HIV immunotherapy without advance immunization step

By isolating and transducing PBMCs with lentiviral vectors to inhibit CCR5 and target HIV RNA, this method enhances the immune response against HIV, addressing the limitations of current therapies and aiming for a functional cure.

JP2025098175AInactive Publication Date: 2025-07-01AMERICAN GENE TECHNOLOGIES INTERNATIONAL INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025051839
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2017-01-09
Filing Date
2025-03-26
Publication Date
2025-07-01
Estimated Expiration
Not applicable · inactive patent

AI Technical Summary

Technical Problem

Current antiretroviral therapies for HIV are limited by drug toxicity and the emergence of drug-resistant viruses, and traditional immunotherapies have not achieved a functional cure, necessitating improved methods to enhance the host's immune response against HIV.

Method used

A method involving the isolation of peripheral blood mononuclear cells (PBMCs) from a subject, ex vivo stimulation with a stimulatory agent, transduction with a viral delivery system encoding specific genetic elements, and culture to enhance HIV-specific CD4 T cell response without prior immunization, using lentiviral vectors to inhibit chemokine receptor CCR5 and target HIV RNA sequences.

Benefits of technology

This approach enhances the host's immune response to HIV, potentially achieving a functional cure by reducing viral replication and the need for antiretroviral therapy, with the potential for complete eradication of HIV.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025098175000136
    Figure 2025098175000136
  • Figure 2025098175000137
    Figure 2025098175000137
  • Figure 2025098175000138
    Figure 2025098175000138
Patent Text Reader

Abstract

To provide an HIV immunotherapy without advance immunization step.SOLUTION: The present invention generally relates to an immunotherapy for treatment or prevention of HIV. Particularly, the present disclosure provides a lentivirus vector and a related method which are optimized in order to treat HIV without an advance immunization step. One embodiment of the present disclosure discloses a method for treating HIV infection of a subject. The method includes: a step of taking out a leukocyte from a subject and refining a peripheral blood mononuclear cell (PBMC). The method further includes: a step of bringing PBMC in contact with a therapeutically effective dose of stimulatory agent in ex vivo; a step of transducing into PBMC by using a virus delivery system encoding at least one gene element in ex vivo; and a step of culturing the transduced PBMC for at least one day.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Cross - Reference to Related Applications This application claims priority based on U.S. Patent Application No. 62 / 444,147, entitled "HIV Immunotherapy With No Pre - Immunization Step", filed on January 9, 2017, the disclosure of which is incorporated herein by reference.

[0002] Field of the Invention The present invention generally relates to the field of immunotherapy for treating and preventing HIV. In particular, the disclosed methods of treatment and prevention relate to the administration of viral vectors and systems for delivering genes without a pre - immunization step, as well as other therapeutic, diagnostic, or research uses.

Background Art

[0003] Background of the Invention Combination antiretroviral therapy (cART), also known as highly active antiretroviral therapy or HAART, limits HIV - 1 replication and delays disease progression, but drug toxicity and the emergence of drug - resistant viruses are challenges for long - term control in HIV - infected individuals. Furthermore, traditional antiretroviral therapies, while successful in delaying the onset or death from AIDS, have not yet provided a functional cure. Alternative treatment strategies are needed.

[0004] The emergence of data indicating that the immune system plays a major but usually insufficient role in restricting HIV replication has generated strong interest in immunotherapy for HIV infection. Virus - specific T helper cells are important for maintaining cytolytic T lymphocyte (CTL) function and probably play a role. Also, viremia is affected by neutralizing antibodies, but these antibodies are generally of low magnitude in HIV infection and lag behind the viral variants that evolve in vivo.

[0005] When combined, these data indicate that increasing the strength and breadth of the HIV-specific cellular immune response may have clinical benefits through so-called HIV immunotherapy. Some studies are testing vaccines against HIV, but to date success has been limited. Furthermore, there has been interest in enhancing HIV immunotherapy by using gene therapy techniques, but as with other immunotherapy approaches, success has been limited.

[0006] Due to viral mechanisms regarding specific virus envelope-host cell receptor interactions and gene expression, viral vectors can be used to transduce genes into target cells. As a result, viral vectors have been used as vehicles for the transfer of genes into many different cell types, including all T cells or other immune cells as well as embryos, fertilized eggs, isolated tissue samples, in situ tissue targets, and cultured cells. The ability to introduce and express foreign or modified genes intracellularly is useful for therapeutic interventions such as gene therapy, somatic cell reprogramming of induced pluripotent stem cells, and various types of immunotherapy.

[0007] Gene therapy is one of the most mature areas of biomedical research with the potential to create new therapies that may involve the use of viral vectors. Given the wide variety of potential genes available for therapy, efficient means of delivering these genes are needed to realize the promise of gene therapy as a means of treating infectious and non-infectious diseases. Several viral systems, including murine retroviruses, adenoviruses, parvoviruses (adeno-associated viruses), vaccinia viruses, and herpesviruses, have been developed as gene transfer vectors for therapy.

[0008] There are many factors that must be considered when developing viral vectors, including tissue tropism, stability of the viral preparation, stability and control of expression, genomic packaging capacity, and construct-dependent vector stability. Furthermore, in vivo applications of viral vectors are often limited by the host immune response to viral structural proteins and / or transgene products.

[0009] Therefore, toxicity and safety are important hurdles that must be overcome for viral vectors used in vivo for the treatment of subjects. There are numerous historical examples of gene therapy applications in humans that have suffered from problems related to the host immune response to gene delivery vehicles or therapeutic gene products. Viral vectors that co-transduce several viral genes along with one or more therapeutic genes (e.g., adenovirus) are particularly problematic.

[0010] Lentiviral vectors generally do not induce cytotoxicity and do not elicit a strong host immune response, but some lentiviral vectors such as HIV-1 with several immunostimulatory gene products can cause cytotoxicity and induce a strong immune response in vivo. However, this may not be a problem for lentiviral-derived transduction vectors that do not encode multiple viral genes after transduction. Of course, this may not always be the case, as the purpose of the vector may be to encode a protein that will elicit a clinically useful immune response.

[0011] Another important issue regarding the use of lentiviral vectors is the problem of cytopathogenicity that can occur upon exposure to some cytotoxic viral proteins. Exposure to certain HIV-1 proteins may induce cell death or functional unresponsiveness in T cells. Similarly, the potential to generate recombinantly replication-competent toxic viruses is often a problem. Therefore, improved treatments for HIV are still needed. SUMMARY OF THE INVENTION

Means for Solving the Problem

[0012] Summary of the Invention In one aspect of the present disclosure, a method for treating a subject's HIV infection is disclosed. The method includes the steps of removing white blood cells from the subject and purifying peripheral blood mononuclear cells (PBMCs). The method further includes contacting the PBMCs with a therapeutically effective amount of a stimulatory agent ex vivo; transducing the PBMCs with a viral delivery system encoding at least one gene element ex vivo; and culturing the transduced PBMCs for at least one day. The transduced PBMCs may be cultured for about 1 to about 35 days. The method may further include injecting the transduced PBMCs into the subject. The subject may be a human. The stimulatory agent may include a peptide or a mixture of peptides. In a preferred embodiment, the stimulatory agent includes a gag peptide. The stimulatory agent may include a vaccine. The vaccine may be an HIV vaccine, and in a preferred embodiment, the HIV vaccine is an MVA / HIV62B vaccine or a variant thereof. In a preferred embodiment, the viral delivery system includes lentiviral particles. In one embodiment, the at least one gene element may include a small RNA capable of inhibiting the production of chemokine receptor CCR5, or at least one small RNA capable of targeting an HIV RNA sequence. In another embodiment, the at least one gene element may include a small RNA capable of inhibiting the production of chemokine receptor CCR5 and at least one small RNA capable of targeting an HIV RNA sequence. The HIV RNA sequence may include an HIV Vif sequence, an HIV Tat sequence, or a variant thereof. The at least one gene element may include a microRNA or shRNA. In a preferred embodiment, the at least one gene element includes a microRNA cluster.

[0013] In another aspect, at least one gene element is

Chemical formula

Chemical formula

[0014] In another aspect, at least one gene element is

Chemical formula

Chemical formula

Chemical formula

[0015] In another aspect, the microRNA cluster is

Chemical formula

Chemical formula

[0016] In another aspect, a method of treating cells infected with HIV is provided. The method comprises the steps of contacting peripheral blood mononuclear cells (PBMCs) isolated from a subject infected with HIV with a therapeutically effective amount of a stimulatory agent, wherein the contacting is performed ex vivo; transducing the PBMCs ex vivo with a viral delivery system encoding at least one gene element; and culturing the transduced PBMCs for at least one day. The transduced PBMCs may be cultured for about 1 to about 35 days. The method may further comprise injecting the transduced PBMCs into the subject. The subject may be a human. The stimulatory agent may comprise a peptide or a mixture of peptides, and in a preferred embodiment, comprises a gag peptide. The stimulatory agent may comprise a vaccine. The vaccine may be an HIV vaccine, and in a preferred embodiment, the HIV vaccine is an MVA / HIV62B vaccine or a variant thereof. In a preferred embodiment, the viral delivery system comprises lentiviral particles. In one embodiment, the at least one gene element may comprise a small RNA capable of inhibiting the production of chemokine receptor CCR5, or at least one small RNA capable of targeting an HIV RNA sequence. In another embodiment, the at least one gene element may comprise a small RNA capable of inhibiting the production of chemokine receptor CCR5 and at least one small RNA capable of targeting an HIV RNA sequence. The HIV RNA sequence may comprise an HIV Vif sequence, an HIV Tat sequence, or a variant thereof. The at least one gene element may comprise a microRNA or shRNA. In a preferred embodiment, the at least one gene element comprises a microRNA cluster.

[0017] In another aspect, the at least one gene element is

Chemical formula

Chemical formula

[0018] In another aspect, at least one gene element is

Chemical formula

Chemical formula

Chemical formula

[0019] In another aspect, the microRNA cluster

Chemical formula

Chemical formula

[0020] In another aspect, a lentiviral vector is disclosed. The lentiviral vector comprises at least one encoded gene element, and the at least one encoded gene element comprises a small RNA capable of inhibiting the production of chemokine receptor CCR5, or at least one small RNA capable of targeting an HIV RNA sequence. In another aspect, the at least one encoded gene element comprises a small RNA capable of inhibiting the production of chemokine receptor CCR5 and at least one small RNA capable of targeting an HIV RNA sequence. The HIV RNA sequence may comprise an HIV Vif sequence, an HIV Tat sequence, or variants thereof. The at least one encoded gene element may comprise a microRNA or shRNA. The at least one encoded gene element may comprise a microRNA cluster.

[0021] In another aspect, the at least one gene element

Chemical formula

Chemical formula

[0022] In another aspect, the at least one gene element

Chemical formula

Chemical formula

Chemical formula

[0023] In another aspect, the microRNA cluster

Chemical formula

Chemical formula

[0024] In another aspect, a lentiviral vector system for expressing lentiviral particles is disclosed. The system includes a lentiviral vector as described herein; an envelope plasmid for expressing an envelope protein optimized for infection of cells; and at least one helper plasmid for expressing the gag, pol, and rev genes, wherein when the lentiviral vector, the envelope plasmid, and at least one helper plasmid are transfected into a packaging cell line, the packaging cell line produces lentiviral particles, and the lentiviral particles can inhibit the production of the chemokine receptor CCR5 or can target the HIV RNA sequence. The system may further include a first helper plasmid for expressing the gag and pol genes, and a second plasmid for expressing the rev gene.

[0025] In another aspect, lentiviral particles capable of infecting cells are disclosed. The lentiviral particles include an envelope protein optimized for infection of cells and a lentiviral vector as described herein. The envelope protein may be optimized for infection of T cells. In a preferred embodiment, the envelope protein is optimized for infection of CD4+ T cells.

[0026] In another aspect, modified cells are disclosed. The modified cells include CD4+ T cells, and the CD4+ T cells are infected with lentiviral particles as described herein. In a preferred embodiment, the CD4+ T cells also recognize an HIV antigen. In a further preferred embodiment, the HIV antigen includes a gag antigen. In a further preferred embodiment, the CD4+ T cells express a reduced level of CCR5 after infection with the lentiviral particles.

[0027] In another aspect, a method of selecting a subject for a therapeutic treatment regimen is disclosed. The method includes removing white blood cells from a subject, purifying peripheral blood mononuclear cells (PBMCs), and determining a first quantifiable measurement related to at least one factor associated with the PBMCs; ex vivo, contacting the PBMCs with a therapeutically effective amount of a second stimulatory agent and determining a second measurement related to at least one factor associated with the PBMCs, wherein if the second quantifiable measurement is higher than the first quantifiable measurement, the subject is selected for the treatment regimen. The at least one factor may be T cell proliferation or IFN gamma production.

[0028] In another aspect, the methods disclosed herein include depleting at least one subset of cells from PBMCs. The method includes depleting at least one subset of cells from PBMCs, and the at least one subset of cells is CD8+ It includes any one or more of T cells, γδ cells, NK cells, B cells, neutrophils, basophils, eosinophils, regulatory T cells, NKT cells, and red blood cells. In an embodiment, the step of depletion is performed after extracting white blood cells. In an embodiment, the step of depletion is performed simultaneously with extracting white blood cells.

[0029] The foregoing general description and the following brief description of the drawings and the mode for carrying out the invention are illustrative and explanatory and are intended to provide a further description of the claimed invention. Other objects, advantages, and novel features will become readily apparent to those skilled in the art from the following brief description of the drawings and the mode for carrying out the invention.

Brief Description of the Drawings

[0030]

Figure 1

[0031]

Figure 2

[0032]

Figure 3

[0033]

Figure 4

[0034]

Figure 5

[0035]

Figure 6

[0036]

Figure 7

[0037]

Figure 8

[0038]

Figure 9

[0039]

Figure 10

[0040]

Figure 11

[0041]

Figure 12

[0042]

Figure 13

[0043]

Figure 14

[0044]

Figure 15

[0045]

Figure 16

[0046]

Figure 17

[0047]

Figure 18

[0048]

Figure 19

[0049]

Figure 20

[0050]

Figure 21

[0051]

Figure 22

[0052]

Figure 23-1

Figure 23-2

[0053]

Figure 24

[0054]

Figure 25-1

Figure 25-2

Figure 25-3

[0055]

Figure 26

[0056]

Figure 27-1

Figure 27-2

[0057]

Figure 28

[0058]

Figure 29

[0059] **Detailed Description** **Summary** Methods and compositions for treating and / or preventing human immunodeficiency virus (HIV) disease to achieve functional cure are disclosed herein. Functional cure is defined as a state resulting from the disclosed treatments and methods that reduce or eliminate the need for cART and may or may not require supportive adjuvant therapy. The methods of the invention include gene delivery by the lentiviral integration, non-integrating lentiviral, and related viral vector technologies described below.

[0060] Disclosed herein are therapeutic viral vectors (e.g., lentiviral vectors), immunotherapies, and methods for using them in strategies to achieve a functional cure of HIV infection. As shown in Figure 1 herein, the strategy for treating HIV involves initial therapeutic immunization with a vaccine intended to generate a strong immune response against HIV in HIV-infected patients with stable suppression of viremia by daily administration of HAART, aimed at concentrating a fraction of HIV-specific CD4 T cells. However, as detailed herein, initial therapeutic immunization may not necessarily be required. Subsequently, (1) the step of isolating peripheral white blood cells by leukapheresis or purifying PBMCs from venous blood, (2) the step of restimulating CD4 T cells ex vivo with an HIV vaccine protein, (3) lentiviral transduction for therapy, performing T cell culture ex vivo, and (4) the step of reinfusing back into the original donor follow.

[0061] In view of the foregoing description, referring to Figure 2 herein, the method can be used to prevent new cells, such as CD4+ T cells, from becoming infected with HIV. To prevent new cells from becoming infected, CCR5 expression can be targeted to prevent viral attachment. Additionally, the destruction of any remaining infectious viral RNA can also be targeted. In view of the foregoing description, referring to Figure 2 herein, the method can also be used to halt the HIV viral cycle in cells that are already infected with HIV. To halt the HIV viral cycle, the viral RNA produced by latently infected cells, such as latently infected CD4+ T cells, can be targeted.

[0062] New strategies for achieving a functional cure of HIV have been developed by providing highly effective therapeutic lentiviruses that can inhibit HIV.

[0063] Definitions and Interpretations Unless otherwise defined herein, scientific and technical terms used in connection with the present disclosure shall have the meanings commonly understood by one of ordinary skill in the art. Further, unless the context dictates otherwise, the singular terms shall include the plural and the plural terms shall include the singular. In general, the nomenclature and techniques used in connection with cell and tissue culture, molecular biology, immunology, microbiology, genetics, and protein and nucleic acid chemistry, as well as hybridization, described herein are well known and commonly used in the art. The methods and techniques of the present disclosure are generally carried out according to conventional methods well known in the art, as described in various general and more specific references cited and discussed throughout this specification, unless otherwise specified. For example, Sambrook J. and Russell D. Molecular Cloning: A Laboratory Manual, 3rd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2000); Ausubel et al., Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Wiley, John & Sons, Inc. (2002); Harlow and Lane, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1998); and Coligan et al., Short Protocols in Protein Science, Wiley, John & Sons, Inc. (2003). Any enzyme reaction or purification technique is that of the manufacturer's It is carried out in accordance with the specifications, as generally achieved in the art, or as described herein. The nomenclature, experimental procedures, and techniques used herein with respect to analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry are well-known and commonly used in the art.

[0064] As used herein, the term "about" will be understood by those skilled in the art and will vary to some extent depending on the context in which it is used. Considering the context in which it is used, where there is a use of a term that is not clear to those skilled in the art, "about" will mean plus or minus 10% of the particular term.

[0065] As used herein, the term "administer" or "administering" an active agent means providing the active agent of the present invention in a form capable of introducing a therapeutically effective amount into the body of an individual in a therapeutically useful form to a subject in need of treatment.

[0066] As used herein, the term "AGT103" refers to a particular embodiment of a lentiviral vector comprising a miR30-CCR5 / miR21-Vif / miR185-Tat microRNA cluster sequence as detailed herein.

[0067] As used herein, the term "AGT103T" refers to a cell transduced with a lentivirus or lentiviral particle comprising an AGT103 lentiviral vector.

[0068] Throughout this specification and the claims, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of the stated integer or group of integers but not the exclusion of any other integer or group of integers. Further, as used herein, the term "includes" means including but not limited to.

[0069] The term "engraftment" refers to the ability of one of ordinary skill in the art to determine a quantitative level of engraftment in a subject after infusion of a cell source (see, e.g., Rosenberg et al., N. Engl. J. Med. 323:570-578 (1990); Dudley et al., J. Immunother. 24: 363-373 (2001); Yee et al., Curr. Opin. Immunol. 13:141-146 (2001); Rooney et al., Blood 92:1549-1555 (1998)).

[0070] The terms "express," "expressed," or "encoding" refer to the process by which a polynucleotide is transcribed into mRNA and / or the process by which the transcribed mRNA is subsequently translated into a peptide, polypeptide, or protein. Expression can include splicing of mRNA in eukaryotic cells, or other forms of post-transcriptional or post-translational modification.

[0071] The term "functional cure" refers to a situation or state in which an HIV+ individual who previously required cART or HAART can survive with low or undetectable viral replication using lower or intermittent doses of cART or HAART, or after discontinuation of dosing. An individual may still be said to be "functionally cured" even if they still require adjunctive therapy to maintain low levels of viral replication and slow or eliminate disease progression. One possible result of a functional cure is the ultimate eradication of HIV that prevents all possibility of recurrence.

[0072] The term "HIV vaccine" encompasses immunogens, vehicles, and adjuvants intended to induce an HIV-specific immune response. "HIV vaccine" may include purified inactivated virus particles or whole inactivated virus particles that may be HIV, or recombinant viral vectors capable of expressing HIV proteins, protein fragments or peptides, glycoprotein fragments or glycopeptides, recombinant bacterial vectors, plasmid DNA or RNA that can induce cells to produce HIV proteins, glycoproteins or protein fragments capable of inducing specific immunity. Alternatively, for the purpose of enriching HIV-specific CD4 T cells prior to transduction, or for in vitro assays of lentiviral transduced CD4 T cells, specific methods for immune stimulation can be used that include anti-CD3 / CD28 beads, T cell receptor-specific antibodies, mitogens, superantigens, and other chemical or biological stimuli to activate dendritic, T or B cells. The activating substance may be soluble, polymeric aggregates, liposomes or endosome-based or conjugated beads. Cytokines including interleukin-2, 6, 7, 12, 15, 23 or others can be added to improve the cellular response to stimulation and / or improve the survival of CD4 T cells throughout the culture and transduction intervals. Alternatively, without being limited to any of the foregoing, the term "HIV vaccine" includes the MVA / HIV62B vaccine and its variants. The MVA / HIV62B vaccine is a known highly attenuated double recombinant MVA vaccine. The MVA / HIV62B vaccine was constructed by inserting the HIV-1 gag-pol and env sequences into a known MVA vector (see, for example, Goepfert et al. (2014) J. Infect. Dis. 210(1):99-110, and International Publication No. WO 2006 / 026667. Both documents are incorporated herein by reference). Also, the term "HIV vaccine" includes any one or more of the vaccines provided in Table 1 below. (See International Publication No. WO 2006 / 026667, which is incorporated herein by reference). Also, the term "HIV vaccine" includes any one or more of the vaccines provided in Table 1 below.

Table 1-1

[0073] The term "in vivo" refers to a process occurring within a living organism. The term "ex vivo" refers to a process occurring outside a living organism.

[0074] The term "miRNA" refers to microRNA and may also be called "miR".

[0075] The term "packaging cell line" refers to any cell line that can be used to express lentiviral particles.

[0076] The term "percent identity" in the context of two or more nucleic acid or polypeptide sequences refers to the percentage of identical nucleotide or amino acid residues as measured using one of the sequence comparison algorithms described below (e.g., BLASTP and BLASTN, or other algorithms available to those of skill in the art) or by visual inspection when compared and aligned at maximum correspondence. "Percent identity" may exist over regions of the sequences being compared, e.g., over functional domains, or alternatively may exist over the full length of the two sequences being compared, depending on the purpose. In the case of sequence comparison, typically one sequence serves as a reference sequence to which the test sequence is compared. When using a sequence comparison algorithm, the test and reference sequences are input into a computer, sub-sequence coordinates are designated as necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity of the test sequence to the reference sequence based on the designated program parameters.

[0077] The optimal alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman and Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson and Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988), Thus, it can be carried out by computer implementation of these algorithms (GAP, BESTFIT, FASTA, and TFASTA of Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by visual inspection (generally, see Ausubel et al., supra).

[0078] An example of an algorithm suitable for determining percent sequence identity and percent sequence similarity is the BLAST algorithm, which is described in Altschul et al., J. Mol. Biol. 21 Vol. 215: 403-410 (1990). Software for performing BLAST analyses is publicly available from the website of the National Center for Biotechnology Information.

[0079] The percent identity between two nucleotide sequences can be determined using the GAP program of the GCG software package (available from http: / / www.gcg.com) with the NWSgapdna.CMP matrix and gap weights of 40, 50, 60, 70, or 80 and length weights of 1, 2, 3, 4, 5, or 6. In addition, the percent identity between two nucleotide sequences or amino acid sequences can be determined using the algorithm of E. Meyers and W. Miller (CABIOS, Vol. 4: 11-17 (1989)) incorporated into the ALIGN program (version 2.0) using a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4. Further, the percent identity between two amino acid sequences can be determined using either the Blossum62 matrix or the PAM250 matrix, and the GAP program of the GCG software package (available from http: / / www.gcg.com) with gap weights of 16, 14, 12, 10, 8, 6, or 4 and length weights of 1, 2, 3, 4, 5, or 6, incorporating the algorithm of Needleman and Wunsch (J. Mol. Determined using the algorithm of Biol. (Vol. 48): pp. 444-453 (1970). It can be done.

[0080] Furthermore, the nucleic acid sequences and protein sequences of the present disclosure can be used as "query sequences" for performing searches of public databases to identify, for example, related sequences. Such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul et al. (1990) J. Mol. Biol. 215:403-10. It can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul et al. (1990) J. Mol. Biol. 215:403-10. The NBLAST program can be used with a score = 100 and word length = 12 to perform a BLAST nucleotide search to obtain a nucleotide sequence homologous to the nucleic acid molecule of the present invention. The XBLAST program can be used with a score = 50 and word length = 3 to perform a BLAST protein search to obtain an amino acid sequence homologous to the protein molecule of the present invention. To obtain a gapped alignment for comparison purposes, Gapped BLAST may be utilized as described in Altschul et al. (1997) Nucleic Acids Res. 25(17):3389-3402. When using the BLAST program and the Gapped BLAST program, the default parameters of each program (e.g., XBLAST and NBLAST) may be used. See http: / / www.ncbi.nlm.nih.gov.

[0081] As used herein, "pharmaceutically acceptable" refers to compounds, materials, compositions, and / or dosage forms that, within the scope of sound medical judgment, do not cause excessive toxicity, irritation, allergic response, or other problems or complications commensurate with a reasonable benefit / risk ratio, and are suitable for use in contact with human and animal tissues, organs, and / or body fluids.

[0082] As used herein, the term "pharmaceutically acceptable carrier" refers to and includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible. Compositions can include pharmaceutically acceptable salts, such as acid addition salts or base addition salts (see, e.g., Berge et al. (1977) J Pharm Sci 66:1-19).

[0083] As used herein, the term "SEQ ID NO" is synonymous with the term "Sequence ID No".

[0084] As used herein, "small RNA" generally refers to non-coding RNA that is less than or about 200 nucleotides in length and has a silencing or interfering function. In other embodiments, the small RNA is about 175 nucleotides or less, about 150 nucleotides or less, about 125 nucleotides or less, about 100 nucleotides or less, or about 75 nucleotides or less in length. Such RNAs include microRNA (miRNA), small interfering RNA (siRNA), double-stranded RNA (dsRNA), and short hairpin RNA (shRNA). The "small RNA" of the present disclosure should be capable of inhibiting or knocking down gene expression of a target gene, generally via a pathway that results in destruction of the target gene mRNA.

[0085] As used herein, the term "stimulatory agent" refers to any exogenous agent that can stimulate white blood cells.

[0086] As used herein, the term "subject" includes not only human patients but also other mammals. The terms "subject", "individual", "host", and "patient" can be used interchangeably herein.

[0087] As used herein, the term "target cell" generally refers to CD4+ T cells that respond to stimulation with a protein or peptide fragment that exhibits an HIV gene sequence, and includes CD4+ T cells transduced with a lentiviral vector as detailed herein that reduces the susceptibility of CD4+ T cells to HIV.

[0088] The term "therapeutically effective amount" refers to a sufficient amount of an active agent of the present invention in a composition appropriate for treating or preventing the onset of symptoms, progression, or complications found in a patient suffering from a given discomfort, injury, disease, or condition, and in an appropriate dosage form. The therapeutically effective amount will vary depending on the condition or severity thereof of the patient, and the age, weight, etc. of the subject being treated. The therapeutically effective amount can vary depending on any of a number of factors including, for example, the route of administration, the condition of the subject, and other factors understood by those skilled in the art.

[0089] As used herein, the term "therapy vector" is synonymous with a lentiviral vector such as the AGT103 vector.

[0090] The term "treatment" or "treating" generally refers to an intervention in an attempt to alter the natural course of the subject being treated, and can be carried out either for prophylaxis or during the course of clinical pathology. Desirable effects include, but are not limited to, preventing the occurrence or recurrence of a disease, alleviating symptoms, suppressing, reducing, or inhibiting any direct or indirect pathological consequence of the disease, improving or alleviating the disease state, and causing remission or improvement of the prognosis.

[0091] Description of aspects of the present disclosure As detailed herein, in one aspect, a method for treating a subject's HIV infection is disclosed. The method includes the steps of removing white blood cells from the subject and purifying peripheral blood mononuclear cells (PBMCs). The method further includes the steps of contacting the PBMCs with a therapeutically effective amount of a stimulatory agent ex vivo; transducing the PBMCs ex vivo with a viral delivery system encoding at least one genetic element; and culturing the transduced PBMCs for at least one day. The method may further include further enrichment of the PBMCs, for example, by preferably enriching the PBMCs with respect to CD4+ T cells. The transduced PBMCs may be cultured for about 1 to about 35 days. The method may further include injecting the transduced PBMCs into the subject. The subject may be a human. The stimulatory agent may include a peptide or a mixture of peptides. In a preferred embodiment, the stimulatory agent includes a gag peptide. The stimulatory agent may include a vaccine. The vaccine may be an HIV vaccine, and in a preferred embodiment, the HIV vaccine is an MVA / HIV62B vaccine or a variant thereof. In a preferred embodiment, the viral delivery system includes lentiviral particles. In one embodiment, the at least one genetic element may include a small RNA capable of inhibiting the production of the chemokine receptor CCR5, or at least one small RNA capable of targeting an HIV RNA sequence. In another embodiment, the at least one genetic element may include a small RNA capable of inhibiting the production of the chemokine receptor CCR5, and at least one small RNA capable of targeting an HIV RNA sequence. The HIV RNA sequence may include an HIV Vif sequence, an HIV Tat sequence, or variants thereof. The at least one genetic element may include a microRNA or shRNA. In a preferred embodiment, the at least one genetic element includes a microRNA cluster.

[0092] In another aspect, the at least one genetic element is [Chemistry] and comprises a microRNA having an identity percentage of at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, or higher. In a preferred embodiment, at least one gene element is [Chemistry] comprises.

[0093] In another aspect, at least one gene element is [Chemistry] has an identity percentage of at least 80%, or at least 85%, or at least 90%, or at least 95%, or [Chemistry] and comprises a microRNA having an identity percentage of at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95% or higher. In a preferred embodiment, at least one gene element is [Chemistry] comprises.

[0094] In another aspect, the microRNA cluster is [Chemistry] and contain sequences having an identity percentage of at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95% or higher. In a preferred embodiment, the microRNA cluster is

Chemical formula

[0095] In another aspect, a method of treating cells infected with HIV is provided. The method comprises the steps of contacting peripheral blood mononuclear cells (PBMCs) isolated from a subject infected with HIV with a therapeutically effective amount of a stimulatory agent, wherein the contacting is performed ex vivo; transducing the PBMCs ex vivo using a viral delivery system encoding at least one genetic element; and culturing the transduced PBMCs for at least one day. The transduced PBMCs may be cultured for about 1 to about 35 days. The method may further comprise the step of injecting the transduced PBMCs into the subject. The subject may be a human. The stimulatory agent may comprise a peptide or a mixture of peptides, and in a preferred embodiment, comprises a gag peptide. The stimulatory agent may comprise a vaccine. The vaccine may be an HIV vaccine, and in a preferred embodiment, the HIV vaccine is an MVA / HIV62B vaccine or a variant thereof. In a preferred embodiment, the viral delivery system comprises lentiviral particles. In one embodiment, the at least one genetic element may comprise a small RNA capable of inhibiting the production of the chemokine receptor CCR5, or at least one small RNA capable of targeting an HIV RNA sequence. In another embodiment, the at least one genetic element may comprise a small RNA capable of inhibiting the production of the chemokine receptor CCR5 and at least one small RNA capable of targeting an HIV RNA sequence. The HIV RNA sequence may comprise an HIV Vif sequence, an HIV Tat sequence, or variants thereof. The at least one genetic element may comprise a microRNA or shRNA. In a preferred embodiment, the at least one genetic element comprises a microRNA cluster.

[0096] In another aspect, the at least one genetic element

Chemical formula

Chemical formula

[0097] In another aspect, at least one gene element is

Chemical formula

Chemical formula

Chemical formula

[0098] In another aspect, the microRNA cluster is [Chem.] and includes sequences having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, or a higher percent identity. In a preferred embodiment, the microRNA cluster [Chem.] includes.

[0099] In another aspect, a lentiviral vector is disclosed. The lentiviral vector includes at least one encoded gene element, and the at least one encoded gene element includes a small RNA capable of inhibiting the production of chemokine receptor CCR5, or at least one small RNA capable of targeting an HIV RNA sequence. In another aspect, a lentiviral vector is disclosed in which the at least one encoded gene element includes a small RNA capable of inhibiting the production of chemokine receptor CCR5 and at least one small RNA capable of targeting an HIV RNA sequence. The HIV RNA sequence may include an HIV Vif sequence, an HIV Tat sequence, or a variant thereof. The at least one encoded gene element may include a microRNA or shRNA. The at least one encoded gene element may include a microRNA cluster.

[0100] In another aspect, the at least one gene element [Chem.] comprising a microRNA having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, or a higher percent identity. In a preferred embodiment, at least one gene element is

Chemical formula

[0101] In another aspect, at least one gene element is

Chemical formula

Chemical formula

Chemical formula

[0102] In another aspect, the microRNA cluster is [Chem.] and contains a sequence having an identity percentage of at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, or higher. In a preferred embodiment, the microRNA cluster [Chem.] contains.

[0103] In another aspect, a lentiviral vector system for expressing lentiviral particles is disclosed. The system includes a lentiviral vector as described herein; an envelope plasmid for expressing an envelope protein optimized for infection of cells; and at least one helper plasmid for expressing the gag, pol, and rev genes, wherein when the lentiviral vector, the envelope plasmid, and the at least one helper plasmid are transfected into a packaging cell line, the packaging cell line produces lentiviral particles, and the lentiviral particles can inhibit the production of the chemokine receptor CCR5 or can target the HIV RNA sequence.

[0104] In another aspect, lentiviral particles capable of infecting cells are disclosed. The lentiviral particles include an envelope protein optimized for infection of cells and a lentiviral vector as described herein. The envelope protein may be optimized for infection of T cells. In a preferred embodiment, the envelope protein is optimized for infection of CD4+ T cells.

[0105] In another aspect, modified cells are disclosed. The modified cells include CD4+ T cells, which are infected with lentiviral particles as described herein. In a preferred embodiment, the CD4+ T cells also recognize HIV antigens. In a more preferred embodiment, the HIV antigen includes the gag antigen. In a more preferred embodiment, the CD4+ T cells express reduced levels of CCR5 after infection with the lentiviral particles.

[0106] In another aspect, a method of selecting a subject for a treatment regimen is disclosed. The method includes removing leukocytes from the subject, purifying peripheral blood mononuclear cells (PBMCs), and determining a first quantifiable measurement related to at least one factor associated with the PBMCs; ex vivo, contacting the PBMCs with a therapeutically effective amount of a second stimulatory agent and determining a second measurement related to at least one factor associated with the PBMCs, wherein if the second quantifiable measurement is higher than the first quantifiable measurement, the subject is selected for the treatment regimen. The at least one factor may be T cell proliferation or IFN gamma production.

[0107] In another aspect, any of the methods comprising treating HIV-infected cells described herein further comprises depleting at least one subset of cells from the PBMCs. In an embodiment, the method includes depleting at least one subset of cells from the PBMCs, and the at least one subset of cells includes any one or more of CD8+ T cells, γδ cells, NK cells, B cells, neutrophils, basophils, eosinophils, regulatory T cells, NKT cells, and red blood cells. In an embodiment, the depleting step is performed after removing the leukocytes. In an embodiment, the depleting step is performed simultaneously with removing the leukocytes.

[0108] In another aspect, any of the methods comprising treating the subject's HIV described herein further comprises depleting at least one subset of cells from PBMCs. In embodiments, the method comprises depleting at least one subset of cells from PBMCs, and the at least one subset of cells comprises any one or more of CD8+ T cells, γδ cells, NK cells, B cells, neutrophils, basophils, eosinophils, regulatory T cells, NKT cells, and red blood cells. In embodiments, the depleting step is performed after leukocytes are removed. In embodiments, the depleting step is performed simultaneously with removing leukocytes.

[0109] In another aspect, any of the methods comprising selecting a subject for a treatment regimen described herein further comprises depleting at least one subset of cells from PBMCs. In embodiments, the method comprises depleting at least one subset of cells from PBMCs, and the at least one subset of cells comprises any one or more of CD8+ T cells, γδ cells, NK cells, B cells, neutrophils, basophils, eosinophils, regulatory T cells, NKT cells, and red blood cells. In embodiments, the depleting step is performed after leukocytes are removed. In embodiments, the depleting step is performed simultaneously with removing leukocytes.

[0110] In another aspect, any of the methods described herein further comprises the step of depleting at least one subset of immune cells from PBMCs, wherein the at least one subset of cells comprises any one or more of CD8+ T cells, γδ cells, NK cells, B cells, neutrophils, basophils, eosinophils, regulatory T cells, NKT cells, and red blood cells. In embodiments, the cells depleted from PBMCs are CD8+ T cells. In embodiments, the cells depleted from PBMCs are γδ cells. In embodiments, the cells depleted from PBMCs are NK cells. In embodiments, the cells depleted from PBMCs are B cells. In embodiments, the cells depleted from PBMCs are regulatory T cells. In embodiments, the cells depleted from PBMCs are NKT cells. In embodiments, the cells depleted from PBMCs are red blood cells. In embodiments, the cells depleted from PBMCs are CD8+ T cells and γδ cells. In embodiments, the cells depleted from PBMCs are CD8+ T cells, γδ cells, and NK cells. In embodiments, the cells depleted from PBMCs are CD8+ T cells, γδ cells, NK cells, and B cells. In embodiments, the cells depleted from PBMCs are CD8+ T cells, γδ cells, NK cells, B cells, and regulatory T cells. In embodiments, the cells depleted from PBMCs are CD8+ T cells, γδ cells, NK cells, B cells, regulatory T cells, and NKT cells. In embodiments, the cells depleted from PBMCs are CD8+ T cells, γδ cells, NK cells, B cells, regulatory T cells, NKT cells, and red blood cells. In embodiments, the cells depleted from PBMCs are γδ cells and NK cells. In embodiments, the cells depleted from PBMCs are γδ cells, NK cells, and B cells. In embodiments, the cells depleted from PBMCs are γδ cells, NK cells, B cells, and regulatory T cells. In embodiments, the cells depleted from PBMCs are γδ cells, NK cells, B cells, regulatory T cells, and NKT cells. In embodiments, the cells depleted from PBMCs are γδ cells, NK cells, B cells, regulatory T cells, NKT cells, and red blood cells. In embodiments, the cells depleted from PBMCs are NK cells and B cells. In embodiments, the cells depleted from PBMCs are NK cells, B cells, and regulatory T cells. In embodiments, the cells depleted from PBMCs are NK cells, B cells, regulatory T cells, and NKT cells. In embodiments, the cells depleted from PBMCs are NK cells, B cells, regulatory T cells, NKT cells, and red blood cells. In embodiments, the cells depleted from PBMCs are B cells and regulatory T cells. In embodiments, the cells depleted from PBMCs are B cells, regulatory T cells, and NKT cells. In embodiments, the cells depleted from PBMCs are B cells, regulatory T cells, NKT cells, and red blood cells. In embodiments, the cells depleted from PBMCs are regulatory T cells and NKT cells. In embodiments, the cells depleted from PBMCs are regulatory T cells, NKT cells, and red blood cells. In embodiments, the cells depleted from PBMCs are NKT cells and red blood cells. In embodiments, the cells depleted from PBMCs are CD8+ T cells and NK cells.In embodiments, the cells depleted from PBMCs are CD8+ T cells, NK cells, and B cells. In embodiments, the cells depleted from PBMCs are CD8+ T cells, NK cells, B cells, and regulatory T cells. In embodiments, the cells depleted from PBMCs are CD8+ T cells, NK cells, B cells, regulatory T cells, and NKT cells. In embodiments, the cells depleted from PBMCs are CD8+ T cells, NK cells, B cells, regulatory T cells, NKT cells, and red blood cells. In embodiments, the cells depleted from PBMCs are γδ and B cells. In embodiments, the cells depleted from PBMCs are γδ, B cells, and regulatory T cells. In embodiments, the cells depleted from PBMCs are γδ, B cells, regulatory T cells, and NKT cells. In embodiments, the cells depleted from PBMCs are γδ, B cells, regulatory T cells, NKT cells, and red blood cells. In embodiments, the cells depleted from PBMCs are NK cells and regulatory T cells. In embodiments, the cells depleted from PBMCs are NK cells, regulatory T cells, and NKT cells. In embodiments, the cells depleted from PBMCs are NK cells, regulatory T cells, NKT cells, and red blood cells. In embodiments, the cells depleted from PBMCs are B cells and NKT cells. In embodiments, the cells depleted from PBMCs are B cells, NKT cells, and red blood cells. In embodiments, the cells depleted from PBMCs are regulatory T cells and red blood cells. In embodiments, as described herein, the cells depleted from PBMCs include any one or any combination of neutrophils, basophils, and eosinophils.

[0111] In another aspect, CD8+ T cells are depleted at the start of cell proliferation to improve CD4+ T cell proliferation. In an embodiment, cell depletion is performed after peptide stimulation and before lentiviral transduction such that the cells can better withstand mechanical stress. In an embodiment, after CD8+ T cell depletion, the cells are placed in culture medium for approximately 24 hours. In an embodiment, after CD8+ cell depletion, the cells are placed in culture for less than 24 hours, such as less than 20 hours, less than 16 hours, less than 8 hours, or less than 4 hours. In an embodiment, after CD8+ T cell depletion, the cells are placed in culture for longer than 24 hours, such as longer than 30 hours, longer than 36 hours, longer than 42 hours, or longer than 48 hours. In an embodiment, the culture medium contains IL-7. In an embodiment, the culture medium contains IL-15. In an embodiment, the culture medium contains IL-7 and IL-15. In an embodiment, cell depletion is performed before peptide stimulation. In an embodiment, the gag protein is used to cause peptide stimulation. In an embodiment, an HIV vaccine is used to cause peptide stimulation. In an embodiment, the vaccine is the MVA / HIV62B vaccine used to cause peptide stimulation. In an embodiment, CD8+ T cells are depleted using a PE anti-human CD8 antibody and anti-PE microbeads. In an embodiment, the CD8 antibody is an anti-rat antibody. In an embodiment, the CD8 antibody is an anti-mouse antibody. In an embodiment, the CD8 antibody is an anti-rabbit antibody. In an embodiment, the CD8 antibody is an anti-goat antibody. In an embodiment, after cell depletion and peptide stimulation, the cells are transduced. In an embodiment, the cells are transduced using a lentivirus. In an embodiment, the lentivirus has GFP. In an embodiment, the lentivirus has RFP. In an embodiment, the lentivirus has EGFP. In an embodiment, the cells are placed in culture after transduction. In an embodiment, the culture medium contains IL-7. In an embodiment, the culture medium contains IL-15. In an embodiment, the culture medium contains IL-7 and IL-15. In an embodiment, the cells are cultured for approximately 2 days to enable CD4+ T cell proliferation.In an embodiment, the cells are cultured for approximately three days to enable CD4+ T cell proliferation. In an embodiment, the cells are cultured for less than two days, such as less than 42 hours, less than 36 hours, less than 30 hours, less than 24 hours, less than 18 hours, less than 12 hours, or less than 6 hours. In an embodiment, the cells are cultured for a time longer than three days, such as a time longer than four days, a time longer than five days, a time longer than six days, a time longer than seven days, a time longer than eight days, a time longer than nine days, or a time longer than ten days. In an embodiment, the cells are cultured for between two and three days, such as approximately 30 hours, approximately 36 hours, or approximately 42 hours.

[0112] In another aspect, CD8+, γδ, NK, or B cells are depleted to improve CD4+ T cell proliferation. In an embodiment, any two or more of CD8+, γδ, NK, and B cells are depleted to improve CD4+ T cell proliferation. In an embodiment, CD8+, γδ, NK, B, regulatory T, NKT, or erythrocyte cells are CD4+ Depleted to improve T cell proliferation. In embodiments, any two or more of CD8+, γδ, NK, B, regulatory T, NKT, and red blood cells are depleted to improve CD4+ T cell proliferation. In embodiments, cell depletion is performed after peptide stimulation and before lentiviral transduction. In embodiments, after cell depletion, the cells are placed in culture medium for about 24 hours. In embodiments, after cell depletion, the cells are placed in culture for less than 24 hours, such as less than 20 hours, less than 16 hours, less than 8 hours, or less than 4 hours. In embodiments, after CD8+ T cell depletion, the cells are placed in culture for longer than 24 hours, such as longer than 30 hours, longer than 36 hours, longer than 42 hours, or longer than 48 hours. In embodiments, the culture medium contains IL-7. In embodiments, the culture medium contains IL-15. In embodiments, the culture medium contains IL-7 and IL-15. In embodiments, cell depletion is performed before peptide stimulation. In embodiments, the gag protein is used to cause peptide stimulation. In embodiments, an HIV vaccine is used to cause peptide stimulation. In embodiments, the MVA / HIV62B vaccine is used to cause peptide stimulation. In embodiments, CD8+ T, γδ, NK, and / or B cells are depleted using a PE-labeled specific antibody and anti-PE microbeads. In embodiments, the antibody used is an anti-human antibody. In embodiments, the antibody used was an anti-rat antibody. In embodiments, the antibody used is an anti-mouse antibody. In embodiments, the antibody used is an anti-goat antibody. In embodiments, after cell depletion and peptide stimulation, the cells are transduced. In embodiments, the cells are transduced using a lentivirus. In embodiments, the lentivirus has GFP. In embodiments, the lentivirus has RFP. In embodiments, the lentivirus has EGFP. In embodiments, the cells are placed in culture after transduction. In embodiments, the culture medium contains IL-7. In embodiments, the culture medium contains IL-15. In embodiments, the culture medium contains IL-7 and IL-15.In an embodiment, the cells are cultured for approximately two days to enable CD4+ T cell proliferation. In an embodiment, the cells are cultured for about three days to enable CD4+ T cell proliferation. In an embodiment, the cells are cultured for less than two days, such as less than 42 hours, less than 36 hours, less than 30 hours, less than 24 hours, less than 18 hours, less than 12 hours, or less than 6 hours. In an embodiment, the cells are cultured for a time longer than three days, such as a time longer than four days, a time longer than five days, a time longer than six days, a time longer than seven days, a time longer than eight days, a time longer than nine days, or a time longer than ten days. In an embodiment, the cells are cultured for between two and three days, such as about 30 hours, about 36 hours, or about 42 hours.

[0113] In another aspect, the lentivirus contains GFP used to measure transduction efficiency. In an embodiment, the lentivirus contains RFP. In an embodiment, the lentivirus has EGFP. In an embodiment, a cytokine capture system is used to identify antigen-specific CD4+ T cells using GFP-positive cells. In an embodiment, GFP is used to identify a subset of transduced cells. In an embodiment, RFP is used to identify a subset of transduced cells. In an embodiment, EGFP is used to identify a subset of transduced cells. In an embodiment, any of the transduction methods described herein can be used to measure transduction efficiency. In an embodiment, prior to lentiviral transduction, any of the depletion methods described herein can be used to deplete any one or more of CD8+ T, γδ, NK, B, neutrophils, basophils, eosinophils, regulatory T, NKT, and red blood cells.

[0114] In other aspects, transduction efficiency is measured by detecting vector copy number (VCN) by qPCR. In embodiments, the percentage of transduced cells based on VCN in the final cell product can be estimated by establishing the relationship between the transduced cells and the VCN. In embodiments, a lentivirus having GFP is used to determine the percentage of transduced cells. In embodiments, a lentivirus having RFP is used to determine the percentage of transduced cells. In embodiments, a lentivirus having EGFP is used to determine the percentage of transduced cells. In embodiments, any of the transduction methods described herein can be used to measure transduction efficiency. In embodiments, prior to lentiviral transduction, any of the depletion methods described herein can be used to deplete any one or more of CD8+ T, γδ, NK, B cells.

[0115] Human immunodeficiency virus (HIV) The human immunodeficiency virus, commonly referred to as "HIV", is a retrovirus that causes acquired immunodeficiency syndrome (AIDS) in humans. AIDS is a condition in which opportunistic infections and cancers that threaten life rage due to progressive failure of the immune system. Without treatment, the average survival period after HIV infection is estimated to be 9 to 11 years, depending on the HIV subtype. HIV infection occurs by the transfer of body fluids including, but not limited to, blood, semen, vaginal fluid, pre-ejaculate, saliva, tears, lymph fluid or cerebrospinal fluid, or breast milk. HIV can exist within an infected individual as both free virus particles and within infected immune cells.

[0116] HIV infects living cells of the human immune system, such as helper T cells, but the tropism can vary within HIV subtypes. Immune cells that can be specifically susceptible to HIV infection include, but are not limited to, CD4+ T cells, macrophages, and dendritic cells. HIV infection leads to a decrease in the level of CD4+ T cells through a number of mechanisms, including, but not limited to, apoptosis of uninfected bystander cells, direct viral killing of infected cells, and killing of infected CD4+ T cells by CD8 cytotoxic lymphocytes that recognize the infected cells. When the CD4+ T cell count drops below a critical level, cell-mediated immunity is lost, and the body becomes progressively more susceptible to opportunistic infections and cancers.

[0117] Structurally, HIV is different from many other retroviruses. The RNA genome consists of at least seven structural landmarks (LTR, TAR, RRE, PE, SLIP, CRS, and INS) and at least nine genes (gag, pol, env, tat, rev, nef, vif, vpr, vpu, and sometimes a tenth tev that is a fusion of tat, env, and rev) that encode 19 proteins. Three of these genes, gag, pol, and env, contain the information necessary to make the structural proteins of the new virus particles.

[0118] HIV replicates mainly in CD4 T cells, causing cell destruction or dysregulation that reduces host immunity. HIV is difficult to treat because it can establish infection as an integrated provirus and can transition to a latent infection state where viral expression in certain cells drops below the level of cytopathology that affects the cell or the level of detection by the host immune system, and it has not been eradicated even after long-term highly active antiretroviral therapy (HAART). The survival period may be extended by HAART, but in most cases, HIV infection causes a fatal disease.

[0119] The main goal in the fight against HIV is to develop strategies to cure the disease. Since extended HAART has not achieved this goal, researchers are looking at alternative procedures. Initial efforts to improve host immunity by therapeutic immunization (using vaccines after infection has occurred) have had little or no impact. Similarly, intensification of treatment has had a moderate or no impact.

[0120] Some progress has been made using gene therapy, but positive results have been sporadic and found only among rare humans with a deletion in one or both alleles of the gene encoding CCR5 (chemokine receptor), which plays an important role in viral entry into host cells. However, many researchers are optimistic that gene therapy has the greatest potential for ultimately achieving a cure for HIV.

[0121] As disclosed herein, the methods and compositions of the present invention can achieve a functional cure, which may or may not include complete eradication of all HIV from the body. As mentioned above, a functional cure is defined as a situation or state in which an HIV+ individual who previously required HAART can survive with low or undetectable viral replication and is using lower or intermittent doses of HAART or potentially can discontinue HAART completely. As used herein, a functional cure may still require adjuvant therapy to maintain low-level viral replication and slow or eliminate disease progression. A possible outcome of a functional cure is the ultimate eradication of HIV to prevent any possibility of recurrence.

[0122] The primary obstacle to achieving functional cure lies in the basic biology of HIV itself. Viral infection depletes CD4 T cells, which are important for almost all immune functions. Most importantly, HIV infection and CD4 T cell depletion require the activation of individual cells. Activation is a mechanism specific to individual CD4 T cell clones that use a rearranged T cell receptor to recognize pathogens or other molecules.

[0123] In the case of HIV, infection activates and consequently depletes the population of T cells specific to HIV before other T cells that are not very specific to the virus, effectively disabling the immune system's defense against the virus. The ability of the HIV-specific T cell response is reconstituted during long-term HAART; however, when HAART is interrupted, recurrent viral infections repeat the process, depleting virus-specific cells again and resetting the clock of disease progression.

[0124] Clearly, functional cure is only possible if sufficient HIV-specific CD4 T cells are protected and the host's natural immunity can combat and control HIV even when HAART is interrupted. In one embodiment, aspects of the present disclosure provide methods and compositions for enhancing host immunity to HIV to provide functional cure without the need for prior immunization.

[0125] Gene therapy Viral vectors are used to deliver gene constructs to host cells for the purpose of treating or preventing disease.

[0126] A gene construct can include, but is not limited to, a functional gene or a part of a gene that corrects or complements an existing defect, a DNA sequence encoding a regulatory protein, a DNA sequence encoding a regulatory RNA molecule including antisense, short homology RNA, long non-coding RNA, small interfering RNA or others, and a decoy sequence encoding either an RNA or a protein designed to compete for important cytokines that alter a disease state. Gene therapy involves delivering these therapeutic gene constructs to target cells to provide treatment or alleviation of a particular disease.

[0127] Multiple efforts have been made to utilize gene therapy in the treatment of HIV disease, but so far the results have been poor. A few treatment successes have been obtained in rare HIV patients who have a spontaneous deletion of the CCR5 gene (an allele known as CCR5delta32).

[0128] Nucleases delivered by lentivirus or other mechanisms for gene deletion / modification can be used to reduce the overall expression of CCR5 and / or help reduce HIV replication. There is at least one study reporting success in treating this disease when lentivirus was administered to patients with the genetic background of CCR5delta32. However, this is only a single example of success, and many other patients without the CCR5delta32 genotype have not been successfully treated. As a result, there is a substantial need to improve the performance of viral gene therapy for HIV, both in terms of the performance of individual viral vector constructs and the use of strategies to improve the use of vectors to achieve functional HIV cure.

[0129] For example, some existing therapies rely on zinc finger nucleases to delete a portion of CCR5 in an attempt to make cells resistant to HIV infection. However, even after optimal treatment, only 30% of T cells are modified by the nuclease, and of those modified, only 10% of the total CD4 T cell population are modified to prevent HIV infection. In contrast, the disclosed method results in a reduction of CCR5 expression below the levels necessary to permit HIV infection in substantially all cells carrying the lentiviral transgene. This allows for successful treatment of HIV without a prior immunization step to increase the number of the initial CD4+ T cell pool. This results in such a result.

[0130] For the purposes of the disclosed method, gene therapy can include, but is not limited to, an increased expression of HIV restriction elements including, but not limited to, affinity-enhanced T cell receptors, chimeric antigen receptors on CD4 T cells (or alternatively on CD8 T cells), modification of signaling pathways to avoid cell death caused by viral proteins, TREX, SAMHD1, MxA or MxB proteins, APOBEC complexes, TRIM5-alpha complexes, tetherin (BST2), and similar proteins identified as being able to reduce HIV replication in mammalian cells.

[0131] Immunotherapy Historically, vaccines have been a reliable weapon against deadly infectious diseases, including smallpox, polio, measles, and yellow fever. Unfortunately, there is currently no approved vaccine for HIV. The HIV virus has unique means of evading the immune system, and it appears that the human body is unable to mount an effective immune response against it. As a result, scientists are not clear on what is needed to provide protection against HIV.

[0132] However, immunotherapy can provide solutions that could not be previously addressed by conventional vaccination approaches. Immunotherapy, also known as biological therapy, is a type of treatment designed to enhance the body's natural defenses against infections or cancer. It uses materials made either in the body or in the laboratory to improve, target, or restore the function of the immune system.

[0133] In certain aspects of the present disclosure, an immunotherapy approach can be used to enrich a population of HIV-specific CD4 T cells for the purpose of increasing the host's anti-HIV immunity. In other aspects of the disclosed invention, an integrative or non-integrative lentiviral vector can be used to transduce the host's immune cells for the purpose of increasing the host's anti-HIV immunity. In other aspects of the present disclosure, an HIV protein, including but not limited to killed particles, virus-like particles, HIV peptides or peptide fragments, recombinant viral vectors, recombinant bacterial vectors, purified subunits or plasmid DNA, in combination with a suitable vehicle and / or a biological or chemical adjuvant for increasing the host's immune response, can be used to enrich a population of virus-specific T cells or antibodies, and these methods can be further enhanced by the use of HIV-targeted gene therapy using lentiviral or other viral vectors.

[0134] Method In one aspect, the present disclosure provides a method of using a viral vector to achieve a functional cure of HIV disease. This method may include immunotherapy to enrich the proportion of HIV-specific CD4 T cells, followed by lentiviral transduction to deliver inhibitors of HIV as well as CCR5 and CXCR4, if necessary. Importantly, the enrichment of HIV-specific CD4 T cells and lentiviral transduction can be effective without a prior immunization step.

[0135] In an embodiment, the method includes therapeutic immunization as a method for enriching the proportion of HIV-specific CD4 T cells, and this immunization is performed simultaneously with or after the injection of stimulated cells into the subject. Therapeutic immunization can include biological or chemical adjuvants, vehicles, and methods for immunization, including purified proteins, inactivated viruses, virus-vectored proteins, bacterially-vectored proteins, peptides or peptide fragments, virus-like particles (VLPs), cytokines and / or chemokines.

[0136] The therapeutic vaccine can include one or more HIV proteins having protein sequences representative of the dominant viral strain in the geographical region where the treatment is being carried out. The therapeutic vaccine can include biological or chemical adjuvants, vehicles, and methods for immunization, including purified proteins, inactivated viruses, virus-vectored proteins, bacterially-vectored proteins, peptides or peptide fragments, virus-like particles (VLPs), cytokines and / or chemokines. Vaccination can be administered according to standard methods known in the art, and HIV patients can continue antiretroviral therapy during the period of immunization and during ex vivo lymphocyte culture including subsequent lentiviral transduction.

[0137] In certain embodiments, HIV+ patients can be immunized with an HIV vaccine to increase the frequency of HIV-specific CD4 T cells by about 2, about 25, about 250, about 500, about 750, about 1000, about 1250, or about 1500-fold (or any amount between these values). The vaccine can be any clinically utilized or experimental HIV vaccine that includes a disclosed lentivirus, other viral vector, or other bacterial vector used as a vaccine delivery system. In another embodiment, the vector can encode virus-like particles (VLPs) to induce higher titers of neutralizing antibodies and a stronger HIV-specific T cell response. In another embodiment, the vector can encode HIV-related peptides or peptide fragments including, but not limited to, gag, pol, and env, tat, rev, nef, vif, vpr, vpu, and tev as well as LTR, TAR, RRE, PE, SLIP, CRS, and INS. Alternatively, the HIV vaccine used in the disclosed method can include purified proteins, inactivated viruses, virus-vectored proteins, bacterially-vectored proteins, peptides or peptide fragments, virus-like particles (VLPs), or biological or chemical adjuvants including cytokines and / or chemokines.

[0138] For example, peripheral blood mononuclear cells (PBMCs) are obtained by leukapheresis, processed ex vivo, and about 1 × 10 10 CD4 T cells can be obtained, about 0.1%, about 1%, about 5%, or about 10%, or about 30% of which are HIV-specific in terms of antigen response and are HIV-resistant by having a therapeutic transgene delivered by a disclosed lentiviral vector. Alternatively, about 1 × 10 7 , about 1 × 10 8 , about 1 × 10 9 , about 1 × 10 10 , about 1 × 10 11 , or about 1 × 10 12Individual CD4 T cells can be isolated for restimulation. Importantly, any suitable amount of CD4 T cells can be isolated for ex vivo restimulation.

[0139] The isolated CD4 T cells can be cultured in a suitable medium through restimulation with an HIV vaccine antigen, which may or may not contain antigens present in previous therapeutic vaccinations. Antiretroviral therapy drugs containing inhibitors of reverse transcriptase, protease, or integrase can be added to prevent viral recurrence during long-term ex vivo culture. CD4 T cell restimulation can be used to enrich the proportion of HIV-specific CD4 T cells in the culture. The same procedure can also be used for analytical purposes of identifying HIV-specific T cells and measuring the frequency of this subpopulation using a small blood volume with peripheral blood mononuclear cells obtained by purification.

[0140] The PBMC fraction can be enriched for HIV-specific CD4 T cells by contacting the cells with HIV proteins that are identical or complementary to the components of the vaccine previously used for in vivo immunization. Ex vivo restimulation can increase the relative frequency of HIV-specific CD4 T cells by about 5, about 10, about 25, about 50, about 75, about 100, about 125, about 150, about 175, or about 200-fold. Ex vivo restimulation can increase the relative frequency of HIV-specific CD4 T cells regardless of the presence or absence of a prior immunization step.

[0141] The methods detailed herein can include ex vivo restimulation of CD4 T cells using ex vivo lentiviral transduction and culture. The methods detailed herein can also include ex vivo restimulation of CD4 T cells using ex vivo lentiviral transduction and culture without a prior immunization step.

[0142] Thus, in one embodiment, the restimulated PBMC fraction enriched for HIV-specific CD4 T cells can be transduced with a therapeutic anti-HIV lentivirus or other vector and maintained in culture for about 1 to about 21 days or up to about 35 days. Alternatively, the cells can be cultured for about 1 to about 18 days, about 1 to about 15 days, about 1 to about 12 days, about 1 to about 9 days, or about 3 to about 7 days. Thus, the transduced cells can be cultured for about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, or about 35 days.

[0143] Once the transduced cells are sufficiently cultured, the transduced CD4 T cells are infused into and returned to the original patient. The infusion can be performed using various machines and methods known in the art. In some embodiments, the infusion may be accompanied by pretreatment with cyclophosphamide or similar compounds to enhance the efficiency of retransplantation.

[0144] In some embodiments, CCR5-targeted therapy may be continuously added to the subject's antiretroviral therapy regimen throughout the treatment process. Examples of CCR5-targeted therapy include, but are not limited to, Maraviroc (CCR5 antagonist) or Rapamycin (immunosuppressant that reduces CCR5). In some embodiments, the antiretroviral therapy can be discontinued and the subject can be tested for viral rebound. If no rebound occurs, the adjuvant therapy can also be removed and the subject can be retested for viral rebound.

[0145] Antiretroviral therapy, including cART or HAART, that has been reduced or is absent, and adjuvant therapy for about 26 weeks that has been reduced or is absent, and continuous viral suppression can be considered a functional cure for HIV. Other definitions of functional cure are described herein.

[0146] The lentiviral vectors and other vectors used in the disclosed methods can encode at least one, at least two, at least three, at least four, or at least five genes of interest, or at least six genes of interest, or at least seven genes of interest, or at least eight genes of interest, or at least nine genes of interest, or at least ten genes of interest, or at least eleven genes of interest, or at least twelve genes of interest. Considering the diversity and therapeutic potential of HIV-targeted gene therapy, the viral vectors of the present invention can include (i) antibodies against antigens associated with infectious diseases or toxins produced by infectious pathogens, (ii) cytokines including interleukins that are necessary for the proliferation or function of immune cells and can be therapies for immune dysregulation encountered with HIV and other chronic or acute human viral or bacterial pathogens, (iii) factors that suppress the growth of HIV in vivo, including CD8 suppressors, (iv) mutations or deletions of chemokine receptor CCR5, chemokine receptor CXCR4, or chemokine receptor CXCR5, (v) antisense DNA or RNA against specific receptors or peptides associated with HIV or host proteins associated with HIV, (vi) small interfering RNA against specific receptors or peptides associated with HIV or host proteins associated with HIV, or (vii) genes or nucleic acid sequences including but not limited to various other therapeutically useful sequences that can be used to treat HIV or AIDS.

[0147] Further examples of HIV-targeted gene therapy that can be used in the disclosed methods include T cell receptors with enhanced affinity, chimeric antigen receptors on CD4 T cells (or alternatively on CD8 T cells), modification of signaling pathways to avoid cell death induced by viral proteins, TREX, SAMHD1, MxA or MxB proteins, APOBEC complexes, TRIM5-alpha complexes, tetherin (BST2), and increased expression of HIV restriction elements including similar proteins identified to be able to reduce HIV replication in mammalian cells, but are not limited thereto.

[0148] In some embodiments, a patient may be receiving cART or HAART while being treated according to the methods of the invention. In other embodiments, a patient may receive cART or HAART before or after being treated according to the methods of the invention. In some embodiments, cART or HAART is maintained throughout treatment according to the methods of the invention, and the patient may be monitored for HIV viral load in the blood and for the frequency of lentivirally transduced CD4 T cells in the blood. Preferably, a patient who has received cART or HAART before being treated according to the methods of the invention may discontinue or reduce cART or HAART after treatment according to the methods of the invention.

[0149] For purposes of evaluating efficacy, the frequency of transduced HIV-specific CD4 T cells, a novel surrogate marker for gene therapy effect, may be determined as discussed in more detail herein.

[0150] Composition In one aspect, the disclosed invention provides a lentiviral vector capable of delivering a gene construct to inhibit HIV entry into susceptible cells. For example, one mechanism of action is to decrease the mRNA levels of CCR5 and / or CXCR4 chemokine receptors, thereby reducing the rate of viral entry into susceptible cells.

[0151] Alternatively, the disclosed lentiviral vectors may be able to inhibit the formation of HIV-infected cells by reducing the stability of the incoming HIV genomic RNA. In yet another embodiment, the disclosed lentiviral vectors can prevent HIV production from latently infected cells, and the mechanism of action is to cause instability of the viral RNA sequence by the action of inhibitory RNAs including short homology, small interfering, or other regulatory RNA species.

[0152] The lentiviruses for therapy disclosed in this application generally contain at least one of two types of genetic cargo. First, the lentivirus may encode a genetic element that directs the expression of a small RNA that can inhibit the production of the chemokine receptors CCR5 and / or CXCR4, which are important for HIV entry into susceptible cells. The second type of genetic cargo includes constructs that can express small RNA molecules that target the HIV RNA sequence for the purpose of preventing reverse transcription, RNA splicing, RNA translation to produce proteins, or packaging of the viral genomic RNA for particle production and infection spread. An exemplary structure is illustrated in Figure 3.

[0153] As shown in Figure 3 (upper panel), an exemplary construct can include a number of sections or components. For example, in one embodiment, an exemplary LV construct may include the following sections or components: · RSV - Rous Sarcoma virus terminal repeat sequences; · 5’LTR - A portion of the HIV terminal repeat sequence that can be cleaved to prevent replication of the vector after chromosomal integration; · Psi - A packaging signal that enables the vector RNA genome to be incorporated into viral particles during packaging; · RRE - The Rev-responsive element can be added to improve expression from the transgene by moving the RNA from the nucleus to the cytoplasm of the cell; ·cPPT - A poly purine tract that promotes second-strand DNA synthesis before integrating the transgene into the chromosome of the host cell; ·Promoter - A promoter is what initiates RNA transcription from the integrated transgene in order to express the microRNA cluster (or other gene elements of the construct). In some embodiments, the vector may use the EF-1 promoter; ·Anti-CCR5 - A microRNA that targets the messenger RNA of the host cell factor CCR5 and reduces its expression on the cell surface; ·Anti-Rev / Tat - A microRNA that targets HIV genomic RNA or messenger RNA at the junction between the HIV Rev coding region and the Tat coding region, sometimes referred to as miRNA Tat or similarly described in this application; ·Anti-Vif - A microRNA that targets HIV genomic RNA or messenger RNA within the Vif coding region; ·WPRE - The woodchuck hepatitis virus post-transcriptional regulatory element is an additional vector component that can be used to facilitate nuclear RNA transport; and ·deltaU3 3’LTR - A modified version of the HIV 3’ terminal repeat sequence with a partial deletion in the U3 region to improve the safety of the vector.

[0154] One of ordinary skill in the art will recognize that the above components are merely examples, and such components may be rearranged, substituted with other elements, or changed in other ways including, but not limited to, nucleotide substitutions, deletions, additions, or mutations, as long as the construct can prevent the expression of HIV genes and reduce the spread of infection.

[0155] The vectors of the present invention may contain one or both of the types of gene cargo discussed above (i.e., gene elements that direct gene expression or small RNAs such as siRNA, shRNA, or miRNA that can block translation or transcription), and the vectors of the present invention may also encode additional useful products for the purpose of treating or diagnosing HIV. For example, in some embodiments, these vectors may also encode green fluorescent protein (GFP) for the purpose of selectively maintaining genetically modified cells in vivo, tracking the vector or antibiotic resistance gene.

[0156] The combination of gene elements incorporated into the disclosed vectors is not particularly limited. For example, the vector may encode 1 small RNA, 2 small RNAs, 3 small RNAs, 4 small RNAs, 5 small RNAs, 6 small RNAs, 7 small RNAs, 8 small RNAs, 9 small RNAs, or 10 small RNAs, or 11 small RNAs, or 12 small RNAs. Such vectors may further encode other gene elements that function in concert with the small RNAs to block the expression and infection of HIV.

[0157] One of ordinary skill in the art will understand that therapeutic lentiviruses may use alternative sequences in place of the promoter region, targeting of regulatory RNA, and type of regulatory RNA. Additionally, the therapeutic lentiviruses of the present disclosure may contain changes in the plasmids used to package the lentiviral particles; these changes are necessary to increase the level of production in vitro.

[0158] Lentiviral vector system Lentiviral virions (particles) are expressed by a vector system that encodes viral proteins necessary for virion (virus particle) production. There is at least one vector that contains a nucleic acid sequence encoding a lentiviral pol protein, which is necessary for reverse transcription and integration and is operably linked to a promoter. In another embodiment, the pol protein is expressed by multiple vectors. There is also a vector that encodes a lentiviral gag protein necessary for forming the viral capsid and contains a nucleic acid sequence operably linked to a promoter. In certain embodiments, this gag nucleic acid sequence is present in a vector that is different from at least some of the pol nucleic acid sequences. In another embodiment, the gag nucleic acid is present in a vector that is different from all of the pol nucleic acid sequences encoding the pol protein.

[0159] The vectors can be modified in numerous ways. Such modifications are used to create particles with an even further minimized likelihood of obtaining wild-type revertants. These include, but are not limited to, deletions in the U3 region of the LTR, tat deletions, and matrix (MA) deletions.

[0160] The gag, pol, and env vectors do not contain lentiviral genome-derived nucleotides that package lentiviral RNA, called the lentiviral packaging sequence.

[0161] The vector forming the particle preferably does not contain a lentiviral genome-derived nucleic acid sequence that expresses an envelope protein. Preferably, another vector containing a nucleic acid sequence encoding an envelope protein operably linked to a promoter is used. This env vector also does not contain the lentiviral packaging sequence. In one embodiment, the env nucleic acid sequence encodes a lentiviral envelope protein.

[0162] In another embodiment, the envelope protein is derived from a virus other than a lentivirus. The resulting particles are called pseudotyped particles. By appropriately selecting the envelope, it is possible to "infect" virtually any cell. For example, env genes encoding envelope proteins that target endocytic compartments, such as those of influenza virus, VSV-G, alphavirus (Semliki Forest virus, Sindbis virus), arenavirus (lymphocytic choriomeningitis virus), flavivirus (tick-borne encephalitis virus, dengue virus, hepatitis C virus, GB virus), rhabdovirus (vesicular stomatitis virus, rabies virus), paramyxovirus (mumps or measles), and orthomyxovirus (influenza virus), can be used. Other envelopes that can preferably be used include those derived from Moloney leukemia virus, such as MLV-E, MLV-A, and GALV. These latter envelopes are particularly preferred when the host cell is a primary cell. Depending on the desired host cell, other envelope proteins may be selected. For example, for brain delivery, targeting specific receptors such as dopamine receptors can be used. Another target may be the vascular endothelium. These cells can be targeted using a filovirus envelope. For example, the GP of Ebola, which becomes the GP and GP2 glycoproteins by post-transcriptional modification. In another embodiment, various lentiviral capsids with pseudotyped envelopes can be used. For example, FIV or SHIV [U.S. Patent No. 5,654,195]. SHIV pseudotyped vectors can be easily used in animal models such as monkeys.

[0163] As detailed herein, a lentiviral vector system typically includes at least one helper plasmid that contains at least one of the gag, pol, or rev genes. Each of the gag, pol, and rev genes may be provided on an individual plasmid, or one or more of the genes may be provided together on the same plasmid. In one embodiment, the gag, pol, and rev genes are provided on the same plasmid (e.g., FIG. 4). In another embodiment, the gag and pol genes are provided on a first plasmid, and the rev gene is provided on a second plasmid (e.g., FIG. 5). Thus, both the three-vector system and the four-vector system can be used to produce lentiviruses as described in the Examples section and elsewhere in this specification. The therapeutic vector, the envelope plasmid, and the at least one helper plasmid are transfected into a packaging cell line. A non-limiting example of a packaging cell line is the 293T / 17 HEK cell line. When the therapeutic vector, the envelope plasmid, and the at least one helper plasmid are transfected into the packaging cell line, lentiviral particles are ultimately produced.

[0164] In another aspect, a lentiviral vector system for expressing lentiviral particles is disclosed. The system includes a lentiviral vector as described herein; an envelope plasmid for expressing an envelope protein optimized for infecting cells; and at least one helper plasmid for expressing the gag, pol, and rev genes, wherein when the lentiviral vector, the envelope plasmid, and the at least one helper plasmid are transfected into a packaging cell line, the packaging cell line produces lentiviral particles, and the lentiviral particles can inhibit the production of chemokine receptor CCR5 or target the HIV RNA sequence.

[0165] In another aspect, as detailed herein, a lentiviral vector, also referred to herein as a therapeutic vector, can include the following elements: a hybrid 5' end repeat sequence (RSV / 5'LTR) (SEQ ID NOs: 34-35), a Psi sequence (RNA packaging site) (SEQ ID NO: 36), an RRE (Rev response element) (SEQ ID NO: 37), a cPPT (polypurine tract) (SEQ ID NO: 38), an EF-1α promoter (SEQ ID NO: 4), miR30CCR5 (SEQ ID NO: 1), miR21Vif (SEQ ID NO: 2), miR185Tat (SEQ ID NO: 3), a woodchuck post-transcriptional regulatory element (WPRE) (SEQ ID NO: 32 or 80), and a ΔU3 3'LTR (SEQ ID NO: 39). In another aspect, sequence variations by substitution, deletion, or addition can be used to modify the sequences referenced above.

[0166] In another aspect, as detailed herein, a helper plasmid is designed to include the following elements: a CAG promoter (SEQ ID NO: 41); an HIV component gag (SEQ ID NO: 43); an HIV component pol (SEQ ID NO: 44); an HIV Int (SEQ ID NO: 45); an HIV RRE (SEQ ID NO: 46); and an HIV Rev (SEQ ID NO: 47). In another aspect, the helper plasmid may be modified to include a first helper plasmid for expressing the gag and pol genes, as well as a second separate plasmid for expressing the rev gene. In another aspect, sequence variations by substitution, deletion, or addition can be used to modify the sequences referenced above.

[0167] In another aspect, as detailed herein, an envelope plasmid is designed to include the following elements from left to right: an RNA polymerase II promoter (CMV) (SEQ ID NO: 60) and a vesicular stomatitis virus G glycoprotein (VSV-G) (SEQ ID NO: 62). In another aspect, sequence variations by substitution, deletion, or addition can be used to modify the sequences referenced above.

[0168] In another aspect, the plasmids used for lentiviral packaging can be modified by similar elements without losing vector function, and the intron sequences can potentially be removed. For example, instead of the similar elements of the plasmid containing the packaging system, the following elements can be used: elongation factor-1 (EF-1), phosphoglycerate kinase (PGK), and ubiquitin C (UbC) promoters can be used instead of the CMV or CAG promoter. SV40 polyA and bGH polyA can be used instead of the rabbit beta-globin polyA. The HIV sequences of the helper plasmid may be constructed from different HIV strains or clades. The VSV-G glycoprotein can be replaced with a membrane glycoprotein derived from feline endogenous virus (RD114), gibbon ape leukemia virus (GALV), rabies (FUG), lymphocytic choriomeningitis virus (LCMV), influenza A avian pestivirus (FPV), Ross River alphavirus (RRV), murine leukemia virus 10A1 (MLV), or Ebola virus (EboV).

[0169] Notably, lentiviral packaging systems are commercially available (e.g., the Lenti-vpak packaging kit from OriGene Technologies, Inc., Rockville, MD) and can also be designed as described herein. Furthermore, it is within the skill of the art to substitute or modify aspects of the lentiviral packaging system to improve any number of related factors, including the production efficiency of lentiviral particles.

[0170] Bioassay In one aspect, the invention includes a bioassay for determining the success of HIV treatment to achieve functional cure. These assays provide a method for measuring the effectiveness of the disclosed methods by measuring the frequency of transduced HIV-specific CD4 T cells in a patient. HIV-specific CD4 T cells can be recognized because they proliferate, modify the composition of cell surface markers, induce signaling pathways including phosphorylation, or express specific marker proteins that can be cytokines, chemokines, caspases, phosphorylated signaling molecules or other cytoplasmic and / or nuclear components. Specific responsive CD4 T cells can be recognized using, for example, flow cytometry sorting, magnetic bead separation or other recognized methods for antigen-specific CD4 T cell isolation, using labeled monoclonal antibodies or specific in situ amplification of mRNA sequences that enable the selection of HIV-specific cells. The isolated CD4 T cells are tested to determine the frequency of cells with the incorporated therapeutic lentivirus. Single cell assays can also be used, including microfluidic separation of individual cells, combined with mass spectrometry, PCR, ELISA, or antibody staining to confirm responsiveness to HIV and the presence of the incorporated therapeutic lentivirus.

[0171] Thus, in certain embodiments, after application of a treatment according to the invention (e.g., (a) without immunization, (b) ex vivo lymphocyte culture; (c) biological or chemical adjuvants including purified proteins, inactivated viruses, virus-vectored proteins, bacterially-vectored proteins, cytokines and / or chemokines, restimulation by vehicle; and (d) injection of enriched and transduced T cells), the patient may then be assayed to determine the effectiveness of the treatment. The threshold of target T cells in the cell product for injection may be established, for example, as about 1×10 8 individuals as HIV-specific CD4 T cells having gene modification by the therapeutic lentivirus for measuring functional cure. Alternatively, the threshold may be about 1×10 5 in the patient's body, about 1×10 6 about 1×107 , about 1×10 8 , about 1×10 9 , or about 1×10 10 CD4 T cells may also be used.

[0172] HIV-specific CD4 T cells having gene modification by a lentivirus for therapy can be determined using any suitable method such as, for example, but not limited to, flow cytometry, cell sorting, FACS analysis, DNA cloning, PCR, RT-PCR or Q-PCR, ELISA, FISH, Western blotting, Southern blotting, high-throughput sequencing, RNA sequencing, oligonucleotide primer extension, or other methods known in the art.

[0173] Methods for defining antigen-specific T cells having gene modification are known in the art. However, using such methods to identify HIV-specific T cells in combination with an incorporated or unincorporated gene therapy construct as a standard measure of efficacy is a new concept in the field of HIV treatment.

[0174] Dosage and dosage form The disclosed methods and compositions can be used to treat HIV+ patients during various stages of the disease. Thus, the dosing regimen can vary based on the patient's condition and the method of administration.

[0175] In one aspect, the HIV-specific vaccine can be administered to a subject simultaneously with or after the injection of the stimulated cells. In one embodiment, the HIV-specific vaccine can be administered to the subject in need thereof at various doses. Generally, vaccines delivered by intramuscular injection contain from about 10 μg to about 300 μg, about 25 μg to about 275 μg, about 50 μg to about 250 μg, about 75 μg to about 225 μg, or about 100 μg to about 200 μg of HIV protein, either inactivated virus particles, whole virus proteins prepared from virus-like particles, or purified virus proteins purified from recombinant systems or virus preparations. Recombinant viruses or bacterial vectors can be administered by any route described. Intramuscular vaccines contain from about 1 μg to about 100 μg, about 10 μg to about 90 μg, about 20 μg to about 80 μg, about 30 μg to about 70 μg, about 40 μg to about 60 μg, or about 50 μg of a suitable adjuvant molecule, and are suspended in an oil, saline, buffer, or water having a volume of 0.1 to 5 ml per injection dose, and can be a soluble or emulsion preparation. Vaccines delivered orally, rectally, buccally, to the genital mucosa, or intranasally, including some virus-vectored or bacterially-vectored vaccines, fusion proteins, liposome formulations, or similar preparations, may contain larger amounts of virus protein and adjuvant. Transdermal, subdermal, or subcutaneous vaccines utilize amounts of protein and adjuvant similar to those of orally, rectally, or intranasally delivered vaccines. Depending on the response to the initial immunization, vaccination may be repeated 1 to 5 times using the same or alternative routes for delivery. The interval may be 2 to 24 weeks between immunizations. The immune response to vaccination is measured by testing for HIV-specific antibodies in serum, plasma, vaginal secretions, rectal secretions, saliva, or bronchoalveolar lavage fluid using ELISA or similar methods. Cellular immune responses are tested by in vitro stimulation with vaccine antigen, followed by staining for intracellular cytokine accumulation, and then flow cytometry, or similar methods including lymphocyte proliferation, expression of phosphorylated signaling proteins, or changes in cell surface activation markers.The upper limit of dosing may be determined on an individual patient basis and depends on the toxicity / safety profile of each individual product or product lot.

[0176] Immunization may be performed once, twice, three times, or repeatedly. For example, agents for HIV immunization may be administered to a subject in need thereof once a week, once every two weeks, once every three weeks, once a month, once every two months, once every three months, once every six months, once every nine months, once a year, once every 18 months, once every two years, once every 36 months, or once every three years.

[0177] After ex vivo expansion and enrichment of CD4 T cells, immunization may be performed once, twice, three times, or more after ex vivo lymphocyte culture / restimulation and injection.

[0178] In one embodiment, the HIV vaccine for immunization is administered as a pharmaceutical composition. In one embodiment, the pharmaceutical composition containing the HIV vaccine can be formulated in a wide variety of nasal, pulmonary, oral, topical, or parenteral dosage forms for clinical applications. Each dosage form can contain diluents or other pharmaceutically acceptable excipients such as various disintegrants, surfactants, fillers, thickeners, binders, wetting agents. The pharmaceutical composition containing the HIV vaccine can also be formulated for injection.

[0179] The HIV vaccine composition for the purpose of immunization can be administered using any pharmaceutically acceptable method such as intranasal, buccal, sublingual, oral, rectal, ocular, parenteral (intravenous, intradermal, intramuscular, subcutaneous, intrasternal, intraperitoneal), intralung, intravaginal, topical administration, local administration, local administration after prick, mucosal administration, via aerosol, or via buccal or nasal spray formulations.

[0180] Furthermore, the HIV vaccine composition can be formulated into any pharmaceutically acceptable dosage form, such as solid dosage forms, tablets, pills, lozenges, capsules, liquid dispersions, gels, aerosols, pulmonary aerosols, nasal aerosols, ointments, creams, semi-solid dosage forms, and suspensions. Further, the composition may be a controlled release formulation, a sustained release formulation, an immediate release formulation, or any combination thereof. Further, the composition may be a transdermal delivery system.

[0181] In another embodiment, a pharmaceutical composition comprising an HIV vaccine can be formulated in a solid dosage form for oral administration, and the solid dosage form can be a powder, granule, capsule, tablet or pill. In yet another embodiment, the solid dosage form may contain one or more excipients such as calcium carbonate, starch, sucrose, lactose, microcrystalline cellulose or gelatin. Further, the solid dosage form can contain a lubricant such as talc or magnesium stearate in addition to the excipient. In some embodiments, the oral dosage form can be an immediate release or modified release form. Modified release dosage forms include controlled release or sustained release, enteric release, etc. Excipients used in modified release dosage forms are generally known to those skilled in the art.

[0182] In a further embodiment, a pharmaceutical composition comprising an HIV vaccine can be formulated as a sublingual or buccal dosage form. Such dosage forms include sublingual tablets or solution compositions administered under the tongue, and buccal tablets placed between the cheek and the gum.

[0183] In still further embodiments, a pharmaceutical composition comprising an HIV vaccine can be formulated as a nasal dosage form. Such dosage forms of the present invention include solution, suspension and gel compositions for nasal delivery.

[0184] In one embodiment, the pharmaceutical composition can be formulated in a liquid dosage form for oral administration, such as a suspension, emulsion or syrup. In other embodiments, the liquid dosage form can include various excipients such as humectants, sweeteners, flavorants or preservatives in addition to commonly used simple diluents such as water and liquid paraffin. In certain embodiments, a composition comprising an HIV vaccine or a pharmaceutically acceptable salt thereof can be formulated to be suitable for administration to pediatric patients.

[0185] In one embodiment, the pharmaceutical composition can be formulated in a dosage form for parenteral administration, such as a sterile aqueous solution, suspension, emulsion, non-aqueous solution or suppository. In other embodiments, the non-aqueous solution or suspension can include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, or injectable esters such as ethyl oleate. As a base for suppositories, witepsol, macrogol, tween 61, cocoa butter, laurin oil or glycerolated gelatin can be used.

[0186] The dosage of the pharmaceutical composition can vary depending on the patient's weight, age, gender, time and form of administration, excretion rate, and severity of the disease.

[0187] For the purpose of restimulation, lymphocytes, PBMC, and / or CD4 T cells are removed from the patient and isolated for stimulation and culture. The isolated cells may be contacted with the same HIV vaccine or activator used for immunization or a different HIV vaccine or activator. In one embodiment, the isolated cells are contacted with about 10 6 to about 10 ng to 5 μg (or any other appropriate amount) of an HIV vaccine or activator per cell in culture. More specifically, the isolated cells are about 10 6Per cell, it may be contacted with about 50 ng, about 100 ng, about 200 ng, about 300 ng, about 400 ng, about 500 ng, about 600 ng, about 700 ng, about 800 ng, about 900 ng, about 1 μg, about 1.5 μg, about 2 μg, about 2.5 μg, about 3 μg, about 3.5 μg, about 4 μg, about 4.5 μg, or about 5 μg of an HIV vaccine or activator.

[0188] The activator or vaccine is generally used once for each in vitro cell culture, but may be repeated after an interval of about 15 to about 35 days. For example, the repeated dosing may be performed at about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, or about 35 days.

[0189] For transduction of the enriched and restimulated cells, the cells may be transduced using a lentiviral vector or other known vector systems disclosed herein. The cells to be transduced may be contacted with about 1 to 1,000 (or any other appropriate amount) viral genomes (measured by RT-PCR assay of the culture fluid containing the lentiviral vector) per target cell in culture. Lentiviral transduction may be repeated 1 to 5 times using the same range of 1 to 1,000 viral genomes per target cell in the culture.

[0190] Cell concentration In one approach, cells such as T cells may be obtained from an HIV-infected patient and cultured in a culture medium containing a conditioning medium ("CM") in a multi-well plate. Supernatant p24 gag(The levels of p24 and viral RNA can be evaluated by standard means. Patients whose CM-cultured cells have peak p24 supernatant levels of less than 1 ng / ml may be suitable for expanding large numbers of T cells in CM with or without further antiviral agents. Additionally, drugs or combinations of drugs for different purposes may be added to different wells, and the effect on viral levels in the sample may be evaluated by standard means. Combinations of drugs that provide moderate viral suppression are therapeutically useful combinations. It is within the competence of a qualified expert to determine what constitutes moderate viral suppression for a particular subject. To test the effectiveness of a drug of interest in restricting viral growth, additional factors such as anti-CD3 antibody may be added to the culture to stimulate viral production. Different from the methods known in the art for culturing HIV-infected cell samples, CM enables the culture of T cells over a period longer than two months, thereby providing an effective system for assaying long-term drug efficacy.)

[0191] This approach enables the inhibition of gene expression driven by the HIV LTR promoter region in a cell population by culturing cells in a medium containing CM. Culturing in CM4 is likely to inhibit HIV LTR-driven gene expression by altering one or more interactions between transcription-mediated proteins and HIV gene expression regulatory elements. Transcription-mediated proteins of interest include proteins encoded by host cells such as AP-1, NFkappaB, NF-AT, IRF, LEF-1, and Sp1, as well as the protein Tat encoded by HIV. HIV gene expression regulatory elements of interest include binding sites for AP-1, NFkappaB, NF-AT, IRF, LEF-1, and Sp1, as well as the trans-acting response element (TAR) that interacts with Tat.)

[0192] In a preferred embodiment, the HIV-infected cells are obtained from a subject having a sensitive transcription-mediated protein sequence and a sensitive HIV regulatory element sequence. In a more preferred embodiment, the HIV-infected cells are obtained from a subject having a wild-type transcription-mediated protein sequence and a wild-type HIV regulatory sequence.

[0193] In another method of enriching T cells, selection based on immunoaffinity is utilized. This approach may include simultaneously enriching or selecting a first and a second cell population, such as CD4+ and CD8+ cell populations. Cells, including primary human T cells, are contacted in an incubation composition with a first immunoaffinity reagent that specifically binds to CD4 and a second immunoaffinity reagent that specifically binds to CD8, under conditions such that the immunoaffinity reagents specifically bind to CD4 and CD8 molecules on the surface of cells in the sample, respectively. Cells bound to the first and / or second immunoaffinity reagent are recovered, thereby generating an enriched composition comprising CD4+ cells and CD8+ cells. This approach may include incubating the composition with a concentration of the first and / or second immunoaffinity reagent that is below an optimal yield concentration. Notably, in some embodiments, the transduced cells are a mixed T cell population, and in other embodiments, the transduced cells are not a mixed T cell population.

[0194] In some embodiments, selection based on immunoaffinity is used, where the solid support is a sphere, such as a bead, like a microbead or a nanobead. In other embodiments, the bead may be a magnetic bead. In another embodiment, the antibody comprises one or more binding partners capable of reversibly binding to a binding reagent immobilized on a solid surface, such as a sphere or a chromatographic matrix, to form a reversible bond and reversibly immobilize the antibody on the solid surface. In some embodiments, cells expressing a cell surface marker to which the antibody on the solid surface binds can be recovered from the matrix by breaking the reversible bond between the binding reagent and the binding partner. In some embodiments, the binding reagent is streptavidin, or a streptavidin analog or variant.

[0195] Stable transduction of primary cells of the hematopoietic system and / or hematopoietic stem cells can be obtained by contacting the cell surface with both a lentiviral vector and at least one molecule that binds to the cell surface, either in vitro or ex vivo. The cells may be cultured in a ventilated container containing two or more layers under conditions that promote growth and / or proliferation. In some embodiments, this approach can be used with non-CD4+ T cell depletion and / or broad polyclonal expansion.

[0196] In another approach to T cell enrichment, PBMCs are stimulated with a peptide and enriched for cells that secrete cytokines such as interferon-gamma. This approach generally includes the steps of stimulating a mixture of cells containing T cells with an antigen and achieving separation of the antigen-stimulated cells according to the degree of labeling with a product. Antigen stimulation is achieved by exposing the cells to at least one antigen under conditions effective to induce antigen-specific stimulation of at least one T cell. Labeling with the product is achieved by modifying the cell surface to include at least one capture moiety and culturing the cells under conditions where the product is secreted, released, and specifically binds to (is "captured" or "trapped" by) the capture moiety, and labeling the captured product with a label moiety, where the labeled cells are not lysed as part of the labeling procedure or as part of the separation procedure. The capture moiety may incorporate detection of cell surface glycoproteins CD3 or CD4 to refine the enrichment step and generally increase the proportion of antigen-specific T cells, particularly CD4+ T cells.

[0197] The following examples are presented to illustrate aspects of the invention. However, it should be understood that the invention is not limited to the specific conditions or details described in these examples. All publications referred to herein are specifically incorporated by reference.

Examples

[0198] (Example 1: Development of a Lentiviral Vector System) A lentiviral vector system was developed as summarized in FIGS. 3 (linear form) and 4 (circularized form). First, referring to the upper part of FIG. 3, a representative therapeutic vector was designed and generated to have the following elements from left to right: hybrid 5' end repeat sequence (RSV / 5'LTR) (SEQ ID NOs: 34-35), Psi sequence (RNA packaging site) (SEQ ID NO: 36), RRE (Rev response element) (SEQ ID NO: 37), cPPT (polypurine tract) (SEQ ID NO: 38), EF-1α promoter (SEQ ID NO: 4), miR30CCR5 (SEQ ID NO: 1), miR21Vif (SEQ ID NO: 2), miR185Tat (SEQ ID NO: 3), woodchuck post-transcriptional regulatory element (WPRE) (SEQ ID NO: 32 or 80), and ΔU3 3'LTR (SEQ ID NO: 39). The therapeutic vector detailed in FIG. 3 is also referred to herein as AGT103.

[0199] Next, referring to the middle part of FIG. 3, a helper plasmid was designed and generated to have the following elements from left to right: CAG promoter (SEQ ID NO: 41); HIV component gag (SEQ ID NO: 43); HIV component pol (SEQ ID NO: 44); HIV Int (SEQ ID NO: 45); HIV RRE (SEQ ID NO: 46); and HIV Rev (SEQ ID NO: 47).

[0200] Next, referring to the lower part of FIG. 3, an envelope plasmid was designed and generated to have the following elements from left to right: RNA polymerase II promoter (CMV) (SEQ ID NO: 60) and vesicular stomatitis virus G glycoprotein (VSV-G) (SEQ ID NO: 62).

[0201] Lentiviral particles were produced in 293T / 17 HEK cells (purchased from American Type Culture Collection, Manassas, VA), and then the therapeutic vector, en The envelope plasmid and the helper plasmid (as shown in Figure 3) were transfected. For the transfection of 293T / 17 HEK cells that produced functional virus particles, the reagent poly(ethyleneimine) (PEI) was used to increase the efficiency of plasmid DNA uptake. First, the plasmid and DNA were separately added to the serum-free culture medium at a ratio of 3:1 (mass ratio of PEI to DNA). After 2 - 3 days, the cell culture medium was collected, and the lentivirus particles were purified by anion exchange chromatography after high-speed centrifugation and / or filtration. The concentration of lentivirus particles can be expressed in transduction units / ml (TU / ml). The determination of TU was achieved by measuring the HIV p24 level in the culture fluid (the p24 protein is incorporated into the lentivirus particles), by measuring the number of viral DNA copies per cell by quantitative PCR, or by infecting the cells and using light (when the vector encodes a luciferase or fluorescent protein marker).

[0202] As mentioned above, a 3-vector system (i.e., a 2-vector lentivirus packaging system) was designed for the production of lentivirus particles. A schematic diagram of the 3-vector system is shown in Figure 4. The schematic diagram in Figure 4 is a circularized version of the linear system described above in Figure 3. Briefly, referring to Figure 4, the top vector is the helper plasmid, which in this case contains Rev. The vector appearing in the middle of Figure 4 is the envelope plasmid. The bottom vector is the therapeutic vector described above.

[0203] Referring to Figure 4 in more detail, the helper + Rev plasmid contains the CAG enhancer ( SEQ ID NO: 40); the CAG promoter (SEQ ID NO: 41); the chicken beta-actin intron (SEQ ID NO: 42); HIV gag (SEQ ID NO: 43); HIV Pol (SEQ ID NO: 44); HIV Int (SEQ ID NO: 45); HIV RRE (SEQ ID NO: 46); HIV Rev (SEQ ID NO: 47); and the rabbit beta-globin polyA (SEQ ID NO: 48).

[0204] The envelope plasmid contains the CMV promoter (SEQ ID NO: 60); the beta-globin intron (SEQ ID NO: 61); VSV-G (SEQ ID NO: 62); and the rabbit beta-globin polyA (SEQ ID NO: 63).

[0205] Two-vector lentivirus containing the helper (+Rev) and the envelope plasmid Synthesis of the packaging system. Materials and methods: Construction of the helper plasmid: The helper plasmid was constructed by first PCR amplifying a DNA fragment derived from the pNL4-3 HIV plasmid (NIH AIDS Reagent Program) containing the Gag, Pol, and integrase genes. The primers were designed to amplify a fragment having EcoRI and NotI restriction sites that could be used for insertion into the same sites of the pCDNA3 plasmid (Invitrogen). The forward primer was (5’-TAAGCAGAATTCATGAATTTGCCAGGAAGAT-3’) (SEQ ID NO: 81), and the reverse primer was (5’-CCATACAATGAATGGACACTAGGCGGCCGCACGAAT-3’) (SEQ ID NO: 82). The sequences of the Gag, Pol, integrase fragments were as follows:

Chemical formula

Chemical formula

[0206] Next, a DNA fragment containing the Rev, RRE, and rabbit beta-globin polyA sequences and having XbaI and XmaI flanking restriction sites was synthesized by MWG Operon. Subsequently, the DNA fragment was inserted into the XbaI and XmaI restriction sites of the plasmid. The DNA sequence was as follows:

Chemical formula

[0207] Finally, the CMV promoter of pCDNA3.1 was replaced with the CAG enhancer / promoter + chicken β-actin intron sequence. A DNA fragment containing the CAG enhancer / promoter / intron sequence and having MluI and EcoRI flanking restriction sites was synthesized by MWG Operon. Subsequently, the DNA fragment was inserted into the MluI and EcoRI restriction sites of the plasmid. The DNA sequence was as follows:

Chemical formula

[0208] Construction of the VSV-G envelope plasmid: A vesicular stomatitis Indiana virus glycoprotein (VSV-G) sequence having flanking EcoRI restriction sites was synthesized by MWG Operon. Subsequently, the DNA fragment was inserted into the EcoRI restriction site of the pCDNA3.1 plasmid (Invitrogen), and its correct orientation was determined by sequencing using CMV-specific primers. The DNA sequence was as follows:

Chemical formula

[0209] Also, a four-vector system (i.e., a three-vector lentiviral packaging system) was designed and generated using the methods and materials described herein. A schematic diagram of the four-vector system is shown in FIG. 5. Briefly referring to FIG. 5, the top vector is a helper plasmid, which in this case does not contain Rev. The second vector from the top is another Rev plasmid. The second vector from the bottom is the envelope plasmid. The bottom vector is the therapeutic vector described above.

[0210] Referring in part to Figure 5, the helper plasmid contains the CAG enhancer (SEQ ID NO: 49); CAG promoter (SEQ ID NO: 50); chicken beta-actin intron (SEQ ID NO: 51); HIV gag (SEQ ID NO: 52); HIV Pol (SEQ ID NO: 53); HIV Int (SEQ ID NO: 54); HIV RRE (SEQ ID NO: 55); and rabbit beta-globin polyA (SEQ ID NO: 56).

[0211] The Rev plasmid contains the RSV promoter (SEQ ID NO: 57); HIV Rev (SEQ ID NO: 58); and rabbit beta-globin polyA (SEQ ID NO: 59).

[0212] The envelope plasmid contains the CMV promoter (SEQ ID NO: 60); beta-globin intron (SEQ ID NO: 61); VSV-G (SEQ ID NO: 62); and rabbit beta-globin polyA (SEQ ID NO: 63).

[0213] Synthesis of a three-vector lentiviral packaging system containing the helper, Rev, and envelope plasmids. Materials and Methods: Construction of a Rev-free helper plasmid: A Rev-free helper plasmid was constructed by inserting a DNA fragment containing the RRE and rabbit beta-globin polyA sequences. This sequence, which has adjacent XbaI and XmaI restriction sites, was synthesized by MWG Operon. Subsequently, the RRE / rabbit polyA beta-globin sequence was inserted into the XbaI and XmaI restriction sites of the helper plasmid. The DNA sequence is as follows:

Chemical formula

[0214] Construction of the Rev plasmid: The RSV promoter and the HIV Rev sequence were synthesized by MWG Operon as a single DNA fragment with adjacent MfeI and XbaI restriction sites. Subsequently, the DNA fragment was inserted into the MfeI and XbaI restriction sites of the pCDNA3.1 plasmid (Invitrogen) in which the CMV promoter had been replaced by the RSV promoter. The DNA sequence was as follows:

Chemical formula

[0215] The plasmids of the 2-vector and 3-vector packaging systems can be modified with similar elements to potentially remove intron sequences without losing vector function. For example, the following elements may be used in place of the similar elements of the 2-vector and 3-vector packaging systems.

[0216] Promoters: Elongation factor-1 (EF-1) (SEQ ID NO: 64), phosphoglycerate kinase (PGK) (SEQ ID NO: 65), and ubiquitin C (UbC) (SEQ ID NO: 66) can be used in place of the CMV (SEQ ID NO: 60) or CAG promoter (SEQ ID NO: 100).

[0217] PolyA sequences: SV40 polyA (SEQ ID NO: 67) and bGH polyA (SEQ ID NO: 68) can be used in place of the rabbit beta-globin polyA (SEQ ID NO: 48).

[0218] HIV Gag, Pol, and integrase sequences: The HIV sequences in the helper plasmid can be constructed from different HIV strains or clades. For example, HIV Gag (SEQ ID NO: 69) derived from the Bal strain; HIV Pol (SEQ ID NO: 70); and HIV Int (SEQ ID NO: 71) can be exchanged with the gag, pol, and int sequences contained in the helper / helper+Rev plasmids as outlined herein can be done.

[0219] Envelope: The VSV-G glycoprotein can be replaced with a membrane glycoprotein derived from feline endogenous virus (RD114) (SEQ ID NO: 72), simian sarcoma virus (GALV) (SEQ ID NO: 73), rabies (FUG) (SEQ ID NO: 74), lymphocytic choriomeningitis virus (LCMV) (SEQ ID NO: 75), influenza A fowl pest virus (FPV) (SEQ ID NO: 76), Ross River alphavirus (RRV) (SEQ ID NO: 77), murine leukemia virus 10A1 (MLV) (SEQ ID NO: 78), or Ebola virus (EboV) (SEQ ID NO: 79). The sequences of these envelopes are specified in the sequence section herein.

[0220] In summary, the 3-vector system versus the 4-vector system can be compared and contrasted as follows. The 3-vector lentiviral vector system includes the following: 1. Helper plasmid: HIV Gag, Pol, Integrase, and Rev / Tat; 2. Envelope plasmid: VSV-G / FUG envelope; and 3. Therapeutic vector: RSV 5’LTR, Psi packaging signal, Gag fragment, RRE, Env fragment, cPPT, WPRE, and 3’ delta LTR. The 4-vector lentiviral vector system includes the following: 1. Helper plasmid: HIV Gag, Pol, and Integrase; 2. Rev plasmid: Rev; 3. Envelope plasmid: VSV-G / FUG envelope; and 4. Therapeutic vector: RSV 5’LTR, Psi packaging signal, Gag fragment, RRE, Env fragment, cPPT, WPRE, and 3’ delta LTR. The sequences corresponding to the above elements are specified in the sequence listing section of this specification.

[0221] (Example 2: Development of an anti-HIV lentiviral vector) The objective of this example was to develop an anti-HIV lentiviral vector.

[0222] Inhibitory RNA design. Using the sequence of Homo sapiens chemokine C-C motif receptor 5 (CCR5) (GC03P046377) mRNA, potential siRNA or shRNA candidates were explored to knockdown CCR5 levels in human cells. Potential RNA interference sequences were selected from candidates selected by siRNA or shRNA design programs such as from the Broad Institute or the BLOCK-iT RNAi Designer from Thermo Scientific. To regulate shRNA expression, individual selected shRNA sequences were inserted into lentiviral vectors immediately 3' to RNA polymerase III promoters such as H1, U6, or 7SK. Using these lentiviral-shRNA constructs, cells were transduced and changes in specific mRNA levels were measured. The most potent shRNAs to reduce mRNA levels were individually embedded within a microRNA backbone to enable expression by either the CMV or EF-1 alpha RNA polymerase II promoter. The microRNA backbone was selected from mirbase.org / . RNA sequences were also synthesized as synthetic siRNA oligonucleotides and introduced directly into cells without using lentiviral vectors.

[0223] Using the genomic sequence of the BaL strain of human immunodeficiency virus type 1 (HIV-1 85US_BaL, accession number AY713409), potential siRNA or shRNA candidates were searched for that knockdown HIV replication levels in human cells. Based on sequence homology and experience, the search was focused on regions of the HIV Tat and Vif genes, although those skilled in the art will understand that the use of these regions is non-limiting and other potential targets may be selected. Importantly, highly conserved regions of the Gag or polymerase genes could not be targeted by shRNA because these sequences were present in the packaging system complementing plasmids required for vector production. Similar to CCR5 (NM 000579.3, NM 001100168.1 specific) RNA, potential HIV-specific RNA interference sequences were selected from candidates selected by siRNA or shRNA design programs such as the Gene-E Software Suite hosted by the Broad Institute (broadinstitute.org / mai / public) or the BLOCK-iT RNAi Designer from Thermo Scientific (rnadesigner.thermofisher.com / rnaiexpress / setOption.do?designOption=shrna&pid=6712627360706061801). To regulate shRNA expression, individual selected shRNA sequences were inserted into lentiviral vectors immediately 3' to an RNA polymerase III promoter such as H1, U6, or 7SK. Using these lentiviral-shRNA constructs, cells were transduced and changes in specific mRNA levels were measured. The most potent shRNAs for decreasing mRNA levels were individually embedded within a microRNA backbone to allow expression by either the CMV or EF-1 alpha RNA polymerase II promoter.

[0224] Vector construction. For CCR5, Tat, or Vif shRNA, oligonucleotide sequences containing BamHI and EcoRI restriction sites were synthesized by Eurofins MWG Operon, LLC. Overlapping sense and antisense oligonucleotide sequences were mixed and annealed while cooling from 70 °C to room temperature. The lentiviral vector was digested with restriction enzymes BamHI and EcoRI at 37 °C for 1 hour. The digested lentiviral vector was purified by agarose gel electrophoresis and extracted from the gel using Invitrogen's DNA gel extraction kit. The DNA concentration was determined, and vector-to-oligo (3:1 ratio) was mixed, annealed, and ligated. The ligation reaction was carried out at room temperature for 30 minutes using T4 DNA ligase. 2.5 microliters of the ligation mix was added to 25 microliters of STBL3 competent bacterial cells. Transformation was achieved after heat shock at 42 °C. Bacterial cells were spread on an agar plate containing ampicillin, and drug-resistant colonies (indicating the presence of the ampicillin-resistant plasmid) were recovered, purified, and grown in LB broth. To check for the insertion of the oligo sequence, plasmid DNA was extracted from the harvested bacterial culture using the Invitrogen DNA miniprep kit. The insertion of the shRNA sequence in the lentiviral vector was confirmed by DNA sequencing using specific primers for the promoter used to regulate shRNA expression. Exemplary vector sequences determined to restrict HIV replication can be found in FIG. 6. Subsequently, for example, shRNA sequences having the highest activity against CCR5, Tat, or Vif gene expression were assembled into a microRNA (miR) cluster under the control of the EF-1 alpha promoter. The sequences of the promoter and miR are shown in FIG. 6.

[0225] Furthermore, a series of lentiviral vectors were developed as shown in FIG. 7 of the present specification using standard molecular biology techniques (e.g., Sambrook; Molecular Cloning: A Laboratory Manual, 4th Edition) as well as the techniques described herein.

[0226] Vector 1 was developed. Vector 1 contains the following from left to right: a long terminal repeat (LTR) portion (SEQ ID NO: 35); an H1 element (SEQ ID NO: 101); shCCR5 (SEQ ID NO: 16, 18, 20, 22, or 24); the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) (SEQ ID NO: 32, 80); and a long terminal repeat portion (SEQ ID NO: 102).

[0227] Vector 2 was developed. Vector 2 contains the following from left to right: a long terminal repeat (LTR) portion (SEQ ID NO: 35); an H1 element (SEQ ID NO: 101); shRev / Tat (SEQ ID NO: 10); an H1 element (SEQ ID NO: 101); shCCR5 (SEQ ID NO: 16, 18, 20, 22, or 24); the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) (SEQ ID NO: 32, 80); and a long terminal repeat portion (SEQ ID NO: 102).

[0228] Vector 3 was developed. Vector 3 contains the following from left to right: a long terminal repeat (LTR) portion (SEQ ID NO: 35); an H1 element (SEQ ID NO: 101); shGag (SEQ ID NO: 12); an H1 element (SEQ ID NO: 101); shCCR5 (SEQ ID NO: 16, 18, 20, 22, or 24); the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) (SEQ ID NO: 32, 80); and a long terminal repeat portion (SEQ ID NO: 102).

[0229] Vector 4 was developed. Vector 4 contains the following from left to right: a long terminal repeat (LTR) portion (SEQ ID NO: 35); a 7SK element (SEQ ID NO: 103); shRev / Tat (SEQ ID NO: 10); an H1 element (SEQ ID NO: 101); shCCR5 (SEQ ID NO: 16, 18, 20, 22, or 24); the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) (SEQ ID NO: 32, 80); and a long terminal repeat portion (SEQ ID NO: 102).

[0230] Vector 5 was developed. Vector 5 contains, from left to right: a long terminal repeat (LTR) portion (SEQ ID NO: 35); an EF1 element (SEQ ID NO: 4); miR30CCR5 (SEQ ID NO: 1); MiR21Vif (SEQ ID NO: 2); miR185Tat (SEQ ID NO: 3); a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) (SEQ ID NO: 32, 80); and a long terminal repeat portion (SEQ ID NO: 102).

[0231] Vector 6 was developed. Vector 6 contains, from left to right: a long terminal repeat (LTR) portion (SEQ ID NO: 35); an EF1 element (SEQ ID NO: 4); miR30CCR5 (SEQ ID NO: 1); MiR21Vif (SEQ ID NO: 2); miR155Tat (SEQ ID NO: 104); a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) (SEQ ID NO: 32, 80); and a long terminal repeat portion (SEQ ID NO: 102).

[0232] Vector 7 was developed. Vector 7 contains, from left to right: a long terminal repeat (LTR) portion (SEQ ID NO: 35); an EF1 element (SEQ ID NO: 4); miR30CCR5 (SEQ ID NO: 1); MiR21Vif (SEQ ID NO: 2); miR185Tat (SEQ ID NO: 3); a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) (SEQ ID NO: 32, 80); and a long terminal repeat portion (SEQ ID NO: 102).

[0233] Vector 8 was developed. Vector 8 contains, from left to right: a long terminal repeat (LTR) portion (SEQ ID NO: 35); an EF1 element (SEQ ID NO: 4); miR30CCR5 (SEQ ID NO: 1); MiR21Vif (SEQ ID NO: 2); miR185Tat (SEQ ID NO: 3); and a long terminal repeat portion (SEQ ID NO: 102).

[0234] Vector 9 was developed. Vector 9 contains, from left to right: a long terminal repeat (LTR) region (SEQ ID NO: 35); a CD4 element (SEQ ID NO: 30); miR30CCR5 (SEQ ID NO: 1); miR21Vif (SEQ ID NO: 2); miR185Tat (SEQ ID NO: 3); a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) (SEQ ID NO: 32, 80); and a long terminal repeat region (SEQ ID NO: 102).

[0235] Development of Vectors It should be noted that not all of the vectors developed for these experiments functioned as planned. More specifically, a lentiviral vector against HIV may contain three main components: 1) inhibitory RNA to reduce the level of an HIV binding protein (receptor) on the surface of the target cell and block initial virus attachment and entry; 2) overexpression of the HIV TAR sequence that sequesters the viral Tat protein and reduces its ability to transactivate viral gene expression; and 3) inhibitory RNA that attacks important conserved sequences within the HIV genome.

[0236] Regarding the first point above, an important cell surface HIV-binding protein is the chemokine receptor CCR5. HIV particles attach to susceptible T cells by binding to the CD4 and CCR5 cell surface proteins. Since CD4 is an essential cell surface glycoprotein important for the immunological function of T cells, it was not selected as a target for manipulating its expression level. However, people who are homozygous for a naturally occurring null mutation in the CCR5 gene and completely lack receptor expression lead normal lives, except that they have an enhanced susceptibility to a few infectious diseases and may rarely develop autoimmunity. In this example, safety is enhanced because only a relatively small number of systemic CD4+ T cells are genetically modified to reduce CCR5 expression, and the CD4+ T cells required for pathogen immunity or autoimmunity control are unlikely to be present in the modified cells. Therefore, modulation of CCR5 was judged to be a relatively safe approach and was targeted as a major target in the development of anti-HIV lentiviral vectors.

[0237] Regarding the second point above, the viral TAR sequence is a highly structured region of the HIV genomic RNA that binds tightly to the viral Tat protein. The Tat:TAR complex is important for the efficient production of viral RNA. Overexpression of the TAR region is envisioned as a decoy molecule that sequesters the Tat protein and reduces the level of viral RNA. However, TAR has been shown to be toxic to most mammalian cells, including those used to produce lentiviral particles. Furthermore, TAR has been abandoned as a viable component in HIV gene therapy because inhibition of viral gene expression has been inefficient in other laboratories.

[0238] Regarding the above-mentioned third point, viral gene sequences that meet the following three criteria were identified: i) the sequences are moderately conserved across a series of HIV isolates and are representative of the epidemic in the target geographical region; ii) the reduction in RNA levels due to the activity of inhibitory RNA in the viral vector results in a reduction in the corresponding protein levels by an amount sufficient to significantly reduce HIV replication; and iii) the viral gene sequences targeted by the inhibitory RNA are not present in the genes required to package and incorporate viral vector particles during production. The last point is important because having inhibitory RNA that targets genes necessary for the effective function of the virus particle itself is entirely disadvantageous. In this embodiment, the sequence at the junction of the HIV Tat gene and the Rev gene, and a second sequence within the HIV Vif gene, were targeted by the inhibitory RNA. Tat / Rev targeting has the additional benefit of reducing HIV envelope glycoprotein expression because this region overlaps with the envelope gene of the HIV genome.

[0239] The strategy for developing and testing the vector is to first identify the appropriate target (as described herein), then construct plasmid DNA expressing individual or multiple inhibitory RNA species for testing in cell models, and finally construct a lentiviral vector containing inhibitory RNA with demonstrated anti-HIV function. The lentiviral vector is tested for toxicity, yield during in vitro production, and effectiveness against HIV in terms of reducing CCR5 expression levels or reducing viral gene products to inhibit viral replication.

[0240] Table 2 below shows the progress from multiple versions of the inhibitory construct to arriving at a clinical candidate. First, shRNA (short hairpin RNA) molecules were designed and expressed from plasmid DNA constructs.

[0241] Using plasmids 1-4 detailed in Table 2 below, shRNA sequences against the HIV Gag, Pol, and RT genes were tested. Each shRNA was active in suppressing viral protein expression in the cell model, but there were two important problems that hindered further development. First, these sequences targeted laboratory isolates of HIV that did not represent the clade B HIV strains currently circulating in North America and Europe. Second, since these shRNAs targeted important components of the lentiviral vector packaging system, the vector yield would be significantly reduced during production. Plasmid 5 detailed in Table 2 was selected to target CCR5 and provided a lead candidate sequence. Plasmids 6, 7, 8, 9, 10, and 11 detailed in Table 2 were found to have unacceptable toxicity to mammalian cells, including those used in lentiviral vector production, due to the incorporation of the TAR sequence. In plasmid 2 detailed in Table 2, a lead shRNA sequence capable of reducing Tat RNA expression was identified. Plasmid 12 detailed in Table 2 demonstrated that shCCR5 expressed as a microRNA (miR) of the lentiviral vector was effective and was confirmed to be present in the final product. Plasmid 13 detailed in Table 2 demonstrated that shVif expressed as a microRNA (miR) of the lentiviral vector was effective and was confirmed to be present in the final product. Plasmid 14 detailed in Table 2 demonstrated that shTat expressed as a microRNA (miR) of the lentiviral vector was effective and was confirmed to be present in the final product. Plasmid 15 detailed in Table 2 contained miR CCR5, miR Tat, and miR Vif in the form of a miR cluster expressed from a single promoter. These miRs did not target important components of the lentiviral vector packaging system and were shown to have negligible toxicity to mammalian cells. The miRs within the cluster were as effective as the individual miRs tested previously. The overall effect was a significant reduction in the replication of the CCR5-tropic HIV BaL strain.

Table 2-1

Table 2-2

Table 2-3

Table 2-4

Table 2-5

Table 2-6

Table 2-7

Table 2-8

[0242] Functional assay. Individual lentiviral vectors containing CCR5, Tat, or Vif shRNA sequences and expressing green fluorescent protein (GFP) under the control of the CMV Immediate Early Promoter, designated AGT103 / CMV-GFP, were tested for their ability to knockdown CCR5, Tat, or Vif expression. Lentiviral particles were transduced into mammalian cells in the presence or absence of polybrene. Cells were harvested 2 - 4 days later; protein and RNA were analyzed for CCR5, Tat, or Vif expression. Protein levels were tested by Western blot assay or by labeling cells with specific fluorescent antibodies (CCR5 assay) followed by flow cytometry analysis comparing the fluorescence of modified and unmodified cells using either a CCR5-specific antibody or an isotype control antibody.

[0243] ​Start of lentivirus test. T cell culture medium was prepared using RPMI 1640 supplemented with 10% FBS and 1% penicillin-streptomycin. Cytokine stocks of IL2 10,000 units / ml, IL-12 1 μg / ml, IL-7 1 μg / ml, and IL-15 1 μg / ml were also prepared in advance.

[0244] Before lentivirus transduction, the infectious virus titer was determined and used to calculate the amount of virus to add for the appropriate multiplicity of infection (MOI).

[0245] Days 0 - 12: Antigen-specific enrichment: On day 0, cryopreserved PBMCs were thawed, washed with 10 ml of medium at 37°C for 10 minutes at 1200 rpm, and resuspended at a concentration of 2×10 6 cells / ml. Cells were cultured at 37°C in 5% CO2 in a 24-well plate at 0.5 ml / well. To define the optimal stimulation conditions, cells were stimulated with the combinations of reagents listed in Table 3 below:

Table 3-1

[0246] Final concentration: IL-2 = 20 units / ml, IL-12 = 10 ng / ml, IL-7 = 10 ng / ml, IL-15 = 10 ng / ml, peptide = 5 μg / ml for each individual peptide, MVA MOI = 1.

[0247] On days 4 and 8, 0.5 ml of fresh medium and cytokines at the listed concentrations (all concentrations indicate the final concentration in the culture) were added to the stimulated cells.

[0248] Days 12 - 24: Non-specific proliferation and lentivirus transduction. On day 12, the stimulated cells were removed from the plate with a pipette and placed in fresh T cell medium at 1×10 6Resuspended at a concentration of cells / ml. The resuspended cells were transferred to a T25 culture flask and stimulated with DYNABEADS® Human T-Activator CD3 / CD28 and the cytokines listed above according to the manufacturer's instructions; the flask was incubated in a vertical position.

[0249] On day 14, AGT103 / CMV-GFP was added at an MOI of 20 and the culture was returned to the incubator for 2 days. At this point, the cells were harvested by pipetting, collected by centrifugation at 1300 rpm for 10 minutes, resuspended in the same volume of fresh medium, and centrifuged again to form a loose cell pellet. The cell pellet was resuspended in fresh medium containing the same cytokines as used in the previous step at 0.5×10 6 viable cells per ml.

[0250] From day 14 to day 23, the cell number was evaluated every 2 days and the cells were diluted to 0.5×10 6 cells / ml in fresh medium. The cytokines were added each time.

[0251] On day 24, the cells were collected and the beads were removed from the cells. To remove the beads, the cells were transferred to an appropriate tube and placed in a sorting magnet for 2 minutes. The supernatant containing the cells was transferred to a new tube. Then, the cells were cultured at 1×10 in fresh medium for 1 day. Assays were performed to determine the frequencies of antigen-specific T cells and lentivirus-transduced cells. 6 per ml.

[0252] To prevent possible virus growth, amprenavir (0.5 ng / ml) or saquinavir (0.5 ng / ml) or another appropriate protease or integrase inhibitor was added to the culture on the first day of stimulation and every other day during culture.

[0253] Antigen-specific T cells were examined by intracellular cytokine staining for IFN-gamma. After peptide stimulation or at 1×106 Cultured cells after lentiviral transduction at cells / ml were stimulated with medium alone (negative control), Gag peptides (individual peptides at 5 μg / ml), or PHA (5 μg / ml, positive control). After 4 hours, BD GolgiPlug™ (1:1000, BD Biosciences) was added to block Golgi transport. After 8 hours, the cells were washed and stained with extracellular (CD3, CD4 or CD8; BD Biosciences) antibodies and intracellular (IFN-gamma; BD Biosciences) antibodies using the BD Cytofix / Cytoperm™ kit according to the manufacturer's instructions. Samples were analyzed on a BD FACSCalibur™ flow cytometer. Control samples labeled with appropriate isotype-matched antibodies were included in each experiment. Data were analyzed using Flowjo software.

[0254] The lentiviral transduction rate was determined by the frequency of GFP+ cells. Transduced antigen-specific T cells were determined by the frequency of CD3+CD4+GFP+IFN gamma+ cells; tests of CD3+CD8+GFP+IFN gamma+ cells were included as controls.

[0255] These results show that CD4 T cells, which are the target T cell population, can be transduced with a lentivirus designed to specifically knockdown the expression of HIV-specific proteins, and thus generate a proliferable population of T cells that are immune to the virus. This example serves as a proof of concept that the disclosed lentiviral constructs can be used to effect a functional cure in HIV patients.

[0256] (Example 4: CCR5 knockdown with experimental vectors) AGTc120 is a Hela cell line that stably expresses large amounts of CD4 and CCR5. AGTc120 was transduced with or without LV-CMV-mCherry (red fluorescent protein mCherry expressed under the control of the CMV immediate early promoter) or AGT103 / CMV-mCherry. The gene expression of the mCherry fluorescent protein was controlled by a CMV (cytomegalovirus immediate early promoter) expression cassette. While AGT103 / CMV-mCherry expressed therapeutic miRNAs against CCR5, Vif and Tat, the LV-CMV-mCherry vector lacked a microRNA cluster.

[0257] As shown in Figure 8A, the transduction efficiency was >90%. After 7 days, the cells were collected, stained with a fluorescent monoclonal antibody against CCR5 and subjected to flow cytometry analysis. In these histograms, the isotype control is shown in gray, plotting the cell number (y-axis) normalized to the mode against the mean fluorescence intensity of CCR5 APC (x-axis). After staining of cell surface CCR5, cells treated without lentivirus or with a control lentivirus (expressing only the mCherry marker) did not show a change in CCR5 density, while AGT103 (right section) decreased the CCR5 staining intensity to almost the level of the isotype control. After 7 days, the cells were infected with or without the R5-tropic HIV reporter virus Bal-GFP. After 3 days, the cells were collected and analyzed by flow cytometry. More than 90% of the cells were transduced. AGT103-CMV / CMVmCherry decreased CCR5 expression in transduced AGTc120 cells and blocked R5-tropic HIV infection compared to cells treated with the control vector.

[0258] Figure 8B shows the relative insensitivity of transfected AGTc120 cells to HIV infection. As above, the lentiviral vector expresses the mCherry protein, and transduced cells infected with HIV (expressing GFP) appear as double-positive cells in the upper right quadrant of the pseudocolored flow cytometry dot plot. In the absence of HIV (upper panel), no GFP+ cells were present under any conditions. After HIV infection (lower panel), 56% of the cells were infected in the absence of lentiviral transduction, and 53.6% of the cells were infected in AGTc120 cells transduced with LV-CMV-mCherry. When the cells were transduced with the AGT103 / CMV-mCherry vector for therapy, only 0.83% of the cells appeared in the double-positive quadrant, indicating that they were transduced and infected.

[0259] Dividing 53.62 (percentage of double-positive cells with the control vector) by 0.83 (percentage of double-positive cells with the therapy vector) shows that AGT103 provided more than 65-fold protection against HIV in this experimental system.

[0260] (Example 5: Regulation of CCR5 Expression by shRNA Inhibitor Sequences of Lentiviral Vectors) Design of inhibitory RNA. Using the sequence of Homo sapiens chemokine receptor CCR5 (CCR5, NC000003.12), potential siRNA or shRNA candidates were searched for to knockdown the CCR5 level in human cells. Potential RNA interference sequences were selected from candidates selected by siRNA or shRNA design programs such as from the Broad Institute or the BLOCK-IT RNA iDesigner from Thermo Scientific. The shRNA sequence may be inserted immediately after an RNA polymerase III promoter of a plasmid, such as H1, U6, or 7SK, to regulate shRNA expression. Also, the shRNA sequence may be inserted into a lentiviral vector using a similar promoter, or may be embedded within a microRNA backbone to enable expression by an RNA polymerase II promoter such as CMV or EF-1 alpha. The RNA sequence may also be synthesized as an siRNA oligonucleotide and utilized independently of a plasmid or lentiviral vector.

[0261] Plasmid construction. For the CCR5 shRNA, an oligonucleotide sequence containing BamHI and EcoRI restriction sites was synthesized by MWG Operon. The oligonucleotide sequence was annealed by incubation at 70°C and then cooled to room temperature. The annealed oligonucleotide was digested with the restriction enzymes BamHI and EcoRI at 37°C for 1 hour, and then the enzymes were inactivated at 70°C for 20 minutes. In parallel, plasmid DNA was digested with the restriction enzymes BamHI and EcoRI at 37°C for 1 hour. The digested plasmid DNA was purified by agarose gel electrophoresis and extracted from the gel using Invitrogen's DNA gel extraction kit. The DNA concentration was determined, and the plasma was ligated to the oligonucleotide sequence at an insert-to-vector ratio of 3:1. The ligation reaction was carried out at room temperature for 30 minutes using T4 DNA ligase. 2.5 μL of the ligation mix was added to 25 μL of STBL3 competent bacterial cells. Heat shock at 42°C was required for transformation. The bacterial cells were spread on an agar plate containing ampicillin, and the colonies were grown in L broth. To check for the insertion of the oligo sequence, plasmid DNA was extracted from the harvested bacterial culture using the Invitrogen DNA miniprep kit and tested by restriction enzyme digestion. The insertion of the shRNA sequence into the plasmid was confirmed by DNA sequencing using primers specific to the promoter used to regulate shRNA expression.

[0262] Functional assay for CCR5 mRNA reduction: For the assay of CCR5 expression inhibition, co-transfection of two plasmids was required. The first plasmid contained one of five different shRNA sequences against CCR5 mRNA. The second plasmid contained the cDNA sequence of the human CCR5 gene. The plasmids were co-transfected into 293T cells. After 48 hours, the cells were lysed and RNA was extracted using Qiagen's RNeasy kit. cDNA was synthesized from the RNA using Invitrogen's Super Script kit. Subsequently, the samples were analyzed by quantitative RT-PCR using an Applied Biosystems Step One PCR machine. CCR5 expression was detected using Invitrogen's SYBR green under standard conditions for polymerase chain reaction analysis with a forward primer (5'-AGGAATTGATGGCGAGAAGG-3') (SEQ ID NO: 93) and a reverse primer (5'-CCCCAAAGAAGGTCAAGGTAATCA-3') (SEQ ID NO: 94). The samples were normalized for mRNA of beta-actin gene expression under standard conditions for polymerase chain reaction analysis with a forward primer (5'-AGCGCGGCTACAGCTTCA-3') (SEQ ID NO: 95) and a reverse primer (5'-GGCGACGTAGCACAGCTTCT-3') (SEQ ID NO: 96). The relative expression of CCR5 mRNA was determined by its Ct value normalized to the level of actin messenger RNA in each sample. The results are shown in Figure 9.

[0263] As shown in Figure 9A, CCR5 knockdown was tested in 293T cells by co-transfection of a CCR5 shRNA construct and a CCR5 expression plasmid. A control sample was transfected with a scrambled shRNA sequence that did not target any human gene and a CCR5 expression plasmid. 60 hours after transfection, the samples were harvested and CCR5 mRNA levels were measured by quantitative PCR. Furthermore, as shown in Figure 9B, CCR5 was knocked down after transduction with a lentivirus expressing CCR5 shRNA-1 (SEQ ID NO: 16).

[0264] (Example 6: Regulation of HIV components by shRNA inhibitor sequences of lentiviral vectors) Inhibitory RNA design. Using the sequences of HIV type 1 Rev / Tat (5'-GCGGAGACAGCGACGAAGAGC-3') (SEQ ID NO: 9) and Gag (5'-GAAGAAATGATGACAGCAT-3') (SEQ ID NO: 11), [Chemical formula] shRNAs were designed, synthesized, and cloned into plasmids as described above.

[0265] Plasmid construction. The Rev / Tat or Gag target sequence was inserted into the 3' UTR (untranslated region) of the firefly luciferase gene, which is commonly used as a reporter of gene expression in cells or tissues. In addition, one plasmid was constructed to express Rev / Tat shRNA and a second plasmid was constructed to express Gag shRNA. Plasmid construction was as described above.

[0266] Functional assay of shRNA targeting Rev / Tat or Gag mRNA: Using plasmid co - transfection, we tested whether the shRNA plasmid could degrade luciferase messenger RNA and whether it could reduce the luminescence intensity of co - transfected cells. Using an shRNA control (scrambled sequence), we established the maximum light generation from cells transfected with luciferase. When a luciferase construct containing the Rev / Tat target sequence inserted into the 3’ - UTR (untranslated region of mRNA) was co - transfected with the Rev / Tat shRNA sequence, a nearly 90% reduction in luminescence was brought about, indicating that the function of the shRNA sequence is powerful. Similar results were obtained when a luciferase construct containing the Gag target sequence in the 3’ - UTR was co - transfected with the Gag shRNA sequence. These results indicate that the activity of the shRNA sequence is powerful.

[0267] As shown in Figure 10A, knockdown of the Rev / Tat target gene was measured by the reduction of luciferase activity fused to the target mRNA sequence in the 3’UTR by transient transfection of 293T cells. As shown in Figure 10B, the Gag target gene sequence fused to the luciferase gene was knocked down. The results are shown as the mean ± SD of three independent transfection experiments in triplicate.

[0268] (Example 7: AGT103 reduces the expression of Tat and Vif) The exemplary vector AGT103 / CMV - GFP was transfected into cells. AGT103 and other exemplary vectors are defined in Table 3 below.

Table 3 - 2

[0269] The T lymphoblastoid cell line (CEM; CCRF-CEM; American Type Culture Collection catalog number CCL119) was transduced with AGT103 / CMV-GFP. After 48 hours, the cells were transfected with an HIV expression plasmid encoding the entire viral sequence. After 24 hours, RNA was extracted from the cells and tested for the level of intact Tat sequence using reverse transcriptase polymerase chain reaction. The relative expression level of intact Tat RNA decreased from approximately 850 in the presence of the control lentiviral vector to approximately 200 in the presence of AGT103 / CMV-GFP, a >4-fold decrease, as shown in Figure 11.

[0270] (Example 8: Regulation of HIV components by synthetic microRNA sequences of lentiviral vectors) Inhibitory RNA design. The sequences of the HIV-1 Tat and Vif genes were used to search for potential siRNA or shRNA candidates that knockdown Tat or Vif levels in human cells. Potential RNA interference sequences were selected from candidates selected by siRNA or shRNA design programs such as from the Broad Institute or the BLOCK-IT RNA iDesigner from Thermo Scientific. The selected shRNA sequences with the most potent Tat or Vif knockdown were embedded within a microRNA backbone such that expression by an RNA polymerase II promoter such as CMV or EF-I alpha was enabled. Also, the RNA sequences may be synthesized as siRNA oligonucleotides and used independently of plasmids or lentiviral vectors.

[0271] Plasmid construction. The Tat target sequence (5’-TCCGCTTCTTCCTGCCATAG-3’) (SEQ ID NO: 7) was incorporated into the miR185 backbone to generate Tat miRNA

Chemical formula

Chemical formula

[0272] Functional assay of miR185 Tat inhibition of Tat mRNA accumulation. A lentiviral vector (LV-EF1-miR-CCR5-Vif-Tat) expressing miR185 Tat was used to transduce 293T cells at a multiplicity of infection equal to 5. Twenty-four hours after transduction, the cells were transfected with a plasmid expressing the HIV strain NL4-3 (pNL4-3) using Lipofectamine2000 under standard conditions. Twenty-four hours later, RNA was extracted, and the level of Tat messenger RNA was tested by RT-PCR using Tat-specific primers and compared to the level of the control actin mRNA.

[0273] Functional assay of miR21 Vif inhibition of Vif protein accumulation. The lentiviral vector (LV-EF1-miR-CCR5-Vif-Tat) expressing miR21 Vif was used at a multiplicity of infection equal to 5 to transduce 293T cells. Twenty-four hours after transduction, the plasmid expressing the HIV strain NL4-3 (pNL4-3) was transfected into the cells using Lipofectamine2000. Twenty-four hours later, the cells were lysed and all soluble proteins were tested to measure the content of Vif protein. The cell lysates were separated by SDS-PAGE according to established techniques. The separated proteins were transferred to a nylon membrane and probed with a Vif-specific monoclonal antibody or an actin control antibody.

[0274] As shown in Figure 12A, Tat knockdown was tested in 293T cells transfected with either a control lentiviral vector or a lentiviral vector expressing either synthetic miR185 Tat or miR155 Tat microRNA. Twenty-four hours later, the HIV vector pNL4-3 was transfected for 24 hours using Lipofectamine2000, and then RNA was extracted for qPCR analysis using primers for Tat. As shown in Figure 12B, Vif knockdown was tested in 293T cells transfected with either a control lentiviral vector or a lentiviral vector expressing synthetic miR21 Vif microRNA. Twenty-four hours later, the HIV vector pNL4-3 was transfected for 24 hours using Lipofectamine2000, and then proteins were extracted for immunoblot analysis using an antibody against HIV Vif.

[0275] (Example 9: Regulation of CCR5 Expression by Synthetic MicroRNA Sequences of Lentiviral Vectors) CEM-CCR5 cells were transduced with lentiviral vectors containing synthetic miR30 sequences of CCR5 (AGT103: TGTAAACTGAGCTTGCTCTA (SEQ ID NO: 97), AGT103-R5-1: TGTAAACTGAGCTTGCTCGC (SEQ ID NO: 98), or AGT103-R5-2: CATAGATTGGACTTGACAC (SEQ ID NO: 99)). Six days later, CCR5 expression was determined by FACS analysis with an APC-conjugated CCR5 antibody and quantified by mean fluorescence intensity (MFI). CCR5 levels were expressed as a percentage of CCR5 with LV-control set as 100%. The target sequences of AGT103 and AGT103-R5-1 are in the same region as CCR5 target sequence #5. The target sequence of AGT103-R5-2 is the same as CCR5 target sequence #1. AGT103 (2% of total CCR5) is most effective in reducing CCR5 levels compared to AGT103-R5-1 (39% of total CCR5) and AGT103-R5-2 which did not reduce CCR5 levels. Data are demonstrated in Figure 13 herein.

[0276] (Example 10: Regulation of CCR5 expression by synthetic microRNA sequences of lentiviral vectors containing either long or short WPRE sequences.) Vector construction. Lentiviral vectors often require RNA regulatory elements to optimally express therapeutic genes or gene constructs. A common choice is to use the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE). We compared AGT103 containing the full-length WPRE:

Chemical formula

Chemical formula

[0277] ​Functional assay of cell surface CCR5 expression modulation as a function of long-chain WPRE element vs. short-chain WPRE element within a vector array. AGT103 containing either a long-chain or short-chain WPRE element was used to transduce CEM-CCR5 T cells at a multiplicity of infection equal to 5. Six days after transduction, the cells were harvested and stained with a monoclonal antibody capable of detecting cell surface CCR5 protein. The antibody was conjugated to a fluorescent marker. The staining intensity is directly proportional to the level of CCR5 on the cell surface. The control lentivirus had no effect on cell surface CCR5 levels, resulting in a single population with an average fluorescence intensity of 73.6 units. Conventional AGT103 with a long-chain WPRE element reduced CCR5 expression to an average fluorescence intensity level of 11 units. AGT103 modified to incorporate a short-chain WPRE element resulted in a single population of cells with an average fluorescence intensity of 13 units. Thus, substitution of the short-chain WPRE element had little or no effect on the ability of AGT103 to reduce the expression of cell surface CCR5.

[0278] As shown in Figure 14, CEM-CCR5 cells were transduced with AGT103 containing either a long-chain or short-chain WPRE sequence. Six days later, CCR5 expression was determined by FACS analysis using an APC-conjugated CCR5 antibody and quantified as the mean fluorescence intensity (MFI). CCR5 levels were expressed as a percentage of CCR5 with LV-control set at 100%. Reduction in CCR5 levels was similar for AGT103 with either a short-chain (5.5% of total CCR5) or long-chain (2.3% of total CCR5) WPRE sequence.

[0279] (Example 11: Regulation of CCR5 Expression by Synthetic MicroRNA Sequences of Lentiviral Vectors with or without WPRE Sequences) Vector construction. To test whether WPRE is required for AGT103 downregulation of CCR5 expression, the inventors constructed a modified vector lacking the WPRE element sequence.

[0280] Functional assay of cell surface CCR5 expression modulation as a function of the presence or absence of the long-chain WPRE element in the AGT103 vector. To test whether the WPRE is required for modulation of CCR5 expression levels by AGT103, the inventors transduced CEM-CCR5 T cells using a modified vector lacking AGT103 or WPRE, using a multiplicity of infection equal to 5. Six days after transduction, the cells were harvested and stained with a monoclonal antibody capable of recognizing cell surface CCR5 protein. The monoclonal antibody was directly conjugated to a fluorescent marker. The staining intensity is directly proportional to the number of CCR5 molecules per cell surface. The lentiviral control vector had no effect on cell surface CCR5 levels, resulting in a homogeneous population with an average fluorescence intensity of 164. The lentiviral vector (AGT103 having a long-chain WPRE and further expressing the GFP marker protein), AGT103 lacking GFP but containing the long-chain WPRE element, or AGT103 lacking both GFP and WPRE were all equally effective in modulating cell surface CCR5 expression. After removing GFP, AGT103 with or without the WPRE element was indistinguishable in terms of their ability to modulate cell surface CCR5 expression.

[0281] CEM-CCR5 cells were transduced with AGT103 with or without GFP and WPRE. Six days later, CCR5 expression was determined by FACS analysis using an APC-conjugated CCR5 antibody and quantified as the mean fluorescence intensity (MFI). CCR5 levels were expressed as % of CCR5 with LV-control set at 100%. The reduction in CCR5 levels was similar for AGT103 with (0% of total CCR5) or without (0% of total CCR5) the WPRE sequence. Data are demonstrated in Figure 15.

[0282] (Example 12: Regulation of CCR5 Expression by the CD4 Promoter-Regulated Synthetic MicroRNA Sequence of the Lentiviral Vector) Vector construction. To construct a modified version of AGT103 and test the effect of substituting an alternative promoter for expressing a microRNA cluster that suppresses CCR5, Vif, and Tat gene expression, the inventors substituted a T cell-specific promoter for expressing the CD4 glycoprotein using the following sequence instead of the normal EF-1 promoter:

Chem.

[0283] Functional assay comparing the EF-1 and CD4 gene promoters in terms of their potency to reduce cell surface CCR5 protein expression. AGT103 modified by using the CD4 gene promoter instead of the normal EF-1 promoter was used for the transduction of CEM-CCR5 T cells. Six days after transduction, the cells were collected and stained with a monoclonal antibody capable of recognizing the cell surface CCR5 protein. The monoclonal antibody was conjugated to a fluorescent marker. The staining intensity is directly proportional to the level of cell surface CCR5 protein. Control lentiviral transduction resulted in a population of CEM-CCR5 T cells stained with the CCR5-specific monoclonal antibody and showing an average fluorescence intensity of 81.7 units. Modified AGT103 in which the CD4 gene promoter was used instead of the EF-1 promoter for expressing the microRNA showed a broad staining distribution, and the average fluorescence intensity was approximately equal to 17.3 units. Based on this result, the EF-1 promoter may be at least as good as and superior to the CD4 gene promoter for microRNA expression. Depending on the desired target cell population, the EF-1 promoter is ubiquitously active in all cell types, while the CD4 promoter is active only in T lymphocytes.

[0284] CEM-CCR5 cells were transduced with a lentiviral vector (AGT103) containing a CD4 promoter that regulates synthetic microRNA sequences against CCR5, Vif, and Tat. Six days later, CCR5 expression was determined by FACS analysis using an APC-conjugated CCR5 antibody and quantified as mean fluorescence intensity (MFI). CCR5 levels were expressed as the percentage of CCR5 with LV-control set at 100%. In cells transduced with LV-CD4-AGT103, the CCR5 level was 11% of total CCR5. This was equivalent to that observed with LV-AGT103 containing the EF1 promoter. This data is demonstrated in Figure 16.

[0285] (Example 13: Detection of HIV Gag-Specific CD4 T Cells) Cells and reagents. Viable cryopreserved peripheral blood mononuclear cells (PBMCs) were obtained from a vaccine company. Data were obtained using representative specimens from HIV+ individuals enrolled in a Phase 1 clinical trial (Trial Registration: clinicaltrials.gov NCT01378156) testing a vaccine candidate for HIV therapy. Two specimens were obtained for "pre-vaccination" and "post-vaccination" studies. Cell culture products, supplements, and cytokines were from commercial suppliers. Cells were prepared as described by Thompson, M., S. L. Heath, B. Sweeton, K. Williams, P. Cunningham, B. F. Keele, S. Sen, B. E. Palmer, N. Chomont, Y. Xu, R. Basu, M. S. Hellerstein, S. Kwa, and H. L. Robinson (2016). "DNA / MVA Vaccination of HIV-1 Infected Participants with Viral Suppression on Antiretroviral Therapy, followed by Treatment Interruption: Elicitation of Immune Responses without Control of Re-Emergent Virus." PLoS One 11(10):e0163164. We tested the response to recombinant modified Vaccinia Ankara 63B of eovax Corporation. A synthetic peptide representing the entire HIV-1 Gag protein was obtained from GeoVax. Alternatively, the HIV(GAG)Ultra peptide set was obtained from JPT Peptide Technologies GmbH (www.jpt.com), Berlin, Germany. HIV(GAG)Ultra contains 150 peptides, each 15 amino acids in length, with 11 amino acids overlapping. After being chemically synthesized, they were purified and analyzed by liquid chromatography-mass spectrometry. Together, these peptides represent the major immunogenic regions of the HIV Gag protein and are designed for an average coverage of 57.8% among known HIV strains. The peptide sequences are based on the HIV sequence database of the Los Alamos National Laboratory (http: / / www.hiv.lanl.gov / content / sequence / NEWALIGN / align.html). The peptides are provided as 25 micrograms of dry trifluoroacetate per peptide. It is dissolved in approximately 40 microliters of DMSO and diluted to the final concentration with PBS. Monoclonal antibodies for detecting CD4 and cytoplasmic IFN-gamma were obtained from commercial sources. Intracellular staining was performed with the BD Pharmingen Intracellular Staining Kit for interferon-gamma. The peptides were resuspended in DMSO. We included control conditions with DMSO only.

[0286] Functional assay for detecting HIV-specific CD4+ T cells. Frozen PBMCs were thawed, washed, and resuspended in RPMI medium containing 10% fetal bovine serum, supplements, and cytokines. Cultured PBMCs collected before or after vaccination were treated with DMSO control, MVA GeoVax (multiplicity of infection equal to 1 plaque-forming unit per cell), peptide GeoVax (1 microgram / ml), or HIV (GAG) Ultra peptide mixture (1 microgram / ml) for 20 hours in the presence of Golgi Stop reagent. Cells were collected, washed, fixed, permeabilized, and stained with monoclonal antibodies specific for cell surface CD4 or intracellular interferon-gamma. The stained cells were analyzed with a flow cytometer for FACSCalibur analysis. The data were gated on the CD4+ T cell subset. The highlighted cells within the boxed area were double positive and were designated as HIV-specific CD4 T cells based on interferon-gamma expression after MVA or peptide stimulation. The numerical value within the boxed area indicates the percentage of total CD4 identified as HIV-specific. The inventors did not detect a strong response to DMSO or MVA. The peptide of GeoVax induced fewer responsive cells compared to the HIV (GAG) Ultra peptide mixture of JPT, but the difference was small and not significant.

[0287] As shown in FIG. 17, PBMCs derived from HIV-positive patients before or after vaccination were stimulated with DMSO (control), recombinant MVA expressing GeoVax's HIV Gag (MVA GeoVax), GeoVax's Gag peptide (Pep GeoVax, also referred to herein as Gag peptide pool 1), or JPT's Gag peptide (HIV(GAG)Ultra peptide mixture, also referred to herein as Gag peptide pool 2) for 20 hours. IFNγ production was detected by intracellular staining and flow cytometry using a standard protocol. Flow cytometry data was gated on CD4 T cells. The numerical values shown within the squares are the percentage of all CD4 T cells designated as "HIV-specific" based on the cytokine response to antigen-specific stimulation.

[0288] (Example 14: HIV-Specific CD4 T Cell Proliferation and Lentiviral Transduction) Design and testing of a method for enriching PBMCs to increase the proportion of HIV-specific CD4 T cells and transducing those cells with AGT103 to produce the cell product AGT103T. A protocol was designed for ex vivo culturing of PBMCs (peripheral blood mononuclear cells) derived from HIV-positive patients who had received a therapeutic HIV vaccine. In this example, the therapeutic vaccine consisted of three doses of plasmid DNA expressing the HIV Gag, Pol, and Env genes, followed by two doses of MVA 62-B (modified vaccinia Ankara number 62-B) expressing the same HIV Gag, Pol, and Env genes. The protocol is not specific to the vaccine product and only requires sufficient levels of HIV-specific CD4+ T cells after immunization. Venous blood was collected and PBMCs were purified by Ficoll-Paque density gradient centrifugation. Alternatively, PBMCs or defined cell traction may be prepared by positive or negative selection methods using an antibody cocktail and fluorescence activation or magnetic bead sorting. The purified PBMCs were washed and cultured in a standard medium containing supplements, antibiotics, and fetal bovine serum. A pool of synthetic peptides representing possible T cell epitopes within the HIV Gag polyprotein was added to these cultures. The cultures were supplemented by adding the cytokines interleukin-2 and interleukin-12, which were selected after testing combinations of interleukin-2 and interleukin-12, interleukin-2 and interleukin-7, and interleukin-2 and interleukin-15. Peptide stimulation was performed, followed by culturing for approximately 12 days. During the 12-day culture, fresh medium and fresh cytokine supplements were added approximately once every 4 days.

[0289] The peptide stimulation intervals are designed to increase the frequency of HIV-specific CD4 T cells in the PBMC cultures. These HIV-specific CD4 T cells were activated by previous therapeutic immunizations. They can be restimulated and proliferated by synthetic peptide exposure. The goal of the present inventors is to achieve that by the end of the peptide stimulation culture period, the total CD4 T cells specific for HIV are more than 1% or equal to 1%.

[0290] On approximately day 12 of the culture, the cells are washed to remove residual substances and then stimulated with synthetic beads modified with antibodies against the CD4 T cell surface proteins CD3 and CD28. This well-established method for polyclonal stimulation of T cells will reactivate the cells and make them more sensitive to AGT103 lentiviral transduction. On approximately day 13 of the culture, lentiviral transduction is performed using a multiplicity of infection of 1 to 5. After transduction, the cells are washed to remove residual lentiviral vectors and cultured in a medium containing interleukin-2 and interleukin-12, and fresh medium and cytokines are added approximately once every 4 days until approximately day 24 of the culture.

[0291] Throughout the culture interval, the antiretroviral drug saquinavir is added at a concentration of approximately 100 nM to suppress any possible HIV growth.

[0292] On approximately day 24 of the culture, the cells are harvested, washed, samples for potency and release assays are secured, and then the remaining cells are suspended in cryopreservation medium and frozen as approximately 1×10 8 individual HIV-specific CD4 T cells per dose containing approximately 1×10 10 cells as a single aliquot.

[0293] The potency of the cell product (AGT103T) is tested in one of two alternative potency assays. In potency assay 1, the average genomic copy number (integrated AGT103 vector sequence) per CD4 T cell is tested. The minimum potency for release of the product is approximately 0.5 genomic copies per CD4 T cell. This assay is performed by positively selecting CD3-positive / CD4-positive T cells using a magnetic bead-labeled monoclonal antibody, extracting total cellular DNA, and detecting sequences unique to the AGT103 vector using a quantitative PCR reaction. In potency assay 2, the average genomic copy number of integrated AGT103 within a subpopulation of HIV-specific CD4 T cells is tested. This assay is achieved by first stimulating PBMCs with a pool of synthetic peptides representing the HIV Gag protein. The cells are then stained with a specific antibody reagent that can bind to CD4 T cells and can also capture the secreted interferon-gamma cytokine. CD4-positive / interferon-gamma-positive cells are captured by magnetic bead selection, total cellular DNA is prepared, and the genomic copy number of AGT103 per cell is determined by a quantitative PCR reaction. The release criterion based on potency using assay 2 requires that there be greater than or equal to 0.5 genomic copies per HIV-specific CD4 T cell present in the AGT103 cell product. This is first accomplished by stimulating PBMCs with a pool of synthetic peptides representing the HIV Gag protein. The cells are then stained with a specific antibody reagent that can bind to CD4 T cells and can also capture the secreted interferon-gamma cytokine. CD4-positive / interferon-gamma-positive cells are captured by magnetic bead selection, total cellular DNA is prepared, and the genomic copy number of AGT103 per cell is determined by a quantitative PCR reaction. The release criterion based on potency using assay 2 requires that there be greater than or equal to 0.5 genomic copies per HIV-specific CD4 T cell present in the AGT103 cell product.

[0294] Functional testing of the enrichment and transduction of HIV-specific CD4 T cells derived from PBMCs of HIV-positive patients who received a therapeutic HIV vaccine. The effect of therapeutic vaccination on the frequency of HIV-specific CD4 T cells was tested in a peptide stimulation assay (Figure 14 panel B). The frequency of HIV-specific CD4 T cells prior to vaccination was 0.036% in this representative individual. The frequency of HIV-specific CD4 T cells after vaccination increased to 0.076%, approximately twice the value. Responsive cells (HIV-specific) identified by the accumulation of cytoplasmic interferon-gamma were detected only after specific peptide stimulation.

[0295] In addition, the inventors tested whether their goal of generating CD4 T cells that are HIV-specific and transduced with AGT103, which represent approximately 1% of the total CD4 T cells in the culture, could be achieved by enriching for HIV-specific CD4 T cells by peptide stimulation and then transducing them with AGT103. In this case, the inventors used an experimental version of AGT103 that expresses green fluorescent protein (see GFP). In panel C of FIG. 14, it was demonstrated that in the post-vaccination cultures after peptide stimulation (HIV(GAG)Ultra) and AGT103 transduction, 1.11% of the total CD4 T cells were HIV-specific (based on their expression of interferon-gamma in response to peptide stimulation) and transduced with AGT103 (based on the expression of GFP).

[0296] Several patients in the HIV vaccine study for therapy were tested to evaluate the degree of response to peptide stimulation and to initiate the definition of eligibility criteria for inclusion in the gene therapy cohort of future human clinical trials. Panel D of FIG. 18 shows the frequency of HIV-specific CD4 T cells in four vaccine study participants, with pre- and post-vaccination specimens being compared. Importantly, in three cases, the post-vaccination specimens show values of HIV-specific CD4 T cells that are higher than or equal to 0.076% of total CD4 T cells. The ability to reach this value was not predicted by pre-vaccination specimens. This is because patients 001-004 and patient 001-006 both had pre-vaccination values of HIV-specific CD4 T cells of 0.02% at the start, but one ultimately reached a post-vaccination value of 0.12% of HIV-specific CD4 T cells while the other individual was unable to increase this value after vaccination. Also, the same three patients who responded well to the vaccine showed substantial enrichment of HIV-specific CD4 T cells after peptide stimulation and culture in terms of increasing the frequency of HIV-specific CD4 T cells. In the three cases shown in panel E of FIG. 18, peptide stimulation and subsequent culture generated samples in which 2.07%, 0.72%, or 1.54% of total CD4 T cells, respectively, were specific for HIV. These values are large enough to enable the inventors' goal of having the final cell product reach approximately 1% of total CD4 T cells with CD4 T cells that are specific for HIV and transduced with AGT103, indicating that the ex vivo response to peptide stimulation, which most individuals responding to the HIV vaccine for therapy will have, is sufficient.

[0297] As shown in FIG. 18, panel A illustrates the treatment schedule. Panel B demonstrates that PBMCs were stimulated with Gag peptide or DMSO control for 20 hours. IFN gamma production was detected by FACS by intracellular staining. CD4 + T cells were gated for analysis. Panel C uses the method as shown in panel A to CD4 +Demonstrate the proliferation of T cells and transduction of AGT103-GFP. The expanded CD4 + T cells were rested for 2 days in fresh cytokine-free medium and restimulated for 20 hours with Gag peptide or DMSO control. IFN gamma production and GFP expression were detected by FACS. CD4 + T cells were gated for analysis. Panel D demonstrates the detection of the frequency of HIV-specific CD4 + T cells (IFN gamma positive, pre- and post-vaccination) from 4 patients. Panel E demonstrates the expansion of post-vaccination PBMCs from 4 patients and the examination of HIV-specific CD4 + T cells.

[0298] (Example 15: Dose Response) Vector construction. A modified version of AGT103 was constructed to test the dose response upon increasing AGT103 and its effect on cell surface CCR5 levels. AGT103 was modified to contain a green fluorescent protein (GFP) expression cassette under the control of the CMV promoter. Transduced cells express the miR30CCR5 miR21Vif miR185Tat microRNA cluster and emit green light due to GFP expression.

[0299] Functional assays regarding the dose response upon increasing AGT103-GFP and inhibition of CCR5 expression. AGT103-GFP was transduced into CEM-CCR5 T cells using a multiplicity of infection from 0 to 5 per cell. Transduced cells were stained with a fluorescent conjugate (APC) monoclonal antibody specific for cell surface CCR5. The staining intensity is proportional to the number of CCR5 molecules per cell surface. The intensity of green fluorescence is proportional to the number of integrated AGT103-GFP copies per cell.

[0300] As shown in Figure 19, Panel A demonstrates the dose response upon increasing AGT103-GFP and its effect on cell surface CCR5 expression. At a multiplicity of infection equal to 0.4, only 1.04% of the cells are green (indicating transduction) and show a significant reduction in CCR5 expression. At a multiplicity of infection equal to 1, the number of low CCR5, GFP+ cells increased to 68.1%, and at a multiplicity of infection equal to 5, the number of low CCR5, GFP+ cells increased to 95.7%. These data are presented in histogram form in Panel B of Figure 19, showing that the population, which was normally distributed in terms of CCR5 staining, shifted towards lower mean fluorescence intensity with an increase in the AGT103-GFP dose. The potency of AGT103-GFP is presented in graph form in Panel C of Figure 19, showing the percentage inhibition of CCR5 expression upon increasing the dose of AGT103-GFP. At a multiplicity of infection equal to 5, there was a reduction in CCR5 expression levels higher than 99%.

[0301] (Example 16: AGT103 efficiently transduces primary human CD4 + T cells) Transduction of primary CD4 T cells with the AGT103 lentiviral vector. A modified AGT103 vector containing the green fluorescent protein marker (GFP) was used at multiplicities of infection of 0.2 to 5 to transduce purified primary human CD4 T cells.

[0302] Functional assay of the transduction efficiency of AGT103 into primary human CD4 T cells. CD4 T cells were isolated from human PBMCs (HIV-negative donors) using magnetic bead-labeled antibodies and standard procedures. The purified CD4 T cells were stimulated ex vivo with CD3 / CD28 beads and cultured for 1 day in medium containing interleukin-2 prior to AGT103 transduction. The relationship between the lentiviral vector dose (multiplicity of infection) and the transduction efficiency is demonstrated in panel A of FIG. 20, where a multiplicity of infection equal to 0.2 resulted in 9.27% of CD4-positive T cells transduced with AGT103, and at a multiplicity of infection equal to 5, this value of CD4-positive T cells transduced with AGT103 was shown to increase to 63.1%. In addition to achieving efficient transduction of primary CD4-positive T cells, it is also necessary to quantify the genomic copy number per cell. In panel B of FIG. 20, total cellular DNA derived from primary human CD4 T cells transduced at several multiplicities of infection was tested by quantitative PCR to determine the genomic copy number per cell. At a multiplicity of infection equal to 0.2, the inventors measured 0.096 genomic copies per cell. This was in good agreement with the 9.27% GFP-positive CD4 T cells in panel A. At a multiplicity of infection equal to 1, 0.691 genomic copies per cell were generated, and at a multiplicity of infection equal to 5, 1.245 genomic copies per cell were generated.

[0303] As shown in FIG. 20, CD4 + T cells isolated from PBMCs were stimulated with CD3 / CD28 beads and IL-2 for 1 day and transduced with various concentrations of AGT103. After 2 days, the beads were removed and CD4 + T cells were collected. As shown in panel A, the frequency of transduced cells (GFP-positive) was detected by FACS. As shown in panel B, the vector copy number per cell was determined by qPCR. At a multiplicity of infection (MOI) of 5, 63% of CD4 + T cells were transduced with an average of 1 vector copy per cell.

[0304] (Example 17: AGT103 is primary CD4 +Inhibiting HIV replication in T cells) Protection of primary human CD4+ T cells from HIV infection by transducing the cells with AGT103. The lentiviral therapy AGT103 was used at a multiplicity of infection of 0.2 to 5 per cell to transduce primary human CD4+ T cells. Subsequently, the transduced cells were challenged with the CXCR4-tropic HIV strain NL4.3, which does not require cell surface CCR5 for entry. In this assay, the efficacy of microRNAs against the HIV Vif and Tat genes is tested in terms of prevention of productive infection in primary CD4+ T cells, but an indirect method is used to detect the amount of HIV released from infected primary human CD4 T cells.

[0305] Functional assay of AGT103 protection against CXCR4-tropic HIV infection of primary human CD4+ T cells. CD4 T cells were isolated from human PBMC (HIV-negative donors) using magnetic bead-labeled antibodies and standard procedures. The purified CD4 T cells were stimulated ex vivo with CD3 / CD28 beads and cultured for 1 day in medium containing interleukin-2 before being transduced with AGT103 using a multiplicity of infection of 0.2 to 5. Two days after transduction, the CD4+ T cell cultures were challenged with an HIV strain NL4.3 engineered to express green fluorescent protein (GFP). Primary CD4 transduced and exposed to HIV T cell cultures were maintained for 7 days and then cell-free culture supernatants containing HIV were harvested. The cell-free culture supernatants were used to infect the highly permissive T cell line C8166 for 2 days. The percentage of C8166 cells infected with HIV was determined by flow cytometry detecting GFP fluorescence. In the case of mock lentiviral infection, a dose of multiplicity of infection (MOI) of 0.1 for NL4.3 HIV resulted in the release of an amount of HIV into the culture medium that enabled productive infection to be established in 15.4% of C8166 T cells. At a dose of AGT103 with an MOI of 0.2, this value for HIV infection of C8166 cells was reduced to 5.3%, and at an MOI of AGT103 equal to 1, only 3.19% of C8166 T cells were infected with HIV. C8166 infection was further reduced to 0.62% after AGT103 transduction using an MOI equal to 5. There is an obvious dose-response relationship between the amount of AGT103 used for transduction and the amount of HIV released into the culture medium.

[0306] As shown in Figure 21, CD4 + T cells isolated from PBMCs were stimulated with CD3 / CD28 beads and IL-2 for 1 day and transduced with various concentrations (MOI) of AGT103. After 2 days, the beads were removed and the CD4 + T cells were infected with 0.1 MOI of HIV NL4.3-GFP. After 24 hours, the cells were washed three times with PBS and cultured for 7 days with IL-2 (30 U / ml). At the end of the culture, the supernatant was harvested and used to infect the HIV permissive cell line C8166 for 2 days. C8166 cells infected with HIV (GFP positive) were detected by FACS. As observed by the less infection of C8166 cells, viable HIV was reduced as the MOI of AGT103 increased (MOI 0.2 = 65.6%, MOI 1 = 79.3%, and MOI 5 = 96%).

[0307] (Example 18: AGT103 protects primary human CD4 + T cells from HIV-induced depletion) Transduction of primary human CD4 T cells with AGT103 to protect against HIV-mediated cytopathology and cell depletion. PBMCs were obtained from healthy HIV-negative donors, stimulated with CD3 / CD28 beads, and then cultured in medium containing interleukin-2 for 1 day before being transduced with AGT103 using a multiplicity of infection of 0.2 to 5.

[0308] Functional assay of AGT103 protection of primary human CD4 T cells from HIV-mediated cytopathology. Primary human CD4 T cells transduced with AGT103 were infected with the HIV NL4.3 strain (CXCR4-tropic) that does not require CCR5 for cell entry. When using the CXCR4-tropic NL4.3, only the effects of Vif and Tat microRNAs on HIV replication were tested. The dose of HIV NL4.3 was a multiplicity of infection of 0.1. One day after HIV infection, the cells were washed to remove residual virus and cultured in medium and interleukin-2. During the 14-day culture, the cells were collected every 3 days and then stained with a monoclonal antibody specific for CD4 and directly conjugated to a fluorescent marker to enable measurement of the proportion of CD4-positive T cells in PBMCs. Untreated CD4 T cells, or CD4 T cells transduced with a control lentiviral vector, were highly sensitive to HIV challenge, and the proportion of CD4-positive T cells in PBMCs decreased to less than 10% by day 14 of culture. In contrast, AGT103 showed a dose-dependent effect on preventing cell depletion by HIV challenge. At an AGT103 dose of a multiplicity of infection of 0.2, more than 20% of PBMCs were CD4 T cells by day 14 of culture, and at an AGT103 dose equal to 5, the PBMCs that became CD4-positive T cells by day 14 of culture increased to a value higher than 50%. Again, AGT103 showed a clear dose-response effect on the HIV cytopathogenicity of human PBMCs.

[0309] As shown in Fig. 22, PBMCs were stimulated with CD3 / CD28 beads and IL-2 for 1 day and transduced with various concentrations (MOI) of AGT103. After 2 days, the beads were removed and the cells were infected with 0.1 MOI of HIV NL4.3. After 24 hours, the cells were washed 3 times with PBS and cultured with IL-2 (30 U / ml). The cells were collected every 3 days and the frequency of CD4 + T cells was analyzed by FACS. Fourteen days after exposure to HIV, CD4 + T cells transduced with LV-control were reduced by 87%, by 60% with AGT103 MOI 0.2, by 37% with AGT103 MOI 1, and by 17% with AGT103 MOI 5.

[0310] (Example 19: Generation of a population of CD4+ T cells enriched for HIV specificity and transduced with AGT103 / CMV-GFP) Vaccination for therapy against HIV had minimal impact on the distribution of CD4+, CD8+, and CD4+ / CD8+ T cells. As shown in Fig. 23A, the CD4 T cell population is shown in the upper left quadrant of the analysis flow cytometry dot plot and changes from 52% to 57% of total T cells after the vaccination series. These are representative data.

[0311] Peripheral blood mononuclear cells from participants in an HIV therapy vaccine trial were cultured for 12 days in medium + / - interleukin-2 / interleukin-12 or + / - interleukin-7 / interleukin-15. Some cultures were stimulated with overlapping peptides representing the entire p55 Gag protein of HIV-1 (HIV(GAG)Ultra peptide mixture) as a source of epitope peptides for T cell stimulation. These peptides are 10 - 20 amino acids in length, with 20 - 50% of their length overlapping, and represent the entire Gag precursor protein (p55) from the HIV-1 BaL strain. The composition and sequence of individual peptides can be adjusted to compensate for regional variations in the major circulating HIV sequences or when detailed sequence information is available for individual patients receiving this therapy. At the end of the culture, cells were harvested, stained with anti-CD4 or anti-CD8 monoclonal antibodies, gated on the CD3+ population, and shown here. HIV(GAG)Ultra peptide mixture stimulation for any sample, either before or after vaccination, was similar to the medium control, indicating that the HIV(GAG)Ultra peptide mixture was not toxic to the cells and did not act as a polyclonal mitogen. The results of this analysis can be found in Figure 23B.

[0312] HIV(GAG)Ultra peptide mixture and interleukin-2 / interleukin-12 were provided for optimal proliferation of antigen-specific CD4 T cells. As shown in the upper panel of Figure 23C, there was an increase in cytokine (interferon-gamma) secreting cells in the post-vaccination specimens exposed to the HIV(GAG)Ultra peptide mixture. In pre-vaccination samples, as a result of exposure to the antigenic peptides, cytokine secreting cells increased from 0.43 to 0.69%. In contrast, post-vaccination samples showed an increase in cytokine secreting cells from 0.62 to 1.76% of total CD4 T cells as a result of peptide stimulation. These data demonstrate a strong effect of vaccination on the CD4 T cell response to HIV antigen.

[0313] Finally, transduction of antigen-expanded CD4 T cells with AGT103 / CMV-GFP produced HIV-specific and HIV-resistant helper CD4 T cells that are required for infusion into patients as part of a functional cure for HIV (depending on the various other aspects and embodiments, AGT103 may be used alone, for example, clinical embodiments may not include the CMV-GFP segment). The upper panel in FIG. 23C shows the results of analyzing the CD4+ T cell population in culture. The x-axis in FIG. 23C shows green fluorescent protein (GFP) emission, indicating that individual cells have been transduced with AGT103 / CMV-GFP. In samples after vaccination, 1.11% of all CD4 T cells secreting cytokines were recovered, indicating that the cells specifically respond to HIV antigen and have been transduced with AGT103 / CMV-GFP. This is the target cell population and clinical product intended for HIV infusion and functional cure. With the efficiency of cell proliferation during antigen stimulation in ex vivo culture and subsequent polyclonal expansion phase, 4×10 8 individual antigen-specific, lentivirus-transduced CD4 T cells can be produced. This exceeds the target for cell production by more than 4-fold and would be able to achieve a number of antigen-specific and HIV-resistant CD4 T cells that is approximately 40 cells / microliter of blood or approximately 5.7% of total circulating CD4 T cells.

[0314] Table 4 below shows the results of ex vivo production of HIV-specific and HIV-resistant CD4 T cells using the disclosed vectors and methods.

Table 4

[0315] (Example 20) Clinical study of treatment of HIV-positive subjects without immunization AGT103T is a genetically modified autologous PBMC containing ≧5×10 7 individual HIV-specific CD4 T cells further transduced with the AGT103 lentiviral vector.

[0316] In the Phase I clinical trial, the safety and feasibility of injecting ex vivo - modified autologous CD4 T cells (AGT103T) into adult study participants with confirmed HIV infection, while on cART, having a CD4+ T cell count > 600 cells per 1 mm 3 of blood and stable viral suppression of less than 200 copies per 1 ml of plasma will be tested. All study participants will continue to receive standard antiretroviral drug therapy throughout the Phase I clinical trial. Study participants are screened by submitting blood for in vitro tests to measure the frequency of CD4+ T cells that respond to stimulation by a pool of overlapping synthetic peptides representing the HIV - 1 Gag protein. Subjects in whom ≥0.065% of total CD4 T cells are designated as Gag - specific CD4 T cells are enrolled in the gene therapy study, undergo leukapheresis, after which PBMCs are purified (using Ficoll density gradient centrifugation or negative selection by antibody), the PBMCs are cultured ex vivo, stimulated with HIV Gag peptides and interleukin - 2 and interleukin - 12 for 12 days, and then restimulated with beads modified with a CD3 / CD28 bispecific antibody. The anti - retroviral drug saquinavir is included at 100 nM during ex vivo culture to prevent the emergence of autologous HIV. One day after CD3 / CD28 stimulation, the cells are transduced with AGT103 at a multiplicity of infection of 1 - 10. The transduced cells are cultured for an additional 7 - 14 days, during which time the transduced cells proliferate by polyclonal expansion. The culture period is ended by harvesting, the cells are washed, aliquoted for potency and release safety assays, and the remaining cells are resuspended in cryopreservation medium. The single dose is ≤1×10 10 autologous PBMCs. In the potency assay, the frequency of CD4 T cells that respond to peptide stimulation is measured by the expression of interferon - gamma. Other release criteria include that the product has ≥0.5×10 of cells further transduced with AGT103 7It must contain individual HIV-specific CD4 T cells. Another release criterion is that the number of AGT103 genomic copies per cell must not exceed 3. Five days before injecting AGT103T, the subject undergoes a conditioning regimen of 1 dose of busulfuram (or cyclophosphane or fludarabine or a combination of suitable drugs), after which ≤1×10 10 PBMCs are injected.

[0317] In the Phase II study, the efficacy of AGT103T cell therapy will be evaluated. Phase II study participants will include individuals who were previously enrolled in the inventors' Phase I study and who have had a successful stable engraftment of genetically modified autologous HIV-specific CD4 T cells and a clinical response defined as a positive change in the parameters monitored as described in the efficacy evaluation (1.3). Study participants will be required to add maraviroc to their existing regimen of antiretroviral drug therapy. Maraviroc is a CCR5 antagonist that enhances the efficacy of gene therapy aimed at reducing CCR5 levels. Once the maraviroc regimen is established, the subject will be required to discontinue their previous antiretroviral drug regimen and maintain only maraviroc monotherapy for 28 days or until the plasma viral RNA level exceeds 10,000 per ml in two sequential weekly blood draws. In the case of persistent high viremia, participants will need to return to their original antiretroviral drug regimen, with or without maraviroc, following the recommendation of their HIV clinician.

[0318] If the participant's HIV has been suppressed for >28 days on maraviroc monotherapy (less than 2,000 vRNA copies per 1 ml of plasma), the participant will be required to have maraviroc dosing gradually reduced over a 4-week period, followed by intensive monitoring for an additional 28 days. Subjects who maintain HIV suppression on maraviroc monotherapy are considered to have a functional cure. Subjects who also maintain HIV suppression after discontinuation of maraviroc are considered to have a functional cure. Monthly monitoring for 6 months, followed by less intensive monitoring, will establish the durability of the functional cure.

[0319] 1.1 Patient Selection Selection Criteria: · Be between 18 and 60 years of age. · Have been diagnosed with HIV infection prior to study enrollment. · Be willing to comply with the evaluations mandated by the study, including not changing their antiretroviral regimen (unless medically indicated) during the study period. · Have a CD4+ T cell count of >600 cells per cubic millimeter (cells / mm 3 ) · Have a CD4+ T cell nadir of >400 cells / mm 3 · Have an HIV viral load of >1,000 copies per milliliter (mL). Exclusion Criteria: · Any viral hepatitis · Acute HIV infection · Have an HIV viral load of >1,000,000 copies / mL. · Complications defining active or recent (past 6 months) AIDS · Any change in HIV pharmacotherapy within 12 weeks of study entry · Cancer or malignancy not in remission for at least 5 years, except for successfully treated basal cell carcinoma of the skin. · Currently diagnosed with NYHA grade 3 or 4 congestive heart failure or poorly controlled angina or arrhythmia · History of bleeding disorders · Use of chronic steroids in the past 30 days · Pregnancy or lactation · Active drug or alcohol abuse · Severe illness in the past 30 days · Currently participating in another clinical trial or any previous gene therapy

[0320] 1.2 Safety evaluation · Acute injection reaction · Safety follow-up after injection

[0321] 1.3 Efficacy evaluation - Phase I · Number and frequency of modified CD4 T cells. · Persistence of modified CD4 T cells. · In vitro response (ICS assay) to Gag peptide restimulation as a measure of memory T cell function. · Multifunctional anti-HIV CD8 T cell responses compared at time points before and after vaccination. · Frequency of CD4 T cells producing doubly spliced HIV mRNA after in vitro stimulation.

[0322] 1.4 Efficacy evaluation - Phase II · Number and frequency of genetically modified CD4 T cells. · Maintenance of virus suppression by maraviroc monotherapy (up to <2,000 vRNA copies per ml, but two consecutive weekly blood draws not exceeding 5×10 4 copies per ml are allowed). · Sustained virus suppression during and after maraviroc discontinuation. · Stable CD4 T cell count.

[0323] (Example 21) Generate a population of CD4+ T cells via depletion of CD8+ T cells prior to peptide stimulation CD8+ T cell overgrowth significantly affected the proliferation of target CD4+ T cells. Therefore, CD8+ T cells were depleted at the start of cell proliferation to determine whether it would improve CD4+ T cell proliferation. In current CD8+ T cell depletion methods, cells need to pass through a magnetic column. To avoid possible effects of this procedure on antigen-presenting cells and CD4+ T cells, cell depletion was performed after peptide stimulation and before lentiviral transduction, when cells can better withstand mechanical stress.

[0324] More specifically, HIV-positive human peripheral blood was obtained. PBMCs were isolated using Ficoll-Paque PLUS (GE Healthcare, catalog number 17-1440-02). Freshly isolated PBMCs (1×10 7 cells) were stimulated for 18 hours with PepMix™ HIV (GAG) Ultra (catalog number PM-HIV-GAG, JPT Peptide Technologies, Berlin, Germany) in 1 mL of medium in a 24-well plate. CD8+ T cells were depleted using a PE anti-human CD8 antibody and anti-PE microbeads. The negatively selected cells were cultured at 2×10 6 / mL in TexMACS GMP medium (catalog number 170-076-309, Miltenyi Biotech, Bergisch Gladbach, Germany) containing IL-7 (170-076-111, Miltenyi Biotech, Bergisch Gladbach, Germany), IL-15 (170-076-114, Miltenyi Biotech, Bergisch Gladbach, Germany), and saquinavir (catalog number 4658, NIH AIDS Reagent Program, Germantown, MD). Lentivirus AGT103 was added at an MOI of 5 after 24 hours. Fresh medium containing IL-7, IL-15, and saquinavir was added every 2 - 3 days during proliferation. The final concentration of IL-7 / IL-15 was 10 ng / mL. The final concentration of saquinavir was 100 nM. On days 12 - 16, 2 - 3×10 6Cells were collected for peptide restimulation and intracellular cytokine staining (ICS) analysis. A schematic diagram of this depletion protocol is shown in Figure 24.

[0325] When CD8+ T cells were depleted, HIV-specific CD4 T cell proliferation was significantly improved (Figures 25A - C). However, overgrowth by Vδ1 T cells (PTID 01 - 006) (Figure 25A) and NK cells (PTID 01 - 008) (Figure 25C) was observed.

[0326] Referring to Figure 25A, on day 0, the lower left quadrant, lower right quadrant, upper left quadrant, and upper right quadrant of the control had fluorescence intensities of 44.5%, 55.5%, 0.032%, and 0%, respectively. On day 0, the lower left quadrant, lower right quadrant, upper left quadrant, and upper right quadrant of GagPepMix had fluorescence intensities of 44.2%, 55.3%, 0.48%, and 0.053%, respectively. On day 12, without CD8 depletion, the lower left quadrant, lower right quadrant, upper left quadrant, and upper right quadrant of the control had fluorescence intensities of 79.8%, 20.1%, 0.12%, and 0.018%, respectively. On day 12, without CD8 depletion, the lower left quadrant, lower right quadrant, upper left quadrant, and upper right quadrant of GagPepMix had fluorescence intensities of 58.9%, 19.2%, 21.2%, and 0.69%, respectively. On day 12, with CD8 depletion, the lower left quadrant, lower right quadrant, upper left quadrant, and upper right quadrant of the control had fluorescence intensities of 64.4%, 35.0%, 0.44%, and 0.14%, respectively. On day 12, with CD8 depletion, the lower left quadrant, lower right quadrant, upper left quadrant, and upper right quadrant of GagPepMix had fluorescence intensities of 61.9%, 32.9%, 3.47%, and 1.70%, respectively.

[0327] On the 12th day, gating data with CD8 depletion was also generated using CD4 and CD8 as variables. The lower left quadrant, lower right quadrant, upper left quadrant, and upper right quadrant had fluorescence intensities of 45.5% / 45.3%, 44.9%, 9.26%, and 0.35%, respectively. Additionally, gating data was generated using Vδ1 and Vδ2 as variables. The lower left quadrant, lower right quadrant, upper left quadrant, and upper right quadrant had fluorescence intensities of 16.9%, 82.8%, 0.14%, and 0.12%, respectively.

[0328] Referring to Figure 25B, on day 0, the lower left quadrant, lower right quadrant, upper left quadrant, and upper right quadrant of the control had fluorescence intensities of 33.6%, 66.4%, 5.9E-4%, and 1.78E-3, respectively. On day 0, the lower left quadrant, lower right quadrant, upper left quadrant, and upper right quadrant of GagPepMix had fluorescence intensities of 33.7%, 66.3%, 0.011%, and 0.016%, respectively. On day 16, without CD8 depletion, the lower left quadrant, lower right quadrant, upper left quadrant, and upper right quadrant of the control had fluorescence intensities of 78.4%, 21.2%, 0.30%, and 0.018%, respectively. On day 16, without CD8 depletion, the lower left quadrant, lower right quadrant, upper left quadrant, and upper right quadrant of GagPepMix had fluorescence intensities of 76.3%, 20.2%, 2.95%, and 0.61%, respectively. On day 16, with CD8 depletion, the lower left quadrant, lower right quadrant, upper left quadrant, and upper right quadrant of the control had fluorescence intensities of 50.9%, 48.7%, 0.36%, and 0.10%, respectively. On day 16, with CD8 depletion, the lower left quadrant, lower right quadrant, upper left quadrant, and upper right quadrant of GagPepMix had fluorescence intensities of 51.6%, 44.4%, 0.43%, and 3.60%, respectively.

[0329] Referring to Fig. 25C, on day 0, the lower left quadrant, lower right quadrant, upper left quadrant, and upper right quadrant of the control had fluorescence intensities of 65.4%, 34.5%, 0.096%, and 7.71E-4, respectively. On day 0, the lower left quadrant, lower right quadrant, upper left quadrant, and upper right quadrant of GagPepMix had fluorescence intensities of 65.4%, 34.3%, 0.20%, and 0.10%, respectively. On day 16, without CD8 depletion, the lower left quadrant, lower right quadrant, upper left quadrant, and upper right quadrant of the control had fluorescence intensities of 87.9%, 12.1%, 0.028%, and 6.24E-3%, respectively. On day 16, without CD8 depletion, the lower left quadrant, lower right quadrant, upper left quadrant, and upper right quadrant of GagPepMix had fluorescence intensities of 82.3%, 12.1%, 5.38%, and 0.23%, respectively. On day 16, with CD8 depletion, the lower left quadrant, lower right quadrant, upper left quadrant, and upper right quadrant of the control had fluorescence intensities of 87.8%, 12.0%, 0.22%, and 0.013%, respectively. On day 16, with CD8 depletion, the lower left quadrant, lower right quadrant, upper left quadrant, and upper right quadrant of GagPepMix had fluorescence intensities of 87.8%, 11.1%, 0.30%, and 0.78%, respectively.

[0330] On day 16, when the gating data for the case with CD8 depletion was also generated using the variables CD3 and CD4, a fluorescence intensity of 83.1% was shown in the indicated region. Furthermore, when the gating data was generated using the variables CD56 and CD4, a fluorescence intensity of 65.7% was shown in the indicated region.

[0331] (Example 22) Generate a population of CD4+ T cells via depletion of CD8+, γδ, NK, and B cells prior to peptide stimulation When CD8+ T cells were depleted, overgrowth of γδ or NK cells was observed in multiple patients. Therefore, CD8, γδ, NK, or B cells were depleted to test whether it would improve CD4+ T cell proliferation. Cell depletion was performed after peptide stimulation and before lentiviral transduction.

[0332] HIV-positive human peripheral blood was obtained. PBMCs were isolated using Ficoll-Paque PLUS (GE Healthcare, catalog number 17-1440-02). Freshly isolated PBMCs (1×10 7 cells) were stimulated for 18 hours with PepMix™ HIV (GAG) Ultra (catalog number PM-HIV-GAG, JPT Peptide Technologies, Berlin, Germany) in 1 mL of medium in a 24-well plate. CD8+ T, γδ, NK, or B cells were depleted using PE-labeled specific antibodies and anti-PE microbeads. The negatively selected cells were cultured at 2×10 6 / mL in TexMACS GMP medium (catalog number 170-076-309, Miltenyi Biotech, Bergisch Gladbach, Germany) containing IL-7 (170-076-111, Miltenyi Biotech, Bergisch Gladbach, Germany), IL-15 (170-076-114, Miltenyi Biotech, Bergisch Gladbach, Germany), and saquinavir (catalog number 4658, NIH AIDS Reagent Program, Germantown, MD). Lentivirus AGT103 was added at an MOI of 5 after 24 hours. Fresh medium containing IL-7, IL-15, and saquinavir was added every 2 - 3 days during proliferation. The final concentration of IL-7 / IL-15 was 10 ng / mL. On days 12 - 16, 2 - 3×10 6 cells were collected for peptide restimulation and intracellular cytokine staining (ICS) analysis. A schematic diagram of this depletion protocol is shown in Figure 26.

[0333] When additional cell subsets were depleted, HIV Gag-specific CD4 T cells proliferated to higher levels (Figs. 27A–B). Overgrowth of CD8, γδ, or NK cells appears to inhibit CD4 T cell proliferation or kill lentivirally transduced antigen-specific CD4 T cells. This optimized protocol is suitable for scale-up and cell manufacturing.

[0334] Referring to Fig. 27A, on day 0, the lower left quadrant, lower right quadrant, upper left quadrant, and upper right quadrant of the control had fluorescence intensities of 56.4%, 43.5%, 0.034%, and 7.44E-4%, respectively. On day 0, the lower left quadrant, lower right quadrant, upper left quadrant, and upper right quadrant of GagPepMix had fluorescence intensities of 54.8%, 44.8%, 0.30%, and 0.055%, respectively. Without depletion after 18 hours, the lower left quadrant, lower right quadrant, upper left quadrant, and upper right quadrant of the control had fluorescence intensities of 83.9%, 16.0%, 0.061%, and 0.027%, respectively. Without depletion after 18 hours, the lower left quadrant, lower right quadrant, upper left quadrant, and upper right quadrant of GagPepMix had fluorescence intensities of 77.6%, 15.4%, 6.39%, and 0.54%, respectively. With depletion after 18 hours, the lower left quadrant, lower right quadrant, upper left quadrant, and upper right quadrant of the control had fluorescence intensities of 41.9%, 57.9%, 0.094%, and 0.099%, respectively. With depletion after 18 hours, the lower left quadrant, lower right quadrant, upper left quadrant, and upper right quadrant of GagPepMix had fluorescence intensities of 43.3%, 50.7%, 3.00%, and 2.98%, respectively. With CD8 and γδ depletion after 18 hours, the lower left quadrant, lower right quadrant, upper left quadrant, and upper right quadrant of the control had fluorescence intensities of 40.4%, 59.3%, 0.12%, and 0.13%, respectively. With CD8 and γδ depletion after 18 hours, the lower left quadrant, lower right quadrant, upper left quadrant, and upper right quadrant of GagPepMix had fluorescence intensities of 38.3%, 54.7%, 3.14%, and 3.86%, respectively. With CD8, γδ, and B depletion after 18 hours, the lower left quadrant, lower right quadrant, upper left quadrant, and upper right quadrant of the control had fluorescence intensities of 46.2%, 53.6%, 0.13%, and 0.080%, respectively. With CD8, γδ, and B depletion after 18 hours, the lower left quadrant, lower right quadrant, upper left quadrant, and upper right quadrant of GagPepMix had fluorescence intensities of 42.1%, 48.5%, 4.28%, and 5.06%, respectively.

[0335] Referring to Fig. 27B, on day 0, the lower left quadrant, lower right quadrant, upper left quadrant, and upper right quadrant of the control had fluorescence intensities of 42.6%, 57.4%, 2.71E-3%, and 0.0%, respectively. On day 0, the lower left quadrant, lower right quadrant, upper left quadrant, and upper right quadrant of GagPepMix had fluorescence intensities of 42.5%, 57.4%, 0.031%, and 0.048%, respectively. Without depletion after 18 hours, the lower left quadrant, lower right quadrant, upper left quadrant, and upper right quadrant of the control had fluorescence intensities of 79.5%, 20.5%, 0.017%, and 9.73E-3%, respectively. Without depletion after 18 hours, the lower left quadrant, lower right quadrant, upper left quadrant, and upper right quadrant of GagPepMix had fluorescence intensities of 78.9%, 19.5%, 0.93%, and 0.65%, respectively. With depletion after 18 hours, the lower left quadrant, lower right quadrant, upper left quadrant, and upper right quadrant of the control had fluorescence intensities of 51.4%, 48.4%, 0.11%, and 0.063%, respectively. With depletion after 18 hours, the lower left quadrant, lower right quadrant, upper left quadrant, and upper right quadrant of GagPepMix had fluorescence intensities of 51.7%, 43.0%, 0.22%, and 5.03%, respectively. With depletion of CD8, CD56, γδ, and B after 18 hours, the lower left quadrant, lower right quadrant, upper left quadrant, and upper right quadrant of the unstimulated cells had fluorescence intensities of 12.8%, 87.0%, 0.14%, and 0.10%, respectively. With depletion of CD8, CD56, γδ, and B after 18 hours, the lower left quadrant, lower right quadrant, upper left quadrant, and upper right quadrant of GagPepMix had fluorescence intensities of 13.2%, 79.4%, 0.27%, and 7.17%, respectively.

[0336] (Example 23) Method for Measuring Transduction Efficiency of AGT103 Lentivirus To improve the proliferation of CD4+ T cells, the target cells are lentivirus AGT103 transduced antigen-specific CD4+ T cells. A lentivirus with GFP was used to measure the transduction efficiency. Since intracellular staining causes a significant loss of GFP signal, CCS was used to identify antigen-specific CD4+ T cells and GFP-positive cells were used to identify the subset of transduced cells.

[0337] 1×10 7 PBMCs from HIV-positive patients were stimulated for 18 hours with PepMix™ HIV(GAG)Ultra (catalog number PM-HIV-GAG, JPT Peptide Technologies, Berlin, Germany) in 1 mL of medium in a 24-well plate. CD8, γδ, NK, or B cells were depleted using PE-labeled specific antibodies and anti-PE microbeads. The negatively selected cells were cultured at 2×10 6 / mL in TexMACS GMP medium (catalog number 170-076-309, Miltenyi Biotech, Bergisch Gladbach, Germany) containing IL-7 (170-076-111, Miltenyi Biotech, Bergisch Gladbach, Germany), IL-15 (170-076-114, Miltenyi Biotech, Bergisch Gladbach, Germany), and saquinavir (catalog number 4658, NIH AIDS Reagent Program, Germantown, MD). A lentivirus with GFP was added at an MOI of 5 after 24 hours. Fresh medium containing IL-7, IL-15, and saquinavir was added every 3 days during proliferation. The final concentration of IL-7 / IL-15 was 10 ng / mL. On days 12 - 16, 2 - 3×10 6 cells were collected. Peptide restimulation and CCS assays were performed to evaluate IFN-γ-positive antigen-specific CD4+ T cells and GFP signal generation was used to evaluate the transduction efficiency. All experiments were performed according to the manufacturer's instructions.

[0338] IFN-γ positive antigen-specific CD4+ T cells showed fairly good transduction efficiency compared to other cell subsets in the culture (Figure 28). This is reasonable considering that antigen-specific CD4+ T cells received TCR stimulation, proliferated faster, and were more easily infected by lentivirus. As shown in Figure 28, the lower right quadrant (68.6% fluorescence) and the upper right quadrant (12.6% fluorescence) had GFP transduction efficiencies of 41.5% and 67.8%, respectively. This is in contrast to the lower left quadrant (9.75% fluorescence) and the upper left quadrant (2.46% fluorescence), which had GFP transduction efficiencies of 35.6% and 43.3%, respectively.

[0339] (Example 24) Method for determining the relationship between the percentage of transduced cells and the vector copy number Since the target cells are AGT103 lentivirus-transduced HIV-specific CD4 T cells, it is important to know how many target cells are included in the final cell product. However, clinically graded AGT103 lentivirus does not contain a detectable marker. As a result, the transduction efficiency was measured by detecting the vector copy number (VCN) by qPCR. By establishing the relationship between the percentage of transduced cells and the VCN using a lentivirus with GFP, the percentage of transduced cells can be established based on the VCN in the final cell product.

[0340] 1×10 from HIV-positive patients 7Individual PBMCs were stimulated with PepMix™ HIV (GAG) Ultra (Catalog No. PM-HIV-GAG, JPT Peptide Technologies, Berlin, Germany) in 1 mL medium in a 24-well plate for 18 hours. CD8, γδ, NK or B cells were depleted using PE-labeled specific antibodies and anti-PE microbeads. The negatively selected cells were cultured at 2 × 10 6 / mL in TexMACS GMP medium (Catalog No. 170-076-309, Miltenyi Biotech, Bergisch Gladbach, Germany) containing IL-7 (170-076-111, Miltenyi Biotech, Bergisch Gladbach, Germany), IL-15 (170-076-114, Miltenyi Biotech, Bergisch Gladbach, Germany) and saquinavir (Catalog No. 4658, NIH AIDS Reagent Program, Germantown, MD). Lentivirus with GFP was added at an MOI of 5 after 24 hours. Fresh medium containing IL-7, IL-15 and saquinavir was added every 3 days during proliferation. The final concentration of IL-7 / IL-15 was 10 ng / mL. The final concentration of saquinavir was 100 nM. On days 12 - 16, 2 - 3 × 10 6 cells were collected. Peptide restimulation and CCS assays were performed to evaluate antigen-specific CD4+ T cells, and transduction efficiency was evaluated using GFP signal generation. QPCR was performed to detect vector copy number. All experiments were carried out according to the manufacturer's instructions.

[0341] After testing four samples, a positive correlation was observed between the percentage of transduced cells and the vector copy number (Figure 29).

[0342] Sequence The following sequences are cited herein:

Table 5-1

Table 5-2

Table 5-3

Table 5-4

Table 5-5

Table 5-6

Table 5-7

Table 5-8

Table 5-9

Table 5-10

Table 5-11

Table 5-12

Table 5-13

Table 5-14

Table 5-15

Table 5-16

Table 5-17

Table 5-18

Table 5-19

Table 5-20

Table 5-21

Table 5-22

Table 5-23

Table 5-24

Table 5-25

Table 5-26

Table 5-27

Table 5-28

Table 5-29

Table 5-30

Table 5-31

Table 5-32

Table 5-33

Table 5-34

[0343] Some preferred embodiments of the present invention have been described and specifically exemplified above, but the present invention is not intended to be limited to such embodiments. Various modifications may be made thereto without departing from the scope and spirit of the present invention. In certain embodiments, for example, the following items are provided. (Item 1) A method for treating cells infected with HIV, comprising: (a) contacting peripheral blood mononuclear cells (PBMCs) isolated from a subject infected with HIV with a therapeutically effective amount of a stimulating agent, wherein the contacting is performed ex vivo; (b) transducing the PBMCs ex vivo using a viral delivery system encoding at least one genetic element; and (c) culturing the transduced PBMCs for at least one day. A method comprising the above steps. (Item 2) The method according to Item 1, wherein the transduced PBMCs are cultured for about 1 to about 35 days. (Item 3) The method according to Item 1, further comprising injecting the transduced PBMCs into a subject. (Item 4) The method according to Item 3, wherein the subject is a human. (Item 5) The method according to Item 1, wherein the stimulating agent comprises a peptide. (Item 6) The method according to Item 5, wherein the peptide comprises a gag peptide. (Item 7) The method according to Item 1, wherein the stimulating agent comprises a vaccine. (Item 8) The method according to Item 7, wherein the vaccine comprises an HIV vaccine. (Item 9) The method according to Item 8, wherein the HIV vaccine comprises an MVA / HIV62B vaccine or a variant thereof. (Item 10) The method according to item 1, wherein the virus delivery system comprises lentiviral particles. (Item 11) The method according to item 1, wherein the at least one gene element comprises a small RNA capable of inhibiting the production of chemokine receptor CCR5 or at least one small RNA capable of targeting an HIV RNA sequence. (Item 12) The method according to item 1, wherein the at least one gene element comprises a small RNA capable of inhibiting the production of chemokine receptor CCR5 and at least one small RNA capable of targeting an HIV RNA sequence. (Item 13) The method according to item 11 or 12, wherein the HIV RNA sequence comprises an HIV Vif sequence, an HIV Tat sequence, or a variant thereof. (Item 14) The method according to item 11 or 12, wherein the at least one gene element comprises a microRNA or shRNA. (Item 15) The method according to item 14, wherein the at least one gene element comprises a microRNA cluster. (Item 16) The at least one gene element is

Chemical formula

Chemical formula

Chemical formula

Chemical formula

Chemical formula

Chem.

Chem.

Chem.

Chem.

Chem.

Chemical formula

Chemical formula

Chem.

Chem.

Chem.

Chem.

Chem.

Claims

[Claim 1] The invention as depicted in the drawings.