winking,H.,Herbst,E.W.& Claussen,C.P.Murine trisomy:developmental profiles of the embryo,and isolation of trisomic cellular systems.The Journal of experimental zoology 228,253-269,doi:10.1002 / jez.l402280210(1983).

[0245] Materials and Methods Tissue collection and cell culture. To isolate mature lymphocytes, spleens from 1-week-old GOF mice or ICR mice were minced with scissors and mechanically separated using a Pasteur pipette. The separated spleens were filtered through a cell strainer (BD Biosciences, San Jose). The collected cells were resuspended in DMEM medium, the same volume of lympholyte (CEDARLANE® , Ontario, Canada) was added, and then centrifuged at 1000 g for 15 minutes. The lymphocyte layer was removed and obtained together with CD45 antibody (ab25603, abeam, Cambridge, Massachusetts). CD45-positive cells were sorted by FACS Aria (BD Biosciences). Subsequently, the CD45-positive cells were stressed (for 15 minutes with a solution of pH 5.5) and seeded in B27 medium supplemented with 1000 U of LIF (Sigma).

[0246] Exposure to external stimuli - stress treatment. To apply mechanical stress to mature cells, a Pasteur pipette was heated and then pulled and stretched to form a lumen with a diameter of approximately 50 microns and then folded. Subsequently, mature somatic cells were triturated through this pipette for 20 minutes and cultured for 7 days. To apply hypoxia stimulation to mature cells, the cells were cultured in an incubator with 5% oxygen for 3 weeks. By culturing mature cells in a basal medium for 3 weeks, nutritional stress stimulation was applied to the cells. By culturing mature cells in a medium containing 2 mM CaCl2 for 7 days, a high Ca culture concentration was brought about in the cells. To expose mature cells to physiological stress, the cells were treated with a low pH (pH 5.5) solution and cultured for 7 days. Additionally, more severe damage was inflicted on the cells. To generate pores in the mature cell membrane, the cells were treated with 230 ng / ml of SLO (streptolysin O) (S5265, Sigma) for 2 hours and then cultured for 7 days.

[0247] Bisulfite sequencing. Cells obtained from GOF mice were separated into single cells. GFP-positive cells were collected using a FACS Aria™. Genomic DNA was extracted from the SAC and examined. Bisulfite treatment of the DNA was performed using the CpGenome™ DNA Modification Kit (Chemicon, Temecula, CA, http: / / www.chemicon.com) according to the manufacturer's instructions.

[0248] The resulting modified DNA was ...

Claims

[Claim 1] The invention as depicted in the drawings.