Compositions and methods for detecting human papillomavirus

Abstract

To provide compositions and methods for detecting and / or identifying the genotype of a human papillomavirus (HPV) in a biological sample taken from a subject in need thereof.SOLUTION: Provided are a combination of primers and probes for simultaneously detecting multiple HPV genotypes in a single-tube PCR reaction, and kits and methods for detecting and / or identifying genotypes of human papillomavirus (HPV) in a biological sample.SELECTED DRAWING: None

Description

Technical Field

[0001] Cross-reference This application claims the benefit of PCT Application No. PCT / CN2019 / 070277, filed on January 3, 2019, which is hereby incorporated by reference in its entirety.

[0002] The present disclosure relates to compositions and methods for detecting and / or genotyping human papillomavirus (HPV).

Background Art

[0003] Human papillomavirus (HPV) is a virus of the genus Papillomavirus in the Papovavirus family. It has host specificity and tissue specificity and usually infects human skin and mucosal cells. It is a common pathogen mainly transmitted through sexual intercourse.

[0004] The HPV genome is a double-stranded DNA that forms a closed loop. The genome can be classified into three regions: the early region (E region), the late region (L region), and the non-coding region (NCR). The E region can be further classified into seven open reading frames (E1 - E7) that mainly encode proteins involved in viral replication, transcription, regulation, and cell transformation. The L region can be classified into L1 and L2, which encode the major capsid protein and the minor capsid protein, respectively. More than 200 subtypes of HPV have been discovered. These subtypes are classified into high-risk types and low-risk types based on their toxicity and carcinogenic risk to genital tract-related tumors. Common low-risk subtypes such as HPV6, HPV11, HPV42, HPV43, and HPV44 often cause benign lesions such as external genital warts, while high-risk subtypes such as HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, and HPV68 can cause cancers such as cervical cancer and cervical intraepithelial neoplasia. Furthermore, HPV26, HPV53, and HPV66 are suspected to be high-risk subtypes. Studies have shown that HPV is detectable in 99% of patients with cervical cancer. In 1995, the International Agency for Research on Cancer (IARC) symposium concluded that HPV infection is the main cause of cervical cancer. Certain subtypes of HPV can also cause anal cancer, oropharyngeal cancer, vulvar cancer, vaginal cancer, and penile cancer. Most (70% - 90%) HPV infections are asymptomatic and are automatically cleared by the immune system within 1 - 2 years. Therefore, regular HPV testing can effectively prevent the occurrence of related cancers.

[0005] HPV detection techniques include conventional cytological methods, widely used HPV DNA detection methods, and the latest HPV mRNA detection methods. Conventional cytological detection methods, such as Pap smear and liquid-based cytology, have low sensitivity and insufficient specificity. The HPV mRNA detection method has better specificity for the detection of cervical lesions after CIN2 (cervical intraepithelial neoplasia stage 2), but this method uses mRNA, which has higher requirements for clinical sample collection and preservation, as well as nucleic acid extraction, as the detection target.

[0006] Currently, the most widely used HPV DNA detection techniques can be classified into the following categories: (1) After PCR amplification using MY9 / 11, PGMY09 / 11, GP5+ / 6+, or other universal primers, specific probe hybridization such as PCR-reverse dot blot method and gene chip method is used for detection; (2) Signal amplification methods such as HC2 HPV DNA test (Digene) and Cervista™ HPV HR (Hologic); (3) Real-time fluorescence quantitative PCR such as Cobas® 4800 HPV detection method (Roche).

[0007] Methods based on hybridization detection after PCR amplification using universal primer PCR have the disadvantages of complicated operations for different HPV subtypes, frequent cross-contamination, and inconsistent amplification efficiency. HC2 and Cervista™ techniques based on signal amplification have the disadvantage of high detection limit (LOD) leading to low sensitivity.

[0008] The Cobas® 4800 HPV test based on fluorescence real-time PCR was approved by the FDA in 2014 for cervical cancer screening, but this method requires dedicated equipment and is costly. In addition, Bernal et al. (Journal of Clinical Virology 61:548-552 (2014)) analyzed urine samples and cervical samples from the same patient population by the Cobas® 4800 HPV test and showed that the overall percent agreement between HPV detection in urine samples and HPV detection in cervical samples was only 88%, indicating significant false detections when using urine samples.

[0009] In addition, the clinical trial samples used in the above detection method are usually cervical exfoliated cell samples collected using a cervical swab or sampling brush. This sampling method is invasive and may cause pain and discomfort, and is not preferred for women in conservative countries / regions due to cultural and / or religious reasons. In particular, due to the traditional moral and ethical constraints in certain regions, the invasive sampling method used in the above detection method is not acceptable for women, especially unmarried women. As a result, the willingness of women to undergo the HPV test is significantly reduced, and the HPV test participation rate is limited. On the other hand, since men can also be carriers of HPV, the detection of HPV in the male population has a positive effect on the prevention of the occurrence of cervical cancer in the female population. However, currently in clinical practice, there are few HPV tests for men, and the common sampling method for men (i.e., urethral swabbing) is very painful. Therefore, there is still a great need for a new HPV test method that is less invasive, easy to perform, and inexpensive without compromising accuracy, sensitivity, and specificity. The present disclosure provides an HPV detection method using urine samples for the detection of HPV DNA so that sample collection can be achieved in a non-invasive, painless, rapid, and convenient manner. The present disclosure also provides a series of compositions and methods for urine DNA extraction and purification and for the detection of 14 high-risk HPV subtypes and at least 2 low-risk HPV subtypes. The invention described herein is not only suitable for increasing the participation rate of women in the female population in the HPV test, but also very suitable for the HPV test in the male population. Therefore, the present invention has great social significance for the prevention of HPV-related conditions such as cervical cancer.

Summary of the Invention

[0010] The present disclosure provides primers and probes related to HPV. In some embodiments, these primers and probes can be used to detect and / or distinguish genotypes of human papillomavirus (HPV). In some embodiments, (1) A forward primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity with the sequence of SEQ ID NO: 1, a reverse primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity with the sequence of SEQ ID NO: 2, and a probe comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity with the sequence of SEQ ID NO: 37. (2) A forward primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity with the sequence of SEQ ID NO: 3, a reverse primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity with the sequence of SEQ ID NO: 4, and a probe comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity with the sequence of SEQ ID NO: 38. (3) A forward primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity with the sequence of SEQ ID NO: 5, a reverse primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity with the sequence of SEQ ID NO: 6, and a probe comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity with the sequence of SEQ ID NO: 39. (4) A forward primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity with the sequence of SEQ ID NO: 7, a reverse primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity with the sequence of SEQ ID NO: 8, and a probe comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity with the sequence of SEQ ID NO: 39. (5) A forward primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 9, a reverse primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 10, and a probe comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 39, (6) A forward primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 11, a reverse primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 12, and a probe comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 40, (7) A forward primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 13, a reverse primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 14, and a probe comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 41, (8) A forward primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 15, a reverse primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 16, and a probe comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 42, (9)A forward primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 17, a reverse primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 18, and a probe comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 42, (10)A forward primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 19, a reverse primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 20, and a probe comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 41, (11)A forward primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 21, a reverse primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 22, and a probe comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 39, (12)A forward primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 23, a reverse primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 24, and a probe comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 40, (13) A forward primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 25, a reverse primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 26, and a probe comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 41, (14) A forward primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 27, a reverse primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 28, and a probe comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 40, (15) A forward primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 29, a reverse primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 30, and a probe comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 40, (16) A forward primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 33, a reverse primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 34, and a probe comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 44, A combination of primers and probes is provided, comprising one or more groups of primers and probes selected from the group consisting of a forward primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 35, a reverse primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 36, and a probe comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 45, and any combination thereof.

[0011] In some embodiments, the combination of primers and probes comprises the primers and probes of (1) and (2); the primers and probes of (3), (4), (5), and (11); the primers and probes of (6), (12), (14), and (15); the primers and probes of (7), (10), and (13); and / or the primers and probes of (8) and (9).

[0012] In some embodiments, the combination of primers and probes comprises at least one group of the primers and probes of (1) and (2), and at least one group of the primers and probes of (3), (4), (5), and (11).

[0013] In some embodiments, the combination of primers and probes comprises at least one group of the primers and probes of (1) and (2), and at least one group of the primers and probes of (6), (12), (14), and (15).

[0014] In some embodiments, the combination of primers and probes comprises at least one group of the primers and probes of (1) and (2), and at least one group of the primers and probes of (7), (10), and (13).

[0015] In some embodiments, the combination of primers and probes includes at least one group of primers and probes of (1) and (2), and at least one group of primers and probes of (8) and (9).

[0016] In some embodiments, the combination of primers and probes includes at least one group of primers and probes of (1) and (2), at least one group of primers and probes of (3), (4), (5), and (11), and at least one group of primers and probes of (6), (12), (14), and (15).

[0017] In some embodiments, the combination of primers and probes includes at least one group of primers and probes of (1) and (2), at least one group of primers and probes of (3), (4), (5), and (11), and at least one group of primers and probes of (7), (10), and (13).

[0018] In some embodiments, the combination of primers and probes includes at least one group of primers and probes of (1) and (2), at least one group of primers and probes of (3), (4), (5), and (11), and at least one group of primers and probes of (8) and (9).

[0019] In some embodiments, the combination of primers and probes includes at least one group of primers and probes of (1) and (2), at least one group of primers and probes of (6), (12), (14), and (15), and at least one group of primers and probes of (7), (10), and (13).

[0020] In some embodiments, the combination of primers and probes includes at least one group of primers and probes of (1) and (2), at least one group of primers and probes of (6), (12), (14), and (15), and at least one group of primers and probes of (8) and (9).

[0021] In some embodiments, the combination of primers and probes includes at least one group of primers and probes of (1) and (2), at least one group of primers and probes of (7), (10), and (13), and at least one group of primers and probes of (8) and (9).

[0022] In some embodiments, the combination of primers and probes includes at least one group of primers and probes of (1) and (2), at least one group of primers and probes of (3), (4), (5), and (11), at least one group of primers and probes of (6), (12), (14), and (15), and at least one group of primers and probes of (7), (10), and (13).

[0023] In some embodiments, the combination of primers and probes includes at least one group of primers and probes of (1) and (2), at least one group of primers and probes of (3), (4), (5), and (11), at least one group of primers and probes of (6), (12), (14), and (15), and at least one group of primers and probes of (8) and (9).

[0024] In some embodiments, the combination of primers and probes includes at least one group of primers and probes of (1) and (2), at least one group of primers and probes of (3), (4), (5), and (11), and at least one group of primers and probes of (7), (10), and (13), and at least one group of primers and probes of (8) and (9).

[0025] In some embodiments, the combination of primers and probes includes at least one group of primers and probes of (1) and (2), at least one group of primers and probes of (6), (12), (14), and (15), and at least one group of primers and probes of (7), (10), and (13), and at least one group of primers and probes of (8) and (9).

[0026] In some embodiments, the combination of primers and probes described herein further includes the group of primers and probes of (16) and / or (17).

[0027] In some embodiments, the combination of primers and probes consists of the group of primers and probes of (1) to (15) or consists of the group of primers and probes of (1) to (17).

[0028] In some embodiments, the combination of primers and probes further includes a group of primers and probes for a reference control gene. In some embodiments, the reference control gene is β-actin (ACTB), the primers for the ACTB gene are SEQ ID NOs: 31 and 32, and the probe for the ACTB gene is SEQ ID NO: 43.

[0029] In some embodiments, each probe as described herein has a fluorescent dye attached to its 5' end. In some embodiments, the fluorescent dye is selected from the group consisting of FAM (fluorescein), TET, JOE, VIC (2'-chloro-7'-phenyl-1,4-dichloro-6-carboxy-fluorescein), HEX (hexachloro-fluorescein), ROX, TAMRA, Cy3, cy3.5, Cy5, Cy5.5, OregonGreen™, CALRed™, Red640, Texas Red, LighterCycler® Cyan500, LighterCycler® Red610, a biotin-binding material, Alexa 647, Alexa 555, 5-(2-aminoethyl)amino-1-naphthalenesulfonic acid (EDANS), tetramethylrhodamine (TMR), tetramethylrhodamine isocyanate (TMRITC), fluorescein isocyanate (FITC), and χ-rhodamine.

[0030] In some embodiments, the fluorescent dyes on the probes of (3), (4), (5), and / or (11) are the same dye or different dyes having substantially the same emission wavelength. In some embodiments, the fluorescent dyes on the probes of (6), (12), (14), and / or (15) are the same dye or different dyes having substantially the same emission wavelength. In some embodiments, the fluorescent dyes on the probes of (7), (10), and / or (13) are the same dye or different dyes having substantially the same emission wavelength. In some embodiments, the fluorescent dyes on the probes of (8) and (9) are the same dye or different dyes having substantially the same emission wavelength. In some embodiments, the fluorescent dyes on the probes of (3), (4), (5), and / or (11) are different dyes having substantially the same or different emission wavelengths. In some embodiments, the fluorescent dyes on the probes of (6), (12), (14), and / or (15) are different dyes having substantially the same or different emission wavelengths. In some embodiments, the fluorescent dyes on the probes of (7), (10), and / or (13) are different dyes having substantially the same or different emission wavelengths. In some embodiments, the fluorescent dyes on the probes of (8) and (9) are different dyes having substantially the same or different emission wavelengths.

[0031] In some embodiments, each probe has a fluorescent dye attached to its 5' end, (i) The probe of (1) has a first dye, (ii) The probe of (2) has a second dye, (iii) The probes of (3), (4), (5), and (11) have a third dye, (iv) The probes of (6), (12), (14), and (15) have a fourth dye, (v) The probes of (7), (10), and (13) have a fifth dye, (vi) The probes of (8) and (9) have a sixth dye, (iii) to (vi) The dyes are the same dye, but different from the dyes of (i) and (ii).

[0032] In some embodiments, each probe has a fluorescent dye attached to its 5' end, (i) The probe of (1) has a first dye, (ii) The probe of (2) has a second dye, (iii) The probes of (3), (4), (5), and (11) have a third dye, (iv) The probes of (6), (12), (14), and (15) have a fourth dye, (v) The probes of (7), (10), and (13) have a fifth dye, (vi) The probes of (8) and (9) have a sixth dye, (vii) The probe of (16) has a seventh dye, (viii) The probe of (17) has an eighth dye, (iii)-(vi) The dyes are the same dye, but are different from the dyes of (i), (ii), (vii), and (viii).

[0033] In some embodiments, the combination of primers and probes further includes a group of primers and probes for a reference control gene, the probe for the reference control gene also has a fluorescent dye attached to its 5' end, and the fluorescent dye for the control gene is different from the other dyes of this combination.

[0034] In some embodiments, each probe described herein has a fluorescence quencher attached to its 3' end. In some embodiments, the fluorescence quencher is selected from the group consisting of DDQ-I, DDQ-II, Dabcyl, Eclipse, Iowa Black FQ, Iowa Black RQ, BHQ-1, BHQ-2, BHQ-3, QSY-7, QSY-9, and QSY-21.

[0035] In some embodiments, the probe of (1) includes a Cy5 fluorescent dye bound to its 5'-end and a BHQ-2 fluorescence quencher bound to its 3'-end; the probe of (2) includes a FAM fluorescent dye bound to its 5'-end and a BHQ-1 fluorescence quencher bound to its 3'-end; the probes of (3) to (15) include a VIC fluorescent dye bound to their 5'-ends and an MGBNFQ fluorescence quencher bound to their 3'-ends; the probes of (16) and (17) include a FAM fluorescent dye bound to their 5'-ends and a BHQ-1 fluorescence quencher bound to their 3'-ends.

[0036] In some embodiments, the probe of (1) includes a Cy5 fluorescent dye bound to its 5'-end and a BHQ-2 fluorescence quencher bound to its 3'-end; the probe of (2) includes a FAM fluorescent dye bound to its 5'-end and a BHQ-1 fluorescence quencher bound to its 3'-end; the probes of (3) to (15) include a VIC fluorescent dye bound to their 5'-ends and an MGBNFQ fluorescence quencher bound to their 3'-ends; the probes of (16) and (17) include a FAM fluorescent dye bound to their 5'-ends and a BHQ-1 fluorescence quencher bound to their 3'-ends; the probe for the reference control gene includes a ROX fluorescent dye bound to its 5'-end and a BHQ-2 fluorescence quencher bound to its 3'-end.

[0037] The present disclosure also provides a composition comprising a combination of primers and probes as described herein.

[0038] The present disclosure also provides a DNA chip for detecting and / or genotyping HPV. In some embodiments, the DNA chip includes one or more polynucleotide sequences selected from SEQ ID NOs: 1 to 45.

[0039] The present disclosure also provides a kit for detecting and / or discriminating genotypes of human papillomavirus (HPV) in a biological sample, comprising a combination of primers and probes as described herein, a PCR buffer, dNTPs, MgCl2, a PCR additive, Taq enzyme, and negative and positive controls as quality controls.

[0040] In some embodiments, the kit used for detecting and / or discriminating genotypes of human papillomavirus (HPV) in a biological sample comprises an HPV qPCR mixture, Taq enzyme, a negative control, and a positive control.

[0041] In some embodiments, the HPV qPCR mixture comprises a primer and probe combination as described herein, a PCR buffer, dNTPs, MgCl2, a PCR additive, and deionized water. In some embodiments, the primer and probe combination includes all of the primer-probe combinations of (1)-(15) having a primer concentration of 0.1 μM to 1.2 μM and a probe concentration of 1 / 5 to 1 times the corresponding primer concentration, as well as reference control gene primers and probes (SEQ ID NOs: 31, 32, and 43). In some embodiments, the PCR buffer contains about 10-30 mM Tris-HCL buffer and about 30-70 mM KCL, preferably having a Tris-HCL buffer concentration of about 20.5 mM and a preferred KCL concentration of about 51 mM. In some embodiments, the dNTP concentration is 0.15 mM to 0.3 mM, preferably about 0.25 mM. In some embodiments, the concentration of MgCl2 is 1.5 mM to 4 mM, preferably about 3.0 mM. In some embodiments, the PCR additive contains about 0.1-1 mg / ml BSA, 0.2%-2% (V / V) formamide, 0.2 mM to 2 mM spermidine, 10 mM to 30 mM tetramethylammonium chloride, 0.01 mM to 0.1 mM dithiothreitol (DTT), 0.2%-2% 2-pyrrolidone, and the preferred PCR additive contains about 0.64 mg / ml BSA, about 1% (V / V) formamide, about 1 mM spermidine, about 21 mM tetramethylammonium chloride, about 0.064 mM DTT, and about 1% (V / V) 2-pyrrolidone.

[0042] In some embodiments, the Taq enzyme contains Platinum™ Taq DNA Polymerase (Invitrogen™, 10966018) having a concentration of 1-6 U / μl, and preferably Platinum™ Taq DNA Polymerase (Invitrogen™, 10966018) having a concentration of 4 U / μl.

[0043] In some embodiments, the negative control is obtained from urine that has been diluted 1 to 1000 times, preferably about 100 times, or its DNA from adults who are negative for high-risk HPV DNA.

[0044] In some embodiments, the positive control is a plasmid containing a high-risk HPV L1 gene with a final concentration of 10 to 10 5 copies / μl prepared using the negative control as a diluent. The high-risk HPV L1 genotype can be one or more of the 14 high-risk HPV genotypes described in the present invention. Preferably, the positive control contains the L1 plasmids of HPV16, HPV18, and HPV45, and their final concentrations are 10 3 copies / μl.

[0045] The present invention also provides a kit that can guide and evaluate the effectiveness of an HPV vaccine by detecting and / or differentiating the genotypes of human papillomavirus (HPV) in a biological sample, including a combination of primers and probes, a PCR buffer, dNTPs, MgCl2, a PCR additive, Taq enzyme, and negative and positive controls as quality controls.

[0046] In some embodiments, a kit used to detect and / or differentiate the genotypes of human papillomavirus (HPV) in a biological sample for HPV vaccine guidelines and effectiveness evaluation includes an HPV qPCR mixture I, an HPV qPCR mixture II, Taq enzyme, and negative and positive controls as quality controls.

[0047] In some embodiments, the HPV qPCR mixture I contains the primer and probe combinations referred to in the present invention, a PCR buffer, dNTPs, MgCl2, a PCR additive, and deionized water. In some embodiments, the primer and probe combinations have primer concentrations in the range of 0.2 μM to 1.2 μM and probe concentrations in the range of 1 / 5 to 1 times the corresponding primer concentration, all of the primer-probe combinations of (1), (2), (5), (6), (8), (10), (12), (13), (14), and (15), as well as reference control gene primers and probes (SEQ ID NOs: 31, 32, and 43). In some embodiments, the PCR buffer contains about 10 to 30 mM Tris-HCl buffer and about 30 to 70 mM KCl, preferably having a Tris-HCl buffer concentration of about 25.6 mM and a preferred KCl concentration of about 64.1 mM. In some embodiments, the dNTP concentration is 0.15 mM to 0.3 mM, preferably about 0.25 mM. In some embodiments, the concentration of MgCl2 is 1.5 mM to 4 mM, preferably about 3.0 mM. In some embodiments, the PCR additive contains about 0.1 to 1 mg / ml BSA, 0.2% to 2% (V / V) formamide, 0.2 to 2 mM spermidine, 10 mM to 30 mM tetramethylammonium chloride, 0.01 mM to 0.1 mM DTT, and 0.2% to 2% 2-pyrrolidone. Preferably, the PCR additive contains about 0.64 mg / ml BSA, about 1% (V / V) formamide, about 1 mM spermidine, about 21 mM tetramethylammonium chloride, about 0.064 mM DTT, and about 1% (V / V) 2-pyrrolidone.

[0048] In some embodiments, an HPV qPCR mixture II comprising a primer and probe combination, a PCR buffer, dNTPs, MgCl2, a PCR additive, and deionized water as referred to in the present invention. In some embodiments, all of the primer-probe combinations of (3), (4), (7), (9), (11), (16), (17) having a primer concentration of 0.2 μM to 1.2 μM and a probe concentration in the range of 1 / 5 to 1 times the corresponding primer concentration, as well as a primer and probe combination comprising a reference control gene primer and probe (SEQ ID NOs: 31, 32, and 43). In some embodiments, the PCR buffer contains about 10 to 30 mM Tris-HCl buffer and about 30 to 70 mM KCl, preferably having a Tris-HCl buffer concentration of about 25.6 mM and preferably a KCl concentration of about 64.1 mM. In some embodiments, the dNTP concentration is 0.15 mM to 3 mM, preferably about 0.25 mM dNTP concentration. In some embodiments, the concentration of MgCl2 is 1.5 mM to 4 mM, preferably about 3.0 mM. In some embodiments, the PCR additive contains about 0.1 mg / ml BSA, 0.2% to 2% (V / V) formamide, 0.2 to 2 mM spermidine, 10 mM to 30 mM tetramethylammonium chloride, 0.01 mM to 0.1 mM DTT, and 0.2% to 2% 2-pyrrolidone. Preferably, the PCR additive contains about 0.64 mg / ml BSA, about 1% (V / V) formamide, about 1 mM spermidine, about 21 mM tetramethylammonium chloride, about 0.064 mM DTT, and about 1% (V / V) 2-pyrrolidone.

[0049] In some embodiments, the biological sample is collected from a human subject. In some embodiments, the biological sample includes urine from a human subject.

[0050] In some embodiments, the kit further includes a reagent for isolating DNA from the biological sample.

[0051] In some embodiments, the reagents for isolating DNA from a biological sample include a lysis solution, magnetic nanoparticles, protease, a first wash buffer, a second wash buffer, an elution buffer, or any combination thereof.

[0052] In some embodiments, the lysis solution includes guanidinium isothiocyanate, Triton X 100, Tris-HCl, EDTA, and isopropanol. In some embodiments, the guanidinium isothiocyanate has a concentration of about 2-6 M. In some embodiments, Triton X-100 has a concentration of about 1-5%. In some embodiments, Tris-HCl has a concentration of about 20-50 mM, and the lysis solution has a pH of about 6.5. In some embodiments, EDTA has a concentration of about 10-50 mM. In some embodiments, isopropanol is added after all the other components are mixed together. In some embodiments, isopropanol has a dosage of about 50%-200% (v / v).

[0053] In some embodiments, the lysis solution includes guanidinium isothiocyanate, Triton X 100, Tris-HCl, EDTA, and isopropanol. In some embodiments, the guanidinium isothiocyanate has a concentration of about 1-2 M. In some embodiments, Triton X-100 has a concentration of about 1-2%. In some embodiments, Tris-HCl has a concentration of about 5-10 mM. In some embodiments, the lysis solution has a pH of about 6-7. In some embodiments, EDTA has a concentration of about 3-5 mM. In some embodiments, isopropanol has a volume of about 50%-80% (v / v) of the lysis solution.

[0054] In some embodiments, the magnetic nanoparticles have an inner core layer and an outer shell layer, the inner core layer is composed of core-shell type magnetic nanoparticles, and the outer shell layer is composed of SiO2. In some embodiments, the magnetic nanoparticles have a diameter of about 100 to 1000 nm and a concentration of about 50 mg / ml.

[0055] In some embodiments, the first washing buffer contains guanidinium isothiocyanate, Tris-HCl, NaCl, and ethanol. In some embodiments, guanidinium isothiocyanate has a concentration of about 50 mM. In some embodiments, Tris-HCl has a concentration of about 20 to 50 mM. In some embodiments, the first washing buffer has a pH of about 5.0. In some embodiments, NaCl has a concentration of about 50 to 200 mM. In some embodiments, ethanol has a concentration of about 40% to 60% (v / v).

[0056] In some embodiments, the second washing buffer contains Tris-HCl and ethanol. In some embodiments, Tris-HCl in the second washing buffer has a concentration of about 10 to 50 mM, and the second washing buffer has a pH of about 6.0. In some embodiments, ethanol has a concentration of about 70% to 80% (v / v).

[0057] In some embodiments, the elution buffer is a Tris-EDTA buffer having a pH of about 8.0.

[0058] In some embodiments, the protease is protease K. In some embodiments, protease K has a concentration of about 10 to 20 mg / ml.

[0059] The present disclosure further provides a method for detecting and / or discriminating genotypes of human papillomavirus (HPV) in a biological sample obtained from a subject in need thereof. In some embodiments, the method comprises: (a) obtaining DNA from the biological sample; (b) amplifying the DNA by fluorescence PCR using a combination of primers and probes as described herein; and (c) determining the presence or absence of DNA of one or more HPV subtypes in the biological sample based on the results of the fluorescence PCR.

[0060] The present disclosure further provides a method for detecting and / or discriminating genotypes of human papillomavirus (HPV) in a biological sample obtained from a subject in need thereof. In some embodiments, the method comprises: (a) obtaining DNA from the biological sample; (b) amplifying the DNA by fluorescence PCR using a kit as described herein; and (c) determining the presence or absence of DNA of one or more HPV subtypes in the biological sample based on the results of the fluorescence PCR.

[0061] The present disclosure further provides a method for detecting and / or discriminating genotypes of human papillomavirus (HPV) in a biological sample obtained from a subject in need thereof. In some embodiments, the method comprises: (a) extracting DNA from the biological sample and amplifying the DNA by fluorescence PCR using a kit as described herein; and (b) determining the presence or absence of DNA of one or more HPV subtypes in the biological sample based on the results of the fluorescence PCR.

[0062] In some embodiments, the method includes detecting and / or discriminating the presence or absence of DNA of at least one HPV subtype in a biological sample. In some embodiments, the method includes detecting and / or discriminating the presence or absence of DNA of 14 high-risk HPV subtypes in a biological sample through a single test tube, the high-risk HPV subtypes being HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66, and HPV68.

[0063] In some embodiments, the method includes detecting and / or discriminating the presence or absence of DNA of 14 high-risk HPV subtypes in a biological sample through a single test tube, the high-risk HPV subtypes being HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66, and HPV68.

[0064] In some embodiments, the method includes detecting and / or discriminating the presence or absence of DNA of 14 high-risk HPV subtypes and at least one low-risk HPV subtype in a biological sample through two test tubes, the high-risk HPV subtypes being HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66, and HPV68, and the low-risk HPV subtypes being HPV6 and HPV11. The presence or absence of 7 high-risk HPV subtypes HPV16, HPV18, HPV35, HPV39, HPV51, HPV56, HPV59, HPV66, and HPV68 in the biological sample is detected and / or discriminated in one test tube, while the presence or absence of 5 high-risk HPV subtypes HPV31, HPV33, HPV45, HPV52, and HPV68, and the presence or absence of the two low-risk HPV subtypes HPV6 and / or HPV11 in the biological sample are detected and / or discriminated in another test tube.

[0065] In some embodiments, the biological sample is a cervical smear, a fresh tissue sample, a fixed tissue sample, a cross-sectional specimen of a tissue sample, a urine sample, a sample containing exfoliated cells, a peripheral blood sample, a penile swab, or other body fluid. In some embodiments, the sample is a urine sample.

[0066] The present disclosure further provides for the use of a combination of primers and probes, or a kit, as described herein for detecting and / or discriminating genotypes of human papillomavirus (HPV).

[0067] The present disclosure further provides a method for treating a condition associated with human papillomavirus (HPV) in a subject in need thereof. In some embodiments, the method includes (1) detecting and / or discriminating a genotype of human papillomavirus (HPV) in a biological sample obtained from a subject in need thereof. In some embodiments, step (1) includes (a) amplifying DNA extracted from the biological sample by fluorescence PCR using a combination of primers and probes as described herein, and (b) determining the presence or absence of DNA of one or more HPV subtypes in the biological sample based on the results of the fluorescence PCR. In some embodiments, the method further includes (2) treating the subject using a pharmaceutical composition and / or a medical procedure according to the results of step (1).

[0068] In some embodiments, the condition is a pre-cancerous lesion caused by HPV. In some embodiments, the pharmaceutical composition includes an antiviral agent.

[0069] The present disclosure further provides a method for vaccinating a human subject in need thereof. In some embodiments, the method comprises (1) detecting and / or discriminating a genotype of human papillomavirus (HPV) in a biological sample obtained from a human subject in need thereof, before and / or after the human subject is vaccinated. In some embodiments, step (1) comprises (a) amplifying DNA extracted from the biological sample by fluorescence PCR using a combination of primers and probes as described herein, and (b) determining the presence or absence of DNA of one or more HPV subtypes in the biological sample based on the results of the fluorescence PCR. In some embodiments, the method further comprises (2) vaccinating the subject with a selected HPV-targeting composition based on the results of step (1).

[0070] The present disclosure further provides a method for evaluating the effectiveness of vaccination in a human subject in need thereof. In some embodiments, the method comprises (1) detecting and / or discriminating a genotype of human papillomavirus (HPV) in a biological sample obtained from a human subject in need thereof, after or before and after the human subject is vaccinated. In some embodiments, step (1) comprises (a) amplifying DNA extracted from the biological sample by fluorescence PCR using a combination of primers and probes as described herein, after or before and after the human subject is vaccinated, and (b) determining the presence or absence of DNA of one or more HPV subtypes in the biological sample based on the results of the fluorescence PCR, after or before and after the human subject is vaccinated. In some embodiments, the method further comprises (2) vaccinating the subject with a selected HPV-targeting composition, and (3) determining the effectiveness of vaccination based on the results of step (1).

[0071] The present disclosure further provides primers or primer pairs related to HPV. In some embodiments, the primer comprises an oligonucleotide sequence having at least 85%, 90%, 95%, or 100% identity to any one of SEQ ID NOs: 1-36. In some embodiments, the primer has less than 100, 90, 80, 70, 60, 50, 40, 30, or 20 nucleotides. In some embodiments, the primer pair comprises a forward primer and a reverse primer. In some embodiments, each primer of the primer pair has at least 85%, 90%, 95%, or 100% identity to any one of SEQ ID NOs: 1-36. In some embodiments, each primer of the primer pair has less than 100, 90, 80, 70, 60, 50, 40, 30, or 20 nucleotides. In some embodiments, the forward and reverse primers of the primer pair are selected from the group consisting of SEQ ID NOs: 1-2, 3-4, 5-6, 7-8, 9-10, 11-12, 13-14, 15-16, 17-18, 19-20, 21-22, 23-24, 25-26, 27-28, 29-30, 31-32, 33-34, 35-36, and any combination thereof.

[0072] The present disclosure further provides a probe related to HPV. In some embodiments, the probe comprises a fluorescent dye and an oligonucleotide. In some embodiments, the oligonucleotide comprises a sequence having at least 85%, 90%, 95%, or 100% identity to any one of SEQ ID NOs: 37-45. In some embodiments, the oligonucleotide has less than 100, 90, 80, 70, 60, 50, 40, 30, or 20 nucleotides.

[0073] In some embodiments, the fluorescent dye binds to the 5' terminus of the probe. In some embodiments, the fluorescent dye is selected from the group consisting of FAM (fluorescein), TET, JOE, VIC, HEX, ROX, TAMRA, Cy3, cy3.5, Cy5, Cy5.5, OregonGreen™, CALRed™, Red640, Texas Red, LighterCycler® Cyan500, LighterCycler® Red610, a biotin binding material, Alexa 647, Alexa 555, 5-(2-aminoethyl)amino-1-naphthalenesulfonic acid (EDANS), tetramethylrhodamine (TMR), tetramethylrhodamine isocyanate (TMRITC), fluorescein isocyanate (FITC), and χ-rhodamine.

[0074] In some embodiments, the probe further comprises a fluorescence quencher. In some embodiments, the fluorescence quencher binds to the 3' terminus of the probe. In some embodiments, the fluorescence quencher is selected from the group consisting of DDQ-I, DDQ-II, Dabcyl, Eclipse, Iowa Black FQ, Iowa Black RQ, BHQ-1, BHQ-2, BHQ-3, QSY-7, QSY-9, and QSY-21.

[0075] The present disclosure further provides a kit for detecting and / or discriminating genotypes of human papillomavirus (HPV) in a biological sample. In some embodiments, the kit comprises one or more primers as described herein and one or more probes as described herein. In some embodiments, the kit comprises at least 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, or 36 primers as described herein. In some embodiments, the kit comprises at least 2, 3, 4, 5, 6, 7, 8, or 9 probes as described herein. In some embodiments, the kit further comprises a lysis solution, magnetic nanoparticles, protease, a first wash buffer, a second wash buffer, an elution buffer, or any combination thereof.

[0076] The present disclosure further provides a method for detecting and / or discriminating genotypes of human papillomavirus (HPV) in a urine sample obtained from a subject in need thereof. In some embodiments, the method comprises: (a) obtaining DNA from the urine sample; (b) amplifying the DNA by fluorescence PCR using one or more primers as described herein and one or more probes as described herein; and (c) determining the presence or absence of DNA of one or more HPV subtypes in the biological sample based on the results of the fluorescence PCR. BRIEF DESCRIPTION OF THE DRAWINGS

[0077]

Figure 1

Figure 2

Figure 3A

Figure 3B

Figure 3C

Figure 3D

Figure 3E

Figure 3F

Figure 3G

Figure 3H

Figure 3I

Figure 3J

Figure 3K

Figure 3L

Figure 3M

Figure 3N

Figure 3O

Figure 3P

Figure 3Q

Figure 4

Figure 5

Mode for Carrying Out the Invention

[0078] Primers, Probes, and Multiplex PCR for HPV Subtype Detection and / or Genotyping The present disclosure provides compositions and methods for HPV detection and genotyping.

[0079] Among the HPV detection methods using real-time PCR, the E6 / E7, E1, and L1 genes of the HPV virus are commonly used as detection targets. Since the HPV genotype is distinguished by its L1 gene, the advantage of using the L1 gene as a target for designing primers and probes is that the primers and probes can have better genotype specificity. However, when the aim is to detect 14 high-risk HPVs in the same qPCR reaction, these sequences are very similar, and it is necessary to consider the cross-reactivity between the primers and probes with unintended types. Therefore, it is difficult to design primers and probes for the L1 gene that are both comprehensive and specific. By comparing and analyzing the L1 genes of 12 high-risk HPVs other than HPV16 and HPV18, it has been found that four conserved regions can be used to design probes (e.g., TaqMan probes). Compared with the daily practice that requires 12 specific probes, only four probes are necessary to cover 12 high-risk HPVs other than HPV16 and HPV18. Together with optimized combination-type specific primers, qPCR detection of 14 high-risk HPV types can be achieved in the same reaction, or detection of 14 high-risk types of HPV and two additional low-risk types can be realized in two-tube reactions.

[0080] In some embodiments, the present disclosure provides oligonucleotides that can be used as primers for amplifying DNA of HPV, and oligonucleotides that can be used as probes for detecting and / or discriminating DNA of specific HPV genotypes.

[0081] In some embodiments, the HPV subtypes include at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, or at least 14 high-risk subtypes such as HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66, and HPV68, and one or two low-risk HPV subtypes such as HPV6 and HPV11.

[0082] In some embodiments, the primers and probes are specific for the L1 region of the HPV subtype. In some embodiments, the primers and probes used in the HPV test are provided in Tables 1 and 2.

Table 1-1

Table 1-2

Table 2

[0083] The oligonucleotides of the present disclosure, particularly those having the nucleotide sequences listed in SEQ ID NOs: 1 to 30 and 33 to 36, advantageously enable highly specific amplification of the L1 gene of the corresponding HPV subtype in a biological sample potentially containing different human HPV subtypes.

[0084] The oligonucleotides of the present disclosure, particularly those having the nucleotide sequences listed in SEQ ID NOs: 37 to 42 and 44 to 45, specifically recognize the L1 gene of the corresponding HPV subtype in a biological sample potentially containing different human HPV subtypes.

[0085] The oligonucleotides of the present disclosure, particularly the oligonucleotides having the nucleotide sequences listed in SEQ ID NOs: 31-32 and 43, can specifically amplify and recognize the β-actin gene in a biological sample.

[0086] In some embodiments, oligonucleotides highly similar to the sequences of SEQ ID NOs: 1-45 are also provided. In some embodiments, such oligonucleotides have at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity with the sequences of SEQ ID NOs: 1-45. In some embodiments, oligonucleotides that hybridize to the sequences of SEQ ID NOs: 1-45 under stringent hybridization conditions are also provided. In some embodiments, oligonucleotides that are functional variants of the sequences of SEQ ID NOs: 1-45 under stringent hybridization conditions are also provided.

[0087] In some embodiments, oligonucleotides that are partially or fully complementary to the sequences of SEQ ID NOs: 1-45 are provided.

[0088] In some embodiments, oligonucleotides having one or more modifications as compared to the sequences of SEQ ID NOs: 1-45 are provided. In some embodiments, the oligonucleotide is obtained by a) deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides of one of the nucleotide sequences listed in SEQ ID NOs: 1-45, b) addition of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides of one of the nucleotide sequences listed in SEQ ID NOs: 1-45, and / or c) substitution of 1, 2, 3, 4, 5 nucleotides of one of the nucleotide sequences listed in SEQ ID NOs: 1-45. The modification can occur at the 5' end and / or 3' end of one of the nucleotide sequences listed in SEQ ID NOs: 1-45.

[0089] Examples of modified base moieties that can be used to modify nucleotides at any position in their structure include, among others, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, acetylcytosine, 5-(carboxyhydroxylmethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N-6-sopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-sopentenyladenine, uracil-5-oxyacetic acid, pseudouracil, queuosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, methyl ester of uracil-5-oxyacetic acid, uracil-S-oxyacetic acid, 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl)uracil, and 2,6-diaminopurine, but are not limited thereto.

[0090] Examples of modified sugar moieties that can be used to modify nucleotides at any position in their structure include arabinose, 2-fluoroarabinose, xylose, and hexose, or modified components of the phosphate backbone, such as phosphorothioate, phosphorodithioate, phosphoramidothioate, phosphoralamidate, phosphorodiamidate, methylphosphonate, alkylphosphotriester, or their formacetal or analogs, but are not limited thereto.

[0091] In some embodiments, the oligonucleotides in the sequences of SEQ ID NOs: 1-45 are replaced by non-natural nucleotides such as artificial nucleic acids. Artificial nucleic acids include, but are not limited to, peptide nucleic acid (PNA), morpholino, locked nucleic acid (LNA), glycol nucleic acid (GNA), and threose nucleic acid (TNA). Each of these is distinguished from naturally occurring DNA or RNA by a change in the backbone of the molecule.

[0092] The present disclosure provides primer pairs for amplifying nucleic acid regions of HPV subtypes. Each pair of primers includes a forward primer and a reverse primer. In some embodiments, these primer pairs A forward primer comprising, consisting of, or consisting essentially of the polynucleotide sequence of SEQ ID NO: 1 for amplifying a sequence in HPV16, and a reverse primer comprising the polynucleotide sequence of SEQ ID NO: 2 A forward primer comprising, consisting of, or consisting essentially of the polynucleotide sequence of SEQ ID NO: 3 for amplifying a sequence in HPV18, and a reverse primer comprising the polynucleotide sequence of SEQ ID NO: 4 A forward primer comprising, consisting of, or consisting essentially of the polynucleotide sequence of SEQ ID NO: 5 for amplifying a sequence in HPV31, and a reverse primer comprising the polynucleotide sequence of SEQ ID NO: 6 A forward primer comprising, consisting of, or consisting essentially of the polynucleotide sequence of SEQ ID NO: 7 for amplifying a sequence in HPV33, and a reverse primer comprising the polynucleotide sequence of SEQ ID NO: 8 A forward primer comprising, consisting of, or consisting essentially of the polynucleotide sequence of SEQ ID NO: 9 for amplifying a sequence in HPV35, and a reverse primer comprising the polynucleotide sequence of SEQ ID NO: 10 A forward primer comprising, consisting of, or consisting essentially of the polynucleotide sequence of SEQ ID NO: 11, a reverse primer comprising the polynucleotide sequence of SEQ ID NO: 12, for amplifying the sequence in HPV39 A forward primer comprising, consisting of, or consisting essentially of the polynucleotide sequence of SEQ ID NO: 13, a reverse primer comprising the polynucleotide sequence of SEQ ID NO: 14, for amplifying the sequence in HPV45 A forward primer comprising, consisting of, or consisting essentially of the polynucleotide sequence of SEQ ID NO: 15, a reverse primer comprising the polynucleotide sequence of SEQ ID NO: 16, for amplifying the sequence in HPV51 A forward primer comprising, consisting of, or consisting essentially of the polynucleotide sequence of SEQ ID NO: 17, a reverse primer comprising the polynucleotide sequence of SEQ ID NO: 18, for amplifying the sequence in HPV52 A forward primer comprising, consisting of, or consisting essentially of the polynucleotide sequence of SEQ ID NO: 19, a reverse primer comprising the polynucleotide sequence of SEQ ID NO: 20, for amplifying the sequence in HPV56 A forward primer comprising, consisting of, or consisting essentially of the polynucleotide sequence of SEQ ID NO: 21, a reverse primer comprising the polynucleotide sequence of SEQ ID NO: 22, for amplifying the sequence in HPV58 A forward primer comprising, consisting of, or consisting essentially of the polynucleotide sequence of SEQ ID NO: 23, a reverse primer comprising the polynucleotide sequence of SEQ ID NO: 24, for amplifying the sequence in HPV59 A forward primer comprising, consisting of, or consisting essentially of the polynucleotide sequence of SEQ ID NO: 25, a reverse primer comprising the polynucleotide sequence of SEQ ID NO: 26, for amplifying the sequence in HPV66 A forward primer comprising, consisting of, or consisting essentially of the polynucleotide sequence of SEQ ID NO: 27, a reverse primer comprising the polynucleotide sequence of SEQ ID NO: 28, for amplifying the sequence in HPV68a, A forward primer comprising, consisting of, or consisting essentially of the polynucleotide sequence of SEQ ID NO: 29, a reverse primer comprising the polynucleotide sequence of SEQ ID NO: 30, for amplifying the sequence in HPV68b, A forward primer comprising, consisting of, or consisting essentially of the polynucleotide sequence of SEQ ID NO: 33, a reverse primer comprising the polynucleotide sequence of SEQ ID NO: 34, for amplifying the sequence in HPV6, and A forward primer comprising, consisting of, or consisting essentially of the polynucleotide sequence of SEQ ID NO: 35, a reverse primer comprising the polynucleotide sequence of SEQ ID NO: 36, for amplifying the sequence in HPV11.

[0093] In some embodiments, the disclosure provides a mixture comprising at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 pairs of primers as described herein. In some embodiments, the mixture comprises the primer pairs of (1) and (2). In some embodiments, the mixture comprises at least one primer pair selected from (1) and (2), and at least one primer pair selected from (3)-(17). In some embodiments, the mixture comprises at least one primer pair selected from (1) and (2), at least one primer pair selected from (3), (4), (5), and (11), at least one primer pair selected from (6), (12), (14), and (15), at least one primer pair selected from (7), (10), and (13), at least one primer pair selected from (8) and (9), the primer pair in (16), and / or the primer pair in (17), or any combination thereof.

[0094] In some embodiments, the mixture comprises primer pairs of (1) and (2), and primer pairs of (3) to (15). In some embodiments, the mixture comprises primer pairs of (1) and (2), primer pairs of (3) to (15), and primer pairs of (16) and / or (17).

[0095] In some embodiments, the mixture consists of, or consists essentially of, primer pairs of (1) and (2), and at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 primer pairs of (3) to (15). In some embodiments, the mixture consists of, or consists essentially of, primer pairs of (1) and (2), at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 primer pairs of (3) to (15), and primer pairs of (16) and / or (17).

[0096] In some embodiments, the mixture further comprises one or more probes corresponding to one or more primer pairs in the mixture (e.g., probes that match the sequences amplified by the primer pairs).

[0097] The present disclosure provides probes that can specifically recognize sequences in HPV. In some embodiments, the probes are (1) probes comprising, consisting of, or consisting essentially of the sequence of SEQ ID NO: 37 for recognizing sequences in HPV16, (2) probes comprising, consisting of, or consisting essentially of the sequence of SEQ ID NO: 38 for recognizing sequences in HPV18, (3) probes comprising, consisting of, or consisting essentially of the sequence of SEQ ID NO: 39 for recognizing sequences in HPV31, HPV33, HPV35, and / or HPV38, (4) A probe comprising, consisting of, or consisting essentially of the sequence of SEQ ID NO: 40 for recognizing sequences in HPV39, HPV59, and / or HPV68. (5) A probe comprising, consisting of, or consisting essentially of the sequence of SEQ ID NO: 41 for recognizing sequences in HPV45, HPV56, and / or HPV66. (6) A probe comprising, consisting of, or consisting essentially of the sequence of SEQ ID NO: 42 for recognizing sequences in HPV51 and / or HPV52. (7) A probe comprising, consisting of, or consisting essentially of the sequence of SEQ ID NO: 44 for recognizing sequences in HPV6. (8) A probe comprising, consisting of, or consisting essentially of the sequence of SEQ ID NO: 45 for recognizing sequences in HPV11.

[0098] In some embodiments, the probes of the present disclosure comprise a label at the 5' end and on the probe.

[0099] In some embodiments, the 5’ label of the probe comprises a fluorescent dye, such as a fluorophore. As used herein, a fluorophore is a fluorescent chemical compound that can re-emit light upon photoexcitation. Fluorophores typically contain several combined aromatic groups, or planar or cyclic molecules with several π bonds. Non-protein organic fluorophores include xanthene derivatives (e.g., fluorescein, rhodamine, Oregon Green, eosin, and Texas Red), cyanine derivatives (e.g., cyanine, indocarbocyanine, oxacarbocyanine, thiacarbocyanine, and merocyanine), squaraine derivatives and ring-substituted squaraines (e.g., Seta, SeTau, and squaric dyes), naphthalene derivatives (e.g., dansyl and prodan derivatives), coumarin derivatives, oxadiazole derivatives (e.g., pyridyloxazole, nitrobenzoxadiazole, and benzoxadiazole), anthracene derivatives (e.g., anthraquinones including DRAQ5, DRAQ7, and CyTRAK Orange), pyrene derivatives (such as cascade blue), oxazine derivatives (e.g., Nile Red, Nile Blue, cresyl violet, oxazine 170, etc.), acridine derivatives (e.g., proflavine, acridine orange, acridine yellow, etc.), arylmethine derivatives (e.g., auramine, crystal violet, malachite green), tetrapyrrole derivatives (e.g., porphyrin, phthalocyanine, bilirubin), but are not limited thereto. Specific examples include, but are not limited to, VIC, PET, Texas Red, Cy3, Cy5, FAM (6-carboxyfluorescein), HEX (6-carboxy-2’,4,4’,5’,7,7’-hexachlorofluorescein), ROX (5(6)-carboxy-X-rhodamine), JOE (6-carboxy-4’,5’-dichloro-21,71-dimethoxyfluorescein), TET (5’-tetrachloro-fluorescein phosphoramidite), NED (fluorescein benzoxanthene), TAMRA (6-carboxy-N,N,N,N-tetramethylrhodamine), FITC (fluorescein isothiocyanate). Examples of specific fluorophores that can be used in the probes disclosed herein areKnown to those skilled in the art, and in particular provided in U.S. Patent No. 5,866,366 to Nazarenko et al., for example, 4-acetamido-4'-isothiocyanatostilbene-2,2'-disulfonic acid; acridine and derivatives, such as acridine and acridine isothiocyanate, 5-(2'-aminoethyl)aminonaphthalene-1-sulfonic acid (EDANS), 4-amino-N-[3-(vinylsulfonyl)phenyl]naphthalimide-3,5-disulfonate (Lucifer Yellow VS), N-(4-anilino-1-naphthyl)maleimide, anthranilamide; Brilliant Yellow; coumarin and derivatives, such as coumarin, 7-amino-4-methylcoumarin (AMC, Coumarin 120), 7-amino-4-trifluoromethylcoumarin (Coumaran 151); cyanine; 4',6-diamidin-2-phenylindole (DAPI); 5',5''-dibromopyrogallol-sulfonphthalein (Bromopyrogallol Red); 7-diethylamino-3-(4'-isothiocyanatophenyl)-4-methylcoumarin; diethylenetriaminepentaacetate; 4,4'-diisothiocyanatodihydro-stilbene-2,2'-disulfonic acid; 4,4'-diisothiocyanatostilbene-2,2'-disulfonic acid; 5-[dimethylamino]naphthalene-1-sulfonyl chloride (DNS, dansyl chloride); 4-dimethylaminophenylazophenyl-4'-isothiocyanate (DABITC); eosin and derivatives, such as eosin and eosin isothiocyanate; erythrosin and derivatives, such as erythrosin B and erythrosin isothiocyanate; ethidium; fluorescein and derivatives, such as 5-carboxyfluorescein (FAM), 5-(4,6-dichlorotriazin-2-yl)aminofluorescein (DTAF), 2'7'-dimethoxy-4'5-dichloro-6-carboxyfluorescein (JOE), fluorescein, fluorescein isothiocyanate (FITC), QFITC (XRITC), -6-carboxyfluorescein (HEX),and TET (tetramethylrhodamine); fluorescamine; IR144; IR1446; malachite green isothiocyanate; 4-methylumbelliferone; orthocresolphthalein; nitrotyrosine; pararosaniline; phenol red; B-phycoerythrin; o-phthalaldehyde; pyrene and derivatives thereof, such as pyrene, pyrenebutyrate, and succinimidyl 1-pyrenebutyrate; reactive red 4 (CIBACRON™ brilliant red 3B-A); rhodamine and derivatives thereof, such as 6-carboxy-X-rhodamine (ROX), 6-carboxyrhodamine (R6G), lysamine rhodamine B sulfonyl chloride, rhodamine (Rhod), rhodamine B, rhodamine 123, rhodamine X isothiocyanate, N,N,N’,N’-tetramethyl-6-carboxyrhodamine (TAMRA), tetramethylrhodamine, and tetramethylrhodamine isothiocyanate (TRITC); sulforhodamine B; sulforhodamine 101 and sulfonyl chloride derivatives of sulforhodamine 101 (Texas Red); riboflavin; rose bengal and terbium chelate derivatives; LightCycler red 640; Cy5.5; and Cy5 6-carboxyfluorescein; boron dipyrromethene difluoride (BODIPY); acridine; stilbene; 6-carboxy-X-rhodamine (ROX); Cy3; Cy3.5, Cy5, Cy5.5, VIC® (for use in Biosystems); LC red 640; LC red 705; OregonGreen®; CALRed®; red 640; and Yakima Yellow; LightCycler® cyan 500; LightCycler®; red 610; Alexa 647; Alexa 555; 5-(2-aminoethyl)amino-1-naphthalenesulfonic acid (EDANS); tetramethylrhodamine (TMR); tetramethylrhodamine isocyanate (TMRITC), fluorescein isocyanate (FITC), χ-rhodamine, their derivatives, or any combination thereof. U.S. Patent Nos. 5,866,366, 6,818,431, 6,056,859, 9,140,688, 9,581,587, 6,165,765, 6,485,909,Same as U.S. Patent No. 8,158,358, No. 7,625,723, No. 7,560,236, No. 7,867,701, No. 9,150,912, No. 7,960,543, No. 6,555,383, No. 6,881,570, No. 8,198,026, No. 5,625,081, No. 8,445,291, No. 9,194,801, No. 8,835,110, No. 7,893,227, No. 9,243,289, No. 7,427,674, No. 9,512,493, U.S. Patent Application Publication No. 2017 / 0152552, No. 2003 / 0170672, No. 2016 / 0281151, No. 2013 / 0084558, No. 2006 / 0281100, No. 2014 / 0234833, No. 2015 / 0072340, No. 2005 / 0089910, No. 2009 / 0081677, No. 2014 / 0024022, No. 2018 / 0171393, No. 2006 / 0188886, No. 2001 / 0018185, No. 2011 / 0151446, and WO / 2000 / 017330A1, WO / 2008 / 030071A1, WO / 2013 / 049631A1, WO / 2016 / 179090A1, WO / 2016 / 123895A1, WO / 2003 / 079022A1, more fluorescent dyes are described, each of which is hereby incorporated by reference in its entirety.,

[0100] In some embodiments, the probes of the present disclosure include a fluorescent donor and an acceptor fluorophore. As used herein, an acceptor fluorophore (e.g., a "fluorescence quencher") is a fluorophore that absorbs energy from a donor fluorophore, for example, in the range of about 400 - 900 nm. The acceptor fluorophore generally absorbs light at a wavelength that is typically at least 10 nm higher (e.g., at least 20 nm higher) than the maximum absorbance wavelength of the donor fluorophore. The acceptor fluorophore has an excitation spectrum that overlaps with the emission of the donor fluorophore such that the energy emitted by the donor can excite the quencher. Any acceptor fluorophore known in the art can be utilized. In certain examples, the acceptor fluorophore is a dark quencher, such as Dabcyl, QSY7 (Molecular Probes), QSY9 (Molecular Probes), QSY21 (Molecular Probes), QSY33 (Molecular Probes), BLACK HOLE QUENCHERS™ (Glen Research, e.g., BHQ-1, BHQ-2, BHQ-3), ECLIPSE™ dark quencher (Epoch Biosciences), DDQ-I, DDQ-II, Dabcyl, Eclipse, or IOWA BLACK™ (Integrated DNA Technologies, e.g., Iowa Black FQ, Iowa Black RQ). More fluorescent quenchers are described in U.S. Patent No. 9,957,546, US9,274,008, U.S. Patent Publication Nos. 2014 / 0295422, 2009 / 0042205, 2016 / 0281182, 2018 / 0142284, 2014 / 0147929, and WO / 2009 / 009615A1, WO / 2016 / 160572A1, WO / 2016 / 178953A1, WO / 2018 / 229663A1, WO / 2010 / 051544A2, WO / 2013 / 152220A2, each of which is incorporated herein by reference in its entirety. The quencher can reduce or quench the emission of the donor fluorophore.In such an example, instead of detecting an increase in the emission signal from the acceptor fluorophore when in sufficient proximity to the donor fluorophore (or detecting a decrease in the emission signal from the acceptor fluorophore when at a significant distance from the donor fluorophore), a quencher can detect an increase in the emission signal from the donor fluorophore when at a significant distance from the donor fluorophore (or a decrease in the emission signal from the donor fluorophore when in sufficient proximity to the quencher acceptor fluorophore).

[0101] In some embodiments, the primers and probes of the present disclosure are based on fluorescence resonance energy transfer (FRET). Examples of oligonucleotides that use FRET and can be used to detect amplicons include linear oligoprobes, such as HybProbes, 5' nuclease oligoprobes, such as TAQMAN® probes, hairpin oligoprobes, such as molecular beacons, Scorpion primers and UniPrimers, minor groove binding probes, and self-fluorescent amplicons, such as Sunrise primers.

[0102] In some embodiments, the primers and / or probes of the present disclosure are labeled with other functional entities such as biotin, hapten, antigen, chemical groups, radioactive substances, enzyme markers, etc. Detection of the labeled amplification products can be achieved using, for example, fluorescence methods, chemiluminescence methods, densitometry, photometry, precipitation reactions, enzyme reactions including enzyme enhancement reactions, SPR ("surface plasmon resonance") methods, ellipsometry, measurement of refractive index, measurement of reflectivity, and similar methods.

[0103] In some embodiments, the primers and probes of the present disclosure are used in a multiplex PCR system to amplify the sequences of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 different HPV subtypes. In some embodiments, the multiplex PCR system further includes oligonucleotides for amplifying and detecting reference control oligonucleotide sequences.

[0104] In some embodiments, the multiplex PCR system can be used to detect and / or genotype HPV subtypes in a biological sample. In some embodiments, the multiplex PCR system is established in a single test tube to detect and / or genotype at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 different HPV subtypes. In some embodiments, the HPV subtypes are selected from the group consisting of HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66, and HPV68, HPV6 and HPV11. In some embodiments, the probes within the multiplex PCR system are marked with different labels. In some embodiments, the probes within the multiplex PCR system are marked with different fluorescent dyes. In some embodiments, the probes for HPV16 and / or HPV18 are labeled with a fluorescent dye different from the fluorescent dye that labels the probes for the other 12 high-risk HPVs (i.e., HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66, and HPV68). In some embodiments, the probes for the 12 high-risk HPVs other than HPV16 and HPV18 are labeled with the same fluorescent dye.

[0105] In some embodiments, the multiplex PCR system includes primers and probes for detecting and / or genotyping high-risk HPV16 and / or HPV18. In some embodiments, the probes for detecting HPV16 and HPV18 are HPV16-P and HPV18-P as described herein, respectively. In some embodiments, HPV16-P is labeled with a first dye and HPV18-P is labeled with a second dye.

[0106] In some embodiments, the multiplex PCR system further comprises primers and probes for detecting and / or genotyping at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 other high-risk HPV subtypes (i.e., HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66, and HPV68). In some embodiments, the probe for detecting and / or genotyping HPV31, HPV33, HPV35, and / or HPV58 is HPV31, 33, 35, 58-P1 (SEQ ID NO: 39). In some embodiments, the probe for detecting and / or genotyping HPV39, HPV59, and / or HPV68 is HPV39, 59, 68-P2 (SEQ ID NO: 40). In some embodiments, the probe for detecting and / or genotyping HPV45, HPV56, and / or HPV66 is HPV45, 56, 66-P3 (SEQ ID NO: 41). In some embodiments, the probe for detecting and / or genotyping HPV51 and / or HPV52 is HPV51, 52-P4 (SEQ ID NO: 42). In some embodiments, the probe for detecting and / or genotyping HPV6 is HPV6-P (SEQ ID NO: 44). In some embodiments, the probe for detecting and / or genotyping HPV11 is HPV11-P (SEQ ID NO: 45). In some embodiments, the probe HPV31, 33, 35, 58-P1 comprises a third dye. In some embodiments, the probe HPV39, 59, 68-P2 comprises a fourth dye. In some embodiments, the probe HPV45, 56, 66-P3 comprises a fifth dye. In some embodiments, the probe HPV51, 52-P4 comprises a sixth dye. In some embodiments, the probe HPV6-P comprises a seventh dye. In some embodiments, the probe HPV11-P comprises an eighth dye. In some embodiments, the first dye and the second dye are different.In some embodiments, the third to sixth dyes are the same, but different from the dyes in HPV16-P and HPV18-P. In some embodiments, the seventh dye in HPV6-P is different from the dye in HPV11-P and different from the dyes in HPV16-P, HPV18-P, HPV31, 33, 35, 58-P1, HPV39, 59, 68-P2, HPV45, 56, 66-P3, and HPV51, 52-P4. In some embodiments, the eighth dye in HPV11-P is different from the dye in HPV6-P and different from the dyes in HPV16-P, HPV18-P, HPV31, 33, 35, 58-P1, HPV39, 59, 68-P2, HPV45, 56, 66-P3, and HPV51, 52-P4.

[0107] In some embodiments, the multiplex PCR system includes at least one primer pair and at least one probe for the detection of at least one reference control gene. In some embodiments, the reference control gene is a gene in a subject whose activity is not affected by the presence or absence of any HPV. In some embodiments, the reference control genes include, but are not limited to, β-globin (HBB), telomerase (TERT), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), albumin (ALB), β-actin (ACTB), and T cell receptor γ (TRG). In some embodiments, the reference control gene is an actin gene in a subject such as β-actin (ACTB). The present disclosure further provides primers for amplifying ACTB in a biological sample such as SEQ ID NOs: 31-32. The present disclosure further provides a probe for detecting ACTB in a biological sample such as SEQ ID NO: 43. In some embodiments, the probe for ACTB includes a ninth dye different from any of the dyes used in the probes for any of the HPV subtypes.

[0108] As a non-limiting example, a multiplex PCR system for detecting and / or genotyping 14 high-risk HPV subtypes (i.e., HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66, and HPV68) is provided. In some embodiments, the multiplex PCR system may further detect and / or genotype two low-risk HPV subtypes (HPV6, HPV11) in addition to the 14 high-risk HPVs. In some embodiments, the multiplex PCR system is established in a single test tube. In some embodiments, the multiplex PCR system is established in two test tubes. In some embodiments, whether a single test tube system or a two test tube system is selected depends on the number of fluorescence detection channels in the qPCR instrument.

[0109] For example, in some embodiments, if the qPCR instrument has at least 6 detection channels (e.g., can recognize at least 6 different fluorescent dyes), a single test tube system can be selected. (i) The probe for HPV16 has a first dye such as a Cy5 fluorescent dye attached to its 5' end, and a quencher, e.g., a BHQ-2 fluorescence quencher attached to its 3' end; (ii) The probe for HPV18 has a second dye such as a FAM fluorescent dye attached to its 5' end, and a quencher, e.g., a BHQ-1 fluorescence quencher attached to its 3' end; (iii) Probes for HPV31, HPV33, HPV45, HPV52, and HPV58 (e.g., HPV31, 33, 35, 58-P1, HPV45, 56, 66-P3, and HPV51, 52-P4) are used, all having the same dye (e.g., a third dye); (iv) Probes for HPV35, HPV39, HPV51, HPV56, HPV59, HPV66, and HPV68 (e.g., HPV31, 33, 35, 58-P1, HPV39, 59, 68-P2, HPV45, 56, 66-P3, and HPV51, 52-P4) all have the same dye (e.g., the fourth dye), e.g., a VIC fluorescent dye bound to their 5'-end, and a quencher, e.g., an MGBNFQ fluorescence quencher bound to their 3'-end; (v) Probes for reference control genes have a fifth dye such as an ROX fluorescent dye bound to their 5'-end, and a quencher, e.g., a BHQ-2 fluorescence quencher bound to their 3'-end; (vi) Probes for HPV6 and HPV11 have the same dye as a sixth dye different from the dyes in (i)-(v).

[0110] In another example, in some embodiments, if the qPCR instrument has less than 6 but at least 4 detection channels (e.g., can recognize at least 4 but less than 6 different fluorescent dyes), a two-tube system using a first test tube and a second test tube can be selected. Each test tube contains at least a probe for detecting a reference control gene having a first dye such as an ROX fluorescent dye bound to its 5'-end, and a quencher, e.g., a BHQ-2 fluorescence quencher bound to its 3'-end. The following probes can be dispersed in the two test tubes as long as the two test tubes together cover all of the 14 high-risk HPV subtypes and 2 low-risk HPV subtypes in addition to the reference control gene without causing interference between the fluorescence detection channels. For example, in some embodiments, the following strategy can be taken: (i) In the first test tube, a probe for HPV16 having a second dye such as a Cy5 fluorescent dye bound to its 5'-end, and a quencher, e.g., a BHQ-2 fluorescence quencher bound to its 3'-end; (ii) In the first test tube, a probe for HPV18 having a third dye such as a FAM fluorescent dye bound to its 5'-end, and a quencher, e.g., a BHQ-1 fluorescence quencher bound to its 3'-end; (iii) In the first test tube, all the probes for HPV31, HPV33, HPV45, HPV52, and HPV58 (e.g., HPV31, 33, 35, 58-P1, HPV45, 56, 66-P3, and HPV51, 52-P4) have the same dye (e.g., the fourth dye), e.g., the VIC fluorescent dye bound to their 5'-ends, and a quencher, e.g., the MGBNFQ fluorescent quencher bound to their 3'-ends; (iv) In the second test tube, all the probes for HPV35, HPV39, HPV51, HPV56, HPV59, HPV66, and HPV68 (e.g., HPV31, 33, 35, 58-P1, HPV39, 59, 68-P2, HPV45, 56, 66-P3, and HPV51, 52-P4) have the same dye (e.g., the second dye), e.g., the VIC fluorescent dye bound to their 5'-ends, and a quencher, e.g., the MGBNFQ fluorescent quencher bound to their 3'-ends, (v) In the second test tube, the probes for HPV6 and HPV11 have the same dye as the third dye, e.g., the HEX fluorescent dye bound to their 5'-ends, and a quencher, e.g., the BHQ-1 fluorescent quencher bound to their 3'-ends.

[0111] In some embodiments, the probe for HPV16 is labeled with CY5 at its 5'-end and BHQ-2 at its 3'-end, the probe for HPV18 is labeled with FAM at its 5'-end and BHQ-1 at its 3'-end, the probes for the other 12 high-risk HPVs (e.g., HPV31, 33, 35, 58-P1, HPV39, 59, 68-P2, HPV45, 56, 66-P3, and HPV51, 52-P4) are labeled with VIC at their 5'-ends and MGBNFQ at their 3'-ends, the probes for HPV6 and HPV11 are labeled with FAM at their 5'-ends and BHQ-1 at their 3'-ends, and the probe for the control gene (e.g., β-actin) is labeled with ROX at its 5'-end and BHQ-1 at its 3'-end.

[0112] Methods of using primers and probes The present disclosure also provides methods for amplifying HPV DNA using primers and probes as described herein, as well as methods for detecting and / or genotyping HPV subtypes.

[0113] In some embodiments, the amplification products using the primers of the present disclosure can be used to detect the presence or absence of a given HPV subtype in a biological sample. The presence of an amplification product using one or more specific pairs of the primers and probes described herein indicates the presence of one or more corresponding HPV subtypes in the biological sample being tested. The absence of an amplification product indicates that one or more corresponding HPV subtypes are not present in the biological sample being tested.

[0114] In some embodiments, qPCR is used to determine the presence or absence of a given HPV subtype. In some embodiments, a positive reaction is detected by the accumulation of a fluorescent signal. The cycle threshold (Ct) is defined as the number of cycles required for the fluorescent signal to cross a threshold (e.g., exceed the background level). In some embodiments, the threshold is automatically determined by the software of the qPCR instrument or other suitable methods. In some embodiments, the threshold is set to just exceed (e.g., about 0.01%, 0.1%, 1%, 5%, or 10% higher than) the end fluorescence value in the negative control sample. In some embodiments, if the Ct value associated with the amplification of the HPV subtype in the test sample is about 35, 34, 33, 32, 31, 30 or less (≦), the sample is determined to contain the HPV subtype (positive result), otherwise the sample is determined to not contain the HPV subtype (negative result). For reference control gene amplification, if the Ct value associated with the amplification of the control gene in the sample is about 35, 34, 33, 32, 31, 30, 29 or less (≦), the reference control gene amplification is determined to be positive, otherwise the reference control gene amplification is determined to be negative. If the reference control gene amplification is determined to be negative and the HPV gene amplification result is also negative, the test result is invalid.

[0115] The methods of using the primers and probes of the present disclosure provide unexpected sensitivity and specificity for HPV detection and / or HPV genotyping. In some embodiments, the primers and probes of the present disclosure provide very high sensitivity and specificity for HPV detection and / or HPV genotyping, particularly when the sample is a urine sample.

[0116] As used herein, the term "sensitivity" refers to the rate at which samples that actually contain HPV in a given population are correctly diagnosed as having HPV by using the methods of the present invention. In some embodiments, the sensitivity of the detection / genotyping methods of the present disclosure is at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or more. In some embodiments, the size of the population is at least about 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10,000 or more.

[0117] As used herein, the term "specificity" refers to the rate at which samples that do not actually contain HPV in a given population are correctly diagnosed as not having HPV. In some embodiments, the specificity of the detection / genotyping methods of the present disclosure is at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or more. In some embodiments, the size of the population is at least about 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10,000 or more.

[0118] The method of using the primers and probes of the present disclosure can detect the presence of HPV DNA in a biological sample when the copy number of HPV DNA in the sample is low. For example, the methods described herein can identify the presence of HPV DNA when at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 or more copies of DNA are among 10 5 DNA molecules in the sample. In some embodiments, for the multiplex PCR systems described herein, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 or more copies of DNA from each HPV subtype are among 10 5 DNA molecules in the sample, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 high-risk HPVs can be detected.

[0119] The detection / genotyping method of the present disclosure using urine samples also provides results that are highly consistent with the results obtained using samples collected from the same subject through invasive procedures such as cervical samples (e.g., cervical scrapers), vaginal samples (e.g., vaginal swabs), or urethral samples (e.g., urethral swabs). In some embodiments, the concordance rate using urine samples and samples obtained through invasive procedures is at least about 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more.

[0120] The present disclosure also provides a method for identifying / screening a subject harboring HPV using primers and probes as described herein. In some embodiments, the method comprises determining the presence or absence of one or more HPV subtypes in a biological sample collected from a subject by amplifying the DNA in the biological sample using a pair of primers of the present disclosure. In some embodiments, the method comprises hybridizing the amplified DNA in the biological sample using a probe of the present disclosure. In some embodiments, the subject is a human, e.g., a female human subject or a male human subject. In some embodiments, the biological sample is collected from the genitourinary system of a human subject. The human subject can be any subject such as a subject suspected of having an HPV infection or a subject at risk of having an HPV infection. In some embodiments, the human subject has one or more symptoms associated with an HPV-related condition such as genital warts, common warts, plantar warts, flat warts, lesions, inflammation, bleeding, genital bumps and nodules, and genital itching. In some embodiments, the human subject has no symptoms at all.

[0121] The present disclosure also provides a method for identifying a subject having pre-cancerous / pre-malignant cells (e.g., abnormal cells that can turn into cancerous cells but are not themselves invasive) and / or at risk of having cancerous cells. In some embodiments, the pre-cancerous and / or cancerous cells are caused by HPV infection by any one or more high-risk HPV subtypes, and / or any one or more low-risk HPV subtypes, or a mixture thereof. HPV-related cancers include, but are not limited to, cervical cancer, vaginal cancer, vulvar cancer, penile cancer, anal cancer, and head and neck cancers (e.g., oral and pharyngeal cancers). In some embodiments, the method includes detecting the presence or absence of one or more HPV subtypes in a biological sample collected from the subject being tested. In some embodiments, the presence of one or more HPV subtypes in the biological sample indicates that the subject is at risk of having pre-cancerous / pre-malignant cells.

[0122] The present disclosure also provides a method for providing an indication for HPV vaccination in a subject in need thereof. In some embodiments, the method includes detecting and / or identifying an HPV subtype in a biological sample collected from the subject in need thereof. In some embodiments, a suitable HPV vaccine is selected for the subject based on the HPV test results. For example, in some embodiments, the HPV vaccine should target at least one or more HPV subtypes identified in the subject's biological sample.

[0123] The present disclosure also provides a method for evaluating the effectiveness of HPV vaccination in a subject in need thereof. In some embodiments, the method comprises detecting and / or discriminating HPV subtypes in a biological sample collected from a subject in need thereof, before and / or after the subject receives an HPV vaccination. In some embodiments, the HPV test results are used to determine the presence and / or level of one or more HPV subtypes in the pre- and / or post-vaccination biological samples, which in turn indicates the effectiveness of the HPV vaccination. In some embodiments, the HPV vaccination can be enhanced, repeated, paused, terminated, and / or replaced based on the HPV test results.

[0124] In some embodiments, the method described herein comprises performing PCR. In some embodiments, the PCR is real-time PCR. In some embodiments, the real-time PCR is quantitative or semi-quantitative PCR. Information obtained from the PCR, such as an amplification curve, can be used to determine the presence of a target nucleic acid (such as an HPV gene) and / or to quantify the initial amount of the target nucleic acid sequence. In some examples, the amount of amplified target nucleic acid (such as an HPV gene) is detected using a labeled probe, such as a probe labeled with a fluorophore, such as a TAQMAN® probe. In this example, the increase in fluorescence emission is measured in real time during the course of the real-time PCR. This increase in fluorescence emission is directly related to the increase in target nucleic acid amplification (such as HPV gene amplification).

[0125] The present disclosure also provides a method for treating or preventing HPV infection and / or HPV-related conditions (e.g., pre-cancer or cancer) in a subject in need thereof. In some embodiments, the method comprises detecting and / or genotyping an HPV subtype in a biological sample collected from a subject in need thereof and treating the subject based on the detection / genotyping results. In some embodiments, treatment includes, but is not limited to, vaccination, surgery, chemotherapy, radiation therapy, immunotherapy, palliative care, and exercise. As used herein, the phrase "treatment regimen" refers to a treatment plan that specifies the type, dosage, schedule and / or duration of treatment provided to a subject in need thereof (e.g., a pathologically diagnosed subject). The selected treatment regimen may be an aggressive regimen expected to result in the best clinical outcome (e.g., complete cure of the pathology) or a more moderate regimen that may alleviate the symptoms of the pathology but result in an incomplete cure of the pathology. It should be understood that in certain cases, a treatment regimen may be associated with some discomfort or harmful side effects to the subject (e.g., damage to healthy cells or tissues). The type of treatment may include surgical intervention in local or systemic mode (e.g., removal of lesions, diseased cells, tissues, or organs), cell replacement therapy, administration of therapeutic agents (e.g., receptor agonists, antagonists, hormones, chemotherapeutic agents), exposure to radiation therapy using external sources (e.g., external beam) and / or internal sources (e.g., brachytherapy), and / or any combination thereof. The dosage, treatment schedule, and duration may vary depending on the pathological severity and the type of treatment selected, and one of ordinary skill in the art can adjust the type of treatment along with the dosage, treatment schedule, and duration.

[0126] In some embodiments, one or more probes and / or primers of the present disclosure are used in other HPV detection methods. Such methods include, but are not limited to, DNA chips, microarrays, hybridization, and / or droplet microfluidic PCR technology.

[0127] In some embodiments, in any of the methods described herein, the biological sample contains urine collected from a subject in need thereof. In some embodiments, the urine sample is processed as described herein to release DNA in exfoliated cells and / or potential viruses in the urine sample. The methods described herein are suitable for HPV DNA samples obtained by any known method in the art, including but not limited to available viral DNA extraction methods such as boiling, phenol-chloroform, magnetic beads, or other commercially available separation methods. In some embodiments, the reagents and methods for extracting DNA from urine samples are those described in this disclosure.

[0128] In some embodiments, in any of the methods described herein, the biological sample includes, but is not limited to, blood, sweat, tears, urine, saliva, semen, serum, plasma, cerebrospinal fluid (CSF), excrement, vaginal fluid or tissue, sputum, nasopharyngeal aspirate or swab, lacrimal fluid, mucosa, or epithelial swab (oral swab), tissue, organ, bone, tooth, or tumor, etc., and these are collected from the subject in need thereof. In some embodiments, the biological sample is processed as described herein to release DNA in exfoliated cells and / or potential viruses in the urine sample. The methods described herein are suitable for HPV DNA samples obtained by any known method in the art, including but not limited to available viral DNA extraction methods such as boiling, phenol-chloroform, magnetic beads, or other commercially available separation methods. In some embodiments, the reagents and methods for extracting DNA from urine samples are those described in this disclosure.

[0129] Compositions and Methods for DNA Extraction The present disclosure also provides compositions and methods for extracting DNA from a biological sample collected from a subject. In some embodiments, the biological sample is collected from a mammalian subject such as a human. In some embodiments, the biological sample is a urine sample. Non-limiting examples of biological samples include, inter alia, blood, sweat, tears, urine, saliva, semen, serum, plasma, cerebrospinal fluid (CSF), excrement, vaginal fluid or tissue, sputum, nasopharyngeal aspirate or swab, lacrimal fluid, mucosa, or epithelial swab (oral swab), tissue, organ, bone, tooth, or tumor.

[0130] The compositions and methods of the present disclosure provide a simple and cost-effective way to extract DNA from biological samples such as urine samples. In particular, the compositions and methods of the present disclosure enable the simultaneous extraction of DNA from exfoliated cells in a biological sample and DNA from one or more pathogens in the sample. For example, in some embodiments, the DNA extraction compositions and methods of the present disclosure can more effectively extract DNA in a urine sample. In addition, the compositions and methods of the present disclosure enable automated DNA extraction, thus reducing the labor intensity while increasing the overall throughput.

[0131] In some embodiments, the present disclosure provides reagents for DNA extraction from a biological sample. In some embodiments, the biological sample is a urine sample. In some embodiments, the reagent comprises magnetic particles. In some embodiments, the reagent comprises a protease. In some embodiments, the reagent further comprises a lysis solution. In some embodiments, the reagent further comprises a first wash buffer. In some embodiments, the reagent further comprises a second wash buffer. In some embodiments, the reagent further comprises an elution buffer. In some embodiments, the reagent can be provided either as a kit or separately before use.

[0132] In some embodiments, the magnetic particles and protease are used to pretreat a urine sample and prepare for DNA extraction.

[0133] In some embodiments, the lysis solution, the first wash buffer, the second wash buffer, and the elution buffer are used to extract DNA from a pretreated urine sample.

[0134] In some embodiments, the DNA extraction of the present disclosure is based on magnetic particles such as magnetic nanoparticles (e.g., magnetic nanobeads).

[0135] In some embodiments, the magnetic particles have a magnetic core and are protected by a coating. The coating prevents irreversible aggregation of the magnetic particles and enables functionalization by attachment of ligands for DNA adsorption. In some embodiments, the magnetic particles are incubated in the sample for a period of time necessary to achieve optimal adsorption. In some embodiments, the magnetic particles contain iron oxide such as Fe3O4 or Fe2O3. In some embodiments, the iron oxide material is processed into a magnetic "pigment" by reducing its size to a few nanometers, and then the magnetic "pigment" can be encapsulated in a non-magnetic matrix such as silica, polyvinyl alcohol (PVA), dextran, agarose, sepharose, and polystyrene that can be biofunctionalized and used for life science applications.

[0136] In some embodiments, the magnetic particles have a core-shell structure. In some embodiments, the magnetic particles have an embedded structure.

[0137] In the case of a core-shell structure, the magnetic particles are composed of a single superparamagnetic core with a polymeric or silica surface coating such as a magnetic core surrounded by a SiO2 shell. In some other embodiments, the magnetic particles are composed of a polystyrene or polyvinyl alcohol (PVA) core surrounded by superparamagnetic particles and protected by a surface coating. In some embodiments, the magnetic particles have multiple layers of superparamagnetic particles alternating with an encapsulating material.

[0138] Regarding an embedding structure, superparamagnetic beads can be composed of a monodisperse matrix such as polystyrene, agarose, or sepharose impregnated with a plurality of iron oxide nanoparticles (“magnetic pigments”). These beads are typically several hundred nanometers in diameter and are sealed with a material that prevents loss of the magnetic pigment.

[0139] Non-limiting examples of magnetic particles for DNA extraction can be found in U.S. Patent Nos. 6,514,688; 6,673,631; 6,027,945; 8,710,211; 6,033,878; 6,368,800; 8,324,372; 8,729,252; U.S. Patent Application Publications 2003 / 0087286; 2015 / 0141258; 2016 / 0102305; 2013 / 0096292; 2002 / 0086326; 2005 / 0287583; 2010 / 0009351; 2011 / 0171640; 2011 / 0008797; 2018 / 0195035; 2008 / 0132694; 2004 / 0002594; 2009 / 0131650; 2016 / 0369263; 2014 / 0288398; 2003 / 0224366; as well as WO / 2001 / 037291A1; WO / 2001 / 045522A1; WO / 1998 / 031840A1; WO / 2005 / 021748A1; WO / 2017 / 051939A1; WO / 2017 / 137192A1; WO / 2010 / 005444A1; WO / 1992 / 008805A1; WO / 2013 / 164319A1; WO / 2015 / 126340A1; WO / 2017 / 156336A1; WO / 2009 / 102632A3; WO / 2009 / 102632A2; WO / 2009 / 012185A1; WO / 2009 / 012185A9; WO / 2009 / 115335A1; WO / 2015 / 120445A1; WO / 2015 / 123433A2; WO / 2007 / 050327A2; WO / 2007 / 050327A3; and WO / 2013 / 028548A2, each of which is hereby incorporated by reference in its entirety for all purposes.

[0140] In some embodiments, the magnetic particles are hydroxyl magnetic beads coated with silica.

[0141] In some embodiments, the magnetic particles are magnetic beads having an average diameter of about 50 nm, 60 nm, 70 nm, 80 nm, 90 nm, 100 nm, 150 nm, 200 nm, 250 nm, 300 nm, 350 nm, 400 nm, 450 nm, 500 nm, 550 nm, 600 nm, 650 nm, 700 nm, 750 nm, 800 nm, 850 nm, 900 nm, 950 nm, 1000 nm or more.

[0142] Also provided is a solution containing the magnetic particles. The concentration of the magnetic particles in the solution can be determined in advance as needed. In some embodiments, the concentration is about 5 mg / ml to about 100 mg / ml, about 100 mg / ml to 200 mg / ml, about 200 mg / ml to 300 mg / ml, about 300 mg / ml to 400 mg / ml, about 400 mg / ml to 500 mg / ml or more. In some embodiments, the concentration is about 10 mg / ml, about 20 mg / ml, about 30 mg / ml, about 40 mg / ml, about 50 mg / ml, about 60 mg / ml, about 70 mg / ml, about 80 mg / ml, about 90 mg / ml, about 100 mg / ml, about 200 mg / ml, about 300 mg / ml, about 400 mg / ml, about 500 mg / ml or more.

[0143] In some embodiments, the solution containing magnetic particles is mixed with the sample containing DNA. In some embodiments, the final concentration of the magnetic particles after mixing with the sample is determined in advance based on the potential or actual amount of DNA in the sample. In some embodiments, the final working concentration of the magnetic particles after being mixed with the sample containing DNA is about 0.01 to 0.5 mg / ml. In some embodiments, the final working concentration is about 0.01 mg / ml, 0.02 mg / ml, 0.03 mg / ml, 0.04 mg / ml, 0.05 mg / ml, 0.06 mg / ml, 0.07 mg / ml, 0.08 mg / ml, 0.09 mg / ml, 0.1 mg / ml, 0.15 mg / ml, 0.2 mg / ml, 0.25 mg / ml, 0.3 mg / ml, 0.35 mg / ml, 0.4 mg / ml, 0.45 mg / ml, 0.5 mg / ml or more.

[0144] In some embodiments, after the sample containing the mixed DNA and the magnetic particles are mixed, the mixture is shaken for a predetermined time. In some embodiments, optionally, the mixture is allowed to stand for a certain period of time after being mixed. Then, the mixture is centrifuged at a predetermined speed to precipitate the magnetic particles. In some embodiments, the supernatant is removed and the precipitated magnetic particles are further processed for DNA extraction.

[0145] In some embodiments, the precipitated magnetic particles are treated with a protease. In some embodiments, the protease is a broad-spectrum protease. In some embodiments, the protease is a serine protease, a cysteine protease, a threonine protease, an aspartic protease, a glutamic protease, a metalloprotease, an asparagine peptidase.

[0146] In some embodiments, the serine protease is protease K (EC 3.4.21.64, proteinase K, endopeptidase K, Tritirachium alkaline proteinase, Tritirachium album serine proteinase, Tritirachium album proteinase K). In some embodiments, the term protease K also includes any functional variants of native protease K.

[0147] Also provided is a solution containing a protease such as protease K. The concentration of the protease in the solution can be determined in advance as needed. In some embodiments, the concentration is from about 1 mg / ml to about 100 mg / ml. In some embodiments, the concentration is about 1 mg / ml, about 2 mg / ml, about 3 mg / ml, about 4 mg / ml, about 5 mg / ml, about 6 mg / ml, about 7 mg / ml, about 8 mg / ml, about 9 mg / ml, about 10 mg / ml, about 11 mg / ml, about 12 mg / ml, about 13 mg / ml, about 14 mg / ml, about 15 mg / ml, about 16 mg / ml, about 17 mg / ml, about 18 mg / ml, about 19 mg / ml, about 20 mg / ml, about 30 mg / ml, about 40 mg / ml, about 50 mg / ml, about 60 mg / ml, about 70 mg / ml, about 80 mg / ml, about 90 mg / ml, about 100 mg / ml or more.

[0148] In some embodiments, the precipitated magnetic particles are mixed with a solution containing a protease such as protease K. In some embodiments, the final concentration of the protease after mixing is determined in advance. In some embodiments, the final working concentration of the protease after mixing with the precipitated magnetic particles is from about 5 to 500 μg / ml. In some embodiments, the final working concentration is about 5 μg / ml, 6 μg / ml, 7 μg / ml, 8 μg / ml, 9 μg / ml, 10 μg / ml, 50 μg / ml, 100 μg / ml, 150 μg / ml, 200 μg / ml, 250 μg / ml, 300 μg / ml, 350 μg / ml, 400 μg / ml, 450 μg / ml, 500 μg / ml, 1 or more.

[0149] In some embodiments, the mixture of precipitated magnetic particles and protease can be allowed to stand at a desired temperature for a predetermined time. In some embodiments, the desired temperature is the preferred enzymatic reaction temperature of the protease. In some embodiments, the protease is protease K and the temperature is from about 20°C to about 60°C. In some embodiments, the temperature is from about 50°C to about 60°C. In some embodiments, the temperature is about 55°C (±2°C).

[0150] In some embodiments, the mixture of precipitated magnetic particles and protease can be allowed to stand for a predetermined time. In some embodiments, the time is about 5 minutes, about 10 minutes, about 15 minutes, about 20 minutes, about 25 minutes, about 30 minutes, about 35 minutes, about 40 minutes, about 45 minutes, about 50 minutes, about 55 minutes, about 60 minutes, about 1.5 hours, about 2 hours, about 3 hours, about 4 hours, about 5 hours or more.

[0151] In some embodiments, after pretreating a urine sample with magnetic particles and protease, it is subjected to the next step for DNA extraction. In some embodiments, a lysis solution, a first wash buffer, a second wash buffer, and an elution buffer are used sequentially.

[0152] In some embodiments, the lysis solution contains a compound having the structure of formula (I),

[0153] [Chemical formula] Formula (I), wherein R1, R2, R3, R4, and R5 are each independently hydrogen, halogen, acyl, substituted acyl, alkoxycarbonyl, substituted alkoxycarbonyl, aryloxycarbonyl, substituted aryloxycarbonyl, alkyl, substituted alkyl, aryl, substituted aryl, arylalkyl, substituted arylalkyl, heteroaryl, substituted heteroaryl, heteroarylalkyl, substituted heteroarylalkyl, heteroalkyl.

[0154] In some embodiments, the compound contains guanidine. In some embodiments, the compound contains guanidine isothiocyanate, or a functional derivative thereof.

[0155] In some embodiments, the lysis solution further contains a surfactant, a pH buffer, a chelating agent, and an alcohol (for example, an organic compound in which a hydroxyl functional group (-OH) is bonded to carbon). In some embodiments, the surfactant is Triton X 100. In some embodiments, the pH buffer is Tris-HCl. In some embodiments, the chelating agent is EDTA. In some embodiments, the alcohol is isopropanol.

[0156] In some embodiments, the lysis solution has a pH of about 6.2 to 6.8, for example, about 6.2, about 6.3, about 6.4, about 6.5, about 6.6, about 6.7, or about 6.8.

[0157] In some embodiments, the lysis solution of the present disclosure can be in a concentrated state before being added to a sample containing DNA (for example, a liquid sample), such as 2X, 3X, 4X, 5X, 6X, 7X, 8X, 9X, 10X, 15X, 20X, 25X, 30X, 40X, 50X, 60X, 70X, 80X, 90X, 100X or more, according to the dilution scale. In some embodiments, the dilution scale can be 10:1, 9:1, 8:1, 7:1, 6:1, 5:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:15, 1:20, 1:25, 1:30, 1:40, 1:50, 1:60, 1:70, 1:80, 1:90, 1:99, etc. Based on the dilution scale, the lysis solution is mixed with the sample containing DNA so that a final working concentration of 1-fold is achieved.

[0158] In some embodiments, the dilution scale is 3:1 (e.g., 3 volumes of the lysis solution are added to 1 volume of the DNA-containing sample). In this case, the preparation of the lysis solution includes: a) preparing a solution containing about 2 - 6 M guanidinium isothiocyanate, about 1% - about 5% Triton X 100, about 20 mM - about 50 mM Tris-HCl, and about 10 - about 50 mM EDTA; and b) adding about 50% - about 200% (v / v) of isopropanol to the solution.

[0159] In some embodiments, after the lysis solution is mixed with the DNA-containing sample, the working concentration (1X) of each component is (a) about 1.0 M - 5.0 M guanidinium isothiocyanate, e.g., about 1.0 M, about 1.5 M, about 2.0 M, about 2.5 M, about 3.0 M, about 3.5 M, about 4.0 M, about 4.5 M, about 5.0 M or more; (b) about 0.5% - about 4% Triton X-100, e.g., about 0.5%, about 0.75%, about 1.0%, about 1.25%, about 1.5%, about 1.75%, about 2.0%, about 2.25%, about 2.55, about 2.75%, about 3.0%, about 3.255, about 3.5%, about 3.75%, about 4% or more; (c) about 5 mM - about 30 mM Tris-HCl, e.g., about 5 mM, about 10 mM, about 15 mM, about 20 mM, about 25 mM, about 30 mM or more; (d) about 2 mM - about 20 mM EDTA, e.g., about 2 mM, about 5 mM, about 8 mM, about 11 mM, about 14 mM, about 17 mM, about 20 mM or more; (e) about 30% - about 150% (v / v) isopropanol, e.g., about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%, about 105%, about 110%, about 115%, about 120%, about 125%, about 130%, about 135%, about 140%, about 145%, about 150% or more.

[0160] In some embodiments, after a sample containing magnetic particles is mixed with a lysis solution, the container holding the mixture is shaken for a pre-determined time. In some embodiments, the container is shaken for about 10 to 20 minutes, for example, about 10 minutes, about 11 minutes, about 12 minutes, about 13 minutes, about 14 minutes, about 15 minutes, about 16 minutes, about 17 minutes, about 18 minutes, about 19 minutes, about 20 minutes or more.

[0161] In some embodiments, after a sample containing magnetic particles is lysed by the lysis solution of the present disclosure, the magnetic particles in the sample are collected by using a magnetic object such as a magnetic frame or an automatic nucleic acid extraction device.

[0162] In some embodiments, the collected magnetic particles are washed in a first washing buffer (washing buffer I).

[0163] In some embodiments, the first washing buffer contains a compound having the structure of formula (I),

[0164]

Chemical formula

[0165] In some embodiments, the first washing buffer further contains a pH buffer, a salt, and an alcohol (for example, an organic compound in which a hydroxyl functional group (-OH) is bonded to carbon).

[0166] In some embodiments, the pH buffer is Tris-HCl. In some embodiments, the salt is a sodium salt such as NaCl. In some embodiments, the alcohol is ethanol.

[0167] In some embodiments, the first washing buffer has a pH of about 4.5 to 5.5, such as about 4.5, about 4.6, about 4.7, about 4.8, about 4.9, about 5.0, about 5.0, about 5.1, about 5.2, about 5.3, about 5.4, about 5.5.

[0168] In some embodiments, the first washing buffer of the present disclosure can be in a concentrated state before being used to wash magnetic particles, such as 2X, 3X, 4X, 5X, 6X, 7X, 8X, 9X, 10X, 15X, 20X, 25X, 30X, 40X, 50X, 60X, 70X, 80X, 90X, 100X or more, depending on the dilution scale. In some embodiments, the dilution scale can be 10:1, 9:1, 8:1, 7:1, 6:1, 5:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:15, 1:20, 1:25, 1:30, 1:40, 1:50, 1:60, 1:70, 1:80, 1:90, 1:99, etc. Based on the dilution scale, the washing buffer is diluted with a suitable solvent so that the final working concentration is achieved.

[0169] The working concentration of each component is (a) about 50 to about 100 mM guanidinium isothiocyanate, such as about 50 mM, about 55 mM, about 60 mM, about 65 mM, about 70 mM, about 75 mM, about 80 mM, about 85 mM, about 90 mM, about 95 mM, about 100 mM or more; (b) about 20 mM to about 50 mM Tris-HCl, such as about 20 mM, about 25 mM, about 30 mM, about 35 mM, about 40 mM, about 45 mM, about 50 mM or more; (c) About 50 mM to about 200 mM of NaCl, for example, about 50 mM, about 55 mM, about 60 mM, about 65 mM, about 70 mM, about 75 mM, about 80 mM, about 85 mM, about 90 mM, about 95 mM, about 100 mM, about 105 mM, about 110 mM, about 115 mM, about 120 mM, about 125 mM, about 130 mM, about 135 mM, about 140 mM, about 145 mM, about 150 mM, about 155 mM, about 160 mM, about 165 mM, about 170 mM, about 175 mM, about 180 mM, about 185 mM, about 190 mM, about 195 mM, about 200 mM or more; and (d) About 40% to about 60% (v / v) of ethanol, for example, about 40%, about 45%, about 50%, about 55%, about 60% or more.

[0170] In some embodiments, for every 0.1 mg to 1 mg of magnetic particles, about 500 to 1000 μl of the first washing buffer is used.

[0171] In some embodiments, the magnetic particles in the sample are washed for a pre-determined period of time. In some embodiments, the magnetic particles are washed for about 1 to 10 minutes, for example, about 1 minute, about 2 minutes, about 3 minutes, about 4 minutes, about 5 minutes, about 6 minutes, about 7 minutes, about 8 minutes, about 9 minutes, about 10 minutes or more.

[0172] After the magnetic particles are washed in the first washing buffer, the magnetic particles are re-collected by using a magnetic object such as a magnetic frame or an automatic nucleic acid extraction device.

[0173] In some embodiments, the collected magnetic particles are washed in a second washing buffer (washing buffer II).

[0174] In some embodiments, the second washing buffer further comprises a pH buffer and an alcohol (for example, an organic compound in which a hydroxyl functional group (-OH) is bonded to a carbon).

[0175] In some embodiments, the pH buffer is Tris-HCl. In some embodiments, the alcohol is ethanol.

[0176] In some embodiments, the second washing buffer has a pH of about 5.5 to 6.5, such as about 5.5, about 5.6, about 5.7, about 5.8, about 5.9, about 6.0, about 6.1, about 6.2, about 6.3, about 6.4, about 6.5.

[0177] In some embodiments, the second washing buffer of the present disclosure can be in a concentrated state before being used to wash magnetic particles, such as 2X, 3X, 4X, 5X, 6X, 7X, 8X, 9X, 10X, 15X, 20X, 25X, 30X, 40X, 50X, 60X, 70X, 80X, 90X, 100X or more, depending on the dilution scale. In some embodiments, the dilution scale can be 10:1, 9:1, 8:1, 7:1, 6:1, 5:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:15, 1:20, 1:25, 1:30, 1:40, 1:50, 1:60, 1:70, 1:80, 1:90, 1:99, etc. Based on the dilution scale, the washing buffer is diluted with a suitable solvent so that the final working concentration is achieved.

[0178] The working concentration of each component is (a) about 10 mM to about 50 mM Tris-HCl, such as about 10 mM, about 15 mM, about 20 mM, about 25 mM, about 30 mM, about 35 mM, about 40 mM, about 45 mM, about 50 mM or more; and (b) about 70% to 80% ethanol, such as about 71%, about 72%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%.

[0179] In some embodiments, about 500 to 1000 μl of the second washing buffer is used per 0.1 mg to 1 mg of magnetic particles.

[0180] In some embodiments, the magnetic particles in the sample are washed in the second wash buffer for a predetermined time. In some embodiments, the magnetic particles are washed for about 1 to 10 minutes, for example, about 1 minute, about 2 minutes, about 3 minutes, about 4 minutes, about 5 minutes, about 6 minutes, about 7 minutes, about 8 minutes, about 9 minutes, about 10 minutes or more.

[0181] In some embodiments, after washing with the second wash buffer, the magnetic particles are recollected by using a magnetic object such as a magnetic frame or an automated nucleic acid extraction device.

[0182] In some embodiments, the collected magnetic particles are treated in an elution buffer to release the isolated DNA molecules.

[0183] In some embodiments, the elution buffer is a TE buffer. In some embodiments, the TE buffer is a 1X TE buffer containing about 10 mM Tris and about 1 mM EDTA. In some embodiments, the pH of the TE buffer is adjusted to about 8.0 with HCl.

[0184] In some embodiments, before the magnetic particles are treated with the elution buffer, they are allowed to stand at a preselected temperature for a predetermined time.

[0185] In some embodiments, the predetermined time is about 1 to 10 minutes, for example, about 1 minute, about 2 minutes, about 3 minutes, about 4 minutes, about 5 minutes, about 6 minutes, about 7 minutes, about 8 minutes, about 9 minutes, about 10 minutes or more.

[0186] In some embodiments, the preselected temperature can be room temperature, a higher, or a lower temperature, for example, about -80°C to about 37°C.

[0187] In some embodiments, the wash removal step includes heating the elution buffer containing the magnetic particles to a suitably high temperature of about 50°C to about 75°C, for example, about 50°C, about 55°C, about 60°C, about 65°C, about 70°C, about 75°C or more.

[0188] Compositions, Chips, and Kits The present disclosure further provides nucleotide arrays for detecting and / or discriminating HPV genotypes. In some embodiments, the nucleotide array is a DNA array, an RNA array, or a mixture thereof. In some embodiments, the nucleotide array is a DNA microarray. As used herein, a DNA microarray (commonly also known as a DNA chip or biochip) is a collection of microscopic DNA spots attached to a solid surface. The nucleotide array may include DNA molecules containing one or more of the primers / probes of the present disclosure.

[0189] In some embodiments, the arrays of the present disclosure are an arrangement of addressable positions on a substrate, each address containing a nucleic acid such as a probe. In some embodiments, each address corresponds to a single type or class of nucleic acid such as a single probe, although a particular nucleic acid may be redundantly contained at multiple addresses. The array can be either a microarray or a macroarray. A microarray is a miniaturized array that requires microscopy for detection of hybridization. With a larger macroarray, each address is visible to the naked eye, and in some embodiments, the hybridization signal is detectable without additional magnification. The addresses can be labeled, keyed to a separate guide, or otherwise identified by their location.

[0190] The use of the term "array" includes arrays found in DNA microchip technology. One non-limiting example is that the probes can be contained on a DNA microchip similar to the GENECHIP® products and related products commercially available from Affymetrix, Inc. (Santa Clara, Calif.).

[0191] The present disclosure further provides a kit. In some embodiments, the kit can be a kit for the amplification, detection, identification, or quantification of HPV sequences in a sample. The kit can include a pair of primers (e.g., a forward primer, a reverse primer) and corresponding probes as described herein.

[0192] The kit of the present disclosure can include the polynucleotides of the present disclosure as described herein. In some embodiments, the kit can also include reagents and / or devices for extracting DNA from a sample, such as a urine sample, as described herein. The kit can also be used in a subject in need thereof for cancer prediction.

[0193] In some embodiments, the kit can include the polynucleotides described herein together with any or all of the following assay reagents, buffers, probes and / or primers, and assay solutions, or another pharmaceutically acceptable emulsion and suspension base. Additionally, the kit can include a teaching material including instructions (e.g., protocols) for the practice of the methods described herein. The kit can further comprise a software package for data analysis.

[0194] Any of the compositions described herein can be included in the kit. By way of non-limiting example, reagents for isolating, labeling, and / or evaluating DNA and / or RNA populations are included in the kit. It can also include one or more buffers such as reaction buffers, labeling buffers, washing buffers, or hybridization buffers, compounds for preparing DNA samples, component hybridization, and components for isolating DNA.

[0195] In some embodiments, the kit comprises a container such as a solution container or a reaction tube. The container in which the nucleic acid is supplied can be any conventional container capable of holding the supplied form, such as a microcentrifuge tube, an ampoule, or a bottle. The kit can include either labeled or unlabeled nucleic acid probes used for the detection, typing, and subtyping of HPV.

[0196] In some applications, one or more primers and / or probes as described herein, such as primer pairs and / or their corresponding probes, can be provided in a pre-measured single-use amount in individual, typically disposable tubes or equivalent containers. With such an arrangement, the sample to be tested for the presence of HPV is added to the individual tubes and amplification can be carried out directly.

[0197] The amount of primers and probes supplied in the kit can be any appropriate amount and can depend on the target market the product is directed towards. For example, if the kit is adapted for research or clinical use, the amount of each nucleic acid primer provided is likely to be an amount sufficient to prime several PCR amplification reactions.

[0198] In some embodiments, the kit can also include reagents necessary to carry out a PCR amplification reaction, including DNA sample preparation reagents, appropriate buffers (such as polymerase buffers), salts (e.g., magnesium chloride), and deoxyribonucleotides (dNTPs).

[0199] One or more reference control sequences for use in the PCR reaction can also be supplied in the kit (e.g., for the detection of a control gene such as β-actin).

[0200] The kit can also include positive and / or negative control samples (e.g., samples containing or not containing the DNA of one or more given HPV subtypes).

[0201] Definitions References to "one embodiment", "an embodiment", "one example", and "an example" indicate that the embodiment(s) or example(s) so described may include a particular feature, structure, characteristic, property, element, or limitation, but not all embodiments or examples necessarily include that particular feature, structure, characteristic, property, element, or limitation. Further, repeated use of the phrase "in one embodiment" does not necessarily refer to the same embodiment, but may.

[0202] As used herein, the term "biological sample" means a cell, tissue, organ biopsy, tissue biopsy, body fluid, body secretion, culture or culture medium, aqueous solution, emulsion, dispersion, suspension containing isolated and purified pathogens or their components; a sample unfixed, frozen, fixed in formalin, and / or embedded in paraffin. A biological sample may have already been subjected to a purification step, but it may also exist in an unpurified form. In some embodiments, the biological sample is amniotic fluid, aqueous humor and vitreous humor, bile, plasma, serum, cerebrospinal fluid, cerumen (earwax), chyle, endolymph and perilymph, exudate, excrement, female ejaculate, gastric acid, gastric juice, lymph, mucus (including nasal mucus and sputum), pericardial fluid, ascites, pleural effusion, pus, rectal secretion, mucosal secretion, saliva, sebum (skin oil), serous fluid, sperm fluid, serum, smegma, sputum, synovial fluid, sweat, tears, urine, milk, skin scrapings, prostatic fluid, surface washings, vaginal secretion, bone marrow aspirate, bronchoalveolar lavage fluid, tracheal aspirate, nasopharyngeal aspirate, vaginal secretion, vomit, pharyngeal aspirate, or any mixture thereof.

[0203] As used herein, "nucleic acid" or "oligonucleotide" or "polynucleotide" means at least two nucleotides covalently linked. A single-stranded depiction also defines the sequence of the complementary strand. Thus, a nucleic acid also encompasses the complementary strand of the depicted single strand. Many variants of a nucleic acid can be used for the same purpose as a given nucleic acid. Thus, a nucleic acid also encompasses substantially identical nucleic acids and their complements. A single strand provides a probe that can hybridize to a target sequence under stringent hybridization conditions. Thus, a nucleic acid also encompasses probes that hybridize under stringent hybridization conditions. A nucleic acid can be a single-stranded or double-stranded sequence, or can contain portions of both double-stranded and single-stranded sequences. A nucleic acid can be DNA, both genomic and cDNA, RNA, or a hybrid, and a nucleic acid can contain combinations of deoxyribo and ribonucleotides, as well as combinations of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine, hypoxanthine, isocytosine, and isoguanine. A nucleic acid can be obtained by chemical synthesis methods or by recombinant methods.

[0204] As used herein, "stringent hybridization conditions" means conditions under which a first nucleic acid sequence (e.g., a probe) hybridizes to a second nucleic acid sequence (e.g., a target), e.g., in a complex mixture of nucleic acids. Stringent conditions are sequence-dependent and will be different in different circumstances. Stringent conditions can be selected to be about 5-10 °C lower than the thermal melting point (T m ) of the specific sequence at a defined ionic strength and pH. T m is the temperature at which 50% of the probes complementary to the target (under defined ionic strength, pH, and nucleic acid concentration) hybridize to the target sequence at equilibrium (because the target sequence is present in excess, T mIt can be the temperature at which 50% of the probe is occupied in the equilibrium state. The exact conditions are that the salt concentration is less than about 1.0 M sodium ions at pH 7.0 - 8.3, for example, a sodium ion concentration (or other salts) of about 0.01 - 1.0 M, and the temperature is at least about 30 °C for short probes (e.g., about 10 - 50 nucleotides) and at least about 60 °C for long probes (e.g., more than about 50 nucleotides). The exact conditions can also be achieved by adding destabilizing agents such as formamide. For selective or specific hybridization, the positive signal can be at least 2 - 10 times that of background hybridization. Exemplary exact hybridization conditions are as follows: 50% formamide, 5×SSC, and 1% SDS, incubated at 42 °C, or 5×SSC, 1% SDS, incubated at 65 °C, washed in 0.2×SSC, and containing 0.1% SDS at 65 °C.

[0205] As used herein, a "variant" referring to a nucleic acid means (i) a portion of a reference nucleotide sequence, (ii) a reference nucleotide sequence or a complement thereof, (iii) a nucleic acid that is substantially identical to the reference nucleic acid or its complement, or (iv) a nucleic acid that hybridizes to the reference nucleic acid, its complement, or a sequence substantially identical thereto under stringent conditions.

[0206] As used herein, "substantially complementary" means that the first sequence is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identical to the complement of the second sequence over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more nucleotides, or that the two sequences hybridize under stringent hybridization conditions.

[0207] As used herein, "substantially identical" means that when a first sequence is substantially complementary to the complement of a second sequence, the first and second sequences are at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more nucleotides or amino acids in length, or, with respect to nucleic acids, are at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identical.

[0208] As used herein, the term "diagnosing" refers to pathology, or distinguishing symptoms and determining the pathological severity (e.g., grade or stage), monitoring the pathological progression, and predicting the pathological outcome and / or prognosis of recovery.

[0209] As used herein, the phrase "subject in need thereof" refers to an animal or human subject known to have cancer or at risk of having cancer (e.g., a genetically predisposed subject, a subject with a cancer history and / or family history, a subject exposed to carcinogens, occupational risks, environmental risks), and / or a subject exhibiting suspicious clinical signs of cancer (e.g., blood in the stool or bloody stool, pain of unknown origin, sweating, fever of unknown origin, unexplained weight loss up to anorexia, changes in bowel habits (constipation and / or diarrhea), tenesmus (specifically, the feeling of incomplete defecation due to rectal cancer), anemia, and / or general debility). Additionally or alternatively, the subject in need thereof can be a healthy human subject undergoing routine health examinations.

[0210] As used herein, the term "about" refers to ±10%.

[0211] The phrase "consisting essentially of" means that a composition or method may include additional components and / or steps, but only if the additional components and / or steps do not materially alter the basic and novel characteristics of the composition or method recited in the claims.

[0212] As used herein, the singular forms "a", "an", and "the" include plural references unless the context clearly dictates otherwise. For example, the term "compound" or "at least one compound" can include a plurality of compounds including mixtures thereof.

[0213] The word "exemplary" is used herein to mean "serving as an example, instance, or illustration". Any embodiment described as "exemplary" is not necessarily to be construed as preferred or advantageous over other embodiments, and / or does not exclude the incorporation of features from other embodiments.

[0214] The phrase "optionally" is used herein to mean "provided in some embodiments and not provided in other embodiments". Any particular embodiment of the invention can include a plurality of "optional" features as long as such features are not mutually inconsistent.

[0215] As used herein, "the dosage of isopropanol (v / v)" means the ratio of the volume of isopropanol to the volume of the solution containing all other components in the solution during the preparation of the final solution. For example, "isopropanol has a dosage of about 50% to 200% (v / v)" means that when preparing the final solution, the volume of added isopropanol is about 50% to 200% of the volume of the solution containing all other components in the final solution.

[0216] Certain embodiments of the present disclosure are further described in the following examples. It should be understood that these examples are given by way of illustration only. From the above considerations and these examples, those skilled in the art can identify the essential characteristics and make various changes and modifications to the embodiments of the present invention without departing from its spirit and scope, and adapt them to various uses and conditions. Therefore, in addition to what is shown and described herein, various modifications to the embodiments of the present invention will be apparent to those skilled in the art from the foregoing description. Such modifications are also intended to be within the scope of the appended claims.

Example

[0217] Example 1: Primer / Probe Design and Testing Snijders et al. (J. Gen. Virol., 71 (1990), 173-181), and Surentheran et al., (J. Clin. Path., 51 (1998), 606-610) have described PCR processes for detecting HPV L1 gene DNA. The drawback of both methods is that only a limited number of HPV types can be detected. For example, the primers described by Snijder et al. detect only some of the HPV types such as HPV30, HPV39, and HPV51, but with a significantly reduced sensitivity. In addition, using the primers described by Snijder et al., some HPV types such as HPV18 result in the formation of additional bands. Therefore, existing tests detect only a limited spectrum of HPV subtypes and cannot adequately detect some rare HPV subtypes. The present disclosure provides compositions and methods that can be used to detect and / or genotype up to 14 high-risk HPV subtypes and 2 low-risk HPV subtypes in a single test tube or two test tubes.

[0218] Primer and Probe Design The L1 gene sequences in several HPV subtypes (HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66, HPV68a, HPV68b, HPV6, HPV11, and HPV17), as well as other common HPV types (HPV26, HPV40, HPV42, HPV43, HPV44, HPV53, HPV54, HPV61, HPV67, HPV69, HPV70, HPV71, HPV72, HPV73, HPV81, HPV82, HPV83) are obtained from the National Center for Biotechnology Information (NCBI). The L1 gene sequences in 12 high-risk HPVs (HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66, and HPV68) were compared using DNAstart® software. According to the phylogenetic tree (Figure 1), the 12 high-risk HPVs were classified into 4 categories: Class 1 (HPV31, HPV33, HPV35, 58), Class 2 (HPV39, HPV59, HPV68), Class 3 (HPV45, HPV56, HPV66), Class 4 (HPV51, HPV52). Then, the HPV L1 genes of these 4 classes were aligned using DNAstart® software to discover conserved regions. Based on the conserved regions, probes P1, P2, P3, and P4 (SEQ ID NOs: 37, 38, 39, and 40) were designed for the detection of these 12 HPV subtypes (Figure 2).

[0219] Primers and probes for HPV16, HPV18, HPV6, HPV11, and these 12 high-risk HPVs were designed using software. For each design, there were several possible sets of specific primers or probes. Software was used to determine the dimers that could be formed between primers and probes in each design, and the primer / probe combination with the lowest possible dimer formation rate was selected.

[0220] Primer and Probe Test According to the optimal primer-probe sequences obtained by software design analysis, the corresponding primers and probes were synthesized and tested in a real-time fluorescence quantitative PCR reaction solution. The reaction solution was used to amplify template DNA. The template DNA used contained 33 synthetic HPV L1 genes (cloned into the pUC57 vector). The real-time PCR system used contained 1x buffer (Invitrogen), 0.2 mM dNTP (Invitrogen), 3 mM MgCl2 (Invitrogen), 0.2 μM - 0.6 μM primers and probes, and 1 U of Taq enzyme (Invitrogen Platinum (trademark) Taq). The instrument used for fluorescence quantitative PCR was the Roche Lightcycler 480II. The qPCR reaction conditions were as follows:

Table 3

[0221] Among all the primers and probes tested, the combination of primers and probes that provided the best results was selected, and their amplification curves for each HPV subtype L1 gene are shown in Figures 3A - 3P. Figure 3Q shows the amplification curve of the β-actin control gene using the most optimized primer / probe set.

[0222] Next, when these preferred primers / probes were used in a multiplex PCR system to amplify all HPV subtype sequences, it was tested whether the amplification results of any particular HPV subtype(s) would be worse than those of a singleplex PCR system that amplifies one particular HPV subtype sequence using only a single set of primers / probes. For this purpose, HPV L1 template DNA for each HPV subtype was used in either a series of singleplex PCRs (each containing two primers and one probe specific for a single HPV subtype L1 gene), or in a multiplex PCR (containing primers and probes for all 16 HPV subtypes, namely, PHV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66, HPV68, HPV6, and HPV11). As shown in FIGS. 4A-4B, except for HPV18, there was no significant difference in the amplification of the HPV L1 sequences in the multiplex PCR and in each of the singleplex PCRs (as demonstrated by HPV16, HPV33, and HPV6).

[0223] For each HPV subtype, the primers and probes disclosed herein are superior to other primers and probes. For example, the preferred primers and probes for HPV16 (SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 37) were compared to a set of primer and probe candidates provided by software (candidate forward primer SEQ ID NO: 46, TCCAGATTATATTAAAATGGTGTCAGAACC, candidate reverse primer SEQ ID NO: 47, GACCCAGAGCCTTTAATGTATAAATCG, and candidate probe SEQ ID NO: 48, 5’-CY5-ACATTTTCACCAACAGCACCAGCCCTATT3’-BHQ2). Using both the preferred set and the candidate set, a multiplex qPCR system for the detection of all 14 high-risk HPVs (PHV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66, HPV68) was prepared. In each multiplex qPCR system, the same amount of HPV16 template DNA was used. The results as shown in Figure 5 indicate that the preferred set of primers and probes for HPV16 provided better HPV16 amplification compared to the candidate set.

[0224] Example 2: High-Risk HPV Detection Kit As a non-limiting example, a typical kit may include the following components: (1) High-risk HPV qPCR mixture: 1X buffer (20 mM Tris-HCl, 50 mM KCl, pH 8.4), 0.15 - 0.3 mM dNTP, 2 - 4 mM MgCl2, 0.2 - 1.2 μM primer / probe (14 high-risk types), 0.1 - 1 mg / ml BSA, 0.2% - 2% (V / V) formamide, 0.2 mM - 2 mM spermidine, 10 mM - 30 mM tetramethylammonium chloride, 0.01 mM - 0.1 mM DTT, 0.2% - 2% 2-pyrrolidone, and H2O (2) Taq enzyme: 1 - 6 U / μl Taq enzyme (3) Positive control: High-risk HPV16, HPV18, and HPV45 L1 gene plasmids mixed with high-risk HPV DNA-negative urine (each plasmid is 10 3 copies / ml): (4) Negative control: High-risk HPV DNA-negative urine

[0225] Example 3: HPV detection kit for 14 high-risk subtypes and 2 low-risk subtypes As a non-limiting example, a typical kit for the detection of 14 high-risk subtypes and 2 low-risk subtypes may include the following parts: (1) HPV qPCR mixture I: 1× buffer (20 mM Tris-HCl, 50 mM KCl, pH 8.4), 0.2 - 0.3 mM dNTP, 2 - 3 mM MgCl2, 0.2 - 0.8 μM primer-probe (HPV16, HPV18, HPV35, HPV39, HPV68, HPV59, HPV56, HPV66, HPV51), 0.1 - 1 mg / ml BSA, 0.2% - 2% (V / V) formamide, 0.2 mM - 2 mM spermidine, 10 mM - 30 mM tetramethylammonium chloride, 0.01 mM - 0.1 mM DTT, 0.2% - 2% 2-pyrrolidone, and H2O; (2) HPV qPCR mixture II: 1× buffer (20 mM Tris-HCl, 50 mM KCl, pH 8.4), 0.2 - 0.3 mM dNTP, 2 - 3 mM MgCl2, 0.2 - 0.8 μM primer-probe (HPV6, HPV11, HPV33, HPV58, HPV31, HPV45, HPV52, β-actin), 0.1 - 1 mg / ml BSA, 0.2% - 2% (V / V) formamide, 0.2 mM - 2 mM spermidine, 10 mM - 30 mM tetramethylammonium chloride, 0.01 mM - 0.1 mM DTT, 0.2% - 2% 2-pyrrolidone, and H2O; (3) Taq enzyme: 1 - 6 U / μl Taq enzyme; (4) Positive control: High-risk HPV16, HPV18, and HPV45 L1 gene plasmids (each plasmid is, 10 3(per ml of copy), as well as high-risk HPV DNA-negative urine or its DNA; (5) Negative control: HPV DNA-negative urine or its DNA.

[0226] Example 4: Detection of high-risk HPV in clinical urine samples A total of 170 samples from a local hospital were used in a large-scale HPV detection clinical trial.

[0227] 1. Pretreatment of urine samples: 10 ml of each urine sample was added to a 50 ml centrifuge tube. 20 μl of hydroxyl magnetic beads was added to the sample and mixed by vortexing. The tube was centrifuged at 10,000 rpm for 5 minutes. Then, the supernatant was carefully discarded, and 500 μl of the pellet was placed into a new 1.5 ml centrifuge tube. 2.5 μl of proteinase K was mixed with the pellet. The tube was heated in a metal bath at 56 °C for 30 minutes.

[0228] 2. Distribution of extraction reagents: Lysis solution, washing buffer A, washing buffer B, and elution buffer were added to a 96-well deep-well extraction plate with volumes of 750 μl, 600 μl, 600 μl, and 50 μl, respectively.

[0229] Table 3 demonstrated a possible sample loading plan. Among them, for each of columns 8A - H, two samples can be held for DNA extraction. For a 96-well plate, DNA can be extracted from 16 samples.

Table 4

[0230] 750 μl of lysis solution and 250 μl of the above pretreated urine sample were mixed in each well of columns 1, 2, 7, and 8. 600 μl of washing solution A was added to each well of columns 3 and 9. 600 μl of washing buffer B was added to each well of columns 4 and 10. 50 μl of elution buffer was added to each well of columns 6 and 12.

[0231] 3. DNA extraction using an automated DNA extraction device: The above-mentioned 96-well-containing sample was placed in an automated DNA extraction device (Xi’An Tian Long, model NP968-S). Based on the manufacturing manual, the following program was used.

Table 5

[0232] 4. Preparation and packaging of a high-risk HPV qPCR reaction system: To generate a high-risk HPV multiplex qPCR reaction system, for each sample, 39 μl of “high-risk HPV qPCR reaction solution” and 1 μl of “Taq enzyme” were mixed and dispensed into 200 μl PCR tubes.

[0233] 5. Loading of the template: 10 μl of the DNA template extracted in step 3 above was added to the mentioned HPV qPCR reaction system in a 200 μl PCR tube using an 8-channel pipette. The PCR tube was centrifuged to prepare for PCR.

[0234] 6. Fluorescent quantitative PCR instrument amplification test: The PCR tubes containing the above-mentioned template and reaction solution were placed in a fluorescent quantitative PCR instrument for detection. The PCR instrument includes CY5, HEX, FAM, and ROX fluorescence channels, and the PCR program is set as follows.

Table 6

[0235] The detection results are provided in Table 5 below.

Table 7

[0236] Example 5: Comparison of high-risk HPV tests using urine samples and cervical exfoliated cell samples Both urine samples and cervical exfoliated cell samples were collected from 90 human subjects, generating 90 sample sets. Each of the sample sets included a urine sample and a cervical exfoliated cell sample collected from the same human subject. The samples in each set were subjected to the procedures as described in Example 4 for the purpose of detecting high-risk HPV subtypes in these samples. The results of the comparison are demonstrated in Table 6.

Table 8

[0237] The results indicate that by using the compositions and methods of the present disclosure, the company's test using urine samples achieved high sensitivity and specificity equivalent to the test using cervical exfoliated cell samples.

[0238] Therefore, the compositions and methods of the present disclosure for detecting HPV in urine samples provide a non-invasive, harmless, and painless method for facilitating and simplifying the HPV test compared to conventional methods involving cervical exfoliated cell samples from women or urethral swab samples from men.

[0239] Example 6: Evaluating the Effect of Urine HPV Test in Cervical Cancer Screening 1,381 subjects were selected from women diagnosed as HPV positive or negative in the previous year in Shanxi Province, China. Urine samples and cervical exfoliated cell samples were collected for each subject respectively. The urine samples were tested with the urine HPV detection reagent of the present invention, and the cervical exfoliated cells were tested with an HPV nucleic acid detection reagent (bohui-tech) by the microfluidic chip method. When the test result of the cervical exfoliated cells was positive, pathological confirmation was performed. Finally, using the pathological results as the gold standard, the effectiveness of the urine HPV nucleic acid detection technology and the microfluidized microchip HPV detection technology for cervical cancer screening was compared. The results are shown in Table 7 and Table 8.

Table 9

Table 10

[0240] From the above test results, it can be seen that the urine HPV detection technology in the present invention is used for cervical cancer screening, and its effect is basically the same as that of the microfluidic chip HPV detection technology.

Claims

1. A combination of primers and probes for detecting and / or discriminating genotypes of human papillomavirus (HPV), wherein the combination of the primers and probes comprises (1) a forward primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 1, a reverse primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 2, and a probe comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 37; (2) a forward primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 3, a reverse primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 4, and a probe comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 38; (3) a forward primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 5, a reverse primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 6, and a probe comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 39; (4) a forward primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 7, a reverse primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 8, and a probe comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 39; A forward primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 9, a reverse primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 10, and a probe comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 39 A forward primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 11, a reverse primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 12, and a probe comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 40 A forward primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 13, a reverse primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 14, and a probe comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 41 A forward primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 15, a reverse primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 16, and a probe comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 42 A forward primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 17, a reverse primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 18, and a probe comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 42 A forward primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 19, a reverse primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 20, and a probe comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 41 A forward primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 21, a reverse primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 22, and a probe comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 39 A forward primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 23, a reverse primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 24, and a probe comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 40 A forward primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 25, a reverse primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 26, and a probe comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 41 A forward primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 27, a reverse primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 28, and a probe comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity to the sequence of SEQ ID NO: 40 A forward primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity with the sequence of SEQ ID NO: 29, a reverse primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity with the sequence of SEQ ID NO: 30, and a probe comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity with the sequence of SEQ ID NO: 40 A forward primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity with the sequence of SEQ ID NO: 33, a reverse primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity with the sequence of SEQ ID NO: 34, and a probe comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity with the sequence of SEQ ID NO: 44 One or more groups of primers and probes selected from the group consisting of a forward primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity with the sequence of SEQ ID NO: 35, a reverse primer comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity with the sequence of SEQ ID NO: 36, and a probe comprising a polynucleotide sequence having at least 85%, 90%, 95%, or 100% identity with the sequence of SEQ ID NO: 45, and any combination thereof, comprising the combination of the primer and the probe

2. The combination of the primer and the probe according to claim 1, wherein the combination of the primer and the probe comprises the primers and the probes of (1) and (2).

3. The combination of the primer and the probe according to claim 1, wherein the combination of the primer and the probe comprises the primers and the probes of (3), (4), (5), and (11).

4. The combination of the primer and the probe according to claim 1, wherein the combination of the primer and the probe comprises the primers and the probes of (6), (12), (14), and (15).

5. The combination of the primer and the probe according to claim 1, wherein the combination of the primer and the probe includes the primers and the probes of (7), (10), and (13).

6. The combination of the primer and the probe according to claim 1, wherein the combination of the primer and the probe includes the primers and the probes of (8) and (9).

7. The combination of the primer and the probe according to claim 1, wherein the combination of the primer and the probe includes at least one group of the primers and the probes of (1) and (2), and at least one group of the primers and the probes of (3), (4), (5), and (11).

8. The combination of the primer and the probe according to claim 1, wherein the combination of the primer and the probe includes at least one group of the primers and the probes of (1) and (2), and at least one group of the primers and the probes of (6), (12), (14), and (15).

9. The combination of the primer and the probe according to claim 1, wherein the combination of the primer and the probe includes at least one group of the primers and the probes of (1) and (2), and at least one group of the primers and the probes of (7), (10), and (13).

10. The combination of the primer and the probe according to claim 1, wherein the combination of the primer and the probe includes at least one group of the primers and the probes of (1) and (2), and at least one group of the primers and the probes of (8) and (9).

11. The combination of the primer and the probe according to claim 1, wherein the combination of the primer and the probe includes at least one group of the primers and the probes of (1) and (2), at least one group of the primers and the probes of (3), (4), (5), and (11), and at least one group of the primers and the probes of (6), (12), (14), and (15).

12. The combination of the primer and the probe according to claim 1, wherein the combination of the primer and the probe includes at least one group of the primers and probes of (1) and (2), at least one group of the primers and probes of (3), (4), (5), and (11), and at least one group of the primers and probes of (7), (10), and (13).

13. The combination of the primer and the probe according to claim 1, wherein the combination of the primer and the probe includes at least one group of the primers and probes of (1) and (2), at least one group of the primers and probes of (3), (4), (5), and (11), and at least one group of the primers and probes of (8) and (9).

14. The combination of the primer and the probe according to claim 1, wherein the combination of the primer and the probe includes at least one group of the primers and probes of (1) and (2), at least one group of the primers and probes of (6), (12), (14), and (15), and at least one group of the primers and probes of (7), (10), and (13).

15. The combination of the primer and the probe according to claim 1, wherein the combination of the primer and the probe includes at least one group of the primers and probes of (1) and (2), at least one group of the primers and probes of (6), (12), (14), and (15), and at least one group of the primers and probes of (8) and (9).

16. The combination of the primer and the probe according to claim 1, wherein the combination of the primer and the probe includes at least one group of the primers and probes of (1) and (2), at least one group of the primers and probes of (7), (10), and (13), and at least one group of the primers and probes of (8) and (9).

17. The combination of the primer and the probe according to claim 1, wherein the combination of the primer and the probe includes at least one group of the primers and probes of (1) and (2), at least one group of the primers and probes of (3), (4), (5), and (11), at least one group of the primers and probes of (6), (12), (14), and (15), and at least one group of the primers and probes of (7), (10), and (13).

18. The combination of the primer and the probe according to claim 1, wherein the combination of the primer and the probe includes at least one group of the primers and probes of (1) and (2), at least one group of the primers and probes of (3), (4), (5), and (11), at least one group of the primers and probes of (6), (12), (14), and (15), and at least one group of the primers and probes of (8) and (9).

19. The combination of the primer and the probe according to claim 1, wherein the combination of the primer and the probe includes at least one group of the primers and probes of (1) and (2), at least one group of the primers and probes of (3), (4), (5), and (11), at least one group of the primers and probes of (7), (10), and (13), and at least one group of the primers and probes of (8) and (9).

20. The combination of the primer and the probe according to claim 1, wherein the combination of the primer and the probe includes at least one group of the primers and probes of (1) and (2), at least one group of the primers and probes of (6), (12), (14), and (15), at least one group of the primers and probes of (7), (10), and (13), and at least one group of the primers and probes of (8) and (9).

21. The combination of the primer and the probe according to any one of claims 2 to 20, wherein the combination of the primer and the probe further includes the group of the primers and probes of (16) and / or (17).

22. The combination of the primer and the probe according to claim 1, wherein the combination of the primer and the probe consists of the group of primers and probes of (1) to (15).

23. The combination of the primer and the probe according to claim 1, wherein the combination of the primer and the probe consists of the group of primers and probes of (1) to (17).

24. The combination of the primer and the probe according to any one of claims 1 to 23, wherein the combination of the primer and the probe further includes a group of primers and probes for a reference control gene.

25. The combination of the primer and the probe according to claim 24, wherein the reference control gene is β-actin (ACTB), the primers for the ACTB gene are SEQ ID NOs: 31 and 32, and the probe for the ACTB gene is SEQ ID NO:

43.

26. The combination of the primer and the probe according to any one of claims 1 to 25, wherein each probe has a fluorescent dye bound to its 5'-end.

27. The combination of the primer and the probe according to claim 26, wherein the fluorescent dye is selected from the group consisting of FAM (fluorescein), TET, JOE, VIC, HEX, ROX, TAMRA, Cy3, cy3.5, Cy5, Cy5.5, OregonGreen (trademark), CALRed (trademark), Red640, Texas Red, LightCycler (registered trademark) Cyan500, LightCycler (registered trademark), Red610, biotin-binding material, Alexa 647, Alexa 555, 5-(2-aminoethyl)amino-1-naphthalenesulfonic acid (EDANS), tetramethylrhodamine (TMR), tetramethylrhodamine isocyanate (TMITC), fluorescein isocyanate (FITC), and χ-rhodamine.

28. The combination of the primer and the probe according to claim 26, wherein the fluorescent dyes on the probes of (3), (4), (5), and (11) are the same dye, or different dyes having substantially the same or different emission wavelengths.

29. The combination of primer and probe according to claim 26, wherein the fluorescent dyes on the probes of (6), (12), (14), and (15) are the same dye, or different dyes having substantially the same or different emission wavelengths.

30. The combination of primer and probe according to claim 26, wherein the fluorescent dyes on the probes of (7), (10), and (13) are the same dye, or different dyes having substantially the same or different emission wavelengths.

31. The combination of primer and probe according to claim 26, wherein the fluorescent dyes on the probes of (8) and (9) are the same dye, or different dyes having substantially the same or different emission wavelengths.

32. Each probe has a fluorescent dye attached to its 5'-end, (i) the probe of (1) has a first dye, (ii) the probe of (2) has a second dye, (iii) the probes of (3), (4), (5), and (11) have a third dye, (iv) the probes of (6), (12), (14), and (15) have a fourth dye, (v) the probes of (7), (10), and (13) have a fifth dye, (vi) the probes of (8) and (9) have a sixth dye, The combination of primer and probe according to claim 22, wherein the dyes of (iii) to (vi) are the same dye, but different from the dyes of (i) and (ii).

33. Each probe has a fluorescent dye attached to its 5'-end, (i) the probe of (1) has a first dye, (ii) the probe of (2) has a second dye, (iii) the probes of (3), (4), (5), and (11) have a third dye, (iv) the probes of (6), (12), (14), and (15) have a fourth dye, (v) the probes of (7), (10), and (13) have a fifth dye, (vi) the probes of (8) and (9) have a sixth dye, (vii) the probe of (16) has a seventh dye, (viii) the probe of (17) has an eighth dye, The combination of primer and probe according to claim 23, wherein the dyes of (iii) to (vi) are the same dye, but different from the dyes of (i), (ii), (vii), and (viii).

34. The combination of the primer and the probe further includes a group of primers and probes for a reference control gene, the probe for the reference control gene also has a fluorescent dye bound to its 5'-end, and the fluorescent dye for the control gene is different from other dyes in the combination. The combination of the primer and the probe according to claims 32 and 33.

35. The combination of the primer and the probe according to any one of claims 1 to 23, wherein each probe has a fluorescence quencher bound to its 3'-end.

36. The combination of the primer and the probe according to claim 35, wherein the fluorescence quencher is selected from the group consisting of DDQ-I, DDQ-II, Dabcy1, Eclipse, Iowa Black FQ, Iowa Black RQ, BHQ-1, BHQ-2, BHQ-3, QSY-7, QSY-9, and QSY-21.

37. The probe of (1) includes a Cy5 fluorescent dye bound to its 5'-end and a BHQ-2 fluorescence quencher bound to its 3'-end. The probe of (2) includes a FAM fluorescent dye bound to its 5'-end and a BHQ-1 fluorescence quencher bound to its 3'-end. The probes of (3) to (15) include a VIC fluorescent dye bound to their 5'-ends and an MGBNFQ fluorescence quencher bound to their 3'-ends. The combination of the primer and the probe according to claim 36, wherein the probes of (16) and (17) include a FAM fluorescent dye bound to their 5'-ends and a BHQ-1 fluorescence quencher bound to their 3'-ends.

38. The probe of (1) includes a Cy5 fluorescent dye bound to its 5'-end and a BHQ-2 fluorescence quencher bound to its 3'-end. The probe of (2) includes a FAM fluorescent dye bound to its 5'-end and a BHQ-1 fluorescence quencher bound to its 3'-end. The probes of (3) to (15) include a VIC fluorescent dye bound to their 5'-ends and an MGBNFQ fluorescence quencher bound to their 3'-ends. The probes of (16) and (17) include a FAM fluorescent dye bound to their 5'-ends and a BHQ-1 fluorescence quencher bound to their 3'-ends. The combination of primer and probe according to claim 35, wherein the probe for the reference control gene comprises an ROX fluorescent dye bound to its 5'-end and a BHQ-2 fluorescence quencher bound to its 3'-end.

39. A composition comprising the combination of primer and probe according to any one of claims 1 to 38.

40. A DNA chip for testing an HPV genotype comprising one or more polynucleotides selected from SEQ ID NOs: 1 to 45.

41. A kit for detecting and / or discriminating the genotype of human papillomavirus (HPV) in a biological sample, comprising the combination of primer and probe according to any one of claims 1 to 38.

42. The kit according to claim 41, wherein the biological sample is collected from a human subject.

43. The kit according to claim 42, wherein the biological sample comprises urine of the human subject.

44. The kit according to claim 41, wherein the kit further comprises a reagent for isolating DNA from the biological sample and / or further comprises a negative and / or positive control DNA template.

45. The kit according to claim 44, wherein the reagent for isolating DNA from the biological sample comprises a lysis solution, magnetic nanoparticles, protease, a first washing buffer, a second washing buffer, an elution buffer, or any combination thereof.

46. The kit according to claim 45, wherein the lysis solution comprises guanidinium isothiocyanate, Triton X 100, Tris-HCl, EDTA, and isopropanol.

47. The kit according to claim 46, wherein the guanidinium isothiocyanate has a concentration of about 1 to 2 M.

48. The kit according to claim 46, wherein the Triton X 100 has a concentration of about 1 to 2%.

49. The kit according to claim 46, wherein the Tris-HCl has a concentration of about 5 to 10 mM and the lysis solution has a pH of about 6 to 7.

50. The kit according to claim 46, wherein the EDTA has a concentration of about 3 to 5 mM.

51. The kit according to claim 46, wherein the isopropanol has a volume of about 50% to 80% (v / v) of the lysis solution.

52. The magnetic nanoparticles have an inner core layer and an outer shell layer, the inner core layer is composed of core-shell type magnetic nanoparticles, and the outer shell layer is composed of SiO ２ The kit according to claim 45, which is composed of.

53. The kit according to claim 51, wherein the magnetic nanoparticles have a diameter of about 100 to 1000 nm and a concentration of about 50 mg / ml.

54. The kit according to claim 45, wherein the first washing buffer contains guanidinium isothiocyanate, Tris-HCl, NaCl, and ethanol.

55. The kit according to claim 54, wherein the guanidinium isothiocyanate has a concentration of about 50 mM.

56. The kit according to claim 54, wherein the Tris-HCl has a concentration of about 20 to 50 mM.

57. The kit according to claim 46, wherein the first washing buffer has a pH of about 5.

0.

58. The kit according to claim 54, wherein the NaCl has a concentration of about 50 to 200 mM.

59. The kit according to claim 54, wherein the ethanol has a concentration of about 40% to 60% (v / v).

60. The kit according to claim 45, wherein the second washing buffer contains Tris-HCl and ethanol.

61. The kit according to claim 60, wherein the Tris-HCl in the second washing buffer has a concentration of about 10 to 50 mM and the second washing buffer has a pH of about 6.

0.

62. The kit according to claim 60, wherein the ethanol has a concentration of about 70% to 80% (v / v).

63. The kit according to claim 45, wherein the elution buffer is a Tris-EDTA buffer having a pH of about 8.

0.

64. The kit according to claim 45, wherein the protease is protease K.

65. The kit according to claim 64, wherein the protease K has a concentration of about 10 to 20 mg / ml.

66. A method for detecting and / or discriminating the genotype of human papillomavirus (HPV) in a biological sample obtained from a subject in need thereof, comprising: (a) obtaining DNA from the biological sample; (b) amplifying the DNA by fluorescent PCR using a combination of primers and probes according to any one of claims 1 to 38; and (c) determining the presence or absence of DNA of one or more HPV subtypes in the biological sample based on the results of the fluorescent PCR.

67. A method for detecting and / or discriminating said genotypes of human papillomavirus (HPV) in a biological sample obtained from a subject in need thereof, comprising: (a) obtaining DNA from said biological sample; and (b) amplifying said DNA by fluorescent PCR using the kit according to claim 31; and (c) determining the presence or absence of DNA of one or more HPV subtypes in said biological sample based on the results of said fluorescent PCR.

68. A method for detecting and / or discriminating said genotypes of human papillomavirus (HPV) in a biological sample obtained from a subject in need thereof, comprising: (a) extracting DNA from said biological sample and amplifying said DNA by fluorescent PCR using the kit according to any one of claims 42 to 63; and (b) determining the presence or absence of DNA of one or more HPV subtypes in said biological sample based on the results of said fluorescent PCR.

69. The method according to any one of claims 66 to 68, wherein the method comprises detecting and / or discriminating the presence or absence of DNA of at least 7 HPV subtypes in said biological sample.

70. The method according to any one of claims 66 to 68, wherein the method comprises detecting and / or discriminating the presence or absence of DNA of 14 high-risk HPV subtypes in said biological sample through a single test tube, and the high-risk HPV subtypes are HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66, and HPV68.

71. The method according to any one of claims 66 to 68, wherein the method comprises detecting and / or discriminating the presence or absence of DNA of 14 high-risk HPV subtypes and at least one low-risk HPV subtype in said biological sample through a single test tube, the high-risk HPV subtypes are HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66, and HPV68, and the at least one low-risk HPV subtype is HPV6 or HPV11.

72. The method according to claim 70, wherein the biological sample is a smear of the cervix, a fresh tissue sample, a fixed tissue sample, a cross-sectional specimen of a tissue sample, a urine sample, a sample containing exfoliated cells, a peripheral blood sample, a penile swab, or other body fluid.

73. The method according to claim 72, wherein the sample is a urine sample.

74. Use of a combination of primers and probes according to any one of claims 1 to 38 for detecting and / or discriminating said genotypes of human papillomavirus (HPV).

75. A method for treating a condition associated with human papillomavirus (HPV) in a subject in need thereof, comprising: (1) detecting and / or discriminating said genotypes of human papillomavirus (HPV) in a biological sample obtained from a subject in need thereof, (a) amplifying DNA extracted from said biological sample by fluorescence PCR using a combination of primers and probes according to any one of claims 1 to 38; and (b) determining the presence or absence of DNA of one or more HPV subtypes in said biological sample based on the results of said fluorescence PCR, (2) treating said subject using a pharmaceutical composition and / or a medical procedure according to the results of step (1).

76. The method according to claim 75, wherein the condition is a pre-cancerous lesion caused by HPV.

77. The method according to claim 75, wherein the pharmaceutical composition comprises an antiviral agent.

78. A method for vaccinating a human subject in need thereof, comprising: (1) detecting and / or discriminating said genotypes of human papillomavirus (HPV) in a biological sample obtained from said human subject in need thereof before and / or after said human subject is vaccinated, (a) amplifying DNA extracted from said biological sample by fluorescence PCR using a combination of primers and probes according to any one of claims 1 to 38; and (b) determining the presence or absence of DNA of one or more HPV subtypes in said biological sample based on the results of said fluorescence PCR, (2) vaccinating the subject with a composition targeting the selected HPV based on the result of step (1), wherein the method comprises the above steps.

79. A method for evaluating the effectiveness of vaccination in a human subject in need thereof, comprising: (1) detecting and / or identifying the genotype of human papillomavirus (HPV) in a biological sample obtained from the human subject in need thereof, after or around the time the human subject is vaccinated; (a) amplifying DNA extracted from the biological sample by fluorescence PCR using a combination of primers and probes according to any one of claims 1 to 38 after or around the time the human subject is vaccinated; (b) determining the presence or absence of DNA of one or more HPV subtypes in the biological sample based on the result of the fluorescence PCR, wherein the above steps are included. (2) vaccinating the subject with a composition targeting the selected HPV; (3) determining the effectiveness of vaccination based on the result of step (1), wherein the method comprises the above steps.

80. The kit according to claim 41, further comprising a reagent for testing the DNA amplification of 14 high-risk types of HPV. The HPV qPCR mixture further comprises the primer and probe compositions, PCR buffer, dNTP, MgCl ２ , PCR additives, and deionized water, the kit according to claim 81.

81. The kit according to claim 80, which is used in a 14 high-risk HPV DNA amplification test and further comprises an HPV qPCR mixture, Taq enzyme, positive control, and negative control.

82.

83. The kit according to claim 82, wherein the primer and the probe composition have a primer and probe concentration of 0.1 to 1.2 M, and the primer and probe combination includes all primer and probe combinations of (1) to (15), as well as reference control gene primers and probes (SEQ ID NOs: 31, 32, and 43).

84. The kit according to claim 82, wherein the PCR buffer contains 10 to 30 mM Tris-HCl buffer and 30 to 70 mM KCl, the preferred Tris-HCl buffer concentration is 20.5 mM, and the preferred KCl concentration is about 51 mM. MgCl ２ has a concentration of 1.5 mM to 4 mM, and the preferred concentration of MgCl ２ is about 3.0 mM, the kit according to claim 82.

85. The kit according to claim 82, wherein the dNTP concentration is 0.15 mM to 0.3 mM, and the preferred dNTP concentration is about 0.25 mM.

86.

87. The PCR additive contains about 0.1 to 1 mg / ml of BSA, 0.2% to 2% (v / v) formamide, 0.2 mM to 2 mM spermidine, 10 mM to 30 mM tetramethylammonium chloride, 0.01 mM to 0.1 mM DTT, 0.2% to 2% 2-pyrrolidone, and preferably, the PCR additive contains about 0.64 mg / ml of BSA, about 1% (v / v) formamide, about 1 mM spermidine, about 21 mM tetramethylammonium chloride, about 0.064 mM DTT, about 1% (v / v) 2-pyrrolidone. The kit according to claim 82.

88. The Taq enzyme concentration is 1 to 6 U / μl, and the preferred Taq enzyme is Platinum Taq DNA polymerase having a concentration of 4 U / μl. The kit according to claim 81.

89. The negative control is the urine of an adult having high-risk HPV DNA negativity or its DNA, diluted 1 to 1000 times, and the optimal dilution is about 100 times. The kit according to claim 81.

90. The positive control uses the negative control as a diluent and contains a plasmid having a final concentration of 10 to 10 ５ copies / μl of a high-risk HPV L1 gene, wherein the high-risk HPV L1 genotype can be one or more of the 14 high-risk HPV types described in the present invention. The kit according to claim 81. Preferably, the positive control contains L1 plasmids of HPV16, HPV18, and hpv45, and their final concentrations are 10 ３ copies / μL.

91. A kit for detecting and / or recognizing human papillomavirus (HPV) genotypes in a biological sample, and for guiding and evaluating the effectiveness of an HPV vaccine.

92. The kit according to claim 91, further comprising reagents for amplifying and detecting the DNA of 16 types of HPV.

93. The reagents for amplifying and detecting 16 types of HPV DNA further comprise HPV qPCR mixture I, HPV qPCR mixture II, Taq enzyme, a positive control, and a negative control. The kit according to claim 92.

94. The HPV qPCR mixture I further comprises the primer and probe compositions, PCR buffer, dNTP, MgCl ２ , PCR additives, and deionized water according to claim 93, of the kit according to claim 23 and 24.

95. The primer and probe concentrations in the primer and probe composition are 0.1 to 1.2 μM, and the primer and probe combinations include all of the primer and probe combinations of (1), (2), (5), (6), (8), (10), (12), (13), (14), (15), and internal gene primers and probes (SEQ ID NOs: 31, 32, and 43). The kit according to claim 94.

96. The PCR buffer contains 10 to 30 mM Tris-HCl buffer and 30 to 70 mM KCl. The preferred Tris-HCl buffer concentration is 20.5 mM, and the preferred KCl concentration is about 51 mM. The kit according to claim 94.

97. The kit according to claim 94, wherein the dNTP concentration is 0.15 mM to 0.3 mM, and the preferred dNTP concentration is about 0.25 mM.

98. MgCl ２ has a concentration of 1.5 mM to 4 mM, and the preferred concentration of MgCl ２ is about 3.0 mM, the kit according to claim 94.

99. The kit according to claim 94, wherein the PCR additive contains about 0.1 to 1 mg / ml of BSA, 0.2% to 2% (V / V) of formamide, 0.2 mM to 2 mM of spermidine, 10 mM to 30 mM of tetramethylammonium chloride, 0.01 mM to 0.1 mM of DTT, and 0.2% to 2% of 2-pyrrolidone. Preferably, the PCR additive contains about 0.64 mg / ml of BSA, about 1% (V / V) of formamide, about 1 mM of spermidine, about 21 mM of tetramethylammonium chloride, about 0.064 mM of DTT, and about 1% (V / V) of 2-pyrrolidone.

100. The HPV qPCR mixture II further comprises the primer and probe compositions, PCR buffer, dNTP, MgCl ２ as claimed in claim 93, PCR additives, and deionized water, and the kit according to claim 93.

101. The kit according to claim 100, wherein the primer-probe concentration in the primer-probe composition is 0.1 to 1.2 μm, and the primer and probe combination includes all of the primer-probe combinations of (3), (4), (7), (9), (11), (16), (17), as well as the reference control gene primers and probes (SEQ ID NOs: 31, 32, and 43).

102. The kit according to claim 100, wherein the PCR buffer contains 10 to 30 mM of Tris-HCl buffer and 30 to 70 mM of KCl. The preferred Tris-HCl buffer concentration is 20.5 mM, and the preferred KCl concentration is about 51 mM.

103. The kit according to claim 100, wherein the dNTP concentration is 0.15 mM to 0.3 mM, and the preferred dNTP concentration is about 0.25 mM.

104. MgCl ２ has a concentration of 1.5 mM to 4 mM, and the preferred concentration of MgCl ２ is about 3.0 mM, the kit according to claim 100.

105. The kit according to claim 100, wherein the PCR additive contains about 0.1 to 1 mg / ml of BSA, 0.2% to 2% (V / V) of formamide, 0.2 mM to 2 mM of spermidine, 10 mM to 30 mM of tetramethylammonium chloride, 0.01 mM to 0.1 mM of DTT, and 0.2% to 2% of 2-pyrrolidone. Preferably, the PCR additive contains about 0.64 mg / ml of BSA, about 1% (V / V) of formamide, about 1 mM of spermidine, about 21 mM of tetramethylammonium chloride, about 0.064 mM of DTT, and about 1% (V / V) of 2-pyrrolidone.

106. A primer comprising an oligonucleotide sequence having at least 85%, 90%, 95%, or 100% identity to any one of SEQ ID NOs: 1 to 36, and having less than 100, 90, 80, 70, 60, 50, 40, 30, or 20 nucleotides, said primer.

107. A pair of primers comprising a forward primer and a reverse primer, each having at least 85%, 90%, 95%, or 100% identity to any one of SEQ ID NOs: 1 to 36, each having less than 100, 90, 80, 70, 60, 50, 40, 30, or 20 nucleotides, and said forward primer and said reverse primer being selected from the group consisting of SEQ ID NOs: 1 to 2, 3 to 4, 5 to 6, 7 to 8, 9 to 10, 11 to 12, 13 to 14, 15 to 16, 17 to 18, 19 to 20, 21 to 22, 23 to 24, 25 to 26, 27 to 28, 29 to 30, 31 to 32, 33 to 34, 35 to 36, and any combination thereof, said pair of primers.

108. A probe comprising a fluorescent dye and an oligonucleotide, said oligonucleotide comprising a sequence having at least 85%, 90%, 95%, or 100% identity to any one of SEQ ID NOs: 37 to 45, and said oligonucleotide having less than 100, 90, 80, 70, 60, 50, 40, 30, or 20 nucleotides, said probe.

109. The probe according to claim 108, wherein said fluorescent dye is bound to the 5' end of said probe.

110. The probe according to claim 108 or 109, wherein said fluorescent dye is selected from the group consisting of FAM (fluorescein), TET, JOE, VIC, HEX, ROX, TAMRA, Cy3, cy3.5, Cy5, Cy5.5, OregonGreen (trademark), CALRed (trademark), Red640, Texas Red, LightCycler (registered trademark) Cyan500, LightCycler (registered trademark), Red610, biotin-binding material, Alexa 647, Alexa 555, 5-(2-aminoethyl)amino-1-naphthalenesulfonic acid (EDANS), tetramethylrhodamine (TMR), tetramethylrhodamine isocyanate (TMITC), fluorescein isocyanate (FITC), and χ-rhodamine.

111. The probe according to any one of claims 108 to 110, further comprising a fluorescence quencher.

112. The probe according to claim 111, wherein the fluorescence quencher binds to the 3'-end of the probe.

113. The probe according to claim 111 or 112, wherein the fluorescence quencher is selected from the group consisting of DDQ-I, DDQ-II, Dabcyl, Eclipse, Iowa Black FQ, Iowa Black RQ, BHQ-1, BHQ-2, BHQ-3, QSY-7, QSY-9, and QSY-21.

114. A kit for detecting and / or discriminating the genotype of human papillomavirus (HPV) in a biological sample, the kit comprising one or more primers according to claim 106 or 107 and one or more probes according to any one of claims 108 to 113.

115. The kit according to claim 114, comprising at least 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, or 36 primers selected from claims 106 or 107.

116. The kit according to claim 114 or 115, comprising at least 2, 3, 4, 5, 6, 7, 8, or 9 probes selected from any one of claims 108 to 113.

117. The kit according to any one of claims 114 to 116, further comprising a lysis solution, magnetic nanoparticles, protease, a first washing buffer, a second washing buffer, an elution buffer, or any combination thereof.

118. A method for detecting and / or discriminating the genotype of human papillomavirus (HPV) in a urine sample obtained from a subject in need thereof, the method comprising: (a) obtaining DNA from the urine sample; (b) amplifying the DNA by fluorescence PCR using one or more primers according to claim 106 or 107 and one or more probes according to any one of claims 108 to 113; and (c) determining the presence or absence of DNA of one or more HPV subtypes in the biological sample based on the results of the fluorescence PCR.

Images