Engineered dual binding antibodies and uses thereof
Engineered bispecific antibodies targeting IL-13 and TSLP provide a therapeutic solution for allergic and respiratory conditions by inhibiting cytokine signaling, addressing the unmet need in existing treatments.
Patent Information
- Application Number
- JP2025066629
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-01-20
- Filing Date
- 2025-04-15
- Publication Date
- 2025-07-03
AI Technical Summary
There is an unmet need for compositions and methods to treat diseases and conditions induced by IL-13 and TSLP activation, such as allergic and respiratory conditions including asthma, as existing treatments do not effectively target these cytokines.
Development of engineered bispecific antibodies that bind to IL-13 and TSLP, comprising specific complementarity determining regions (CDRs) with defined amino acid sequences, which can be produced using nucleic acid constructs and expressed in host cells to inhibit IL-13 and TSLP signaling pathways.
The engineered bispecific antibodies effectively inhibit IL-13 and TSLP signaling, providing therapeutic benefits for allergic and respiratory conditions by reducing inflammation and improving symptoms in asthma and other related diseases.
Smart Images

Figure 2025100730000046 
Figure 2025100730000047 
Figure 2025100730000048
Abstract
Description
Technical Field
[0001] Statement Regarding Sequence Listing This application includes a sequence listing submitted electronically in ASCII format, which is hereby incorporated by reference in its entirety. The ASCII copy created on May 25, 2022, is named P-605548-PC.txt and is 14.8 kilobytes in size.
[0002] The present disclosure generally relates to bispecific antibodies that bind to IL-13 and TSLP. In one embodiment, the antibodies can be used to treat allergic or respiratory conditions.
Background Art
[0003] IL-13 is a monomeric protein of the class I cytokine with a molecular weight of 12.3 kDa. IL-13 has the typical four alpha-helix bundle core topology of class I short-chain cytokines. Its structure is similar to that of its closely related cytokine IL-4, with low sequence identity but high structural identity. Together with IL-4, IL-13 has been shown to control immunoglobulin class switching to IgE in B cells and is involved in the recruitment of mast cells. IL-13 is secreted by CD4 + Th2 cells, as well as type 2 innate lymphoid cells ILC2. It has been shown that IL-13 can induce the production of (TGF-β) and induce gene expression of MUC5AC and mucus production in bronchial epithelial cells. IL-13 can also enhance contraction in smooth bronchial muscle cells. IL-13 binds to the IL-4Ra / IL-13Ra1 heterodimeric complex, and upon binding, it induces the JAK signal transducer and STAT6-dependent signaling cascade, which then induces Th2 helper T cell differentiation, macrophage polarization to the M2 "alternatively activated" phenotype, epithelial mucus production, smooth muscle contractility, and chemokine release.
[0004] IL-13 has been shown to be involved in the defense against parasites. In knockout IL-13 mouse models, clearance of Necator americanus was shown to be significantly delayed. Also, expulsion of Trichuris muris was completely inhibited despite an intact Th2 response. Further studies have shown that IL-13 is a double-edged sword, playing an important role in defense against parasites, while IL-13 function in the context of immune dysregulation is also known.
[0005] IL-13 is involved in the etiology of human asthma as increased levels of IL-13 mRNA and protein have been detected in the lungs of asthmatic patients and correlate with disease severity. Furthermore, human IL-13 gene polymorphisms leading to increased IL-13 levels have been identified and are associated with asthma and atopy, and increased IL-13 levels have been detected in the lungs of asthmatic patients.
[0006] IL-13 and IL-4 share similar receptors and signaling pathways, but IL-13 has a distinct role in asthma independent of IL-4. In mouse models, administration of IL-13 alone has been shown to be sufficient to induce eosinophil-derived inflammation and mucous cell hyperplasia. Furthermore, specific blockade of IL-13 but not IL-4 is sufficient to reverse airway hyperreactivity and mucus production in mouse models. Additionally, polymorphisms in the human IL-13 locus are known to be associated with high susceptibility to asthma.
[0007] Therefore, specific inhibition of IL-13 signaling may have a positive therapeutic effect in asthmatic patients or patients with other known allergic or respiratory conditions.
[0008] Thymic stromal lymphopoietin (TSLP) is a cytokine that signals through a heterodimeric receptor consisting of the IL-7Rα subunit and TSLP-R, which has homology to the common γ receptor-like chain. TSLP is expressed by epithelial cells of the thymus, lung, skin, intestine, and tonsils, as well as airway smooth muscle cells, lung fibroblasts, and stromal cells. These cells produce TSLP in response to pro-inflammatory stimuli, and TSLP elicits an allergic inflammatory response through its activity on a number of innate immune cells, including dendritic cells. TSLP can also promote the proliferation of naive T cells and lead to their differentiation into Th2 cells that express high levels of IL-4, IL-5, and IL-13. High levels of TSLP expression have been found in asthmatic lung epithelial cells and in chronic atopic dermatitis lesions, suggesting a role for TSLP in allergic inflammation. Recent evidence also associates TSLP with the differentiation of Th17 cells and Th17-derived inflammatory processes. Chronic allergic (atopic) asthma is often characterized by Th2-type inflammation, whereas non-allergic asthmatic inflammation is predominantly neutrophilic and is associated with a mixed Th1 and Th17 cytokine environment. Antagonists to TSLP are expected to be useful in the treatment of inflammatory conditions.
[0009] Accordingly, unmet needs still exist for compositions and methods for the treatment of diseases and conditions induced by IL-13 and TSLP activation, such as, but not limited to, allergic and respiratory conditions including asthma. SUMMARY OF THE INVENTION
[0010] In one embodiment, the present disclosure provides an isolated bispecific antibody comprising three complementarity determining regions (CDRs) on the heavy chain (HCDR1, HCDR2, and HCDR3) and three CDRs on the light chain (LCDR1, LCDR2, and LCDR3), wherein the CDRs have the sequences of SEQ ID NOs: 149-154. In another embodiment, the bispecific antibody comprises a heavy chain variable domain (VH) and a light chain variable domain (VL) having the amino acid sequences of SEQ ID NOs: 155 and 156, or SEQ ID NOs: 157 and 158.
[0011] In one aspect, an isolated bispecific antibody is disclosed herein, wherein HCDR1, HCDR2, and HCDR3 each comprise the amino acid sequences of SEQ ID NOs: 349, 350, and 351, and LCDR1, LCDR2, and LCDR3 each comprise the amino acid sequences of SEQ ID NOs: 359, 360, and 361.
[0012] In another embodiment, HCDR1, HCDR2, and HCDR3 each comprise the amino acid sequences of SEQ ID NOs: 349, 356, and 351, and LCDR1, LCDR2, and LCDR3 each comprise the amino acid sequences of SEQ ID NOs: 364, 360, and 371.
[0013] In another embodiment, HCDR1, HCDR2, and HCDR3 each comprise the amino acid sequences of SEQ ID NOs: 349, 350, and 351, and LCDR1, LCDR2, and LCDR3 each comprise the amino acid sequences of SEQ ID NOs: 362, 360, and 384.
[0014] In another embodiment, HCDR1, HCDR2, and HCDR3 each comprise the amino acid sequences of SEQ ID NOs: 349, 350, and 351, and LCDR1, LCDR2, and LCDR3 each comprise the amino acid sequences of SEQ ID NOs: 364, 360, and 384.
[0015] In another embodiment, HCDR1, HCDR2, and HCDR3 each comprise the amino acid sequences shown in Table 8 or Table 4, and LCDR1, LCDR2, and LCDR3 each comprise the amino acid sequences shown in Table 9 or Table 5.
[0016] In one aspect, an isolated double - chain antibody is disclosed herein, the double - chain antibody comprising a heavy - chain variable region (VH) domain and a light - chain variable region (VL) domain, the VH domain comprising a set of complementarity - determining regions (CDRs), HCDR1, HCDR2, and HCDR3, the amino acid sequence of HCDR1 being set forth in SEQ ID NO: 136, the amino acid sequence of HCDR2 being described as I HX1 Y D G S N K (SEQ ID NO: 142) (where HX1 is any amino acid), and the amino acid sequence of HCDR3 being A R HX2 HX3 HX4 HX5 HX6 HX7 HX8 HX9 HX10 HX11 F D HX12 (SEQ ID NO: 143) (where XH2, HX3, HX4, HX5, HX6, HX7, HX8, HX9, HX10, HX11, and HX12 are any amino acids), or the VL domain comprising a set of CDRs, LCDR1, LCDR2, and LCDR3, the amino acid sequence of LCDR1 being described as LX1, LX2, G S K LX3 V (SEQ ID NO: 144) (where LX1, LX2, and LX3 are any amino acids), the amino acid sequence of LCDR2 being described as D D LX4 (SEQ ID NO: 145) (where LX4 is any amino acid), and the amino acid sequence of LCDR3 being described as Q V W D LX5 LX6 S D LX7 V V (SEQ ID NO: 146) (where LX5, LX6, and LX7 are any amino acids), or comprising the antigen - binding domain site of an antibody comprising a combination of (a) and (b).
[0017] In related embodiments, the amino acid sequence of HCDR2 is set forth in SEQ ID NO: 137, HX1 is selected from the group consisting of W and S, the amino acid sequence of HCDR3 is set forth in SEQ ID NO: 138, HX2 is selected from the group consisting of A and S, HX3 is P, HX4 is Q, HX5 is W, HX6 is selected from the group consisting of E, Q, M, L, and V, HX7 is selected from the group consisting of L, W, and Y, HX8 is selected from the group consisting of V and T, HX9 is selected from the group consisting of H, A, S, HX10 is E, HX11 is A, HX12 is selected from the group consisting of I, L, and M, the amino acid sequence of LCDR1 is set forth in SEQ ID NO: 139, LX1 is selected from the group consisting of N, L, and I, LX2 is selected from the group consisting of L and I, LX3 is selected from the group consisting of S and L, the amino acid sequence of LCDR2 is set forth in SEQ ID NO: 140, LX4 is selected from the group consisting of S and G, the amino acid sequence of LCDR3 is set forth in SEQ ID NO: 141, LX5 is selected from the group consisting of S and T, LX6 is selected from the group consisting of S and G, and LX7 is selected from the group consisting of H and G.
[0018] In a further related embodiment of the isolated bispecific antibody, HX1 is W, HX2 is selected from the group consisting of A and S, HX6 is selected from the group consisting of E and M, HX7 is selected from the group consisting of L and W, HX8 is selected from the group consisting of V and T, HX9 is selected from the group consisting of H and A, HX12 is selected from the group consisting of I and L, LX1 is L, LX2 is I, LX3 is L, LX4 is selected from the group consisting of S and G, LX5 is S, LX6 is S, and LX7 is selected from the group consisting of H and G.
[0019] In yet another related aspect of the isolated bispecific antibody, the isolated bispecific antibody comprises CDRs, where HX1 is W, HX2 is A, HX6 is E, HX7 is L, HX8 is T, HX9 is A, HX12 is I, LX4 is S, LX7 is G; or HX1 is W, HX2 is A, HX6 is M, HX7 is L, HX8 is V, HX9 is A, HX12 is L, LX4 is S, LX7 is H; or HX1 is W, HX2 is S, HX6 is E, HX7 is W, HX8 is V, HX9 is H, HX12 is L, LX4 is G, LX7 is G.
[0020] In another related aspect of the isolated bispecific antibody, the VH domain comprising the amino acid sequence set forth in SEQ ID NO: 1 having at least one amino acid variant at any one of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or a combination thereof), the VL domain comprising the amino acid sequence set forth in SEQ ID NO: 2 having at least one amino acid variant at any one of positions 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or a combination thereof), or the combination of the VH domain as described in (a) and the VL domain as described in (b), the total number of variant positions in the VH domain, the VL domain, or the combination thereof of the bispecific antibody is at least 2.
[0021] In a further related aspect, the at least one variant amino acid in the VH domain includes a variant at position 106 of SEQ ID NO: 1 (IMTG position 112). In another further related aspect, the amino acid sequence of the VH domain is selected from the sequences set forth in SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, and 54. In yet another further related aspect, the at least one amino acid variant in the VL domain includes a variant amino acid in the CDR region. In yet another further related aspect, the variant amino acid in the VL domain includes a variant at any one of positions 26, 27, 31, or 96 of SEQ ID NO: 2, or a combination thereof (IMGT positions 27, 28, 38, or 115, or a combination thereof). In another further related aspect, there are at least two variants in the VL domain, and the second variant includes a variant amino acid in the framework region. In yet another further related aspect, the variant amino acid in the framework region includes a variant at position 56 or 77 of SEQ ID NO: 2, or a combination thereof (IMGT positions 70 or 94, or a combination thereof).
[0022] In another related aspect, the amino acid sequence of the VL domain is selected from the sequences set forth in SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, and 53. In yet another related aspect, the amino acid sequence of the VH domain-VL domain pair is selected from the paired sequences set forth in SEQ ID NOs: 4 and 3, 6 and 5, 8 and 7, 10 and 9, 12 and 11, 14 and 13, 16 and 15, 18 and 17, 20 and 19, 22 and 21, 24 and 23, 26 and 25, 28 and 27, 30 and 29, 32 and 31, 34 and 33, 36 and 35, 38 and 37, 40 and 39, 42 and 41, 44 and 43, 46 and 45, 48 and 47, 50 and 49, 52 and 51, and 54 and 53.
[0023] In another embodiment, the isolated bispecific antibody disclosed herein comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), and the VH and VL comprise the amino acid sequences of SEQ ID NOs: 209 and 210.
[0024] In another embodiment, the isolated bispecific antibody disclosed herein comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), and the VH and VL comprise the amino acid sequences of SEQ ID NOs: 219 and 220.
[0025] In another embodiment, the isolated bispecific antibody disclosed herein comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), and the VH and VL comprise the amino acid sequences of SEQ ID NOs: 249 and 250.
[0026] In another embodiment, the isolated bispecific antibody disclosed herein comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), and the VH and VL comprise the amino acid sequences of SEQ ID NOs: 337 and 338.
[0027] In another embodiment, the isolated bispecific antibody disclosed herein comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), and the VH and VL comprise the amino acid sequences shown in Table 1 or Table 10.
[0028] In another related aspect, the bispecific antibody comprises an IgG, Fv, scFv, Fab, F(ab’)2, minibody, diabody, or triabody. In a further related aspect, the IgG comprises IgG1, IgG2, IgG3, or IgG4. In yet another related aspect, the IgG comprises a mutant IgG that is unable to bind to the antibody-dependent cell cytotoxicity component.
[0029] In one aspect, a composition comprising an isolated bispecific antibody and a pharmaceutically acceptable carrier is disclosed herein.
[0030] In one aspect, a nucleic acid construct comprising a nucleic acid sequence encoding a bispecific antibody is disclosed herein, the antibody comprising a heavy chain variable region (VH) domain and a light chain variable region (VL) domain, the VH domain comprising a set of CDRs, HCDR1, HCDR2, and HCDR3, the amino acid sequence of HCDR1 being as set forth in SEQ ID NO: 136, the amino acid sequence of HCDR2 being described as I HX1 Y D G S N K (SEQ ID NO: 142) (wherein HX1 is any amino acid), the amino acid sequence of HCDR3 being described as A R HX2 HX3 HX4 HX5 HX6 HX7 HX8 HX9 HX10 HX11 F D HX12 (SEQ ID NO: 143) (wherein XH2, HX3, HX4, HX5, HX6, HX7, HX8, HX9, HX10, HX11, and HX12 are any amino acids), or the VL domain comprising a set of CDRs, LCDR1, LCDR2, and LCDR3, the amino acid sequence of LCDR1 being LX1, LX2, G Described as S K LX3 V (SEQ ID NO: 144) (where LX1, LX2, and LX3 are arbitrary amino acids), the amino acid sequence of LCDR2 is described as D D LX4 (SEQ ID NO: 145) (where LX4 is an arbitrary amino acid), and the amino acid sequence of LCDR3 is described as Q V W D LX5 LX6 S D LX7 V V (SEQ ID NO: 146) (where LX5, LX6, and LX7 are arbitrary amino acids), or includes the antigen-binding domain site of an antibody comprising a combination of (a) and (b).
[0031] In related aspects of the nucleic acid, the amino acid sequence encoded by HCDR2 is described in SEQ ID NO: 137, HX1 is selected from the group consisting of W and S, the amino acid sequence of HCDR2 is described in SEQ ID NO: 138, HX2 is selected from the group consisting of A and S, HX3 is P, HX4 is Q, HX5 is W, HX6 is selected from the group consisting of E, Q, M, L, and V, HX7 is selected from the group consisting of L, W, and Y, HX8 is selected from the group consisting of V and T, HX9 is selected from the group consisting of H, A, S, HX10 is E, HX11 is A, HX12 is selected from the group consisting of I, L, and M, the amino acid sequence of LCDR1 is described in SEQ ID NO: 139, LX1 is selected from the group consisting of N, L, and I, LX2 is selected from the group consisting of L and I, LX3 is selected from the group consisting of S and L, the amino acid sequence of LCDR2 is described in SEQ ID NO: 140, LX4 is selected from the group consisting of S and G, the amino acid sequence of LCDR3 is described in SEQ ID NO: 141, LX5 is selected from the group consisting of S and T, LX6 is selected from the group consisting of S and G, and LX7 is selected from the group consisting of H and G.
[0032] In aspects related to nucleic acids, the amino acid encoded for HX1 is W, HX2 is selected from the group consisting of A and S, HX6 is selected from the group consisting of E and M, HX7 is selected from the group consisting of L and W, HX8 is selected from the group consisting of V and T, HX9 is selected from the group consisting of H and A, HX12 is selected from the group consisting of I and L, LX1 is L, LX2 is I, LX3 is L, LX4 is selected from the group consisting of S and G, LX5 is S, LX6 is S, LX7 is selected from the group consisting of H and G. The amino acid encoded for HX1 is W, HX2 is A, HX6 is E, HX7 is L, HX8 is T, HX9 is A, HX12 is I, LX4 is S, LX7 is G, or HX1 is W, HX2 is A, HX6 is M, HX7 is L, HX8 is V, HX9 is A, HX12 is L, LX4 is S, LX7 is H, or HX1 is W, HX2 is S, HX6 is E, HX7 is W, HX8 is V, HX9 is H, HX12 is L, LX4 is G, LX7 is G, further related aspects.
[0033] In related aspects of the nucleic acid construct, the VH domain comprising the amino acid sequence set forth in SEQ ID NO: 1 having at least one amino acid variant at any one of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or a combination thereof), the VL domain comprising the amino acid sequence set forth in SEQ ID NO: 2 having at least one amino acid variant at any one of positions 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or a combination thereof), or the combination of the VH domain described in (a) and the VL domain described in (b), the total number of variant positions in the encoded VH domain, the encoded VL domain, or a combination thereof is at least 2. In a further related aspect, the sequence comprises two nucleic acid sequences, one encoding a variant bispecific antibody VH domain and one encoding a variant bispecific antibody VL domain. In a further related aspect, the nucleic acid sequence encoding the VH domain is selected from the sequences set forth in SEQ ID NOs: 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 105, and 107. In another further related aspect, the nucleic acid sequence encoding the VL domain is selected from the sequences set forth in SEQ ID NOs: 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, and 108.In yet another further related aspect, the nucleic acid sequence encoding the bispecific antibody VH domain-VL domain pair is selected from the paired sequences set forth in SEQ ID NO: 57 and 58, SEQ ID NO: 59 and 60, SEQ ID NO: 61 and 62, SEQ ID NO: 63 and 64, SEQ ID NO: 65 and 66, SEQ ID NO: 67 and 68, SEQ ID NO: 69 and 70, SEQ ID NO: 71 and 72, SEQ ID NO: 73 and 74, SEQ ID NO: 75 and 76, SEQ ID NO: 77 and 78, SEQ ID NO: 79 and 80, SEQ ID NO: 81 and 82, SEQ ID NO: 83 and 84, SEQ ID NO: 85 and 86, SEQ ID NO: 87 and 88, SEQ ID NO: 89 and 90, SEQ ID NO: 91 and 92, SEQ ID NO: 93 and 94, SEQ ID NO: 95 and 96, SEQ ID NO: 97 and 98, SEQ ID NO: 99 and 100, SEQ ID NO: 101 and 102, SEQ ID NO: 103 and 104, SEQ ID NO: 105 and 106, and SEQ ID NO: 107 and 108.
[0034] In related aspects of the nucleic acid construct, the antibody includes IgG, Fv, scFv, Fab, F(ab’)2, minibody, diabody, or triabody. In a further related aspect, the IgG includes a mutant IgG that cannot bind to antibody-dependent cell cytotoxicity components.
[0035] In another related aspect, the nucleic acid construct further includes a control sequence operably linked to the nucleic acid sequence.
[0036] In one aspect, an expression vector comprising a nucleic acid construct encoding a bispecific antibody is disclosed herein, and the antibody includes an antigen-binding domain site of an antibody that includes a heavy chain variable region (VH) domain and a light chain variable region (VL) domain.
[0037] In one aspect, a host cell comprising an expression vector comprising a nucleic acid construct encoding a bispecific antibody is disclosed herein, and the antibody includes an antigen-binding domain site of an antibody that includes a heavy chain variable region (VH) domain and a light chain variable region (VL) domain.
[0038] In one aspect, a composition is disclosed herein that includes a nucleic acid construct encoding a bispecific antibody and a pharmaceutically acceptable carrier, wherein the antibody includes an antigen-binding domain site of an antibody that includes a heavy chain variable region (VH) domain and a light chain variable region (VL) domain.
[0039] In one aspect, a method is disclosed herein for producing a bispecific antibody that includes an antigen-binding domain site of an antibody that includes a heavy chain variable region (VH) domain and a light chain variable region (VL) domain, the method including culturing a host cell that includes an expression vector including a nucleic acid construct encoding the bispecific antibody, wherein the antibody includes an antigen-binding domain site of an antibody that includes a heavy chain variable region (VH) domain and a light chain variable region (VL) domain, expressing the nucleic acid construct from the vector, and isolating the bispecific antibody.
[0040] In one aspect, a library of immunoglobulins or fragments thereof comprising an antigen-binding domain site of an antibody comprising a heavy chain variable region (VH) domain and a light chain variable region (VL) domain is disclosed herein, wherein the VH domain comprises a set of CDRs, HCDR1, HCDR2, and HCDR3, the amino acid sequence of HCDR1 is set forth in SEQ ID NO: 136, the amino acid sequence of HCDR2 is described as I HX1 Y D G S N K (SEQ ID NO: 142) (wherein HX1 is any amino acid), the amino acid sequence of HCDR3 is described as A R HX2 HX3 HX4 HX5 HX6 HX7 HX8 HX9 HX10 HX11 F D HX12 (SEQ ID NO: 143) (wherein XH2, HX3, HX4, HX5, HX6, HX7, HX8, HX9, HX10, HX11, and HX12 are any amino acids), or the VL domain comprises a set of CDRs, LCDR1, LCDR2, and LCDR3, the amino acid sequence of LCDR1 is described as LX1, LX2, G S K LX3 V (SEQ ID NO: 144) (wherein LX1, LX2, and LX3 are any amino acids), the amino acid sequence of LCDR2 is described as D D LX4 (SEQ ID NO: 145) (wherein LX4 is any amino acid), and the amino acid sequence of LCDR3 is described as Q V W D LX5 LX6 S D LX7 V V (SEQ ID NO: 146) (wherein LX5, LX6, and LX7 are any amino acids).
[0041] In related aspects of the library, the amino acid sequence of HCDR2 is set forth in SEQ ID NO: 137, HX1 is selected from the group consisting of W and S, the amino acid sequence of HCDR2 is set forth in SEQ ID NO: 138, HX2 is selected from the group consisting of A and S, HX3 is P, HX4 is Q, HX5 is W, HX6 is selected from the group consisting of E, Q, M, L, and V, HX7 is selected from the group consisting of L, W, and Y, HX8 is selected from the group consisting of V and T, HX9 is selected from the group consisting of H, A, S, HX10 is E, HX11 is A, HX12 is selected from the group consisting of I, L, and M, the amino acid sequence of LCDR1 is set forth in SEQ ID NO: 139, LX1 is selected from the group consisting of N, L, and I, LX2 is selected from the group consisting of L and I, LX3 is selected from the group consisting of S and L, the amino acid sequence of LCDR2 is set forth in SEQ ID NO: 140, LX4 is selected from the group consisting of S and G, the amino acid sequence of LCDR3 is set forth in SEQ ID NO: 141, LX5 is selected from the group consisting of S and T, LX6 is selected from the group consisting of S and G, and LX7 is selected from the group consisting of H and G.
[0042] In further related aspects of the library, HX1 is W, HX2 is selected from the group consisting of A and S, HX6 is selected from the group consisting of E and M, HX7 is selected from the group consisting of L and W, HX8 is selected from the group consisting of V and T, HX9 is selected from the group consisting of H and A, HX12 is selected from the group consisting of I and L, LX1 is L, LX2 is I, LX3 is L, LX4 is selected from the group consisting of S and G, LX5 is S, LX6 is S, and LX7 is selected from the group consisting of H and G.
[0043] In yet another related aspect of the library, HX1 is W, HX2 is A, HX6 is E, HX7 is L, HX8 is T, HX9 is A, HX12 is I, LX4 is S, LX7 is G, HX1 is W, HX2 is A, HX6 is M, HX7 is L, HX8 is V, HX9 is A, HX12 is L, LX4 is S, LX7 is H, or HX1 is W, HX2 is S, HX6 is E, HX7 is W, HX8 is V, HX9 is H, HX12 is L, LX4 is G, LX7 is G. In yet another related aspect of the library, the VH domain comprising the amino acid sequence set forth in SEQ ID NO: 1 having at least one amino acid variant at any one of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or a combination thereof), the VL domain comprising the amino acid sequence set forth in SEQ ID NO: 2 having at least one amino acid variant at any one of positions 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or a combination thereof), or the combination of the VH domain described in (a) and the VL domain described in (b), the total number of variant positions in the VH domain, VL domain, or a combination thereof is at least 2.
[0044] In another related aspect of the library, the immunoglobulin comprises IgG, Fv, scFv, Fab, F(ab’)2, minibody, diabody, or triabody.
[0045] In another related aspect of the library, the IgG comprises a mutant IgG that cannot bind to the antibody-dependent cell cytotoxicity component.
[0046] In one aspect, a method of treating a subject suffering from a disease or condition including an allergic or respiratory condition, an inflammatory condition of the skin or gastrointestinal organs and / or an autoimmune condition; scleroderma; or a tumor or cancer including Hodgkin's lymphoma is disclosed herein, the method comprising administering to the subject an isolated bispecific antibody disclosed herein.
[0047] In one related aspect of the method of treating a subject, the allergic or respiratory condition is asthma, allergic asthma, non-allergic asthma, severe asthma, mild asthma, chronic obstructive pulmonary disease (COPD), eosinophilia, fibrosis and hypersecretion, cystic fibrosis, allergic lung disease, airway hyperresponsiveness, goblet cell metaplasia, mucus hypersecretion, airway remodeling, a condition with airway inflammation including pulmonary fibrosis, atopic dermatitis, urticaria, eczema, allergic gastroenteritis, and atopic diseases including allergic rhinitis, or a combination thereof, or the inflammatory and / or autoimmune condition includes inflammatory bowel disease (IBD) and liver conditions including cirrhosis or fibrosis, or a combination thereof. BRIEF DESCRIPTION OF THE DRAWINGS
[0048] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings will be provided by the Office upon request and payment of the necessary fee.
[0049] The subject matter of the engineered bispecific antibodies is particularly pointed out and distinctly claimed in the concluding portion of this specification. However, these bispecific antibodies may be most readily understood by reference to the following detailed description when read in conjunction with the accompanying drawings, in light of both their production and method of use, their purposes, features, and advantages.
[0050]
Figure 1A
Figure 1B
[0051]
Figure 2A
Figure 2B
[0052]
Figure 3A
Figure 3B
Figure 3C
Figure 3D
Figure 3E
Figure 3F
[0053]
Figure 4A
Figure 4B
[0054]
Figure 5A
Figure 5B
Figure 5C
Figure 5D
Figure 5E
Figure 5F
Figure 5G
Figure 5H
[0055]
Figure 6A
Figure 6B
Figure 6C
Figure 6D
Figure 6E
[0056]
Figure 7A
Figure 7B
Figure 7C
Figure 7D
[0057]
Figure 8
[0058]
Figure 9
[0059]
Figure 10
[0060]
Figure 11A
Figure 11B
Figure 11C
Figure 11D
[0061]
Figure 12A
Figure 12B
Figure 12C
[0062]
Figure 13
[0063]
Figure 14A
Figure 14B
Figure 14C
[0064]
Figure 15
[0065]
Figure 16A
Figure 16B
Figure 16C
Figure 16D
Figure 16E
Figure 16F
[0066]
Figure 17A
Figure 17B
[0067]
Figure 18A
Figure 18B
Figure 18C
Figure 18D
[0068]
Figure 19A
Figure 19B
[0069]
Figure 20A
Figure 20B
Figure 20C
Figure 20D
[0070]
Figure 21A
Figure 21B
[0071]
Figure 22
[0072]
Figure 23
[0073]
Figure 24A
Figure 24B
[0074]
Figure 25A
Figure 25B
[0075]
Figure 26A
Figure 26B
Figure 26C
Figure 26D
[0076]
Figure 27A
Figure 27B
[0077]
Figure 28A
Figure 28B
Figure 28C
Figure 28D
Mode for Carrying Out the Invention
[0078] In the following detailed description, numerous specific details are set forth in order to provide a thorough understanding of the engineered bispecific antibodies disclosed herein, including descriptions of those heavy and light chain variable regions. However, one of ordinary skill in the art will understand that the preparation and use of bispecific antibodies can in certain instances be practiced without these specific details. In other instances, well-known methods, procedures, and components have not been described in detail so as not to obscure the disclosure presented herein.
[0079] Antigen-binding sequences are conventionally located within the heavy chain variable region sequences and the light chain variable region sequences of antibodies. These heavy and light chain variable regions may in certain instances be engineered to create new binding sites, for example, to create antibodies or fragments thereof that bind to different antigens or different epitopes of an antigen. In some embodiments, engineering the sequence of the heavy chain variable region or the light chain variable region, or both, as described herein creates a new binding site for an epitope while maintaining the functionality of the antibody. In one embodiment, 21 specific sites within the heavy and light chain variable regions are identified, and in certain embodiments, the presence of variant amino acids at these sites results in the generation of an engineered bispecific antibody or fragment thereof. In some embodiments, the 21 possible variant sites provide a unique platform for engineering bispecific antibodies or fragments thereof.
[0080] Engineered bispecific antibodies or fragments thereof are disclosed herein, wherein either the heavy chain variable region, or the light chain variable region, or both, are mutated to contain variant amino acids. In some embodiments, these engineered bispecific antibodies may be identified and selected from libraries generated to contain variant amino acid residues at specific sites within the variable heavy chain region or variable light chain region, or both. In some embodiments, these engineered bispecific antibodies may be generated by specifically mutating target amino acid sites within the variable heavy chain region or variable light chain region, or both. In some embodiments, these engineered bispecific antibodies may be used in a method of treatment for treating a subject suffering from an allergic condition or a respiratory condition.
[0081] Engineered bispecific antibody As used herein, the term "bispecific antibody" refers to an antibody having two binding specificities. In certain embodiments, the bispecific antibodies disclosed herein bind to IL-13 and TSLP.
[0082] In some embodiments, the present disclosure provides an isolated bispecific antibody comprising three complementarity determining regions (CDRs) on the heavy chain (HCDR1, HCDR2, and HCDR3) and three CDRs on the light chain (LCDR1, LCDR2, and LCDR3) (see, e.g., Tables 8 and 9). In some embodiments, the CDRs have the sequences of SEQ ID NOs: 149-154. In some embodiments, the bispecific antibody comprises a heavy chain variable domain (VH) and a light chain variable domain (VL) having the amino acid sequences of SEQ ID NOs: 155 and 156, or SEQ ID NOs: 157 and 158.
[0083] In one embodiment, HCDR1, HCDR2 and HCDR3 each comprise the amino acid sequences of SEQ ID NOs: 349, 350 and 351, and LCDR1, LCDR2 and LCDR3 each comprise the amino acid sequences of SEQ ID NOs: 359, 360 and 361.
[0084] In another embodiment, HCDR1, HCDR2, and HCDR3 each comprise the amino acid sequences of SEQ ID NO: 349, 356, and 351, respectively, and LCDR1, LCDR2, and LCDR3 each comprise the amino acid sequences of SEQ ID NO: 364, 360, and 371, respectively.
[0085] In another embodiment, HCDR1, HCDR2, and HCDR3 each comprise the amino acid sequences of SEQ ID NO: 349, 350, and 351, respectively, and LCDR1, LCDR2, and LCDR3 each comprise the amino acid sequences of SEQ ID NO: 362, 360, and 384, respectively.
[0086] In another embodiment, HCDR1, HCDR2, and HCDR3 each comprise the amino acid sequences of SEQ ID NO: 349, 350, and 351, respectively, and LCDR1, LCDR2, and LCDR3 each comprise the amino acid sequences of SEQ ID NO: 364, 360, and 384, respectively.
[0087] In another embodiment, HCDR1, HCDR2, and HCDR3 each comprise the amino acid sequences shown in Table 8 or Table 4, and LCDR1, LCDR2, and LCDR3 each comprise the amino acid sequences shown in Table 9 or Table 5.
[0088] In some embodiments, an isolated bispecific antibody is disclosed herein that includes three complementarity determining regions (CDRs) on the heavy chain (HCDR1, HCDR2, and HCDR3) and three CDRs on the light chain (LCDR1, LCDR2, and LCDR3), (i) HCDR1 comprises the amino acid sequence of SEQ ID NO: 349 or 355, or the amino acid sequence of SEQ ID NO: 149 or SEQ ID NO: 136, (ii) HCDR2 comprises any one of the amino acid sequences of SEQ ID NO: 350, 352, 354, and 356, or the amino acid sequence of SEQ ID NO: 150 or the sequence described as I HX1 Y D G S N K (SEQ ID NO: 142), where HX1 is any amino acid, (iii) The HCDR3 comprises one amino acid sequence of SEQ ID NO: 351, 353, 357, and 358, or the amino acid sequence of SEQ ID NO: 151 or ARHX2HX3HX4HX5HX6HX7HX8HX9HX10HX11FDHX12 (SEQ ID NO: 143) (wherein HX2, HX3, HX4, HX5, HX6, HX7, HX8, HX9, HX10, HX11, and HX12 are arbitrary amino acids), (iv) The LCDR1 comprises one amino acid sequence of SEQ ID NO: 359, 362, 364, 366, 369, and 375, or the amino acid sequence of SEQ ID NO: 152, or the sequence described as LX1, LX2, GSKLX3V (SEQ ID NO: 144) (wherein LX1, LX2, and LX3 are arbitrary amino acids), (v) The LCDR2 comprises the amino acid sequence of SEQ ID NO: 360 or 367, or the amino acid sequence of SEQ ID NO: 153, or the sequence described as DDLX4 (SEQ ID NO: 145) (wherein LX4 is an arbitrary amino acid), (vi) The LCDR3 comprises one amino acid sequence of SEQ ID NO: 361, 363, 365, 368, 370 - 374, 376 - 407, or the amino acid sequence of SEQ ID NO: 154, or Q VWDLX5LX6SDLX7VV (SEQ ID NO: 146) (wherein LX5, LX6, and LX7 are arbitrary amino acids).
[0089] In some embodiments, isolated bispecific antibodies are disclosed herein, The HCDR1, HCDR2, and HCDR3 each comprise the amino acid sequences of SEQ ID NO: 349, 350, and 351, and the LCDR1, LCDR2, and LCDR3 each comprise the amino acid sequences of SEQ ID NO: 359, 360, and 361, or The HCDR1, HCDR2, and HCDR3 each comprise the amino acid sequences of SEQ ID NO: 349, 356, and 351, and the LCDR1, LCDR2, and LCDR3 each comprise the amino acid sequences of SEQ ID NO: 364, 360, and 371, or HCDR1, HCDR2, and HCDR3 each contain the amino acid sequences of SEQ ID NO: 349, 350, and 351, respectively, and LCDR1, LCDR2, and LCDR3 each contain the amino acid sequences of SEQ ID NO: 362, 360, and 384, respectively, or HCDR1, HCDR2, and HCDR3 each contain the amino acid sequences of SEQ ID NO: 349, 350, and 351, respectively, and LCDR1, LCDR2, and LCDR3 each contain the amino acid sequences of SEQ ID NO: 364, 360, and 384, respectively.
[0090] In some embodiments, an isolated bispecific antibody is disclosed herein, wherein HCDR1, HCDR2, and HCDR3 contain the amino acid sequences shown in Table 8 or Table 4, and LCDR1, LCDR2, and LCDR3 contain the amino acid sequences shown in Table 9 or Table 5.
[0091] In some embodiments, an isolated bispecific antibody is disclosed herein, wherein HX1 is W or S, HX2 is A or S, HX3 is P, HX4 is Q, HX5 is W, HX6 is E, Q, M, L, or V, HX7 is L, W, or Y, HX8 is V or T, HX9 is H, A, or S, HX10 is E, HX11 is A, HX12 is I, L, or M, LX1 is N, L, or I, LX2 is L or I, LX3 is S or L, LX4 is S or G, LX5 is S or T, LX6 is S or G, and LX7 is H or G.
[0092] In some embodiments, an isolated bispecific antibody is disclosed herein, wherein HX1 is W, HX2 is A or S, HX6 is E or M, HX7 is L or W, HX8 is V or T, HX9 is H or A, HX12 is I or L, LX1 is L, LX2 is I, LX3 is L, LX4 is S or G, LX5 is S, LX6 is S, and LX7 is H or G.
[0093] In some embodiments, an isolated bispecific antibody is disclosed herein, (a) HX1 is W, HX2 is A, HX6 is E, HX7 is L, HX8 is T, HX9 is A, HX12 is I, LX4 is S, LX7 is G, or (b) HX1 is W, HX2 is A, HX6 is M, HX7 is L, HX8 is V, HX9 is A, HX12 is L, LX4 is S, LX7 is H, or (c) HX1 is W, HX2 is S, HX6 is E, HX7 is W, HX8 is V, HX9 is H, HX12 is L, LX4 is G, LX7 is G.
[0094] In some embodiments, an isolated bispecific antibody is disclosed herein that comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 1 and having at least one amino acid variant at any position, or a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 2 and having at least one amino acid variant at any position, or a combination thereof, wherein the total number of variant positions in the heavy chain variable region, the light chain variable region, or the combination thereof is at least two. In some embodiments, an isolated bispecific antibody is disclosed herein that comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 1 and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 2, wherein at least two amino acid variants are present within the heavy chain variable region, the light chain variable region, or a combination thereof. In some embodiments, an isolated bispecific antibody is disclosed herein that comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 1 and having at least two amino acid variants at any position and any light chain variable region. In some embodiments, an isolated bispecific antibody is disclosed herein that comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 2 and having at least two amino acid variants at any position and any heavy chain variable region.
[0095] As used herein, the term "heavy chain variable region" may be used interchangeably with the term "VH domain" or the term "VH", and all have the same meaning and quality. As used herein, the term "light chain variable region" may be used interchangeably with the term "VL domain" or the term "VL", and all have the same meaning and quality.
[0096] In certain embodiments, libraries of complementary variable regions can be screened using the specific variant VH and / or VL domains described herein to identify VH / VLs having desirable properties such as increased affinity for an antigen. Such methods are described, for example, in Portolano et al., J. Immunol. (1993) 150:880-887, Clarkson et al., Nature (1991) 352:624-628 Fischer et al., (2015) Exploiting light chains for the scalable generation and platform purification of native human bispecific IgG. Nature Communications volume 6, Article number: 6113.
[0097] Other methods may be used to mix and match VH and VL domains to identify Fabs or F’(ab)2s with the desired bivalent activity. For example, Klimka et al., British Journal of Cancer (2000) 83:252-260 describes a screening process using a human VH library with mouse VL and retained CDR3 and FR4 from mouse VH. After obtaining an antibody, the VH was screened against a human VL library to obtain an antibody that bound the antigen. Beiboer et al., J. Mol. Biol. (2000) 296:833-849 describes a screening process using the entire mouse heavy chain and human light chain libraries. After obtaining an antibody, one VL was combined with a human VH library having the retained mouse CDR3. An antibody that could bind the antigen was obtained. Rader et al., PNAS (1998) 95:8910-8915 describes a process similar to that of Beiboer et al. above.
[0098] The techniques described herein are, in themselves, known in the art. However, one of ordinary skill in the art will be able to use such techniques, using the ordinary methodology of the art, to obtain antigen-binding fragments of antibodies according to some embodiments of the disclosure described herein.
[0099] One of ordinary skill in the art will understand that bivalent antibodies, in their broadest sense, include antibodies that specifically bind to the epitopes of IL-13 and TSLP. One of ordinary skill in the art will further understand that specificity for binding to IL-13 or TSLP reflects that the binding is selective for the antigen and can be distinguished from unwanted or non-specific interactions. In certain embodiments, the bivalent antibody comprises one or more antibody fragments.
[0100] In some embodiments, the antigenic determinant comprises an IL-13 or TSLP epitope. The term "epitope" in certain embodiments includes polypeptide determinants capable of specific binding to an anti-IL-13 or anti-TSLP binding domain. An epitope is the region of an antigen that is bound by an antibody or an antigen-binding fragment thereof. In some embodiments, the antigen-binding fragment of an antibody comprises a heavy chain variable region, a light chain variable region, or a combination thereof as described herein.
[0101] In certain embodiments, the epitope determinant includes chemically active surface groups of molecules such as amino acids, sugar side chains, phosphoryl or sulfonyl, and in certain embodiments may have specific three-dimensional structural characteristics and / or specific charge characteristics. In certain embodiments, a bispecific antibody is said to specifically bind to an IL-13 or TSLP epitope if it preferentially recognizes IL-13 or TSLP in a complex mixture of proteins and / or macromolecules. A bispecific antibody has an equilibrium dissociation constant of ≤ 10 -5 10 -6 or 10 -7 M and is said to specifically bind to the epitope. In some embodiments, the equilibrium dissociation constant may be ≤ 10 -8 M or 10 -9 M. In some further embodiments, the equilibrium dissociation constant may be ≤ 10 -10 M, 10 -11 M, or 10 -12 M. In some embodiments, the equilibrium dissociation constant may be in the range of ≤ 10 -5 M to 10 -12 M.
[0102] An antibody binding domain may be a fragment of an antibody or a genetically engineered product of one or more fragments of an antibody, and this fragment is involved in specific binding to an antigen. "Specific binding" means that the binding is selective for the antigen of interest, for example, in the embodiments described herein, for IL-13 or TSLP, and can be distinguished from unwanted or non-specific interactions. As used herein, the term "bispecific antibody" may, in certain embodiments, include a complete immunoglobulin structure, a fragment thereof, or a domain thereof.
[0103] Examples of antibody binding domains include, but are not limited to, complementarity determining regions (CDRs), variable regions (Fv), VH domains, light chain variable regions (VL), heavy chains, light chains, single chain variable regions (scFv), and Fab fragments. One of ordinary skill in the art will understand that an scFv is actually not a fragment of an antibody, but rather a fusion polypeptide containing the variable heavy (VH) and variable light (VL) regions of an immunoglobulin, linked, for example, non-limitingly, by a short linker peptide of about 10 to about 25 amino acids. One of ordinary skill in the art will also understand that the term "Fab" with respect to an antibody generally encompasses the portion of the antibody consisting of a single light chain (both variable and constant regions) linked by a disulfide bond to the variable region and the first constant region of a single heavy chain.
[0104] In some embodiments, an antibody encompasses the entire antibody molecule, including monoclonal antibodies, polyclonal antibodies, and multispecific (e.g., bispecific) antibodies. In some embodiments, an antibody includes antibody fragments that retain binding specificity, including variable heavy (VH) fragments, variable light (VL) fragments, Fab fragments, F(ab’)2 fragments, scFv fragments, Fv fragments, minibodies, diabodies, triabodies, and tetra-bodies (see, e.g., Hudson and Souriau, Nature Med. 9:129-134 (2003), which is incorporated herein by reference in its entirety), but are not limited thereto. Also included are humanized antibodies, primatized antibodies, and chimeric antibodies.
[0105] As used herein, in some embodiments, the term "antibody" may be used interchangeably with the term "immunoglobulin" and have all the same properties and meanings. Similarly, as used herein, in some embodiments, the term "antibody or fragment thereof" may be used interchangeably with the term "immunoglobulin or fragment thereof" and have all the same properties and meanings. Thus, one of ordinary skill in the art will understand that, in some embodiments, "antibody or fragment thereof", or "immunoglobulin or fragment thereof", may encompass a fragment or a structure thereof that includes fragments such as IgG immunoglobulins, or IgG, scFv fragments, Fab fragments, F(ab’)2 fragments, Fv fragments, minibodies, diabodies, triabodies, and tetra-bodies, but is not limited thereto.
[0106] One of ordinary skill in the art will recognize that the "heavy chain variable region" or "VH" with respect to an antibody encompasses a fragment of the heavy chain containing three CDRs that are more conserved than the CDRs and are flanked by adjacent regions known as framework (FR) regions that form a scaffold to support the CDRs. In certain embodiments, the term "heavy chain variable region" or "VH" may be used interchangeably with the term "VH domain".
[0107] One of ordinary skill in the art will recognize that the "light chain variable region" or "VL" with respect to an antibody encompasses a fragment of the light chain containing three CDRs that are flanked by framework (FR) regions. In certain embodiments, the term "light chain variable region" or "VL" may be used interchangeably with the term "VL domain".
[0108] A number of amino acid sequences for HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, LCDR3, and the VH and VL regions are disclosed herein for a bispecific antibody that binds to IL-13 and TSLP. Considerations regarding some embodiments of representative sequences disclosed herein are set forth below. Figure 1A shows the template VH domain amino acid sequence set forth in SEQ ID NO: 1, as well as the positions of the three heavy chain (H) CDR regions (HCDR1, HCDR2, HCDR3) and the four FR regions (HFR1, HFR2, HFR3, HFR4), while Figure 1B shows the template VL domain amino acid sequence set forth in SEQ ID NO: 2, as well as the positions of the three light chain (L) CDR regions (LCDR1, LCDR2, LCDR3) and the four FR regions (LFR1, LFR2, LFR3, LFR4). Amino acid residues that include the variant residues present in each of the CDR regions of the re-epitope cloned clones, and in each of the FR regions, are unambiguously identified by comparing a linear schematic representation of the template VH or template VL sequence to the numbering and amino acids provided below (Figures 1A and 1B).
[0109] In some embodiments, the isolated bispecific antibody comprises an antigen-binding domain site of an antibody that includes a VH domain and a VL domain, the VH domain includes a set of CDRs, HCDR1, HCDR2, and HCDR3, the amino acid sequence of HCDR1 is set forth in SEQ ID NO: 136, the amino acid sequence of HCDR2 is described as I HX1 Y D G S N K (SEQ ID NO: 142) (wherein HX1 is any amino acid), and the amino acid sequence of HCDR3 is described as A R HX2 HX3 HX4 HX5 HX6 HX7 HX8 HX9 HX10 HX11 F D HX12 (SEQ ID NO: 143) (wherein XH2, HX3, HX4, HX5, HX6, HX7, HX8, HX9, HX10, HX11, and HX12 are any amino acids). One of ordinary skill in the art will recognize the 12 unique sites within the VH domain presented in Figure 1A, and variant amino acids may be found, which are identified herein as HX and may, in certain embodiments, include the presence of variant amino acids within the template sequence of the heavy chain.
[0110] In some embodiments, the VH domain of the bispecific antibody comprises HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 142), and HCDR3 (SEQ ID NO: 143), and the VH domain comprises variant amino acids in at least one of HX1, HX2, HX3, HX4, HX5, HX6, HX7, HX8, HX9, HX10, HX11, and HX12.
[0111] In some embodiments, the VH domain of the bispecific antibody comprises HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (wherein HX1 is selected from the group consisting of W and S), and HCDR3 (SEQ ID NO: 138) (wherein HX2 is selected from the group consisting of A and S, HX3 is P, HX4 is Q, HX5 is W, HX6 is selected from the group consisting of E, Q, M, L, and V, HX7 is selected from the group consisting of L, W, and Y, HX8 is selected from the group consisting of V and T, HX9 is selected from the group consisting of H, A, S, HX10 is E, HX11 is A, and HX12 is selected from the group consisting of I, L, and M). In certain embodiments, the isolated bispecific antibody comprises variant amino acids comprising CDR1 (SEQ ID NO: 136), CDR2 (SEQ ID NO: 137) (wherein HX1 is W), CDR3 (SEQ ID NO: 138) (wherein HX2 is selected from the group consisting of A and S, HX3 is P, HX4 is Q, HX5 is W, HX6 is selected from the group consisting of E and M, HX7 is selected from the group consisting of L and W, HX8 is selected from the group consisting of V and T, HX9 is selected from the group consisting of H and A, HX10 is E, HX11 is A, and HX12 is selected from the group consisting of I and L).
[0112] In some embodiments, the bispecific antibody may have a VH domain comprising HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (where HX1 is W), and HCDR3 (SEQ ID NO: 138), where HX2 is A, HX3 is P, HX4 is Q, HX5 is W, HX6 is E, HX7 is L, HX8 is T, HX9 is A, HX10 is E, HX11 is A, HX12 is I); or HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (where HX1 is W), HCDR3 (SEQ ID NO: 138) (where HX2 is A, HX3 is P, HX4 is Q, HX5 is W, HX6 is M, HX7 is L, HX8 is V, HX9 is A, HX10 is E, HX11 is A, HX12 is L); or HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (where HX1 is W), and HCDR3 (SEQ ID NO: 138) (where HX2 is S, HX3 is P, HX4 is Q, HX5 is W, HX6 is E, HX7 is W, HX8 is V, HX9 is H, HX10 is E, HX11 is A, HX12 is L).
[0113] Engineered antibody clones having variants in the VH domain described above are shown in FIG. 1A.
[0114] In some embodiments, the isolated bispecific antibody comprises an antigen-binding domain portion of an antibody comprising a VH domain and a VL domain, and in some embodiments, the VL domain comprises a set of CDRs, LCDR1, LCDR2, and LCDR3, where the amino acid sequence of LCDR1 is described as LX1, LX2, GSK LX3 V (SEQ ID NO: 144) (where LX1, LX2, and LX3 are any amino acids), the amino acid sequence of LCDR2 is described as DD LX4 (SEQ ID NO: 145) (where LX4 is any amino acid), and the amino acid sequence of LCDR3 is QVW D LX5 LX6 S It is described as D LX7 V V (SEQ ID NO: 146) (where LX5, LX6, and LX7 are arbitrary amino acids). Those skilled in the art will recognize the 7 unique sites within the VL domain presented in Figure 1B, and the variant amino acids can be found within the CDR, which is specified herein as LX, and in certain embodiments, may include the presence of variant amino acids within the template sequence of the light chain.
[0115] In some embodiments, the variant amino acid within the light chain may be present in one of the framework regions. In some embodiments, the variant amino acid within the VL domain is within the LFR3 region.
[0116] In some embodiments, the VL domain of the diabody comprises LCDRs, the amino acid sequence of LCDR1 is set forth in SEQ ID NO: 139, LX1 is selected from the group consisting of N, L, and I, LX2 is selected from the group consisting of L and I, LX3 is selected from the group consisting of S and L, the amino acid sequence of LCDR2 is set forth in SEQ ID NO: 140, LX4 is selected from the group consisting of S and G, the amino acid sequence of LCDR3 is set forth in SEQ ID NO: 141, LX5 is selected from the group consisting of S and T, LX6 is selected from the group consisting of S and G, and LX7 is selected from the group consisting of H and G. In certain embodiments, the isolated diabody comprises variant amino acids, LCDR1 (SEQ ID NO: 139) (where LX1 is L, LX2 is I, and LX3 is L), LCDR2 (SEQ ID NO: 140) (where LX4 is selected from the group consisting of S and G), and LCDR3 (SEQ ID NO: 141) (where LX5 is S, LX6 is S, and LX7 is selected from the group consisting of H and G).
[0117] In some embodiments, the bispecific antibody has a VL domain comprising LCDR1 (SEQ ID NO: 139) (wherein LX1 is L, LX2 is I, and LX3 is L), LCDR2 (SEQ ID NO: 140) (wherein LX4 is S), and LCDR3 (SEQ ID NO: 141) (wherein LX5 is S, LX6 is S, and LX7 is G); or LCDR1 (SEQ ID NO: 139) (wherein LX1 is L, LX2 is I, and LX3 is L), LCDR2 (SEQ ID NO: 140) (wherein LX4 is S), and LCDR3 (SEQ ID NO: 141) (wherein LX5 is S, LX6 is S, and LX7 is H); or LCDR1 (SEQ ID NO: 139) (wherein LX1 is L, LX2 is I, and LX3 is L), LCDR2 (SEQ ID NO: 140) (wherein LX4 is G), and LCDR3 (SEQ ID NO: 141) (wherein LX5 is S, LX6 is S, and LX7 is G).
[0118] Engineered antibody clones having variants in the VL domain described above are shown in FIG. 1B.
[0119] In some embodiments, an isolated antibody comprising a heavy chain variable domain (VH) and a light chain variable domain (VL) is disclosed herein, wherein the VH and VL comprise the amino acid sequences of SEQ ID NO: 209 and 210, SEQ ID NO: 219 and 220, SEQ ID NO: 249 and 250, SEQ ID NO: 337 and 338, SEQ ID NO: 155 and 156, SEQ ID NO: 157 and 158, SEQ ID NO: 4 and 3, SEQ ID NO: 6 and 5, SEQ ID NO: 8 and 7, SEQ ID NO: 10 and 9, SEQ ID NO: 12 and 11, SEQ ID NO: 14 and 13, SEQ ID NO: 16 and 15, SEQ ID NO: 18 and 17, SEQ ID NO: 20 and 19, SEQ ID NO: 22 and 21, SEQ ID NO: 24 and 23, SEQ ID NO: 26 and 25, SEQ ID NO: 28 and 27, SEQ ID NO: 30 and 29, SEQ ID NO: 32 and 31, SEQ ID NO: 34 and 33, SEQ ID NO: 36 and 35, SEQ ID NO: 38 and 37, SEQ ID NO: 40 and 39, SEQ ID NO: 42 and 41, SEQ ID NO: 44 and 43, SEQ ID NO: 46 and 45, SEQ ID NO: 48 and 47, SEQ ID NO: 50 and 49, SEQ ID NO: 52 and 51, or SEQ ID NO: 54 and 53.
[0120] In some embodiments, an isolated antibody comprising a heavy chain variable domain (VH) and a light chain variable domain (VL) is disclosed herein, and the antibody comprises a sequence that is at least 80% identical (e.g., 80%, 85%, 90%, 95%, 98%, or 99% identical) to the sequences set forth in any of SEQ ID NO: 209 and 210, SEQ ID NO: 219 and 220, SEQ ID NO: 249 and 250, SEQ ID NO: 337 and 338, SEQ ID NO: 155 and 156, SEQ ID NO: 157 and 158, SEQ ID NO: 4 and 3, SEQ ID NO: 6 and 5, SEQ ID NO: 8 and 7, SEQ ID NO: 10 and 9, SEQ ID NO: 12 and 11, SEQ ID NO: 14 and 13, SEQ ID NO: 16 and 15, SEQ ID NO: 18 and 17, SEQ ID NO: 20 and 19, SEQ ID NO: 22 and 21, SEQ ID NO: 24 and 23, SEQ ID NO: 26 and 25, SEQ ID NO: 28 and 27, SEQ ID NO: 30 and 29, SEQ ID NO: 32 and 31, SEQ ID NO: 34 and 33, SEQ ID NO: 36 and 35, SEQ ID NO: 38 and 37, SEQ ID NO: 40 and 39, SEQ ID NO: 42 and 41, SEQ ID NO: 44 and 43, SEQ ID NO: 46 and 45, SEQ ID NO: 48 and 47, SEQ ID NO: 50 and 49, SEQ ID NO: 52 and 51, or SEQ ID NO: 54 and 53.
[0121] In some embodiments, an isolated one is disclosed herein, and the antibody comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), and the VH and VL comprise the amino acid sequences shown in Table 10 or Table 1. In some embodiments, an isolated antibody comprising a heavy chain variable domain (VH) and a light chain variable domain (VL) is disclosed herein, and the antibody comprises a sequence that is at least 80% identical (e.g., 80%, 85%, 90%, 95%, 98%, or 99% identical) to the sequences described in Table 10 or Table 1.
[0122] In some embodiments, an isolated antibody comprising a heavy chain variable domain (VH) and a light chain variable domain (VL) is disclosed herein, (a) When the VH domain has amino acid variants at two or more of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or a combination thereof), it contains the amino acid sequence set forth in SEQ ID NO: 1, (b) When the VL domain has amino acid variants at two or more of positions 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or a combination thereof), it contains the amino acid sequence set forth in SEQ ID NO: 2.
[0123] In one embodiment, the isolated bispecific antibody disclosed herein comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), and the VH and VL contain the amino acid sequences of SEQ ID NOs: 209 and 210.
[0124] In another embodiment, the isolated bispecific antibody disclosed herein comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), and the VH and VL contain the amino acid sequences of SEQ ID NOs: 219 and 220.
[0125] In another embodiment, the isolated bispecific antibody disclosed herein comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), and the VH and VL contain the amino acid sequences of SEQ ID NOs: 249 and 250.
[0126] In another embodiment, the isolated bispecific antibody disclosed herein comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), and the VH and VL contain the amino acid sequences of SEQ ID NOs: 337 and 338.
[0127] In another embodiment, the isolated bispecific antibody disclosed herein comprises a heavy chain variable domain (VH) and a light chain variable domain (VL), and the VH and VL comprise the amino acid sequences shown in Table 1 or Table 10.
[0128] In another embodiment, the isolated bispecific antibody disclosed herein comprises VH and VL sequences that are at least 80%, 85%, 90%, 95%, 98%, or 99% identical to the VH and VL sequences disclosed herein.
[0129] In some embodiments, the isolated bispecific antibody comprises an antigen-binding domain site of an antibody comprising a VH domain and a VL domain that includes a combination of the above VH domain HCDRs and VL domain LCDRs. For example, but not limited to, in certain embodiments, the VH domain comprises a set of CDRs, HCDR1, HCDR2, and HCDR3, the amino acid sequence of HCDR1 is set forth in SEQ ID NO: 136, the amino acid sequence of HCDR2 is described as I HX1 Y D G S N K (SEQ ID NO: 142) (where HX1 is any amino acid), and the amino acid sequence of HCDR3 is A R HX2 HX3 HX4 HX5 HX6 HX7 HX8 HX9 HX10 HX11 F D HX12 (SEQ ID NO: 143) (where XH2, HX3, HX4, HX5, HX6, HX7, HX8, HX9, HX10, HX11, and HX12 are any amino acids), the VL domain comprises a set of CDRs, LCDR1, LCDR2, and LCDR3, the amino acid sequence of LCDR1 is described as LX1, LX2, G S K LX3 V (SEQ ID NO: 144) (where LX1, LX2, and LX3 are any amino acids), the amino acid sequence of LCDR2 is described as D D LX4 (SEQ ID NO: 145) (where LX4 is any amino acid), and the amino acid sequence of LCD3 is described as Q V W D LX5 LX6 S D LX7 V V (SEQ ID NO: 146) (where LX5, LX6, and LX7 are any amino acids).
[0130] In some embodiments, the VH domain comprises a set of CDRs, HCDR1, HCDR2, and HCDR3, the amino acid sequence of HCDR1 is set forth in SEQ ID NO: 136, the amino acid sequence of HCDR2 is set forth in SEQ ID NO: 137, HX1 is selected from the group consisting of W and S, the amino acid sequence of HCDR3 is set forth in SEQ ID NO: 138, HX2 is selected from the group consisting of A and S, HX3 is P, HX4 is Q, HX5 is W, HX6 is selected from the group consisting of E, Q, M, L, and V, HX7 is selected from the group consisting of L, W, and Y, HX8 is selected from the group consisting of V and T, HX9 is selected from the group consisting of H, A, and S, HX10 is E, HX11 is A, HX12 is selected from the group consisting of I, L, and M, the VL domain comprises a set of CDRs, LCDR1, LCDR2, and LCDR3, the amino acid sequence of LCDR1 is set forth in SEQ ID NO: 139, LX1 is selected from the group consisting of N, L, and I, LX2 is selected from the group consisting of L and I, LX3 is selected from the group consisting of S and L, the amino acid sequence of LCDR2 is set forth in SEQ ID NO: 140, LX4 is selected from the group consisting of S and G, the amino acid sequence of LCDR3 is set forth in SEQ ID NO: 141, LX5 is selected from the group consisting of S and T, LX6 is selected from the group consisting of S and G, and LX7 is selected from the group consisting of H and G.
[0131] In certain embodiments, the isolated bispecific antibody comprises a VH domain comprising a set of CDRs, HCDR1, HCDR2, and HCDR3, wherein the amino acid sequence of HCDR1 is set forth in SEQ ID NO: 136, the amino acid sequence of HCDR2 is set forth in SEQ ID NO: 137, HX1 is W, the amino acid sequence of HCDR3 is set forth in SEQ ID NO: 138, HX2 is selected from the group consisting of A and S, HX3 is P, HX4 is Q, HX5 is W, HX6 is selected from the group consisting of E and M, HX7 is selected from the group consisting of L and W, HX8 is selected from the group consisting of V and T, HX9 is selected from the group consisting of H and A, HX10 is E, HX11 is A, HX12 is selected from the group consisting of I and L, and comprises a VL domain comprising a set of CDRs, LCDR1, LCDR2, and LCDR3, wherein the amino acid sequence of LCDR1 is set forth in SEQ ID NO: 139, LX1 is L, LX2 is I, LX3 is L, the amino acid sequence of LCDR2 is set forth in SEQ ID NO: 140, LX4 is selected from the group consisting of S and G, the amino acid sequence of LCDR3 is set forth in SEQ ID NO: 141, LX5 is S, LX6 is S, and LX7 is selected from the group consisting of H and G.
[0132] In some embodiments, the bispecific antibody comprises a VH domain comprising a set of CDRs, HCDR1, HCDR2, and HCDR3, and a VL domain comprising a set of CDRs, LCDR1, LCDR2, and LCDR3, wherein the amino acid sequences of the respective CDRs are set forth in FIGS. 1A and 1B for the clones described in FIGS. 1A and 1B, and include, for example, without limitation, Clone C2: HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (where HX1 is W), HCDR3 (SEQ ID NO: 138) (where HX2 is A, HX3 is P, HX4 is Q, HX5 is W, HX6 is E, HX7 is L, HX8 is T, HX9 is A, HX10 is E, HX11 is A, HX12 is I), LCDR1 (SEQ ID NO: 139) (where LX1 is L, LX2 is I, LX3 is L), LCDR2 (SEQ ID NO: 140) (where LX4 is S), and LCDR3 (SEQ ID NO: 141) (where LX5 is S, LX6 is S, LX7 is G), Clone C6: HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (where HX1 is W), HCDR3 (SEQ ID NO: 138) (where HX2 is A, HX3 is P, HX4 is Q, HX5 is W, HX6 is M, HX7 is L, HX8 is V, HX9 is A, HX10 is E, HX11 is A, HX12 is L), LCDR1 (SEQ ID NO: 139) (where LX1 is L, LX2 is I, LX3 is L), LCDR2 (SEQ ID NO: 140) (where LX4 is S), and LCDR3 (SEQ ID NO: 141) (where LX5 is S, LX6 is S, LX7 is H); or Clone C9: HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (where HX1 is W), HCDR3 (SEQ ID NO: 138) (where HX2 is S, HX3 is P, HX4 is Q, HX5 is W, HX6 is E, HX7 is W, HX8 is V, HX9 is H, HX10 is E, HX11 is A, HX12 is L), LCDR1 (SEQ ID NO: 139) (where LX1 is L, LX2 is I, LX3 is L), LCDR2 (SEQ ID NO: 140) (where LX4 is G), and LCDR3 (SEQ ID NO: 141) (where LX5 is S, LX6 is S, LX7 is G).
[0133] In some embodiments, the bispecific antibody comprises a set of HCDRs disclosed herein and any VL domain. In some embodiments, the bispecific antibody comprises a set of LCDRs disclosed herein and any VH domain. In some embodiments, the bispecific antibody comprises a set of paired HCDR-LCDRs disclosed herein.
[0134] In certain embodiments, a bispecific antibody comprising a VH domain comprising an HCDR described herein can be encoded by a nucleic acid construct. In certain embodiments, a bispecific antibody comprising a VL domain comprising an LCDR described herein can be encoded by a nucleic acid construct. In certain embodiments, a bispecific antibody comprising a VH domain comprising an HCDR and a VL domain comprising an LCDR described herein can be encoded by a nucleic acid construct.
[0135] In certain embodiments, a bispecific antibody comprising a VH domain comprising an HCDR described herein can be encoded by a nucleic acid construct. In certain embodiments, a bispecific antibody comprising a VL domain comprising an LCDR described herein can be encoded by a nucleic acid construct. In certain embodiments, a bispecific antibody comprising a VH domain comprising an HCDR and a VL domain comprising an LCDR described herein can be encoded by a nucleic acid construct.
[0136] In certain embodiments, a bispecific antibody comprising a VH domain comprising an HCDR described herein can be included within a library of immunoglobulins. In certain embodiments, a bispecific antibody comprising a VL domain comprising an LCDR described herein can be included within a library of immunoglobulins. In certain embodiments, a bispecific antibody comprising a VH domain comprising an HCDR and a VL domain comprising an LCDR described herein can be included within a library of immunoglobulins.
[0137] In certain embodiments, a bispecific antibody comprising a VH domain comprising an HCDR described herein can be produced by expressing a nucleic acid construct comprising a nucleic acid sequence encoding the HCDR from a host cell and isolating the antibody. In certain embodiments, a bispecific antibody comprising a VL domain comprising an LCDR described herein can be produced by expressing a nucleic acid construct comprising a nucleic acid sequence encoding the LCDR from a host cell and isolating the antibody. In certain embodiments, a bispecific antibody comprising a VH domain comprising an HCDR and a VL domain comprising an LCDR described herein can be produced by expressing a nucleic acid construct comprising nucleic acid sequences encoding the HCDR and the LCDR from a host cell and isolating the antibody.
[0138] In certain embodiments, a bispecific antibody comprising a VH domain comprising an HCDR described herein can be administered in a method of treating a subject in need thereof, wherein the subject is suffering from a disease or condition including an allergic or respiratory condition, an inflammatory and / or autoimmune condition of the skin or gastrointestinal organs, scleroderma, or a tumor or cancer including Hodgkin's lymphoma. In certain embodiments, a bispecific antibody comprising a VL domain comprising an LCDR described herein can be administered in a method of treating a subject in need thereof, wherein the subject is suffering from a disease or condition including an allergic or respiratory condition, an inflammatory and / or autoimmune condition of the skin or gastrointestinal organs, scleroderma, or a tumor or cancer including Hodgkin's lymphoma. In certain embodiments, a bispecific antibody comprising a VH domain comprising an HCDR and a VL domain comprising an LCDR described herein can be administered in a method of treating a subject in need thereof, wherein the subject is suffering from a disease or condition including an allergic or respiratory condition, an inflammatory and / or autoimmune condition of the skin or gastrointestinal organs, scleroderma, or a tumor or cancer including Hodgkin's lymphoma.
[0139] In some embodiments, an antibody comprising the heavy chain variable region amino acid sequence set forth in SEQ ID NO: 1 or the light chain variable region amino acid sequence set forth in SEQ ID NO: 2, or a combination thereof, does not bind to an IL-13 epitope. Accordingly, the bispecific antibodies described herein are engineered to include a binding region not pre-existing in the antibody. In other words, bispecific antibodies include "re-epitoped" antibodies. When used throughout, the terms "engineered" and "re-epitoped" can be used interchangeably and have the same quality and meaning in certain embodiments. In some embodiments, "re-epitoped" antibodies include improved binding as compared to available antibodies. In some embodiments, "re-epitoped" antibodies include improved association and dissociation constants (K on and K off ) as compared to the parental antibody. In some embodiments, "re-epitoped" antibodies include improved stability as compared to the parental antibody. In certain embodiments, incorporating variant amino acid residues into at least two of a unique set of 21 variant sites within the CDRs and FRs of the VH and VL domains described herein results in a "re-epitoped" bispecific antibody that includes improved characteristics as compared to the parental antibody. These re-epitoped antibodies can provide advantageous features.
[0140] One of ordinary skill in the art will recognize that the "Fv" of an antibody encompasses the smallest fragment of the antibody that gives rise to a complete antigen-binding site. An Fv fragment consists of the variable region of a single heavy chain (VH) bound to the variable region of a single light chain (VL).
[0141] One of ordinary skill in the art will recognize that the "single-chain Fv antibody" or "scFv" with respect to an antibody encompasses engineered antibodies consisting of a VL domain and a VH domain that are directly or indirectly linked to each other via a peptide linker sequence. One of ordinary skill in the art will understand that the linker may, in some embodiments, include a linear amino acid sequence. In some embodiments, the linear amino acid sequence ("linker") includes an enzyme cleavage site and, in certain embodiments, may be referred to as a "cleavable linker" or "linker" or "cleavable peptide". In some embodiments, the linker may be a cleavable linker. In some embodiments, the linker may be a non-cleavable linker. In some embodiments, the linker sequence is set forth in SEQ ID NO: 147 (GGGGSGGGGSGGGGS; SEQ ID NO: 147).
[0142] In some embodiments, the peptide linker sequence contains, for example, Gly, Asn, or Ser residues in various combinations. Other substantially neutral amino acids such as Thr and Ala may also be included in the linker sequence.
[0143] Other amino acid sequences that can be usefully employed as linkers include those described in Maratea et al., Gene 40:39-46 (1985); Murphy et al., Proc. Natl. Acad. Sci. USA 83:8258-8262 (1986), U.S. Patent No. 4,935,233, U.S. Patent No. 4,751,180, Chaudhary et al., 1990, Proc. Natl. Acad. Sci. U.S.A. 87:1066-1070; Bird et al., 1988, Science 242:423-426, the entireties of which are incorporated herein by reference.
[0144] In some embodiments, the coding sequences of the VH and VL domains of a diabody or fragment thereof can be fused directly without any linker amino acids or by using a constructed flexible polypeptide linker.
[0145] In certain embodiments, the peptide linker is designed to allow the correct interaction between the two beta sheets forming the variable region of the single-chain antibody. Any suitable linker can be used to form an indirect bond, such as, but not limited to, a peptide linker, a polymer linker, and a chemical linker. In certain embodiments, the covalent bond is an indirect bond through a peptide linker.
[0146] In some embodiments, the antibody comprises a mutant immunoglobulin. Examples of mutant immunoglobulins include, but are not limited to, IgG that does not bind to antibody-dependent cell-mediated cytotoxicity (ADCC) components. 234 A / L 235 IgG containing the A(LALA) mutation cannot bind to the Fc receptor (see Xu D, Alegre ML, Varga SS, Rothermel AL, Collins AM, Pulito VL, et al.. In vitro characterization of five humanized OKT3 effector function variant antibodies. Cell Immunol. (2000) 200:16 - 26. 10.1006 / cimm.2000.1617). In some embodiments, the bispecific antibody comprises 234 A / L 235 IgG containing the A(LALA) mutation. The numbered mutations herein are based on the EU numbering convention used for the constant region (see Xu D, Alegre ML, Varga SS, Rothermel AL, Collins AM, Pulito VL, et al.. In vitro characterization of five humanized OKT3 effector function variant antibodies. Cell Immunol. (2000) 200:16 - 26. 10.1006 / cimm.2000.1617).
[0147] In some embodiments, the variant IgG includes IgG1 and the Fc region is engineered. In some embodiments, the variant IgG includes IgG2 and the Fc region is engineered. In some embodiments, the variant IgG includes IgG3 and the Fc region is engineered. In some embodiments, the variant IgG includes IgG4 and the Fc region is engineered. In certain embodiments, the mutations within the Fc region of the antibody abolish the immune effector functions of the antibody.
[0148] In some embodiments, the isolated bispecific antibody includes IgG, Fv, scFv, Fab, F(ab’)2, minibody, bispecific antibody, or tribody. In some embodiments, the isolated bispecific antibody includes IgG, and the IgG is IgG1, IgG2, IgG3, or IgG4.
[0149] In some embodiments, the isolated bispecific antibody includes a variant IgG that is unable to bind to antibody-dependent cellular cytotoxicity components.
[0150] In some embodiments, the bispecific antibodies described herein include IgG immunoglobulins. In some embodiments, the bispecific antibodies described herein include IgG1 immunoglobulins, IgG2 immunoglobulins, IgG3 immunoglobulins, or IgG4 immunoglobulins. In some embodiments, the bispecific antibody includes IgG1 immunoglobulins. In some embodiments, the bispecific antibody includes IgG2 immunoglobulins. In some embodiments, the bispecific antibody includes IgG3 immunoglobulins. In some embodiments, the bispecific antibody includes IgG4 immunoglobulins. In some embodiments, the bispecific antibody includes IgG1 immunoglobulins or IgG4 immunoglobulins.
[0151] In some embodiments, the bispecific antibodies described herein include Fab immunoglobulin fragments. In some embodiments, the bispecific antibodies described herein include F(ab’)2 It contains immunoglobulin fragments. In some embodiments, the bispecific antibodies described herein contain Fv immunoglobulin constructs. In some embodiments, the bispecific antibodies described herein contain scF immunoglobulin constructs. In some embodiments, the bispecific antibodies described herein contain minibody immunoglobulin constructs comprising a pair of single-chain Fv fragments linked via a CH3 domain.
[0152] In some embodiments, the bispecific antibodies described herein contain diabody immunoglobulin constructs. In some embodiments, a diabody immunoglobulin construct contains heavy chain variable (VH) and light chain variable (VL) regions linked by a small peptide linker. In some embodiments, a diabody immunoglobulin construct contains a single-chain (Fv)2 in which two scFv fragments are covalently bound to each other. In some embodiments, the bispecific antibodies described herein contain diabody immunoglobulin constructs comprising three scFv fragments covalently bound to each other. Diabodies have been shown in the art to have a dissociation constant up to 40-fold lower than the corresponding scFv, which means they have a much higher affinity for their targets. As a result, the use of diabodies in the methods of use described below can result in a much lower dosage of diabody or tribody than IgG containing the same VH and VL domains.
[0153] In some embodiments, the bispecific antibody contains a linker or linkers between the binding components, for example, but not limited to, between VH and VL in an scFv, minibody, diabody, tribody, or tetrabody. In some embodiments, the bispecific antibody does not contain a linker or linkers between the binding components, for example, but not limited to, between VH and VL in an scFv, minibody, diabody, tribody, or tetrabody. In some embodiments, the linker may contain a single amino acid. In some embodiments, the linker contains any linker known in the art. In some embodiments, the linker contains the amino acid sequence set forth in SEQ ID NO: 147.
[0154] One of ordinary skill in the art will understand that the term "variant", for example, includes polypeptides that are different from a specifically recited polypeptide sequence, such as the amino acid sequences set forth in SEQ ID NO: 1 and SEQ ID NO: 2, which are generated using recombinant DNA techniques by one or more amino acid insertions, deletions, and / or substitutions. Variants of the antigen-binding molecules disclosed herein include antigen-binding molecules in which one or some of the amino acid residues are modified by at least one substitution, addition, and / or deletion such that the antigen-binding affinity is newly generated within the antigen-binding molecule.
[0155] The dual-binding portion of the antibody described herein includes an immunoglobulin heavy chain variable region and an immunoglobulin light chain variable region (VH and VL, respectively). The amino acid sequence set forth in SEQ ID NO: 1 includes the VH template, and the amino acid sequence set forth in SEQ ID NO: 2 includes the VL template. The dual-binding region includes at least two variants within the VH template sequence, or within the VL template sequence, or a combination thereof.
[0156] One of ordinary skill in the art would understand that "isolated bispecific antibody" encompasses, in certain embodiments, (1) an antibody that does not contain at least some other proteins that would typically be found naturally or that would typically be found during its synthesis, (2) an antibody that is essentially free of other non-identical binding antibodies from the same source, (3) an antibody that can be recombinantly expressed by a cell, (4) an antibody that is separated from at least about 50 percent of polynucleotides, lipids, carbohydrates, or other materials associated during synthesis, or (5) an antibody that does not occur naturally, or a combination thereof. Such isolated antibodies may be encoded by genomic DNA, cDNA, mRNA, or other RNA, may be of synthetic origin, or may be any combination thereof. In certain embodiments, the isolated antibody is substantially free of proteins or polypeptides or other contaminants that would interfere with its use (therapeutic, diagnostic, prophylactic, research, or other). Throughout use, the terms "bispecific antibody" and "bispecific binding antibody" may be used interchangeably and have all the same meanings and qualities.
[0157] In some embodiments, a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 1, having at least one amino acid variant at any one of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT numbering of heavy chain variable region variant positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or a combination thereof), a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 2, having at least one amino acid variant at any one of positions 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT numbering of light chain variable region variant positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or a combination thereof), or an isolated bispecific antibody comprising a combination of a variant heavy chain variable region and a variant light chain variable region is disclosed herein, and the total number of variant positions in the heavy chain variable region, the light chain variable region, or the combination thereof is at least 2.
[0158] IMGT® is the international ImMunoGeneTics Information system® (Nucleic Acids Res. 2015 Jan;43(Database issue):D413-22.doi:10.1093 / nar / gku1056.Epub 2014 Nov 5 Free article.PMID:25378316 LIGM:441 and Dev Comp See Immunol. 2003 Jan; 27(1): 55-77). IMGT is a unique numbering system for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains (Lefranc MP1, Pommie C, Ruiz M, Giudicelli V, Foulquier E, Truong L, Thouvenin-Contet V, Lefranc G. Dev Comp Immunol 27: 55-77. (2003)). IMGT® takes into account the Kabat definitions of FRs and CDRs, structural data, and the Chothia characterization of hypervariable loops, combines them, and presents a uniform numbering system for these IG and TcR variable domain sequences based on aligning five or more IG and TcR variable region sequences. IMGT is considered a universal numbering scheme for antibodies well-known in the art.
[0159] When describing variant amino acid positions present in the VH and VL domains, in some embodiments, IMGT numbering is used. In some embodiments, the variant amino acid positions are presented as specific positions within a given sequence, e.g., without limitation, within SEQ ID NO: 1 and SEQ ID NO: 2. In some embodiments, the variant amino acid positions are identified by both a specific position within a given SEQ ID NO: sequence and the IMGT numbering system. One of ordinary skill in the art will recognize that the actual amino acid position numbers of the amino acids identified by the position numbers relative to the SEQ ID NOs may differ from the IMGT numbering system, but the residues identified are the same. For example, without limitation, the amino acid residue at position 106 of SEQ ID NO: 1 is the same residue identified as position 112 by the IMGT numbering system. One of ordinary skill in the art will recognize that the same amino acid residue may be identified as having different positions depending on which system is used, but the positions and identities of the amino acid residues within the contiguous amino acid sequence will be apparent.
[0160] In some embodiments, a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 1, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 2, optionally wherein the amino acid sequence of SEQ ID NO: 2 comprises at least one variant amino acid, having at least one amino acid variant at any one of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT numbering of heavy chain variable region variant positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or a combination thereof), are disclosed herein, and the total number of variant positions in the heavy chain variable region, light chain variable region, or combination thereof is at least 2. In some embodiments, a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 1, and any light chain variable region, having at least two amino acid variants at any one of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT numbering of heavy chain variable region variant positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or a combination thereof), are disclosed herein.
[0161] The amino acid sequences of many light chain variable regions are known per se in the art. One of ordinary skill in the art could use such known sequences in combination with the heavy chain variable regions described herein and analyze the bispecific binding using routine methodologies and techniques well known in the art (e.g., see, but not limited to, Example 1 below).
[0162] In some embodiments, an isolated bispecific antibody comprising a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 2 having at least one amino acid variant at any one of positions 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT numbering 27, 28, 38, 65, 70, 94, 109, 110, or 115 of the light chain variable region variant positions, or a combination thereof), and a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 1, optionally, the amino acid sequence of SEQ ID NO: 1 comprises at least one variant amino acid, is disclosed herein, and the total number of variant positions in the heavy chain variable region, the light chain variable region, or a combination thereof is at least 2. In some embodiments, an isolated bispecific antibody comprising a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 2 having at least two amino acid variants at any one of positions 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT numbering 27, 28, 38, 65, 70, 94, 109, 110, or 115 of the light chain variable region variant positions, or a combination thereof), and any heavy chain variable region is disclosed herein.
[0163] The amino acid sequences of many heavy chain variable regions are known per se in the art. One of ordinary skill in the art could use such known sequences in combination with the light chain variable regions described herein and analyze the bispecificity using routine methodologies and techniques well known in the art (see, for example, but not limited to, Example 1 below).
[0164] In some embodiments, the VH domain described herein comprises the amino acid sequence set forth in SEQ ID NO: 1 and has at least one amino acid variant at any position. In some embodiments, the VH comprising the amino acid sequence set forth in SEQ ID NO: 1 comprises at least two amino acid variants at any position. In some embodiments, the VH comprising the amino acid sequence set forth in SEQ ID NO: 1 comprises at least 1 to 10 amino acid variants at any position. In some embodiments, the VH comprising the amino acid sequence set forth in SEQ ID NO: 1 comprises 1 to 5 amino acid variants at any position. In some embodiments, the VH comprising the amino acid sequence set forth in SEQ ID NO: 1 comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acid variants at any position.
[0165] In some embodiments, the VL domain described herein comprises the amino acid sequence set forth in SEQ ID NO: 2 and has at least one amino acid variant at any position. In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 comprises at least two amino acid variants at any position. In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 comprises at least 1 to 10 amino acid variants at any position. In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 comprises 1 to 5 amino acid variants at any position. In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino acid variants at any position.
[0166] In some embodiments, the VH and VL domains described herein that include the amino acid sequences set forth in SEQ ID NO: 1 and SEQ ID NO: 2 have scrupulously the combined number of at least 2 variant positions. In some embodiments, the VH and VL domains described herein that include the amino acid sequences set forth in SEQ ID NO: 1 and SEQ ID NO: 2 have scrupulously the combined number of 2 to 20 variant positions. In some embodiments, the VH and VL domains described herein that include the amino acid sequences set forth in SEQ ID NO: 1 and SEQ ID NO: 2 have scrupulously the combined number of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 variant positions. In some embodiments, the VH and VL domains described herein that include the amino acid sequences set forth in SEQ ID NO: 1 and SEQ ID NO: 2 have scrupulously the combined number of more than 20 variant positions.
[0167] In certain embodiments, the bispecific antibody binding regions described herein each include a set of heavy and light chain CDRs that are interposed between a set of heavy and light chain framework regions (FRs) that provide support to the CDRs and define the spatial relationship of the CDRs to each other. As used herein, the term "set of CDRs" refers to the three hypervariable regions of a heavy chain variable region or a light chain variable region. Proceeding from the N-terminus of a heavy or light chain polypeptide, these regions are designated "CDR1", "CDR2", and "CDR3", respectively. Thus, an antigen binding site includes six CDRs, including a set of CDRs from each of the heavy and light chain variable regions. Crystallographic analysis of some antigen-antibody complexes has shown that the amino acid residues of the CDRs contact the bound antigen extensively, and that the most extensive antigen contact is with the heavy chain CDR3. Thus, the CDR regions are primarily involved in the specificity of the antigen binding site.
[0168] As used herein, the term "FR set" refers to four adjacent amino acid sequences that form the CDRs of a CDR set of a heavy chain variable region or a light chain variable region. Some FR residues may contact the bound antigen, but the FRs are mainly involved in folding the variable region into the antigen-binding site, particularly the FR residues immediately adjacent to the CDRs. Within the FRs, certain amino residues and certain structural features are highly conserved. In this regard, all variable region sequences contain an internal disulfide loop of about 90 amino acid residues. When the variable region is folded into the binding site, the CDRs are presented as protruding loop motifs that form the antigen-binding surface. It is generally recognized that there are conserved structural regions of the FRs, which affects the folded shape of the CDR loops into a particular "reference" structure regardless of the exact CDR amino acid sequence. Further, certain FR residues are known to be involved in non-covalent domain-to-domain contacts that stabilize the interaction between the heavy and light chains of the antibody.
[0169] In some embodiments, at least one variant in the VH contains variant amino acids in the CDR region. In some embodiments, at least one variant in the VL contains variant amino acids in the CDR region. In some embodiments, at least one variant in the VH contains variant amino acids in the FR region. In some embodiments, at least one variant in the VL contains variant amino acids in the FR region. In some embodiments, at least two variants in the VH contain variant amino acids in the CDR region, the FR region, or both. In some embodiments, at least two variants in the VL contain variant amino acids in the CDR region, the FR region, or both. In some embodiments, the variant positions in the VH contain variants in at least one CDR and at least one FR region. In some embodiments, the variant positions in the VL contain variants in at least one CDR and at least one FR region.
[0170] In some embodiments, the VH comprising the amino acid sequence set forth in SEQ ID NO: 1 comprises an amino acid variant at position 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT numbering of heavy chain variable region variant positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or a combination thereof). In some embodiments, the VH comprising the amino acid sequence set forth in SEQ ID NO: 1 comprises an amino acid variant at position 52 (IMGT position 57). In some embodiments, the VH comprising the amino acid sequence set forth in SEQ ID NO: 1 comprises an amino acid variant at position 99 (IMGT position 107). In some embodiments, the VH comprising the amino acid sequence set forth in SEQ ID NO: 1 comprises an amino acid variant at position 100 (IMGT position 108). In some embodiments, the VH comprising the amino acid sequence set forth in SEQ ID NO: 1 comprises an amino acid variant at position 101 (IMGT position 109). In some embodiments, the VH comprising the amino acid sequence set forth in SEQ ID NO: 1 comprises an amino acid variant at position 102 (IMGT position 110). In some embodiments, the VH comprising the amino acid sequence set forth in SEQ ID NO: 1 comprises an amino acid variant at position 103 (IMGT position 111). In some embodiments, the VH comprising the amino acid sequence set forth in SEQ ID NO: 1 comprises an amino acid variant at position 104 (IMGT position 111A). In some embodiments, the VH comprising the amino acid sequence set forth in SEQ ID NO: 1 comprises an amino acid variant at position 105 (IMGT position 112A). In some embodiments, the VH comprising the amino acid sequence set forth in SEQ ID NO: 1 comprises an amino acid variant at position 106 (IMGT position 112). In some embodiments, the VH comprising the amino acid sequence set forth in SEQ ID NO: 1 comprises an amino acid variant at position 107 (IMGT position 113). In some embodiments, the VH comprising the amino acid sequence set forth in SEQ ID NO: 1 comprises an amino acid variant at position 108 (IMGT position 114). In some embodiments, the VH comprising the amino acid sequence set forth in SEQ ID NO: 1 comprises an amino acid variant at position 111 (IMGT position 117).
[0171] In some embodiments, the VH comprising the amino acid sequence set forth in SEQ ID NO: 1 comprises an amino acid variant at position 52 (IMGT position 57) and 1 to 3 additional variant amino acids. In some embodiments, the VH comprising the amino acid sequence set forth in SEQ ID NO: 1 comprises an amino acid variant at position 99 (IMGT position 107) and 1 to 3 additional variant amino acids. In some embodiments, the VH comprising the amino acid sequence set forth in SEQ ID NO: 1 comprises an amino acid variant at position 100 (IMGT position 108) and 1 to 3 additional variant amino acids. In some embodiments, the VH comprising the amino acid sequence set forth in SEQ ID NO: 1 comprises an amino acid variant at position 101 (IMGT position 109) and 1 to 3 additional variant amino acids. In some embodiments, the VH comprising the amino acid sequence set forth in SEQ ID NO: 1 comprises an amino acid variant at position 102 (IMGT position 110) and 1 to 3 additional variant amino acids. In some embodiments, the VH comprising the amino acid sequence set forth in SEQ ID NO: 1 comprises an amino acid variant at position 103 (IMGT position 111) and 1 to 3 additional variant amino acids. In some embodiments, the VH comprising the amino acid sequence set forth in SEQ ID NO: 1 comprises an amino acid variant at position 104 (IMGT position 111A) and 1 to 3 additional variant amino acids. In some embodiments, the VH comprising the amino acid sequence set forth in SEQ ID NO: 1 comprises an amino acid variant at position 105 (IMGT position 112A) and 1 to 3 additional variant amino acids. In some embodiments, the VH comprising the amino acid sequence set forth in SEQ ID NO: 1 comprises an amino acid variant at position 106 (IMGT position 112) and 1 to 3 additional variant amino acids. In some embodiments, the VH comprising the amino acid sequence set forth in SEQ ID NO: 1 comprises an amino acid variant at position 107 (IMGT position 113) and 1 to 3 additional variant amino acids. In some embodiments, the VH comprising the amino acid sequence set forth in SEQ ID NO: 1 comprises an amino acid variant at position 108 (IMGT position 114) and 1 to 3 additional variant amino acids.In some embodiments, the VH comprising the amino acid sequence set forth in SEQ ID NO: 1 comprises an amino acid variant at position 111 (IMGT position 117) and 1 to 3 additional variant amino acids.
[0172] In some embodiments, the VH comprising the amino acid sequence set forth in SEQ ID NO: 1 comprises amino acid variants at positions 105 and 106 (IMGT positions 112A and 112). In some embodiments, the VH comprising the amino acid sequence set forth in SEQ ID NO: 1 comprises amino acid variants at positions 106 and 111 (IMGT positions 112 and 117). In some embodiments, the VH comprising the amino acid sequence set forth in SEQ ID NO: 1 comprises amino acid variants at positions 103 and 106 (IMGT positions 111 and 112). In some embodiments, the VH comprising the amino acid sequence set forth in SEQ ID NO: 1 comprises amino acid variants at positions 104 and 106 (IMGT positions 111A and 112). In some embodiments, the VH comprising the amino acid sequence set forth in SEQ ID NO: 1 comprises amino acid variants at positions 104, 106 and 111 (IMGT positions 111A, 112 and 117). In some embodiments, the VH comprising the amino acid sequence set forth in SEQ ID NO: 1 comprises amino acid variants at positions 105, 106 and 111 (IMGT positions 112A, 112 and 117). In some embodiments, the VH comprising the amino acid sequence set forth in SEQ ID NO: 1 comprises amino acid variants at positions 103, 106 and 111 (IMGT positions 111, 112 and 117). In some embodiments, the VH comprising the amino acid sequence set forth in SEQ ID NO: 1 comprises amino acid variants at positions 99, 104 and 111 (IMGT positions 107, 111A and 117). In some embodiments, the VH comprising the amino acid sequence set forth in SEQ ID NO: 1 comprises amino acid variants at positions 52, 99, 104 and 111 (IMGT positions 57, 107, 111A and 117).
[0173] In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 comprises an amino acid variant at any one of positions 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT numbering of light chain variable region variant positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or a combination thereof). In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 comprises an amino acid variant at position 26 (IMGT position 27). In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 comprises an amino acid variant at position 27 (IMGT position 28). In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 comprises an amino acid variant at position 31 (IMGT position 38). In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 comprises an amino acid variant at position 51 (IMGT position 65). In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 comprises an amino acid variant at position 56 (IMGT position 70). In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 comprises an amino acid variant at position 77 (IMGT position 94). In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 comprises an amino acid variant at position 92 (IMGT position 109). In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 comprises an amino acid variant at position 93 (IMGT position 110). In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 comprises an amino acid variant at position 96 (IMGT position 115).
[0174] In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 comprises an amino acid variant at position 26 (IMGT position 27) and 1 to 7 additional variant amino acids. In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 comprises an amino acid variant at position 27 (IMGT position 28) and 1 to 7 additional variant amino acids. In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 comprises an amino acid variant at position 31 (IMGT position 38) and 1 to 7 additional variant amino acids. In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 comprises an amino acid variant at position 51 (IMGT position 65) and 1 to 7 additional variant amino acids. In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 comprises an amino acid variant at position 56 (IMGT position 70) and 1 to 7 additional variant amino acids. In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 comprises an amino acid variant at position 77 (IMGT position 94) and 1 to 7 additional variant amino acids. In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 comprises an amino acid variant at position 92 (IMGT position 109) and 1 to 7 additional variant amino acids. In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 comprises an amino acid variant at position 93 (IMGT position 110) and 1 to 7 additional variant amino acids. In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 comprises an amino acid variant at position 96 (IMGT position 115) and 1 to 7 additional variant amino acids.
[0175] In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 comprises amino acid variants at positions 26, 27, 31, 56, 77, and 96 (IMGT positions 27, 28, 38, 70, 94, and 115). In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 comprises amino acid variants at positions 26, 27, 31, 56, 77, 92, and 96 (IMGT positions 27, 28, 38, 70, 94, 109, and 115). In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 comprises amino acid variants at positions 26, 31, 56, and 77 (IMGT positions 27, 38, 70, and 94). In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 comprises amino acid variants at positions 26, 27, 31, 56, and 77 (IMGT positions 27, 28, 38, 70, and 94). In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 comprises amino acid variants at positions 26, 27, 31, 56, 77, and 92 (IMGT positions 27, 28, 38, 70, 94, and 109). In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 comprises amino acid variants at positions 26, 27, 31, 51, 56, 77, and 92 (IMGT positions 27, 28, 38, 65, 70, 94, and 109). In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 comprises amino acid variants at positions 26, 31, 56, 77, 92, and 96 (IMGT positions 27, 38, 70, 94, 109, and 115). In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 comprises amino acid variants at positions 26, 31, 77, and 92 (IMGT positions 27, 38, 94, and 109). In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 comprises amino acid variants at positions 26, 27, 31, 56, 77, and 93 (IMGT positions 27, 28, 38, 70, 94, and 110). In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 comprises amino acid variants at positions 26, 27, 31, 56, 77, 93, and 96 (IMGT positions 27, 28, 38, 70, 94, 110, and 115).In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 contains amino acid variants at positions 26, 27, 31, 51, 77, 93, and 96 (IMGT positions 27, 28, 38, 65, 94, 110, and 115). In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 contains amino acid variants at positions 26, 27, 31, 56, 77, 93, and 96 (IMGT positions 27, 28, 38, 70, 94, 110, and 115). In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 contains amino acid variants at positions 27, 31, 56, 77, and 96 (IMGT positions 28, 38, 70, 94, and 115). In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 contains amino acid variants at positions 27, 31, 56, 77, 92, and 96 (IMGT positions 28, 38, 70, 94, 109, and 115). In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 contains amino acid variants at positions 26, 27, 31, 51, 77, and 96 (IMGT positions 27, 28, 38, 65, 94, and 115). In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 contains amino acid variants at positions 26, 27, 31, or 96 (IMGT positions 27, 28, 38, and 115), or any combination thereof.
[0176] In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 contains an amino acid variant at a position in the framework region at either position 56 or 77 of SEQ ID NO: 2, or a combination thereof (IMGT position 70 or 94, or a combination thereof). In some embodiments, the VL comprising the amino acid sequence set forth in SEQ ID NO: 2 contains at least one amino acid variant at a position in the framework region at either position 56 or 77 of SEQ ID NO: 2, or a combination thereof (IMGT position 70 or 94, or a combination thereof), wherein the variant amino acid at position 56 comprises leucine, alanine, arginine, lysine, aspartic acid, glycine, or glutamic acid, and / or the variant amino acid at position 77 comprises valine.
[0177] In some embodiments, an isolated bispecific antibody is disclosed herein that comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 1 and having at least one amino acid variant at any of positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117 (IMGT), or a combination thereof, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 2 and having at least one amino acid variant at any of positions 27, 28, 38, 65, 70, 94, 109, 110, or 115 (IMGT), or a combination thereof, wherein the total number of variant positions in the bispecific antibody is at least 2.
[0178] In some embodiments, the isolated bispecific antibody comprises a variant VH or a variant VL, or a combination thereof, having variant amino acids at positions other than (IMGT) 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117 in the heavy chain variable region and / or (IMGT) 27, 28, 38, 65, 70, 94, 109, 110, or 115 in the light chain variable region.
[0179] In some embodiments, at least one amino acid variant in VH contains a variant amino acid in the CDR region. In some embodiments, at least one amino acid variant in VH contains a variant amino acid in the CDR1 region. In some embodiments, at least one amino acid variant in VH contains a variant amino acid in the CDR2 region. In some embodiments, at least one amino acid variant in VH contains a variant amino acid in the CDR3. In some embodiments, at least two amino acid variants in VH contain variant amino acids in two different CDR regions. In some embodiments, at least two amino acid variants in VH contain variant amino acids in the same CDR region. In some embodiments, at least two amino acid variants in VH contain variant amino acids in the same CDR1 region. In some embodiments, at least two amino acid variants in VH contain variant amino acids in the same CDR2 region. In some embodiments, at least two amino acid variants in VH contain variant amino acids in the same CDR3 region. In some embodiments, at least two amino acid variants in VH contain variant amino acids in the CDR1 and CDR2 regions. In some embodiments, at least two amino acid variants in VH contain variant amino acids in the CDR1 and CDR3 regions. In some embodiments, at least two amino acid variants in VH contain variant amino acids in the CDR2 and CDR3 regions. In some embodiments, at least three amino acid variants in VH contain variant amino acids in a single CDR region. In some embodiments, at least three amino acid variants in VH contain variant amino acids in the CDR1 region. In some embodiments, at least three amino acid variants in VH contain variant amino acids in the CDR2 region. In some embodiments, at least three amino acid variants in VH contain variant amino acids in the CDR3 region. In some embodiments, at least three amino acid variants in VH contain variant amino acids in the CDR1 region and the CDR2 region.In some embodiments, at least three amino acid variants in VH contain variant amino acids in the CDR1 region and the CDR3 region. In some embodiments, at least three amino acid variants in VH contain variant amino acids in the CDR2 region and the CDR3 region. In some embodiments, at least three amino acid variants in VH contain variant amino acids in the CDR1 region, the CDR2 region, and the CDR3 region. In some embodiments, at least four amino acid variants in VH contain variant amino acids in a single CDR region. In some embodiments, at least four amino acid variants in VH contain variant amino acids in the CDR1 region. In some embodiments, at least four amino acid variants in VH contain variant amino acids in the CDR2 region. In some embodiments, at least four amino acid variants in VH contain variant amino acids in the CDR3 region. In some embodiments, at least four amino acid variants in VH contain variant amino acids in the CDR1 region and the CDR2 region. In some embodiments, at least four amino acid variants in VH contain variant amino acids in the CDR1 region and the CDR3 region. In some embodiments, at least four amino acid variants in VH contain variant amino acids in the CDR2 region and the CDR3 region. In some embodiments, at least four amino acid variants in VH contain variant amino acids in the CDR1 region, the CDR2 region, and the CDR3 region. In some embodiments, when there are five or more amino acid variants in VH, the variant positions contain variant amino acids in a single CDR region. In some embodiments, when there are five or more amino acid variants in VH, the variant positions contain amino acids in the CDR1 region. In some embodiments, when there are five or more amino acid variants in VH, the variant positions contain variant amino acids in the CDR2 region. In some embodiments, when there are five or more amino acid variants in VH, the variant positions contain variant amino acids in the CDR3 region.In some embodiments, when there are five or more amino acid variants in VH, the variant positions contain variant amino acids in the CDR1 region and the CDR2 region. In some embodiments, when there are five or more amino acid variants in VH, the variant positions contain variant amino acids in the CDR1 region and the CDR3 region. In some embodiments, when there are five or more amino acid variants in VH, the variant positions contain variant amino acids in the CDR2 region and the CDR3 region. In some embodiments, when there are five or more amino acid variants in VH, the variant positions contain variant amino acids in the CDR1 region, the CDR2 region, and the CDR3 region.
[0180] In some embodiments, at least one amino acid variant in VL contains a variant amino acid in the CDR region. In some embodiments, at least one amino acid variant in VL contains a variant amino acid in the CDR1 region. In some embodiments, at least one amino acid variant in VL contains a variant amino acid in the CDR2 region. In some embodiments, at least one amino acid variant in VL contains a variant amino acid in CDR3. In some embodiments, at least two amino acid variants in VL contain variant amino acids in two different CDR regions. In some embodiments, at least two amino acid variants in VL contain variant amino acids in the same CDR region. In some embodiments, at least two amino acid variants in VL contain variant amino acids in the same CDR1 region. In some embodiments, at least two amino acid variants in VL contain variant amino acids in the same CDR2 region. In some embodiments, at least two amino acid variants in VL contain variant amino acids in the same CDR3 region. In some embodiments, at least two amino acid variants in VL contain variant amino acids in the CDR1 and CDR2 regions. In some embodiments, at least two amino acid variants in VL contain variant amino acids in the CDR1 and CDR3 regions. In some embodiments, at least two amino acid variants in VL contain variant amino acids in the CDR2 and CDR3 regions. In some embodiments, at least three amino acid variants in VL contain variant amino acids in a single CDR region. In some embodiments, at least three amino acid variants in VL contain variant amino acids in the CDR1 region. In some embodiments, at least three amino acid variants in VL contain variant amino acids in the CDR2 region. In some embodiments, at least three amino acid variants in VL contain variant amino acids in the CDR3 region. In some embodiments, at least three amino acid variants in VL contain variant amino acids in the CDR1 region and the CDR2 region.In some embodiments, at least three amino acid variants in VL contain variant amino acids in the CDR1 region and the CDR3 region. In some embodiments, at least three amino acid variants in VL contain variant amino acids in the CDR2 region and the CDR3 region. In some embodiments, at least three amino acid variants in VL contain variant amino acids in the CDR1 region, the CDR2 region, and the CDR3 region. In some embodiments, at least four amino acid variants in VL contain variant amino acids in a single CDR region. In some embodiments, at least four amino acid variants in VL contain variant amino acids in the CDR1 region. In some embodiments, at least four amino acid variants in VL contain variant amino acids in the CDR2 region. In some embodiments, at least four amino acid variants in VL contain variant amino acids in the CDR3 region. In some embodiments, at least four amino acid variants in VL contain variant amino acids in the CDR1 region and the CDR2 region. In some embodiments, at least four amino acid variants in VL contain variant amino acids in the CDR1 region and the CDR3 region. In some embodiments, at least four amino acid variants in VL contain variant amino acids in the CDR2 region and the CDR3 region. In some embodiments, at least four amino acid variants in VL contain variant amino acids in the CDR1 region, the CDR2 region, and the CDR3 region. In some embodiments, when there are five amino acid variants in VL, the variant positions contain variant amino acids in a single CDR region. In some embodiments, when there are five amino acid variants in VL, the variant positions contain amino acids in the CDR1 region. In some embodiments, when there are five amino acid variants in VL, the variant positions contain variant amino acids in the CDR2 region. In some embodiments, when there are five amino acid variants in VL, the variant positions contain variant amino acids in the CDR3 region. In some embodiments, when there are five amino acid variants in VL, the variant positions contain variant amino acids in the CDR1 region and the CDR2 region.In some embodiments, when there are five amino acid variants in the VL, the variant positions contain variant amino acids in the CDR1 region and the CDR3 region. In some embodiments, when there are five amino acid variants in the VL, the variant positions contain variant amino acids in the CDR2 region and the CDR3 region. In some embodiments, when there are five amino acid variants in the VL, the variant positions contain variant amino acids in the CDR1 region, the CDR2 region, and the CDR3 region. In some embodiments, when there are six amino acid variants in the VL, the variant positions contain variant amino acids in a single CDR region. In some embodiments, when there are six amino acid variants in the VL, the variant positions contain amino acids in the CDR1 region. In some embodiments, when there are six amino acid variants in the VL, the variant positions contain variant amino acids in the CDR2 region. In some embodiments, when there are six amino acid variants in the VL, the variant positions contain variant amino acids in the CDR3 region. In some embodiments, when there are six amino acid variants in the VL, the variant positions contain variant amino acids in the CDR1 region and the CDR2 region. In some embodiments, when there are six amino acid variants in the VL, the variant positions contain variant amino acids in the CDR1 region and the CDR3 region. In some embodiments, when there are six amino acid variants in the VL, the variant positions contain variant amino acids in the CDR2 region and the CDR3 region. In some embodiments, when there are six amino acid variants in the VL, the variant positions contain variant amino acids in the CDR1 region, the CDR2 region, and the CDR3 region. In some embodiments, when there are seven or more amino acid variants in the VL, the variant positions contain variant amino acids in a single CDR region. In some embodiments, when there are seven or more amino acid variants in the VL, the variant positions contain amino acids in the CDR1 region. In some embodiments, when there are seven or more amino acid variants in the VL, the variant positions contain variant amino acids in the CDR2 region.In some embodiments, when there are seven or more amino acid variants in VL, the variant positions contain variant amino acids in the CDR3 region. In some embodiments, when there are seven or more amino acid variants in VL, the variant positions contain variant amino acids in the CDR1 region and the CDR2 region. In some embodiments, when there are seven or more amino acid variants in VL, the variant positions contain variant amino acids in the CDR1 region and the CDR3 region. In some embodiments, when there are seven or more amino acid variants in VL, the variant positions contain variant amino acids in the CDR2 region and the CDR3 region. In some embodiments, when there are seven or more amino acid variants in VL, the variant positions contain variant amino acids in the CDR1 region, the CDR2 region, and the CDR3 region.
[0181] In some embodiments, an amino acid variant includes a substitution of one amino acid residue for another amino acid residue. In some embodiments, an amino acid variant includes a substitution of a hydrophobic residue for a non-hydrophobic residue. In some embodiments, an amino acid variant includes a substitution of a charged residue for a non-charged residue. In some embodiments, an amino acid variant includes a neutral substitution where the substituted amino acid has similar properties. In some embodiments, an amino acid variant includes a substitution of an aromatic residue for a non-aromatic residue. In some embodiments, natural aromatic amino acids such as Trp, Tyr, and Phe are substituted with synthetic non-natural acids such as phenylglycine, TIC, naphthyranine (Nol), ring-methylated derivatives of Phe, halogenated derivatives of Phe, or o-methyl-Tyr. In some embodiments, variant substitutions include substituting a modified amino acid or a non-amino acid monomer (e.g., fatty acid, complex carbohydrate, etc.). One of ordinary skill in the art will understand that the selection of amino acid residues at each variant position can affect the 3D structure of VH, VL, and / or combinations thereof in a particular embodiment, but the selection of amino acid residues at each variant position is considered independently.
[0182] In some embodiments, "amino acid" or "amino acid residue" or "residue" includes the 20 naturally occurring, encoded amino acid residues, and those amino acids that are often modified after translation in vivo, including, for example, hydroxyproline, phosphoserine, and phosphothreonine, as well as other non-conventional amino acids including, but not limited to, 2-aminoadipic acid, hydroxylysine, isodomosine, nor-valine, nor-leucine, and ornithine. In some embodiments, "amino acid" includes both D-amino acids and L-amino acids. In some embodiments, the amino acid variant substitution is a D-amino acid. In some embodiments, the amino acid variant substitution is an L-amino acid. In some embodiments, the variant residue includes naturally occurring amino acids. In some embodiments, the variant residue includes naturally occurring, encoded amino acid residues. In some embodiments, the variant residue includes naturally occurring, non-encoded amino acid residues. In some embodiments, the variant residue includes non-naturally occurring amino acids.
[0183] In some embodiments, the variant residue includes non-naturally occurring, non-proteinogenic amino acids.
[0184] In some embodiments, the amino acid sequence of the VH domain of the bispecific antibody is selected from the sequences set forth in any of SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, and 54, without limitation. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region comprising the amino acid sequence set forth in any of SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, and 54, and an optional variable light chain region. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 4 and an optional variable light chain region. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 6 and an optional variable light chain region. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 8 and an optional variable light chain region. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 10 and an optional variable light chain region. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 12 and an optional variable light chain region. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 14 and an optional variable light chain region. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 16 and an optional variable light chain region. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 18 and an optional variable light chain region. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 20 and an optional variable light chain region. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 22 and an optional variable light chain region. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 24 and an optional variable light chain region.In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 26 and any variable light chain region. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 28 and any variable light chain region. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 30 and any variable light chain region. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 32 and any variable light chain region. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 34 and any variable light chain region. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 36 and any variable light chain region. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 38 and any variable light chain region. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 40 and any variable light chain region. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 42 and any variable light chain region. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 44 and any variable light chain region. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 46 and any variable light chain region. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 48 and any variable light chain region. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 50 and any variable light chain region. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 52 and any variable light chain region. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 54 and any variable light chain region.
[0185] In some embodiments, the amino acid sequence of the VH domain of the bispecific antibody is one of those described in Table 1 or Table 10. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region comprising one of the amino acid sequences described in Table 1 or Table 10, and an optional variable light chain region.
[0186] In some embodiments, the amino acid sequence of the VL domain of the bispecific antibody is selected, without limitation, from the sequences set forth in SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, and 53. In some embodiments, the isolated bispecific antibody comprises a light chain variable region comprising the amino acid sequence set forth in any of SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, and 53, and any variable heavy chain region. In some embodiments, the isolated bispecific antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 3, and any variable heavy chain region. In some embodiments, the isolated bispecific antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 5, and any variable heavy chain region. In some embodiments, the isolated bispecific antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 7, and any variable heavy chain region. In some embodiments, the isolated bispecific antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 9, and any variable heavy chain region. In some embodiments, the isolated bispecific antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 11, and any variable heavy chain region. In some embodiments, the isolated bispecific antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 13, and any variable heavy chain region. In some embodiments, the isolated bispecific antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 15, and any variable heavy chain region. In some embodiments, the isolated bispecific antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 17, and any variable heavy chain region. In some embodiments, the isolated bispecific antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 19, and any variable heavy chain region. In some embodiments, the isolated bispecific antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 21, and any variable heavy chain region. In some embodiments, the isolated bispecific antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 23, and any variable heavy chain region.In some embodiments, the isolated bispecific antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 25, and any variable heavy chain region. In some embodiments, the isolated bispecific antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 27, and any variable heavy chain region. In some embodiments, the isolated bispecific antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 29, and any variable heavy chain region. In some embodiments, the isolated bispecific antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 31, and any variable heavy chain region. In some embodiments, the isolated bispecific antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 33, and any variable heavy chain region. In some embodiments, the isolated bispecific antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 35, and any variable heavy chain region. In some embodiments, the isolated bispecific antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 37, and any variable heavy chain region. In some embodiments, the isolated bispecific antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 39, and any variable heavy chain region. In some embodiments, the isolated bispecific antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 42, and any variable heavy chain region. In some embodiments, the isolated bispecific antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 43, and any variable heavy chain region. In some embodiments, the isolated bispecific antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 45, and any variable heavy chain region. In some embodiments, the isolated bispecific antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 47, and any variable heavy chain region. In some embodiments, the isolated bispecific antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 49, and any variable heavy chain region. In some embodiments, the isolated bispecific antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 51, and any variable heavy chain region. In some embodiments, the isolated bispecific antibody comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 53, and any variable heavy chain region.
[0187] In some embodiments, the amino acid sequence of the VL domain of the bispecific antibody is one of those described in Table 1 or Table 10. In some embodiments, the isolated bispecific antibody comprises a light chain variable region comprising one of the amino acid sequences described in Table 1 or Table 10, and an optional variable heavy chain region.
[0188] One of ordinary skill in the art will recognize that when pairing a VH domain or VL domain comprising a known amino acid sequence with a VL domain or VH domain, respectively, to comprise an antigen-binding region, such pairing can be analyzed for binding characteristics using methods well known in the art (see, e.g., the disclosure herein and the examples below).
[0189] In some embodiments, the amino acid sequences of the heavy chain variable region-light chain variable region pairs are, without limitation, selected from the paired sequences set forth in SEQ ID NO: 4 and 3, SEQ ID NO: 6 and 5, SEQ ID NO: 8 and 7, SEQ ID NO: 10 and 9, SEQ ID NO: 12 and 11, SEQ ID NO: 14 and 13, SEQ ID NO: 16 and 15, SEQ ID NO: 18 and 17, SEQ ID NO: 20 and 19, SEQ ID NO: 22 and 21, SEQ ID NO: 24 and 23, SEQ ID NO: 26 and 25, SEQ ID NO: 28 and 27, SEQ ID NO: 30 and 29, SEQ ID NO: 32 and 31, SEQ ID NO: 34 and 33, SEQ ID NO: 36 and 35, SEQ ID NO: 38 and 37, SEQ ID NO: 40 and 39, SEQ ID NO: 42 and 41, SEQ ID NO: 44 and 43, SEQ ID NO: 46 and 45, SEQ ID NO: 48 and 47, SEQ ID NO: 50 and 49, SEQ ID NO: 52 and 51, and SEQ ID NO: 54 and 53. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region-light chain variable region pair selected from the paired sequences set forth in SEQ ID NO: 4 and 3. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region-light chain variable region pair selected from the paired sequences set forth in SEQ ID NO: 6 and 5. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region-light chain variable region pair selected from the paired sequences set forth in SEQ ID NO: 8 and 7. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region-light chain variable region pair selected from the paired sequences set forth in SEQ ID NO: 10 and 9. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region-light chain variable region pair selected from the paired sequences set forth in SEQ ID NO: 12 and 11. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region-light chain variable region pair selected from the paired sequences set forth in SEQ ID NO: 14 and 13. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region-light chain variable region pair selected from the paired sequences set forth in SEQ ID NO: 16 and 15. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region-light chain variable region pair selected from the paired sequences set forth in SEQ ID NO: 18 and 17. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region-light chain variable region pair selected from the paired sequences set forth in SEQ ID NO: 20 and 19.In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region-light chain variable region pair selected from the paired sequences set forth in SEQ ID NOs: 22 and 21. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region-light chain variable region pair selected from the paired sequences set forth in SEQ ID NOs: 24 and 23. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region-light chain variable region pair selected from the paired sequences set forth in SEQ ID NOs: 26 and 25. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region-light chain variable region pair selected from the paired sequences set forth in SEQ ID NOs: 28 and 27. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region-light chain variable region pair selected from the paired sequences set forth in SEQ ID NOs: 30 and 29. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region-light chain variable region pair selected from the paired sequences set forth in SEQ ID NOs: 32 and 31. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region-light chain variable region pair selected from the paired sequences set forth in SEQ ID NOs: 34 and 33. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region-light chain variable region pair selected from the paired sequences set forth in SEQ ID NOs: 36 and 35. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region-light chain variable region pair selected from the paired sequences set forth in SEQ ID NOs: 38 and 37. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region-light chain variable region pair selected from the paired sequences set forth in SEQ ID NOs: 40 and 39. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region-light chain variable region pair selected from the paired sequences set forth in SEQ ID NOs: 42 and 41. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region-light chain variable region pair selected from the paired sequences set forth in SEQ ID NOs: 44 and 43. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region-light chain variable region pair selected from the paired sequences set forth in SEQ ID NOs: 46 and 45. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region-light chain variable region pair selected from the paired sequences set forth in SEQ ID NOs: 48 and 47. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region-light chain variable region pair selected from the paired sequences set forth in SEQ ID NOs: 50 and 49.In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region-light chain variable region pair selected from the pair of sequences set forth in SEQ ID NOs: 52 and 51. In some embodiments, the isolated bispecific antibody comprises a heavy chain variable region-light chain variable region pair selected from the pair of sequences set forth in SEQ ID NOs: 54 and 53.
[0190] In some embodiments, the amino acid sequences of the heavy chain variable region-light chain variable region pair are selected from the paired sequences described in any one of the following: SEQ ID NO: 209 and 210, SEQ ID NO: 211 and 212, SEQ ID NO: 213 and 214, SEQ ID NO: 215 and 216, SEQ ID NO: 217 and 218, SEQ ID NO: 219 and 220, SEQ ID NO: 221 and 222, SEQ ID NO: 223 and 224, SEQ ID NO: 225 and 226, SEQ ID NO: 227 and 228, SEQ ID NO: 229 and 230, SEQ ID NO: 231 and 232, SEQ ID NO: 233 and 234, SEQ ID NO: 235 and 236, SEQ ID NO: 237 and 238, SEQ ID NO: 239 and 240, SEQ ID NO: 241 and 242, SEQ ID NO: 243 and 244, SEQ ID NO: 245 and 246, SEQ ID NO: 247 and 248, SEQ ID NO: 249 and 250, SEQ ID NO: 251 and 252, SEQ ID NO: 253 and 254, SEQ ID NO: 255 and 256, SEQ ID NO: 257 and 258, SEQ ID NO: 259 and 260, SEQ ID NO: 261 and 262, SEQ ID NO: 263 and 264, SEQ ID NO: 265 and 266, SEQ ID NO: 267 and 268, SEQ ID NO: 269 and 270, SEQ ID NO: 271 and 272, SEQ ID NO: 273 and 274, SEQ ID NO: 275 and 276, SEQ ID NO: 277 and 278, SEQ ID NO: 279 and 280, SEQ ID NO: 281 and 282, SEQ ID NO: 283 and 284, SEQ ID NO: 285 and 286, SEQ ID NO: 287 and 288, SEQ ID NO: 289 and 290, SEQ ID NO: 291 and 292, SEQ ID NO: 293 and 294, SEQ ID NO: 295 and 296, SEQ ID NO: 297 and 298, SEQ ID NO: 299 and 300, SEQ ID NO: 301 and 302, SEQ ID NO: 303 and 304, SEQ ID NO: 305 and 306, SEQ ID NO: 307 and 308, SEQ ID NO: 309 and 310, SEQ ID NO: 311 and 312, SEQ ID NO: 313 and 314, SEQ ID NO: 315 and 316, SEQ ID NO: 317 and 318, SEQ ID NO: 319 and 320, SEQ ID NO: 321 and 322, SEQ ID NO: 323 and 324, SEQ ID NO: 325 and 326, SEQ ID NO: 327 and 328, SEQ ID NO: 329 and 330, SEQ ID NO: 331 and 332, SEQ ID NO: 333 and 334, SEQ ID NO: 335 and 336, SEQ ID NO: 337 and 338, SEQ ID NO: 339 and 340, SEQ ID NO: 341 and 342,Sequence numbers 343 and 344, sequence numbers 345 and 346, sequence numbers 347 and 348.
[0191] In some embodiments, the amino acid sequences of the scFv fragments include, without limitation, the following pairs of sequences: any of the pairs of sequences set forth in sequence numbers 4 and 3, sequence numbers 6 and 5, sequence numbers 8 and 7, sequence numbers 10 and 9, sequence numbers 12 and 11, sequence numbers 14 and 13, sequence numbers 16 and 15, sequence numbers 18 and 17, sequence numbers 20 and 19, sequence numbers 22 and 21, sequence numbers 24 and 23, sequence numbers 26 and 25, sequence numbers 28 and 27, sequence numbers 30 and 29, sequence numbers 32 and 31, sequence numbers 34 and 33, sequence numbers 36 and 35, sequence numbers 38 and 37, sequence numbers 40 and 39, sequence numbers 42 and 41, sequence numbers 44 and 43, sequence numbers 46 and 45, sequence numbers 48 and 47, sequence numbers 50 and 49, sequence numbers 52 and 51, and sequence numbers 54 and 53.
[0192] Nucleotide sequences encoding engineered "re-epitoped" VH domains, VL domains, or both VH and VL domains, and vectors and host cells containing these nucleotide sequences The present disclosure provides a double - binding antibody comprising a VH domain, a VL domain, or both a VH domain and a VL domain, each comprising a variant amino acid sequence as compared to the template VH and VL sequences of SEQ ID NO: 1 and SEQ ID NO: 2. As described in detail above, in some embodiments, the double - binding antibody has at least one amino acid variant at any of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or a combination thereof), and comprises a heavy - chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 1, has at least one amino acid variant at any of positions 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or a combination thereof), and comprises a light - chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 2, or a combination of the heavy - chain variable region described in (a) and the light - chain variable region described in (b), and the total number of variant positions in the encoded heavy - chain variable region, the encoded light - chain variable region, or a combination thereof is at least 2.
[0193] In some embodiments, a nucleic acid construct comprising a nucleic acid sequence encodes an isolated bispecific antibody comprising an antigen-binding domain site of an antibody comprising a VH domain and a VL domain, wherein the VH domain comprises the set of CDRs, HCDR1, HCDR2, and HCDR3 disclosed herein. In some embodiments, a nucleic acid construct comprising a nucleic acid sequence encodes an isolated bispecific antibody comprising an antigen-binding domain site of an antibody comprising a VH domain and a VL domain, wherein the VH domain comprises the set of CDRs, HCDR1, HCDR2, and HCDR3 disclosed in Table 8 or Table 4. In some embodiments, the amino acid sequence of HCDR1 is set forth in SEQ ID NO: 136, the amino acid sequence of HCDR2 is set forth as I HX1 Y D G S N K (SEQ ID NO: 142) (wherein HX1 is any amino acid), and the amino acid sequence of HCDR3 is set forth as A R HX2 HX3 HX4 HX5 HX6 HX7 HX8 HX9 HX10 HX11 F D HX12 (SEQ ID NO: 143) (wherein XH2, HX3, HX4, HX5, HX6, HX7, HX8, HX9, HX10, HX11, and HX12 are any amino acids).
[0194] In some embodiments, a nucleic acid construct comprising a nucleic acid sequence encodes a VH domain of a bispecific antibody comprising HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 142), and HCDR3 (SEQ ID NO: 143), wherein the VH domain comprises variant amino acids at at least one of HX1, HX2, HX3, HX4, HX5, HX6, HX7, HX8, HX9, HX10, HX11, and HX12.
[0195] In some embodiments, a nucleic acid construct comprising a nucleic acid sequence encodes a VH domain of a bispecific antibody comprising HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (wherein HX1 is selected from the group consisting of W and S), and HCDR3 (SEQ ID NO: 138) (wherein HX2 is selected from the group consisting of A and S, HX3 is P, HX4 is Q, HX5 is W, HX6 is selected from the group consisting of E, Q, M, L, and V, HX7 is selected from the group consisting of L, W, and Y, HX8 is selected from the group consisting of V and T, HX9 is selected from the group consisting of H, A, and S, HX10 is E, HX11 is A, and HX12 is selected from the group consisting of I, L, and M). In certain embodiments, a nucleic acid construct comprising a nucleic acid sequence encodes a bispecific antibody comprising variant amino acids comprising HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (wherein HX1 is W, HX2 is selected from the group consisting of A and S, HX3 is P, HX4 is Q, HX5 is W, HX6 is selected from the group consisting of E and M, HX7 is selected from the group consisting of L and W, HX8 is selected from the group consisting of V and T, HX9 is selected from the group consisting of H and A, HX10 is E, HX11 is A, and HX12 is selected from the group consisting of I and L).
[0196] In some embodiments, a nucleic acid construct comprising a nucleic acid sequence encodes a bispecific antibody comprising a VH domain comprising HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (wherein HX1 is W), and HCDR3 (SEQ ID NO: 138) (wherein HX2 is A, HX3 is P, HX4 is Q, HX5 is W, HX6 is E, HX7 is L, HX8 is T, HX9 is A, HX10 is E, HX11 is A, HX12 is I), or HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (wherein HX1 is W), and HCDR3 (SEQ ID NO: 138) (wherein HX2 is A, HX3 is P, HX4 is Q, HX5 is W, HX6 is M, HX7 is L, HX8 is V, HX9 is A, HX10 is E, HX11 is A, HX12 is L), or HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (wherein HX1 is W), and HCDR3 (SEQ ID NO: 138) (wherein HX2 is S, HX3 is P, HX4 is Q, HX5 is W, HX6 is E, HX7 is W, HX8 is V, HX9 is H, HX10 is E, HX11 is A, HX12 is L).
[0197] In some embodiments, a nucleic acid construct comprising a nucleic acid sequence encodes an isolated bispecific antibody comprising an antigen-binding domain site of an antibody comprising a VH domain and a VL domain, and in some embodiments, the VL domain comprises a set of CDRs, LCDR1, LCDR2, and LCDR3, wherein the amino acid sequence of LCDR1 is described as LX1, LX2, G S K LX3 V (SEQ ID NO: 144) (wherein LX1, LX2, and LX3 are any amino acids), the amino acid sequence of LCDR2 is described as D D LX4 (SEQ ID NO: 145) (wherein LX4 is any amino acid), and the amino acid sequence of LCDR3 is described as Q V W D LX5 LX6 S D LX7 V V (SEQ ID NO: 146) (wherein LX5, LX6, and LX7 are any amino acids).
[0198] In some embodiments, a nucleic acid construct comprising a nucleic acid sequence encodes a VL domain of a bispecific antibody comprising an LCDR. In some embodiments, a nucleic acid construct comprising a nucleic acid sequence encodes an isolated bispecific antibody comprising an antigen-binding domain site of an antibody comprising a VH domain and a VL domain, wherein the VL domain comprises a set of CDRs, LCDR1, LCDR2, and LCDR3 disclosed in Table 9 or Table 5. In some embodiments, the amino acid sequence of LCDR1 is set forth in SEQ ID NO: 139, LX1 is selected from the group consisting of N, L, and I, LX2 is selected from the group consisting of L and I, LX3 is selected from the group consisting of S and L, the amino acid sequence of LCDR2 is set forth in SEQ ID NO: 140, LX4 is selected from the group consisting of S and G, the amino acid sequence of LCDR3 is set forth in SEQ ID NO: 141, LX5 is selected from the group consisting of S and T, LX6 is selected from the group consisting of S and G, and LX7 is selected from the group consisting of H and G. In certain embodiments, a nucleic acid construct comprising a nucleic acid sequence encodes an isolated bispecific antibody comprising variant amino acids, LCDR1 (SEQ ID NO: 139) (where LX1 is L, LX2 is I, and LX3 is L), LCDR2 (SEQ ID NO: 140) (where LX4 is selected from the group consisting of S and G), LCDR3 (SEQ ID NO: 141) (where LX5 is S, LX6 is S, and LX7 is selected from the group consisting of H and G).
[0199] In some embodiments, a nucleic acid construct comprising a nucleic acid sequence encodes a VL domain bispecific antibody comprising LCDR1 (SEQ ID NO: 139) (wherein LX1 is L, LX2 is I, and LX3 is L), LCDR2 (SEQ ID NO: 140) (wherein LX4 is S), and LCDR3 (SEQ ID NO: 141) (wherein LX5 is S, LX6 is S, and LX7 is G), or LCDR1 (SEQ ID NO: 139) (wherein LX1 is L, LX2 is I, and LX3 is L), LCDR2 (SEQ ID NO: 140) (wherein LX4 is S), and LCDR3 (SEQ ID NO: 141) (wherein LX5 is S, LX6 is S, and LX7 is H), or LCDR1 (SEQ ID NO: 139) (wherein LX1 is L, LX2 is I, and LX3 is L), LCDR2 (SEQ ID NO: 140) (wherein LX4 is G), and LCDR3 (SEQ ID NO: 141) (wherein LX5 is S, LX6 is S, and LX7 is G).
[0200] In some embodiments, a nucleic acid construct comprising a nucleic acid sequence encodes an isolated bispecific antibody comprising an antigen-binding domain site of an antibody comprising a VH domain and a VL domain, the VH domain and VL domain comprising a combination of the above VH domain HCDRs and VL domain LCDRs. For example, and without limitation, in certain embodiments, a nucleic acid construct comprising a nucleic acid sequence encodes a VH domain comprising a set of CDRs, HCDR1, HCDR2, and HCDR3, wherein the amino acid sequence of HCDR1 is set forth in SEQ ID NO: 136, and the amino acid sequence of HCDR2 is I HX1 Y D G S N Described as K (SEQ ID NO: 142) (where HX1 is any amino acid), the amino acid sequence of HCDR3 is AR HX2 HX3 HX4 HX5 HX6 HX7 HX8 HX9 HX10 HX11 F D HX12 (SEQ ID NO: 143) (where XH2, HX3, HX4, HX5, HX6, HX7, HX8, HX9, HX10, HX11, and HX12 are any amino acids), and the VL domain includes a set of CDR, LCDR1, LCDR2, and LCDR3. The amino acid sequence of LCDR1 is described as LX1, LX2, G S K LX3 V (SEQ ID NO: 144) (where LX1, LX2, and LX3 are any amino acids), the amino acid sequence of LCDR2 is described as D D LX4 (SEQ ID NO: 145) (where LX4 is any amino acid), and the amino acid sequence of LCD3 is Q V W D LX5 Described as LX6 S D LX7 V V (SEQ ID NO: 146) (where LX5, LX6, and LX7 are any amino acids).
[0201] In some embodiments, a nucleic acid construct comprising a nucleic acid sequence encodes a VH domain comprising a set of CDRs, HCDR1, HCDR2, and HCDR3, wherein the amino acid sequence of HCDR1 is set forth in SEQ ID NO: 136, the amino acid sequence of HCDR2 is set forth in SEQ ID NO: 137, HX1 is selected from the group consisting of W and S, the amino acid sequence of HCDR3 is set forth in SEQ ID NO: 138, HX2 is selected from the group consisting of A and S, HX3 is P, HX4 is Q, HX5 is W, HX6 is selected from the group consisting of E, Q, M, L, and V, HX7 is selected from the group consisting of L, W, and Y, HX8 is selected from the group consisting of V and T, HX9 is selected from the group consisting of H, A, and S, HX10 is E, HX11 is A, HX12 is selected from the group consisting of I, L, and M, the VL domain comprises a set of CDRs, HCDR1, HCDR2, and HCDR3, the amino acid sequence of LCDR1 is set forth in SEQ ID NO: 139, LX1 is selected from the group consisting of N, L, and I, LX2 is selected from the group consisting of L and I, LX3 is selected from the group consisting of S and L, the amino acid sequence of LCDR2 is set forth in SEQ ID NO: 140, LX4 is selected from the group consisting of S and G, the amino acid sequence of LCDR3 is set forth in SEQ ID NO: 141, LX5 is selected from the group consisting of S and T, LX6 is selected from the group consisting of S and G, and LX7 is selected from the group consisting of H and G.
[0202] In certain embodiments, a nucleic acid construct comprising a nucleic acid sequence encodes an isolated bispecific antibody comprising a VH domain comprising a set of CDRs, HCDR1, HCDR2, and HCDR3, wherein the amino acid sequence of HCDR1 is set forth in SEQ ID NO: 136, the amino acid sequence of HCDR2 is set forth in SEQ ID NO: 137, HX1 is W, the amino acid sequence of HCDR3 is set forth in SEQ ID NO: 138, HX2 is selected from the group consisting of A and S, HX3 is P, HX4 is Q, HX5 is W, HX6 is selected from the group consisting of E and M, HX7 is selected from the group consisting of L and W, HX8 is selected from the group consisting of V and T, HX9 is selected from the group consisting of H and A, HX10 is E, HX11 is A, HX12 is selected from the group consisting of I and L, and comprises a VL domain comprising a set of CDRs, LCDR1, LCDR2, and LCDR3, wherein the amino acid sequence of LCDR1 is set forth in SEQ ID NO: 139, LX1 is L, LX2 is I, LX3 is L, the amino acid sequence of LCDR2 is set forth in SEQ ID NO: 140, LX4 is selected from the group consisting of S and G, the amino acid sequence of LCDR3 is set forth in SEQ ID NO: 141, LX5 is S, LX6 is S, and LX7 is selected from the group consisting of H and G.
[0203] In some embodiments, a nucleic acid construct comprising a nucleic acid sequence encodes a re-epitope bispecific antibody comprising a VH domain comprising a set of CDRs, HCDR1, HCDR2, and HCDR3, and a VL domain comprising a set of CDRs, LCDR1, LCDR2, and LCDR3, wherein the amino acid sequence of each CDR is set forth in FIGS. 1A and 1B for the clones described in FIGS. 1A and 1B, and includes, for example, without limitation,
[0204] Clone C2: HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (where HX1 is W), HCDR3 (SEQ ID NO: 138) (where HX2 is A, HX3 is P, HX4 is Q, HX5 is W, HX6 is E, HX7 is L, HX8 is T, HX9 is A, HX10 is E, HX11 is A, HX12 is I), LCDR1 (SEQ ID NO: 139) (where LX1 is L, LX2 is I, LX3 is L), LCDR2 (SEQ ID NO: 140) (where LX4 is S), and LCDR3 (SEQ ID NO: 141) (where LX5 is S, LX6 is S, LX7 is G),
[0205] Clone C6: HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (where HX1 is W), HCDR3 (SEQ ID NO: 138) (where HX2 is A, HX3 is P, HX4 is Q, HX5 is W, HX6 is M, HX7 is L, HX8 is V, HX9 is A, HX10 is E, HX11 is A, HX12 is L), LCDR1 (SEQ ID NO: 139) (where LX1 is L, LX2 is I, LX3 is L), LCDR2 (SEQ ID NO: 140) (where LX4 is S), and LCDR3 (SEQ ID NO: 141) (where LX5 is S, LX6 is S, LX7 is H); or
[0206] Clone C9: HCDR1 (SEQ ID NO: 136), HCDR2 (SEQ ID NO: 137) (where HX1 is W), HCDR3 (SEQ ID NO: 138) (where HX2 is S, HX3 is P, HX4 is Q, HX5 is W, HX6 is E, HX7 is W, HX8 is V, HX9 is H, HX10 is E, HX11 is A, HX12 is L), LCDR1 (SEQ ID NO: 139) (where LX1 is L, LX2 is I, LX3 is L), LCDR2 (SEQ ID NO: 140) (where LX4 is G), and LCDR3 (SEQ ID NO: 141) (where LX5 is S, LX6 is S, LX7 is G).
[0207] In certain embodiments, the nucleic acid construct comprises a single nucleic acid sequence. In certain embodiments, the nucleic acid construct comprises two nucleic acid sequences. In certain embodiments, the nucleic acid construct comprises a single nucleic acid sequence, and the VH domain and the VL domain are encoded by the nucleic acid sequence. In certain embodiments, the nucleic acid construct comprises two nucleic acid sequences, the VH domain is encoded by one nucleic acid sequence, and the VL domain is encoded by the other nucleic acid sequence.
[0208] The present disclosure provides polynucleotide sequences encoding the variant VH, VL, or both the VH domain and the VL domain described herein. In certain embodiments, the template VH domain is encoded by the nucleotide sequence set forth in SEQ ID NO: 55, and the template VL domain is encoded by the nucleotide sequence set forth in SEQ ID NO: 56.
[0209] In some embodiments, a nucleic acid construct comprising a nucleic acid sequence encoding a bispecific antibody is disclosed herein, wherein the antibody has at least one amino acid variant at any one of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or a combination thereof), and comprises a heavy chain variable region having the amino acid sequence set forth in SEQ ID NO: 1, at least one amino acid variant at any one of positions 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or a combination thereof), and comprises a light chain variable region having the amino acid sequence set forth in SEQ ID NO: 2, or a combination of the heavy chain variable region described in (a) and the light chain variable region described in (b), and the total number of variant positions in the encoded heavy chain variable region, the encoded light chain variable region, or a combination thereof is at least 2.
[0210] In some embodiments, the nucleotide construct sequence comprises two nucleic acid sequences, one encoding a variant heavy chain variable region and one encoding a variant light chain variable region. In some embodiments, the nucleotide sequence or sequences encoding the bispecific antibody heavy chain variable region, light chain variable region, or both are optimized for mammalian transcription and translation.
[0211] The present disclosure further provides, in certain embodiments, an isolated nucleic acid construct encoding the nucleic acid sequences described herein. Exemplary polynucleotide sequences encoding variant VH and VL domains are provided in Table 2 below. Exemplary nucleic acid constructs comprising a nucleic acid sequence encoding a variant VH domain linked to a VL domain are provided in Table 3 below.
[0212] Nucleic acids include DNA and RNA. These and related embodiments can include polynucleotides encoding the bispecific antibodies described herein. As used herein, the term "isolated polynucleotide" means a polynucleotide of genomic, cDNA, or synthetic origin, or some combination thereof, and depending on its origin, the isolated polynucleotide is (1) not associated with all or part of the polynucleotide in which it is naturally found, (2) linked to a polynucleotide that is not naturally linked, or (3) does not occur naturally as part of a longer sequence.
[0213] One of ordinary skill in the art will understand that the terms "polynucleotide" and "nucleic acid sequence" can be used interchangeably with the same meaning and quality in some embodiments.
[0214] In some embodiments, the isolated nucleic acid sequences disclosed herein encode a VH domain comprising the set of HCDRs disclosed throughout and in FIG. 1A, a VL domain comprising the set of LCDRs disclosed throughout and in FIG. 1B, a VH domain comprising the set of HCDRs, and a VL domain comprising the set of LCDRs disclosed throughout and in FIGS. 1A and 1B, a VL domain or VL domains, or a VH domain and a VL domain.
[0215] As used herein, the term "polynucleotide" encompasses single-stranded or double-stranded nucleic acid polymers. In certain embodiments, the nucleotides comprising the polynucleotide can be ribonucleotides or deoxyribonucleotides, or modified forms of either type of nucleotide. Such modifications include base modifications such as bromouridine, ribose modifications such as arabinoside and 2',3'-dideoxyribose, and internucleotide linkage modifications such as phosphorothioate, phosphorodithioate, phosphorosenoate, phosphorodiselenothioate, phosphoranoanilothioate, phosphoralanate, and phosphoramidate. The term "polynucleotide" specifically includes single-stranded and double-stranded forms of DNA.
[0216] The term "naturally occurring nucleotide" includes deoxyribonucleotides and ribonucleotides. The term "modified nucleotide" includes, for example, nucleotides having modified or substituted sugar groups. The term "oligonucleotide linkage" includes oligonucleotide linkages such as phosphorothioate, phosphorodithioate, phosphorosenoate, phosphorodiselenothioate, phosphoranoanilothioate, phosphoralanate, and phosphoramidate. See, for example, LaPlanche et al., 1986, Nucl. Acids Res., 14:9081; Stec et al., 1984, J. Am. Chem. Soc., 106:6077; Stein et al., 1988, Nucl. Acids Res., 16:3209; Zon et al., 1991, Anti-Cancer Drug Design, 6:539; Zon et al., 1991, OLIGONUCLEOTIDES AND ANALOGUES: A PRACTICAL APPROACH, pp. 87-108 (F. Eckstein, Ed.), Oxford University Press, Oxford Reference is made to England; Stec et al., U.S. Patent No. 5,151,510, Uhlmann and Peyman, 1990, Chemical Reviews, 90:543, the disclosure of which is incorporated herein by reference for any purpose. An oligonucleotide can include a detectable label that enables the detection of the oligonucleotide or its hybridization.
[0217] In other related embodiments, a polynucleotide variant can have substantial identity with a polynucleotide template sequence, provided that the template sequence does not encode a diabody, or a fragment or domain thereof.
[0218] In some embodiments, a polynucleotide variant contains one or more substitutions, additions, deletions, and / or insertions such that the binding affinity of the binding domain encoded by the variant polynucleotide newly binds to an epitope as compared to the unmodified template specifically described herein.
[0219] In some embodiments, the nucleic acid sequence has at least one amino acid variant at any one of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or a combination thereof), and encodes a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the nucleic acid sequence has at least two amino acid variants at any one of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or a combination thereof), and encodes a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the nucleic acid sequence has at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid variants at any one of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or a combination thereof), and encodes a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 1.
[0220] In some embodiments, the nucleic acid construct comprises a nucleic acid sequence encoding a heavy chain variable region comprising a sequence selected from the sequences set forth in SEQ ID NOs: 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 105, and 107. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO: 57. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO: 59. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO: 61. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO: 63. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO: 65. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO: 67. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO: 69. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO: 71. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO: 73. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO: 75. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO: 77. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO: 79. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO: 81. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO: 83. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO: 85. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO: 87. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO: 89. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO: 91.In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO: 93. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO: 95. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO: 97. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO: 99. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO: 101. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO: 105. In some embodiments, the nucleic acid sequence encoding the heavy chain variable region comprises the sequence set forth in SEQ ID NO: 107.
[0221] In some embodiments, the nucleic acid construct comprises a nucleic acid sequence encoding a double - binding antibody heavy - chain variable region sequence as set forth in any of SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, and 54. In some embodiments, the nucleic acid sequence encodes the double - binding antibody heavy - chain variable region sequence set forth in SEQ ID NO: 4. In some embodiments, the nucleic acid sequence encodes the double - binding antibody heavy - chain variable region sequence set forth in SEQ ID NO: 6. In some embodiments, the nucleic acid sequence encodes the double - binding antibody heavy - chain variable region sequence set forth in SEQ ID NO: 8. In some embodiments, the nucleic acid sequence encodes the double - binding antibody heavy - chain variable region sequence set forth in SEQ ID NO: 10. In some embodiments, the nucleic acid sequence encodes the double - binding antibody heavy - chain variable region sequence set forth in SEQ ID NO: 12. In some embodiments, the nucleic acid sequence encodes the double - binding antibody heavy - chain variable region sequence set forth in SEQ ID NO: 14. In some embodiments, the nucleic acid sequence encodes the double - binding antibody heavy - chain variable region sequence set forth in SEQ ID NO: 16. In some embodiments, the nucleic acid sequence encodes the double - binding antibody heavy - chain variable region sequence set forth in SEQ ID NO: 18. In some embodiments, the nucleic acid sequence encodes the double - binding antibody heavy - chain variable region sequence set forth in SEQ ID NO: 20. In some embodiments, the nucleic acid sequence encodes the double - binding antibody heavy - chain variable region sequence set forth in SEQ ID NO: 22. In some embodiments, the nucleic acid sequence encodes the double - binding antibody heavy - chain variable region sequence set forth in SEQ ID NO: 24. In some embodiments, the nucleic acid sequence encodes the double - binding antibody heavy - chain variable region sequence set forth in SEQ ID NO: 26. In some embodiments, the nucleic acid sequence encodes the double - binding antibody heavy - chain variable region sequence set forth in SEQ ID NO: 28. In some embodiments, the nucleic acid sequence encodes the double - binding antibody heavy - chain variable region sequence set forth in SEQ ID NO: 30. In some embodiments, the nucleic acid sequence encodes the double - binding antibody heavy - chain variable region sequence set forth in SEQ ID NO: 32. In some embodiments, the nucleic acid sequence encodes the double - binding antibody heavy - chain variable region sequence set forth in SEQ ID NO: 34. In some embodiments, the nucleic acid sequence encodes the double - binding antibody heavy - chain variable region sequence set forth in SEQ ID NO: 36.In some embodiments, the nucleic acid sequence encodes a double - binding antibody heavy - chain variable region sequence set forth in SEQ ID NO: 38. In some embodiments, the nucleic acid sequence encodes a double - binding antibody heavy - chain variable region sequence set forth in SEQ ID NO: 40. In some embodiments, the nucleic acid sequence encodes a double - binding antibody heavy - chain variable region sequence set forth in SEQ ID NO: 42. In some embodiments, the nucleic acid sequence encodes a double - binding antibody heavy - chain variable region sequence set forth in SEQ ID NO: 44. In some embodiments, the nucleic acid sequence encodes a double - binding antibody heavy - chain variable region sequence set forth in SEQ ID NO: 46. In some embodiments, the nucleic acid sequence encodes a double - binding antibody heavy - chain variable region sequence set forth in SEQ ID NO: 48. In some embodiments, the nucleic acid sequence encodes a double - binding antibody heavy - chain variable region sequence set forth in SEQ ID NO: 50. In some embodiments, the nucleic acid sequence encodes a double - binding antibody heavy - chain variable region sequence set forth in SEQ ID NO: 52. In some embodiments, the nucleic acid sequence encodes a double - binding antibody heavy - chain variable region sequence set forth in SEQ ID NO: 54.
[0222] In some embodiments, the nucleic acid construct comprises a nucleic acid sequence encoding a double - binding antibody heavy - chain variable region sequence described in Table 10 or Table 1. For example, VH can comprise any one of SEQ ID NOs: 209, 211, 213, 215, 217, 219, 221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243, 245, 247, 249, 251, 253, 255, 257, 259, 261, 263, 265, 267, 269, 271, 273, 275, 277, 279, 281, 283, 285, 287, 289, 291, 293, 295, 297, 299, 301, 303, 305, 307, 309, 311, 313, 315, 317, 319, 321, 323, 325, 327, 329, 331, 333, 335, 337, 339, 341, 343, 345, and 347. In another embodiment, the nucleic acid construct comprises a nucleic acid sequence encoding a VH that is at least 80%, 85%, 90%, 95%, 98%, or 99% identical to the VH sequences disclosed herein.
[0223] In some embodiments, the nucleic acid sequence encodes a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 2, having at least one amino acid variant at any one of positions 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or a combination thereof). In some embodiments, the nucleic acid sequence encodes a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 2, having at least one amino acid variant at any one of positions 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or a combination thereof). In some embodiments, the nucleic acid sequence encodes a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 2, having at least one amino acid variant at any one of positions 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or a combination thereof).
[0224] In some embodiments, the nucleic acid construct comprises a nucleic acid sequence encoding a light chain variable region comprising a sequence selected from the sequences set forth in SEQ ID NOs: 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, and 108. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 58. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 60. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 62. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 64. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 66. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 68. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 70. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 72. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 74. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 76. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 78. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 80. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 82. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 84. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 86. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 88. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 90. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 92. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 94. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 96. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 98. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 100. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 102. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 104. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 106.In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 94. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 96. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 98. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 100. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 102. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 104. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 106. In some embodiments, the nucleic acid sequence encoding the light chain variable region comprises the sequence set forth in SEQ ID NO: 108.
[0225] In some embodiments, the nucleic acid construct comprises a nucleic acid sequence encoding a diabody light chain variable region sequence as set forth in any of SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, and 53. In some embodiments, the nucleic acid sequence encodes a diabody light chain variable region sequence as set forth in SEQ ID NO: 3. In some embodiments, the nucleic acid sequence encodes a diabody light chain variable region sequence as set forth in SEQ ID NO: 5. In some embodiments, the nucleic acid sequence encodes a diabody light chain variable region sequence as set forth in SEQ ID NO: 7. In some embodiments, the nucleic acid sequence encodes a diabody light chain variable region sequence as set forth in SEQ ID NO: 9. In some embodiments, the nucleic acid sequence encodes a diabody light chain variable region sequence as set forth in SEQ ID NO: 11. In some embodiments, the nucleic acid sequence encodes a diabody light chain variable region sequence as set forth in SEQ ID NO: 13. In some embodiments, the nucleic acid sequence encodes a diabody light chain variable region sequence as set forth in SEQ ID NO: 15. In some embodiments, the nucleic acid sequence encodes a diabody light chain variable region sequence as set forth in SEQ ID NO: 17. In some embodiments, the nucleic acid sequence encodes a diabody light chain variable region sequence as set forth in SEQ ID NO: 19. In some embodiments, the nucleic acid sequence encodes a diabody light chain variable region sequence as set forth in SEQ ID NO: 21. In some embodiments, the nucleic acid sequence encodes a diabody light chain variable region sequence as set forth in SEQ ID NO: 23. In some embodiments, the nucleic acid sequence encodes a diabody light chain variable region sequence as set forth in SEQ ID NO: 25. In some embodiments, the nucleic acid sequence encodes a diabody light chain variable region sequence as set forth in SEQ ID NO: 27. In some embodiments, the nucleic acid sequence encodes a diabody light chain variable region sequence as set forth in SEQ ID NO: 29. In some embodiments, the nucleic acid sequence encodes a diabody light chain variable region sequence as set forth in SEQ ID NO: 31. In some embodiments, the nucleic acid sequence encodes a diabody light chain variable region sequence as set forth in SEQ ID NO: 33. In some embodiments, the nucleic acid sequence encodes a diabody light chain variable region sequence as set forth in SEQ ID NO: 35.In some embodiments, the nucleic acid sequence encodes a diabody light chain variable region sequence set forth in SEQ ID NO: 37. In some embodiments, the nucleic acid sequence encodes a diabody light chain variable region sequence set forth in SEQ ID NO: 39. In some embodiments, the nucleic acid sequence encodes a diabody light chain variable region sequence set forth in SEQ ID NO: 41. In some embodiments, the nucleic acid sequence encodes a diabody light chain variable region sequence set forth in SEQ ID NO: 43. In some embodiments, the nucleic acid sequence encodes a diabody light chain variable region sequence set forth in SEQ ID NO: 45. In some embodiments, the nucleic acid sequence encodes a diabody light chain variable region sequence set forth in SEQ ID NO: 47. In some embodiments, the nucleic acid sequence encodes a diabody light chain variable region sequence set forth in SEQ ID NO: 49. In some embodiments, the nucleic acid sequence encodes a diabody light chain variable region sequence set forth in SEQ ID NO: 51. In some embodiments, the nucleic acid sequence encodes a diabody light chain variable region sequence set forth in SEQ ID NO: 53.
[0226] In some embodiments, the nucleic acid construct comprises a nucleic acid sequence encoding a diabody light chain variable region sequence set forth in Table 10 or Table 1, for example, VL may comprise any one of SEQ ID NOs: 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272, 274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 300, 302, 304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 328, 330, 332, 334, 336, 338, 340, 342, 344, 346 and 348. In another embodiment, the nucleic acid construct comprises a nucleic acid sequence encoding a VL that is at least 80%, 85%, 90%, 95%, 98%, or 99% identical to the VL sequences disclosed herein.
[0227] In some embodiments, the nucleic acid construct comprises a nucleic acid sequence encoding a double-stranded antibody heavy chain variable region-light chain variable region pair, and the nucleic acid sequence is selected from the paired sequences set forth in SEQ ID NO: 57 and 58, SEQ ID NO: 59 and 60, SEQ ID NO: 61 and 62, SEQ ID NO: 63 and 64, SEQ ID NO: 65 and 66, SEQ ID NO: 67 and 68, SEQ ID NO: 69 and 70, SEQ ID NO: 71 and 72, SEQ ID NO: 73 and 74, SEQ ID NO: 75 and 76, SEQ ID NO: 77 and 78, SEQ ID NO: 79 and 80, SEQ ID NO: 81 and 82, SEQ ID NO: 83 and 84, SEQ ID NO: 85 and 86, SEQ ID NO: 87 and 88, SEQ ID NO: 89 and 90, SEQ ID NO: 91 and 92, SEQ ID NO: 93 and 94, SEQ ID NO: 95 and 96, SEQ ID NO: 97 and 98, SEQ ID NO: 99 and 100, SEQ ID NO: 101 and 102, SEQ ID NO: 103 and 104, SEQ ID NO: 105 and 106, and SEQ ID NO: 107 and 108.
[0228] In some embodiments, the nucleic acid construct comprises a nucleic acid sequence encoding a double-stranded antibody heavy chain variable region-light chain variable region pair shown in Table 10 or Table 1. For example, the VH and VL pairs can be one of the following: SEQ ID NO: 209 and 210, SEQ ID NO: 211 and 212, SEQ ID NO: 213 and 214, SEQ ID NO: 215 and 216, SEQ ID NO: 217 and 218, SEQ ID NO: 219 and 220, SEQ ID NO: 221 and 222, SEQ ID NO: 223 and 224, SEQ ID NO: 225 and 226, SEQ ID NO: 227 and 228, SEQ ID NO: 229 and 230, SEQ ID NO: 231 and 232, SEQ ID NO: 233 and 234, SEQ ID NO: 235 and 236, SEQ ID NO: 237 and 238, SEQ ID NO: 239 and 240, SEQ ID NO: 241 and 242, SEQ ID NO: 243 and 244, SEQ ID NO: 245 and 246, SEQ ID NO: 247 and 248, SEQ ID NO: 249 and 250, SEQ ID NO: 251 and 252, SEQ ID NO: 253 and 254, SEQ ID NO: 255 and 256, SEQ ID NO: 257 and 258, SEQ ID NO: 259 and 260, SEQ ID NO: 261 and 262, SEQ ID NO: 263 and 264, SEQ ID NO: 265 and 266, SEQ ID NO: 267 and 268, SEQ ID NO: 269 and 270, SEQ ID NO: 271 and 272, SEQ ID NO: 273 and 274, SEQ ID NO: 275 and 276, SEQ ID NO: 277 and 278, SEQ ID NO: 279 and 280, SEQ ID NO: 281 and 282, SEQ ID NO: 283 and 284, SEQ ID NO: 285 and 286, SEQ ID NO: 287 and 288, SEQ ID NO: 289 and 290, SEQ ID NO: 291 and 292, SEQ ID NO: 293 and 294, SEQ ID NO: 295 and 296, SEQ ID NO: 297 and 298, SEQ ID NO: 299 and 300, SEQ ID NO: 301 and 302, SEQ ID NO: 303 and 304, SEQ ID NO: 305 and 306, SEQ ID NO: 307 and 308, SEQ ID NO: 309 and 310, SEQ ID NO: 311 and 312, SEQ ID NO: 313 and 314, SEQ ID NO: 315 and 316, SEQ ID NO: 317 and 318, SEQ ID NO: 319 and 320, SEQ ID NO: 321 and 322, SEQ ID NO: 323 and 324, SEQ ID NO: 325 and 326, SEQ ID NO: 327 and 328, SEQ ID NO: 329 and 330, SEQ ID NO: 331 and 332, SEQ ID NO: 333 and 334, SEQ ID NO: 335 and 336, SEQ ID NO: 337 and 338,SEQ ID NO: 339 and 340, SEQ ID NO: 341 and 342, SEQ ID NO: 343 and 344, SEQ ID NO: 345 and 346, SEQ ID NO: 347 and 348. In another embodiment, the VH and VL pairs are at least 80%, 85%, 90%, 95%, 98%, or 99% identical to the VH and VL sequences disclosed herein.,
[0229] One of ordinary skill in the art will understand that, in some embodiments, the sequence encoding the VH domain and the sequence encoding the VL domain are linked by a sequence encoding a linker sequence. In some embodiments, the nucleic acid sequence encodes a polypeptide linker. ggcggtggtggtagcggaggcggaggatcaggtggaggcggcagt (SEQ ID NO: 148).
[0230] In some embodiments, the nucleic acid construct comprises a nucleic acid sequence encoding a diabody heavy chain variable region-light chain variable region scFv, and the nucleic acid sequence is selected from the sequences set forth in SEQ ID NOs: 109-135.
[0231] In some embodiments, the nucleic acid construct comprising the nucleic acid sequence encoding the diabody described herein encodes an IgG immunoglobulin. In some embodiments, the nucleic acid sequence encoding the diabody encodes an IgG1 immunoglobulin, an IgG2 immunoglobulin, an IgG3 immunoglobulin, or an IgG4 immunoglobulin. In some embodiments, the nucleic acid sequence encoding the diabody encodes an IgG1 immunoglobulin. In some embodiments, the nucleic acid sequence encoding the diabody encodes an IgG2 immunoglobulin. In some embodiments, the nucleic acid sequence encoding the diabody encodes an IgG3 immunoglobulin. In some embodiments, the nucleic acid sequence encoding the diabody encodes an IgG4 immunoglobulin. In some embodiments, the nucleic acid sequence encoding the diabody encodes an IgG1 immunoglobulin or an IgG4 immunoglobulin.
[0232] In some embodiments, the nucleic acid sequence encoding the bispecific antibody encodes a Fab immunoglobulin fragment. In some embodiments, the nucleic acid sequence encoding the bispecific antibody encodes an F(ab’)2 immunoglobulin fragment. In some embodiments, the nucleic acid sequence encoding the bispecific antibody encodes an Fv immunoglobulin. In some embodiments, the nucleic acid sequence encoding the bispecific antibody encodes a scFv immunoglobulin. In some embodiments, the nucleic acid sequence encoding the bispecific antibody encodes a minibody immunoglobulin construct comprising a pair of single-chain Fv fragments linked via a CH3 domain.
[0233] In some embodiments, the nucleic acid sequence encoding the bispecific antibody encodes a diabody immunoglobulin. In some embodiments, the diabody immunoglobulin construct comprises a heavy chain variable (VH) and a light chain variable (VL) region linked by a small peptide linker. In some embodiments, the diabody immunoglobulin construct comprises a single-chain (Fv)2 in which two scFv fragments are covalently bound to each other. In some embodiments, the nucleic acid sequence encoding the bispecific antibody encodes a diabody immunoglobulin construct comprising three scFv fragments covalently bound to each other.
[0234] In some embodiments, the isolated polynucleotide construct encodes an isolated bispecific binding antibody disclosed herein.
[0235] In some embodiments, the nucleic acid sequence encoding the bispecific antibody encodes a mutant immunoglobulin. In some embodiments, the nucleic acid sequence encoding the bispecific antibody encodes a mutant IgG that is unable to bind to an antibody-dependent cell cytotoxicity component. In some embodiments, the nucleic acid sequence encoding the bispecific antibody encodes a mutant IgG1 that is unable to bind to an antibody-dependent cell cytotoxicity component. In some embodiments, the nucleic acid sequence encoding the bispecific antibody encodes an IgG comprising an L 234 A / L 235 A(LALA) mutation. In some embodiments, the nucleic acid sequence encoding the bispecific antibody encodes an L 234 A / L 235It encodes an IgG1 containing the A(LALA) mutation.
[0236] In some embodiments, as disclosed herein, mutagenesis approaches such as site-directed mutagenesis may be used to prepare variant VH, VL, or variant VH and VL amino acid sequences, or variant VH, VL, or VH and VL nucleic acid sequences encoding the same. The template VH and VL nucleic acid sequences of SEQ ID NOs: 55 and 56, respectively, encode the template amino acid sequences of SEQ ID NOs: 1 and 2, respectively. In some embodiments, the bispecific antibody comprises a variant VH domain, a variant VL domain, or both, encoded by a variant VH, VL, or VH and VL nucleotide sequence, which nucleotide sequences comprise the nucleotide template sequences of SEQ ID NOs: 55 and 56 for site-directed mutagenesis, respectively. By this approach, specific modifications in the polypeptide sequence can be made via mutagenesis of the underlying polynucleotide encoding the polypeptide sequence. These techniques provide a simple approach for preparing and testing sequence variants, for example, but not limited to, introducing one or more nucleotide sequence changes into a polynucleotide, taking into account the desired amino acid variant site(s) described in detail above.
[0237] Site-directed mutagenesis enables the production of variants through the use of specific oligonucleotide sequences encoding the desired mutated DNA sequence, as well as a sufficient number of adjacent nucleotides, providing a primer sequence of sufficient size and sequence complexity to form stable double-strands on both sides of the crossover deletion junction. The mutations may be utilized in the selected polynucleotide sequence to improve, change, reduce, modify, or otherwise alter the properties of the polynucleotide itself and / or to change the properties, activity, composition, stability, or primary sequence of the encoded polypeptide.
[0238] In certain embodiments, mutagenesis of the polynucleotide sequences encoding the component parts of the bispecific antibodies (VH domain, VL domain, or combinations thereof) disclosed herein is contemplated to alter the binding characteristics of the encoded template VH or VL, or both, such that the resulting antibody contains bispecific affinity. Techniques for site-directed mutagenesis are well known in the art and are widely used to generate variants of both polypeptides and polynucleotides. For example, site-directed mutagenesis is often used to change specific portions of a DNA molecule. In such embodiments, primers typically having a length of about 14 to about 25 nucleotides are used, and about 5 to about 10 residues on either side of the junction of the sequence are altered.
[0239] As will be appreciated by those skilled in the art, site-directed mutagenesis techniques have often utilized phage vectors that exist in both single-stranded and double-stranded forms. Typical vectors useful for site-directed mutagenesis include vectors such as M13 phage. These phages are commercially available and readily accessible, and their use is generally well known to those skilled in the art. Double-stranded plasmids are also routinely used in site-directed mutagenesis that eliminates the step of transferring the gene of interest from the plasmid to the phage.
[0240] Generally, site-directed mutagenesis according to the present specification is carried out by first obtaining a single-stranded vector or by melting and separating the double-strands of a double-stranded vector containing a DNA sequence encoding the desired peptide within its sequence. Oligonucleotide primers having the desired mutant sequence are generally prepared synthetically. The primer is then annealed with the single-stranded vector and subjected to a DNA polymerase such as the Klenow fragment of Escherichia coli polymerase I to complete the synthesis of the mutant-bearing strand. In this way, a heteroduplex is formed, one strand encoding the original non-mutant sequence and the second strand having the desired mutation. The heteroduplex vector is then used to transform a suitable cell such as an Escherichia coli cell, and clones containing recombinant vectors having the mutant sequence arrangement are selected.
[0241] The preparation of sequence variants of a selected peptide-encoding DNA segment using site-directed mutagenesis provides a means of producing potentially useful species, but is not intended to be limiting as there are other ways in which peptide sequence variants and the DNA sequences encoding them can be obtained. In some embodiments, methods of preparing libraries include those known in the art, such as those described in U.S. Patent No. 9,889,423, which are hereby incorporated by reference in their entirety, but are not limited thereto. In some embodiments, methods for designing sequence variants within a library include designing variant sequences on a computer and then synthesizing the sequences in a method that includes both chemical and biochemical processes.
[0242] As used herein, the term "oligonucleotide-directed mutagenesis procedure" encompasses template-dependent processes and vector-mediated propagation, thereby resulting in an increase in the concentration of a particular nucleic acid molecule relative to its initial concentration, or an increase in the concentration of a detectable signal, such as amplification. As used herein, the term "oligonucleotide-directed mutagenesis procedure" encompasses processes involving template-dependent extension of primer molecules. The term "template-dependent process" encompasses nucleic acid synthesis of RNA or DNA molecules, wherein the sequence of the newly synthesized strand of nucleic acid is determined by the well-known rules of complementary base pairing (see, e.g., Watson, 1987). Typically, vector-mediated methods involve introduction of a nucleic acid fragment into a DNA or RNA vector, clonal amplification of the vector, and recovery of the amplified nucleic acid fragment. Examples of such methodologies are provided by U.S. Patent No. 4,237,224, which is hereby specifically incorporated herein by reference in its entirety.
[0243] Another approach to the production of polypeptide VH and VL variants is described in U.S. Patent As described in U.S. Patent No. 5,837,458, iterative array recombination can be used. In this approach, iterative cycles of recombination and screening or selection are performed to "evolve", for example, individual polynucleotide variants with increased binding affinity. Certain embodiments also provide constructs in the form of plasmids, vectors, transcription or expression cassettes that include at least one polynucleotide described herein.
[0244] In certain embodiments, the polynucleotides described above that encode amino acid VH, VL, or VH and VL variants, e.g., VH, VL, or VH and VL variant polynucleotides, fragments, and hybridization sequences are included in a diabody.
[0245] The polynucleotides described herein, or fragments thereof, regardless of the length of the coding sequence itself, may be combined with other DNA sequences such as promoters, polyadenylation signals, additional restriction enzyme sites, multiple cloning sites, other coding segments, etc., such that their full lengths can vary considerably. Accordingly, it is contemplated that nucleic acid fragments of almost any length can be used, and the full length is preferably limited by the ease of preparation and use in the intended recombinant DNA protocol. For example, exemplary polynucleotide segments of lengths of about 10,000, about 5000, about 3000, about 2,000, about 1,000, about 500, about 200, about 100, about 50 base pairs in length (including all intermediate lengths) are contemplated to be useful.
[0246] In certain embodiments, the isolated polynucleotide is inserted into a vector. In some embodiments, the vector includes an expression vector that includes a polynucleotide construct disclosed herein.
[0247] As used herein, the term "vector" includes a vehicle into which a polynucleotide encoding a protein can be covalently inserted so as to effect expression of that protein and / or cloning of the polynucleotide. The isolated polynucleotide may be inserted into a vector using any suitable method known in the art. For example, without limitation, the vector may be digested using an appropriate restriction enzyme and then ligated to the isolated polynucleotide having compatible restriction enzyme ends.
[0248] Examples of suitable vectors include, but are not limited to, plasmids, phagemids, cosmids, artificial chromosomes such as yeast artificial chromosomes (YACs), bacterial artificial chromosomes (BACs), or P1-derived artificial chromosomes (PACs), bacteriophages such as lambda phage or M13 phage, and animal viruses. Examples of categories of animal viruses useful as vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpesviruses (e.g., herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, and papovaviruses (e.g., SV40).
[0249] For expression of a bispecific antibody or a component thereof, the vector may be introduced into a host cell to enable expression of the polypeptide in the host cell. The expression vector may contain various elements for controlling expression, including, but not limited to, a promoter sequence, a transcription initiation sequence, an enhancer sequence, a selectable marker, and a signal sequence. These elements may be appropriately selected by those skilled in the art. In some embodiments, these elements may be considered "regulatory elements."
[0250] One of ordinary skill in the art will understand that the term "regulatory sequence" can include polynucleotide sequences that can affect the expression, processing, or intracellular localization of a coding sequence to which they are ligated or operably linked. The nature of such regulatory sequences can depend on the host organism. In certain embodiments, prokaryotic transcriptional regulatory sequences can include a promoter, ribosome binding site, and transcription termination sequence. In other certain embodiments, eukaryotic transcriptional regulatory sequences can include a promoter that includes one or more recognition sites for transcription factors, transcriptional enhancer sequences, transcription termination sequences, and polyadenylation sequences. In certain embodiments, a "regulatory sequence" can include a leader sequence and / or a fusion partner sequence.
[0251] In some embodiments, for example, without limitation, a promoter sequence may be selected to promote transcription of a polynucleotide in a vector. Suitable promoter sequences include, but are not limited to, the T7 promoter, T3 promoter, SP6 promoter, beta-actin promoter, EF1a promoter, CMV promoter, and SV40 promoter. An enhancer sequence may be selected to enhance transcription of a polynucleotide. A selection marker may be selected such that host cells into which the vector is inserted can be selected from host cells that do not, and for example, the selection marker may be a gene conferring antibiotic resistance. A signal sequence may be selected such that an expressed polypeptide can be transported outside of the host cell.
[0252] The vector may also include materials that aid its entry into cells, including, but not limited to, viral particles, liposomes, or protein coatings. In some embodiments, a host cell includes an expression vector disclosed herein.
[0253] In some embodiments, the expression vector comprises a bispecific antibody or a component thereof, e.g., without limitation, the VH domain, VL domain, isolated nucleic acid sequences encoding the combined VH-VL domain that may be present in the above-described Fab element, F(ab’)2 element, scFv, Fv, minibody, diabody, or triabody. The bispecific binding domain and its components are described in detail above.
[0254] In some embodiments, the expression vector comprises an isolated nucleic acid sequence encoding a VH domain. In some embodiments, the expression vector comprises an isolated nucleic acid sequence encoding a VL domain. In some embodiments, the expression vector comprises an isolated nucleic acid sequences encoding VH and VL domains. In some embodiments, the expression vector comprises an isolated nucleic acid sequence encoding two VH and VL domains. In some embodiments, the expression vector comprises an isolated nucleic acid sequence encoding three VH and VL domains.
[0255] In some embodiments, the expression vector comprises an isolated nucleic acid sequence encoding a VH domain component of a bispecific antibody. In some embodiments, the expression vector comprises an isolated nucleic acid sequence encoding a VL domain component of a bispecific antibody. In some embodiments, the expression vector comprises an isolated nucleic acid sequences encoding VH and VL domain components of a bispecific antibody.
[0256] In some embodiments, the expression vector comprises an isolated nucleic acid sequence encoding a VH domain component of a bispecific IgG antibody or a fragment thereof. In some embodiments, the expression vector comprises an isolated nucleic acid sequence encoding a VL domain component of a bispecific IgG antibody or a fragment thereof. In some embodiments, the expression vector comprises an isolated nucleic acid sequences encoding VH and VL domain components of a bispecific IgG antibody or a fragment thereof.
[0257] In some embodiments, the expression vector comprises an isolated nucleic acid sequence encoding the VH domain component of the scFv. In some embodiments, the expression vector comprises an isolated nucleic acid sequence encoding the VL domain component of the scFv. In some embodiments, the expression vector comprises an isolated nucleic acid sequence encoding the VH and VL domain components of the scFv.
[0258] Bispecific antibodies are described in detail above. One of ordinary skill in the art will be able to surely understand the scope of the components that can be encoded by the isolated nucleic acids described herein using the knowledge in the art and the specific details newly described herein.
[0259] For cloning of polynucleotides, the vector may be introduced into a host cell (isolated host cell) to enable replication of the vector itself, thereby amplifying copies of the polynucleotide contained therein. Cloning vectors generally include, but are not limited to, an origin of replication, a promoter sequence, a transcription start sequence, an enhancer sequence, and a selectable marker. These elements can be appropriately selected by those skilled in the art. For example, the origin of replication can be selected to facilitate autonomous replication of the vector in the host cell.
[0260] In certain embodiments, the present disclosure provides an isolated host cell containing the vector provided herein. The host cell containing the vector can be useful for the expression or cloning of the polynucleotide contained in the vector.
[0261] In some embodiments, the recombinant host cell contains one or more of the above-described constructs. The nucleic acid encodes any CDR or set of CDRs or VH domain or VL domain or antibody antigen-binding site or antibody molecule, such as, without limitation, IgG, Fv, scFv, Fab, F(ab’)2, minibody, diabody, or triabody. In some embodiments, methods for producing the encoded product are disclosed herein, the methods including expression from the encoding nucleic acid construct. Expression can be achieved, in some embodiments, by culturing the recombinant host cell containing the nucleic acid construct under appropriate conditions. After production by expression, the VH or VL domain, or VH-VL pair, or antibody is isolated and / or purified using any suitable technique and can then be used, as needed, in, for example, the therapeutic methods described herein.
[0262] In some embodiments, the bispecific antibodies, VH domains and / or VL domains encoding the nucleic acid molecules and vectors according to the invention may be prepared, isolated and / or purified in a substantially pure or homogeneous form.
[0263] In some embodiments, systems for the cloning and expression of polypeptides in a variety of different host cells are well known. Suitable host cells can include, but are not limited to, prokaryotic cells, fungal cells, yeast cells, or higher eukaryotic cells such as insect cells or mammalian cells.
[0264] Suitable prokaryotic cells for this purpose include eubacteria such as Gram-negative or Gram-positive organisms, for example, Escherichia, for example, E. coli, Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella, for example, Salmonella typhimurium, Serratia, for example, Serratia marcescens, and Shigella of the family Enterobacteriaceae, as well as Bacillus such as Bacillus subtilis and Bacillus licheniformis, Pseudomonas such as Pseudomonas aeruginosa, and Streptomyces, but are not limited thereto.
[0265] The expression of antibodies and antigen-binding fragments in prokaryotic cells such as E. coli is well established in the art. For a review, see, for example, Pluckthun, A. Bio / Technology 9:545-551 (1991). Expression in eukaryotic cells in culture is also available to those skilled in the art as an option for the production of antibodies or their antigen-binding fragments. See, for example, Ref, M.E. (1993) Curr. Opinion Biotech. 4:573-576, Trill J.J. et al. (1995) Curr. Opinion Biotech 6:553-560.
[0266] Fungal cells suitable for this purpose include, but are not limited to, filamentous fungi and yeasts. Exemplary examples of fungal cells include Saccharomyces cerevisiae, common baker's yeast, Schizosaccharomyces pombe, for example, Kluyveromyces lactis, Kluyveromyces fragilis (ATCC 12,424), Kluyveromyces bulgaricus (ATCC 16,045), Kluyveromyces wickeramii (ATCC 24,178), Kluyveromyces waltii (ATCC 56,500), Kluyveromyces drosophilarum (ATCC 36,906), Kluyveromyces thermotolerans, and Kluyveromyces hosts such as Kluyveromyces marxianus, Yarrowia (EP 402,226), Pichia pastoris (EP 183,070), Candida, Trichoderma reesia (EP 244,234), Neurospora crassa, Schwanniomyces such as Schwanniomyces occidentalis, and filamentous fungi such as, for example, Neurospora, Penicillium, Trichocladium, and Aspergillus hosts such as Aspergillus nidulans and Aspergillus niger.
[0267] Higher eukaryotic cells, particularly cells derived from multicellular organisms, can be used for the expression of the glycosylated VH and VL domains provided herein. Suitable higher eukaryotic cells include, but are not limited to, invertebrate cells and insect cells, as well as vertebrate cells. Examples of invertebrate cells include plant cells and insect cells. A number of baculovirus strains and variants, as well as corresponding insect host cells that are permissive for hosts such as Spodoptera frugiperda (fall armyworm), Aedes aegypti (mosquito), Aedes albopictus (mosquito), Drosophila melanogaster (fruit fly), and Bombyx mori have been identified. Various virus strains for transfection, such as the K-1 variant of Autographa californica NPV and the Bm-5 strain of Bombyx mori NPV, are publicly available, and such viruses can be used as the viruses described herein for the transfection of, particularly, Spodoptera frugiperda cells. Plant cell cultures of cotton, corn, potato, soybean, petunia, tomato, and tobacco can also be utilized as hosts. Mammalian cell lines available in the art for the expression of heterologous polypeptides include Chinese hamster ovary (CHO) cells, HeLa cells, baby hamster kidney cells, NS0 mouse melanoma cells, YB2 / 0 rat myeloma cells, human embryonic kidney cells, human embryonic retinal cells, and many others. Non-limiting examples of vertebrate cells include the simian kidney CV1 strain transformed by SV40 (COS-7, ATCC CRL 1651), the human embryonic kidney strain (293 or 293 cells subcloned for growth in suspension culture, Graham et al., J. Gen Virol. 36:59 (1977)), baby hamster kidney cells (BHK, ATCC CCL 10), Chinese hamster ovary cells / -DHFR (CHO, Urlaub et al., Proc. Natl. Acad. Sci. USA 77:4216 (1980)), ExpiCHO-S (trademark) cells (ThermoFisher Scientific catalog number A29133), mouse Sertoli cells (TM4, Mather, Biol. Reprod. 23:243 - 251 (1980)), monkey kidney cells (CV1 ATCC CCL 70), African green monkey kidney cells (VERO-76, ATCC CRK-1587), human cervical carcinoma cells (HELA, ATCC CCL 2), dog kidney cells (MDCK, ATCC CCL 34), buffalo rat hepatocytes (BRL 3A, ATCC CRL 1442), human lung cells (W138, ATCC CCL 75), human hepatocytes (Hep G2, HB 8065), mouse mammary tumor (MMT 060562, ATCC CCL51), TRI cells (Mather et al., Annals N.Y. Acad. Sci. 383:44 - 68 (1982)), MRC 5 cells, FS4 cells, and mammalian host cell lines such as the human hepatoma strain (Hep G2).
[0268] In some embodiments, the expression vector comprises the nucleic acid constructs described herein. Suitable vectors can be selected or constructed to contain appropriate control sequences, including a promoter sequence, a terminator sequence, a polyadenylation sequence, an enhancer sequence, a marker gene, and optionally other sequences. The control sequences may be operably linked to the nucleic acid sequences contained within the nucleic acid constructs. The vector may be a plasmid, for example, a phage or phagemid if desired. For further details, see, for example, Molecular Cloning: a Laboratory Manual: 3rd edition, Sambrook and Russell, 2001, Cold Spring Harbor Laboratory Press. For example, many known techniques and protocols for the manipulation of nucleic acids in the preparation of nucleic acid constructs, mutagenesis, sequencing, introduction of DNA into cells and gene expression, as well as protein analysis, are described in detail in Current Protocols in Molecular Biology, Second Edition, Ausubel et al. eds., John Wiley & Sons, 1988, Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, Ausubel et al. eds., John Wiley & Sons, 4th edition 1999. The disclosures of both Sambrook et al. and Ausubel et al. are incorporated herein by reference.
[0269] The vector can be introduced into a host cell using any suitable method known in the art, including but not limited to delivery mediated by DEAE-dextran, calcium phosphate precipitation, cationic lipid-mediated delivery, liposome-mediated transfection, electroporation, microprojectile bombardment, receptor-mediated gene delivery, polylysine, histone, chitosan, and peptide. Standard methods of transfection and transformation of cells for expression of the subject vector are well known in the art.
[0270] In some embodiments, host cells containing the nucleic acids disclosed herein are provided herein. Such host cells may be in vitro and may be cultured. Such host cells may be in vivo. The in vivo presence of the host cells may enable intracellular expression of the bispecific antibodies described herein as "intrabodies" or intracellular antibodies. Intrabodies may be used in gene therapy.
[0271] In certain embodiments, the host cell comprises a first vector encoding a first polypeptide, e.g., a VH domain, and a second vector encoding a second polypeptide, e.g., a VL domain. In certain embodiments, the host cell comprises a vector encoding a first polypeptide, e.g., a VH domain, and a second polypeptide, e.g., a VL domain.
[0272] In certain embodiments, the host cell comprises a first vector encoding a variant VH domain and a second vector encoding a variant VL domain. In certain embodiments, the host cell comprises a single vector encoding a variant VH domain and a variant VL domain.
[0273] In some embodiments, the isolated cell comprises an isolated nucleic acid sequence as disclosed herein. In some embodiments, the isolated cell comprises two isolated nucleic acid sequences as disclosed herein, wherein one nucleic acid encodes a variant VH domain and the other nucleic acid encodes a variant VL domain. In some embodiments, the isolated cell comprises a single isolated nucleic acid sequence as disclosed herein that encodes a variant VH domain and a variant VL domain.
[0274] In certain embodiments, the first vector and the second vector may or may not be introduced simultaneously. In certain embodiments, the first vector and the second vector may be introduced together into the host cell. In certain embodiments, the first vector may be first introduced into the host cell, and then the second vector may be introduced. In certain embodiments, the first vector may be introduced into the host cell, then a stable cell line expressing the first polypeptide may be established, and then the second vector may be introduced into the stable cell line.
[0275] In certain embodiments, the host cell comprises a vector encoding at least one variant VH domain and at least one variant VL contained within the bispecific antibody.
[0276] Following introduction, expression from the nucleic acid may be induced or enabled, for example, by culturing the host cell under conditions for expression of the gene. In certain embodiments, the disclosure provides a method of expressing a polypeptide provided herein, comprising culturing a host cell containing a vector under conditions such that a polynucleotide inserted within the vector is expressed.
[0277] In some embodiments, the nucleic acid is integrated into the genome (e.g., chromosome) of the host cell. Integration can be facilitated by including sequences that promote recombination with the genome according to standard techniques. In some embodiments, the nucleic acid construct is not integrated into the genome and the vector is episomal.
[0278] In some embodiments, methods are disclosed herein that include using the above-described constructs in an expression system to express a bispecific antibody or fragment thereof as described hereinabove in this specification.
[0279] Suitable conditions for polynucleotide expression include, but are not limited to, a suitable medium, a suitable density of host cells in the culture medium, the presence of necessary nutrients, the presence of cofactors, a suitable temperature and humidity, and the absence of microbial contaminants. One of ordinary skill in the art can select conditions suitable for the purpose of expression.
[0280] Method for synthesizing engineered re-epitope dual antibodies In some embodiments, methods are described herein for producing a bispecific antibody comprising a VH domain comprising an HCDR as described herein. In some embodiments, methods are described herein for producing a bispecific antibody comprising a VL domain comprising an LCDR as described herein. In some embodiments, methods are described herein for producing a bispecific antibody comprising a VH domain comprising an HCDR as described herein and a VL domain comprising an LCDR as described herein.
[0281] In some embodiments, a method for producing a bispecific antibody heavy chain variable region comprising: (a) an amino acid sequence set forth in SEQ ID NO: 1 having at least one amino acid variant at any one of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or a combination thereof); (b) an amino acid sequence set forth in SEQ ID NO: 2 having at least one amino acid variant at any one of positions 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or a combination thereof), or (c) a combination of the heavy chain variable region described in (a) and the light chain variable region described in (b), wherein the total number of variant positions in the heavy chain variable region, the light chain variable region, or the combination thereof of the bispecific antibody is at least 2, comprises culturing a cell or cells comprising a nucleic acid sequence encoding at least VH and VL of the bispecific antibody, wherein a polypeptide comprising a variant VH and a variant VL domain is expressed and isolated, and the isolated variant VH and variant VL domains form a heterodimer. As disclosed in detail herein, the isolated nucleic acid sequences encoding the variant VH domain and the variant VL domain may be contained within a vector, and the same or different vectors may be used. In some embodiments, each variant VH domain and variant VL domain may be expressed from a different host cell, and dimer formation occurs after isolation or purification of the component variant VH and variant VL domains. In some embodiments, the variant VH domain and the variant VL domain may be expressed from the same host cell, and dimer formation occurs during culturing or after isolation or purification of the component variant VH and variant VL domains.
[0282] One of ordinary skill in the art will understand that producing a bispecific antibody involves synthesizing amino acid polypeptide components that include the VH domain, the VL domain, or both. In some embodiments, the synthesis begins with the nucleic acid constructs described in detail herein. The terms "producing" and "synthesizing" may be used interchangeably with all the same qualities and meanings in some embodiments.
[0283] In some embodiments, synthesizing a bispecific antibody comprises synthesizing an IgG heavy chain comprising a variant VH domain, synthesizing an IgG light chain comprising a variant VL domain, or both. In some embodiments, synthesizing a bispecific antibody comprises synthesizing an IgG heavy chain comprising a variant VH domain. In some embodiments, synthesizing a bispecific antibody comprises synthesizing an IgG light chain comprising a variant VL domain. In some embodiments, synthesizing a bispecific antibody comprises synthesizing both an IgG heavy chain comprising a variant VH domain and an IgG light chain comprising a variant VL domain. In some embodiments, synthesizing a bispecific antibody comprises synthesizing a Fab comprising a fragment of an IgG heavy chain comprising a variant VH domain and a fragment of an IgG light chain comprising a variant VL domain. In some embodiments, synthesizing a bispecific antibody comprises synthesizing an F(ab’)2 comprising a fragment of an IgG heavy chain comprising a variant VH domain and a fragment of an IgG light chain comprising a variant VL domain. In some embodiments, synthesizing a bispecific antibody comprises synthesizing an Fv comprising a variant VH domain and a variant VL domain. In some embodiments, synthesizing a bispecific antibody comprises synthesizing a scFv comprising a variant VH domain and a variant VL domain. In some embodiments, synthesizing a bispecific antibody comprises synthesizing a minibody comprising a variant VH domain and a variant VL domain. In some embodiments, synthesizing a bispecific antibody comprises synthesizing a diabody comprising a variant VH domain and a variant VL domain. In some embodiments, synthesizing a bispecific antibody comprises synthesizing a triabody comprising a variant VH domain and a variant VL domain. In some embodiments, synthesizing a bispecific antibody comprises synthesizing a variant VH domain. In some embodiments, synthesizing a bispecific antibody comprises synthesizing a variant VL domain.
[0284] In certain embodiments, the polypeptide expressed in the host cell forms a dimer, whereby a bispecific antibody or its binding component can be produced.
[0285] In some embodiments, a method of synthesizing a bispecific antibody comprises mutating a nucleic acid sequence encoding a template heavy chain variable region that does not contain a bispecific VH domain to generate a variant VH domain that may contain a bispecific VH domain. In some embodiments, a method of synthesizing a bispecific antibody comprises mutating a nucleic acid sequence encoding a template light chain variable region that does not contain a bispecific VL domain to generate a variant VL domain that may contain a bispecific VL domain. In some embodiments, a method of synthesizing a bispecific antibody comprises mutating a nucleic acid sequence encoding a template heavy chain variable region that does not contain a bispecific VH domain to generate a variant VH domain that may contain a bispecific VH domain, and mutating a nucleic acid sequence encoding a template light chain variable region that does not contain a bispecific VL domain to generate a variant VL domain that may contain a bispecific VL domain, wherein the variant VH and VL domains comprise the bispecific variable region of the antibody. Methods of mutating nucleic acid sequences are described in detail above and exemplified below in the Examples.
[0286] In some embodiments, the template nucleic acid sequence encoding the template heavy chain variable region is set forth in SEQ ID NO: 55. In some embodiments, the template nucleic acid sequence encoding the template light chain variable region is set forth in SEQ ID NO: 56. As described throughout, the template VH and VL sequences do not contain a bispecific region.
[0287] In some embodiments, a method of synthesizing a bispecific antibody comprises introducing at least two variant sites within the VH domain and the VL domain. In some embodiments, a method of synthesizing a bispecific antibody comprises introducing at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 variant sites within the VH domain and the VL domain. The variant sites may be distributed between the VH domain and the VL domain. In some embodiments, the variant sites are within the CDR regions of the VH domain. In some embodiments, the variant sites are within the CDR regions of the VL domain. In some embodiments, the variant sites are within the FR regions of the VH domain. In some embodiments, the variant sites are within the FR regions of the VL domain. In some embodiments, the variant sites are within the CDR regions and / or FR regions of the VH domain. In some embodiments, the variant sites are within the CDR regions and / or FR regions of the VL domain. In some embodiments, the variant sites are within the CDR regions and / or FR regions of the VH domain and within the CDR regions and / or FR regions of the VL domain.
[0288] In certain embodiments, a complex of a variant VH domain and a variant VL domain may be formed within a host cell. For example, a heterodimer of a variant VH domain and a variant VL domain may be formed within a host cell using a relevant enzyme and / or cofactor. In certain embodiments, a complex of a variant VH domain polypeptide and a variant VL domain polypeptide may be secreted outside the cell. In certain embodiments, a variant VH domain and a variant VL domain may be secreted from a host cell and form a heterodimer outside the host cell.
[0289] In certain embodiments, the variant VH domain and the variant VL domain can be expressed separately and dimerize under appropriate conditions. For example, the variant VH domain and the variant VL domain can be combined in a suitable buffer, enabling the variant VH domain and the variant VL domain to dimerize through appropriate interactions such as hydrophobic interactions. As another example, the variant VH domain and the variant VL domain can be combined in a suitable buffer containing an enzyme and / or cofactor that can promote dimerization of the variant VH domain and the variant VL domain. As another example, the variant VH domain and the variant VL domain can be combined in a suitable vehicle, enabling them to react with each other in the presence of a suitable reagent and / or catalyst.
[0290] In certain embodiments, the variant VH domain and the variant VL domain can be included within a longer polypeptide sequence that includes, but is not limited to, a constant region, a hinge region, a linker region, an Fc region, or a disulfide bond region, or any combination thereof. The constant domain is the immunoglobulin folding unit of the constant portion of the immunoglobulin molecule, also called the domain of the constant region (e.g., CH1, CH2, CH3, CH4, Ck, Cl). In some embodiments, the longer polypeptide may include multiple copies of the variant VH domain, the variant VL domain, or both, for example, without limitation when a bispecific antibody includes a diabody or a triabody.
[0291] In certain embodiments, the variant VH domain and the variant VL domain are generated by DNA synthesis and PCR, and by translation of the generated nucleotide sequences. In certain embodiments, the generated sequences can be subcloned into an expression vector. In certain embodiments, the generated sequences can be subcloned into two expression vectors. In certain embodiments, the expression vector is a plasmid. In certain embodiments, the variant VH domain and the variant VL domain are constructed on an IgG template that has no double binding ability.
[0292] In certain embodiments, transient expression is performed by co-transfecting an expression vector encoding the variant VH domain and the variant VL domain, or by transfecting an expression vector encoding both into a suitable cell. One of ordinary skill in the art will understand that there are numerous transfection methods and protocols that can be used for this purpose. In certain embodiments, transfection or co-transfection is performed using the PEI method.
[0293] An expression polypeptide comprising a variant VH domain and a variant VL domain and / or a polypeptide complex can be collected using any suitable method. The variant VH domain and the variant VL domain and / or the polypeptide complex can be expressed intracellularly, in the periplasmic space of the cell membrane, or secreted into the medium outside the cell. When a polypeptide comprising a variant VH domain and a variant VL domain and / or a polypeptide complex is expressed intracellularly, the host cell containing the polypeptide comprising the variant VH domain and the variant VL domain and / or the polypeptide complex may be lysed, and the polypeptide and / or the polypeptide complex may be isolated from the lysate by removing unwanted debris by centrifugation or ultrafiltration. When a polypeptide comprising a variant VH domain and a variant VL domain and / or a polypeptide complex is secreted into the periplasmic space of E. coli cells, the cell paste may be thawed for about 30 minutes in the presence of agents such as sodium acetate (pH 3.5), EDTA, and phenylmethylsulfonyl fluoride (PMSF), and the cell debris may be removed by centrifugation (Carter et al., BioTechnology 10:163-167 (1992)). When a polypeptide comprising a variant VH domain and a variant VL domain and / or a polypeptide complex is secreted into the medium, the supernatant of the cell culture may be collected and concentrated using a commercially available protein concentration filter, such as an Amincon or Millipore Pellicon ultrafiltration unit. Protease inhibitors and / or antibiotics may be included in the collection and concentration steps to inhibit proteolysis and / or the growth of contaminating microorganisms.
[0294] An expression polypeptide and / or polypeptide complex comprising a variant VH domain and a variant VL domain can be further purified by suitable methods such as affinity chromatography, hydroxylapatite chromatography, size exclusion chromatography, gel electrophoresis, dialysis, ion exchange fractionation on an ion exchange column, ethanol precipitation, reverse phase HPLC, chromatography on silica, chromatography on heparin sepharose, chromatography on an anion or cation exchange resin (such as a polyaspartic acid column), isoelectric focusing electrophoresis, SDS-PAGE, and ammonium sulfate precipitation (for reviews, see Bonner, P.L., Protein purification, published by Taylor & Francis, 2007; Janson, J.C., et al, Protein purification: principles, high resolution methods and applications, published by Wiley-VCH, 1998).
[0295] In certain embodiments, a polypeptide comprising a variant VH domain and a variant VL domain and / or a polypeptide dimer complex can be purified by affinity chromatography. In certain embodiments, protein A chromatography or protein A / G (a fusion protein of protein A and protein G) chromatography can be useful for purifying polypeptides and / or polypeptide complexes comprising components derived from the antibody CH2 domain and / or CH3 domain (Lindmark et al., J. Immunol. Meth. 62:1-13 (1983)), Zettlit, K.A., Antibody Engineering, Part V, 531-535, 2010). In certain embodiments, the bispecific antibodies disclosed herein do not bind to protein A. In certain embodiments, protein G chromatography can be useful for purifying polypeptides and / or polypeptide complexes comprising the IgGγ3 heavy chain (Guss et al., EMBO J. 5:1567 1575(1986)). In certain embodiments, protein L chromatography can be useful for purifying polypeptides and / or polypeptide complexes comprising the K light chain (Sudhir, P., Antigen engineering protocols, Chapter 26, Humana Press, 1995, Nilson, B.H.K. et al, J. Biol. Chem., 267, 2234-2239(1992)). The matrix to which the affinity ligand binds is most often agarose, although other matrices are available. Mechanically stable matrices such as controlled pore glass or poly(styrene divinyl) benzene allow faster flow rates and shorter processing times than can be achieved with agarose. If the antibody comprises a CH3 domain, Bakerbond ABX resin (J.T. Baker, Phillipsburg, N.J.) is useful for purification.
[0296] Following any preliminary purification steps, the mixture containing the bispecific antibody and contaminants may be subjected to low pH hydrophobic interaction chromatography using an elution buffer at a pH of about 2.5 to 4.5, preferably performed at a low salt concentration (e.g., about 0 to 0.25 M salt).
[0297] In certain embodiments, polypeptides comprising variant VH domains and variant VL domains and / or polypeptide dimer complexes can be purified by affinity chromatography and size exclusion chromatography (SEC). Those skilled in the art will understand that there are numerous methods and protocols suitable for this purpose. In certain embodiments, protein purification by affinity chromatography and SEC is performed using an AKTA Pure instrument (GE Lifesciences). In certain embodiments, affinity capture of the bispecific antibody is achieved by passing the recovered supernatant over a column of CaptureSelect™ CH1-XL affinity matrix (Thermo Scientific). After washing the column with PBS, the protein is eluted with 0.1 M glycine, pH 2.5 and immediately neutralized with 1 / 6 volume of 1 M Tris-HCl, pH 8.0. The affinity-purified protein is then concentrated to 5 - 10 mg / ml using an Amicon 30 kD concentrator (Merck Millipore) and subjected to SEC purification on a Superdex® 200 column (GE Lifesciences) equilibrated with PBS. The protein fractions are then collected and analyzed using SDS-PAGE and HPLC-SEC.
[0298] Binding of the synthesized bispecific immunoglobulin to the epitope can be analyzed using methods well known in the art described herein, including ELISA assays, SPR assays, DSF assays, and cell-based binding assays.
[0299] In some embodiments, a method of synthesizing a bispecific antibody comprising a heavy chain variable region comprising the template amino acid sequence set forth in SEQ ID NO: 1, said template comprising at least one amino acid variant at any one of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or a combination thereof); and a light chain variable region comprising the template amino acid sequence set forth in SEQ ID NO: 2, said template comprising at least one amino acid variant at any one of positions 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or a combination thereof), wherein the total number of variant positions in the heavy chain variable region, the light chain variable region, or a combination thereof is at least 2, comprises the following steps, (a) mutating the template heavy chain variable region, the template light chain variable region, or both, (i) mutating the template heavy chain variable region comprises mutating the template heavy chain variable region set forth in SEQ ID NO: 1, and the selected template variable chain does not comprise a bispecific region, (ii) mutating the template light chain variable region comprises mutating the template light chain variable region set forth in SEQ ID NO: 2, and the selected template variable chain does not comprise a bispecific region, (iii) mutating both the template heavy chain variable region and the template light chain variable region comprises mutating the template heavy chain variable region set forth in SEQ ID NO: 1 and mutating the template light chain variable region set forth in SEQ ID NO: 2, and the selected template variable chains together do not comprise a bispecific region, and the mutating comprises mutating at least two residues in the template heavy chain variable region, the template light chain variable region, or a combination thereof, (b) synthesizing the mutated template variant heavy chain variable chain and the mutated template variant light chain variable chain, (c) Forming the mutated template variant heavy chain variable chain and the mutated template variant light chain variable chain into a human antibody format; and (d) Screening the human antibody of (c) for binding to a dual antigen, Thereby producing a dual-binding antibody, including.
[0300] As described herein and as exemplified below, in some embodiments, the synthesized antibody comprises an IgG immunoglobulin. In some embodiments, the synthesized antibody comprises an IgG1 immunoglobulin, an IgG2 immunoglobulin, an IgG3 immunoglobulin, or an IgG4 immunoglobulin. In some embodiments, the synthesized antibody comprises an IgG1 immunoglobulin. In some embodiments, the synthesized antibody comprises an IgG2 immunoglobulin. In some embodiments, the synthesized antibody comprises an IgG3 immunoglobulin. In some embodiments, the synthesized antibody comprises an IgG4 immunoglobulin. In some embodiments, the synthesized antibody comprises an IgG1 immunoglobulin or an IgG4 immunoglobulin.
[0301] In some embodiments, the synthesized antibody comprises a Fab immunoglobulin fragment. In some embodiments, the synthesized antibody comprises an F(ab’)2 immunoglobulin fragment. In some embodiments, the synthesized antibody comprises an Fv immunoglobulin construct, in some embodiments, the synthesized antibody comprises a scFv immunoglobulin construct, and in some embodiments, the synthesized antibody comprises a minibody immunoglobulin construct comprising a pair of single-chain Fv fragments linked via a CH3 domain.
[0302] In some embodiments, the synthesized antibody comprises a diabody immunoglobulin construct. In some embodiments, the synthesized antibody comprises a diabody immunoglobulin construct comprising three scFv fragments covalently linked to each other. In some embodiments, the synthesized antibody comprises a triabody.
[0303] In some embodiments, the synthesized antibody comprises a mutant IgG that is unable to bind to antibody-dependent cytotoxicity components. In some embodiments, the synthesized antibody comprises a mutant IgG1 that is unable to bind to antibody-dependent cytotoxicity components. In some embodiments, the synthesized antibody comprises a mutant IgG4 that is unable to bind to antibody-dependent cytotoxicity components.
[0304] Immunoglobulin library In certain embodiments, a library of immunoglobulins or fragments thereof comprising the variant VH domain, variant VL domain, or variant VH and variant VL domains described in detail herein is disclosed herein (see the following examples). In some embodiments, a library of immunoglobulins or fragments thereof comprising the variant VH domain, variant VL domain, or variant VH and variant VL domains can be screened for bispecific antibodies, fragments thereof, or components thereof.
[0305] In some embodiments, the library of immunoglobulins or fragments thereof comprises a library of variable heavy chain domains. In some embodiments, the library of immunoglobulins or fragments thereof comprises a library of variable light chain domains. In some embodiments, the library of immunoglobulins or fragments thereof comprises a library of variable heavy chain and variable light chain domains.
[0306] In some embodiments, a method of generating a library of dual antigen-binding immunoglobulin variable heavy chain regions for screening for binding to an epitope comprises: (a) selecting a VH template antigen-binding molecule set forth in SEQ ID NO: 1, wherein the selected template does not specifically bind to the epitope; (b) for mutagenesis, selecting at least one residue position from positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111 in the template SEQ ID NO: 1, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or a combination thereof); and (c) selecting at least one variant residue for substitution at the at least one residue position selected in (b) such that a library containing a plurality of variants of the template VH is generated. In some embodiments, a method of generating a library of dual antigen-binding immunoglobulin variable light chain regions for screening for binding to an epitope comprises: (a) selecting a VL template antigen-binding molecule set forth in SEQ ID NO: 2, wherein the selected template does not specifically bind to the epitope; (b) for mutagenesis, selecting at least one residue position from positions 26, 27, 31, 51, 56, 77, 92, 93, or 96 in the template SEQ ID NO: 2, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or a combination thereof); and (c) selecting at least one variant residue for substitution at the at least one residue position selected in (b) such that a library containing a plurality of variants of the template VL is generated.
[0307] In some embodiments, a method of generating a library of bispecific antigen-binding immunoglobulins for screening for binding to an epitope comprises: (a) selecting a VH template antigen-binding molecule set forth in SEQ ID NO: 1, wherein the selected template does not specifically bind to the epitope; (b) selecting a VL template antigen-binding molecule set forth in SEQ ID NO: 2, wherein the selected template does not specifically bind to the epitope; (c) for mutations, selecting at least one residue from position 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111 in the template SEQ ID NO: 1, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or combinations thereof); (d) for mutations, selecting at least one residue from position 26, 27, 31, 51, 56, 77, 92, 93, or 96 in the template SEQ ID NO: 2, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or combinations thereof); and (e) selecting at least one variant residue for substitution at the at least one residue position selected in (c) or at least one variant residue for substitution at the at least one residue position selected in (d) such that the total number of variant residues in each possible bispecific immunoglobulin is at least 2 and a library containing a plurality of variants of the template VH and a plurality of variants of the template VL is generated.
[0308] In some embodiments, methods of constructing the library can be found in the Examples. In some embodiments, the generated libraries described herein can be used to identify immunoglobulins that bind to a bispecific target. In some embodiments, the generated libraries described herein can be used to identify immunoglobulins that bind to a specific epitope.
[0309] In some embodiments, the use of a protein library comprising an immunoglobulin comprising variant VH, variant VL, or both variant VH and variant VL, as described in detail herein, provides a method for identifying immunoglobulins that bind to dual targets. In some embodiments, the use of a protein library comprising an immunoglobulin comprising variant VH, variant VL, or both variant VH and variant VL, as described in detail herein, provides a method for identifying immunoglobulins that bind to specific epitopes.
[0310] In some embodiments, a protein library comprising an immunoglobulin comprising variant VH and variant VL comprises a library of antibody molecules. In some embodiments, a protein library comprising an immunoglobulin comprising variant VH and variant VL comprises a library of IgG molecules. In some embodiments, a protein library comprising an immunoglobulin comprising variant VH and variant VL comprises a library of IgG1, IgG2, IgG3, or IgG4 molecules. In some embodiments, the IgG molecule is a mutant IgG molecule that is unable to bind to antibody-dependent cell cytotoxicity components.
[0311] In some embodiments, a protein library comprising an immunoglobulin comprising variant VH and variant VL comprises a library of Fab or F(ab’)2 molecules. In some embodiments, a protein library comprising an immunoglobulin comprising variant VH and variant VL comprises a library of Fv molecules, scFv molecules, minibody molecules, diabody molecules, or triabody molecules.
[0312] In some embodiments, existing immunoglobulin VH and VL templates can be modified to introduce variant amino acids at specific positions for the purpose of generating dual antigen binding sites in the variant VH domain and the variant VL domain. The protein library of variant VH domains and variant VL domains includes at least 10, 100, 1,000, 10,000, 100,000, or 1,000,000 variant VHs, variant VLs, or variant VHs and variant VLs having at least two variant positions. In some embodiments, the protein library of variant VH domains and variant VL domains includes 1,000 to 1,000,000 variant VH domains, variant VL domains, or variant VH domains and variant VL domains having at least two variant positions. In some embodiments, the protein library of variant VH domains and variant VL domains includes 10,000 to 1,000,000 variant VH domains, variant VL domains, or variant VH domains and variant VL domains having at least two variant positions.
[0313] In some embodiments, the protein library of variant VH domains and variant VL domains includes 1,000 to 1,000,000 variant VH domains, variant VL domains, or variant VH domains and variant VL domains having at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 variant positions. In some embodiments, the protein library of variant VH domains and variant VL domains includes 10,000 to 1,000,000 variant VH domains, variant VL domains, or variant VH domains and variant VL domains having at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 variant positions.
[0314] In some embodiments, the protein library of variant VH domains and variant VL domains has at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 variant positions, 10 6 to 10 14 individual variant VH domains, variant VL domains, or both variant VH domains and variant VL domains. In some embodiments, the protein library of variant VH domains and variant VL domains has at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 variant positions, 10 6 to 10 14 individual variant VH domains, variant VL domains, or both variant VH domains and variant VL domains.
[0315] The library is then screened for binding to one or more antigens. After molecular characterization of the desired properties, the selected antibody domain or region, e.g., but not limited to, the VH domain or VL domain, or both, is cloned into an immunoglobulin molecule by genetic engineering techniques, resulting in replacement of the corresponding region. Alternatively, only the DNA encoding the VH, or VL, or both regions, or the DNA encoding the variant amino acids may be exchanged to obtain an immunoglobulin with additional binding sites for the molecule. In some embodiments, the selection of the immunoglobulin molecule into which the variant region is cloned may be selected from IgG, Fv, scFv, Fab, F(ab’)2, minibody, diabody, or triabody. In some embodiments, the IgG is IgG1, IgG2, IgG3, or IgG4. In some embodiments, the IgG includes a mutant IgG that cannot bind to antibody-dependent cell cytotoxicity components.
[0316] In some embodiments, the expressed CDRs are as described above for HCDR1, HCDR2, HCD3, LCDR1, LCDR2, and LCDR3, and certain positions contain variant amino acids as described in detail above and are shown in FIGS. 1A and 1B.
[0317] The sites for mutations are described above and, in certain embodiments, include positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111 in the template SEQ ID NO: 1, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or a combination thereof), and positions 26, 27, 31, 51, 56, 77, 92, 93, or 96 in the template SEQ ID NO: 2, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or a combination thereof). In some embodiments, additional sites within the VH or VL template may be mutated.
[0318] In certain embodiments, the method of generating a library further includes synthesizing template variants (VH, VL, or both VH and VL) from the nucleic acid construct as described in detail above to generate a library.
[0319] The results of the generation of the above library include: (a) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 1, having at least one amino acid variant at any one of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or a combination thereof); (b) a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 2, having at least one amino acid variant at any one of positions 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or a combination thereof); or (c) a library of immunoglobulins comprising a combination of the heavy chain variable region described in (a) and the light chain variable region described in (b), wherein the total number of variant positions in the heavy chain variable region, the light chain variable region, or a combination thereof is at least 2.
[0320] Mammalian cell expression systems are described above. These expression systems offer numerous potential advantages for therapeutic antibody production, including the ability to simultaneously select for key manufacturing-related properties such as high-level expression and stability while presenting functionally glycosylated IgG on the cell surface, for creating a library of potential bispecific immunoglobulins.
[0321] In some embodiments, the library of immunoglobulins includes IgG molecules, Fab molecules, F(ab’)2 molecules, FV molecules, VH molecules, VL molecules, scFv molecules, diabodies, minibodies, or triabodies. In some embodiments, the IgG molecules include IgG1, IgG2, IgG3, or IgG4. In some embodiments, the IgG includes mutant IgG that cannot bind to antibody-dependent cell cytotoxicity components. In some embodiments, the IgG1 includes mutant IgG1 that cannot bind to antibody-dependent cell cytotoxicity components.
[0322] In some embodiments, methods are disclosed herein for screening a library comprising an antigen molecule or a portion thereof to select a double - bond molecule having desirable properties (e.g., binding affinity, stability, etc.). In some embodiments, a portion of the antigen comprises at least one IL - 13 antigenic epitope. In some embodiments, double - bond molecules isolated from the library after such screening are disclosed herein.
[0323] In some embodiments, methods are disclosed herein for screening a library of immunoglobulins for a double - bond molecule, comprising: (a) screening a library comprising an antigen molecule or a fragment thereof to identify a double - bond molecule that binds to the epitope of interest; (b) screening the binding substance identified in step (a) to determine which residues are variants and which variant residues are enriched in the binding immunoglobulin; (c) using the information from step (b) to synthesize an optimized library of variants of the double - bond substance; and (d) repeating steps (a) - (c) using the optimized library. In some embodiments, methods are disclosed herein for screening a library of immunoglobulins for a double - bond molecule, comprising: (a) screening a library comprising the epitope of interest to identify a double - bond molecule that binds to the epitope of interest; (b) screening the binding substance identified in step (a) to determine which residues are variants and which variant residues are enriched in the binding immunoglobulin; (c) using the information from step (b) to synthesize an optimized library of variants of the double - bond substance; and (d) repeating steps (a) - (c) using the optimized library.
[0324] According to some embodiments, specific binding of the variant immunoglobulin to the antigen molecule is determined by a binding assay selected from the group consisting of immunological assays including, but not limited to, enzyme-linked immunosorbent assay (ELISA), surface plasmon resonance assay, saturation transfer difference nuclear magnetic resonance spectroscopy, transferred NOE (trNOE) nuclear magnetic resonance spectroscopy, competitive assay, tissue binding assay, live cell binding assay, and cell extraction assay.
[0325] The binding assay can be performed using a variety of methods known in the art including, but not limited to, AlphaScreen™ (amplified luminescent proximity homogeneous assay), scintillation proximity assay, ELISA (enzyme-linked immunosorbent assay), SPR (surface plasmon resonance, also known as BIACORE®), isothermal titration calorimetry, differential scanning calorimetry, gel electrophoresis, and chromatography including gel filtration, which are FRET (fluorescence resonance energy transfer) and BRET (bioluminescence resonance energy transfer)-based assays. These and other methods can utilize several fusion partners or labels.
[0326] In some embodiments, the variant immunoglobulin is conjugated to a label selected from the group consisting of organic molecules, enzyme labels, radiolabels, colored labels, fluorescent labels, chromogenic labels, luminescent labels, haptens, digoxigenin, biotin, metal complexes, metals, colloidal gold, and mixtures thereof. The conjugation to the label can, in certain embodiments, enable, for example, simple detection of the conjugate in a binding assay (e.g., ELISA) and binding studies.
[0327] Use Composition In some embodiments, pharmaceutical compositions comprising the bispecific antibodies described herein that provide a therapeutic agent are described herein. In some embodiments, pharmaceutical compositions comprising bispecific antibodies comprising a therapeutic agent that includes a mutant IgG that is unable to bind to an antibody-dependent cytotoxicity component are described herein. In some embodiments, pharmaceutical compositions comprising bispecific antibodies having therapeutic properties against an allergic or respiratory condition are described herein.
[0328] In some embodiments, the pharmaceutical composition comprises a bispecific antibody comprising a variant VH, a variant VL, or variant VH and variant VL, and a pharmaceutically acceptable carrier. The amino acid sequences of the variant VH domain and the variant VL domain, and pairs thereof, are described in detail above (see, e.g., but not limited to, Table 1).
[0329] In certain embodiments, the composition comprises any of the isolated bispecific antibodies disclosed herein, and a pharmaceutically acceptable carrier.
[0330] In one embodiment, the pharmaceutical composition comprises a bispecific antibody having HCDR1, HCDR2, and HCDR3 comprising the amino acid sequences of SEQ ID NOs: 349, 350, and 351, respectively, and LCDR1, LCDR2, and LCDR3 comprising the amino acid sequences of SEQ ID NOs: 359, 360, and 361, respectively.
[0331] In another embodiment, the pharmaceutical composition comprises a bispecific antibody having HCDR1, HCDR2, and HCDR3 comprising the amino acid sequences of SEQ ID NOs: 349, 356, and 351, respectively, and LCDR1, LCDR2, and LCDR3 comprising the amino acid sequences of SEQ ID NOs: 364, 360, and 371, respectively.
[0332] In another embodiment, the pharmaceutical composition comprises a bispecific antibody having HCDR1, HCDR2, and HCDR3 comprising the amino acid sequences of SEQ ID NOs: 349, 350, and 351, respectively, and LCDR1, LCDR2, and LCDR3 comprising the amino acid sequences of SEQ ID NOs: 362, 360, and 384, respectively.
[0333] In another embodiment, the pharmaceutical composition comprises a bispecific antibody having HCDR1, HCDR2, and HCDR3 comprising the amino acid sequences of SEQ ID NOs: 349, 350, and 351, respectively, and LCDR1, LCDR2, and LCDR3 comprising the amino acid sequences of SEQ ID NOs: 364, 360, and 384, respectively.
[0334] In another embodiment, the pharmaceutical composition comprises a bispecific antibody having HCDR1, HCDR2, and HCDR3 comprising the amino acid sequences shown in Table 8 or Table 4, and LCDR1, LCDR2, and LCDR3 comprising the amino acid sequences shown in Table 9 or Table 5.
[0335] In another embodiment, the pharmaceutical composition comprises a bispecific antibody comprising a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein VH and VL comprise the amino acid sequences of SEQ ID NOs: 209 and 210.
[0336] In another embodiment, the pharmaceutical composition comprises a bispecific antibody comprising a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein VH and VL comprise the amino acid sequences of SEQ ID NOs: 219 and 220.
[0337] In another embodiment, the pharmaceutical composition comprises a bispecific antibody comprising a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein VH and VL comprise the amino acid sequences of SEQ ID NOs: 249 and 250.
[0338] In another embodiment, the pharmaceutical composition comprises a bispecific antibody comprising a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein VH and VL comprise the amino acid sequences of SEQ ID NOs: 337 and 338.
[0339] In another embodiment, the pharmaceutical composition comprises a bispecific antibody comprising a heavy chain variable domain (VH) and a light chain variable domain (VL), and the VH and VL comprise the amino acid sequences shown in Table 10 or Table 1.
[0340] In another embodiment, the pharmaceutical composition comprises a bispecific antibody comprising a heavy chain variable domain (VH) and a light chain variable domain (VL), and the VH and VL are at least 80%, 85%, 90%, 95%, 98%, or 99% identical to the VH and VL sequences disclosed herein.
[0341] In some embodiments, the pharmaceutical composition comprising a bispecific antibody comprises any bispecific antibody described herein that comprises a variant VH, a variant VL, or a variant VH and a variant VL. In some embodiments, the pharmaceutical composition comprising a bispecific antibody comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 1 having at least one amino acid variant at any one of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or a combination thereof), a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 2 having at least one amino acid variant at any one of positions 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or a combination thereof), or a combination of the heavy chain variable region described in (a) and the light chain variable region described in (b), and the total number of variant positions in the heavy chain variable region, the light chain variable region, or a combination thereof is at least 2.
[0342] One of ordinary skill in the art will recognize that, in some embodiments, the term "bispecific antibody" can be used interchangeably with the terms "drug" or "agent", all having the same meaning and quality. In some embodiments, a drug comprising a bispecific antibody comprises a pharmaceutical composition.
[0343] In some embodiments, compositions comprising bispecific antibodies described herein and administration of such compositions in various therapeutic settings are described herein.
[0344] Administration of the bispecific antibodies described herein, in pure form or in a suitable pharmaceutical composition, can be effected via any of the acceptable modes of administration of agents for similar utilities. The pharmaceutical composition can be prepared by combining the bispecific antibody or bispecific antibody-containing composition with a suitable physiologically acceptable carrier, diluent, or excipient, and can be formulated into preparations in solid, semi-solid, liquid or gaseous forms such as tablets, capsules, powders, granules, ointments, solutions, suppositories, injections, inhalants, gels, microspheres, and aerosols. Additionally, other pharmaceutically active ingredients such as salts, buffers and stabilizers and / or suitable excipients may or may not be present in the composition. Administration can be accomplished by various different routes including oral, parenteral, nasal, intravenous, intradermal, subcutaneous or topical. In some embodiments, the mode of administration depends on the nature of the condition to be treated or prevented. After administration, an amount that reduces, inhibits, prevents or delays cancer progression and / or metastasis is considered effective. One of ordinary skill in the art will understand that the term "physiologically acceptable carrier, diluent or excipient" can be used interchangeably with the term "pharmaceutically acceptable carrier" in some embodiments, all having the same meaning and quality.
[0345] In some embodiments, the pharmaceutical composition described herein comprises a nucleotide sequence encoding a bispecific antibody. In some embodiments, the nucleotide sequence encoding the bispecific antibody disclosed herein comprises a single linear nucleotide sequence. In some embodiments, the nucleotide sequence encoding the bispecific antibody disclosed herein comprises two linear nucleotide sequences. In some embodiments, the nucleotide sequence encoding the bispecific antibody disclosed herein comprises two nucleotide sequences present in the same vector. In some embodiments, the nucleotide sequence encoding the bispecific antibody disclosed herein comprises two nucleotide sequences present in different vectors.
[0346] In some embodiments, the nucleotide sequence comprises a variant VH domain or a variant VL domain or a combination thereof. In some embodiments, the same nucleotide sequence comprises a variant VH domain or a variant VL domain or a combination thereof. In some embodiments, different nucleotide sequences encode a variant VH domain or a variant VL domain or a combination thereof. In some embodiments, one nucleotide sequence encodes a variant VH domain and another nucleotide sequence encodes a variant VL domain. In some embodiments, one nucleotide sequence encodes a variant VH domain and another nucleotide sequence encodes a variant VL domain having a linker sequence therebetween, thereby enabling heterodimerization of the variant VH domain and the variant VL domain as described in Duperret EK et al., Cancer Res, Oct. 4 (doi:10.1158 / 0008-5472.CAN-18-1429).
[0347] In some embodiments, a method of treating an allergic condition or a respiratory condition, or a combination thereof, in a subject comprises administering to a subject in need thereof a pharmaceutical composition comprising a bispecific antibody comprising (a) a variant VH domain comprising the amino acid sequence set forth in SEQ ID NO: 1 having at least one amino acid variant at any one of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or a combination thereof), and (b) a variant VL domain comprising the amino acid sequence set forth in SEQ ID NO: 2 having at least one amino acid variant at any one of positions 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or a combination thereof), wherein the method treats the allergic condition or the respiratory condition, or the combination thereof, as compared to a subject not administered the pharmaceutical composition.
[0348] In some embodiments, a method of treating an allergic condition or a respiratory condition, or a combination thereof, in a subject comprises administering to a subject in need thereof a pharmaceutical composition comprising a bispecific antibody comprising a variant VH domain comprising the amino acid sequence set forth in SEQ ID NO: 1 having at least one amino acid variant at any one of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or a combination thereof), wherein the method treats the allergic condition or the respiratory condition, or the combination thereof, as compared to a subject not administered the pharmaceutical composition.
[0349] In some embodiments, a method of treating an allergic condition or a respiratory condition, or a combination thereof, in a subject comprises administering to a subject in need thereof a pharmaceutical composition comprising a bispecific antibody comprising a variant VL domain comprising an amino acid sequence set forth in SEQ ID NO: 2 having at least one amino acid variant at any one of positions 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or a combination thereof), wherein the method treats the allergic condition or the respiratory condition, or the combination thereof, as compared to a subject not administered the pharmaceutical composition.
[0350] Method of use In some embodiments, a method of treating a subject afflicted with a disease or condition is disclosed herein, the method comprising administering to the subject a composition comprising an isolated bispecific antibody disclosed herein. In some embodiments, the disease or condition is an allergic condition or a respiratory condition, an inflammatory condition or an autoimmune condition, or a tumor or cancer. In some embodiments, the disease or condition is asthma, allergic asthma, non-allergic asthma, severe asthma, mild asthma, chronic obstructive pulmonary disease (COPD), a condition with airway inflammation, cystic fibrosis, allergic lung disease, airway hyperresponsiveness, goblet cell metaplasia, mucus hypersecretion, airway remodeling, pulmonary fibrosis, atopic dermatitis, urticaria, eczema, allergic gastroenteritis, allergic rhinitis, inflammatory bowel disease, cirrhosis or fibrosis, or a combination thereof.
[0351] In some embodiments, a method of treating an allergic or respiratory condition, an inflammatory and / or autoimmune condition of the skin or gastrointestinal organs, scleroderma, or a tumor or cancer including Hodgkin's lymphoma, or any combination thereof, in a subject, comprises administering a pharmaceutical composition comprising a bispecific antibody or the pharmaceutical composition, wherein the bispecific antibody comprises a heavy chain variable region comprising HCDRs (HCDR1, HCDR2, HCDR3 as described in detail herein, e.g., see Table 8 or Table 4). In some embodiments, a method of treating an allergic or respiratory condition, an inflammatory and / or autoimmune condition of the skin or gastrointestinal organs, scleroderma, or a tumor or cancer including Hodgkin's lymphoma, or any combination thereof, in a subject, comprises administering a pharmaceutical composition comprising a bispecific antibody or the pharmaceutical composition, wherein the bispecific antibody comprises a light chain variable region comprising LCDRs (LCDR1, LCDR2, LCDR3 as described in detail herein, e.g., see Table 9 or Table 5). In some embodiments, a method of treating an allergic or respiratory condition, an inflammatory and / or autoimmune condition of the skin or gastrointestinal organs, scleroderma, or a tumor or cancer including Hodgkin's lymphoma, or any combination thereof, in a subject, comprises administering a pharmaceutical composition comprising a bispecific antibody or the pharmaceutical composition, wherein the bispecific antibody comprises a heavy chain variable region comprising HCDRs (HCDR1, HCDR2, HCDR3) and LCDRs (LCDR1, LCDR2, LCDR3 as described in detail herein).
[0352] In certain embodiments, a method of treating a subject suffering from a disease or condition comprises administering a bispecific antibody comprising three complementarity determining regions (CDRs) on the heavy chain (HCDR1, HCDR2, and HCDR3) and three CDRs on the light chain (LCDR1, LCDR2, and LCDR3), HCDR1, HCDR2, and HCDR3 each contain the amino acid sequences of SEQ ID NO: 349, 350, and 351, and LCDR1, LCDR2, and LCDR3 each contain the amino acid sequences of SEQ ID NO: 359, 360, and 361, or HCDR1, HCDR2, and HCDR3 each contain the amino acid sequences of SEQ ID NO: 349, 356, and 351, and LCDR1, LCDR2, and LCDR3 each contain the amino acid sequences of SEQ ID NO: 364, 360, and 371, or HCDR1, HCDR2, and HCDR3 each contain the amino acid sequences of SEQ ID NO: 349, 350, and 351, and LCDR1, LCDR2, and LCDR3 each contain the amino acid sequences of SEQ ID NO: 362, 360, and 384, or HCDR1, HCDR2, and HCDR3 each contain the amino acid sequences of SEQ ID NO: 349, 350, and 351, and LCDR1, LCDR2, and LCDR3 each contain the amino acid sequences of SEQ ID NO: 364, 360, and 384, or the CDRs have the sequences of SEQ ID NO: 149 - 154.
[0353] In some embodiments, a method of treating a subject afflicted with a disease or condition comprises administering a bispecific antibody comprising three complementarity - determining regions (CDRs) on the heavy chain (HCDR1, HCDR2, and HCDR3) and three CDRs on the light chain (LCDR1, LCDR2, and LCDR3), wherein HCDR1, HCDR2, and HCDR3 contain the amino acid sequences shown in Table 8 or Table 4, and LCDR1, LCDR2, and LCDR3 contain the amino acid sequences shown in Table 9 or Table 5.
[0354] In some embodiments, a method of treating a subject suffering from a disease or condition comprises administering a bispecific antibody comprising VH and VL having the sequences of SEQ ID NO: 209 and 210, SEQ ID NO: 219 and 220, SEQ ID NO: 249 and 250, SEQ ID NO: 337 and 338, SEQ ID NO: 155 and 156, SEQ ID NO: 157 and 158. In some embodiments, a method of treating a subject suffering from a disease or condition comprises administering a bispecific antibody comprising a VH domain and a VL domain having the sequences shown in Table 10 or Table 1.
[0355] In some embodiments, a method of treating an allergic condition or respiratory condition, an inflammatory condition and / or an autoimmune condition of the skin or gastrointestinal organs, scleroderma, or a tumor or cancer including Hodgkin's lymphoma, or any combination thereof, in a subject comprises administering to the subject in need thereof a pharmaceutical composition comprising a bispecific antibody or the pharmaceutical composition, the bispecific antibody comprising: (a) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 1 having at least one amino acid variant at any one of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or a combination thereof); (b) a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 2 having at least one amino acid variant at any one of positions 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or a combination thereof); or a combination of the heavy chain variable region described in (a) and the light chain variable region described in (b), wherein the total number of variant positions in the heavy chain variable region, the light chain variable region, or the combination thereof is at least 2. The method includes treating an allergic condition or respiratory condition, an inflammatory condition and / or an autoimmune condition of the skin or gastrointestinal organs, scleroderma, or a tumor or cancer including Hodgkin's lymphoma in the subject as compared to a subject not administered the bispecific antibody or the pharmaceutical composition thereof.
[0356] In some embodiments, a method of treating an allergic condition or respiratory condition, an inflammatory and / or autoimmune condition of the skin or gastrointestinal organs, scleroderma, or a tumor or cancer including Hodgkin's lymphoma, or any combination thereof, in a subject comprises administering to the subject in need thereof a pharmaceutical composition comprising a bispecific antibody or the pharmaceutical composition, wherein the bispecific antibody comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:1 having at least one amino acid variant at any one of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or a combination thereof), and the total number of variant positions in the heavy chain variable region is at least 2, and the method treats an allergic condition or respiratory condition, an inflammatory and / or autoimmune condition of the skin or gastrointestinal organs, scleroderma, or a tumor or cancer including Hodgkin's lymphoma in the subject as compared to a subject not administered the bispecific antibody or the pharmaceutical composition thereof.
[0357] In some embodiments, a method of treating an allergic or respiratory condition, an inflammatory and / or autoimmune condition of the skin or gastrointestinal organs, scleroderma, or a tumor or cancer including Hodgkin's lymphoma, or any combination thereof, in a subject comprises administering to the subject in need thereof a pharmaceutical composition comprising a bispecific antibody or a pharmaceutical composition thereof, the bispecific antibody comprising a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 2 having at least one amino acid variant at any of positions 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or a combination thereof), wherein the total number of variant positions in the light chain variable region is at least 2, the method treating the allergic or respiratory condition, the inflammatory and / or autoimmune condition of the skin or gastrointestinal organs, scleroderma, or the tumor or cancer including Hodgkin's lymphoma in the subject as compared to a subject not administered the bispecific antibody or the pharmaceutical composition thereof.
[0358] In some embodiments, a method of treating an allergic condition or respiratory condition, an inflammatory and / or autoimmune condition of the skin or gastrointestinal organs, scleroderma, or a tumor or cancer including Hodgkin lymphoma, or any combination thereof, in a subject comprises administering to the subject in need thereof a pharmaceutical composition comprising a bispecific antibody or a pharmaceutical composition thereof, the bispecific antibody comprising: (a) a heavy chain variable region comprising an amino acid sequence set forth in SEQ ID NO: 1 having at least one amino acid variant at any one of positions 52, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, or 111, or any combination thereof (IMGT positions 57, 107, 108, 109, 110, 111, 111A, 112A, 112, 113, 114, or 117, or a combination thereof); and (b) a light chain variable region comprising an amino acid sequence set forth in SEQ ID NO: 2 having at least one amino acid variant at any one of positions 26, 27, 31, 51, 56, 77, 92, 93, or 96, or any combination thereof (IMGT positions 27, 28, 38, 65, 70, 94, 109, 110, or 115, or a combination thereof), wherein the total number of variant positions in the heavy chain variable region, the light chain variable region, or the combination thereof is at least 2, and the method treats an allergic condition or respiratory condition, an inflammatory and / or autoimmune condition of the skin or gastrointestinal organs, scleroderma, or a tumor or cancer including Hodgkin lymphoma in the subject as compared to a subject not administered the bispecific antibody or the pharmaceutical composition thereof.
[0359] In some embodiments of a method for treating an allergic condition or a respiratory condition, an inflammatory condition and / or an autoimmune condition of the skin or gastrointestinal organs, scleroderma, or a tumor or cancer including Hodgkin's lymphoma, the amino acid sequence of the variant VH domain is selected from the sequences set forth in any of SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, and 54, without limitation. In some embodiments of a method for treating an allergic condition or a respiratory condition, an inflammatory condition and / or an autoimmune condition of the skin or gastrointestinal organs, scleroderma, or a tumor or cancer including Hodgkin's lymphoma, the bispecific antibody includes a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, and 54, without limitation, and any variable light chain region. In some embodiments of the methods disclosed herein, the amino acid sequence of the variant VH domain includes a sequence that is at least 80% identical (e.g., 80%, 85%, 90%, 95%, 98%, or 99% identical) to the sequences set forth in any of SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, and 54.
[0360] In some embodiments of the methods disclosed herein, the VH domain of the bispecific antibody is selected from the sequences set forth in any of SEQ ID NOs: 209, 211, 213, 215, 217, 219, 221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243, 245, 247, 249, 251, 253, 255, 257, 259, 261, 263, 265, 267, 269, 271, 273, 275, 277, 279, 281, 283, 285, 287, 289, 291, 293, 295, 297, 299, 301, 303, 305, 307, 309, 311, 313, 315, 317, 319, 321, 323, 325, 327, 329, 331, 333, 335, 337, 339, 341, 343, 345, and 347. In another embodiment, the VH domain is at least 80%, 85%, 90%, 95%, 98%, or 99% identical to the VH sequences disclosed herein.
[0361] One of ordinary skill in the art will understand that the percent sequence identity can be determined using any of a number of publicly available software applications, for example, without limitation, the BlastP software of the National Center for Biotechnology Information (NCBI) using default parameters.
[0362] In some embodiments of a method of treating an allergic or respiratory condition, an inflammatory condition of the skin or gastrointestinal organs and / or an autoimmune condition, scleroderma, or a tumor or cancer including Hodgkin's lymphoma, the amino acid sequence of the variant light chain variable region (VL) is selected from the sequences set forth in any of SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, and 53, without limitation. In some embodiments of a method of treating an allergic or respiratory condition, an inflammatory condition of the skin or gastrointestinal organs and / or an autoimmune condition, scleroderma, or a tumor or cancer including Hodgkin's lymphoma, the bispecific antibody includes a light chain variable region including the amino acid sequence set forth in SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, and 53, without limitation, and any variable heavy chain region. In some embodiments of the methods disclosed herein, the amino acid sequence of the variant VH domain is at least 80% identical (e.g., 80%, 85%, 90%, 95%, 98%, or 99% identical) to the sequence set forth in any of SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, and 53, and includes any variable heavy chain region.
[0363] In some embodiments of the methods disclosed herein, the VL domain of the bispecific antibody is selected from the sequences set forth in any of SEQ ID NOs: 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272, 274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 300, 302, 304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 328, 330, 332, 334, 336, 338, 340, 342, 344, 346 and 348. In another embodiment, the VL domain is at least 80%, 85%, 90%, 95%, 98%, or 99% identical to the VL sequences disclosed herein.
[0364] In some embodiments of a method for treating an allergic condition or respiratory condition, an inflammatory condition of the skin or gastrointestinal organs and / or an autoimmune condition, scleroderma, or a tumor or cancer including Hodgkin's lymphoma, the amino acid sequence of the variant VH domain is selected, without limitation, from the sequences set forth in SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, and 54, and the amino acid sequence of the variant light chain variable region (VH) is selected, without limitation, from the sequences set forth in any of SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, and 53. In some embodiments of a method for treating an allergic condition or respiratory condition, an inflammatory condition of the skin or gastrointestinal organs and / or an autoimmune condition, scle...
Claims
【Claim 1】 The invention described in the specification.