Method for improving body-wide age-associated functional changes

Abstract

To provide methods for preventing and treating age-associated functional changes.SOLUTION: The present invention provides a method of administering a glucagon-like peptide 1 receptor (GLP-1R) agonist to a subject in need thereof. The aging-associated functional change is a measurable change in colon activity, adipose tissue amount, circulating white blood cell amount, spleen activity, lung airflow, skeletal muscle activity, heart activity, liver activity, kidney activity, or any combination thereof.SELECTED DRAWING: None

Description

Technical Field

[0001] Refer to the Sequence Listing The Sequence Listing of this application is "CUHK.237.xml" created on November 16, 2023. By reference to the entire contents of the Sequence Listing, all are incorporated herein by reference.

Background Art

[0002] Aging is a multifaceted process that encompasses various complex biological pathways (see Non-Patent Documents 1 and 2). Currently, there are few pharmaceutical interventions available to effectively prevent and treat the functional decline associated with aging. Inhibiting the kinase activity of the mechanistic target of rapamycin (mTOR) with rapamycin has been demonstrated to improve healthspan and lifespan in diverse model organisms (see, for example, Non-Patent Documents 3, 4, and 5). GLP-1 is a peptide hormone that is mainly produced by intestinal L cells and preproglucagon neurons in the brain and regulates micronutrient balance and food intake behavior. GLP-1R is expressed on pancreatic beta cells. Activation of GLP-1R on these specific cells by GLP-1 or its analogs, collectively referred to as GLP-1 receptor agonists (GLP-1RAs), induces insulin secretion and protects these cells from apoptosis (see, for example, Non-Patent Documents 6 and 7). Targeting this pathway has led to the development and approval of several GLP-1RAs for the treatment of type 2 diabetes (T2DM) (see, for example, Non-Patent Document 8). In addition to their glycemic control properties, GLP-1RAs have shown significant benefits in diabetic patients, such as reduction of cardiovascular events, prevention of deterioration of renal function, and reduction of the risk of stroke (see, for example, Non-Patent Documents 9, 10, 11, and 12). Furthermore, GLP-1RAs also show the advantage of neuroprotection in preclinical models and clinical studies (see, for example, Non-Patent Documents 13, 14, 15, 16, 17, and 18). In previous studies, the inventors demonstrated in a mouse model that exenatide, one of the GLP-1RAs, alleviates age-related cerebrovascular disorders and improves the age-associated transcriptome signature in a number of brain cell types (Non-Patent Documents 19 and 20). However, aging involves almost all cell types and cell processes.

Prior Art Documents

Non-Patent Documents

[0003]

Non-Patent Document 1

Non-Patent Document 5

Non-Patent Document 6

Non-Patent Document 7

Non-Patent Document 8

Non-Patent Document 9

Non-Patent Document 10

Non-Patent Document 13

Non-Patent Document 14

Non-Patent Document 18

Non-Patent Document 19

Non-Patent Document 20

Non-Patent Document 21

Summary of the Invention

Problems to be Solved by the Invention

[0004] Therefore, there is a need for interventions to effectively prevent and treat the age-related decline in function in many cell types and cell processes.

Means for Solving the Problems

[0005] Described herein is a method of treating a subject having age-related functional changes. Aspects of the method include administering a GLP-1R agonist to a subject in need thereof, such as an individual who has developed or is at risk of developing age-related functional changes. Age-related functional changes include, for example, a decrease in muscle strength and endurance, a decrease in the function of the heart, large intestine, adipose tissue, circulating white blood cells, heart, spleen, lung, skeletal muscle, liver, and kidney, or a change in the level of circulating metabolites.

[0006] The present invention relates to a method of improving and / or inhibiting functional changes associated with aging in a subject by targeting the GLP-1 signaling pathway using a GLP-1 receptor agonist (GLP-1RA) such as exenatide. In certain embodiments, the anti-aging effect in the subject is accompanied by changes in the transcriptome in multiple organs and the plasma metabolome. In certain embodiments, the molecular anti-aging effect of the GLP-1RA is dependent on hypothalamic GLP-1R.

[0007] In certain embodiments, the subject is at risk of developing or undergoing functional changes associated with aging that can be treated with a GLP-1 receptor agonist (GLP-1RA) such as exenatide, liraglutide, lixisenatide, albiglutide, dulaglutide, semaglutide, taspoglutide, PF-06882961 (danuglipron), OWL-833, and / or TTP-273.

[0008] In certain embodiments, GLP-1RA treatment can improve and / or inhibit transcriptomic and functional changes presented in a number of cell types within the subject, including cells of the hippocampus, prefrontal cortex, myocardial tissue, skeletal muscle tissue, or circulating white blood cells (WBC).

[0009] This patent or application documents include at least one drawing created in color. Copies of this patent or patent application publication with color drawings are provided by the Patent Office upon payment of the fee for the claims and the necessary procedures.

Brief Description of the Drawings

[0010]

Figure 1A

Figure 1B

Figure 1C

Figure 1D

Figure 2A

Figure 2B

Figure 3A

Figure 3B

Figure 3C

Figure 3D

Figure 4A

Figure 4B

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12A

Figure 12B

Figure 13A

Figure 13B

Figure 13C

Figure 13D

Figure 14A

Figure 14B

Figure 15

Figure 16

Figure 17

Figure 18

Figure 19

Figure 20A

Figure 20B

Figure 20C

Figure 20D

Figure 20E

Figure 20F

BEST MODE FOR CARRYING OUT THE INVENTION

[0011] Selected Definitions As used herein, the singular forms "a", "an", and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise. Further, the terms "including", "having", "with", or variations thereof, as used in any of the detailed description and / or claims, are intended to be inclusive in the same manner as the term "comprising". The transitional terms / phrases "comprising", "consisting essentially of", "consisting of" (and any grammatical variations thereof) can be used interchangeably without distinction.

[0012] The phrase "consisting essentially of" indicates that the claim encompasses embodiments that include a particular material or step and embodiments that do not substantially affect the basic and novel characteristics of the claim.

[0013] The term "about" means within an acceptable error range of a particular value as determined by one of ordinary skill in the art, which depends in part on how the value is measured, i.e., the limitations of the measuring method. In the context of a composition containing a component in an amount for which the term "about" is used, these compositions contain the component in an amount that varies by 0 to 10% (error range) of the recited value (X ± 10%). In other contexts, the term "about" gives a variation of 0 to 10% (error range) of a given value (X ± 10%). As is apparent, this variation represents a range up to 10% above or below the given value, e.g., X ± 1%, X ± 2%, X ± 3%, X ± 4%, X ± 5%, X ± 6%, X ± 7%, X ± 8%, X ± 9%, or X ± 10%.

[0014] In the present disclosure, to avoid having to list out each and every value within a range at length, ranges are described concisely. Any suitable value within a range can, where appropriate, be selected as the upper limit value, lower limit value, or end value of the range. For example, the range of 0.1 to 1.0 includes the end values of 0.1 and 1.0, as well as intermediate values such as 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, and all intermediate ranges included within 0.1 to 1.0 such as 0.2 to 0.5, 0.2 to 0.8, 0.7 to 1.0, etc. Values having at least two significant digits within a range are assumed, for example, the range of 5 to 10 indicates all values between 5.0 and 10.0, as well as between 5.00 and 10.00, including the end values. When a range is used herein, the range (e.g., a sub-range within the disclosed range) and combinations and sub-combinations of specific embodiments therein are explicitly included.

[0015] As used herein, "subject", "host", or "organism" refers to any class of chordates, more preferably any class of vertebrates, or most preferably any class of mammals, and includes, but is not limited to, human and other primate animals, including non-human primate animals such as rhesus monkeys, chimpanzees, and other monkeys and ape species; domestic animals such as cows, sheep, pigs, goats, and horses; companion animals such as dogs and cats; and laboratory animals including rabbits, mice, rats, and guinea pigs. This term does not mean a particular age or sex. Thus, adult, juvenile, and neonatal individuals are intended to be included as well as male and female subjects. In some embodiments, the host tissue is derived from the subject. In some embodiments, the subject is a non-human subject.

[0016] As used herein, the terms "therapeutically effective amount", "therapeutically effective dose", "effective amount", and "effective dose" are used to refer to the amount or dose of a compound or composition that, when administered to a subject, can treat, prevent, or ameliorate a condition, disease, or disorder in the subject. In other words, when administered to a subject, that amount is "therapeutically effective". The actual amount will vary depending on a number of factors including, but not limited to, the particular condition, disease, or disorder being treated, prevented, or ameliorated; the severity of the condition; the weight, height, age, and health of the patient; and the route of administration.

[0017] As used herein, the term "treat" refers to eradicating; reducing; alleviating; weakening; remitting; delaying the onset or reducing the symptoms; slowing the rate of degeneration or decline; reducing the debilitation at the end point of degeneration; and / or improving the physical or mental well-being of the subject, or improving the health condition, disease or disorder, or the signs or symptoms thereof to any extent, including (but not necessarily) complete cure of the condition, disease, or disorder. Treatment can result in cure, improvement, or partial alleviation of the disorder. "Treat" can also include improving or enhancing a condition or property, e.g., bringing the function of a particular system in the body to a healthier or more homeostasis-like state.

[0018] As used herein, "prevent" with respect to a health condition, disease, or disorder refers to avoiding, delaying, preventing, or minimizing the onset of specific signs or symptoms of the condition, disease, or disorder. Prevention can be absolute or complete (not necessarily), i.e., causing the signs or symptoms to develop later. Prevention can include reducing the severity of the onset of such a condition, disease, or disorder and / or inhibiting the progression of the disease or disorder to a more severe state of the condition, disease, or disorder.

[0019] In some embodiments of the present invention, the method comprises administering multiple doses of a compound of the present invention. The method may comprise administering 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100 or more therapeutically effective doses of a composition comprising a compound of the present invention as described herein. In some embodiments, the doses are administered over a period of 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 14 days, 21 days, 30 days, 2 months, 3 months, 6 months, 9 months, 1 year, 1.5 years, 2 years, 2.5 years, 5 years, or over 10 years. Administration of multiple doses of the composition at such frequencies and durations is intended to prevent or treat endothelial dysfunction. Further, treatment of a subject with a therapeutically effective amount of a compound of the present invention can comprise a single treatment, or a series of treatments. It will be understood that the effective dosage of the compound used for treatment may be increased or decreased over the course of a particular treatment. Changes in dosage may result from, and be revealed by, for example, the results of tests for endothelial dysfunction such as electrocardiogram, angiogram, echocardiogram, flow-dependent vasodilation test, blood-based biomarkers, magnetic resonance imaging, or positron emission tomography. In some embodiments of the present invention, the method comprises administering the compound several times a day, including but not limited to 2 times a day, 3 times a day, and 4 times a day.

[0020] As used herein, an "isolated" or "purified" compound is substantially free of other compounds. In certain embodiments, the purified compound is at least 60% by weight (dry weight) of the compound of interest. Preferably, the preparation is at least 75% by weight of the compound of interest, more preferably at least 90% by weight, and most preferably at least 99% by weight. For example, the purified compound is at least 90%, 91%, 92%, 93%, 94%, 95%, 98%, 99%, or 100% (w / w) of the desired compound by weight. Purity is measured by any suitable standard method, such as column chromatography, thin layer chromatography, or high performance liquid chromatography (HPLC) analysis.

[0021] "To reduce" means a negative change of at least 1%, 5%, 10%, 25%, 50%, 75%, or 100%.

[0022] "To increase" means a positive change of at least 1%, 5%, 10%, 25%, 50%, 75%, or 100%.

[0023] As used herein, "pharmaceutical" refers to a compound manufactured for use as a pharmaceutical and / or therapeutic agent.

[0024] As used herein, the term "elderly" refers to subjects in the age group beyond middle age. Elderly refers to subjects in a specific age group, for example, 50 years or older, 60 years or older, 65 years or older, 70 years or older, or 75 years or older. Elderly subjects are preferably mammalian animals, more preferably humans, even more preferably human adults, and at least 50, 55, 60, 65, or 70 years old. More preferably, the patient is an elderly (adult) human patient with aging or old age. Elderly patients can be male or female.

[0025] Functional changes associated with aging During the aging process, functional changes may occur in individual or multiple organs throughout the subject's body.

[0026] In certain embodiments, the subjects who benefit from the treatments disclosed herein include individuals at risk of developing or suffering from age-associated conditions such as, for example, physical and cognitive decline, and / or measurable molecular changes in any organ throughout the subject.

[0027] In certain embodiments, age-associated changes in physical function can include loss of muscle strength and endurance, and accumulation of visceral adipose tissue. Such changes in physical function can be evaluated by physical examination and body composition analysis.

[0028] In certain embodiments, the functional changes associated with aging can include multiple organs including the brain, heart, lungs, kidneys, intestine, pancreas, skeletal muscle, fat, liver, blood, spleen, and bone.

[0029] In certain embodiments, the functional changes associated with aging can, for example, impair molecular changes such as changes in gene expression; DNA transcription; RNA translation; the location of DNA, RNA, or protein in cells or tissues; and / or the secretion or release of proteins, DNA, RNA, mitochondria, cellular components, and / or mitochondrial components, and / or low molecular weight molecules (metabolites) into body fluids. The body fluid can be cerebrospinal fluid (CSF), blood, or plasma.

[0030] The age-related changes in these metrics are defined as changes in the numerical values and / or patterns obtained by each method, which fall within the extreme values (e.g., the upper and lower 5%, 10%, 20%, 25%, 30%) of the distribution of the entire population or group of the same age, or show changes over time in repeated measurements from the same subject (e.g., 5%, 10%, 15%, 20%, 25% or more).

[0031] In certain embodiments, the subjects who can benefit from the treatments as disclosed herein are at least about 50, 60, 70, 80, 90 years old and usually 100 years old or less; or about 50 to 100 years old; or about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, or about 100 years old, and include, for example, individuals at risk of developing or experiencing age-related conditions such as physical and cognitive decline and / or measurable molecular changes in any organ across the subject.

[0032] GLP-1R agonist In certain embodiments, a GLP-1R agonist can be used in the methods of the invention. A GLP-1R agonist is an agonist of the GLP-1 receptor. GLP-1, the natural agonist of the GLP-1R, has a short duration of action. Several pharmacologically optimized GLP-1R agonists are approved or in development for the clinical treatment of diabetes or neurodegenerative diseases such as Alzheimer's disease and Parkinson's disease.

[0033] The activity of a GLP-1R agonist can be determined by assays of well-studied downstream signaling and regulatory pathways associated with GLP-1R activation, such as, for example, increased cAMP production, induction of phosphorylation of ERK1 / 2, enhanced intracellular mobilization of calcium, and recruitment of beta-arrestin-1 and beta-arrestin-2.

[0034] Some non-limiting examples of GLP-1R agonists include exenatide, liraglutide, lixisenatide, albiglutide, dulaglutide, semaglutide, taspoglutide, PF-06882961 (danuglipron), OWL-833, and TTP-273, and LY3502970 (orforglipron). In certain embodiments, the GLP-1RA can be a derivative of exenatide, liraglutide, lixisenatide, albiglutide, dulaglutide, semaglutide, taspoglutide, PF-06882961 (danuglipron), OWL-833, TTP-273, and LY3502970 (orforglipron). In certain embodiments, the derivative of the GLP-1RA can be an antibody-GLP-1RA conjugate, such as, for example, glutaxumab; a peptide-GLP-1RA conjugate; a nucleotide-GLP-1RA conjugate; or a polyethylene glycol-GLP-1RA conjugate, such as NYL01.

[0035] Dosage and Administration In certain embodiments, the methods described herein provide methods for treating functional changes associated with aging. In one embodiment, the subject can be a mammalian animal. In other embodiments, the subject can be a human. However, the invention is effective for all mammalian animals. The method can include administering to the subject an effective amount of a pharmaceutical composition comprising a GLP-1R agonist that improves the transcriptome and functional changes in the aging subject. The composition can further comprise one or more pharmaceutically acceptable carriers and / or excipients and can be formulated into preparations, such as in solid, semi-solid, liquid, or gaseous form, such as tablets, capsules, powders, granules, ointments, solutions, suppositories, injections, inhalants, and aerosols. Pharmaceutically acceptable carriers are well known in the art and include, for example, aqueous solutions, such as water or physiological buffered saline, or other solvents or vehicles, such as polyethylene glycol, Tween-20, olive oil, or injectable organic esters. The dosage range of the agonist can depend on the potency. In certain embodiments, a large amount of the agonist can produce a desired effect, such as improvement of the transcriptome and functional changes in any major cell type in the subject, or improvement of the structural and / or functional changes of an organ or tissue in the subject. The dosage should not be so large as to cause harmful side effects. Generally, the dosage varies depending on the agent used. Further, the age, condition, and gender of the subject can be determined by one of ordinary skill in the art and used to determine the dosage. The dosage can also be adjusted by an individual physician in the case of any complications.

[0036] In one embodiment, the composition is formulated as an orally ingestible product such as a food, capsule, tablet, or drinking liquid. An orally deliverable health-promoting compound is any bioactive substance delivered via initial absorption into the gastrointestinal tract or the mucosa of the mouth. The composition can also be formulated as a solution that can be administered via injection, including, for example, intravenous, intraperitoneal, intramuscular, intrathecal, or subcutaneous. In other embodiments, the present composition is formulated to be administered through the skin via a patch or directly to the skin for local or systemic effects. The composition can also be administered sublingually, intraorally, rectally, or vaginally. Further, the composition can be sprayed into the nose for absorption through the nasal membrane, nebulized, inhaled through the mouth or nose, or administered to the eyes or ears.

[0037] An orally ingestible product according to the present invention is any preparation or composition suitable for ingestion, nutrition, oral hygiene, or pleasure, introduced into the oral cavity of a human or animal, remaining therein for a period of time, and then either swallowed (e.g., a food or tablet ready for ingestion) or intended to be removed from the oral cavity again (e.g., chewing gum or a product for oral hygiene or medical oral rinsing). An orally deliverable pharmaceutical can be formulated as an orally ingestible product, and an orally ingestible product can include an orally deliverable pharmaceutical, but the two terms are not meant to be used interchangeably herein.

[0038] Orally ingestible products include all substances or products intended for human or animal ingestion in processed, semi-processed, or unprocessed states. It also includes substances added to orally ingestible products (especially foods and pharmaceuticals) during manufacture, treatment, or processing and intended to be introduced into the oral cavity of a human or animal.

[0039] An orally ingestible product can also include substances that are intended to be swallowed by a human or animal and then digested in an unmodified, prepared, or processed state. An oral consumption product according to the present invention can also include casings, coatings, or other encapsulated products that are intended to be swallowed with the product or are expected to be swallowed.

[0040] In one embodiment, an orally ingestible product is a capsule, pill, syrup, emulsion, or liquid suspension containing a desired orally deliverable substance. In one embodiment, an orally ingestible product can include an orally deliverable substance in powder form that can be mixed with water or other liquid to produce a drinkable orally ingestible product.

[0041] According to the present invention, carriers and / or excipients can include any and all solvents, diluents, buffers (neutral buffered saline, phosphate buffered saline, or optionally Tris-HCl, acetate, or phosphate buffers), water-in-oil or oil-in-water emulsions, aqueous compositions with or without organic co-solvents, e.g., for IV use, solubilizing agents (e.g., polysorbate 65, polysorbate 80), colloids, dispersion media, vehicles, fillers, chelating agents (e.g., EDTA or glutathione), amino acids (e.g., glycine), proteins, disintegrants, binders, lubricants, wetting agents, emulsifying agents, sweeteners, colorants, flavorants, fragrances, thickeners (e.g., carbomer, gelatin, or sodium alginate), coatings, preservatives (e.g., thimerosal, benzyl alcohol, polyquaternium), antioxidants (e.g., ascorbic acid, sodium metabisulfite), tonicity regulators, absorption delaying agents, adjuvants, bulking agents (e.g., lactose, mannitol), etc. The use of carriers and / or excipients in the fields of drugs and supplements is well known. The use of carriers or excipients in the present composition is contemplated, except for any conventional media or agents that are incompatible with the subject health promoting substance or adjuvant composition.

[0042] In one embodiment, the composition can be formulated as an aerosol preparation so that it can be, for example, sprayed or inhaled. Pharmaceutical preparations suitable for administration in the form of an aerosol or spray are, for example, solutions, suspensions, or emulsions. Preparations for oral or nasal aerosol or inhalation administration may also be formulated, for example, with exemplary carriers including saline, polyethylene glycol, DPPC, methylcellulose, or as a mixture with a powder dispersant or fluorocarbon. The aerosol preparation can be placed in a pressurized propellant such as dichlorodifluoromethane, propane, nitrogen, fluorocarbon, and / or other solubilizing or dispersing agents known in the art. By way of example, delivery can be by use of a single-use delivery device, a mist nebulizer, a breath-activated powder inhaler, an aerosol metered-dose inhaler (MDI), or any of a number of other nebulizer delivery devices available in the art. Additionally, direct administration via a mist tent or an endotracheal tube may be used.

[0043] In one embodiment, the composition can be formulated, for administration by injection, as, for example, a solution or a suspension. The solution or suspension can include a suitable non-toxic parenterally acceptable diluent or solvent, such as mannitol, 1,3-butanediol, water, Ringer's solution, or isotonic sodium chloride solution, or a suitable dispersing or wetting agent and suspending agent, such as a sterile non-irritating non-volatile oil, such as synthetic mono- or diglycerides, and fatty acids including oleic acid. One example of a carrier for intravenous use is a mixture of 10% USP ethanol, 40% USP propylene glycol or polyethylene glycol 600, and the balance USP water for injection (WFI). Other exemplary carriers for intravenous use include 10% USP ethanol and USP WFI; 0.01 - 0.1% triethanolamine in USP WFI; or 0.01 - 0.2% dipalmitoyl phosphatidylcholine in USP WFI; and 1 - 10% squalene or a parenteral aqueous vegetable oil-type emulsion. Water or an aqueous physiological saline solution, and aqueous solutions of dextrose and glycerol can be preferably used, in particular, as carriers for injection solutions. Exemplary examples of carriers for subcutaneous or intramuscular use include phosphate buffered saline (PBS) solution, 5% dextrose in WFI and 0.01 - 0.1% triethanolamine in 5% dextrose or 0.9% sodium chloride in USP WFI, or a 1 - 2 or 1 - 4 mixture of 10% USP ethanol, 40% propylene glycol, the balance being an acceptable isotonic solution such as 5% dextrose or 0.9% sodium chloride; or 0.01 - 0.2% dipalmitoyl phosphatidylcholine in USP WFI and 1 - 10% squalene or a parenteral aqueous vegetable oil-type emulsion.

[0044] In one embodiment, the adjuvant composition can be formulated for administration via topical application to the skin as a topical solution, for example, including rinses, sprays, drops, lotions, gels, ointments, creams, foams, powders, solids, sponges, tapes, water vapor, pastes, tinctures, or transdermal patches. Suitable formulations for topical application can include, in addition to any pharmaceutically active carrier, emollients such as carnauba wax, cetyl alcohol, cetyl ester wax, emulsifying wax, hydrous lanolin, lanolin, lanolin alcohol, microcrystalline wax, paraffin, petrolatum, polyethylene glycol, stearic acid, stearyl alcohol, white beeswax, or yellow beeswax. Further, the composition may contain humectants such as glycerin, propylene glycol, polyethylene glycol, sorbitol solution, and 1,2,6 - hexanetriol, or penetration enhancers such as ethanol, isopropyl alcohol, or oleic acid.

[0045] As determined by those skilled in the art, additional components, such as buffers, carriers, viscosity modifiers, preservatives, fragrances, dyes, and other components according to the intended use, can be added to the composition. Those skilled in the art will recognize that the above description is illustrative rather than exhaustive. Indeed, many additional formulation techniques and pharmaceutically acceptable excipients and carrier solutions suitable for a particular mode of administration are well known to those skilled in the art.

[0046] In certain embodiments, the dosage ranges from about 0.001 mg / kg body weight to about 1 g / kg body weight. In some embodiments, the dosage is from about 0.001 mg / kg body weight to about 0.2 mg / kg body weight, from about 0.001 mg / kg body weight to about 0.1 mg / kg body weight, from about 0.001 mg / kg body weight to about 20 mg / kg body weight, from about 0.001 mg / kg body weight to about 10 mg / kg body weight, from about 0.001 mg / kg body weight to about 5 mg / kg body weight, from about 0.001 mg / kg body weight to about 2 mg / kg body weight, from about 0.001 mg / kg body weight to about 1 mg / kg body weight, from about 0.001 mg / kg body weight to about 0.2 mg / kg body weight, from about 0.001 mg / kg body weight to about 0.02 mg / kg body weight, from about 0.001 mg / kg body weight to about 0.01 mg / kg body weight. Alternatively, in some embodiments, the dosage range is from about 0.01 g / kg body weight to about 1 g / kg body weight, from about 0.05 g / kg body weight to about 1 g / kg body weight, from about 0.1 g / kg body weight to about 1 g / kg body weight, from about 0.2 g / kg body weight to about 1 g / kg body weight, from about 0.25 g / kg body weight to about 1 g / kg body weight, from about 0.5 g / kg body weight to about 1 g / kg body weight. In one embodiment, the dosage range is from about 5 μg / kg body weight to about 50 μg / kg body weight.

[0047] GLP-1RAs that improve age-associated functional changes can be administered, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 times per day; less than once per day; once per week; once every two weeks; once per month; once every two months; four times per year; once every two years; annually; or continuously to achieve a therapeutically effective dosage, etc., multiple times per day. The administration of the dosage used herein can be repeated for a limited period. For example, the dosage used herein can be administered daily for several weeks, several months, or several years. The treatment period depends on the clinical progression of the subject and the responsiveness to treatment. A therapeutically effective amount is an amount of GLP-1RA sufficient to produce a measurable change in gene expression and / or function in various tissues and / or organs in the subject (see "Measurement of Efficacy" below). Such an effective amount can be administered in clinical trials and in animal experiments.

[0048] The GLP-1RAs useful in the present invention can be administered orally, intravenously, intranasally, by inhalation, intraperitoneally, intramuscularly, subcutaneously, or intracavity. In one embodiment, the GLP-1RAs used herein are administered orally or subcutaneously to a patient.

[0049] Measurement of Efficacy In one embodiment, the efficacy of a given treatment can be determined by, for example, improvement in functional ability measured by many tests such as grip strength, balance sense, memory, recall, visuospatial awareness, verbal fluency, expressive language, executive function, walking, and dual task, multitask, etc. These can be reflected as improvement in values obtained by tests including the forelimb grip strength test, rotarod test, Mini-Mental State Test (MMSE), Montreal Cognitive Assessment (MoCA) and its variants, Alzheimer's Disease Assessment Scale-Cognitive Subscale (ADAS-Cog), and Clinical Dementia Rating (CDR) scale. Clinical improvement is defined as a numerical change in any of the following forms: an increase in grip strength, an increase in walking distance before losing balance, an increase in MMSE score, an increase in MoCA score, a decrease in ADAS-Cog score, or a decrease in CDR score. Improvement in ability can also be reflected as no decrease or a slower decrease compared to an age-matched population in any of these scores that are expected to continuously decrease, for example, no change in the values of grip strength, walking distance before losing balance, MMSE, MoCA, ADAS-Cog, or CDR. Scores meeting any of the criteria of MMSE of 26 or less, MoCA of 25 or less, ADAS-Cog of 12 or more, or CDR of 0.5 or more are considered cognitive impairment.

[0050] In other embodiments, the effectiveness of a given treatment can be determined by improvement in age-related structural and associated functional changes, which changes can be measured by imaging methods such as, for example, magnetic resonance imaging (MRI), computed tomography (CT), and ultrasound (US). In certain embodiments, the structural changes are measurements that reflect the function of the heart (e.g., cardiac hypertrophy, ventricular ejection fraction), lungs (e.g., total lung volume and / or expiratory volume), kidneys (e.g., volume, renal cortical thickness, blood perfusion), pancreas (e.g., volume, digestive enzyme production capacity), skeletal muscle (muscle, composition), fat (volume, body distribution), liver (volume), spleen (volume), and / or bone tissue (density).

[0051] In certain embodiments, the structural changes in a subject can be a change in the volume of an organ or tissue, i.e., for example, a decrease of 5%, 10%, 15%, 20% or more in, for example, the brain, heart, lungs, kidneys, intestines, pancreas, skeletal muscle, fat, liver, blood, spleen, and / or bone tissue. The age-related decline in these measurements is defined as a change in the numerical values and / or patterns obtained by each imaging or recording method, which is within the extreme values (e.g., upper or lower 5%, 10%, 20%, 25%, 30%) of the distribution of the entire population or group of the same age, or shows a change over time (e.g., 5%, 10%, 15%, 20%, 25% or more) in repeated measurements from the same subject, reflecting a change in the structure of the volume.

[0052] In certain embodiments, the functional changes in a subject can refer to measurable changes in the subject that reflect a changed state of metabolism or organ function. The functional changes in a subject can be measured by imaging methods such as, for example, spirometry, echocardiography (e.g., to test the cardiac ejection fraction), functional magnetic resonance imaging (fMRI), magnetic resonance imaging (MRI), hyperpolarized carbon-13 ( 13 C) magnetic resonance spectroscopic imaging (MRSI), ultrasound (US), positron emission tomography (PET), or single photon emission computed tomography (SPECT).

[0053] In other embodiments, the effectiveness of a given treatment can be determined by improvement in molecular changes associated with aging, and the changes can be evaluated, for example, by measuring gene expression; DNA transcription; RNA translation; the location of DNA, RNA, or protein in cells or tissues; the secretion or release of molecules from tissues or blood fluids such as proteins, DNA, RNA, mitochondria, cellular components, mitochondrial components into blood fluids. The body fluid can be cerebrospinal fluid (CSF), blood, and / or plasma.

[0054] In certain embodiments, the calculation of differentially expressed genes (DEGs) by the magnitude of the change represented by the associated unadjusted P-value, false discovery rate (FDR)-adjusted P-value, and / or natural logarithm fold change (lnFC) can be performed for each cell type. In certain embodiments, the DEGs are those with a P-value < 0.05, preferably an FDR-adjusted P-value < 0.05.

[0055] In certain embodiments, genes that can be evaluated by the subject methods, and their subsequent transcribed mRNAs and translated proteins, are immune response-related genes, such as C1qa, C1qb, C1qc, C4b, B2m, Tap2, H2-D1, H2-K1; synapse modification-related genes, such as Sparcl1, Gpc6, Tgfb2, Megf10, Merktk, Chrdl1; homeostasis function-related genes, such as Kcnj10, Kcnn2, Slc1a2, Slc1a3, Slc6a1, Slc6a9, Slc6a11, Slc7a10, Slc7a11, Slc6a1, Srebf1, Gjb1, Gjb6, Itpr2, Grm3, Gria2, Gabbr1, Gabbr2; homeostasis-related genes in MG cells, such as Csf2r, and P2ry13; immune activity-related genes in MG cells, such as Appe, Ccl3, Ccl4, Cd52, Cst7, Fabp5, Tyrobp, Cd14, Cd33, Ifngr1, Ly86, Map4k4; immune response inhibitory genes in MG cells, such as Cd300a, Il10ra and Il10rb; calcium signaling-related genes in SMCs, such as Camk2g, Stim1, Gsn, Atp2a2, Inpp4b, Mcur1, S100a6, and Tspo; SMC contraction-related genes, such as Mylk, Itga1, Mgh11, and Sorbs1; and cell adhesion and ECM remodeling in SMCs, such as Col1a2, Lamb1, Itga7, Jam3, Lamb2, Itgb1, and Bsg.In certain embodiments, the genes, the subsequently transcribed messenger RNAs, and the translated proteins that can be evaluated by the present method are those expressed in hypothalamic tissues such as, for example, Akr1c14, Ccl28, Atp8b1, Fignl1, Aspa, Gramd3, Trim59, Gm35315, Lpar4, Calcrl, Prrx1, LOC118567992, Zfp979, Ddias, 4930447C04Rik, Zfp938, Ndufb1, Nox1, Hacd4, Slc7a11, Cntf, Cdc42ep2, Sp7, Clec2d, Zfp977, Gadl1, Zfp469, Ada, Hif3a, Zbtb16, Hr, Tekt4, Hspa1b, C2cd4a, Eps8l2, Ppp1r1b, Fbxw23, Cd101, Ripk4, Bdkrb2, Grin2c, Vgll2, Cacng8, Gm20346, Sf3a2, Egr4, Hspa1a, Rsph1, Lamb3, and Ppp1ccb. In certain embodiments, the genes and the subsequently transcribed messenger RNAs that can be evaluated in the present method are those expressed in prefrontal cortex tissues such as, for example, Dynlt1b, Sdhaf4, 1110025M09Rik, 9430078G10Rik, Hmgb3, Bex3, Tmsb10, Myct1, Ccdc116, Dbp, Apcdd1, Rnf122, Map4k1, Mypn, Il17rd, Rtbdn, Gjb2, Slc6a20a, Alx3, Foxd1, Tnxb, Ntsr1, Rab7b, Edn3, Wdr62, Ppp1r3g, Irf3, Klf14, Cryab, Hsph1, Hsp90b1, Hspa5, Hspe1, Plekhg4, Galm, Pcsk1, Rps19bp1, Mt3, Rpl35a, Paqr5, Smim3, Cbln4, Adi1, Anln, Sgpp2, Tm2d3, Rps23rg1, Plagl1, Rtl8b, and Sptssb.In certain embodiments, the genes, subsequently transcribed messenger RNAs, and translated proteins that can be evaluated in the present method are, for example, those expressed in adipose tissue such as Vmn2497, adam6b, Dmrta1, Dbx2, LOC118568475, P2ry10b, Pgap1, Slc9a7, Zbed6, Gm2808, Gm614, Npas4, St18, Gas213, Ankdd1a, Olfr111, Atp6v0d2, Gpnmb, Gm20056, Tm4sf19, Il7r, Ms4a14, Otop1, Klra10, Ryr2, Baiap2l2, Gkn3, Rimklb, Tceal3, Aqp5, Ttc9, Cyp1a1, 2810459M11Rik, Grem2, Slitrk5, Sox10, Acox2, Rsph1, Gm42517, Atp5k, Hbb-bt, Hba-a1, Hbb-bs, Slc2a5, Slc25a1, H2-Q10, Tafa5, Tbx1, Chchd10, and Cox8b. In certain embodiments, the genes, subsequently transcribed messenger RNAs, and translated proteins that can be evaluated in the present method are, for example, those expressed in heart tissue such as Cnksr1, Gck, Aqp8, Hspb1, Hsp90aa1, Wnt4, Col11a2, Cd163l1, Neurl1a, Map3k7cl, Tpm2, Myl9, Tagln, Eva1c, Gmfg, Rap1gap, Sncg, Mylk, Slc8a2, Eps8l2, Prag1, Capn3, Tmem150c, Kcnc1, Vipr1, 2610044O15Rik8, AW551984, Zfp442, Klhl32, Tfrc, Tmem35a, Kcne1, Mlf1, Tmx1, Pirt, Smim3, Fgf9, Vegfc, Tet1, Lrch2, Car8, Klhl4, Gm6712, Meox2, Ifitm1, Lepr, Gm11100, Scgb1c1, Gins1, and Lhx6.In certain embodiments, the genes, subsequently transcribed messenger RNAs, and translated proteins that can be evaluated in the present method are those expressed in large intestine tissues such as, for example, Gm52351, Gdf15, Chac1, Vstm2l, Ms4a2, Cma2, Mcpt9, Fcer1a, Mcpt4, Cpa3, Mcpt1, Mcpt2, Calca, Pbp2, Misp3, Cnbd2, Smin22, H4c9, Atp5k, Hypk, Ndufa2, Timm13, Uqcr11, H4c8, Tmsb10, Abca8a, Acvr1c, Gm39469, Scai, Gucy1a2, Irs1, Frem2, Cntin, Gm10033, Cd36, Scd1, Pi15, Zfp979, Gm8369, Ednrb, Tnfsf10, Hhip, Fam126b, Lrrc19, Phlpp2, Chrm2, Kctd12b, Il18, Cyp2c68, and Hmcn1. In certain embodiments, the genes, subsequently transcribed messenger RNAs, and translated proteins that can be evaluated in the present method are those expressed in skeletal muscle tissues such as, for example, Tnfrsf12a, Cma1, Mcpt4, Dact2, Itgb7, Banp, Nos1ap, Ppp1r14bl, Catsper4, Bmp8a, Phlda1, Slc25a30, Kif26b, Tead4, Chia1, Pifo, Tekt1, Kcnab1, Otub2, Hip1r, Syt9, Pkp2, Shc2, Jchain, Pard6b, Ptx3, Sfxn2, Socs2, Abhd18, Arhgef26, Peg3, Pfkfb3, Fsbp, Mc5r, Ccnf, Chrdl2, Zfp503, 4930563E22Rik, Sqle, Erfe, Cdc14a, Slc7a2, Trp53i11, Bcl6b, Ptger4, Ctla2a, Tspan6, Gpx8, Elovl3, and Fgfbp1.

[0056] In certain embodiments, for example, 3-indolecarboxylic acid glucuronide (HMDB0013189), 6-hydroxy-5-methoxyindole glucuronide (HMDB0010362), Hmba (HMDB0041901), (2e,4e,6e,8e,10e,12e,14e,16e,18e,20e,22e)-2,4,6,8,10,12,14,16,18,20,22-tetracosaundecanal, S-3-oxodecanoyl cysteamine (HMDB0059773), (2e,4e,8z)-n-(2-hydroxy-2-methylpropyl)-2,4,8-tetradecatrienoamide, 4-oxo-1-(3-pyridyl)-1-butanone (HMDB0062406), methipropalin (HMDB0015239), 3,4-dimethylbenzoic acid (HMDB002237), asarone (HMDB0031469), brassicanal A (KEGG ID:C11048), 4-ethyl-2,6-dihydroxyphenyl hydrogen sulfate (HMDB0128030), andrographolide (KEGG ID:C20214), N-acetyl-l-tyrosine (HMDB000866), indole-3-carbinol (HMDB005785), valerophenone (HMDB0031208), 4-tert-amylphenol (KEGG ID:C14205, HMDB0013825), Leu-val (HMDB0028942), 3-[2-(hydroxymethyl)-4-methoxyphenyl]-6-methoxy-4-oxo-3,4-dihydro-1(2H)-quinazolinecarbaldehyde (HMDB0040442), orodaterol, esmolol (KEGG ID:C06980;HMDB0014333), 5-hydroxyindoleacetate (KEGG ID:C05635;HMDB0000763), indole-3-carboxylic acid-o-sulfate (HMDB0060002), or any combination thereof, circulating metabolites in a subject can be evaluated.

[0057] Materials and Methods Animal subject C57BL / 6 mice were provided by the Experimental Animal Service Center of CUHK, maintained at a controlled temperature (22 - 23 °C), subjected to an alternating 12-hour light / dark cycle, and allowed free access to standard mouse diet and water. The ambient humidity was maintained at <70% relative humidity.

[0058] Active GLP-1 measurement Blood samples were collected into EDTA tubes by cardiac puncture. 10 μl / mL of DPP-IV inhibitor (DPP4-M, Sigma-Aldrich, USA) was supplemented to prevent degradation by DPP-IV. Plasma was isolated by centrifugation at 1600×g for 10 minutes at 4 °C. After 3 minutes of perfusion of ice-cold PBS through the heart, the brain was rapidly removed from the skull, and the brainstem (including midbrain, pons, and medulla), hypothalamus, cerebellum, olfactory bulb, spinal cord, and cortex were collected on ice. Tissues from other organs were also collected. All samples were snap-frozen in liquid nitrogen and stored at -80 °C until further analysis. Tissues were homogenized in a Kimble Dounce homogenizer in ice-cold PBS supplemented with 20 μl / mL of DPP-IV inhibitor and then refrozen at -80 °C for at least 24 hours. The homogenate was thawed again on ice and clarified by centrifugation at 5000×g for 10 minutes at 4 °C. Active GLP-1 in the supernatant was determined by the Millipore Active GLP-1 ELISA Kit (EGLP-35K, Sigma-Aldrich, USA). The capture antibody in this kit recognizes only the active form of GLP-1, including GLP-1(7-37) and GLP-1(7-36 amide). The total protein in the supernatant was measured by the BCA kit (23225, Thermo Fisher Scientific, USA).

[0059] Glp1r knockdown Mouse Glp1r was knocked down using a targeting shRNA having the sequence (5’-GCGTCAACTTTCTTATCTTCA-3’; SEQ ID NO: 1). The shRNA was adapted to a miR-30 expression scaffold having an EF1α promoter and packaged into recombinant AAV2 / 9. An AAV containing a scrambled sequence (5’-CCTAAGGTTAAGTCGCCCTCG-3’: SEQ ID NO: 2) was used as a control. Other AAVs were used to express EGFP having the same promoter to demonstrate the infected regions and cell types. Mice were anesthetized by intraperitoneal injection of 150 mg / kg ketamine and 10 mg / kg xylazine and placed on a stereotaxic frame for injection. A total of 1 μL of 5 - 6×10 9 vg (viral genome) virus was injected into the hypothalamus. To maximize the area of infection, the virus was delivered to four sites having coordinates of anterior / posterior (A / P) = -1.6 mm, medial / lateral (M / L) = ±0.25 mm, dorsal / ventral (D / V) = -5.9 mm from the dura (0.2 μL per site), or A / P = -2 mm from the dura, ML = ±0.25 mm, DV = -5.85 mm (0.3 μL per site). Mice were allowed to recover from the injection for 1 month before further treatment.

[0060] Quantitative PCR (qPCR) for measuring Glp1r transcription Mice were sacrificed and perfused transcardially with 20 mL of ice-cold PBS. Brains were removed from the skulls, and individual brain regions were isolated and stored in RNAlater. Total RNA was extracted with TRIzol reagent and converted to cDNA with PrimeScript RT Master Mix (RR036, Takara, USA). qPCR reactions were prepared using TB Green Premix Ex Taq (Tli RNase H Plus) (RR420B, Takara, USA) and performed on a QuantStudio 12K Flex Real-Time PCR system (Thermo Fisher Scientific, USA). Transcription of Glp1r was determined with the following primers: forward 5’-CAGTGGGGTACGCACTTTCT-3’ (SEQ ID NO: 3) and reverse 5’-TAACGAACAGCAGCGGAACT-3’ (SEQ ID NO: 4). Transcription of Gapdh was determined with the following primers: forward 5’-GGCGGAGATGATGACCCTTT-3’ (SEQ ID NO: 5) and reverse 5’-CATCTTCCAGGAGCGAGACC-3’ (SEQ ID NO: 6).

[0061] Treatment For GLP-1RA treatment, exenatide (5 nmol / kg body weight) was administered intraperitoneally (I.P.) daily (volume: 10 mL / kgbw) within the indicated period. For mTORi treatment, rapamycin (8 mg / kgBW) was administered once daily within the indicated period. Control mice were treated with PBS vehicle.

[0062] Forelimb grip strength test Forelimb grip strength was measured using a grip strength meter (model XR501, Shanghai Xin-Ruan Instruments Inc., Shanghai, China). Mice were allowed to grip a mesh grid with their forelimbs. The peak force to pull the mouse away from the gripped state was recorded. Five repeated measurements were performed for each mouse at 15-minute intervals between two tests.

[0063] Rotarod test The rotor rod (Model R03-1, Xin-Ruan Instruments Inc., Shanghai, China) consists of a rod with a diameter of 3 cm. Mice were trained to get used to the rotating rod by walking on it at a low constant speed (4 revolutions per minute (R.P.M.)) for 2 minutes (2 minutes × 3 times in the baseline test, at 15-minute intervals, and 2 minutes × 1 time in the 3-month or 6-month test). Then, the mice were tested using the rotation of the rod that was continuously accelerated from 4 to 40 R.P.M. over 5 minutes. When the mouse could not withstand the rotation and fell off the rod, it was considered to have reached the end point. Mice that resisted falling by gripping on the rod were also treated as having reached the end point.

[0064] Barnes maze test The handmade burns maze was a white acrylic circular disk with a diameter of 90 cm and had 20 holes (5 cm in diameter) evenly spaced on the circumference 5 cm from the outer edge. 19 of the 20 holes were blocked, and the remaining 1 provided access to the escape box. Visual cues were placed around the maze in the laboratory. On the first day, the mice were trained to recognize the escape box. The mice were covered with a cardboard box at the center of the maze. After 5 seconds, an aversive noise was started from a nearby device (900 Hz, 80 db), and the box was removed to allow exploration and escape. Mice that could not find the escape box within 3 minutes were induced to it by a glass cylinder. One hour later, the mice were tested again using the same procedure. From the second day to the fourth day, the mice were tested twice at 1-hour intervals in the same way. Entering the escape box or spending at least 5 seconds in the escape exploration was defined as escape.

[0065] Open field test The size of the open-field arena was 58 cm × 58 cm, and the wall height was 30 cm. Individual mice were able to freely explore the arena in minutes. Video recordings were made by a web camera, obtained from GitHub-HanLab-OSU / MouseActivity, and analyzed by the MouseActivity open-source code implemented in MATLAB® R2021a.

[0066] Tissue collection and RNA extraction Mice were treated with the final administration of exendin-4 in the morning and fasted for 6 hours before death. Mice were euthanized with isoflurane vapor, blood was collected by cardiac puncture, and then the heart was perfused transcardially with ice-cold PBS (15–20 ml). Blood samples were lysed in ice-cold erythrocyte lysis buffer for 20 minutes. White blood cells were separated by centrifugation at 500 × g for 10 minutes. Other tissues collected included the prefrontal cortex, hippocampus, hypothalamus, pancreas, liver, kidney, spleen, gonadal fat, heart (left ventricle), skeletal muscle (quadriceps), large intestine (proximal), and lung. All tissues were stored in RNAlater for further RNA extraction. Total RNA from the prefrontal cortex, hippocampus, hypothalamus, WBC, kidney, and pancreas of aged mice was extracted using the RNAqueous kit (AM1912, Thermo Fisher Scientific, US), and total RNA from other tissues was extracted using Trizol reagent (15596018, Thermo Fisher Scientific, US).

[0067] Bulk RNA sequencing analysis The RNA samples were sent to Novogene (Tianjin, China) for RNA sequencing. The RNA concentration, purity, and integrity were checked by Novogene. Samples passing these quality checks were used for library preparation. mRNA was enriched by polyA selection, and the whole transcriptome was sequenced on the Illumina Hiseq-PE150 platform in a paired-end non-stranded protocol. Quality control of raw reads data, alignment of reads, and quantification of transcripts were performed on a Linux (registered trademark) system (Ubuntu20.04.4 LTS). QC of raw reads and alignment files was performed using the FastQC v.0.11.9 and MultiQC v.1.13a packages. Reads were aligned to the mouse genome reference GRCm39 by using STAR v.2.7.10b with default parameters. Transcript quantification was performed by HTSeq v.2.0.2 with default settings except that the "mode" was set to "intersection-strict" and "nonunique" was set to "fraction" for ambiguous reads. Batch effects were identified and corrected by the removeBatchEffect function of the Limma v.3.52.4 package. Customized R scripts (R v.4.2.2) executed on RStudio 2023.3.0.386 were used for downstream analysis. Differential gene expression (DGE) analysis was performed by DESeq2 v.1.36.0. To remove low-expressed genes, one pseudo count was added, and genes with counts exceeding 5 in at least n samples were retained for further analysis. Here, n was the minimum value of the size of the experimental groups involved (n = 5 for WBC, n = 7 for colon, and n = 8 for other tissues). Count normalization and variance stabilization transformation were performed by the built-in algorithm of DESeq2. The log2 fold change in each comparison was obtained using the apeglm v.1.18.0 package. The corresponding P-values adjusted for the false discovery rate (FDR) were calculated using the default Benjamini-Hochberg method.

[0068] Plasma metabolome profiling Peripheral blood samples were collected into EDTA tubes and processed immediately. Plasma was isolated by centrifuging the blood sample at 1,600×g for 15 minutes at 4°C and stored at -80°C until further assay. To extract metabolites, 100 μl of plasma was combined with 700 μl of extractant containing an internal standard (methanol:acetonitrile:water = 4:2:1, v / v / v), shaken for 1 minute, and left at -20°C for 2 hours. The sample was then rotated at 25,000×g for 15 minutes at 4°C. The supernatant was transferred to a new EP tube and dried with a solvent. The pellet was reconstituted in 180 μL of methanol:water (1:1 v / v) and rotated again at 25,000×g for 15 minutes at 4°C. The resulting supernatant was subjected to LC-MS / MS analysis (Waters UPLC I-Class Plus (Waters, USA) tandem Q-Exactive high-resolution mass spectrometer (Thermo Fisher Scientific, USA)). Metabolites were identified using a BEH C18 column. This column preferentially detects non-polar and medium-polar small molecules. Offline data from mass spectrometry was imported into Compound DiscoverTM 3.3 software (Thermo Fisher Scientific, USA) and analyzed in combination with the BGI metabolome, mzCloud, and ChemSpider online databases. A data matrix containing metabolite identification information and information such as peak areas was obtained for further analysis. The peak areas were normalized by probabilistic quotient normalization (PQN). Batch effects were corrected by robust LOESS signal correction based on quality control as needed. Further analysis and statistical comparison were performed using custom-written code in R and / or Python.

[0069] All patents, patent applications, provisional applications, and publications mentioned or cited in this specification are hereby incorporated by reference in their entirety, including their drawings and tables, to the extent that they do not conflict with the explicit teachings of this specification.

[0070] The following exemplifies the procedures for carrying out the present invention. These examples are not to be regarded as limiting. All percentages are by weight, and all mixing ratios are by volume unless otherwise specified.

[0071] Example 1 Level of Active Hypothalamic GLP-1 Decrease due to Aging in Mice Figures 1A - 1D show the levels of active GLP-1 in various organs across different ages. In accordance with L cells and α cells being the main sources of GLP-1 production in the periphery, the highest levels of active GLP-1 were detected in the large intestine and pancreas. The large intestine GLP-1 in aged mice was slightly lower than that in young mice (average 86.56 vs 93.94, Sidak's multiple comparison test, adjusted P = 0.6447). Conversely, the pancreatic GLP-1 in aged mice was significantly higher than that in young mice (average 59.12 vs 29.35, Sidak's multiple comparison test, adjusted P = 0.0002). The active GLP-1 in the aged kidney also increased slightly, but there was no statistical significance. The active GLP-1 in skeletal muscle was lower compared to other tissues, and there was no significant difference between groups. Central GLP-1 levels were measured in cohorts of 3-month-old, 10-month-old, and 16-month-old mice (Figure 1B). The highest level of active GLP-1 was detected in the hypothalamus. The results showed a bell-shaped hypothalamic GLP-1 level, which increased from 3 months to 10 months and then decreased from 10 months to 15 months (averages were 35.16, 39.74, and 30.09, respectively). Any comparison between the two age groups was significant (two-way ANOVA, Sidak's multiple comparison test, adjusted P < 0.0001). In the other brain regions tested, there was no age-related difference in the active GLP-1 level. Central GLP-1 levels were further measured in other cohorts of 3-month-old or 30-month-old mice (Figure 1C). Tissues were collected from the olfactory bulb (OB), cortex (CTX), hypothalamus (HTH), brainstem (BS), cerebellum (CRB), and spinal cord (vertebra). Hypothalamic GLP-1 decreased dramatically in aged mice (average 13.05 vs 35.11, two-way ANOVA, Sidak's multiple comparison test, adjusted P < 0.0001). Plasma GLP-1 was very low, and there was no significant difference between the two groups (Figure 1D).

[0072] Example 2 Effect of 6 - month exenatide treatment on body weight and food intake in aged mice Body weight and food intake were monitored during the treatment period (Figures 2A - 2B). Two - way RM ANOVA analysis showed only a significant time effect on BW (time effect P = 0.0007; treatment effect P = 0.4368; interaction P = 0.1508; post - hoc Sidak test showed no significant differences at any individual time points). The daily food intake was not significantly affected by the treatment.

[0073] Example 3 Improvement of exercise ability in aged mice by 6 - month exenatide treatment Exercise ability was measured by forelimb grip strength, accelerating rotarod latency, and open field (Figures 3A, 3B, and 3D). Mice in the treatment group showed significant improvement in forelimb grip strength and rotarod performance. No significant effect was observed in the open field test.

[0074] Example 4 Improvement of spatial reference memory in aged mice by 6 - month exenatide treatment The Barnes maze task relies on the innate preference of rodents for a closed space that is darker than the open area (Non - Patent Document 21). This task requires the mice being tested to learn the location of the escape hole by using some spatial reference. The performance was significantly improved by exenatide treatment (Figure 3C, treatment effect: P = 0.0032).

[0075] Example 5 Decrease in the mass of gonadal adipose tissue in aged mice by 6 - month exenatide treatment The mass of the collected gonadal adipose tissue was measured when the mice were euthanized at the endpoint. Exenatide treatment significantly decreased the gonadal fat mass - to - body weight ratio (Figure 4A, P = 7.7×10 - 4). In contrast, fasting blood glucose did not change with the treatment (Figure 4B).

[0076] Example 6 Improvement of transcriptome changes throughout the body of aged mice associated with aging by 6 - month exenatide One was between the aging-vehicle group and the young group, and the other was between the aging-exenatide group and the aging-vehicle group, comparing gene expression levels. The identified DEGs (differentially expressed genes) showed a significant negative correlation between these two comparisons in tissues of organs including the hypothalamus, adipose tissue, heart, prefrontal cortex, large intestine, and skeletal muscle (Figs. 5-10). An example of the top DEGs associated with aging improved by exenatide is shown in the heat map.

[0077] DEGs were classified into six categories according to the direction of change and the magnitude of the effect. Category 1: Deterioration, i.e., the expression of genes in this classification was significantly increased or decreased in the aging-vehicle group compared to the young group, and exenatide treatment resulted in a statistically significant change in the same direction (deterioration). Category 2: Deterioration (aging dominance), i.e., the expression of genes in this classification was significantly increased or decreased in the aging-vehicle group compared to the young group, and exenatide treatment resulted in a change in the same direction but was not statistically significant. Category 3: Deterioration (Rx dominance), i.e., the expression of genes in this classification increased or decreased in the aging-vehicle group compared to the young group, but there was no significant difference, and exenatide treatment statistically significantly worsened the change. Category 4: Improvement, i.e., the expression of genes in this classification was significantly increased or decreased in the aging-vehicle group compared to the young group, while exenatide treatment statistically significantly resulted in a change in the opposite direction (improvement). Category 5: Improvement (aging dominance), i.e., the expression of genes in this classification was significantly increased or decreased in the aging-vehicle group compared to the young group, and this change was not statistically significant but was improved by exenatide. Category 6: Improvement (Rx dominance), i.e., the expression of genes in this classification increased or decreased in the aging-vehicle group compared to the young group, was not statistically significant, but this change was significantly improved by exenatide. Fig. 11 shows that in most tissues, most of the DEGs belong to the improvement category (including both aging dominance and Rx dominance).

[0078] Example 7: Minimal effect of 6 - month exenatide treatment on young adult mice Young adult mice treated with exenatide had significantly lower body weights, with a maximum difference of approximately 12% (Figures 12A - 12B, two - way RMANOVA, treatment effect P = 0.0121). The daily food intake was not significantly affected by the treatment (Figures 12A - 12B). Exenatide treatment did not affect the forelimb grip strength (Figure 13A), but the performance of the mice improved in the rotarod (Figure 13B) and open field (Figure 13D). The Barnes maze showed no difference in the treatment effect, but there was a significant interaction effect between treatment and assay day (Figure 13C). Treatment resulted in a significant decrease in gonadal fat mass (Figure 14A), but had little effect on fasting blood glucose (Figure 14B).

[0079] Example 8: Improvement of age - associated global transcriptome changes in aged mice by 3 - month exenatide treatment Starting at 18 months of age and continuing for 3 months, another cohort of aged mice was treated with exenatide. The transcriptomes of the hippocampus, prefrontal cortex, circulating white blood cells (WBC), heart, and skeletal muscle were profiled. Even with this short - term treatment plan, exenatide showed a significant and statistically significant anti - aging effect, as shown in Figure 15.

[0080] Example 9: Transcriptome anti - aging effect of exenatide in some organs comparable to rapamycin In conjunction with the experiment described in Example 8, another group of aged mice was treated with the mTOR inhibitor (mTORi), rapamycin, a well - studied potential anti - aging agent. Rapamycin showed a significant and statistically significant anti - aging effect as demonstrated by the transcriptomes of the hippocampus, prefrontal cortex, circulating WBC, heart, and skeletal muscle (Figure 16). Furthermore, DEGs common to both exenatide and rapamycin treatments were identified. These DEGs showed a high level of agreement regarding the direction and magnitude of their changes, indicating comparable correlated treatment effects between exenatide and rapamycin (Figure 17).

[0081] Example 10 Transcriptome anti-aging effect of exenatide sensitive to hypothalamic GLP-1R knockdown In addition to the experiment described in Example 8, in a further group of aging mice, the hypothalamic GLP-1R was knocked down. The knockdown efficiency is shown in FIG. 18. By comparing the transcriptome changes in these knockdown mice, the effect of hypothalamic GLP-1R on the treatment effect was examined. As shown in FIG. 19, the treatment effect showed a significant decrease in the prefrontal cortex, circulating WBC, heart, and skeletal muscle after knockdown of the hypothalamic GLP-1R. However, for the treatment effect on the hippocampus, the effect of GLP-1R knockdown was relatively small.

[0082] Example 11 Treatment effect on circulating metabolites After 6 months of exenatide treatment, a dramatic improvement in circulating metabolites was observed (FIG. 20A). However, for a treatment period shorter than 3 months, the improvement effect was not so significant (FIG. 20B). When the hypothalamic GLP-1R was knocked down, the improvement effect was partially weakened (FIGS. 20C-20D). In addition to exenatide, aging mice treated with rapamycin also showed a strong improvement in circulating metabolites (FIG. 20E). The changes in circulating metabolites induced by exenatide treatment were positively correlated with those by rapamycin treatment (FIG. 20F).

[0083] The examples and embodiments described herein are for illustrative purposes only, and various modifications or changes suggested thereby to those skilled in the art are also understood to be included within the spirit and scope of this application and the scope of the appended claims. Further, the elements or limitations of the invention or its embodiments disclosed herein can be combined with all other elements or limitations (individually or in any combination) disclosed herein or with other inventions or their embodiments, and all such combinations are envisioned within the scope of the invention without limitation thereto.

[0084] Exemplary embodiments A method for reducing age - associated functional changes in a subject, comprising administering to the subject an effective amount of a glucagon - like peptide 1 receptor agonist (GLP - 1RA), wherein the GLP - 1RA is selected from the group consisting of exenatide, liraglutide, lixisenatide, albiglutide, dulaglutide, semaglutide, taspoglutide, PF - 06882961, OWL - 833, TTP - 273, LY3502970, derivatives of exenatide, derivatives of liraglutide, derivatives of lixisenatide, derivatives of albiglutide, derivatives of dulaglutide, derivatives of semaglutide, derivatives of taspoglutide, derivatives of PF - 06882961, derivatives of OWL - 833, derivatives of TTP - 273, and derivatives of LY3502970. The method according to embodiment 1, wherein the subject is a mammalian animal. The method according to embodiment 2, wherein the mammalian animal is a primate animal. The method according to embodiment 3, wherein the primate animal is a human. The method according to embodiment 1, wherein the subject is 50 years of age or older. The method according to embodiment 1, wherein the age - associated functional change is a decrease in muscle strength, balance, muscle endurance, or any combination thereof. The method according to embodiment 1, wherein the age - associated functional change is a decrease in cardiac ejection fraction. The method according to embodiment 1, wherein the age - associated functional change is cognitive impairment. The method according to embodiment 1, wherein the age - associated functional change is a measurable change in colonic activity, adipose tissue mass, circulating white blood cell mass, splenic activity, pulmonary airflow, skeletal muscle activity, cardiac activity, hepatic activity, renal activity, or any combination thereof. The method according to embodiment 9, wherein the measurable change is measured by a functional imaging or recording method. The functional imaging or recording method is spirometry, echocardiography, functional magnetic resonance imaging (fMRI), magnetic resonance imaging (MRI), hyperpolarized carbon - 13 (13 C) The method according to embodiment 10, which is magnetic resonance spectroscopic imaging (MRSI), ultrasound examination (US), positron emission tomography (PET), single photon emission computed tomography (SPECT), electroencephalogram examination (EEG), magnetoencephalogram examination (MEG), functional near-infrared spectroscopy (fNIRS), intracortical electrode recording, or deep brain electrode recording. Embodiment 12 The derivative of exenatide is an exenatide-antibody conjugate, an exenatide-peptide conjugate, an exenatide-nucleotide conjugate, or an exenatide-polyethylene glycol conjugate, The derivative of liraglutide is a liraglutide-antibody conjugate, a liraglutide-peptide conjugate, a liraglutide-nucleotide conjugate, or a liraglutide-polyethylene glycol conjugate, The derivative of lixisenatide is a lixisenatide-antibody conjugate, a lixisenatide-peptide conjugate, a lixisenatide-nucleotide conjugate, or a lixisenatide-polyethylene glycol conjugate, The derivative of albiglutide is an albiglutide-antibody conjugate, an albiglutide-peptide conjugate, an albiglutide-nucleotide conjugate, or an albiglutide-polyethylene glycol conjugate, The derivative of dulaglutide is a dulaglutide-antibody conjugate, a dulaglutide-peptide conjugate, a dulaglutide-nucleotide conjugate, or a dulaglutide-polyethylene glycol conjugate, The derivative of semaglutide is a semaglutide-antibody conjugate, a semaglutide-peptide conjugate, a semaglutide-nucleotide conjugate, or a semaglutide-polyethylene glycol conjugate, The derivative of taspoglutide is a taspoglutide-antibody conjugate, a taspoglutide-peptide conjugate, a taspoglutide-nucleotide conjugate, or a taspoglutide-polyethylene glycol conjugate, The derivative of PF-06882961 is a PF-06882961-antibody conjugate, a PF-06882961-peptide conjugate, a PF-06882961-nucleotide conjugate, or a PF-06882961-polyethylene glycol conjugate, The derivative of OWL-833 is an OWL-833-antibody conjugate, an OWL-833-peptide conjugate, an OWL-833-nucleotide conjugate, or an OWL-833-polyethylene glycol conjugate, The derivative of TTP-273 is a TTP-273-antibody conjugate, a TTP-273-peptide conjugate, a TTP-273-nucleotide conjugate, or a TTP-273-polyethylene glycol conjugate, or The derivative of LY3502970 is a LY3502970-antibody conjugate, a LY3502970-peptide conjugate, a LY3502970-nucleotide conjugate, or a LY3502970-polyethylene glycol conjugate, the method according to claim 1. Embodiment 13 The functional change associated with aging is a change in the expression of at least one gene in the subject, the method according to embodiment 1. Embodiment 14 The functional change associated with aging is a change in the level of at least one circulating metabolite in the subject, the method according to embodiment 1. Embodiment 15 The at least one gene is C1qa, C1qb, C1qc, C4b, B2m, Tap2, H2-D1, H2-K1, Sparcl1, Gpc6, Tgfb2, Megf10, Mertk, Chrdl1, Kcnj10, Kcnn2, Slc1a2, Slc1a3, Slc6a1, Slc6a9, Slc6a11, Slc7a10, Slc7a11, Slc16a1, Srebf1, Gja1, Gjb6, Itpr2, Grm3, Gria2, Gabbr1, Gabbr2, Csf2r, P2ry13, Appe, Ccl3, Ccl4, Cd52, Cst7, Fabp5, Tyrobp, Cd14, Cd33, Ifngr1, Ly86, Map4k4, Cd300a, Il10ra, Il10rb, Camk2g, Stim1, Gsn, Atp2a2, Inpp4b, Mcur1, S100a6, Tspo, Mylk, Itga1, Mgh11, Sorbs1, Col1a2, Lamb1, Itga7, Jam3, Lamb2, Itgb1, Bsg, Akr1c14, Ccl28, Atp8b1, Fignl1, Aspa, Gramd3, Trim59, Gm35315, Lpar4, Calcrl, Prrx1, LOC118567992, Zfp979, Ddias, 4930447C04Rik, Zfp938, Ndufb1, Nox1, Hacd4, Slc7a11, Cntf, Cdc42ep2, Sp7, Clec2d, Zfp977, Gadl1, Zfp469, Ada, Hif3a, Zbtb16, Hr, Tekt4, Hspa1b, C2cd4a, Eps8l2, Ppp1r1b, Fbxw23, Cd101, Ripk4, Bdkrb2, Grin2c, Vgll2, Cacng8, Gm20346, Sf3a2, Egr4, Hspa1a, Rsph1, Lamb3, Ppp1ccb, Dynlt1b, Sdhaf4, 1110025M09Rik, 9430078G10Rik, Hmgb3, Bex3, Tmsb10, Myct1, Ccdc116, Dbp, Apcdd1, Rnf122, Map4k1, Mypn, Il17rd, Rtbdn, Gjb2, Slc6a20a, Alx3, Foxd1, Tnxb, Ntsr1, Rab7b, Edn3, Wdr62, Ppp1r3g, Irf3, Klf14, Cryab, Hsph1, Hsp90b1, Hspa5, Hspe1,Plekhg4, Galm, Pcsk1, Rps19bp1, Mt3, Rpl35a, Paqr5, Smim3, Cbln4, Adi1, Anln, Sgpp2, Tm2d3, Rps23rg1, Plagl1, Rtl8b, Sptssb, Vmn2497, adam6b, Dmrta1, Dbx2, LOC118568475, P2ry10b, Pgap1, Slc9a7, Zbed6, Gm2808, Gm614, Npas4, St18, Gas213, Ankdd1a, Olfr111, Atp6v0d2, Gpnmb, Gm20056, Tm4sf19, Il7r, Ms4a14, Otop1, Klra10, Ryr2, Baiap2l2, Gkn3, Rimklb, Tceal3, Aqp5, Ttc9, Cyp1a1, 2810459M11Rik, Grem2, Slitrk5, Sox10, Acox2, Rsph1, Gm42517, Atp5k, Hbb-bt, Hba-a1, Hbb-bs, Slc2a5, Slc25a1, H2-Q10, Tafa5, Tbx1, Chchd10, Cox8b, Cnksr1, Gck, Aqp8, Hspb1, Hsp90aa1, Wnt4, Col11a2, Cd163l1, Neurl1a, Map3k7cl, Tpm2, Myl9, Tagln, Eva1c, Gmfg, Rap1gap, Sncg, Mylk, Slc8a2, Eps8l2, Prag1, Capn3, Tmem150c, Kcnc1, Vipr1, 2610044O15Rik8, AW551984, Zfp442, Klhl32, Tfrc, Tmem35a, Kcne1, Mlf1, Tmx1, Pirt, Smim3, Fgf9, Vegfc, Tet1, Lrch2, Car8, Klhl4, Gm6712, Meox2, Ifitm1, Lepr, Gm11100, Scgb1c1, Gins1, Lhx6, Gm52351, Gdf15, Chac1, Vstm2l, Ms4a2, Cma2, Mcpt9, Fcer1a, Mcpt4, Cpa3, Mcpt1, Mcpt2, Calca, Pbp2, Misp3, Cnbd2, Smin22, H4c9, Atp5k, Hypk, Ndufa2, Timm13, Uqcr11, H4c8, Tmsb10, Abca8a, Acvr1c, Gm39469, Scai, Gucy1a2, Irs1, Frem2, Cntin, Gm10033, Cd36The method according to embodiment 13, which is Scd1, Pi15, Zfp979, Gm8369, Ednrb, Tnfsf10, Hhip, Fam126b, Lrrc19, Phlpp2, Chrm2, Kctd12b, Il18, Cyp2c68, Hmcn1, Tnfrsf12a, Cma1, Mcpt4, Dact2, Itgb7, Banp, Nos1ap, Ppp1r14bl, Catsper4, Bmp8a, Phlda1, Slc25a30, Kif26b, Tead4, Chia1, Pifo, Tekt1, Kcnab1, Otub2, Hip1r, Syt9, Pkp2, Shc2, Jchain, Pard6b, Ptx3, Sfxn2, Socs2, Abhd18, Arhgef26, Peg3, Pfkfb3, Fsbp, Mc5r, Ccnf, Chrdl2, Zfp503, 4930563E22Rik, Sqle, Erfe, Cdc14a, Slc7a2, Trp53i11, Bcl6b, Ptger4, Ctla2a, Tspan6, Gpx8, Elovl3, or Fgfbp1. Embodiment 16 The at least one circulating metabolite is 3 - indolecarboxylic acid glucuronide, 6 - hydroxy - 5 - methoxyindole glucuronide, Hmba, (2e,4e,6e,8e,10e,12e,14e,16e,18e,20e,22e)-2,4,6,8,10,12,14,16,18,20,22 - tetracosaundecanal, S - 3 - oxodecanoyl cysteamine, (2e,4e,8z)-n-(2 - hydroxy - 2 - methylpropyl)-2,4,8 - tetradecatrieneamide, 4 - oxo - 1-(3 - pyridyl)-1 - butanone, methylprilone, 3,4 - dimethylbenzoic acid, asarone, brassicanal A, 4 - ethyl - 2,6 - dihydroxyphenyl hydrogen sulfate, andrographolide, N - acetyl - l - tyrosine, indole - 3 - carbinol, valerophenone, 4 - tert - amylphenol, Leu - val, 3 - [2 - (hydroxymethyl)-4 - methoxyphenyl]-6 - methoxy - 4 - oxo - 3,4 - dihydro - 1(2h)-quinazolinecarbaldehyde, orodaterol, esmolol, 5 - hydroxyindole acetate or indole - 3 - carboxylic acid - o - sulfate, the method of embodiment 14.

[0085] Brief description of the sequences Sequence number 1: shRNA target Glp1r GCGTCAACTTTCTTATCTTCA Sequence number 2: Scrambled sequence CCTAAGGTTAAGTCGCCCTCG Sequence number 3: Glp1r primer CAGTGGGGTACGCACTTTCT Sequence number 4: Glp1r primer TAACGAACAGCAGCGGAACT Sequence number 5: Gapdh primer GGCGGAGATGATGACCCTTT Sequence number 6: Gapdh primer CATCTTCCAGGAGCGAGACC

Claims

1. A method for reducing functional changes associated with aging in a subject, comprising administering to the subject an effective amount of a glucagon-like peptide 1 receptor agonist (GLP-1RA), wherein the GLP-1RA is selected from the group consisting of exenatide, liraglutide, lixisenatide, albiglutide, dulaglutide, semaglutide, taspoglutide, PF-06882961, OWL-833, TTP-273, LY3502970, derivatives of exenatide, derivatives of liraglutide, derivatives of lixisenatide, derivatives of albiglutide, derivatives of dulaglutide, derivatives of semaglutide, derivatives of taspoglutide, derivatives of PF-06882961, derivatives of OWL-833, derivatives of TTP-273, and derivatives of LY3502970.

2. The method according to claim 1, wherein the subject is a mammalian animal.

3. The method according to claim 2, wherein the mammalian animal is a primate animal.

4. The method according to claim 3, wherein the primate animal is a human.

5. The method according to claim 1, wherein the subject is 50 years of age or older.

6. The method according to claim 1, wherein the functional changes associated with aging are a decrease in muscle strength, balance, muscle endurance, or any combination thereof.

7. The method according to claim 1, wherein the functional changes associated with aging are a decrease in cardiac ejection fraction.

8. The method according to claim 1, wherein the functional changes associated with aging are cognitive impairment.

9. The method according to claim 1, wherein the functional changes associated with aging are measurable changes in colonic activity, adipose tissue mass, circulating white blood cell mass, spleen activity, pulmonary airflow, skeletal muscle activity, cardiac activity, liver activity, kidney activity, or any combination thereof.

10. The method according to claim 9, wherein the measurable changes are measured by a functional imaging or recording method.

11. The functional imaging or recording method is spirometry, echocardiography, functional magnetic resonance imaging (fMRI), magnetic resonance imaging (MRI), hyperpolarized carbon-13 ( １３ C) magnetic resonance spectroscopic imaging (MRSI), ultrasound examination (US), positron emission tomography (PET), single photon emission computed tomography (SPECT), electroencephalogram examination (EEG), magnetoencephalogram examination (MEG), functional near-infrared spectroscopy (fNIRS), intracortical electrode recording, or deep brain electrode recording, and the method according to claim 10.

12. The derivative of exenatide is an exenatide-antibody conjugate, an exenatide-peptide conjugate, an exenatide-nucleotide conjugate, or an exenatide-polyethylene glycol conjugate, The derivative of liraglutide is a liraglutide-antibody conjugate, a liraglutide-peptide conjugate, a liraglutide-nucleotide conjugate, or a liraglutide-polyethylene glycol conjugate, The derivative of the above liraglutide is a liraglutide-antibody conjugate, a liraglutide-peptide conjugate, a liraglutide-nucleotide conjugate, or a liraglutide-polyethylene glycol conjugate, The derivative of the above albiglutide is an albiglutide-antibody conjugate, an albiglutide-peptide conjugate, an albiglutide-nucleotide conjugate, or an albiglutide-polyethylene glycol conjugate, The derivative of the above dulaglutide is a dulaglutide-antibody conjugate, a dulaglutide-peptide conjugate, a dulaglutide-nucleotide conjugate, or a dulaglutide-polyethylene glycol conjugate, The derivative of the above semaglutide is a semaglutide-antibody conjugate, a semaglutide-peptide conjugate, a semaglutide-nucleotide conjugate, or a semaglutide-polyethylene glycol conjugate, The derivative of the above taspoglutide is a taspoglutide-antibody conjugate, a taspoglutide-peptide conjugate, a taspoglutide-nucleotide conjugate, or a taspoglutide-polyethylene glycol conjugate, The derivative of the above PF-06882961 is a PF-06882961-antibody conjugate, a PF-06882961-peptide conjugate, a PF-06882961-nucleotide conjugate, or a PF-06882961-polyethylene glycol conjugate, The derivative of the above OWL-833 is an OWL-833-antibody conjugate, an OWL-833-peptide conjugate, an OWL-833-nucleotide conjugate, or an OWL-833-polyethylene glycol conjugate, The derivative of the above TTP-273 is a TTP-273-antibody conjugate, a TTP-273-peptide conjugate, a TTP-273-nucleotide conjugate, or a TTP-273-polyethylene glycol conjugate, or The method according to claim 1, wherein the derivative of LY3502970 is an LY3502970-antibody conjugate, an LY3502970-peptide conjugate, an LY3502970-nucleotide conjugate, or an LY3502970-polyethylene glycol conjugate.

13. The method according to claim 1, wherein the functional change associated with aging is a change in the expression of at least one gene in the subject.

14. The method according to claim 1, wherein the functional change associated with aging is a change in the level of at least one circulating metabolite in the subject.

15. The at least one gene is C1qa, C1qb, C1qc, C4b, B2m, Tap2, H2-D1, H2-K1, Sparcl1, Gpc6, Tgfβ2, Megf10, MerTK, Chrdl1, Kcnj10, Kcnn2, Slc1a2, Slc1a3, Slc6a1, Slc6a9, Slc6a11, Slc7a10, Slc7a11, Slc16a1, SrebF1, Gja1, Gjb6, Itpr2, Grm3, GluA2, Gabbr1, Gabbr2, CSF2R, P2ry13, Appe, Ccl3, Ccl4, Cd52, Cst7, Fabp5, TYROBP, Cd14, Cd33, Ifngr1, Ly86, Map4k4, Cd300a, Il10ra, Il10rb, Camk2g, Stim1, Gsn, Atp2a2, Inpp4b, Mcur1, S100a6, TSPO, MyLK, Itga1, Mgh11, Sorbs1, Col1a2, Lamb1, Itga7, Jam3, Lamb2, Itgb1, Bsg, Akr1c14, Ccl28, Atp8b1, Fignl1, Aspa, GranD3, TRIM59, Gm35315, Lpar4, CalcrL, Prrx1, LOC118567992, Zfp979, DdiAS, 4930447C04Rik, Zfp938, Ndufb1, Nox1, Hacd4, Slc7a11, CNTF, Cdc42ep2, Sp7, Clec2d, Zfp977, Gadl1, Zfp469, Ada, Hif3a, Zbtb16, Hr, Tekt4, Hspa1b, C2cd4a, Eps8l2, Ppp1r1b, Fbxw23, Cd101, Ripk4, BDKRB2, Grin2c, Vgll2, Cacng8, Gm20346, Sf3a2, Egr4, Hspa1a, Rsph1, Lamb3, Ppp1ccb, Dynlt1b, Sdhaf4, 1110025M09Rik, 9430078G10Rik, Hmgb3, Bex3, Tmsb10, Myct1, Ccdc116, Dbp, ApcdD1, Rnf122, Map4k1, Mypn, Il17rd, Rtbdn, Gjb2, Slc6a20a, Alx3, Foxd1, Tnxb, Ntsr1, Rab7b, Edn3, Wdr62, Ppp1r3g, Irf3, Klf14, Cryab, Hsph1, Hsp90b1, Hspa5, Hspe1, Plekhg4,Gal m, Pcs k1, Rps 19bp1, Mt3, Rpl 35a, Paqr5, Smim3, Cbln4, Adi1, Anln, Sgpp2, Tm2d3, Rps 23rg1, Plagl1, Rtl8b, Sptssb, Vmn2497, adam6b, Dmrt a1, Dbx2, LOC118568475, P2ry10b, Pgap1, Slc9a7, Zbed6, Gm2808, Gm614, Npas4, St18, Gas213, Ankdd1a, Olfr111, Atp6v0d2, Gpnmb, Gm20056, Tm4sf19, Il7r, Ms4a14, Otop1, Klra10, Ryr2, Baiap2l2, Gkn3, Rimklb, Tceal3, Aqp5, Ttc9, Cyp1a1, 2810459M11Rik, Grem2, Slitrk5, Sox10, Acox2, Rsph1, Gm42517, Atp5k, Hbb - bt, Hba - a1, Hbb - bs, Slc2a5, Slc25a1, H2 - Q10, Tafa5, Tbx1, Chchd10, Cox8b, Cnksr1, Gck, Aqp8, Hspb1, Hsp90aa1, Wnt4, Col11a2, Cd163l1, Neur1a, Map3k7cl, Tpm2, Myl9, Tagln, Eva1c, Gmfg, Rap1gap, Sncg, Mylk, Slc8a2, Eps8l2, Prag1, Capn3, Tmem150c, Kcnc1, Vipr1, 2610044O15Rik8, AW551984, Zfp442, Klhl32, Tfrc, Tmem35a, Kcne1, Mlf1, Tmx1, Pirt, Smim3, Fgf9, Vegfc, Tet1, Lrch2, Car8, Klhl4, Gm6712, Meox2, Ifitm1, Lepr, Gm11100, Scgb1c1, Gins1, Lhx6, Gm52351, Gdf15, Chac1, Vstm2l, Ms4a2, Cma2, Mcpt9, Fcer1a, Mcpt4, Cpa3, Mcpt1, Mcpt2, Calca, Pbp2, Missp3, Cnbd2, Sm in22, H4c9, Atp5k, Hypk, Ndufa2, Tim m13, Uqcr11, H4c8, Tmsb10, Abca8a, Acvr1c, Gm39469, Scai, Gucy1a2, Irs1, Frem2, Cont in, Gm10033, Cd36, Scd1, Pi15,The method according to claim 13, wherein it is Zfp979, Gm8369, Ednrb, Tnfsf10, Hhip, Fam126b, Lrrcl9, Phlpp2, Chrrm2, Kctd12b, Il18, Cyp2c68, Hmcn1, Tnfrsf12a, Cma1, Mcpt4, Dact2, Itgb7, Banp, Noslap, Ppp1r14bl, Catsper4, Bmp8a, Phlda1, Slc25a30, Kif26b, Tead4, Chial, Pifo, Tekt1, Kcnab1, Otub2, Hip1r, Syt9, Pkp2, Shc2, Jchain, Pard6b, Ptx3, Sfxn2, Socs2, Abhd18, Arhgef26, Peg3, Pfkfb3, Fsbp, Mc5r, Ccnf, Chrdl2, Zfp503, 4930563E22Rik, Sql, Erfe, Cdc14a, Slc7a2, Trp53i11, Bcl6b, Ptger4, Cta2a, Tspan6, Gpx8, Elovl3, or Fgfblp1.

16. The at least one circulating metabolite is 3-indolecarboxylic acid glucuronide, 6-hydroxy-5-methoxyindole glucuronide, Hmba, (2e,4e,6e,8e,10e,12e,14e,16e,18e,20e,22e)-2,4,6,8,10,12,14,16,18,20,22-tetracosaundecanal, S-3-oxodecanoyl cysteamine, (2e,4e,8z)-n-(2-hydroxy-2-methylpropyl)-2,4,8-tetradecatrienamide, 4-oxo-1-(3-pyridyl)-1-butanone, methylprilone, 3,4-dimethylbenzoic acid, asarone, brassicanal A, 4-ethyl-2,6-dihydroxyphenyl hydrogen sulfate, andrographolide, N-acetyl-l-tyrosine, indole-3-carbinol, valerophenone, 4-tert-amylphenol, Leu-val, 3-[2-(hydroxymethyl)-4-methoxyphenyl]-6-methoxy-4--oxo-3,4-dihydro-1(2h)-quinazolinecarbaldehyde, orodaterol, esmolol, 5-hydroxyindole acetate, or indole-3-carboxylic acid-o-sulfate, according to the method of claim 14.

Images