Composition containing shogaol
Gingerol-based compositions effectively promote FGF-21, CRY1, and PER2 expression, enhancing muscle function and circadian rhythm regulation while addressing obesity and metabolic disorders.
Patent Information
- Application Number
- JP2023216027
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2023-12-21
- Publication Date
- 2025-07-03
AI Technical Summary
There is a need for effective means to promote FGF-21 production, CRY1 expression, and PER2 expression, which are crucial for maintaining muscle function, regulating circadian rhythm, and addressing obesity and metabolic disorders.
A composition containing gingerol, which can be derived from a heat-treated extract of the Zingiberaceae family plant, is used to promote FGF-21 production, CRY1 expression, and PER2 expression, thereby supporting muscle function, regulating circadian rhythm, and providing anti-obesity effects.
The gingerol composition enhances FGF-21 production, increases muscle mass, regulates circadian rhythm, and suppresses ectopic fat accumulation, offering potential therapeutic benefits for metabolic disorders and obesity.
Smart Images
Figure 2025099392000001 
Figure 2025099392000002 
Figure 2025099392000003
Abstract
Description
Technical Field
[0001] The present disclosure relates to a composition containing gingerol, etc. Specifically, it relates to a composition, etc. for use in at least one selected from the group consisting of promoting FGF-21 production, promoting CRY1 expression, and promoting PER2 expression, which contains gingerol.
Background Art
[0002] Ginger, a perennial herb of the genus Zingiber in the family Zingiberaceae, is widely used as a spice and crude drug, and gingerol is known as one of its components.
[0003] On the other hand, myokine is a general term for hormones and peptides secreted from skeletal muscle (muscle), and is an endocrine substance that acts on muscle itself or on multiple organs via blood flow, and is known to be secreted by exercise. FGF-21, one type of myokine, is a type of fibroblast growth factor that has a pharmacological effect of improving lipid and glucose metabolism disorders, and is mainly produced in the liver, but has also been found to be secreted from muscle. Currently, clinical trials are being conducted to use FGF-21 as a drug for improving metabolic diseases, and in recent years, it has been reported to be important for maintaining the function of skeletal muscle.
Prior Art Documents
Non-Patent Documents
[0004]
Non-Patent Document 1
Non-Patent Document 2
Non-Patent Document 3
Non-Patent Document 4
Non-Patent Document 5
Non-Patent Document 6
Non-Patent Document 7
Non-Patent Document 8
Summary of the Invention
Problems to be Solved by the Invention
[0005] Providing a means for promoting FGF-21 production, promoting CRY1 expression, or promoting PER2 expression is an issue.
Means for Solving the Problems
[0006] The inventors have found that gingerol has an effect of promoting FGF-21 production, promoting CRY1 expression, or promoting PER2 expression, and have further improved it.
[0007] This disclosure includes, for example, the subject matter described in the following items. Item 1. A composition for use in at least one selected from the group consisting of promoting FGF-21 production, promoting CRY1 expression, and promoting PER2 expression, comprising gingerol. Item 2. A composition for use in at least one selected from the group consisting of maintaining muscle function, improving muscle function, maintaining muscle mass, increasing muscle mass, and regulating the circadian rhythm, comprising gingerol. Item 3. A composition for suppressing ectopic fat accumulation in muscle, comprising gingerol. Item 4. A composition for anti-obesity, comprising gingerol. Item 5. A heat-treated product of an extract of a plant of the genus Zingiber of the family Zingiberaceae, comprising a heat-treated product containing gingerol. The composition according to any one of Items 1 to 4.
Effects of the Invention
[0008] A composition for use in at least one selected from the group consisting of promoting FGF-21 production, promoting CRY1 expression, and promoting PER2 expression is provided.
Brief Description of the Drawings
[0009]
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Modes for Carrying Out the Invention
[0010] Hereinafter, each embodiment included in the present disclosure will be described in more detail. The composition included in the present disclosure contains gingerol. These can be used alone or in combination of two or more. In this specification, the composition may be referred to as "the composition of the present disclosure".
[0011] Gingerol may be a natural product or a synthetic product, and can be used without particular limitation, such as those purified from natural products or commercially available ones. As gingerol, 6-gingerol is exemplified. For example, gingerol may be contained in a heat-treated product of an extract of a plant of the genus Zingiberaceae. In other words, the composition of the present disclosure may include a heat-treated product of an extract of a plant of the genus Zingiberaceae that contains gingerol.
[0012] The Zingiberaceae family plant Zingiber officinale used in the present disclosure does not include the Zingiberaceae family plant Kaempferia parviflora.
[0013] The parts of the Zingiberaceae family plant Zingiber officinale used in the present disclosure are not particularly limited, and examples include roots, rhizomes, stems, or leaves, etc. These can be used alone or in combination of two or more.
[0014] The heat-treated product of the extract of the Zingiberaceae family plant Zingiber officinale preferably contains gingerol. The content of gingerol contained in the heat-treated product of the extract of the Zingiberaceae family plant Zingiber officinale is preferably, for example, 0.1% by mass or more. The upper limit of this range is not particularly limited, and may be, for example, about 0.5, 1, or 2% by mass.
[0015] The solvent used for the preparation of the extract of the Zingiberaceae family plant Zingiber officinale is not particularly limited as long as it can extract zingerol that can be converted into gingerol by heat treatment. For example, water, solvents that can be used in foods (for example, monohydric alcohols having 1 to 5 carbon atoms such as ethanol, methanol, propanol, isopropanol, etc.; polyhydric alcohols having 2 to 5 carbon atoms such as glycerin, isopropyl glycol, propylene glycol, 1,3-butylene glycol, etc.; hexane, etc.; various polar or non-polar solvents), etc. Among them, water or ethanol is preferred. These can be used alone or in combination of two or more.
[0016] The extraction method is not particularly limited, and examples include a method of immersing in water or a solvent. In the extraction stage, heating, stirring, etc. can be carried out as necessary.
[0017] As a heat treatment method for an extract of a plant of the genus Zingiber of the Zingiberaceae family, it is not particularly limited as long as the heat-treated product of the extract of the plant of the genus Zingiber of the Zingiberaceae family contains gingerol. By performing the heat treatment, it is presumed that gingerol contained in the extract of the plant of the genus Zingiber of the Zingiberaceae family is converted into gingerol. As the heating temperature, for example, it can be about 80 to 100°C. As the heating time, for example, it can be about 120 to 240 minutes.
[0018] The composition of the present disclosure contains gingerol and may further contain other components. Examples of the other components include carriers that are pharmaceutically or food hygienically acceptable.
[0019] In the composition of the present disclosure, the content of gingerol is not particularly limited and may be, for example, about 0.001 to 5% by mass, about 0.05 to 3% by mass, or about 0.01 to 1% by mass. When the composition of the present disclosure contains a heat-treated product of an extract of a plant of the genus Zingiber of the Zingiberaceae family, the content of the heat-treated product of the extract of the plant of the genus Zingiber of the Zingiberaceae family in the composition of the present disclosure is not particularly limited and may be, for example, about 0.01 to 50% by mass, about 0.5 to 30% by mass, or about 0.1 to 10% by mass.
[0020] The composition of the present disclosure can be used as an oral composition. As the oral composition, for example, it can be used as a food composition, a pharmaceutical composition (including quasi-drugs), etc.
[0021] The form of the composition of the present disclosure is not particularly limited. When used as an oral composition, for example, it can be in the form of hard capsules, soft capsules, supplements, chewable tablets, beverages, powdered beverages, granules, films, etc. When used as food or drink, for example, tea-based beverages, sports beverages, beauty beverages, vegetable beverages, fruit juice beverages, carbonated beverages, alcoholic beverages, soft drinks, jelly beverages, concentrated beverages diluted with water, hot water, carbonated water, etc., powders, granules, tablets and other dry solids to be dissolved or suspended in water or hot water for drinking, tablet confections, jellies, snacks, baked confections, fried confections, cakes, chocolates, gums, candies, gummies and other confections, soups, noodles, rice, cereals and other food forms. Among these, when used in normal life, forms such as supplement type, chewable tablets, one-shot drink type, etc. are preferred, and when ingested for the purpose of enhancing exercise effects, the form of beverages such as sports beverages is most preferred. Furthermore, these oral compositions can be provided to consumers as container-packed foods filled in containers. The container is not particularly limited as long as it can be sealed.
[0022] The composition of the present disclosure can be ingested once or divided into multiple times (preferably 2 to 3 times). Also, although humans are preferred as the ingestion target, non-human mammals other than humans (for example, rats, mice, rabbits, cows, pigs, dogs, cats, sheep, monkeys, etc.) may also be acceptable.
[0023] The composition of the present disclosure has an action of promoting the production of FGF-21. The promotion of FGF-21 production may be the promotion of FGF-21 gene expression, the promotion of FGF-21 protein expression, or as a result of the promotion of protein expression, the promotion of FGF-21 protein secretion. Among them, the promotion of FGF-21 production is preferably the promotion of FGF-21 production in muscle.
[0024] As shown in the examples described below, gingerol has an effect of promoting the production of FGF-21 in muscle cells. Since FGF-21 has been reported to promote muscle differentiation and be important for maintaining the function of skeletal muscle (Non-Patent Documents 7 and 8), the composition for promoting the production of FGF-21 of the present disclosure can be preferably used as a composition for maintaining muscle function, a composition for improving muscle function, a composition for maintaining muscle mass, or a composition for increasing muscle mass. The present disclosure also includes a composition for maintaining muscle function, a composition for improving muscle function, a composition for maintaining muscle mass, and a composition for increasing muscle mass, which contain gingerol. These compositions may be collectively referred to as "the compositions for maintaining muscle function etc. of the present disclosure".
[0025] Examples of the subjects for ingesting the compositions for maintaining muscle function etc. of the present disclosure include humans with low muscle mass, humans who have developed or are suspected of developing locomotive syndrome, humans who are not able to ingest appropriate nutrients, humans with disrupted eating habits, humans with insufficient exercise, humans who are unable to exercise, humans who have developed metabolic diseases such as diabetes or obesity or belong to the pre-group thereof, humans who have accumulated or are likely to accumulate ectopic fat (fat accumulated in places other than adipose tissue. For example, fat accumulation in muscle), etc.
[0026] The composition of the present disclosure has an effect of promoting the expression of CRY1, which is a circadian rhythm regulator. The promotion of the expression of CRY1 may be the promotion of the expression of the CRY1 gene or the promotion of the expression of the CRY1 protein. Among them, the promotion of the expression of CRY1 is preferably the promotion of the expression of CRY1 in muscle.
[0027] The composition of the present disclosure has an effect of promoting the expression of PER2, which is a circadian rhythm regulator. The promotion of the expression of PER2 may be the promotion of the expression of the PER2 gene or the promotion of the expression of the PER2 protein. Among them, the promotion of the expression of PER2 is preferably the promotion of the expression of PER2 in muscle.
[0028] As shown in the examples described later, the heat-treated product of the extract of the plant of the genus Zingiber of the family Zingiberaceae containing zingerone has an action of promoting the expression of CRY1 and PER2 in muscle cells. Since CRY1 and PER2 are circadian rhythm regulators, the composition of the present disclosure can be preferably used as a composition for regulating the circadian rhythm. The present disclosure also includes a composition for regulating the circadian rhythm containing zingerone. This composition may be referred to as "the composition for regulating the circadian rhythm of the present disclosure".
[0029] Causes of disrupted circadian rhythms include disrupted lifestyle, disrupted diet, or aging, etc. Also, it is known that the circadian rhythm is disrupted in humans with metabolic diseases such as lifestyle-related diseases. Therefore, the subjects for ingesting the composition for regulating the circadian rhythm of the present disclosure include, for example, humans with disrupted circadian rhythms, humans with disrupted lifestyles, humans with disrupted eating habits, humans suffering from metabolic diseases such as lifestyle-related diseases or belonging to the pre-group thereof, elderly humans, etc.
[0030] As shown in the examples described later, since zingerone can suppress the amount of triglycerides in muscle cells, the composition of the present disclosure can be preferably used as an anti-obesity composition (more preferably, a composition for suppressing fat accumulation in muscle cells, in other words, a composition for suppressing the accumulation of ectopic fat (fatty muscle) in muscle). The present disclosure also includes an anti-obesity composition (more preferably, a composition for suppressing fat accumulation in muscle cells, in other words, a composition for suppressing the accumulation of ectopic fat (fatty muscle) in muscle) containing zingerone. This composition may be referred to as "the anti-obesity composition of the present disclosure".
[0031] Since FGF-21 has been reported to have effects such as improving insulin sensitivity, improving glucose metabolism, improving lipid metabolism, enhancing energy production ability, or suppressing appetite via the central nervous system (Non-Patent Documents 1 and 2), the composition of the present disclosure can be preferably used as a composition for anti-obesity. More specifically, the composition of the present disclosure may be a composition for anti-obesity that improves insulin sensitivity, improves glucose metabolism, improves lipid metabolism, enhances energy production ability, and / or suppresses appetite via the central nervous system through promoting the production of FGF-21 in muscle. The present disclosure also encompasses a composition for anti-obesity containing gingerol. This composition may be referred to as "the composition for anti-obesity of the present disclosure". The composition for anti-obesity of the present disclosure is expected to exhibit an anti-obesity effect (more preferably, an effect of suppressing fat accumulation in muscle cells, in other words, an effect of suppressing the accumulation of ectopic fat (fatty muscle) in muscle) based on promoting the production of FGF-21 in muscle.
[0032] In obesity and type 2 diabetes, a state of FGF-21 resistance exists, and it is considered that the anti-obesity effect of FGF-21 is reduced. Although the blood FGF-21 concentration has increased compensatorily, it is considered that the above-described anti-obesity effect of FGF-21 is not exerted. Therefore, the subjects for ingesting the composition for anti-obesity of the present disclosure include, for example, humans who are not sensitive to FGF-21, humans who have developed metabolic diseases such as lifestyle-related diseases such as obesity and diabetes or belong to the pre-group thereof, elderly humans, etc. In addition, humans with disrupted lifestyles, humans with disrupted eating habits, humans with lack of exercise, humans who cannot exercise, humans with accumulated or likely to accumulate ectopic fat, etc. can be mentioned. In addition, CRY1 or PER2, which are circadian rhythm regulators, are known to lead to the onset of obesity or lifestyle-related diseases due to disruption of their expression rhythms by factors such as disrupted lifestyle, disrupted eating habits, and aging. Also, FGF-21 has a circadian rhythm, and it has been reported that the amplitude of the circadian rhythm is significantly lower in obese individuals compared to healthy individuals. From this, examples of the subjects for ingesting the anti-obesity composition of the present disclosure include, for example, humans with disrupted lifestyles, humans with disrupted eating habits, and humans in whom the expression rhythm of CRY1 or PER2, which are circadian rhythm regulators, has been disrupted due to aging, etc. The composition of the present disclosure may be an anti-obesity composition by regulating the expression of CRY1 or PER2, which are circadian rhythm regulators.
[0033] In addition, in this specification, “comprising” includes “consisting essentially of” and “consisting of.” Also, the present disclosure includes all arbitrary combinations of the constituent elements described in this specification.
[0034] Furthermore, the various characteristics (properties, structures, functions, etc.) described for each of the above-described embodiments of the present disclosure may be combined in any manner when specifying the subject matter encompassed by the present disclosure. That is, the present disclosure includes all subject matters consisting of all possible combinations of the combinable characteristics described in this specification.
Examples
[0035] The content of the present disclosure will be specifically described using the following experimental examples. However, the present disclosure is not limited thereto in any way. In the following, unless otherwise specified, the experiments are carried out under atmospheric pressure and normal temperature conditions. Also, unless otherwise specified, “%” means “mass %”.
[0036] 1. Gene expression evaluation of Fgf21 - Effect of ginger extract Mouse skeletal muscle-derived myoblast cell line (C2C12, ATCC) was seeded in a 12-well plate at a density of 4.0×10 4 cells / 1mL / well and cultured in growth medium (DMEM medium (Dulbecco's Modified Eagle Medium, Sigma-Aldrich) containing 10% FBS (Fetal Bovine Serum, Biowest) and 1% Antibiotics (Gibco)) for 3 days. After reaching confluence, the medium was changed to differentiation medium (DMEM medium containing 2% HS (Horse Serum, Sigma-Aldrich) and 1% Antibiotics), and the cells were cultured for an additional 4 days. Then, ginger extract (400 μg / mL) dissolved in differentiation medium, 6-shogaol (36 μM, Tokyo Chemical Industry Catalog #1771), or capsaicin (36 μM, Sigma-Aldrich Catalog #360376) was added and the cells were treated for 6 h. The control was differentiation medium only. Total RNA was extracted using the RNeasy Mini Kit (Qiagen). cDNA was synthesized using the PrimeScript RT reagent Kit (Takara Bio). Quantitative gene expression was performed using QuantStudio (trademark) 5 Real-Time PCR (Thermo Fisher Scientific) with specific primers for each (Fgf21; forward CGACTGCTGCTGGCTGTCTTC (SEQ ID NO: 1), reverse GGCTTCAGTGTCTTGGTCGTCATC (SEQ ID NO: 2), Rps18 (Ribosomal protein S18); forward GCTTAATTTGACTCAACACGGGA (SEQ ID NO: 3), reverse AGCTATCAATCTGTCAATCCTGTA (SEQ ID NO: 4)), and the intercalator method using TB Green Fast qPCR Mix (Takara Bio). The expression level of the Fgf21 gene was corrected by the expression level of Rps18, and the relative value was determined with the expression in differentiation medium only set as 1. For the ginger extract, a water extract of ginger (Zingiberaceae Zingiber genus) or a solvent extract such as ethanol was heat-treated and used, which contained 0.1% or more of shogaol.
[0037] As shown in Fig. 1, it was confirmed that ginger extract and 6-shogaol exhibit an effect of promoting the expression of the Fgf-21 gene. On the other hand, no such effect was observed for capsaicin.
[0038] 2. Evaluation of the expression of circadian rhythm regulatory genes Cry1 and Per2 - Effect of ginger extract Mouse skeletal muscle-derived myoblast cell line (C2C12) was seeded in a 12-well plate at a density of 4.0×10 4 cells / 1mL / well and cultured in a growth medium (DMEM medium containing 10% FBS and 1% Antibiotics) for 3 days. After reaching confluence, the medium was changed to a differentiation medium (DMEM medium containing 2% HS and 1% Antibiotics), and the cells were further cultured for 4 days. Then, ginger extract (400 μg / mL) dissolved in the differentiation medium was added and the cells were treated for 48 h. The control was the differentiation medium only. Total RNA was extracted using the RNeasy Mini Kit. cDNA was synthesized using the PrimeScript RT reagent Kit. Quantitative analysis of gene expression was performed using QuantStudio (trademark) 5 Real-Time PCR with specific primers for each (Cry1; forward CACTGGTTCCGAAAGGGACTC (SEQ ID NO: 5), reverse CTGAAGCAAAAATCGCCACCT (SEQ ID NO: 6), Per2; forward AAAGCTGACGCACACAAAGAA (SEQ ID NO: 7), reverse ACTCCTCATTAGCCTTCACCT (SEQ ID NO: 8), SEQ ID NOs: 3 and 4), and the intercalator method using TB Green Fast qPCR Mix. The expression levels of the Cry1 and Per2 genes were corrected by the expression level of Rps18, and the relative values were determined with the expression in the differentiation medium only set as 1.
[0039] As shown in Figs. 2 and 3, it was confirmed that ginger extract exhibits an effect of promoting the expression of the circadian rhythm regulatory genes Cry1 and Per2.
[0040] 3. Measurement of intracellular triglyceride amount Mouse skeletal muscle-derived myoblast cell line (C2C12) was seeded in a 96-well plate at a density of 0.3×10 4 cells / 1mL / well and cultured in a growth medium (DMEM medium containing 10% FBS and 1% Antibiotics) for 3 days. After reaching confluence, the medium was changed to a differentiation medium (DMEM medium containing 2% HS and 1% Antibiotics), and the cells were further cultured for 7 days. Then, 6-shogaol (50 μM, Tokyo Chemical Industry Catalog #1771) or capsaicin (50 μM, Sigma-Aldrich Catalog #360376) dissolved in the differentiation medium was added and the cells were treated for 24 h. The control was the differentiation medium only. The amount of intracellular triglyceride was measured using the Triglyceride-Glo Assay Kit (Promega), and the relative value was determined with the amount of intracellular triglyceride when treated with the differentiation medium only set as 100.
[0041] As shown in Fig. 4, it was confirmed that 6-shogaol exhibits an effect of reducing the production of intracellular triglyceride. On the other hand, no similar effect was observed for capsaicin.
[0042] 4. Measurement of muscle mass Mouse skeletal muscle-derived myoblast cell line (C2C12) was seeded at 4.0×10 4Cells were seeded in a 12-well plate at a density of cells / 1mL / well and cultured in a growth medium (DMEM medium containing 10% FBS and 1% Antibiotics) for 3 days. After reaching confluence, the medium was changed to a differentiation medium (DMEM medium containing 2% HS and 1% Antibiotics), and the cells were cultured for an additional 7 days. Subsequently, 6-Shogaol (25 μM) and dexamethasone (5 μM, Tokyo Chemical Industry D1961), diluted with the differentiation medium, and both were added and treated for 48 h. For the positive control, 100 nM of IGF-1 (R&D Systems) was used. After 48 h of addition treatment, the cells were washed twice with PBS(-) and fixed with 4% paraformaldehyde phosphate buffer (FUJIFILM Wako Pure Chemical) for 15 min. The cells were washed three times with PBS(-) and blocked with PBS containing 5% GS (Goat Serum, Thermo Scientific) and 0.3% Triton X-100 (Sigma-Aldrich). Then, according to a standard method, the cells were reacted with a primary antibody (Myosin Heavy Chain Antibody, R&D Systems) and a secondary antibody (Goat anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor(™) 488, Thermo Scientific). The nuclei were stained with Hoechst 33342, and green and blue fluorescence images were taken using an EVOS M7000 Imaging System (Thermo Scientific). Quantification of the fluorescence intensity was performed by processing the fluorescence images using Celleste 5 Image Analysis Software (Thermo Scientific). The quantitative values were calculated by correcting the green fluorescence intensity with the blue fluorescence intensity.
[0043] As shown in Fig. 5, it was found that the addition of dexamethasone decreased the muscle mass in muscle cells. When 6-shogaol was added to this, it was confirmed that the decrease in muscle mass was suppressed.
Claims
**Claim 1** A composition for use in at least one selected from the group consisting of promoting FGF-21 production, promoting CRY1 expression, and promoting PER2 expression, comprising gingerol. **Claim 2** A composition for use in at least one selected from the group consisting of maintaining muscle function, improving muscle function, maintaining muscle mass, increasing muscle mass, and regulating the circadian rhythm, comprising gingerol. **Claim 3** A composition for suppressing ectopic fat accumulation in muscle, comprising gingerol. **Claim 4** A composition for anti-obesity, comprising gingerol. **Claim 5** A heat-treated product of an extract of a plant of the genus Zingiber of the family Zingiberaceae, comprising a heat-treated product containing gingerol, The composition according to any one of claims 1 to 4.