Method for treatment of disease using pigment epithelium-derived factor (PEDF)

Abstract

To provide a pharmaceutical composition for the treatment of exudative age-related macular degeneration.SOLUTION: A pharmaceutical composition for the treatment and / or prevention of a disease in a subject is provided, the pharmaceutical composition comprising pigment epithelium-derived factor (PEDF), wherein the disease is exudative age-related macular degeneration, the subject has or is at risk of having geographic atrophy, and the subject is receiving anti-VEGF therapy concurrently, subsequently, or previously.SELECTED DRAWING: None

Description

Technical Field

[0001] The present invention relates to pigment epithelium-derived factor (PEDF) for use in a method for treating and / or preventing a disease, mRNA encoding pigment epithelium-derived factor (PEDF) for use in a method for treating and / or preventing a disease, a method for screening for PEDF analogs, and a method for screening for anti-VEGF agents. for use in a method for treating and / or preventing a disease, pigment epithelium-derived factor (PEDF), a method for screening for PEDF analogs, and a method for screening for anti-VEGF agents.

Background Art

[0002] Age-related macular degeneration (AMD) is the most common cause of legal blindness in Western countries. Atrophy of the retinal pigment epithelium under the macula and the occurrence of choroidal neovascularization (CNV) secondarily result in a decrease in central vision. Early signs of AMD are deposits (drusen) between the retinal pigment epithelium and Bruch's membrane. There are two forms of AMD: exudative and atrophic. During the disease of exudative AMD, there is sprouting of choroidal blood vessels into the subretinal space of the macula. These new blood vessels often generate abnormal blood vessels, become leaky, and cause subretinal edema. These edemas cause a decrease in the central visual field and reading ability. The early signs of AMD are deposits (drusen) between the retinal pigment epithelium and Bruch's membrane. There are two forms of AMD (exudative and atrophic).

[0003] During the disease of exudative AMD, there is sprouting of choroidal blood vessels into the subretinal space of the macula. These new blood vessels often generate abnormal blood vessels, become leaky, and cause subretinal edema. These edemas cause a decrease in the central visual field and reading ability.

[0004] In patients with atrophic AMD, the primary effect is the disappearance of the choroidal capillary lamina (Biesemeier, Taubitz et al. 2014). Subsequently, the retinal pigment epithelium (RPE) and photoreceptor cells degenerate, causing geographic atrophy (GA). For atrophic AMD, there are currently no available treatments to prevent the disappearance of the choroidal capillary lamina. In patients with atrophic AMD, the primary effect is the disappearance of the choroidal capillary lamina (Biesemeier, Taubitz et al. 2014). Subsequently, the retinal pigment epithelium (RPE) and photoreceptor cells degenerate, causing geographic atrophy (GA). For atrophic AMD, there are currently no available treatments to prevent the disappearance of the choroidal capillary lamina.

[0005] ​Patients with subfoveal CNV have generally been treated with drugs that reduce or block vascular endothelial growth factor (VEGF). Since 2004, anti-VEGF therapy has become the standard of care for exudative AMD, revolutionizing the management of this disease. Between 2004 and 2006, three anti-VEGF drugs received regulatory approval for the treatment of AMD (pegaptanib, ranibizumab), or were introduced into ophthalmology after off-label use (bevacizumab) (Browning, Kaiser et al. 2012). These exhibit important differences in terms of their active site, method of formulation, binding affinity, and biological activity (Julien, Biesemeier et al. 2014). Pegaptanib (Macugen) is an oligonucleotide aptamer that selectively binds to and neutralizes VEGF-A165 by binding to the heparin-binding domain of the major pathogenic isoform of VEGF (VEGF-A165). Ranibizumab (Lucentis, Genentech / Novartis) is an affinity-matured humanized monoclonal antibody fragment (Fab), and bevacizumab (Avastin, Genentech / Roche) is a full- length humanized monoclonal antibody. Both function by blocking the receptor-binding domains of all isoforms of VEGF-A (Ferrara, Damico et al. 2006). Aflibercept (VEGF Trap-Eye, Eylea, Regeneron / Bayer) is an anti-VEGF agent recently approved by the US Food and Drug Administration. It is a fully human recombinant fusion protein.

[0006] Aflibercept binds to all VEGF-A isoforms, VEGF-B, and Pl GF (Papadopoulos, Martin et al. 2012). The effects of intravitreal injection of bevacizumab in monkeys have been widely described (Peters, Heiduschka et al. 2007, Julien , Biesemeier et al. 2013, Schraermeyer and Julien 2013). Its effects include a decrease in the fenestrated structure of the choroid capillary lamina, photoreceptor damage, formation of immune complexes, and thrombotic microangiopathy included. Strong theoretical basis for thrombosis after bevacizumab treatment was presented by Meyer and co-workers (Meyer, Robles-Carrillo et al. 2009). They found that bevacizumab may induce platelet aggregation, degranulation, and thrombosis through complex formation with VEGF, i.e., heparin, and activation of platelet Fc gamma RIIa receptor (Meyer, Robles-Carrillo et al. 2009). Furthermore, other results demonstrated effective binding of the Fc domain of bevacizumab to Fc receptors or membrane-bound VEGF on human RPE and human umbilical vein endothelial cell membranes, activating the complement cascade and causing cell death (Meyer and Holz 2011). Since aflibercept also contains the Fc domain of human IgG1, it is unclear whether similar problems exist in aflibercept . Furthermore, the IgG1 isotype is known to be very effective in activating the complement system via the classical pathway (Daha, Band a et al. 2011). In fact, the Fc portion of IgG1 causes subsequent activation of the classical pathway (Daha, Band a et al. 2011). In fact, the Fc portion of IgG1 causes subsequent activation of the classical pathway It has a high ability to bind to C1q (Daha, Banda et al. 2011). In contrast, ranibizumab does not possess an Fc domain to avoid complement cascade activation, yet nevertheless, it also induces hemolysis and fibrin formation in non-clinical studies (Julien, Biesemeier et al. 2014). et al. 2014).

[0007] VEGF inhibition can activate platelets in humans treated for cancer (Meyer, Robles-Carrillo et al. 2009) or neovascular AMD (Schraermeyer and Julien 2013). In addition, VEGF drugs after intravitreal application induced thrombotic microangiopathy in the choroidal capillary plexus of monkeys (Peters, Heiduschka et al. 2007, Schraermey er and Julien 2012). Anti-VEGF drugs also induce hemolysis, stasis, and fibrin formation in the choroidal capillary plexus (Schraermeyer and Julien 2012, Schraermeyer and Julien 20 13, Julien, Biesemeier et al. 2014). Avastin forms together with heparin-VEGF protein complexes to induce thrombotic events (Julien, Biesemeier et al. 2013). In the blood vessels of the choroid surgically resected from patients with exudative AMD, anti-V EGF (bevacizumab) treatment induced thrombosis and protein complex formation (Schraerm eyer, Julien et al. 2015). In the blood vessels of the choroid surgically resected from patients with exudative AMD, anti-V EGF (bevacizumab) treatment induced thrombosis and protein complex formation (Schraerm eyer, Julien et al. 2015).

[0008] AMD patients are at a higher risk of suffering from stroke or other vascular-related diseases due to age Therefore, these side effects are inconvenient. Thus, in individuals with exudative AMD treated with bevacizumab, an increased long-term mortality was reported compared to the same age and sex group without exudative AMD (Hanhart, Comaneshter et al. 2017). In particular, after myocardial infarction (Hanhart, Comaneshter et al. 2018) and after cerebrovascular events (Hanhart, Comaneshter et al. 2018), the mortality caused by anti-VEGF treatment increases significantly. Furthermore, long-term treatment with anti-VEGF drugs causes the disappearance of the original choroidal capillary lamina and geographic atrophy in the peripheral part of the retina of patients with exudative AMD (Schutze, W edl et al. 2015). Therefore, this treatment induces further visual acuity decline that might not have occurred without this treatment. In recent years, for the new possibility of using optical coherence tomography angiography (OCTA) (Treister, Ne sper et al. 2018) to overcome the drawbacks of previous fluorescein angiography that detects CNV only after leakage has already occurred, a significant prevalence of latent CNV in the fellow eye of unilateral exudative CNV, and significantly larger choroidal capillary lamina non-perfusion adjacent to all CNV lesions have been detected. Treister et al. (Treister et al. 2018) identified an increased tendency of choroidal capillary lamina non-perfusion in the fellow eye of the latent CNV in eyes with exudative A MD compared to that. This clearly indicates that latent CNV exists without reducing the visual acuity of these patients. These new findings suggest that neovascularization can serve the survival of photoreceptor cells later

[0009] recently, for the new possibility of using optical coherence tomography angiography (OCTA) (Treister, Ne sper et al. 2018) to overcome the drawbacks of previous fluorescein angiography that detects CNV only after leakage has already occurred, a significant prevalence of latent CNV in the fellow eye of unilateral exudative CNV, and significantly larger choroidal capillary lamina non-perfusion adjacent to all CNV lesions have been detected. Treister et al. (Treister et al. 2018) identified an increased tendency of choroidal capillary lamina non-perfusion in the fellow eye of the latent CNV in eyes with exudative A MD compared to that. This clearly indicates that latent CNV exists without reducing the visual acuity of these patients. These new findings suggest that neovascularization can serve the survival of photoreceptor cells later MD compared to the fellow eye of its latent CNV. This clearly shows that latent CNV exists without reducing the visual acuity of these patients. These new findings suggest that neovascularization can serve the survival of photoreceptor cells later MD compared to the fellow eye of its latent CNV. This clearly shows that latent CNV exists without reducing the visual acuity of these patients. These new findings suggest that neovascularization can serve the survival of photoreceptor cells later without reducing the visual acuity of these patients. These new findings suggest that neovascularization can serve the survival of photoreceptor cells later without reducing the visual acuity of these patients. These new findings suggest that neovascularization can serve the survival of photoreceptor cells later Supporting previous observations in eyes with neovascular AMD (Biesemeier, Julien et al. 2014).

[0010] Regarding the long history of treating neovascular AMD, the same principle has always been used, namely to remove or block newly formed blood vessels. To achieve this, various methods , for example, laser coagulation, surgical procedures, radiation, photodynamic therapy, and current intravitreal anti VEGF drugs have been used. None of the major methods were able to improve the visual field On the other hand, the use of anti-VEGF (ranibizumab) has been successful and can improve vision for some time but still far from optimal relief. SUMMARY OF THE INVENTION

[0011] The underlying problem of the present invention is to provide a procedure for treating ocular diseases such as age-related macular degeneration (AMD).

[0012] A further underlying problem of the present invention is to provide a means for treating ocular diseases such as age-related macular degeneration (AMD) that achieves improved vision over a long period.

[0013] These and other underlying problems of the present invention are solved by the subject matter of the appended independent claims . Preferred embodiments may be obtained from the appended dependent claims.

[0014] This is an underlying problem of the present invention and also a first aspect in a first embodiment of the first aspect. In this aspect, a pigment epithelium-derived factor (PEDF) for use in a method for treating and / or preventing a disease, the method comprising administering PEDF to a subject, and treating the disease ​​Induction and / or prevention of formation of labyrinth capillaries Inhibiting, inducing growth of the choroid capillary lamina, adhering the choroid capillary lamina Inhibiting extracellular matrix formation, protecting the choroid capillary lamina, and / or Also solved by pigment epithelium-derived factor (PEDF) for use including guiding angiogenesis Is achieved.

[0015] In a second embodiment of the first aspect, which is also an embodiment of the first embodiment of the first aspect, The disease is an eye disease.

[0016] In a third embodiment of the first aspect, which is also an embodiment of the second embodiment of the first aspect, The eye disease is age-related macular degeneration, preferably, the age-related macular degeneration is age-related macular degeneration (AMD), more Preferably, it is atrophic age-related macular degeneration or exudative age-related macular degeneration.

[0017] In a fourth embodiment of the first aspect, which is also an embodiment of the third embodiment of the first aspect, PEDF inhibits the growth and / or Or formation of geographic atrophy in exudative AMD and / or atrophic AMD.

[0018] In a fifth embodiment of the first aspect, which is also an embodiment of the second embodiment of the first aspect, The disease is selected from the group including central serous chorioretinopathy, diabetic retinopathy, iris neovascularization, corneal neovascularization, polyp[[ID=3,7]] Leoidal choroidal vasculopathy, retinopathy of prematurity, and retinal and choroidal fibrosis. Selected.

[0019] In a sixth embodiment of the first aspect, which is also an embodiment of the fifth embodiment of the first aspect, PEDF inhibits the progression of retinal and / or choroidal fibrosis.

[0020] The second aspect, which is the underlying problem of the present invention and is also the first embodiment of the second aspect, In the present invention, pigment epithelium-derived fibroblasts for use in methods for the treatment and / or prevention of diseases are an mRNA encoding PEDF, and administering to a subject, wherein treating and / or preventing the disease comprises inhibiting labyrinthine capillary formation. inhibiting the growth of the choriocapillaris; inducing choriocapillaris growth; Inhibiting extracellular matrix formation, protecting the choriocapillaris, and / or It is also resolved by mRNA, including directing duct development.

[0021] In a second embodiment of the second aspect, which is also an embodiment of the first embodiment of the second aspect, The disease is an eye disease.

[0022] In a third embodiment of the second aspect, which is also an embodiment of the second embodiment of the second aspect, The eye disease is macular degeneration, preferably age-related macular degeneration (AMD), more preferably Dry age-related macular degeneration or wet age-related macular degeneration is preferred.

[0023] In a fourth embodiment of the second aspect, which is also an embodiment of the third embodiment of the second aspect, PEDF inhibits the growth and / or progression of geographic atrophy in wet and / or dry AMD. or inhibit formation.

[0024] In a fifth embodiment of the second aspect, which is also an embodiment of the second embodiment of the second aspect, The diseases include central serous chorioretinopathy, diabetic retinopathy, rubeosis iridis, corneal neovascularization, and polio. Selected from the group including: leapy choroidal vasculopathy, retinopathy of prematurity, and retinal and choroidal fibrosis. It is selected.

[0025] In a sixth embodiment of the second aspect, which is also an embodiment of the fifth embodiment of the second aspect, PEDF inhibits the progression of retinal and / or choroidal fibrosis.

[0026] This is a problem underlying the present invention, and also in a third aspect which is also an embodiment of the first embodiment of the third aspect a pigment epithelium-derived factor (PEDF) or an mRNA encoding a pigment epithelium-derived factor (PEDF) for use in a method for the treatment and / or prevention of a disease, wherein the method comprises administering to a subject PEDF or an mRNA encoding PEDF, and the disease is an eye disease, is also solved by a pigment epithelium-derived factor (PEDF) or an mRNA encoding a pigment epithelium-derived factor ( PEDF).

[0027] In a second embodiment of the third aspect, which is also an embodiment of the first embodiment of the third aspect, treatment and / or prevention of the disease comprises inhibiting angioid streaks formation, inducing the growth of the choroidal capillary lamina, adhering the choroidal capillary lamina, inhibiting extracellular matrix formation, protecting the choroidal capillary lamina, and / or leading angiogenesis.

[0028] In a third embodiment of the third aspect, which is also an embodiment of the first and second embodiments of the third aspect, the eye disease is macular degeneration, preferably the macular degeneration is age-related macular degeneration (AM D), more preferably atrophic age-related macular degeneration or exudative age-related macular degeneration.

[0029] In a fourth embodiment of the third aspect, which is also an embodiment of the third embodiment of the third aspect, PEDF inhibits the growth and / or ​​​or inhibit formation.

[0030] In a fifth embodiment of the third aspect, which is also an embodiment of the second embodiment of the third aspect, the disease includes central serous chorioretinopathy, diabetic retinopathy, iris rubeosis, corneal neovascularization, polypoidal choroidal vasculopathy, retinopathy of prematurity, and retinopathy and / or choroidopathy. is selected from the group consisting of

[0031] In a sixth embodiment of the third aspect, which is also an embodiment of the fifth embodiment of the third aspect, PEDF inhibits the progression of retinopathy and / or choroidopathy.

[0032] This is a problem underlying the present invention, and also in a fourth aspect, which is also a first embodiment of the fourth aspect, a pigment epithelium-derived factor (PEDF) or mRNA encoding a pigment epithelium-derived factor (PEDF) for use in a method for treating and / or preventing a disease, wherein the method comprises administering to a subject PEDF or mRNA encoding PEDF, and the disease is age-related macular degeneration, is also solved by a pigment epithelium-derived factor (PEDF) or mRNA encoding a pigment epithelium-derived factor (PEDF).

[0033] In a second embodiment of the fourth aspect, which is also an embodiment of the first embodiment of the fourth aspect, treatment and / or prevention of the disease includes inhibiting tortuous capillary formation, inducing growth of the choroidal capillary lamina, adhering the choroidal capillary lamina, inhibiting extracellular matrix formation, protecting the choroidal capillary lamina, and / or guiding angiogenesis.

[0034]

[0034] In a third embodiment of the fourth aspect, which is also an embodiment of the first and second embodiments of the fourth aspect, In a form, age-related macular degeneration is age-related macular degeneration (AMD), more preferably atrophic age-related macular degeneration or exudative age-related macular degeneration.

[0035] In a fourth embodiment of a fourth aspect which is also an embodiment of a third embodiment of the fourth aspect, PEDF inhibits the growth and / or or formation of geographic atrophy in exudative AMD and / or atrophic AMD.

[0036] This is a problem underlying the present invention, and also in a fifth aspect which is also an embodiment of a first embodiment of the fifth aspect, a pigment epithelium-derived factor (PEDF) or an mRNA encoding a pigment epithelium-derived factor (PEDF) for use in a method for treating and / or preventing a disease, wherein the method comprises administering to a subject PEDF or an mRNA encoding PEDF, and the disease is central serous chorioretinopathy, which is also solved by a pigment epithelium-derived factor (PEDF) or an mRNA encoding a pigment epithelium-derived factor (PEDF).

[0037] In a second embodiment of a fifth aspect which is also an embodiment of a first embodiment of the fifth aspect, treatment and / or prevention of the disease includes inhibiting angioid streak formation, inducing the growth of the choroidal capillary lamina, adhering the choroidal capillary lamina, inhibiting extracellular matrix formation, protecting the choroidal capillary lamina, and / or guiding angiogenesis.

[0038] This is a problem underlying the present invention, and also in a sixth aspect which is also an embodiment of a first embodiment of the sixth aspect, a pigment epithelium-derived factor (PEDF) or an mRNA encoding a pigment epithelium-derived factor (PEDF) for use in a method for treating and / or preventing a disease, wherein the method comprises administering to a subject PEDF or an mRNA encoding PEDF, and the disease The method comprises administering to a subject PEDF or mRNA encoding PEDF, for a disease which is diabetic retinopathy, is also solved by pigment epithelium-derived factor (PEDF) or mRNA encoding pigment epithelium-derived factor (PEDF).

[0039] In a second embodiment of the sixth aspect, which is also an embodiment of the first embodiment of the sixth aspect, treatment and / or prevention of the disease comprises inhibiting angiosome capillary formation, inducing the growth of the choroidal capillary lamina, adhering the choroidal capillary lamina, inhibiting extracellular matrix formation, protecting the choroidal capillary lamina, and / or guiding angiogenesis.

[0040] This is a problem underlying the present invention, and also in the seventh aspect, which is also an embodiment of the first embodiment of the seventh aspect, pigment epithelium-derived factor (PEDF) or mRNA encoding pigment epithelium-derived factor (PEDF) for use in a method for the treatment and / or prevention of a disease, wherein the method comprises administering to a subject PEDF or mRNA encoding PEDF, for a disease which is iris neovascularization, is also solved by pigment epithelium-derived factor (PEDF) or mRNA encoding pigment epithelium-derived factor (PEDF).

[0041] In a second embodiment of the seventh aspect, which is also an embodiment of the first embodiment of the seventh aspect, treatment and / or prevention of the disease comprises inhibiting angiosome capillary formation, inducing the growth of the choroidal capillary lamina, adhering the choroidal capillary lamina, inhibiting extracellular matrix formation, protecting the choroidal capillary lamina, and / or guiding angiogenesis.

[0042] This is the problem underlying the present invention and also the eighth aspect, which is also the first embodiment of the eighth aspect. In the eighth aspect, which is also the first embodiment of the eighth aspect, a pigment epithelium-derived factor (PEDF) or mRNA encoding a pigment epithelium-derived factor (PEDF) for use in a method for treating and / or preventing a disease, wherein the method comprises administering PEDF or mRNA encoding PEDF to a subject, and the disease is corneal neovascularization, is also solved by a pigment epithelium-derived factor (PEDF) or mRNA encoding a pigment epithelium-derived factor (PEDF).

[0043] In the second embodiment of the eighth aspect, which is also an embodiment of the first embodiment of the eighth aspect, treatment and / or prevention of the disease includes inhibiting tortuous capillary formation, inducing growth of the choroidal capillary lamina, adhering the choroidal capillary lamina, inhibiting extracellular matrix formation, protecting the choroidal capillary lamina, and / or guiding angiogenesis.

[0044] This is the problem underlying the present invention and also the ninth aspect, which is also the first embodiment of the ninth aspect. In the ninth aspect, which is also the first embodiment of the ninth aspect, a pigment epithelium-derived factor (PEDF) or mRNA encoding a pigment epithelium-derived factor (PEDF) for use in a method for treating and / or preventing a disease, wherein the method comprises administering PEDF or mRNA encoding PEDF to a subject, and the disease is polypoidal choroidal vasculopathy, is also solved by a pigment epithelium-derived factor (PEDF) or mRNA encoding a pigment epithelium-derived factor (PEDF).

[0045] In the second embodiment of the ninth aspect, which is also an embodiment of the first embodiment of the ninth aspect, treatment and / or prevention of the disease includes inhibiting tortuous capillary formation, the choroidal capillary lamina Inducing growth, adhering the choroidal capillary plate, inhibiting extracellular matrix formation, protecting the choroidal capillary plate, and / or guiding angiogenesis.

[0046] This is the underlying problem of the present invention and is also the first embodiment of the tenth aspect, the tenth In the aspect, a pigment epithelium-derived factor (PEDF) or an mRNA encoding a pigment epithelium-derived factor (PEDF) for use in a method for treating and / or preventing a disease, wherein the method comprises administering PEDF or an mRNA encoding PEDF to a subject, is also solved by a pigment epithelium-derived factor (PEDF) or an mRNA encoding a pigment epithelium-derived factor (PEDF) for use, wherein the disease is retinopathy of prematurity.

[0047] In the second embodiment of the tenth aspect, which is also an embodiment of the first embodiment of the tenth aspect, the treatment and / or prevention of the disease comprises inhibiting foveolar capillary formation, inducing the growth of the choroidal capillary plate, adhering the choroidal capillary plate, inhibiting extracellular matrix formation, damaging the choroidal capillary plate, protecting the choroidal capillary plate, and / or guiding angiogenesis.

[0048] This is the underlying problem of the present invention and is also the first embodiment of the eleventh aspect, the eleventh In the aspect, a pigment epithelium-derived factor (PEDF) or an mRNA encoding a pigment epithelium-derived factor (PEDF) for use in a method for treating and / or preventing a disease, wherein the method comprises administering PEDF or an mRNA encoding PEDF to a subject, is also solved by a pigment epithelium-derived factor (PEDF) or an mRNA encoding a pigment epithelium-derived factor (PEDF) for use, wherein the disease is retinal and / or choroidal fibrosis. ​F) or is also solved by mRNA encoding pigment epithelium-derived factor (PEDF).

[0049] A second embodiment of the eleventh aspect, which is also an embodiment of the first embodiment of the eleventh aspect is that the treatment and / or prevention of the disease involves inhibiting tortuous capillary formation, inducing the growth of the choroidal capillary plate, adhering the choroidal capillary plate, damaging extracellular matrix formation, protecting the choroidal capillary plate, and / or guiding angiogenesis.

[0050] A third embodiment of the eleventh aspect, which is also an embodiment of the first and second embodiments of the eleventh aspect is that PEDF and / or mRNA encoding PEDF inhibits the progression of retinal and / or choroidal fibrosis.

[0051] In one embodiment of those aspects, including all possible embodiments of the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, and eleventh aspects tortuous capillary formation is preferably tortuous capillary formation in the eye of an eye disease.

[0052] In one embodiment of those aspects, including all possible embodiments of the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, and eleventh aspects inducing the growth of the choroidal capillary plate includes inducing the growth of a new choroidal capillary plate or is inducing the growth of a new choroidal capillary plate.

[0053] In one embodiment of those aspects, including all possible embodiments of the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, and eleventh aspects the growth of the choroidal capillary plate ​​​​Inducing can provide a choroid capillary plate that can replace the original choroid capillary plate and, preferably, the original choroid capillary plate is the choroid capillary plate of the affected area.

[0054] In one embodiment of those aspects including all manner of embodiments of the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, and eleventh aspects adhering the choroid capillary plate includes adhering the pathological choroid capillary plate.

[0055] In one embodiment of those aspects including all manner of embodiments of the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, and eleventh aspects inhibiting extracellular matrix formation includes inhibiting extracellular matrix formation against and / or around the lumen of blood vessels

[0056] In one embodiment of those aspects including all manner of embodiments of the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, and eleventh aspects protecting the choroid capillary plate includes protecting the choroid capillary plate from the damaging effect of an anti-VEGF drug.

[0057] In one embodiment of those aspects including all manner of embodiments of the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, and eleventh aspects protecting the choroid capillary plate includes protecting the choroid capillary plate from the damaging effect of discontinuation of an anti-VEGF drug.

[0058] In one embodiment of those aspects including all manner of embodiments of the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, and eleventh aspects guiding angiogenesis ​includes the generation of functional blood vessels, preferably from diseased blood vessels.

[0059] The first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, and eleventh aspects In one embodiment of those aspects, including all manner of every possible embodiment, the diseased blood vessel is the result of a diseased condition, preferably of a diseased condition of the subject, and more preferably the diseased condition is a disease that the subject has or is at risk of having and / or for the treatment of which PEDF or mRNA encoding PEDF is used or is intended to be used.

[0060] The first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, and eleventh aspects In one embodiment of those aspects, including all manner of every possible embodiment, PEDF or mRNA encoding PEDF is administered intravitreally or subretinally.

[0061] The first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, and eleventh aspects In one embodiment of those aspects, including all manner of every possible embodiment, the method further includes applying an anti-VEGF therapy, and preferably the anti-VEGF therapy includes administering an anti-VEGF drug to the subject, and the anti-VEGF drug is selected from the group consisting of pegaptanib, ranibizumab, bevacizumab, and aflibercept. In one embodiment of those aspects, the combination of PEDF and anti-VEGF therapy enables a reduction in the amount of anti-VEGF therapy administered to the subject as compared to the use of anti-VEGF therapy alone. The reduction in the amount of anti-VEGF therapy administered to such a subject typically results in a reduction in side effects, particularly side effects of the anti-VEGF therapy, such as cardiovascular side effects. ​

[0062] Although not wishing to be bound by any theory, the inventors have surprisingly found that pigment epithelium-derived factor (PEDF) can promote the growth of a healthy and functional choroid capillary lamina, and associated effects such as inhibiting angioid streaks formation, adhering the choroid capillary lamina, inhibiting extracellular matrix formation, inducing the growth of the choroid capillary lamina, protecting the choroid capillary lamina, and / or inducing angiogenesis, and is beneficial for the treatment of eye diseases. To date, the present invention departs from the current state of the art in the treatment of eye diseases based on blocking angiogenesis or removing blood vessels. Considering the inhibition of such angioid streaks formation by PEDF, the therapeutic efficacy of PEDF in the treatment of eye diseases is particularly relevant for eye diseases showing angioid streaks formation, such as age-related macular degeneration (AMD), i.e., both atrophic AMD and exudative AMD, central serous chorioretinopathy, diabetic retinopathy, iris neovascularization, corneal neovascularization, polypoidal choroidal vasculopathy, and retinopathy of prematurity. For example, when a patient with exudative AMD is injected with fluorescein, it is observed that a large amount of fluid leaks from the diseased blood vessels in a short time. The most plausible cause of this finding is that there are large gaps between or within the endothelial walls. However, such gaps do not occur in the endothelium connecting blood cells and extracellular matrix because they are immediately blocked by platelets. In recent years, capillaries with many microvillus-like protrusions of the endothelium, which form a labyrinth-like structure in the lumen of blood vessels, have been surgically removed from AMD patients.

[0063] Considering the inhibition of such angioid streaks formation by PEDF, the therapeutic efficacy of PEDF in the treatment of eye diseases is particularly relevant for eye diseases showing angioid streaks formation, such as age-related macular degeneration (AMD), i.e., both atrophic AMD and exudative AMD, central serous chorioretinopathy, diabetic retinopathy, iris neovascularization, corneal neovascularization, polypoidal choroidal vasculopathy, and retinopathy of prematurity. For example, when a patient with exudative AMD is injected with fluorescein, it is observed that a large amount of fluid leaks from the diseased blood vessels in a short time. The most plausible cause of this finding is that there are large gaps between or within the endothelial walls. However, such gaps do not occur in the endothelium connecting blood cells and extracellular matrix because they are immediately blocked by platelets. In recent years, capillaries with many microvillus-like protrusions of the endothelium, which form a labyrinth-like structure in the lumen of blood vessels, have been surgically removed from AMD patients. For example, when a patient with exudative AMD is injected with fluorescein, it is observed that a large amount of fluid leaks from the diseased blood vessels in a short time. The most plausible cause of this finding is that there are large gaps between or within the endothelial walls. However, such gaps do not occur in the endothelium connecting blood cells and extracellular matrix because they are immediately blocked by platelets. In recent years, capillaries with many microvillus-like protrusions of the endothelium, which form a labyrinth-like structure in the lumen of blood vessels, have been surgically removed from AMD patients. For example, when a patient with exudative AMD is injected with fluorescein, it is observed that a large amount of fluid leaks from the diseased blood vessels in a short time. The most plausible cause of this finding is that there are large gaps between or within the endothelial walls. However, such gaps do not occur in the endothelium connecting blood cells and extracellular matrix because they are immediately blocked by platelets. In recent years, capillaries with many microvillus-like protrusions of the endothelium, which form a labyrinth-like structure in the lumen of blood vessels, have been surgically removed from AMD patients. However, such gaps do not occur in the endothelium connecting blood cells and extracellular matrix because they are immediately blocked by platelets. In recent years, capillaries with many microvillus-like protrusions of the endothelium, which form a labyrinth-like structure in the lumen of blood vessels, have been surgically removed from AMD patients. However, such gaps do not occur in the endothelium connecting blood cells and extracellular matrix because they are immediately blocked by platelets. In recent years, capillaries with many microvillus-like protrusions of the endothelium, which form a labyrinth-like structure in the lumen of blood vessels, have been surgically removed from AMD patients. However, such gaps do not occur in the endothelium connecting blood cells and extracellular matrix because they are immediately blocked by platelets. In recent years, capillaries with many microvillus-like protrusions of the endothelium, which form a labyrinth-like structure in the lumen of blood vessels, have been surgically removed from AMD patients. were found in excised choroidal neovascularization (CNV). The lumens of such capillaries showed open connections to the stroma and were thus the cause of leakage. These capillaries were filled with plasma and were connected to the blood vascular network and were thus the cause of leakage. This type of capillary was frequently observed in CNV and was termed "lacy capillaries". The leaky sites in these lacy capillaries could not be occluded by platelets because the reduced lumen of the lacy capillaries prevented platelet entry. Thus, this type of vessel caused chronic plasma leakage and was the origin of the edema (Schraermeyer, Julien et al. 2015)

[0064] Furthermore, pigment epithelium-derived factor (PEDF) has very potent neurotrophic and neuroprotective effects (King and Suzuma 2000). This factor is produced by the RPE under normal oxygen tension conditions and production ceases during hypoxia. This greatly promotes angiogenesis. In age-related macular degeneration (AMD), damaged RPE cells produce little PEDF which results in unregulated angiogenesis. Although the main effect of PEDF in the eye was thought to be to prevent angiogenesis (King and Suzuma 2000), in the present invention, PEDF can stabilize CNV vessels and avoid lacy capillary formation when pathological angiogenesis is initiated by VEGF

[0065] In a first aspect, which is also a first embodiment of the first aspect, the underlying problem of the present invention is the use of pigment epithelium-derived factor (PE DF) in a method for the treatment and / or prevention of a disease ​​​​​DF), wherein the method comprises administering PEDF, and the treatment and / or prevention of the disease comprises inhibiting tortuous capillary formation, inducing the growth of the choroid capillary plate, making the choroid capillary plate adhere, inhibiting extracellular matrix formation, protecting the choroid capillary plate, and / or guiding angiogenesis, and is solved by pigment epithelium-derived factor (PEDF) for use.

[0066] In a preferred embodiment of that aspect, PEDF is human PEDF protein, and in a more preferred embodiment, PEDF comprises the amino acid sequence of SEQ ID NO: 1. QNPASPPEEG SPDPDSTGAL VEEEDPFFKV PVNKLAAAVS NFGYDLYRVR SSTSPTTNVL LSPLSVATAL SALSLGAEQR TESIIHRALY YDLISSPDIH GTYKELLDTV TAPQKNLKSA SRIVFEKKLR IKSSFVAPLE KSYGTRPRVL TGNPRLDLQE INNWVQAQMK GKLARSTKEI PDEISILLLG VAHFKGQWVT KFDSRKTSLE DFYLDEERTV RVPMMSDPKA VLRYGLDSDL SCKIAQLPLT GSMSIIFFLP LKVTQNLTLI EESLTSEFIH DIDRELKTVQ AVLTVPKLKL SYEGEVTKSL QEMKLQSLFD SPDFSKITGK PIKLTQVEHR AGFEWNEDGA GTTPSPGLQP AHLTFPLDYH LNQPFIFVLR DTDTGALLFI GKILDPRGP (SEQ ID NO: 1)

[0067] In a preferred embodiment of that aspect, PEDF is a derivative of PEDF, preferably human PEDF , more preferably PEDF comprising the amino acid sequence of SEQ ID NO: 1. As long as PEDF can cause the above effects, particularly inhibiting tortuous capillary formation, inducing the growth of the choroidal capillary plate, adhering the choroidal capillary plate, inhibiting extracellular matrix formation, protecting the choroidal capillary plate, and guiding angiogenesis, it will be understood by those skilled in the art that any derivative of PEDF may be used. In one embodiment, PEDF has at least 85%, 86%, 87%, 88%, 89%, 90 %, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology or identity with the amino acid sequence of SEQ ID NO: 1. In a further embodiment, the derivative of PEDF is such that the amino acid residue is pyrrolidone carboxylic acid at amino acid position 20 of SEQ ID NO: 1 , the amino acid residue is phosphoserine at amino acid position 24 of SEQ ID NO: 1, the amino acid residue is phosphoserine at amino acid position 114 of SEQ ID NO: 1 , the amino acid residue is phosphoserine at amino acid position 227 of SEQ ID NO: 1, and / or the amino acid residue is N-linked (GlcNAc) asparagine at amino acid position 285 of SEQ ID NO: 1 .

[0068] Any of the above effects, particularly any variation thereof including tortuous capillary formation and its inhibition, induction of the growth of the choroidal capillary plate, adhesion of the choroidal capillary plate, inhibition of extracellular matrix formation, protection of the choroidal capillary plate, and guidance of angiogenesis, is preferred when combined with fluorescein angiography (FA), which is suitable for detecting and evaluating leaking blood vessels . It will be appreciated that it can be evaluated by optical coherence tomography angiography (OCT-A) (Sp aide et al. 2015). Optical coherence tomography angiography (OCT-A) has emerged as a non-invasive technique for imaging the microvasculature of the retina and choroid (Spaide et al. 2015) . Briefly, OCT-A technology uses the laser light reflectivity on the surface of moving red blood cells to accurately depict blood vessels passing through various divided regions of the eye, thus eliminating the necessity of intravascular pigments. The OCT scan of the patient's retina is composed of multiple individual A-scans, and the A-scans are collected to form a B-scan that provides cross-sectional structural information. In OCT-A technology, the same tissue region is imaged repeatedly, and the differences between scans are analyzed, so it is possible to detect regions containing high flow, i.e., regions with significant changes between scans, and regions with slow flow or no flow at all that are considered to be similar between scans.

[0069] OCT-A and FA can also be used for the detection and evaluation of edema located in the retina and / or subretinal space, respectively.

[0070] In a second embodiment of the first aspect, which is also an embodiment of the first embodiment of the first aspect, the disease is an eye or ocular disease.

[0071] In a third embodiment of the first aspect, which is also an embodiment of the first and second embodiments of the first aspect, the eye disease is macular degeneration, preferably age-related macular degeneration (AMD), more preferably atrophic age-related macular degeneration or exudative age-related macular degeneration.

[0072] A fourth embodiment of the first aspect, which is also an embodiment of the first and second embodiments of the first aspect In the form, the eye disease is selected from the group including central serous chorioretinopathy, diabetic retinopathy, iris neovascularization, corneal neovascularization, polypoidal choroidal vasculopathy, and retinopathy of prematurity.

[0073] A fifth embodiment of the first aspect, which is also an embodiment of the first, second, third, and fourth embodiments of the first aspect In the form, the tortuous capillary formation is preferably tortuous capillary formation in the eye of the eye disease.

[0074] A sixth embodiment of the first aspect, which is also an embodiment of the first, second, third, fourth, and fifth embodiments of the first aspect In the form, inducing the growth of the choroidal capillary lamina includes inducing the growth of a new choroidal capillary lamina or is by inducing the growth of a new choroidal capillary lamina.

[0075] A seventh embodiment of the first aspect, which is also an embodiment of the first, second, third, fourth, fifth, and sixth embodiments of the first aspect In the form, inducing the growth of the choroidal capillary lamina provides a choroidal capillary lamina that can replace the original choroidal capillary lamina, and preferably, the original choroidal capillary lamina is the diseased choroidal capillary lamina. In this regard, it will be recognized by those skilled in the art that the diseased choroidal capillary lamina is located between the Bruch's membrane and the RPE and can be seen in OCT-A.

[0076] An eighth embodiment of the first aspect, which is also an embodiment of the first, second, third, fourth, fifth, sixth, and seventh embodiments of the first aspect In the form, adhering the choroidal capillary lamina includes adhering the diseased choroidal capillary lamina. In this regard, between the Bruch's membrane and the RPE or the retina Each neovascular choroidal capillary plate or blood vessel located within the subretinal space will preferably be considered pathological. More preferably, the choroidal capillary plate is considered pathological only when it develops into tortuous capillaries or becomes leaky for other reasons. The diagnosis can be made by OCT-A and / or fluorescein angiography (FA).

[0077] In a ninth embodiment of the first aspect, which is also an embodiment of the first, second, third, fourth, fifth, sixth, seventh, and eighth embodiments of the first aspect, inhibiting extracellular matrix formation includes inhibiting extracellular matrix formation within and / or around the lumen of blood vessels. Preferably, such blood vessels do not inhibit red blood cell flow due to the absence of endothelial protrusions into the lumen.

[0078] In a tenth embodiment of the first aspect, which is also an embodiment of the first, second, third, fourth, fifth, sixth, seventh, eighth, and ninth embodiments of the first aspect, protecting the choroidal capillary plate includes protecting the choroidal capillary plate from the damaging effects of anti-VEGF drugs. Such anti-VEGF drugs are preferably anti-VEGF drugs selected from the group including pegaptanib, ranibizumab, bevacizumab, and aflibercept. In this regard, such damaging effects may include the regression of blood vessels and the degeneration of RPE and photoreceptor cells that lead to geographic atrophy. Geographic atrophy can be detected as a dark spot in scanning laser ophthalmoscopy (SLO) due to the disappearance of autofluorescence of the RPE. SLO images are the result of the autofluorescence of lipofuscin in the RPE.

[0079] ​​​​​​​​​​​ In a first embodiment of the first aspect, the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, and tenth In an eleventh embodiment of the first aspect, which is also an embodiment of the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, and tenth embodiments of the first aspect, protecting the choroid capillary lamina includes protecting the choroid capillary lamina from the damaging effects of discontinuation of anti-VEGF agents. In this regard, it will be understood that preferably the blood vessels become leaky and transform into tortuous capillaries and the endothelial cells proliferate and migrate.

[0080] In a twelfth embodiment of the first aspect, which is also an embodiment of the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, and eleventh embodiments of the first aspect, inducing angiogenesis includes generating functional blood vessels, preferably functional blood vessels from diseased blood vessels. In this regard, preferably the diseased blood vessels either do not permit proper blood flow, are leaky, or form a very large or heterotypic extracellular matrix protein and are blood vessels that form a very large or heterotypic extracellular matrix protein.

[0081] In a thirteenth embodiment of the first aspect, which is also an embodiment of the twelfth embodiment of the first aspect, the diseased blood vessels are a result of a diseased state. Such diseased states can be one or a combination of hypoxia, upregulation of HIF1 alpha, dysformation of growth factors, and VEGF.

[0082] In a fourteenth embodiment of the first aspect, which is also an embodiment of the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, eleventh, twelfth, and thirteenth embodiments of the first aspect, PEDF is administered intravitreally or subretinally, or as a vector such as an adeno-associated virus encoding PEDF. ​​​

[0083] The first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, eleventh, twelfth, thirteenth, and fourteenth embodiments of the first aspect, and also an embodiment of the fifteenth embodiment of the first aspect, the method further comprises applying an anti-VEGF therapy, preferably, the anti-VEGF therapy comprises administering an anti-VEGF drug to the subject, and the anti-VEGF drug is selected from the group consisting of pegaptanib, ranibizumab, bevacizumab, and aflibercept. In this regard, PEDF may be used early, for example, when CNV is detected in one eye, the fellow eye may be prophylactically treated, and further, those skilled in the art will recognize that treatment may be initiated

[0084] The first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, eleventh, twelfth, thirteenth, fourteenth, and fifteenth embodiments of the first aspect, and also an embodiment of the sixteenth embodiment of the first aspect, the subject is a subject suffering from side effects of anti-VEGF treatment,

[0085] preferably vision loss resulting from anti-VEGF treatment. In the second aspect, which is also the first embodiment of the second aspect, the underlying problem of the present invention is an mRNA encoding pigment epithelium-derived factor (PEDF) for use in a method for the treatment and / or prevention of a disease, the method comprising administering PEDF to a subject, including protecting choroid capillary lamina and / or guiding angiogenesis, mRNA is solved by A. In one embodiment, the mRNA encodes the amino acid sequence of SEQ ID NO: 1 mRNA. When the mRNA encoding PEDF is used in a method for the treatment and / or prevention of a disease, for example, the mRNA contains a sequence encoding a signal peptide that is directed to the endoplasmic reticulum (ER) and cleaved, which is understood by those skilled in the art. In one embodiment, the mRNA encodes the amino acid sequence of SEQ ID NO: 2 mRNA. It will be understood by those skilled in the art. In one embodiment, the mRNA encodes the amino acid sequence of SEQ ID NO: 2 mRNA. is. ATGCAGGCCCTGGTGCTACTCCTCTGCATTGGAGCCCTCCTCGGGCACAGCAGCTGCCAGAACCCTGCCAGCCCCCCGGA GGAGGGCTCCCCAGACCCCGACAGCACAGGGGCGCTGGTGGAGGAGGAGGATCCTTTCTTCAAAGTCCCCGTGAACAAGC TGGCAGCGGCTGTCTCCAACTTCGGCTATGACCTGTACCGGGTGCGATCCAGCACGAGCCCCACGACCAACGTGCTCCTG TCTCCTCTCAGTGTGGCCACGGCCCTCTCGGCCCTCTCGCTGGGAGCGGAGCAGCGAACAGAATCCATCATTCACCGGGC TCTCTACTATGACTTGATCAGCAGCCCAGACATCCATGGTACCTATAAGGAGCTCCTTGACACGGTCACCGCCCCCCAGA AGAACCTCAAGAGTGCCTCCCGGATCGTCTTTGAGAAGAAGCTGCGCATAAAATCCAGCTTTGTGGCACCTCTGGAAAAG TCATATGGGACCAGGCCCAGAGTCCTGACGGGCAACCCTCGCTTGGACCTGCAAGAGATCAACAACTGGGTGCAGGCGCA GATGAAAGGGAAGCTCGCCAGGTCCACAAAGGAAATTCCCGATGAGATCAGCATTCTCCTTCTCGGTGTGGCGCACTTCA AGGGGCAGTGGGTAACAAAGTTTGACTCCAGAAAGACTTCCCTCGAGGATTTCTACTTGGATGAAGAGAGGACCGTGAGG GTCCCCATGATGTCGGACCCTAAGGCTGTTTTACGCTATGGCTTGGATTCAGATCTCAGCTGCAAGATTGCCCAGCTGCC CTTGACCGGAAGCATGAGTATCATCTTCTTCCTGCCCCTGAAAGTGACCCAGAATTTGACCTTGATAGAGGAGAGCCTCA CCTCCGAGTTCATTCATGACATAGACCGAGAACTGAAGACCGTGCAGGCGGTCCTCACTGTCCCCAAGCTGAAGCTGAGT TACGAAGGCGAAGTCACCAAGTCCCTGCAGGAGATGAAGCTGCAATCCTTGTTTGATTCACCAGACTTTAGCAAGATCAC AGGCAAACCCATCAAGCTGACTCAGGTGGAACACCGGGCTGGCTTTGAGTGGAACGAGGATGGGGCGGGAACCACCCCCA GCCCAGGGCTGCAGCCTGCCCACCTCACCTTCCCGCTGGACTATCACCTTAACCAGCCTTTCATCTTCGTACTGAGGGAC ACAGACACAGGGGCCCTTCTCTTCATTGGCAAGATTCTGGACCCCAGGGGCCCCTAA

[0086] The first 57 nucleotides of the nucleotide sequence of SEQ ID NO: 2 encode the signal peptide of human PEDF. However, the signal peptide and the one encoding it The nucleotide sequences are each replaced with a different signal peptide and a nucleotide sequence encoding such a different signal peptide within the scope of the present invention. Such different signal peptides are known in the art. is within the scope of the present invention. Such different signal peptides are known in the art.

[0087] In an alternative embodiment, the mRNA is the nucleotide sequence of SEQ ID NO: 3. GGACGCTGGATTAGAAGGCAGCAAAAAAAGATCTGTGCTGGCTGGAGCCCCCTCAGTGTGCAGGCTTAGAGGGACTAGGC TGGGTGTGGAGCTGCAGCGTATCCACAGGCCCCAGGATGCAGGCCCTGGTGCTACTCCTCTGCATTGGAGCCCTCCTCGG GCACAGCAGCTGCCAGAACCCTGCCAGCCCCCCGGAGGAGGGCTCCCCAGACCCCGACAGCACAGGGGCGCTGGTGGAGG AGGAGGATCCTTTCTTCAAAGTCCCCGTGAACAAGCTGGCAGCGGCTGTCTCCAACTTCGGCTATGACCTGTACCGGGTG CGATCCAGCATGAGCCCCACGACCAACGTGCTCCTGTCTCCTCTCAGTGTGGCCACGGCCCTCTCGGCCCTCTCGCTGGG AGCGGACGAGCGAACAGAATCCATCATTCACCGGGCTCTCTACTATGACTTGATCAGCAGCCCAGACATCCATGGTACCT ATAAGGAGCTCCTTGACACGGTCACTGCCCCCCAGAAGAACCTCAAGAGTGCCTCCCGGATCGTCTTTGAGAAGAAGCTR CGCATAAAATCCAGCTTTGTGGCACCTCTGGAAAAGTCATATGGGACCAGGCCCAGAGTCCTGACGGGCAACCCTCGCTT GGACCTGCAAGAGATCAACAACTGGGTGCAGGCGCAGATGAAAGGGAAGCTCGCCAGGTCCACAAAGGAAATTCCCGATG AGATCAGCATTCTCCTTCTCGGTGTGGCGCACTTCAAGGGGCAGTGGGTAACAAAGTTTGACTCCAGAAAGACTTCCCTC GAGGATTTCTACTTGGATGAAGAGAGGACCGTGAGGGTCCCCATGATGTCGGACCCTAAGGCTGTTTTACGCTATGGCTT GGATTCAGATCTCAGCTGCAAGATTGCCCAGCTGCCCTTGACCGGAAGCATGAGTATCATCTTCTTCCTGCCCCTGAAAG TGACCCAGAATTTGACCTTGATAGAGGAGAGCCTCACCTC (SEQ ID NO: 3)

[0088] In a further embodiment of the second aspect, including any embodiment of the second aspect, the mRNA preferably comprises a recombinant or heterologous mRNA with a 5′UTR and / or a 3′UTR different from the 5′UTR and / or the 3′UTR of the mRNA from which the coding sequence of PEDF is obtained, and other constituent elements thereof. Or it is a heterologous mRNA.

[0089] The disclosure of the first aspect, including any embodiment of the first aspect, is equally applicable to the second aspect In other words, every embodiment of the first aspect is also an embodiment of the second aspect, including any embodiment of the second aspect thereof.

[0090] In a twelfth aspect, which is also a first embodiment of the twelfth aspect, the problem underlying the present invention is a pharmaceutical composition comprising either pigment epithelium-derived factor (PEDF) or mRNA encoding pigment epithelium-derived factor (PEDF), and a method for treating and / or preventing a disease thereof. A pharmaceutical composition for use in, the method comprising administering to a subject PEDF, Treatment and / or prevention of a disease is achieved by the pharmaceutical composition, which includes inhibiting tortuous capillary formation, inducing the growth of the choroid capillary lamina, adhering the choroid capillary lamina, inhibiting extracellular matrix formation, protecting the choroid capillary lamina, and / or guiding angiogenesis. Preferably, the pharmaceutical composition includes a pharmaceutically acceptable excipient or diluent. a diluent. The disclosure of those aspects, including any embodiments of the first aspect and the second aspect, is equally applicable to the twelfth aspect, which includes any embodiments of the first or second aspect. In other words, any and all embodiments of the first aspect and the second aspect are also an embodiment of the twelfth aspect, which includes any embodiments of the twelfth aspect. a diluent.

[0091] The disclosure of those aspects, including any embodiments of the first aspect and the second aspect, is equally applicable to the twelfth aspect, which includes any embodiments of the first or second aspect. In other words, any and all embodiments of the first aspect and the second aspect are also an embodiment of the twelfth aspect, which includes any embodiments of the twelfth aspect. In a thirteenth aspect, which is also a first embodiment of the thirteenth aspect, the underlying problem of the present invention is solved by a pharmaceutical composition comprising either pigment epithelium-derived factor (PEDF) or mRNA encoding pigment epithelium-derived factor (PEDF), which is a pharmaceutical composition for use in a method for the treatment and / or prevention of a disease, wherein the disease is an eye disease. The disclosure of those aspects, including any embodiments of the third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, and eleventh aspects, is equally applicable to the thirteenth aspect, which includes any embodiments of the thirteenth aspect. In other words, any and all embodiments of the third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, and eleventh aspects are also an embodiment of the thirteenth aspect, which includes any embodiments of the thirteenth aspect.

[0092] In a thirteenth aspect, which is also a first embodiment of the thirteenth aspect, the underlying problem of the present invention is solved by a pharmaceutical composition comprising either pigment epithelium-derived factor (PEDF) or mRNA encoding pigment epithelium-derived factor (PEDF), which is a pharmaceutical composition for use in a method for the treatment and / or prevention of a disease, wherein the disease is an eye disease. The disclosure of those aspects, including any embodiments of the third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, and eleventh aspects, is equally applicable to the thirteenth aspect, which includes any embodiments of the thirteenth aspect. In other words, any and all embodiments of the third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, and eleventh aspects are also an embodiment of the thirteenth aspect, which includes any embodiments of the thirteenth aspect. In a thirteenth aspect, which is also a first embodiment of the thirteenth aspect, the underlying problem of the present invention is solved by a pharmaceutical composition comprising either pigment epithelium-derived factor (PEDF) or mRNA encoding pigment epithelium-derived factor (PEDF), which is a pharmaceutical composition for use in a method for the treatment and / or prevention of a disease, wherein the disease is an eye disease. The disclosure of those aspects, including any embodiments of the third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, and eleventh aspects, is equally applicable to the thirteenth aspect, which includes any embodiments of the thirteenth aspect. In other words, any and all embodiments of the third, fourth, fifth, sixth, seventh, eighth, ninth,

[0093] The disclosure of those aspects, including any embodiments of the third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, and eleventh aspects, is equally applicable to the thirteenth aspect, which includes any embodiments of the thirteenth aspect. In other words, any and all embodiments of the third, fourth, fifth, sixth, seventh, eighth, ninth, In a thirteenth aspect, which is also a first embodiment of the thirteenth aspect, the underlying problem of the present invention is solved by a pharmaceutical composition comprising either pigment epithelium-derived factor (PEDF) or mRNA encoding pigment epithelium-derived factor (PEDF), which is a pharmaceutical composition for use in a method for the treatment and / or prevention of a disease, wherein the disease is an eye disease. tenth, and eleventh aspects are also an embodiment of the thirteenth aspect, which includes any embodiments of the thirteenth aspect. tenth, and eleventh aspects are also an embodiment of the thirteenth aspect, which includes any embodiments of the thirteenth aspect. The embodiment also includes an embodiment of the 13th aspect including any of the embodiments of the 13th aspect There is.

[0094] In the 14th aspect, which is also the first embodiment of the 14th aspect, the problem underlying the present invention is , the use of pigment epithelium-derived factor (PED F) or mRNA encoding pigment epithelium-derived factor (PEDF) for the manufacture of a medicament for the treatment and / or prevention of a disease, wherein the treatment and / or prevention of the disease comprises inhibiting tortuous capillary formation, inducing the growth of the choriocapillaris plate, adhering the choriocapillaris plate, inhibiting extracellular matrix formation , protecting the choriocapillaris plate, and / or guiding angiogenesis, which is solved by the use. It is solved by.

[0095] The disclosure of those aspects including any of the embodiments of the first and second aspects is equally applicable to the 1 4th aspect. In other words, any of the embodiments of the first and second aspects is also an embodiment of the 14th aspect including any of the embodiments of the 14th aspect . .

[0096] In the 15th aspect, which is also the first embodiment of the 15th aspect, the problem underlying the present invention is , the use of pigment epithelium-derived factor (PED F) or mRNA encoding pigment epithelium-derived factor (PEDF) for the manufacture of a medicament for the treatment and / or prevention of a disease, wherein the disease is an eye disease, which is also solved by the use.

[0097] The disclosure of those aspects including any of the embodiments of the third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, and eleventh aspects is applicable to any of the embodiments of the 15th aspect including any of the embodiments of the 1 5th aspect It is equally applicable to the aspects of 5. In other words, all embodiments including any embodiments of the 3rd, 4th, 5th, 6th, 7th, 8th, 9th , 10th, and 11th aspects, any and all embodiments thereof, are also an embodiment of the 15th aspect including any embodiments of the 15th aspect. In the 16th aspect, which is also the first embodiment of the 16th aspect, the problem underlying the present invention is a method for treating and / or preventing a disease in a subject, wherein the treatment and / or prevention of the disease

[0098] comprises administering to the subject a therapeutically effective amount of pigment epithelium-derived factor (PEDF) or mRNA encoding pigment epithelium-derived factor (PEDF), and inhibiting fenestrated capillary formation, inducing the growth of the choroidal capillary lamina, adhering the choroidal capillary lamina, inhibiting extracellular matrix formation, protecting the choroidal capillary lamina, and / or guiding angiogenesis, and is solved by the method. The disclosure of those aspects including any embodiments of the 1st and 2nd aspects is equally applicable to the 16th aspect including any embodiments of the 16th aspect. In other words, any embodiment of the 1st and 2nd aspects is also an embodiment of the 16th aspect including any embodiments of the 16th aspect. In the 17th aspect, which is also the first embodiment of the 17th aspect, the problem underlying the present invention is a method for treating and / or preventing a disease in a subject, wherein the treatment and / or prevention of the disease

[0099] comprises administering to the subject a therapeutically effective amount of pigment epithelium-derived factor (PEDF) or mRNA encoding pigment epithelium-derived factor (PEDF), and the disease is an eye disease. The disclosure of those aspects including any embodiments of the 1st and 2nd aspects is equally applicable to the 16th aspect including any embodiments of the 16th aspect. In other words, any embodiment of the 1st and 2nd aspects is also an embodiment of the 16th aspect including any embodiments of the 16th aspect. In the 17th aspect, which is also the first embodiment of the 17th aspect, the problem underlying the present invention is

[0100] a method for treating and / or preventing a disease in a subject, wherein the treatment and / or prevention of the disease comprises administering to the subject a therapeutically effective amount of pigment epithelium-derived factor (PEDF) or mRNA encoding pigment epithelium-derived factor (PEDF), and the disease is an eye disease. / or prevention includes administering to the subject a therapeutically effective amount of pigment epithelium-derived factor (PEDF) or mRNA encoding pigment epithelium-derived factor (PEDF), and the disease is an eye disease. a method for treating and / or preventing a disease in a subject, wherein the treatment and / or prevention of the disease It can also be resolved by law.

[0101] Any of the third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, and eleventh aspects The disclosure of those aspects, including embodiments of the seventeenth aspect, is also applicable to the first aspect, including any embodiment of the seventeenth aspect. This applies equally to the 7th aspect. In other words, the 3rd, 4th, 5th, 6th, 7th, 8th, 9th Any and all of the above aspects, including embodiments of any of the tenth, tenth, and eleventh aspects. The embodiment may be an embodiment of the seventeenth aspect, including any embodiment of the seventeenth aspect. In a preferred embodiment, the treatment and / or prevention of diseases is a method for preventing labyrinthine capillary formation. inhibiting the growth of the choriocapillaris; inducing choriocapillaris growth; Inhibiting extracellular matrix formation, protecting the choriocapillaris, and / or This includes directing duct development.

[0102] In an eighteenth aspect, which is also a first embodiment of the eighteenth aspect, the problem underlying the present invention is to , inhibiting labyrinthine capillary formation, inducing choriocapillaris growth, and choriocapillaris Protects the choriocapillaris by adhering the lamina and inhibiting extracellular matrix formation and / or in a method for inducing vascular development. Physiologically relevant information is available from the Physiological and Clinical Uses of PEDF. This is solved by pigment epithelium-derived factor (PEDF).

[0103] The disclosure of the first aspect, including any embodiment of the first aspect, may also include any of the eighteenth aspects. In other words, any of the first aspect The embodiment is also an embodiment of the 16th aspect including any of the embodiments of the 16th aspect There is.

[0104] In the 19th aspect, which is also the first embodiment of the 19th aspect, the problem underlying the present invention is , to inhibit the formation of labyrinthine capillaries, to induce the growth of the choroidal capillary plate, to adhere the choroidal capillary plate, to inhibit extracellular matrix formation, to protect the choroidal capillary plate and / or for use in a method for guiding angiogenesis, a pigment epithelium-derived factor (PEDF)-encoding mRNA wherein the method comprises administering PEDF to a subject is solved by the mRNA.

[0105] The disclosure of those aspects including any of the embodiments of the first and second aspects is equally applicable to the 1 9th aspect. In other words, any of the embodiments of the first and second aspects is also an embodiment of the 19th aspect including any of the embodiments of the 19th aspect.

[0106] In the 20th aspect, which is also the first embodiment of the 20th aspect, the problem underlying the present invention is , a method for screening for a pigment epithelium-derived factor (PEDF) analog, - administering VEGF intravitreally or subretinally to an animal model, - administering a pigment epithelium-derived factor (PEDF) analog candidate substance to an animal model, - determining the effect of the pigment epithelium-derived factor (PEDF) analog candidate substance after 1 to 72 hours this including, when the effect of VEGF is blocked, when no leakage of blood vessels occurs, when no increase in extracellular matrix occurs, and / or when no thickening of Bruch's membrane occurs, the pigment epithelium A method for a candidate substance of pigment epithelium-derived factor (PEDF) analog to become a PEDF analog is provided. It is solved by the method.

[0107] In the 21st aspect, which is also the first embodiment of the 21st aspect, the problem underlying the present invention is a method for screening an anti-VEGF agent, comprising: - administering VEGF intravitreally or subretinally to an animal model; - administering a candidate anti-VEGF agent to the animal model; - determining the effect of the candidate anti-VEGF agent after 1 to 72 hours. Including, when the effect of VEGF is blocked, when there is no blood vessel leakage, when there is no increase in the extracellular matrix, and / or when there is no thickening of Bruch's membrane, the candidate anti-VEGF agent becomes an anti-VEGF agent, which is solved by the method. It is solved by the method.

[0108] In the second embodiment of the 20th and 21st aspects, which is also an embodiment of the first embodiment of the 20th and 21st aspects, the animal model is the vitreous or subretinal space of an animal, preferably the animal is selected from the group including mice, rats, guinea pigs, pigs, monkeys, and apes. Selected.

[0109] In the third embodiment of the 20th and 21st aspects, which is also an embodiment of the first and second embodiments of the 20th and 21st aspects, the PEDF analog candidate substances of VEGF and the candidate anti-VEGF agent can be administered sequentially or together. It can be administered sequentially or together.

[0110] In the fourth embodiment of the 20th and 21st aspects, which is also an embodiment of the first, second, and third embodiments of the 20th and 21st aspects, blood vessels, preferably blood vessels of the eye, More preferably, the effects of VEGF on the choroidal capillary lamina, such as the effects on blood vessel leakage, the effects on extracellular matrix increase, and / or the effects on Bruch's membrane thickening, are determined for each of the pigment epithelium-derived factor (PEDF) analog candidates and anti-VEGF agent candidates. The effects on such blood vessel leakage, the effects on extracellular matrix increase, and / or the effects on Bruch's membrane thickening Based on the effects, the effects of each of the pigment epithelium-derived factor (PEDF) analog candidates and anti-VEGF agent candidates are determined.

[0111] In one embodiment of the fourth embodiment of the 20th and 21st aspects, which is also one embodiment of the fifth embodiment of the 20th and 21st aspects, the effect is an effect resulting from VEGF applied to an animal model.

[0112] In one embodiment of the sixth embodiment of the 20th and 21st aspects, which is also one embodiment of the first, second, third, fourth, and fifth embodiments of the 20th and 21st aspects, the effect is determined by means selected from the group including electron microscopy, cytochemistry, and molecular biology.

[0113] In one embodiment of the seventh embodiment of the 20th and 21st aspects, which is also one embodiment of the sixth embodiment of the 20th and 21st aspects, the means selected from molecular biology includes reverse PCR (RT-PCR) and protein characterization by mass spectrometry.

[0114] In one embodiment of the eighth embodiment of the 20th and 21st aspects, which is also one embodiment of the first, second, third, fourth, fifth, sixth, and seventh embodiments of the 20th and 21st aspects, VEGF is human VEGF.

[0115] In relation to the screening methods of the 20th and 21st aspects, when the PEDF analog candidates and anti-VEGF agent candidates are each administered subretinally, the above effects are, at the earliest, the effects of administration It will be understood by those skilled in the art that it can be observed 1 hour later. For the 20th and 21st Regarding the screening methods of the aspects of, when a PEDF analog candidate substance and an anti-VEGF agent candidate substance are each administered intravitreally, it will also be understood by those skilled in the art that the above effects can be observed as early as 12 to 24 hours after administration .

[0116] When preferably used herein, the formation of tortuous capillaries is preferably the formation of tortuous capillaries in the eye of an eye disease .

[0117] When preferably used herein, inducing the growth of the choroidal capillary lamina includes inducing the growth of a new choroidal capillary lamina or is inducing the growth of a new choroidal capillary lamina.

[0118] When preferably used herein, inducing the growth of the choroidal capillary lamina provides a choroidal capillary lamina that can replace the original choroidal capillary lamina, and preferably, the original choroidal capillary lamina is the choroidal capillary lamina of the affected part.

[0119] When preferably used herein, adhering the choroidal capillary lamina includes adhering the pathological choroidal capillary lamina.

[0120] When preferably used herein, inhibiting extracellular matrix formation includes inhibiting extracellular matrix formation against the lumen of blood vessels and / or around blood vessels .

[0121] When preferably used herein, protecting the choroidal capillary lamina includes protecting the choroidal capillary lamina from the damaging action of an anti-VEGF drug.

[0122] When preferably used herein, protecting the choroid capillary plate includes protecting the choroid capillary plate from the damaging effects of anti-VEGF drug discontinuation.

[0123] When preferably used herein, inducing angiogenesis includes generating functional blood vessels, preferably from functional blood vessels, more preferably from diseased blood vessels.

[0124] When preferably used herein, PEDF is human PEDF.

[0125] It will be understood that the pharmaceutical composition includes at least PEDF or mRNA encoding PEDF, and preferably a pharmaceutically acceptable excipient. Such excipients can be any excipient used and / or known in the art. More specifically, such excipients are any excipients discussed in connection with the manufacture of the medicaments disclosed herein. In a further embodiment, the pharmaceutical composition further comprises a pharmaceutically active agent.

[0126] The preparation of the medicaments and pharmaceutical compositions is known to those skilled in the art in view of the present disclosure. Typically, such compositions can be prepared as either a liquid solution or suspension for injection; a solid form suitable for dissolution or suspension in a liquid prior to injection; tablets or other solids for oral administration; sustained release capsules; or any other form currently in use, including eye drops, creams, lotions, ointments, inhalants, etc. The use of sterile preparations such as saline-based washes by a surgeon, physician, or healthcare provider to treat specific areas in the surgical field may also be particularly useful. The composition can also be a microdevice It may also be delivered via microparticles or sponges.

[0127] After formulation, the medicament can be administered in a manner compatible with the dosage form and in an amount that is pharmacologically effective. The formulation can be readily administered in various dosage forms, such as the types of injection solutions described above, but drug release capsules and the like can also be used. In this context, the dosage of the active ingredient administered and the volume of the composition depend on the individual or subject being treated.

[0128] The specific amount of the active compound required for administration depends on the judgment of the practitioner and is specific to each individual. Typically, the minimum volume of medicament required to disperse the active compound is utilized. Although suitable dosing regimens are also variable, it may typically be possible to initially administer the compound and monitor the results, and then administer further controlled doses at more widely spaced intervals.

[0129] The pharmaceutical composition or medicament can be sterilized and / or may contain adjuvants such as preservatives, stabilizers, wetting or emulsifying agents, solubilizing agents, salts for adjusting osmotic pressure, and / or buffers. In addition, the pharmaceutical composition or medicament may also contain other therapeutically useful substances. The composition can be prepared by conventional mixing, granulating, or coating methods and typically contains from about 0.1% to 75%, preferably from about 1% to 50%, of the active ingredient.

[0130] Liquid, especially injection compositions, can be prepared, for example, by dissolving, dispersing, etc. The active compound can be, for example, water, physiological saline, aqueous dextrose, glycerol

[0131] It is dissolved in or mixed with a pharmaceutically pure solvent such as ethanol, thereby forming an injectable solution or suspension. In addition, a solid form suitable for dissolving in a liquid before injection may be formulated.

[0132] Also, if desired, the pharmaceutical compositions and medicaments to be administered may each contain a small amount of non-toxic auxiliary substances, such as wetting or emulsifying agents, pH buffers, and other substances such as sodium acetate and triethanolamine oleate.

[0133] The dosing regimens utilizing the nucleic acid molecules and medicaments of the present invention are each selected according to a variety of factors including the patient's type, species, age, body weight, gender, and medical condition; the severity of the condition being treated; the route of administration; the patient's renal and hepatic function; and the particular aptamer or salt thereof being used. A physician or veterinarian of ordinary skill can readily determine and prescribe an effective amount of the drug required to prevent, mitigate, or halt the progression of the condition.

[0134] The present invention is further illustrated by the drawings, examples, and sequence listing from which additional features, embodiments, and advantages can be drawn. In this regard, it is as follows. BRIEF DESCRIPTION OF THE DRAWINGS

[0135]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14

Figure 15

Figure 16

Figure 17a

Figure 17b

Figure 17c

Figure 17d

Figure 17e

Figure 17f

Figure 17g

Figure 17h

Example

[0136] [Example 1: Exposure of the eye to hypoxia] Thirty-two eyes from 16 rats were exposed to mild hypoxia. Ischemia was modeled by incubating the enucleated eyes in DMEM at 4 °C for 14 hours in 15 ml Falcon tubes (one eye per tube). Hypothermia may extend the tolerance time to ischemic attack. The tubes were filled with 7 ml of DMEM and air. The tubes were stored horizontally to enhance oxygen exchange between the DMEM and air. After 14 hours, half of the eyes were embedded in paraffin for immunocytochemistry or in Epon for electron microscopy. Twelve eyes were embedded immediately after enucleation and served as controls. The oxygen pressure was measured with a calibrated fiber optic oxygen sensor (WPI, Friedberg, Germany) inserted into the vitreous of the eyes in this ex vivo experiment for comparison with the eyes of anesthetized living rats. Immediately after enucleation, the oxygen pressure decreased to 2% of the in vivo concentration and then gradually increased to reach the in vivo concentration after 1 hour. Thereafter, the in vivo oxygen concentration did not decrease.

[0137] ​

[0138] Example 2: Measurement of the inner contour of filopodia-like processes of endothelial cells Electron micrographs of choriocapillaris vessels from each plastic-embedded eyeball were taken. The inner contour of the endothelial cells was analyzed. The length of the sample was measured using iTEM image analysis software (iTEM version 5.0; Oly mpus Soft Imaging Solutions, Munster, Germ The results were analyzed using a non-parametric Mann-Whitney test. By using the settings, Microsoft Excel 2011 and IBM Analysis was performed using SPSS Statistics22 software. p<0.05 Values were considered to be significantly different between groups. The endothelial cell perimeter length was the ratio of the microvilli to the vascular lumen. The formation of epidermal processes was increased by 58% compared to the control group (p<0.001). The vessels closely correspond to the labyrinthine capillaries in human CNV (Schraermeyer, Julien et al. 2015).

[0139] Example 3: Effect of hypoxia on the choriocapillaris The choriocapillaris, which has not been exposed to hypoxia, has a fenestrated structure on the side of Bruch's membrane. The capillaries contain a thin, regular endothelium with a thin endothelium (see arrows in Figure 1). After 14 hours of hypoxia, many filopodia-like protrusions were observed in the capillary lumen. The extracellular matrix surrounding the capillaries was strengthened (Fig. 2). Arrowheads), cells appeared within Bruch's membrane (arrows). Individual filopodia within the capillary lumen were 10 μm in size. It was the length of m ultrasonography (see the arrow in Fig. 3). After hypoxia, many open gaps existed between or inside endothelial cells (see the arrow in Fig. 4).

[0140] [Example 4: Expression of VEGF and HIF-1α after Hypoxia] Control and ischemic eyes were fixed in formalin and paraffin-embedded according to standard procedures. 4 μm thick sections were cut out, deparaffinized and rehydrated, and boiled in citrate buffer (pH = 6.0) After three washing steps in TBS (pH = 7.6), immunohistochemical staining of HIF-1α and VEGF was performed in a humid chamber according to the instructions provided by the manufacturer. The slides were incubated with the primary rabbit anti-HIF-1α antibody (1:100, Abcam, Denmark) at 37 °C for 120 minutes, then treated with the DAB KO REAL detection system alkaline phosphatase / red kit rabbit / mouse and used for treatment, then counterstained with hematoxylin and covered. The same procedure was performed for the immunoreactivity analysis of VEGF using the primary mouse antibody (1:50, Gene Tex, USA) and boiled in TBS buffer (pH = 9.0).

[0141] In control rats, HIF-1α was not expressed in the choroid. After hypoxia, HIF- 1α was detected in the choroid. VEGF in control eyes was detected within the RPE. Fourteen hours after ischemia, VEGF staining further appeared in the retina and choroid.

[0142] [Example 5: Inhibition of Lacelike Capillary Formation by PEDF] Twenty micrograms of PEDF (BioVendor) was injected into 12 eyes, and then Example 1 was As described, they were exposed to hypoxia. 0.8 μl of bevacizumab (Avastin) was injected into three eyes. Six eyes were also exposed to hypoxia, but no injection was performed. Ultra-thin sections of the eyes were examined under an electron microscope.

[0143] In the case of no treatment, the choroidal capillary lamina changed into a labyrinthine capillary with gaps between endothelial cells as shown in FIGS. 1-4, collapsed, and often caused complete disappearance of the capillary lumen (see the arrow in FIG. 5). In contrast, the lumen of the choroidal capillary lamina appeared as after in vivo fixation and was well preserved (see the star in FIG. 6). The area surrounded by the inner and outer perimeters of endothelial cells per sectioned blood vessel was measured in electron micrographs of all eyes. From these measurements, the areas occupied by the entire choroidal capillary lamina, the lumen of the choroidal capillary lamina, and the endothelium were calculated. PEDF not only inhibited the formation of endothelial filopodia against the blood vessel lumen and gaps, but also significantly better preserved the blood vessel lumen than in the case of no treatment (see FIG. 7) (p < 0.0000003), and compared to Avastin treatment (p < 0.023). Also, the area of endothelial cells in sections, which is likely to be proportional to the cell volume, was significantly larger compared to untreated (see the right side of FIG. 7) (p < 0.03), but Avastin had no effect (p = 0.75).

[0144] Student's t-test was performed to compare the results of different experimental groups. Excel software was used for analysis. The error rate was 5% (p < 0.05 statistically significant).

[0145]

[0146] ​​​​​​​​​​​ [Example 6: Formation of functional adherent choroid capillary plates and Bruch's membranes after VEGF overexpression and PEDF treatment] For this project, a new vector system was designed using the same VEGF cassette as in previous adenovirus research (Julien, Kreppel et al. 2008). The human VEGF -A165 cDNA from plasmid pBLAST4 9-hVEGF (Invivogen, San Diego, CA) was inserted into the state-of-the-art AAV2 vector (subtype 4) backbone produced by Sirion Biotech GmbH (Munich, Ge rmany). The new AAV vector has the advantage of containing the RPE-specific RPE65 promoter instead of the non-specific CMV promoter previously used in adenovirus research. These new AAV vectors (e.g., AAV-VEGF) are less toxic compared to adenovec tors, have a slower expression rate with a longer expression time, and are convenient for long-term expression studies dedicated to the evaluation of drug candidates for treatment over a time frame of several months (Rolling, Le Meur et al. 2006). (Rolling, Le Meur et al. 2006). (Rolling, Le Meur et al. 2006). (Rolling, Le Meur et al. 2006).

[0147] Subretinal injection of AAV.VEGF-A165 vector into rat eyes

[0148] 2 × 109 viral particles of the AAV-VEGF vector diluted in 2 μl of PBS were subretinally injected into both eyes of 30 Long Evans rats. Briefly, after anesthesia using an intraperitoneal injection of a three-component anesthetic (fentanyl 0.005 mg / kg body weight, midazolam 2 mg / kg body weight, and medetomidine 0.15 mg / kg body weight), 1 - 2 drops of Medr (fentanyl 0.005 mg / kg body weight, midazolam 2 mg / kg body weight, and medetomidine 0.15 mg / kg body weight), 1 - 2 drops of Medr (fentanyl 0.005 mg / kg body weight, midazolam 2 mg / kg body weight, and medetomidine 0.15 mg / kg body weight), 1 - 2 drops of Medr ​Iaticum eye drops (Pharmacy of the University of Tubingen, Germany) were used to dilate the pupils, and 1 drop of topical anesthetic No Vesine (OmniVision, Puchheim, Germany) was applied. . Methocel (OmniVision, Puchheim, Germany) eye drops were used to avoid eye dryness. The injection was performed using a surgical microscope. The sclera near the corneal limbus was first incised using a 25G needle, and then 2 μl of vector suspension (2 μl contains 2 × 109 viral particles of AAV-VEGF; maximum possible dose) was subretinally (pars plana) injected using a 10 μl NanoFil syringe equipped with a NanoFil 34G blunt needle (World Prec ision Instruments). Topical antibiotic eye drops of Gentamicin-POS (registered trademark) (Ursapharm, Saarbrucken, Germany) were applied after the injection. The anesthesia was neutralized by subcutaneous injection of antidotes (naloxone 0.12 mg / kg body weight, flumazenil 0.2 mg / kg body weight, atipamezole 0 .75 mg / kg body weight). .

[0149] <Intravitreal injection> The intravitreal injection of the therapeutic substance was performed 6 weeks after the VEGF vector injection.

[0150] For the intravitreal injection, a small incision was made on the conjunctiva of the eyelid. The eyeball was rotated by gently pulling it with a set of fine pins while grasping the conjunctiva. 5 μl of volume was intravitreally injected through the hole using a 10 μl NanoFil syringe equipped with a NanoFil 34 gauge bevel needle (Worl d Precision Instruments). Performed. After injection, the needle was left in the eye for an additional 3 or 4 seconds to suppress backflow and then withdrawn. The eyeball was returned to its normal position and an antibiotic ointment was applied to the eye. The entire procedure was performed using an operating microscope equipped with illumination. Three groups were investigated.

[0151] 1) Avastin® (bevacizumab; 25 mg / ml; Roche) was intravitreally injected into 20 eyes. Avastin® was purchased and aliquoted by the Pharmacy of the University Hospital of Tübingen. 100 mg of Avastin® was diluted in a 4 milliliter vehicle solution containing 240 mg of α,α-trehalose 2H2O, 3.2 mg of Na2HPO4 H2O, 4.8 mg of NaH2PO4, and 1.6 mg of polysorbate 20.

[0152] 2) Recombinant human PEDF protein (1 μg / μl; BioVendor) was intravitreally injected into 20 eyes. The pellet of the recombinant protein was filtered (0.4 μm) and lyophilized to 0.5 mg / mL in 20 mM TRIS, 50 mM NaCl, pH 7.5. According to the product datasheet, the pellet was dissolved in deionized water (Ampuwa water) to obtain a working stock solution of 1 μg / μl.

[0153] 3) 20 eyes were not treated. In vivo imaging (SLO / OCT, FA, and ICG fluorescein fundus angiography) and quantification were performed according to (Wang, Rendahl et al. 2003). Subretinal AAV-VEGF caused RPE proliferation 5 weeks to 20 months after injection, and leakage was detected by fluorescein fundus angiography. ​ Therefore, it can be observed from 2 to 12 months. Thus, scanning laser ophthalmoscopy (SLO), optical coherence tomography (OCT), fluorescein angiography (FA), and indocyanine green angiography (ICG) were performed 6 weeks after vector injection. The eyes were re-examined 7 weeks after injection of the VEGF vector using a Spectralis(™) HRA + OCT (Heidelberg Engineering, Heidelberg, Germany) device modified according to a protocol from (Fischer, Huber et al. 2009, Huber, Beck et al. 2009) for use in animals. A 78 dpt double aspheric lens (Volk Optical, Inc., Mentor, OH 44060, U.S.A.) was directly attached to the outlet of the device, and an additional custom +3 .5 dpt contact lens was directly attached to the rat's eye. The rats were anesthetized, the pupils were dilated, and Methocel was used to treat to avoid eye dryness and for better adhesion of the 3.5 dpt lens. An ICG dye (250 μl (VERDYE, 5 mg / ml, Diagnostic Green)) was injected into the tail vein, and a fluorescein dye ( Alcon 10% (1 / 10 dilution), 250 μl) was injected subcutaneously. SLO / OCT was performed approximately 2 - 5 minutes after injection for early fluorescein angiography imaging and approximately 15 - 20 minutes after that for late fluorescein angiography imaging. Since the SLO / OCT device is calibrated for use in human eyes, the dimensions of the x and y axes are not corrected for use in rats. The dimensions of the z axis, such as retinal height, are appropriately displayed. Thus, the fluorescein fundus examinations performed here Measurement of the CNV hyperfluorescence area in contrast imaging studies was performed using the original Heidelberg calibration. The OCT data set is shown in arbitrary units (au) rather than in μm. Quantification of the thickness measurements performed is possible when the OCT data set is presented in the z-direction of the beam. , expressed in μm.

[0154] Processing of the eye for histology For electron microscopy (EM), whole eyeballs were soaked in 0.1 M cacodylate buffer (pH 7.4). The specimens were fixed overnight in 5% glutaraldehyde in a 5% aqueous solution. The lesion is then visible, allowing the lesion area to be excised and embedded.

[0155] <Statistics> Student's t-test was performed to compare the results of treated animals with the control group. Excel software was used for the analysis. The error probability was 5% (p<0.05). To avoid multiple comparisons, the results were analyzed using the Holm-Bonferroni method. Corrected.

[0156] <AAV.VEGF-A165のラット眼への網膜下注射の6週間後の蛍光眼底造影検査 CNV investigation by AAV-VEGF-induced rat CNV model as evidenced by in vivo imaging , showing fully developed CNV 6 weeks after VEGF transduction. Representative images are shown ( See Figure 8).

[0157] All 60 eyes overexpressing VEGF showed typical CN on FA and ICG imaging. V lesion-like hyperfluorescence was observed (Fig. 9), indicating 100% VEGF transduction efficacy. meant.

[0158] Hereinafter, eyes that have been successfully transfected with the VEGF vector and show CNV-like lesions are referred to as "C NV eyes", and CNV-like lesions are referred to as "CNV lesions".

[0159] All eyes were examined by fundus fluorescein angiography. Most CNV lesions showed a typical annular pattern in both FA fundus fluorescein angiography and ICG fundus fluorescein angiography. The central hypofluorescent area was surrounded by a bright hyperfluorescent ring, especially in the FA image (see the left panel of Figure 9). This pattern correlated well with OCT analysis showing distinct subretinal lesions in the hyperreflective area. In contrast, the ICG signal showed a somewhat patchy pattern that typically spread over a larger area around the hypofluorescent center of the lesion.

[0160] ICG is a dye that binds to luminal proteins and has a very long half-life. Therefore, ICG can be recorded at several time points after a single intravenous injection when retained in tissues. This is done, for example, with respect to protein leakage from CNV vessels into the surrounding tissue.

[0161] As shown in Figure 9 (see the right panel, green channel), in contrast to the FA signal, ICG hyperfluorescence shows a somewhat patchy pattern that spreads over time around the CNV lesion (within 20 minutes, and at subsequent time points, here a re-examination of ICG without additional dye injection, one week after the first fundus fluorescein angiography session). Eventually, this causes the formation of a single hyperfluorescent area in a larger field that may cover the entire eye background at later time points. However, these patterns do not change dramatically immediately after injection of additional ICG dye.

[0162] <Reduction in Thickness of CNV Lesion Area by PEDF Treatment> For each eye, the area having the entire CNV lesion area (detected by SLO fundus fluorescein angiography) was screened by OCT. The area with the maximum thickness of the lesion was determined and imaged. The maximum thickness was measured in these images. To analyze the changes induced by treatment with various agents, the difference between the measured values for each eye at 7 weeks after subretinal injection of the vector (1 week after treatment) and the corresponding values at 6 weeks after analysis (before treatment) was determined. PEDF inhibited cell proliferation and fibrosis and thus significantly reduced the thickness of CNV compared to the untreated group, but the blood vessels did not completely regress as in the Avastin group. Thus, CNV became flatter in the Avastin group (see Figure 10).

[0163] <Effect of PEDF on the Formation of New Healthy Choroid Capillary Lamina, Bruch's Membrane, and Junctional Complex> Eyes after PEDF protein treatment were examined by electron microscopy, using eyes after injection of VEGF vector without PEDF treatment as a control. Most of the prominent effects of PEDF treatment were that the newly formed choroid capillary lamina was abnormally similar to the healthy choroid capillary lamina without any treatment. The newly formed blood vessels were located directly under the RPE and formed a new Bruch's membrane (see Figure 11). The endothelial cells were thin like healthy blood vessels, associated with pericytes, developed a fenestrated structure (see Figure 12), and did not grow into the subretinal space.

[0164] In addition, the junctional complex between retinal pigment epithelial cells (Figure 14) and between The junction complex (Figure 15) was dramatically enlarged and had high electron density compared to eyes treated with the VEGF vector alone. These complexes consist of adherens junctions and tight junctions. Tight junctions also appeared between endothelial cells of the choroidal capillary lamina, but have not been previously reported in these blood vessels. It is generally recognized that the blood-retinal barrier is constructed by tight junctions of retinal blood vessels and tight junctions of the retinal pigment epithelium. The effect on junction is mediated by PEDF combined with VEGF overexpression.

[0165] PEDF also inhibited the proliferation of RPE cells and the formation of vascular protrusions containing extracellular matrix (see Figures 2 and 15). This phenomenon has also been described in a rabbit model of CNV (Julien, Kreppel et al. 2008). Such protrusions were not seen after PEDF treatment, and PEDF treatment caused the formation of a single-layer basement membrane in newly formed blood vessels, while the basement membrane was multilaminated when no treatment was performed. In addition, the subretinal space and retinal extension of newly formed blood vessels did not occur after PEDF treatment, but were seen when no PEDF injection was performed.

[0166] [Example 7: Effect of the combination of PEDF and anti-VEGF drug] The combination of PEDF and an anti-VEGF drug, such as bevacizumab (Avastin), acts synergistically to support the coordinated growth of new functional blood vessels and further improve the formation of fenestrations in the newly formed choroidal capillary lamina.

[0167] [Example 8: PEDF inhibits the formation of extracellular matrix in CNV] As shown in this example, PEDF inhibits the formation of extracellular matrix in CNV Thus, scars typical of CNV were minimized, and thus, the supply distance of oxygen and nutrients from newly formed blood vessels to the PRE and photoreceptor cells was shortened.

[0168] <Method> 2 μl of AAV.VEGF-A 165 (AAV-VEGF vector diluted in 2 μl of PBS with 2 × 10 9 individual viral particles) was subretinally injected into the eyes of 4 8-week-old Long Evans rats to induce CNV. Three weeks later, the occurrence of CNV was confirmed by in vivo examination, and 100% of the eyes (n = 48 eyes) showed CNV.

[0169] Immediately after the in vivo examination, the eyes were intravitreally treated with 4 μl of PEDF protein (10 μg) “Group 1” (n = 12 eyes) or bevacizumab (50 μg) “Group 2” (n = 12 eyes), or combination therapy (PEDF protein (10 μg) + bevacizumab (50 μg)) “Group 3” ” (n = 12 eyes). Untreated eyes were used as a control “Group 4” (n = 12 eyes ).

[0170] At week 6, a second intravitreal treatment with PEDF protein or bevacizumab, or a combination of both proteins, was performed as described for week 3. One week later, at week 7, the effect on the maturation of the extracellular matrix in CNV was evaluated by polarization microscopy.

[0171] The paraffin sections of the eyeballs were stained according to the following protocol.

[0172] <Picrosirius Red Staining Protocol> 1. Deparaffinize and hydrate in distilled water 2. Stain in Weigert's hematoxylin for 8 minutes 3. Rinse thoroughly in distilled water 4. Place in Solution A for 2 minutes 5. Rinse with distilled water 6. Place in solution B for 60 minutes 7. Place in solution C for 2 minutes 70% ethanol for 8.45 seconds 9. Dehydrate, clear, and mount 10. Slides are evaluated under a polarized light microscope (Axioplan, Zeiss). It allows different types of collagen to be distinguished by their colors: type I (red, orange) ), type III (yellow, green).

[0173] <Result> The results are shown in Figure 16.

[0174] Within the area of choroidal neovascularization, collagen was increased after injection of PEDF and Avastin. The spleen appeared green under a polarized microscope (Fig. 16, left column). The collagen content was greenish, but the amount of collagen was greater compared to the injections of both proteins. The green color indicates that the collagen was type III, typical of fibrous tissue. After injection of PEDF alone, the collagen turned orange and formed a thin layer around the blood vessels. This indicates that collagen is mature and has a high density of extracellular matrix. This indicated that new formation of matrix and blood vessels had stopped. After PEDF injection, no changes were observed even when the specimen was rotated 360 degrees. When injected, the collagen appeared greenish, similar to the results after Avastin injection (Fig. 16, center column). This accounted for most of the CNV region (not shown).

[0175] [Example 9: Mimicking Human AMD by Subretinal or Intravitreal Injection of VEGF] 100 ng of VEGF protein (hVEGF Sigma) in 2 μl of PBS was subretinally or intravitreally injected into the eyes of Long Evans rats. For controls, only PBS

[0176] The eyes were examined by electron microscopy and immunocytochemistry at 1 and 24 hours. The choroidal capillary lamina changed to tortuous capillaries, as shown in Figures 2 - 4 and previous publications on human CNV (Schraermeyer, Julien et al. 2015). In addition, there was a marked increase in the extracellular matrix within Bruch's membrane and peripherally to the choroidal capillary lamina. There were also protrusions of the extracellular matrix that induced endothelial invaginations into the vascular lumen, as shown

[0177] [Example 10: In Vitro Effects of PEDF, Bevacizumab, or a Combination of PEDF and Bevacizumab on Angiogenesis] The in vitro effects of PEDF, bevacizumab (Avastin), or a combination of PEDF and bevacizumab (Avastin) on angiogenesis were determined in an endothelial cell It is a classical in vitro assay for studying the formation effect.

[0178] <Method: Endothelial cell lumen formation assay> A 96-well plate (Corning, USA) was pre-coated with 60 μL of growth factor-reduced Matrigel (BD Biosciences, USA), and HUVEC cells (13,000 cells / well) (Promocell, Germany ) were seeded onto the plate. The wells were supplemented with PEDF alone (250 ng / mL, 500 ng / m l), bevacizumab alone (Avastin; Genentech, Inc., South S an Francisco, CA) (250 μg / mL, 1 mg / mL, 2 mg / mL) , as well as a certain concentration of PEDF (250 ng / mL) + bevacizumab (25 0 μg / mL), and PEDF (250 ng / mL) + bevacizumab (1 mg / mL) to determine the effects of these molecules on endothelial cell lumen formation. After incubation at 37 °C for 5 hours , lumen formation was analyzed in the wells using a Leica DM IL LED inverted phase contrast microscope .

[0179] <Results> The results are shown in Figures 17a - h.

[0180] In the case of PEDF at a concentration of 250 ng / mL, there was only a slight inhibition of endothelial lumen formation (Figure 17b), and complete inhibition was observed at 500 ng / mL (Figure 17c). Bevacizumab inhibited lumen formation only at a concentration of 2 mg / mL (Figure 17f). PEDF and bevacizumab at concentrations of 250 ng / mL (PEDF) and 250 μg / mL (bevacizumab) respectively Co - administration with zumab showed a much more potent inhibitory effect on lumen formation than when treated individually with the same concentration of PEDF or bevacizumab (Figure 17g). This was particularly evident for bevacizumab, which inhibited endothelial lumen formation only at a high concentration of 2 mg / mL when used alone. Thus, bevacizumab was effective in inhibiting lumen formation at a much lower concentration when co - treated with PEDF (Figures 17b and 17h). This data demonstrates the synergistic effect of PEDF and bevacizumab on the inhibition of angiogenesis, and thus on the inhibition of endothelial lumen formation.

[0181] [References] The complete bibliographic data of the documents recited herein the disclosure o f which is incorporated by reference is, if not indicated to the contrary, as fo llows. Biesemeier, A., T. Taubitz, S. Julien, E. Yoeruek and U. Schraermeyer (2014). "C horiocapillaris breakdown precedes retinal degeneration in age - related macular d egeneration." Neurobiol Aging 35(11): 2562 - 2573. Biesemeier, A. K., S. Julien and U. Schraermeyer (2014). "Choroidal neovasculari ​​​zation can help photoreceptors to survive in late AMD." Investigative Ophthalmol ogy & Visual Science 55(13). Browning, D. J., P. K. Kaiser, P. J. Rosenfeld and M. W. Stewart (2012). "Aflibe rcept for age-related macular degeneration: a game-changer or quiet addition?" A m J Ophthalmol 154(2): 222-226. Daha, N. A., N. K. Banda, A. Roos, F. J. Beurskens, J. M. Bakker, M. R. Daha and L. A. Trouw (2011). "Complement activation by (auto-) antibodies." Mol Immunol 48(14): 1656-1665. Ferrara, N., L. Damico, N. Shams, H. Lowman and R. Kim (2006). "Development of r anibizumab, an anti-vascular endothelial growth factor antigen binding fragment, as therapy for neovascular age-related macular degeneration." Retina 26(8): 859 -870. Fischer, M. D., G. Huber, S. C. Beck, N. Tanimoto, R. Muehlfriedel, E. Fahl, C. Grimm, A. Wenzel, C. E. Reme, S. A. van de Pavert, J. Wijnholds, M. Pacal, R. Br emner and M. W. Seeliger (2009). "Noninvasive, in vivo assessment of mouse retin al structure using optical coherence tomography." PLoS One 4(10): e7507. Hanhart, J., D. S. Comaneshter, Y. Freier Dror and S. Vinker (2017). "Mortality in patients treated with intravitreal bevacizumab for age-related macular degene ration." BMC Ophthalmol 17(1): 189. Hanhart, J., D. S. Comaneshter, Y. Freier-Dror and S. Vinker (2018). "Mortality associated with bevacizumab intravitreal injections in age-related macular degen eration patients after acute myocardial infarct: a retrospective population-base d survival analysis." Graefes Arch Clin Exp Ophthalmol 256(4): 651-663. Hanhart, J., D. S. Comaneshter and S. Vinker (2018). "Mortality after a cerebrov ascular event in age-related macular degeneration patients treated with bevacizu mab ocular injections." Acta Ophthalmol 96(6): e732-e739. He, T., J. Hu, G. Yan, L. Li, D. Zhang, Q. Zhang, B. Chen and Y. Huang (2015). " Pigment epithelium-derived factor regulates microvascular permeability through a dipose triglyceride lipase in sepsis." Clin Sci (Lond) 129(1): 49-61. Huber, G., S. C. Beck, C. Grimm, A. Sahaboglu-Tekgoz, F. Paquet-Durand, A. Wenze l, P. Humphries, T. M. Redmond, M. W. Seeliger and M. D. Fischer (2009). "Spectr al domain optical coherence tomography in mouse models of retinal degeneration." Invest Ophthalmol Vis Sci 50(12): 5888-5895. Julien, S., A. Biesemeier and U. Schraermeyer (2013). "In vitro induction of pro tein complexes between bevacizumab, VEGF - A(1)(6)(5) and heparin: explanation for deposits observed on endothelial veins in monkey eyes." Br J Ophthalmol 97(4): 511 - 517. Julien, S., A. Biesemeier, T. Taubitz and U. Schraermeyer (2014). "Different eff ects of intravitreally injected ranibizumab and aflibercept on retinal and choro idal tissues of monkey eyes." Br J Ophthalmol 98(6): 813 - 825. Julien, S., F. Kreppel, S. Beck, P. Heiduschka, V. Brito, S. Schnichels, S. Koch anek and U. Schraermeyer (2008). "A reproducible and quantifiable model of choro idal neovascularization induced by VEGF A165 after subretinal adenoviral gene tr ansfer in the rabbit." Mol Vis 14: 1358 - 1372. King, G. L. and K. Suzuma (2000). "Pigment - epithelium - derived factor - A key coo rdinator of retinal neuronal and vascular functions." New England Journal of Med icine 342(5): 349-351. Meyer, C. H. and F. G. Holz (2011). "Preclinical aspects of anti-VEGF agents for the treatment of wet AMD: ranibizumab and bevacizumab." Eye (Lond) 25(6): 661-6 72. Meyer, T., L. Robles-Carrillo, T. Robson, F. Langer, H. Desai, M. Davila, M. Ama ya, J. L. Francis and A. Amirkhosravi (2009). "Bevacizumab immune complexes acti vate platelets and induce thrombosis in FCGR2A transgenic mice." J Thromb Haemos t 7(1): 171-181. Papadopoulos, N., J. Martin, Q. Ruan, A. Rafique, M. P. Rosconi, E. Shi, E. A. P yles, G. D. Yancopoulos, N. Stahl and S. J. Wiegand (2012). "Binding and neutral ization of vascular endothelial growth factor (VEGF) and related ligands by VEGF Trap, ranibizumab and bevacizumab." Angiogenesis 15(2): 171-185. Peters, S., P. Heiduschka, S. Julien, F. Ziemssen, H. Fietz, K. U. Bartz-Schmidt , G. Tubingen Bevacizumab Study and U. Schraermeyer (2007). "Ultrastructural fin dings in the primate eye after intravitreal injection of bevacizumab." Am J Opht halmol 143(6): 995-1002. Rolling, F., G. Le Meur, K. Stieger, A. J. Smith, M. Weber, J. Y. Deschamps, D. Nivard, A. Mendes-Madeira, N. Provost, Y. Pereon, Y. Cherel, R. R. Ali, C. Hamel , P. Moullier and F. Rolling (2006). "Gene therapeutic prospects in early onset of severe retinal dystrophy: restoration of vision in RPE65 Briard dogs using an AAV serotype 4 vector that specifically targets the retinal pigmented epitheliu m." Bull Mem Acad R Med Belg 161(10-12): 497-508; discussion 508-499. Schraermeyer, U. and S. Julien (2012). "Formation of immune complexes and thromb otic microangiopathy after intravitreal injection of bevacizumab in the primate eye." Graefes Arch Clin Exp Ophthalmol 250(9): 1303-1313. Schraermeyer, U. and S. Julien (2013). "Effects of bevacizumab in retina and cho roid after intravitreal injection into monkey eyes." Expert Opin Biol Ther 13(2) : 157-167. Schraermeyer, U., S. Julien, A. Biesemeier, K. U. Bartz-Schmidt and H. Wolburg ( 2015). "A new kind of labyrinth-like capillary is responsible for leakage from h uman choroidal neovascular endothelium, as investigated by high-resolution elect ron microscopy." Graefes Arch Clin Exp Ophthalmol 253(5): 681-689. Schutze, C., M. Wedl, B. Baumann, M. Pircher, C. K. Hitzenberger and U. Schmidt- Erfurth (2015). "Progression of retinal pigment epithelial atrophy in antiangiog enic therapy of neovascular age-related macular degeneration." Am J Ophthalmol 1 59(6): 1100-1114 e1101. Treister, A. D., P. L. Nesper, A. E. Fayed, M. K. Gill, R. G. Mirza and A. A. Fa wzi (2018). "Prevalence of Subclinical CNV and Choriocapillaris Nonperfusion in Fellow Eyes of Unilateral Exudative AMD on OCT Angiography." Transl Vis Sci Tech nol 7(5): 19. Spaide RF, Klancnik JM, Cooney MJ. Retinal Vascular Layers Imaged by Fluorescein Angiography and Optical Coherence Tomography Angiography. JAMA Ophthalmol. 2015 ;133(1):45. Wang, F., K. G. Rendahl, W. C. Manning, D. Quiroz, M. Coyne and S. S. Miller (20 03). "AAV-mediated expression of vascular endothelial growth factor induces chor "Oidal neovascularization in rat." Invest Ophthalmol Vis Sci 44(2): 781-790.

[0182] The features of the present invention disclosed in this specification, the claims, the sequence listing, and / or the drawings can be materials for realizing the present invention in various forms in any separate and any combination thereof. The features of the present invention disclosed in this specification, the claims, the sequence listing, and / or the drawings can be materials for realizing the present invention in various forms in any separate and any combination thereof. and can be materials for realizing the present invention in various forms in any separate and any combination thereof.

Claims

1. Pigment epithelium-derived factor (PEDF) for use in a method for the treatment and / or prevention of a disease, wherein the method comprises administering PEDF to a subject, the disease is an eye disease, and the treatment and / or prevention of the disease comprises inhibiting tortuous capillary formation, inducing the growth of the choroidal capillary lamina, adhering the choroidal capillary lamina, extracellular matrix inhibiting formation, protecting the choroidal capillary lamina, and / or leading to angiogenesis, Pigment epithelium-derived factor (PEDF) for use.

2. The eye disease is age-related macular degeneration, preferably age-related macular degeneration (AMD) is atrophic age-related macular degeneration or exudative age-related macular degeneration, according to claim 1 Pigment epithelium-derived factor (PEDF) for use as described.

3. Inhibiting the growth and / or formation of geographic atrophy in exudative and / or atrophic AMD, Pigment epithelium-derived factor (PEDF) for use as described in claim 2.

4. The eye disease is selected from the group including central serous chorioretinopathy, diabetic retinopathy, iris neovascularization, corneal neovascularization, polypoidal choroidal vasculopathy, retinopathy of prematurity, and retinal and / or choroidal fibrosis, Pigment epithelium-derived factor (PEDF) for use as described in claim 1. ）。

5. The disease is retinal and / or choroidal fibrosis, and PEDF inhibits the progression of retinal and choroidal fibrosis, Pigment epithelium-derived factor (PEDF) for use as described in claim 4. 。

6. Tortuous capillary formation is preferably tortuous capillary formation in the eye of an eye disease, Pigment epithelium-derived factor (PEDF) for use as described in any one of claims 1 to 5.

7. Inducing the growth of the choroidal capillary lamina includes inducing the growth of a new choroidal capillary lamina, or inducing the growth of a new choroidal capillary lamina, according to any one of claims 1 to 6 Pigment epithelium-derived factor (PEDF) for use.

8. Inducing the growth of the choroidal capillary lamina provides a choroidal capillary lamina that can replace the original choroidal capillary lamina, preferably, the original choroidal capillary lamina is the diseased choroidal capillary lamina, Pigment epithelium-derived factor (PEDF) for use as described in any one of claims 1 to 7.

9. Adhering the choroidal capillary lamina includes adhering the diseased choroidal capillary lamina, Pigment epithelium-derived factor (PEDF) for use according to any one of claims 1 to 8.

10. Inhibiting extracellular matrix formation, including inhibiting extracellular matrix formation in the lumen of blood vessels and / or around blood vessels, Pigment epithelium-derived factor (PEDF) for use according to any one of claims 1 to 9.

11. Protecting the choroid capillary lamina, including protecting the choroid capillary lamina from the damaging effects of anti-VEGF drugs, Pigment epithelium-derived factor (PEDF) for use according to any one of claims 1 to 10.

12. Protecting the choroid capillary lamina, including protecting the choroid capillary lamina from the damaging effects caused by discontinuation of anti-VEGF drugs, Pigment epithelium-derived factor (PEDF) for use according to claim 11. 。

13. Inducing angiogenesis, including the generation of functional blood vessels, preferably functional blood vessels from diseased blood vessels, Pigment epithelium-derived factor (PEDF) for use according to any one of claims 1 to 12.

14. The pigment epithelium-derived factor (PEDF) for use according to claim 13, wherein the diseased blood vessels are a result of a diseased condition.

15. Pigment epithelium-derived factor (PEDF) for use according to any one of claims 1 to 14, which is administered intravitreally or subretinally.

16. The method further includes applying an anti-VEGF therapy, preferably, the anti-VEGF therapy includes administering an anti-VEGF drug to the subject, and the anti-VEGF drug is selected from the group consisting of pegaptanib, ranibizumab, bevacizumab, and aflibercept, Pigment epithelium-derived factor (PEDF) for use according to any one of claims 1 to 15.

17. A method for screening for pigment epithelium-derived factor (PEDF) analogs, comprising: - administering VEGF intravitreally or subretinally to an animal model; - administering a pigment epithelium-derived factor (PEDF) analog candidate substance to the animal model; - determining the effect of the pigment epithelium-derived factor (PEDF) analog candidate substance after 1 to 72 hours; If the effect of VEGF is blocked, if there is no leakage of blood vessels, if there is no increase in the extracellular matrix, and / or if there is no thickening of Bruch's membrane, the pigment epithelium-derived factor (PEDF) analog candidate substance is a pigment epithelium-derived factor (PEDF) analog. Method.

18. A method for screening an anti-VEGF agent, comprising: - administering VEGF intravitreally or subretinally to an animal model; - administering a candidate anti-VEGF agent to the animal model; - determining the effect of the candidate anti-VEGF agent 1 to 72 hours later and wherein when the effect of VEGF is blocked, when there is no occurrence of blood vessel leakage, when there is no increase in the extracellular matrix and / or when there is no thickening of Bruch's membrane, the candidate anti-VEGF agent is an anti-VEGF agent.

Images