Interleukin-27 producing b-cells and uses thereof

Isolated B-1a regulatory cells expressing LAG-3, PD-1, and CXCR4, which secrete IL-27, offer a safe and effective treatment for autoimmune diseases by suppressing the immune system, addressing the limitations of current therapies.

JP2025111489AActive Publication Date: 2025-07-30THE GOVERNMENT OF THE UNITED STATES OF AMERICA AS REPRESENTED BY THE SECRETARY DEPARTMENT OF HEALTH & HUMAN SERVICES
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
JP2025061994
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2019-06-18
Filing Date
2025-04-03
Publication Date
2025-07-30
Estimated Expiration
2040-06-18

AI Technical Summary

Technical Problem

Current treatments for autoimmune diseases such as uveitis, age-related macular degeneration (AMD), graft-versus-host disease (GVHD), and multiple sclerosis (MS) are either ineffective or have severe side effects, necessitating a safe and effective long-term treatment option.

Method used

A pharmaceutical composition comprising an isolated population of mammalian B-1a regulatory cells that express LAG-3, PD-1, and CXCR4 and produce IL-27, which is administered to suppress the immune system and treat these diseases.

Benefits of technology

The composition effectively reduces the severity of autoimmune diseases by modulating the immune response, providing a safer and more enduring treatment alternative to steroids and immunosuppressive agents.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025111489000001_ABST
    Figure 2025111489000001_ABST
Patent Text Reader

Abstract

To provide a pharmaceutical composition for use in suppressing the immune system of a mammal.SOLUTION: Provided is a pharmaceutical composition for use in suppressing the immune system of a mammal, wherein the mammal has an autoimmune disease selected from the group consisting of insulin-dependent diabetes, systemic lupus erythematosus (SLE), psoriasis, autoimmune hepatitis, thyroiditis, insulitis, orchitis, myasthenia gravis, idiopathic thrombocytopenic purpura, inflammatory bowel disease, rheumatoid arthritis (RA), scleroderma, and juvenile arthritis; and wherein the pharmaceutical composition comprises an isolated population of mammal cells comprising about 75% or more B-1a regulatory cells, the regulatory cells (a) expressing the inhibitory cell surface receptors lymphocyte-activation gene 3 (LAG-3), programmed cell death protein 1 (PD-1), and C-X-C chemokine receptor type 4 (CXCR4), and (b) producing interleukin-27 (IL-27).SELECTED DRAWING: Figure 19
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Cross - Reference to Related Applications This patent application claims the benefit of U.S. Provisional Patent Application No. 62 / 863,054, filed on June 18, 2019, which is hereby incorporated by reference in its entirety.

[0002] Statement Regarding Federally Sponsored Research and Development This invention was made with government support under Project No. Z01EY000350 - 18, by the National Eye Institute of the National Institutes of Health. The government has certain rights in this invention.

[0003] Incorporation by Reference of Electronically Submitted Material A computer - readable nucleotide / amino acid sequence listing, submitted herewith and identified as follows, is hereby incorporated by reference in its entirety: one 2,692 - byte ASCII (text) file named "749447_ST25.TXT" dated June 12, 2020.

Background Art

[0004] Uveitis, age-related macular degeneration (AMD), graft-versus-host disease (GVHD), and multiple sclerosis (MS) are diseases that initiate or progress as a result of harmful immunological activity. These diseases can cause blindness, paralysis, and serious medical conditions that affect the quality of life. Uveitis consists of a diverse group of potentially vision-threatening intraocular inflammatory diseases of infectious or autoimmune etiology, and autoreactive lymphocytes contribute to eye pathology by attacking and damaging uveal tissue. Similarly, the autoimmune process greatly contributes to the progression of retinal degeneration associated with AMD, although the process that initiates AMD has not been clearly identified. MS is partially caused by lymphocytes that attack and / or destroy myelinated neurons, thereby interfering with synaptic transmission and interneuronal communication. In GVHD, allogeneic grafts regard the recipient's body as foreign, and the transplanted tissue attacks the host individual. Steroids are effective treatments for uveitis and multiple sclerosis, but cannot be used long-term due to serious side effects. There may be side effects associated with the use of steroids and immunosuppressive agents for treating GVHD, as well as uveitis and multiple sclerosis. Furthermore, there is currently no effective treatment for AMD, and current treatments aim to slow progressive retinal degeneration. Therefore, there remains an unmet need for safe and effective long-term treatments for the aforementioned diseases.

Summary of the Invention

[0005] The present invention provides an isolated population of mammalian cells comprising at least about 75% of B-1a regulatory cells that express inhibitory cell surface receptor lymphocyte activation gene 3 (LAG-3), programmed cell death protein 1 (PD-1), and CXC chemokine receptor type 4 (CXCR4), and secrete interleukin-27 (IL-27).

[0006] The present invention also provides a method for preparing a population of mammalian cells according to an embodiment of the present invention, comprising: (a) using fluorescence-activated cell sorting (FACS) to isolate a cluster of differentiated 5-positive (CD5+) expressing cells from a sample of mammalian peripheral lymphoid tissue, mammalian cord blood, mammalian ascites, or mammalian bone marrow to provide isolated CD5+ expressing cells; (b) culturing the isolated CD5+ expressing cells in a cell culture medium to provide cultured cells; (c) activating the cultured cells with a BCR (B cell receptor) or TLR (Toll-like receptor) agonist to provide activated cells; and (d) exposing the activated cells to IL-27.

[0007] The present invention further provides a method for suppressing the mammalian immune system, comprising administering a population of mammalian cells according to an embodiment of the present invention to a mammalian.

[0008] The present invention further provides a method for treating a mammalian suffering from graft-versus-host disease, comprising administering a population of mammalian cells according to an embodiment of the present invention to a mammalian suffering from graft-versus-host disease.

[0009] The present invention provides a method for preventing or reducing the severity of graft-versus-host disease in a mammalian, comprising administering a population of mammalian cells according to an embodiment of the present invention to a mammalian before the mammalian receives an allogeneic graft.

[0010] The present invention provides a method for preventing or reducing the severity of graft-versus-host disease in a mammalian, comprising: (a) mixing a population of mammalian cells according to an embodiment of the present invention with a graft material to form a graft mixture; and (b) administering the graft mixture to a mammalian. BRIEF DESCRIPTION OF THE DRAWINGS

[0011]

Figure 1

Figure 2A

Figure 2B

Figure 2C

Figure 2D

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13A

Figure 13B

Figure 14A

Figure 14B

Figure 15

Figure 16

Figure 17

Figure 18

Figure 19

Figure 20

Figure 21

Figure 22

Figure 23

Figure 24

Figure 25

Figure 26

Figure 27

Figure 28

Figure 29

Figure 30

Figure 31

Figure 32

Figure 33

Figure 34

Figure 35

Figure 36

Figure 37

Figure 38A

Figure 38B

Figure 38C

Figure 38D

Figure 38E

Figure 39

Figure 40

Figure 41

Figure 42

Figure 43

Figure 44

Figure 45

Figure 46

Figure 47

Figure 48

Figure 49

Figure 50

Figure 51

Figure 52

Figure 53

Figure 54

Figure 55

Figure 56

Figure 57

Figure 58

Figure 59

Figure 60

Figure 61

Figure 62

Figure 63

Figure 64

Figure 65

Figure 66

Figure 67

Figure 68

Figure 69

Figure 70

Figure 71

Figure 72

Figure 73

Figure 74

Figure 75

Figure 76

Figure 77

Figure 78

Figure 79

Figure 80

Figure 81

Figure 82

Figure 83

Figure 84

Figure 85

Figure 86

Figure 87

Figure 88

Figure 89

Figure 90

Figure 91

Figure 92

Figure 93

Figure 94

Figure 95

Figure 96

Figure 97

Figure 98

Figure 99

Figure 100

Figure 101

Figure 102

Figure 103

Figure 104

Figure 105

Figure 106

Figure 107

Figure 108

Figure 109

Figure 110

Figure 111

Figure 112

Figure 113

Figure 114

Figure 115

Figure 116

Figure 117

Figure 118

Figure 119

Figure 120

Figure 121

Figure 122

Figure 123

Figure 124

Figure 125

Figure 126

Figure 127

Figure 128

Figure 129

Figure 130

Figure 131

Figure 132

Figure 133

Figure 134

Figure 135A

Figure 135B

Figure 136

Figure 137

Figure 138

Figure 139

Figure 140

Figure 141A

Figure 141B

Figure 142A

Figure 142B

Figure 143A

【Figure Figure 143B shows a set of scatter plots of human cord blood CD19+ B cells (top) or sorted B-1a cells from blood (bottom) activated with BCR, or BCR and IL-27, showing significant proliferation of IL-27-producing CD27+ CD43+ B-1a cells. ​ Figure 144 shows a representative t-SNE clustering plot and a pie chart of flow cytometry showing the distribution and relative abundance of IL-27 (i27-Breg), IL-35 (i35-Breg), and IL-10-secreting Bregs in the activated B-1 compartment of human cord blood. ​ Figure 145 is a graph and pie chart showing the amounts of various Breg subsets (e.g., i27-Bregs, i35-Bregs, and B10 cells) in cultures after human CD19+ B cells in human blood were activated for 6 days and analyzed by an intracellular cytokine assay. ​ Figure 146 shows the results of RNA-Seq analysis using RNA from conventional CD19+ B-2, i27-Breg, i35-Breg, or B10 cells. ​ Figure 147 is a graph showing a heatmap analysis of genes differentially expressed between i27-Breg cells and i35-Breg cells. ​ Figure 148 is a graph showing a heatmap analysis of genes differentially expressed between conventional CD19+ B-2 cells and i27-Breg cells. ​ Figure 149A shows a representative set of flow cytometry plots showing the percentage of IL-27-secreting CD11b+ B-1a cells after co-culture (1:1) of activated IL-27-producing B-1a and plasmacytoid dendritic cells. ​ Figure 149B is a representative bar graph showing the percentage of IL-27-secreting CD11b+ B-1a cells after co-culture (1:1) of activated IL-27-producing B-1a cells and plasmacytoid dendritic cells. ​ Figure 150 is a scatter plot showing significant suppression of EAE after immunization with MOG35-55 (n = 12) to induce EAE in recipient mice 24 hours after transplantation of IL-27-secreting peritoneal B-1a cells (> 80% i27-Bregs) purified from WT donor CD45.2+ mice into naive syngeneic CD45.1+ mice. ​ Figure 151A is a representative set of flow cytometry plots showing attenuation of EAE symptoms in mice treated with i27-Bregs, shown as the percentage of CD4+ T cells expressing IL-10, IL-17, or IFN-γ. ​ Figure 151B is a set of scatter plots showing attenuation of EAE symptoms in mice treated with i27-Bregs, shown as the percentage of CD4+ T cells expressing IL-10, IL-17, or IFN-γ. ​ Figure 152A is a representative set of flow cytometry plots showing CD19+ CD5+ CD23- B-1a cells or CD19+ CD5- CD23+ B2 cells that secrete IL-27 in the spinal cord. ​ Figure 152B is a set of scatter plots showing CD19+ CD5+ CD23- B-1a or CD19+ CD5- CD23+ B2 cells that secrete IL-27 in the brain. ​ Figure 153A is a representative set of flow cytometry plots showing CD19+ CD5+ CD23- B-1a cells or CD19+ CD5- CD23+ B2 cells that secrete IL-27 in the brain. ​ Figure 153B is a set of scatter plots showing CD19+ CD5+ CD23- B-1a cells or CD19+ CD5- CD23+ B2 cells that secrete IL-27 in the brain. ​Figure 154A is a representative set of flow cytometry plots showing CD19+ CD5+ CD23- B-1a or CD19+ CD5- CD23+ B2 cells that secrete IL-27 in the abdominal cavity. ​ Figure 154B is a set of scatter plots showing CD19+ CD5+ CD23- B-1a or CD19+ CD5- CD23+ B2 cells that secrete IL-27 in the abdominal cavity.

Mode for Carrying Out the Invention

[0012] Detailed Description of the Invention Regulatory B cells (Bregs) suppress autoimmune diseases by producing IL-10 or IL-35 alone or in combination with inhibitory cell surface receptors. However, the Bregs described so far (e.g., U.S. Patent No. 9,629,897) are antigen-specific and are derived from the B2 lymphocyte lineage. The present invention provides an isolated population of human cells comprising a non-naturally occurring high concentration population of regulatory B cells of the B-1a lineage that produce and secrete interleukin-27 (i27-Bregs).

[0013] Interleukin-27 (IL-27) is a member of the IL-12 cytokine family. IL-27 is a heterodimeric cytokine composed of two different protein subunits encoded by ebi3 (Epstein-Barr virus-induced gene 3) and IL-27p28. IL-27 is expressed by cells and interacts with the IL-27 receptor (IL-27R). The IL-27R is composed of two proteins, IL-27α (IL-27 alpha) and gpl30. IL-27 induces the differentiation of diverse populations of T cells in the immune system. Natural activation of B-1a regulatory cells by inflammatory stimuli causes IL-27 production and concurrent efflux of i27-Bregs to the spleen, reprogramming conventional lymphocytes in the spleen to acquire immunomodulatory functions.

[0014] The cell population of the present invention can comprise at least about 25% B-1a regulatory cells (e.g., at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 55% or more, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, or at least about 90% B-1a regulatory cells). A population of B-1a cells at such a relatively high percentage compared to other cell types within the cell population does not exist in the human body or in nature. B-1a cells in the human body are detected in small numbers in peripheral lymphoid tissues (<2%). Within this minority population of less than 2%, i27-Breg is less than 2% and comprises only up to about 4 / 10,000 of the naturally occurring human cell population (i.e., 0.02 × 0.02 = 0.0004).

[0015] The cell population of the present invention expresses the inhibitory cell surface receptor lymphocyte activation gene 3 (LAG-3), programmed cell death protein 1 (PD-1), and C-X-C chemokine receptor type 4 (CXCR4). The cell population can have receptors on their surface or potentially have receptors on their surface.

[0016] LAG-3 (or cluster of differentiation 223 (CD223)) is a protein encoded by the human LAG3 gene. LAG3 is an immune checkpoint receptor.

[0017] PD-1 (or cluster of differentiation 279 (CD279)) is a protein encoded by the human PDCD1 gene. PD-1 is also an immune checkpoint receptor. PD-1 promotes apoptosis of antigen-specific T cells in lymph nodes and reduces apoptosis of regulatory T cells (anti-inflammatory, inhibitory T cells).

[0018] CXCR4 (or fusin or cluster of differentiation 184 (CD184)) is a protein encoded by the human CXCR4 gene. CXCR4 is an alpha chemokine receptor specific for stromal cell-derived factor 1 (SDF-1 or CXCL12), a molecule with chemotactic activity for lymphocytes.

[0019] The cell population, optionally, also expresses the inhibitory cell surface receptor glucocorticoid-induced TNFR-related protein (GITR or tumor necrosis factor receptor superfamily member 18 (TNFRSF18) or activation-induced TNFR family receptor (AITR)). GITR is a protein encoded by the human TNFRSF18 gene. GITR has been shown to have increased expression upon T cell activation.

[0020] The cell population of the present invention optionally also expresses the inhibitory cell surface receptor OX40 (or tumor necrosis factor receptor superfamily member 4 (TNFRSF4) or cluster of differentiation 134 (CD134)). OX40 is a protein encoded by the human TNFRSF4 gene. OX40 is not constitutively expressed in resting naive T cells.

[0021] The cell population of the present invention also optionally expresses the inhibitory cell surface receptor cytotoxic T lymphocyte-associated protein 4 (CTLA4 or cluster of differentiation 152 (CD152)). CTLA4 is a protein encoded by the human CTLA4 gene. CTLA4 is an immune checkpoint that downregulates the immune response. CTLA4 is constitutively expressed in regulatory T cells but is upregulated only in conventional T cells after activation.

[0022] The population of cells of the present invention may be derived from mammals. The term "mammal" includes rodents such as mice, Lagomorpha such as rabbits, Carnivora including cats and dogs, Artiodactyla including cows and pigs, Perissodactyla including Equidae, Primates, Ceboids or Simioids (apes) and Anthropoidea (humans and great apes), but is not limited thereto. More preferably, the population of said cells is of human origin. Including, but not limited to, Simioids (apes) and Anthropoidea (humans and great apes). More preferably, the population of said cells is of human origin.

[0023] The present invention provides a method for preparing a population of cells (e.g., human cells) comprising: (a) isolating CD5+ (CD5 is expressed on the surface of T cells and B-1a cells) expressing cells from a mammalian tissue or liquid sample to provide isolated CD5+ expressing cells; (b) culturing the isolated CD5+ expressing cells in a cell culture medium to provide cultured cells; (c) activating the cultured cells with a BCR (B cell receptor) or TLR (Toll-like receptor) agonist to provide activated cells; and (d) exposing the activated cells to IL-27. In this regard, the isolation of CD5+ expressing cells can be carried out by any suitable method, for example, by using fluorescence-activated cell sorting (FACS), microfluidic cell sorting, or magnetic cell sorting.

[0024] The mammalian tissue or body fluid sample can be from any suitable source such as mammalian peripheral lymphoid tissue, mammalian cord blood, mammalian ascites, mammalian bone marrow, induced pluripotent cells (iPSCs), or other samples containing other B-1a cells. In at least some embodiments, it may be desirable to use ascites or cord blood as the sample because these sources typically have a higher percentage of B-1a cells than other samples (e.g., peripheral lymphoid tissue). In some embodiments, the preferred source of the tissue or liquid can be from the donor subject to be treated with the population of cells of the present invention.

[0025] Any suitable cell culture medium that can support the growth of B-1a cells can be used. For example, Roswell Park Memorial Institute medium (RPMI 1640) medium can be used.

[0026] The cultured cells are exposed to a BCR agonist or a TLR agonist. Any suitable BCR agonist or TLR agonist that can activate the cells can be used. Examples of BCR agonists include anti-CD40 and anti-IgM antibodies. Examples of TLR agonists include TLR9 and TLR4 agonists. As in the case of all lymphocytes, it is necessary to activate B-1a cells to elicit biological activity, and thus CD5+ B-1a cells are activated with a BCR agonist or a TLR agonist. CD40 is a co-stimulatory protein found on antigen-presenting cells and is required for the activation of B cells following the interaction of the B cell receptor with an antibody against IgM. However, for the maximum secretion of IL-27 by activated B-1a cells, an IL-27 signal provided by the binding of IL-27 to its cognate receptor on B-1a cells and further upregulation of the IL-27 receptor is required.

[0027] As used herein, the terms "Toll-like receptor" and "TLR" refer to any member of a family of highly conserved mammalian proteins that recognize pathogen-associated molecular patterns and act as important signaling elements in innate immunity. TLR polypeptides share a characteristic structure that includes an extracellular domain with leucine-rich repeats, a transmembrane domain, and an intracellular domain involved in TLR signaling.

[0028] The terms "Toll-like receptor 4" and "TLR4" refer to a publicly available TLR4 sequence and a nucleic acid or polypeptide having at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or more sequence identity thereto. A suitable TLR4 agonist is LPS.

[0029] The terms "toll-like receptor 9" and "TLR9" refer to publicly available TLR9 sequences and nucleic acids or polypeptides having at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or more sequence identity. Suitable TLR9 agonists are oligonucleotides containing CpG motifs (CpG ODNs).

[0030] The activated cells are exposed to IL-27. Exposure to IL-27 promotes the increase of i27-Bregs and efficiently and continuously increases the proportion and amount of i27-Bregs.

[0031] The method of the present invention is useful for the treatment of mammalian diseases. The treatment may result in a desirable suppression of the immune system.

[0032] The method of the present invention is useful for the treatment, suppression, or prevention of GVHD. A patient can receive a solid organ or an allogeneic bone marrow or hematopoietic stem cell graft. To prevent or reduce the severity of GVHD, the population of mammalian cells of the present invention is administered to a mammal before the mammal receives an allogeneic graft. Alternatively, GVHD can be prevented or suppressed by mixing the i27-Breg population of the cells of the present invention with a graft material to form a transplant mixture and then administering the transplant mixture to a mammal. In this regard, the graft material can contain allogeneic lymphocytes. In one embodiment, the transplanted cells are cells derived from iPS cells (e.g., heart cells, pancreatic cells, retinal cells).

[0033] The population of mammalian cells of the present invention can be mixed with a graft material ex vivo. "Ex vivo" refers to a method performed within or on cells or tissues in an artificial environment outside an organism with minimal changes to natural conditions. In contrast, the term "in vivo" refers to a method performed within an organism in its normal intact state, while the "in vitro" method is performed using components of an organism isolated from their normal biological context.

[0034] A population of mammalian cells can be administered in the form of a pharmaceutically acceptable (e.g., physiologically acceptable) composition. The composition can include a carrier, preferably a pharmaceutically (e.g., physiologically acceptable) carrier, and a population of mammalian cells. Any suitable carrier can be used within the context of the present invention, and many such carriers are known in the art. The choice of carrier will be determined, in part, by the particular site to which the composition can be administered and the particular method used to administer the composition. The composition can optionally be made sterile. The composition can be frozen or lyophilized for storage and reconstituted with a suitable sterile carrier prior to use. The composition can be prepared according to conventional techniques such as those described in Remington: The Science and Practice of Pharmacy, 21st Edition, Lippincott Williams & Wilkins, Philadelphia, PA (2001).

[0035] A population of mammalian cells can be administered to a mammal (as previously defined herein). Preferably, the mammal is a mouse or a human.

[0036] The present invention provides a method of suppressing the immune system of a mammal, the method comprising suppressing the immune system of a mammal by administering to the mammal a population of mammalian cells of the present invention. Thus, the present invention provides a method of suppressing autoimmunity in a mammal, comprising administering to the mammal an isolated population of IL-27-producing B-1a cells, wherein in vivo IL-27 production in the mammal is artificially increased to a high level, whereby autoimmunity in the mammal is suppressed. Although IL-27 is rapidly removed in vivo, administration of an isolated population of IL-27-producing B-1a cells enables the proliferation of i27-Bregs and sustained IL-27 secretion in vivo. This provides a distinct advantage over therapies that may rely on the direct administration of IL-27.

[0037] IL-27 and IL-35 are two immunosuppressive cytokines of the IL-12 family It is a preparation member. Although IL-35 or IL-27 is highly expected to suppress autoimmune diseases, the main drawbacks of using cytokines, especially heterodimeric cytokines, as biopharmaceuticals are their relatively short half-lives, transient bioactivities, and unpredictable pharmacokinetic characteristics. Another important obstacle is related to the dosing problem. Since the binding of IL-35 or IL-27 subunit proteins is not strong (non-covalent), IL-35 and IL-27 subunit proteins easily dissociate, making it difficult to confirm the administered or required effective amount to improve the disease of the bioactive p35:Ebi3 or p28:Ebi3 heterodimer. The therapeutic use of i27-Breg offers several therapeutic advantages compared to the use of biopharmaceuticals such as IL-10, IL-27, or IL-35, which are the most effective cytokines produced by Breg or Treg cells. i27-Breg proliferated in vivo, thereby sustaining the production of IL-27 in the recipient host tissue. (ii) i27-Breg generated ex vivo proliferated in vivo and reprogrammed recipient lymphocytes into IL-10, IL-27, IL-35-producing Breg and Treg, thereby being able to sustain the production of these immunosuppressive cytokines in the recipient host tissue; (iii) Disease suppression by innate i27-Breg does not require prior activation by disease-inducing self-antigens and offers potential therapeutic advantages over disease-specific Breg / Treg therapies used for autoimmune diseases.

[0038] As used herein, the term "autoimmune" refers to the inability of an organism (e.g., a mammal such as a human or a mouse) to recognize its own components as self, which results in an immune response against the organism's own cells and tissues. In other words, autoimmunity is an adaptive immune response against "self" antigens and is characterized by the production of inflammatory cytokines that mediate disease by damaging host tissues or the production of "autoantibodies" that can cause complement-mediated diseases.

[0039] "Autoimmune disease" refers to any one of a group of diseases or disorders in which tissue damage is associated with a humoral and / or cellular immune response against components of the body, or more broadly, an immune response against self. The pathological immune response can be systemic or organ-specific. For example, the immune response against self can affect joints, skin, brain, the myelin sheath that protects neurons, kidneys, liver, pancreas, thyroid, adrenal glands, eyes (such as uveitis), and ovaries. The formation of immune complexes is involved in the etiology and progression of autoimmune diseases. An increase in immune complex formation correlates with the presence of antibodies directed against self (autoantibodies). The presence of autoantibodies can contribute to tissue inflammation either as part of immune complexes or as free antibodies not bound to antigens. In some autoimmune diseases, the presence of free autoantibodies significantly affects the pathology of the disease. Another aspect of the etiology and progression of autoimmune diseases is the role of inflammatory cytokines. Under normal circumstances, inflammatory cytokines such as tumor necrosis factor-α (TNF-α) and interleukin-1 (IL-1) play a protective role in response to infection and cellular stress. However, the pathological consequences resulting from chronic and / or excessive production of TNF-α and IL-1 are thought to underlie the progression of many autoimmune diseases such as rheumatoid arthritis, Crohn's disease, inflammatory bowel disease, uveitis, and psoriasis. Other inflammatory cytokines involved in autoimmune diseases include interleukin-6, interleukin-8, and granulocyte macrophage colony-stimulating factor (see, for example, U.S. Patent No. 8,080,555).

[0040] The cell populations and methods of the present invention can be used to suppress autoimmunity associated with any autoimmune disease. There are over 80 autoimmune diseases known in the art, examples of which include multiple sclerosis (MS), insulin-dependent diabetes mellitus, systemic lupus erythematosus (SLE), psoriasis, autoimmune hepatitis, thyroiditis, pancreatitis, uveitis, orchitis, myasthenia gravis, idiopathic thrombocytopenic purpura, inflammatory bowel disease (e.g., Crohn's disease and ulcerative colitis), encephalomyelitis, systemic autoimmune diseases (e.g., rheumatoid arthritis (RA), scleroderma, and juvenile arthritis).

[0041] Autoimmunity is "suppressed" when one or more symptoms of an autoimmune disease are reduced or alleviated in a mammal (e.g., a human) afflicted with the autoimmune disease. Improvement, worsening, regression, or progression of symptoms can be determined by any objective or subjective measure, many of which are known in the art. One of ordinary skill in the art will understand that the symptoms of an autoimmune disease vary based on the disease and the location of the abnormal immune response. Symptoms common to some autoimmune diseases include, for example, fatigue, muscle and / or joint pain, muscle weakness, fever, gland swelling, inflammation, susceptibility to infection, weight gain or loss, allergies, digestive problems, blood pressure changes, and dizziness.

[0042] Using the cell populations and methods of the present invention, pancreatic inflammation can be reduced or suppressed.

[0043] The cell populations and methods of the present invention can be used to reduce or suppress the symptoms of AMD.

[0044] As used herein, terms such as "treatment," "treating," etc. refer to obtaining a desired pharmacological and / or physiological effect.

[0045] Preferably, the pharmacological and / or physiological effect is therapeutic, i.e., the effect partially or completely cures the disease and / or the adverse symptoms caused by the disease. For this purpose, the methods of the present invention include administering a "therapeutically effective amount" of an isolated IL-27-producing B-1a cell population. "Therapeutically effective amount" refers to an amount effective at the dosage and for the period required to achieve the desired therapeutic result. The therapeutically effective amount can vary depending on factors such as the medical condition, age, sex, and body weight of the individual, as well as the ability of the IL-27-producing B-1a cell population to induce the desired response in the individual.

[0046] Alternatively, the pharmacological and / or physiological effect can be prophylactic, i.e., the effect completely or partially prevents an autoimmune disease or its symptoms. In this regard, the method of the present invention comprises administering to a mammal having a predisposition to an autoimmune disease or otherwise at risk of developing, an "effectively prophylactic amount" of an isolated IL-27-producing B-1a cell population. "Effectively prophylactic amount" refers to an amount effective at the required dosage and duration to achieve the desired prophylactic result (e.g., prevention of onset or prevention of disease relapse).

[0047] A composition comprising the isolated IL-27-producing B-1a cell population of the present invention or an isolated IL-27-producing B-1a cell population can be administered to a mammal using any suitable administration technique, many of which include oral, intravenous, intraperitoneal, subcutaneous, pulmonary, transdermal, intramuscular, intranasal, intraoral, sublingual, or suppository administration and are known in the art. The composition is preferably suitable for parenteral administration. As used herein, the term "parenteral" includes intravenous, intramuscular, subcutaneous, rectal, vaginal, and intraperitoneal administration. More preferably, the composition is administered to a mammal using peripheral systemic delivery by intravenous, intraperitoneal, or subcutaneous injection.

[0048] When the method of the present invention comprises administering an isolated IL-27-producing B-1a cell population to a mammal, the isolated IL-27-producing B-1a cell population is administered to the mammal in a dosage sufficient to produce IL-27 and induce the generation of B cells that suppress the mammal's autoimmunity. The therapeutic or prophylactic effect can be monitored by periodically evaluating the treated patient. In the case of repeated administration over several days, depending on the condition, treatment is repeated until the desired suppression of the disease symptoms occurs. However, other dosing schedules may be useful and are within the scope of the present invention. The desired dosage can be delivered by single bolus administration of the composition, multiple bolus administrations of the composition, or continuous infusion administration of the composition. Returned. However, other dosing schedules may be useful and are within the scope of the present invention. The desired dosage can be delivered by single bolus administration of the composition, multiple bolus administrations of the composition, or continuous infusion administration of the composition.

[0049] Typical amounts of cells administered to a mammal (e.g., a human) can range, for example, from 500,000 to 100 million cells, although amounts below or above this exemplary range may be appropriate in the context of the present invention. For example, the daily dose of cells can be from about 0.5 million to about 50 million cells (e.g., about 5 million cells, about 15 million cells, about 25 million cells, about 35 million cells, about 45 million cells, or a range defined by any two of the foregoing values, preferably from about 10 million to about 100 million cells (e.g., about 20 million cells, about 30 million cells, about 40 million, about 60 million cells, about 70 million cells, about 80 million cells, about 90 million cells, or a range defined by any two of the foregoing values), more preferably from about 10 million cells to about 50 million cells (e.g., about 12 million cells, about 25 million cells, about 35 million cells, about 45 million cells, or a range defined by any two of the foregoing values).

[0050] The present invention can be used in combination with other existing treatments for autoimmune diseases. For example, the cell population of the present invention can be administered in combination with immunosuppressive agents, immunomodulatory agents or other anti-inflammatory agents for the treatment or prevention of autoimmune diseases such as those disclosed herein. In this regard, the methods of the present invention can be used in combination with disease-modifying anti-rheumatic drugs (DMARDs) (e.g., gold salts, sulfasalazine, anti-malarial agents, methotrexate, D-penicillamine, azathioprine, mycophenolic acid, cyclosporine A, tacrolimus, sirolimus, minocycline, leflunomide, and glucocorticoids).) calcineurin inhibitors (e.g., cyclosporin A or FK506), modulators of lymphocyte recirculation (e.g., FTY720 and FTY720 analogs), mTOR inhibitors (e.g., rapamycin, 40-O-(2-hydroxyethyl)-rapamycin, CCI779, ABT578, AP23573, or TAFA-93), ascomycins having immunosuppressive properties (e.g., ABT-281, ASM981, etc.), corticosteroids, cyclophosphamide, azathioprine, methotrexate, leflunomide, mizoribine, mycophenolic acid, mycophenolate mofetil, 15-deoxyspergualin, or its immunosuppressive homologs, analogs or derivatives, immunosuppressive monoclonal antibodies (e.g., monoclonal antibodies against leukocyte receptors such as MHC, CD2, CD3, CD4, CD7, CD8, CD25, CD28, CD40, CD45, CD58, CD80, CD86, etc., or their ligands), other immunomodulatory compounds, adhesion molecule inhibitors (e.g., LFA-1 antagonists, ICAM-1 or -3 antagonists, VCAM-4 antagonists, or VLA-4 antagonists), chemotherapeutic agents (e.g., paclitaxel, gemcitabine, cisplatinum, doxorubicin, or 5-fluorouracil), anti-TNF agents (e.g., monoclonal antibodies against TNF such as infliximab, adalimumab, CDP870, etc., or receptor constructs against TNF-RI or TNF-RII such as ENBREL™ (Etanercept) or PEG-TNF-RI, blockers of pro-inflammatory cytokines, IL-1 blockers (e.g., KINERET™ (anakinra) or IL-1 trap, AAL160, ACZ 885, and IL-6 blockers), chemokine blockers (e.g., protease inhibitors or activators), anti-IL-15 antibodies, anti-IL-6 antibodies, anti-CD20 antibodies, NSAIDs, and / or anti-infective agents can be used in combination.

[0051] The present invention can be used in combination with the administration of B cells that produce interleukin-35 (IL-35). B cells that produce IL-35 (i35-Breg) can be administered to a mammal sequentially (before or after) or simultaneously with the cell population of the present invention. It can be done.

[0052] Embodiments of the present invention can be beneficial alone or in combination with one or more other embodiments. Without limiting the foregoing description, specific non-limiting embodiments of the present invention are provided below as embodiments numbered 1 to 26. As will be apparent to those skilled in the art upon reading this disclosure, each of the individually numbered embodiments can be used or combined with any of the preceding or subsequent individually numbered embodiments. Accordingly, the present invention provides all combinations of these embodiments and is not limited to the combinations of embodiments explicitly provided below.

[0053] (1) (a) Expressing the inhibitory cell surface receptor lymphocyte activation gene 3 (LAG-3), programmed cell death protein 1 (PD-1), and C-X-C chemokine receptor type 4 (CXCR4), and (b) Secreting interleukin-27 (IL-27), An isolated population of mammalian cells comprising about 75% or more B-1a regulatory cells.

[0054] (2) The population of mammalian cells according to embodiment (1), wherein the regulatory cells further express the inhibitory cell surface receptor glucocorticoid-induced TNFR-related protein (GITR).

[0055] (3) The population of mammalian cells according to embodiment (1) or (2), wherein the regulatory cells further express the inhibitory cell surface receptor OX40.

[0056] (4) A population of mammalian cells according to any one of embodiments (1) to (3), wherein the regulatory cells further express inhibitory cell surface receptor cytotoxic T lymphocyte-associated protein 4 (CTLA4).

[0057] (5) A method for preparing a population of mammalian cells according to any one of embodiments (1) to (4), comprising: (a) Using fluorescence-activated cell sorting (FACS), isolating differentiated cluster 5 positive (CD5+) expressing cells from a sample of mammalian peripheral lymphoid tissue, mammalian cord blood, mammalian ascites, induced pluripotent cells (iPSCs), or mammalian bone marrow, and providing the isolated CD5+ expressing cells; (b) Culturing the isolated CD5+ expressing cells in a cell culture medium to provide cultured cells; (c) Activating the cultured cells with a B cell receptor (BCR) or Toll-like receptor (TLR) agonist to provide activated cells; and (d) Exposing the activated cells to IL-27.

[0058] (6) A method for suppressing the immune system of a mammal, comprising administering to the mammal a population of mammalian cells according to any one of embodiments (1) to (4).

[0059] (7) The method according to embodiment (6), further comprising sequentially or simultaneously administering to the mammal B cells that produce interleukin-35 (IL-35).

[0060] (8) The method according to embodiment (6) or (7), wherein the administration treats the disease of the mammal.

[0061] (9) The method according to any one of embodiments (6) to (8), wherein the mammal has an autoimmune disease.

[0062] (10) The method according to embodiment (9), wherein the autoimmune disease is an eye disease.

[0063] (11) The method according to embodiment (9), wherein the autoimmune disease is a disease of the central nervous system.

[0064] (12) The method according to embodiment (9), wherein the autoimmune disease is a disease of the brain.

[0065] (13) The method according to embodiment (9), wherein the autoimmune disease is uveitis.

[0066] (14) The method according to embodiment (9), wherein the autoimmune disease is encephalomyelitis.

[0067] (15) The method according to any one of embodiments (6) to (8), wherein the mammal has multiple sclerosis.

[0068] (16) The method according to any one of embodiments (6) to (8), wherein the administration suppresses inflammation of the pancreas.

[0069] (17) The method according to embodiment (6) or (7), wherein the mammal has received a graft of allogeneic bone marrow or hematopoietic stem cells.

[0070] (18) The method according to embodiment (6) or (7), wherein the mammal has received an allogeneic solid organ graft.

[0071] (19) The method according to embodiment (17) or (18), wherein the mammal has graft-versus-host disease (GVHD).

[0072] (20) The method according to any one of embodiments (6) to (8), wherein the mammal has age-related macular degeneration (AMD).

[0073] (21) A method for treating a mammal having graft-versus-host disease, the method comprising administering to the mammal having graft-versus-host disease a population of mammalian cells according to any one of embodiments (1) to (4).

[0074] (22) The method according to embodiment (21), wherein the mammal has received an allogeneic bone marrow or hematopoietic stem cell graft before administration of the population of mammalian cells.

[0075] (23) The method according to embodiment (21), wherein the mammal has received an allogeneic solid organ graft before administration of the population of mammalian cells.

[0076] (24) A method for preventing or reducing the severity of graft-versus-host disease in a mammal, comprising administering to the mammal a population of mammalian cells according to any one of embodiments (1)-(4) before the mammal receives an allogeneic graft.

[0077] (25) The method according to embodiment (24), wherein the allogeneic graft is an allogeneic bone marrow or hematopoietic stem cell graft.

[0078] (26) The method according to embodiment (24), wherein the allogeneic graft is an allogeneic solid organ graft. [[ID=…]]

[0079] (27) A method for preventing or reducing the severity of graft-versus-host disease in a mammal, comprising: (a) mixing a population of mammalian cells according to any one of embodiments (1)-(4) with a graft material to form a transplant mixture, and (b) administering the transplant mixture to the mammal.

[0080] (28) The method according to embodiment (27), wherein the graft material comprises allogeneic lymphocytes.

[0081] (29) The population of mammalian cells according to any one of embodiments (1)-(4), or the method according to any one of embodiments (5)-(28), wherein the mammal is a human.

Examples

[0082] The following examples further illustrate the present invention, but of course should not be construed as limiting its scope.

[0083] The following materials and procedures were used in Examples 1-5.

[0084] CD19 of mouse and human PBMCs and human umbilical cord blood + B cells. 6- to 8-week-old C57BL / 6J and IL-27RαKO mice were purchased from Jackson Laboratory (Bar Harbor, Maine). Female mice were used and mice were randomized for all studies described. Human peripheral blood mononuclear cells (PBMCs) were obtained from the National Institutes of Health (NIH) Blood Bank, which is managed by the NIH Blood Transfusion Service. Primary human umbilical cord blood CD19 + B cells were purchased from STEMCELL™ Technologies (Vancouver, Canada).

[0085] Isolation of mouse and human B cells. PBMCs from normal human subjects were isolated from buffy coats by density gradient centrifugation using commercially available lymphocyte separation medium (Mediatech Inc., Manassas, Virginia). Human CD19 +B cells were sorted using anti-CD19 antibody-conjugated magnetic beads (Miltenyl Biotec, Bergisch Gladbach, Germany). Mouse B2 cells were isolated from the spleen using a B cell isolation kit (130-090-862), CD19 microbeads (130-052-201), and a plasmacyte isolation kit (130-092-530) (all available from Miltenyl Biotec). B1 cells were isolated from the peritoneal cavity of C57BL / 6J mice. Some mice were immunized with LPS in the presence or absence of IL-27. For B-1a cells, isolation was performed in a two-step procedure using the B-1a Cell Isolation Kit; catalog number 130-097-413) as recommended by the manufacturer. Briefly, B-1a cells from the peritoneal cavity were negatively selected using a MACS (trademark) magnetic cell column consisting of magnetic beads labeled with a cocktail of biotin-conjugated non-B-1a antibodies and B-1a cells. Next, B-1a cells were positively selected using magnetic beads conjugated to a B-1a specific antibody.

[0086] Immunofluorescence staining and confocal imaging analysis CD19 + B cells were activated in vitro for 48 h by stimulation with LPS or anti-CD40 / anti-IgM antibodies in the presence or absence of IL-27. Cells were fixed and blocked with 5% goat serum, then incubated with a fluorescently labeled anti-p28 (Invitrogen, Waltham, MA) or anti-Ebi3 antibody (Santa Cruz Biotechnology, Dallas, TX). Cells were washed and incubated with an ALEXA FLUOR (trademark) 568-, ALEXA FLUOR (trademark) 488-, or ALEXA FLUOR (trademark) 647-labeled secondary antibody (Invitrogen) containing 4’,6-diamidino-2-phenylindole (DAPI), and laser scanning confocal point microscopy (FV1000, Olympus Corporation, Tokyo, JP, or LSM700, Carl s AG) (see Oh et al., J.Biol. Chem., 287:30436-30443 (2012)).

[0087] Experimental autoimmune uveitis (EAU) EAU was performed using 0.2 ml emulsion containing interphotoreceptor retinoid-binding protein (IRBP) in complete Freund's adjuvant (CFA) containing Mycobacterium tuberculosis strain H37RA (2.5 mg / ml) at a 1:1 volume ratio. 651-670 This was induced by active immunization of C57BL / 6J and IL-27RαKO mice with the peptide. Mice were also administered Bordetella pertussis toxin (1 μg / mouse) at the same time as immunization. Mice were treated on day -1 and post-immunization. Mice were treated every other day until day 12 with intraperitoneal injections of IL-27 (100 ng / mouse) or phosphate-buffered saline (PBS). Eight mice were used per group in each study, and the mice were age- and sex-matched. Clinical disease was established and scored by fundus examination and histology (see Wang et al., Nat. Med., 20:633-641 (2014) and Oh et al., J. Immunol., 187:3338-3346 (2011)). Ocular disease severity was examined using a binocular microscope with coaxial illumination. Eyes for histology were enucleated 21 days after immunization, fixed in 10% buffered formalin, and serially sectioned in the perpendicular interpupillary optic nerve plane. All sections were stained with hematoxylin and eosin.

[0088] Fundus examination Fundus examinations were performed on days 10 to 21 after EAU induction. Briefly, following general administration of general anesthesia (intraperitoneal injection of ketamine (1.4 mg / mouse) and xylazine (0.12 mg / mouse)), the pupils were dilated by topical administration of 1% tropicamide eye drops (Alcon Inc., Fort Worth, Texas). Fundus images were captured using a Micron III retinal imaging microscope for small rodents (Phoenix Research Labs, Pleasanton, California) or a modified Karl Storz veterinary endoscope combined with a Nikon D90 digital camera (see Oh et al., (2012), supra, and Paques et al., Invest Ophthalmol. Vis. Sci., 48:2769 - 2774 (2007)). To avoid subjective bias, masked observers evaluated the fundus photographs without knowledge of the mouse identity. By placing the endoscope and observing from the superior, inferior, lateral, and medial fields of view, at least six images (two central posterior retinal images, four peripheral retinal images) were taken from each eye to identify, map, and record individual lesions. A clinical evaluation system for retinal inflammation was used (see Xu et al., Exp. Eye Res., 87:319 - 326 (2008), and Chan et al., J. Autoimmun., 3:247 - 255 (1990)).

[0089] Imaging of the Mouse Retina by Spectral Domain Optical Coherence Tomography (SD - OCT) Optical coherence tomography (OCT) is a noninvasive technique that allows visualization of the internal microstructure of various ocular structures in living animals. An SD-OCT system (Bioptigen Inc., Morrisville, NC) equipped with an 820 nm central wavelength broadband light source was used for in vivo noncontact imaging of control or EAU mouse eyes. Mice were anesthetized, and their pupils were dilated as described above. Next, the mice were immobilized using an easily rotatable, adjustable holder that allowed for horizontal or vertical scan scanning. Each scan was performed at least twice, with readjustment each time. The scan dimensions (depth and lateral extent) were adjusted until optimal signal intensity and contrast were achieved. Retinal thickness was measured from the central retinal region of all images obtained from both horizontal and vertical scans from the same eye using the system software and averaged. Retinal thickness was determined in the system software using known methods (see Gabriele et al., Invest. Ophthalmol. Vis. Sci., 52: 2250-2254 (2011)).

[0090] Electroretinogram (ERG) Before ERG recording, mice were dark-adapted overnight and experiments were performed under dim red light. Mice were anesthetized with a single intraperitoneal injection of ketamine (1.4 mg / mouse) and xylazine (0.12 mg / mouse), and pupils were dilated with MIDRIN™ P (Santen Pharmaceutical, Osaka, Japan) containing 0.5% tropicamide and 0.5% phenylephrine hydrochloride. ERGs were recorded using an electroretinography console (Espion E2; Diagnosys LLC, Lowell, MA) that generates and controls light stimuli. Dark-adapted ERGs were recorded using a single flash in a Ganzfeld dome, with intensities ranging from -4 to 1 log cd s / m. 2 , delivered in 6 steps. The light-adapted ERG was 20 cd / m 2 The background was obtained, and the light stimulus was 0.3 to 30 cd s / m in 5 steps. 2It was started. The Gonioscopy Prism Solution (Alcon Labs, Fort Worth, Texas) was used to provide good electrical contact and maintain the moisture of the cornea. The reference electrode (gold wire) was placed in the mouth and the ground electrode (subcutaneous stainless-steel needle) was placed at the base of the tail. The signals were differentially amplified and digitized at a rate of 1 kHz. The amplitudes of the major ERG components (a-wave and b-wave) were measured using both automatic and manual methods (Espion software; Diagnosys LLC, Lowell, Massachusetts). Immediately after the ERG recording, fundus imaging was performed as described above.

[0091] Isolation of retinal cells To characterize the inflammatory cells passing through the blood-retinal barrier during EAU, mice were anesthetized and perfused with 1×PBS. To immediately isolate the retina under an anatomical microscope, the enucleated eyes were placed in a Petri dish containing culture medium (Roswell Park Memorial Institute medium (RPMI 1640)). The eyes were cut along the corneal limbus, and the lens and cornea were carefully removed. Next, the retina was detached, and the attached optic nerve was removed. Then, the newly isolated retina was digested with collagenase (1 mg / ml) in RPMI 1640 medium containing 10 μg / ml DN ase (Sigma-Aldrich, St. Louis, Missouri) at 37 °C for 2 hours. During incubation, the cells were intermittently pipetted every 30 minutes, and the digestion reaction was stopped with 5 - 10 times the volume of 10% fetal bovine serum (FBS) in RPMI 1640 medium. The cells were washed twice with complete RPMI 1640 medium, and the cells were counted using a VI-CELL™ XR cell viability analyzer (Beckman Coulter, Brea, California).

[0092] Co-culture of cells Budding cells isolated from the lymph nodes and spleens of mice with EAU, B-1a, macrophages, and dendritic cells were isolated from EAU-immunized mice on day 17. B-1a, macrophages, and dendritic cells were separated by magnetic column beads (Miltenyi Biotech). Co-culture experiments were performed in a Transwell system (Corning Incorporated, Corning, New York) with RPMI 1640 medium containing 10% FBS. After seeding budding cells or B-1a cells (5×10 5 cells) in the lower well, macrophages or dendritic cells (5×10 5 cells) were seeded in the upper chamber (pore size: 0.4 pm) and restimulated with IRBP 651-670 (20 μg / ml). Cells were harvested for analysis by flow cytometry and thymidine incorporation assay 72 hours after co-culture. For functional analysis of human B-1a cells, CD19 + CD20 + CD27 + CD43 + B1 cells were purified by cell sorting and stimulated with anti-CD40 (10 μg / ml) and anti-IgM (5 μg / ml) for 72 hours in the presence or absence of rhIL-27 (100 ng / ml).

[0093] Experimental autoimmune encephalomyelitis (EAE) EAE was induced by subcutaneous immunization with 200 μg of myelin oligodendrocyte glycoprotein peptide 35-55 (MOG 35-55 )(Sigma-Aldrich) in CFA emulsion containing 2.5 mg / ml of heat-killed and pulverized Mycobacterium tuberculosis H37RA strain. Mice were also injected intraperitoneally (i.p.) twice on day 0 and 2 days after immunization with 0.3 μg of pertussis toxin (Sigma-Aldrich) in 100 μl of RPMI 1640 medium containing 0.1% normal mouse serum. Some mice received MOG 35-55 ​Simultaneously with immunization and every other day until day 12 after immunization, IL-27 (100 ng / mouse) was administered. The control group or IL-27 treatment group (n = 12) was euthanized on day 17 of immunization. Mice were monitored and masked observers evaluated the disease severity daily. The clinical signs of EAE were graded according to the following scale: 0, no clinical symptoms; 1, delicate motor impairment, incontinence or flaccid bladder, floppy tail; 2, mild paraparesis (trouble initiating movement); 3, moderate paraparesis (hindlimb weakness); 4, complete paralysis of forelimbs and hindlimbs; 5, moribund state (see Liu et al., J. Immunol., 180:6070-6076 (2008)). Spinal cords and brains were harvested 17 days after immunization and stained with hematoxylin and eosin (H&E). In adoptive transfer studies, EAE mice treated with or without IL-27 were sacrificed on day 10 after immunization and used as donors for the passive induction of EAE by adoptive transfer of encephalitogenic cells. Spleen cells were isolated and 35-55 stimulated with MOG 6 peptide (20 μg / ml) and anti-CD40 antibody (10 μg / ml) in the presence or absence of IL-27 for 3 days and transplanted intravenously (i.v.) into naive syngeneic recipients. Mice (10×10

[0094] Adoptive transfer of B-1a cells B-1a cells were isolated from the peritoneal cavities of donor mice and sorted using magnetic beads. B-1a cells were cultured for 48 h in complete RPMI 1640 containing LPS (1 μg / ml), washed (2×) to remove residual LPS, and adoptively transferred (5×l0 5 cells) into C57BL / 6J and IL-27RαKO mice.

[0095] In vivo model of LPS-induced inflammation LPS (50 μg / mouse) was injected into C57BL / 6J mice, and some mice were administered IL-27 (100 ng / mouse) 1 hour before LPS injection by intravenous injection. Mice in the control group and the IL-27 treatment group (n = 5) were euthanized 24 hours after injection, and splenocytes were subjected to fluorescence-activated cell sorting (FACS) analysis.

[0096] Proliferation assay Brucella-forming cells or B-1a cells were collected from IRBP-immunized C57BL / 6J or IL-27RαKO mice on the 17th day after immunization. The cells were restimulated in vitro with IRBP peptide for 72 hours in the presence or absence of B-1a, dendritic cells, and macrophages. For in vitro studies, CD19 + B cells were stimulated with anti-CD40 antibody (10 μg / ml) and anti-IgM antibody (5 μg / ml) in the presence or absence of IL-27. In the last 24 hours of culture, the cells were 3 pulsed with H-thymidine (0.5 μCi / 10 μl / well). The presented data are the mean CPM ± S.E.M of the responses of five replicate cultures.

[0097] Detection of cytokine-expressing lymphocytes by FACS CD19 +B cells (>98%) were either stimulated with LPS (2 μg / ml) or activated with anti-CD40 antibody (10 μg / ml) and anti-IgM antibody (5 μg / ml) as described above. For intracellular cytokine detection, cells were restimulated with phorbol myristate acetate (PMA) (50 ng / ml) / ionomycin (500 ng / ml) for 5 h. GOLGIPLUG™ (BD Pharmingen, San Diego, CA) was added during the last 3 h, and intracellular cytokine staining was performed using the recommended BD CYTOFIX / CYTOPERM™ kit (BD Pharmingen). FACS analysis was performed on a MACSQUANT™ analyzer (Miltenyi Biotec) using protein-specific monoclonal antibodies and corresponding isotype control antibodies (BD Pharmingen) (Amadi-Obi et al., Nat.Med.,13:711-718(2007), and Wang et al., Nat.Med.,20:633-641(2014).). FACS analysis was performed on samples stained with monoclonal antibodies conjugated to fluorescent dyes (including CD19, CD20, CD24, CD27, CD38, CD43, CD138, and CD11b). Cells were color-corrected, and quadrant gates were set using isotype controls with < 0.3% background. Live cells were subjected to side scatter (SSC) and forward scatter (FSC) analysis.

[0098] Characterization of regulatory B cells (Breg) and regulatory T cells (T reg) Primary B cells isolated from the brain, spinal cord, retina, peritoneal cavity, blood, spleen, or draining regional lymph nodes (LN) of naive EAE or EAU mice were gated on CD19 + cells and used for surface and intracellular FACS analysis. Some cells were stimulated with LPS, IRBP 651-670 -peptide and anti-CD40 antibody, MOG 35-55-peptides and reactivated with anti-CD40 (see Wang et al., Nat. Med., 20:633-641 (2014), and Choi et al., Front Immunol., 8:1258 (2017)). For intracellular cytokine detection, cells were restimulated with PMA (50 ng / ml) and ionomycin (500 ng / ml) for 5 hours. GOLGIPLUG™ (BD Pharmingen) was added during the last 1 hour, and intracellular cytokine staining was performed using the recommended BD BD CYTOFIX / CYTOPERM™ kit (BD Pharmingen). FACS analysis was performed on a MACSQUANT™ analyzer (Miltenyi Biotec) using protein-specific monoclonal antibodies and corresponding isotype control antibodies (BD Pharmingen) as described above. Dead cells were stained with a dead cell exclusion dye (Fixable Viability Dye EFLUOR™ 450, Thermo Fisher Scientific), and live cells were subjected to side scatter (SSC) and forward scatter (FSC) analysis. Breg and Treg cells were characterized by analysis of the expression of CD4, CD19, CD5, CD27, CD38, CD138, B220, CD1d, IL-10, p28, p35, or Ebi3. FACS analysis was performed on cells stained with monoclonal antibodies conjugated to fluorescent dyes, excluding dead cells, and each tube of cells was color-corrected. Quadrant gates were set using isotype controls with a background of less than 0.5%.

[0099] Gene deletion via CRISPRJCas9 sgRNAs were generated using a known method (see Sanjana et al., Nat. Med., 11:783 - 784 (2014)) and cloned into lentiCRISPR v2 and pMD2.G. The sgRNAs were selected by CRISPRSCAN, an online tool that racks sgRNA sites by on - target binding efficiency and off - target hit probability. For IL - 27, three sgRNAs were selected and cloned into a lentiviral vector carrying an SpCas9sgRNA scaffold driven by the U6 promoter. The sgRNA sequences were as follows: for the sgp28 target site 1, 5’ - GCTTCCTCGCTACCACACT - 3’ (SEQ ID NO: 1), site 2; 5’ - GGGCCATGAGGCTGGATCTC - 3’ (SEQ ID NO: 2); site 3 5’ - GATGGTATCCCAGGGGCAGG - 3’ (SEQ ID NO: 3). For Ebi3 targeting, the same lentiviral vector was used for cloning of the three sgRNAs. 5’ - GTCGGGGATGGTGCATCGGG - 3’ (SEQ ID NO: 4); site 2 5’ - TCTCTGATGGGTCACTAACT - 3’ (SEQ ID NO: 5); site 3 5’ - CAGGAGCAGTCCACGGCCAC - 3’ (SEQ ID NO: 6). To delete IL - 27, purified B - 1a cells or macrophages were transduced with lentiviral clones expressing the sgRNAs. Two days after infection, the cells were activated with LPS for 48 hours and analyzed by FACS or ELISA.

[0100] Detection of cytokine secretion by ELISA CD19 + B cells or B - 1a cells were activated in vitro in the presence or absence of LPS, anti - CD40, and anti - IgM and / or IL - 27. Supernatants were harvested after 48 hours of culture. IL - 27 and IL - 35 were quantified using a heterodimer ELISA kit specific for mouse IL - 27 or IL - 3(5) (BioLegend, San Diego, CA). IL - 17 or IL - 10 was quantified using an R&D Systems kit as recommended by the manufacturer.

[0101] RNA extraction, NanoString analysis, and PCR Total RNA was isolated from the peritoneal cavity or spleen using the RNEASY (trademark) plus mini kit (Qiagen, Hilden, Germany). cDNA synthesis, RT-PCR, and qPCR analysis were performed according to known techniques (see Amadi-Obi et al., Nat. Med., 13:711-718 (2007)). Each gene-specific primer pair used for RT-PCR analysis spans at least one intron The following primers and probes used for qPCR were purchased from Applied Biosystems (Foster City, California): IRF8 (Mm_00492567), IRF4 (Mm_00516431), BCL6 (Mm_00477633), Blimpl (Mm_00476128), Pax5 (Mm_00435501), Lag-3 (Mm_01185091), PD-1 (Mm_00435532), IL-27 (Mm_004461162), IL-12a (Mm_00434169), IL-10 (Mm_00439614), IL-27Rα (Mm_00497259), p21 (Mm_00817699), p27 (Mm_00438168), Cdk1 (Mm_00772472), Cdk2 (Mm_00443947), Cdk4 (Mm_00726334). mRNA expression was normalized to the level of the GADPH (Mm_99999915) gene. For NanoString nCounter analysis, a total of 100 ng of RNA per sample was used. A custom nCounter gene expression CodeSet immunology panel was used. Data were normalized using housekeeping genes and analyzed with nSolver Analysis software version 3

[0102] Immunoprecipitation and immunoblotting Whole cell lysates were prepared according to known techniques (see Li et al., Invest. Ophthalmol. Vis. Sci., 40:976-982 (1999)). Clarified lysates or cell supernatants were immunoprecipitated with antibodies pre-bound to protein G-Sepharose beads according to known techniques (see Oh et al., J. Biol. Chem., 286:30888-30897 (2014)). Immunoprecipitates were separated by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE), and the blots were probed with specific antibodies. The following antibodies were used for immunoprecipitation and / or Western blotting: p28 (Invitro gen), Ebi3, and β-actin (Santa Cruz Biotechnology). Pre-immune sera were used in parallel as controls, and signals were detected with HRP-conjugated secondary F(ab’)2 (Zymed Labs, San Francisco, Ca lifornia) using an ECL system (Amersham, Arlington Heights, Illinois).

[0103] Western blotting analysis Preparation of whole cell lysates and performance of Western blot analysis were carried out according to known techniques (see Wang et al., Nat. Med., 20:633-641 (2014) and Egwuagu et al., J. Immunol., 168:3181-3187 (2002)). Cell extracts (20-40 μg / lane) were fractionated by 10% gradient SDS-PAGE under reducing conditions, and Western blot analysis was performed using antibodies specific for pSTAT1, pSTAT3, STAT1, STAT3, p28, p35, Ebi3, IL-27Rα, GP130, IRF8, or β-actin (Santa Cruz Biotechnology and Cell Signaling Technology, Danvers, Massachusetts). Pre-immune sera were used in parallel as controls, and HRP-conjugated secondary F(ab’)2 Ab (Zymed Laborat Signals were detected by Western blotting. Each Western blotting analysis was repeated at least three times.

[0104] Chromatin immunoprecipitation (ChIP) assay The ChIP assay was performed using the EZ-CHIP™ Chromatin Immunoprecipitation Kit (Millipore Sigma, Darmstadt, Germany). B cells were activated with LPS in the presence or absence of IL-27, and DNA-protein complexes were cross-linked for 10 minutes by adding fresh formaldehyde (Sigma-Aldrich) to the medium at a final concentration of 1%, followed by quenching with 135 mM glycine. Cells were then washed with cold PBS (2×) and sonicated (5×) in a 15-second burst of lysis buffer (EZ-CHIP™ lysis buffer) (Sonic Dismembrator Model 1000, output 5 of Thermo Fisher Scientific). The lysate was then clarified with protein G-agarose for 1 hour, pelleted, and incubated overnight with control IgG or anti-STAT1 or STAT3 antibodies (Cell Signaling Technology). Before incubating the antibodies, input samples were removed from the lysate and stored at -80 °C until extraction. Immunoprecipitation was performed according to the manufacturer's instructions (EZ-CHIP™). Immunoprecipitated and input DNA were subjected to PCR and qPCR using primers to detect the binding activity of STAT1 and STAT3. Primers for the IL-27p28 gene promoter (5'-CTGAAACCCCAGCTTCCTGCCA-3' (SEQ ID NO: 7) and 5'-CATCTCCTGGGTAGGGGGGTCTTATACT-3' (SEQ ID NO: 8)) were from -134 to -303, and the STAT binding motif GGAAGGGAAA 77 It is ACGTT (SEQ ID NO: 9). The primers for the promoter region of the EBI3 gene (5'-CTGATTCTGTCTCTGTTTCTCTCAGTT-3' (SEQ ID NO: 10) and 5'-GTGGGGAAAGGCCTTGAGGTAGA-3' (SEQ ID NO: 11)) are from -1 to -150, and the STAT binding motif is CCTCAAGGCCTTTCC (SEQ ID NO: 12).

[0105] Electrophoretic mobility shift assay (EMSA) EMSA was performed according to a well-known procedure (see Yu et al., J. Immunol., 157: 126-137 (1996)). A double-stranded oligonucleotide containing the motif from the AP1-IRF-1 composite element (AICE) 5’TGAnTCA / GAAA-3’ (SEQ ID NO: 13) was filled in by the Klenow polymerase (New Englan d BioLabs, Beverly, Massachusetts) using a fill-in reaction with [α-P 32 dATP or (alpha-32P) dGTP (3000 Ci / mmol) (PerkinE labeled. lmer Inc., Waltham, Massachusetts). The sorted CD19 + B cells were stimulated with IL-27 (20 μg / ml) in the presence or absence of LPS (1 μg / ml) for 3 days, and nuclear extracts were prepared in a buffer containing the following protease inhibitors according to a known procedure (see Yu et al., J. Immunol., 157: 126-137 (1996)): 2 μM leupeptin, 2 μM pepstatin, 0.1 μM aprotinin, 1 mM [4-(2-aminoethyl)benzenesulfonyl fluoride, hydrochloride], 0.5 mM phenylmethylsulfonyl fluoride, and 1 μM E-64 [N-(N-l-trans-carboxyoxirane-2-carbonyl)-1-leupeptin] agmatine. Protein levels were measured by the recommended BCA method, and the extracts were stored at -70 °C until use. The DNA-protein binding reaction was carried out with 5 μg of nuclear protein and 1 μg of double-stranded poly(dLC) (Bo Performed with a 20 μl mixture containing ehringer Mannheim, Barcelona, Spain), 12 mM HEPES (pH 7.9), 60 mM KCI, 0.5 mM DTT, 12% glycerol, 2.5 mM MgCl. Incubated on ice for 15 minutes, then 1 μl of P 32 Further incubated with a labeled probe (15,000 cpm) for 20 minutes at room temperature and fractionated on a 5% native polyacrylamide gel in 0.25x Tris-borate-EDTA buffer. For supershift analysis, 32 Before adding the P-labeled probe, the extract was pre-incubated with 1 μl of antibody specific for basic leucine zipper transcription factor (BATF) (Cell Signaling Technology), Jun B, Jun D, IRF-4, IRF-8 or IRF-1 (Santa Cruz Biotechnology).

[0106] Proximity ligation assay The proximity ligation assay (PLA) was performed using the Duolink PLA kit (Sigma Aldrich, St. Louis, MO). Activated B cells were attached to slides and blocked with blocking solution for 1 hour, then incubated overnight with mouse anti-p28 (rabbit) and anti-Ebi3 (mouse) primary antibodies. Next, a pair of oligonucleotide-labeled secondary antibodies (PLA probes) that bind to the primary antibodies was added and incubated for 1 hour, followed by the addition of ligation solution containing hybridizing connector oligos. Next, proximal (within 40 nm) PLA probes interacted and were ligated to the connector oligos. The resulting closed circular DNA template was amplified by DNA polymerase. Next, complementary detection oligos conjugated to fluorescent dyes that hybridized to the amplicon and the repetitive sequences of the p28:Ebi3 heterodimer were detected as individual fluorescent spots by confocal microscopy (LSM 700, Carl Zeiss AG, Oberkochen, Germany).

[0107] RNA-Seq and analysis In the case of RNA-Seq, mRNA was separated by oligo-dT beads, and the library was prepared using the standard Illumina, Inc. library protocol (Kit RS-122-2101 TruSeq Stranded mRNA LT Sample prep kit, Illumina, Inc., San Diego, CA). The library was sequenced on a NovaSeq 6000 system (Illumina, Inc.). The relative abundance of genes was measured as Read Count using StringTie. Statistical analysis was performed to find differentially expressed genes using the estimated abundance values of each gene in the samples. Genes with a Read Count value one more than the zeroed Read Count value in the sample was excluded. One was added to each Read Count value of the filtered genes to facilitate log2 transformation. The filtered data was log2-transformed and subjected to the trimmed mean of M-values (TMM) normalization method. The statistical significance of the differential expression data was determined using an exact t-test with edgeR and fold change, which is the null hypothesis that there is no difference between groups. The P-values were adjusted for multiple testing using the Benjamini and Hochberg false discovery rate (FDR) correction. For heatmaps, counts were normalized using the R package heatmap and Morpheus from the BroadInstitute tool. |Fold change| > 2 and complete linkage and Euclidean distance as a measure of similarity to display the expression patterns of differentially expressed transcripts satisfying the raw p-value of the independent t-test < 0.05. Hierarchical clustering analysis was performed.

[0108] Statistical analysis Graphs were plotted and analyzed using GraphPad Prism 7.0, two-sided unpaired Student's t-test, non-parametric Mann-Whitney U test, or one-way ANOVA, according to the experiment. A p-value < 0.05 was considered statistically significant. Some data are presented as mean + SEM. Asterisks represent p-values as follows: * P < 0.05, ** P < 0.01, *** P < 0.001, and **** P < 0.0001.

[0109] Sample sizes are indicated in the figure or figure legends and refer to the number of animals. In vitro assays using human umbilical cord blood or PBMC were independently repeated using cells from at least 3 unrelated donors. The results shown represent at least 3 independent experiments, as described in the legends. Optical coherence tomography, ERG, and confocal image analysis were performed blindly. EAE and EAU scoring were performed by masked investigators. The essential immunotherapeutic effect of i27-Bregs in EAU was verified and reproduced in the EAE model. Mice were age / sex matched, randomized, and consisted of equal numbers of males and females.

[0110] Example 1 This example demonstrated that peritoneal B1 cells secrete IL-27 (i27-Bregs) and that activation of i27-Bregs during inflammation causes their egress to secondary lymphoid tissues.

[0111] Immunohistochemistry / confocal microscopy of activated mouse CD19 +Co-localization of the expression of p28 and Ebi3 on B cells (Figure 1, white arrows) indicates that B lymphocytes produce IL-27. B1 lymphocytes (B-1a and B-1b) are innate immune B cells mainly localized in the peritoneal cavity, and B2 are conventional antigen-specific B cells in the spleen. Intracellular cytokine staining by flow cytometry of activated B cells in the mouse peritoneal cavity or spleen revealed that both of these developmentally and functionally distinct B cell lineages can produce IL-27 (Figure 2). However, regardless of the activation stimulus or source of B cells, B-1a cells are the major producers of IL-27 (Figure 2A), and the production of IL-27 by B-1a cells was confirmed by ELISA (Figure 2D). Co-expression of p28 and Ebi3 was detected in lysates and supernatants of activated B-1a cells by co-IP / Western analysis, providing further evidence that B-1a cells actually secrete the heterodimeric IL-27 (p28 / Ebi3). PLA further demonstrated the physical interaction between p28 and Ebi3 (Figure 132), providing direct evidence that B cells secrete the heterodimeric IL-27 cytokine. Co-expression of p28 and Ebi3 was detected by co-immunoprecipitation and Western blot (IP / Western) analysis of whole cell extracts or supernatants of activated B-1a cells (Figure 133), further confirming that B cells secrete the heterodimeric IL-27.

[0112] FACS analysis of activated B cells revealed a distinct population of B cells (approximately 7.73%) that produce IL-27 and increase (2.85-fold) in response to IL-27 (Figure 3). Exposure to L-27 was shown to induce an increase in i27-Bregs. NanoString RNA analysis (Figure 5) and Western blotting also showed that BCR / IL-27 synergistically upregulated the expression of the IL-27 subunit p28 and IL-27Rα, and changed the pattern of chemokine receptor expression (Figure 5). Immunohistochemical / confocal microscopy analysis also detected upregulated expression of IL-27 by B cells in response to IL-27 / BCR signaling (white arrows) (Figure 6), suggesting that BCR and IL-27 signals may be required for optimal expansion of i27-Bregs. Furthermore, chromatin immunoprecipitation assays demonstrated that IL-27 mediates its effect by inducing the binding of activated STAT1 and STAT3 to the proximal promoter of U27a (Figures 112 and 113). The BCR / IL-27-induced signal promoted the expansion of IL-27-producing cells, but the BCR / IL-27-induced signal was unable to expand these cells in cultures of B cells lacking the IL-27 receptor (IL-27RαKO) (Figure 7), clarifying that IL-27 signaling is required for the generation of IL-27-producing B cells. Consistent with the requirement for IL-27 for autocrine proliferation of IL-27-producing B-1a cells is the observation that IL-27 upregulates IL-27Rα expression in B1 cells (Figure 8). Importantly, in the context of the applicability of IL-27-producing B cells to immunotherapy, innate-like human B1 cells were also found to produce IL-27 (Figures 9-11).

[0113] To examine whether B cells can produce IL-27 in vivo, C57BL / 6J mice were injected with LPS (i.v.), and the proportion of B-1a or B2 cells producing IL-27 in the peritoneal cavity or spleen was measured. Approximately 19.4% of B-1a cells in the peritoneal cavity of PBS-treated mice produced IL-27 at the 24-hour time point, but the proportion of these cells increased to approximately 55.6% in mice injected with LPS (Figures 13A-14B). The rapid kinetics of this response indicate mobilization rather than proliferation. Interestingly, the proportion of B-1a cells secreting IL-27 rapidly decreased over time in the peritoneal cavity and ultimately returned to basal levels by day 4 of inflammation (Figures 13A-14B). Similar analysis revealed different patterns of mobilization of IL-27-producing B-1a cells to the spleen. From day 1 after LPS injection, the percentage of B-1a cells mobilized to the spleen gradually increased from 2.01% and reached a peak of 8.8% by day 3, and then returned to basal levels on day 4 of inflammation (Figures 13A-14B). Note that IL-27-producing B2 cells in the spleen or peritoneal cavity never exceed 2% (Figures 13B and 14B). These results indicate that LPS injection induced a rapid increase in IL-27-producing B-1a cells, subsequently induced their exit from the peritoneal cavity, and these events were temporally correlated with subsequent mobilization of B-1a cells to the spleen.

[0114] This data shows a time-dependent increase in B-1a cells expressing CXCR3 and CXCR5 in the spleen, which was temporally coincident with a significant decrease in B-1a cells expressing CXCR4 in the peritoneal cavity (Figures 15-17). These results are consistent with NanoString data (Figure 5) showing upregulation of Cxcr5 and downregulation of Cxcr4 transcription by B-1a cells in response to IL-27 (Figures 5 and 134).

[0115] Collectively, these observations suggest that differential regulation of chemokine receptor expression by B-1a cells in response to IL-27 promotes the release of B-1a cells from the peritoneal cavity and their subsequent transport to the spleen.

[0116] Example 2 This example demonstrated that IL-27-producing B-1a cells (i27-Bregs) confer protection from severe uveitis.

[0117] EAU is an animal model of human uveitis and is associated with CFA-induced retinal proteins / peptides. EAU is a predominantly T cell-mediated intraocular inflammatory disease induced by immunization with uveitis. We used the EAU model to investigate whether i27-Bregs contribute to immune regulation during uveitis. EAU is characterized by the expression of interphotoreceptor retinoid-binding protein (IRBP). 651-670 EAU was induced in C57BL / 6J mice by immunization with a peptide derived from the IL-27-antigen (IL-27) and, simultaneously with immunization, the mice were treated with PBS (control) or IL-27. Fundus images of PBS-treated mice revealed features of uveitis, including blurring of the optic nerve head margin, enlargement of the parapapillary region, moderate to severe retinal vasculitis, and cellular infiltration (Figure 18). In contrast, IL-27-treated mice were protected from EAU and exhibited mild EAU with fewer cells and a lower disease score (Figure 19). Histological analysis of PBS-treated eyes showed inflammatory cells in the vitreous, choroiditis, photoreceptor cell damage, and retinal folds, whereas these characteristic features of uveitis were not observed in the eyes of IL-27-treated mice (Figure 20). Optical coherence tomography (OCT) showed substantial accumulation of inflammatory cells in the vitreous and optic nerve head of PBS-treated mice, but not in IL-27-treated mice (Figure 21). Electroretinograms (ERGs) of IL-27-treated mice showed no visual impairment compared with control mice (Figures 22-25). Consistent with the improvement of EAU, increased IL-27 and decreased IL-17 were detected in the serum of IL-27-treated mice (Figures 26-29). Other immunosuppressive cytokines, including IL-10 and IL-35, were also elevated in the serum of IL-27-treated mice (Figures 26-29). Intracellular cytokine analysis showed that approximately 8.2% of B cells in the spleens of PBS-treated mice secreted IL-27, whereas the percentage of i27-Breg cells increased to over 15% in IL-27-treated mice (Figures 30 and 31), indicating a correlation between increased i27-Breg cells and improved EAU. B10(CD 19+ CD5 + CD1d hi ) and B-1a (CD19 + CD5 + CD1d low ) cells are CD5+ and exhibit innate-like Breg function, so we investigated whether i27-Bregs induced in EAU are derived from the B-1a or B10 pool. The spleens of PBS-treated mice contained moderate levels of IL-27-producing B10 cells (about 2.97%), but the proportion of these i27-Bregs did not increase in EAU in IL-27-treated mice (Figures 32 - 34). In contrast, more than about 6% of B-1a cells in the spleens of PBS-treated mice were i27-Bregs, and in IL-27-treated mice, it increased to more than about 11% (Figures 32 - 34), and in vivo exposure to IL-27 further induced an increase in EAU of i27-producing B-1a cells.

[0118] To investigate the potential therapeutic importance of i27-Bregs, peritoneal B-1a cells (>80% i27-Bregs) were purified from WT donor CD45.2 + mice with EAU and 5×10 5 cells / mouse were transferred into naive syngeneic WT or IL-27RaKO CD45.1 + Transplanted into mice, EAU was induced 24 hours after the prophylactic administration of B-1a cells. Fundus images on the 17th day after immunization showed severe uveitis in IL-27Rα-deficient mice (Figs. 35 and 36), which correlated with an increase in Th1 and Th17 cells in the eye (Figs. 37 - 38E). The group injected with PBS showed uveitis characteristics, although with lower severity compared to IL-27Rα KO mice. In contrast, mice given prophylactic B-1a cells developed only mild EAU (Figs. 35 and 36) correlated with a decrease in Th1 / Th17 cells (Fig. 37) and an accompanying increase in IL-27-producing B-1a cells in the eye (about 10.7%) (Fig. 39). This improvement was not observed in IL-27Rα recipients, demonstrating that the improvement was mediated by IL-27. Interestingly, B-1a therapy induced a proliferation of about 2.2-fold of IL-35-producing Breg cells (i35-Breg) (Fig. 40).

[0119] Furthermore, plasmacytoid dendritic cells were found to induce the proliferation of i27-Breg cells, as confirmed by flow cytometry after co-culture (1:1) of activated IL-27-producing B-1a and plasmacytoid dendritic cells (CD11b secreting IL-27 + See Figs. 149A - 149B showing the percentage of B-1a cells.).

[0120] Example 3 This example demonstrated that i27-Bregs in the brain and spinal cord suppress neuroinflammation and encephalomyelitis.

[0121] In these studies, the EAE model was used, which shares essential immunopathogenic features with multiple sclerosis (MS) and represents progressive and relapsing-remitting human diseases. EAE is induced by MOG 35-55-Induced by immunization of C57BL / 6J mice with peptide / CFA. Control PBS-treated mice developed EAE characterized by infiltration of inflammatory cells into the brain and spinal cord, flaccid tail, paraplegia, fore- / hindlimb paralysis, and a moribund state (Figure 44). However, as shown by histology and lower EAE clinical scores, these prominent features of EAE were much reduced in IL-27-treated mice (Figure 45). Disease attenuation was correlated with a significant decrease in the frequency of Thl7 or IFN-γ / IL-17-expressing Thl7 cells in the brain and spinal cord of IL-27-treated mice, and an increase in IL-10-expressing CD4 + T cells (Figures 46-51). More importantly, i27-Breg cells in the spinal cord and brain of EAE mice (Figures 52 and 53), significant levels of IL-27-producing B-1a cells in the spinal cord (Figures 52 and 53), and significant levels of IL-27-producing B-1a cells in the spleen of IL-27-treated mice (Figures 54-58) were detected.

[0122] The role of i27-Breg cells in EAE suppression was further demonstrated in adoptive transfer studies using CD45.1 + and CD45.2 + congenic mouse lineages. CD45.2 + mice were immunized with MOG 35-55 -peptide / CFA and treated with PBS or IL-27. Twenty-one days after immunization, encephalitogenic cells were harvested from the spleen and LN, and 10×10 + cells from PBS-treated or IL-27-treated CD45.2 6 mice were adoptively transferred into non-immunized CD45.1 + mice, and the onset and severity of EAE were evaluated. Transplantation of cells from PBS-treated mice induced disease with features of EAE, whereas CD45.1 + mice administered cells from IL-27-treated CD45.2 +Mice developed mild, late-onset EAE (Figure 59). The reduction of EAE in recipient mice was partially due to suppression of the Th17 response (Figure 60) and co-proliferation of IL-27-producing B-1a cells (Figures 63-66). CD45.2 + Notably, the levels of IL-27-producing B-1a cells were slightly increased in the spinal cord, brain, and spleen of recipient IL-27-treated mice (Figures 63-66), which indicated that the transplanted CD45.2 + i27-Bregs cells might have proliferated in vivo. Most notably, the recruitment of CD45.2 + Bregs into the CNS promoted the expansion of endogenous CD45.1 + Bregs (Figures 63-66). Thus, the expansion of transplanted i27-Bregs and endogenous CD45.1 + Bregs in the spinal cord and brain would have maintained the long-term production of IL-27 in host tissues. Thus, i27-Breg therapy may offer therapeutic advantages over the administration of IL-27, which is rapidly cleared in vivo.

[0123] Example 4 This example demonstrated that innate immune IL-27-producing B-1a cells suppress EAE and EAU antigen-independently.

[0124] Bregs are mainly antigen-specific and effective in suppressing diseases mediated by lymphocytes that recognize the same cognate self-antigen. Thus, we investigated whether IL-27-producing B-1a cells induced by unrelated stimuli such as LPS could suppress encephalitogenic lymphocytes that mediate EAE. CD45.2 + C57BL / 6J mice were injected with LPS, and purified B-1a cells were obtained from the peritoneal cavity 2 days later (>80% B-1a i27-Bregs). Next, i27-Bregs were transferred into naive CD45.1 + congenic mice. EAE was induced by immunizing with MOG 35-55 (n = 7) 24 hours after adoptive transfer, in recipient CD45.1 +Induced in mice. Generated ex vivo Transplantation of the generated B-1a i27-Bregs (5×10 5 cells / mouse) suppressed EAE (Figure 67), and disease improvement correlated with a decrease in IL-17-only positive and IL-17 / IFN-γ double-positive T cells in the brain and spinal cord, and an increase in IL-10-producing regulatory CD4 + T cells (Figures 68 - 71). Suppression of EAE correlated with an increase in i27-Breg cells in the spinal cord (Figures 72 and 73), brain (Figures 74 and 75), and peritoneal cavity (Figures 76 and 77), and most i27-Breg cells were observed to be B-1a cells. Similar results were obtained in the EAU model. Thus, consistent with their ontogenetic origin, suppression of CNS autoimmune diseases by innate immune i27-Breg cells does not require prior activation by the autoantigens that induced EAE or EAU. This result is in contrast to B2 Breg therapy, which mediates antigen-specific immunosuppression, suggesting that transplantation of autologous innate immune i27-Breg cells can be utilized for the treatment of a broader range of autoimmune diseases.

[0125] Example 5 This example shows that there is crosstalk between B-1a producing IL-27 and lymphocytes or bone marrow cells in the CNS.

[0126] In this study, we investigated whether i27-Bregs that enter the CNS during EAE or EAU could be a source of IL-27 that contributes to the immunosuppressive environment in the CNS. B-1a cells and macrophages derived from IRBP immunized wild-type were sorted, and it was found that 3-day co-culture of cells in a transwell system significantly increased IL-27-producing B-1a cells (Figs. 78 - 81), suggesting that soluble mediators produced by bone marrow cells may increase retinal IL-27 levels during uveitis by promoting the proliferation of i27-Breg cells. The data further show that macrophages, like B-1a cells, respond to inflammatory stimuli by producing IL-27 (Figs. 82 and 83). However, infection of either cell type with a lentivirus expressing sgp28 / sgpEbi3 guide RNAs targeting p28 and ehi3 expression suppressed the ability of macrophages or B-1a cells to produce IL-27 (Figs. 82 and 83), suggesting that i27-Bregs may act synergistically with bone marrow cells to increase IL-27 levels in the CNS during inflammation. The potential crosstalk between i27-Bregs and lymphocytes that mediate CNS autoimmune diseases was also investigated. Co-culture with B-1a cells suppressed the proliferation of uveitogenic T cells in the spleen and lymph nodes of EAU mice (Figs. 84 - 90). When B-1a cells were defective in IL-27 expression, the ability to suppress the Thl7-induced inflammatory response was decreased (Figs. 86 - 90). These results suggest that B-1a cells that enter the retina can suppress Thl7 cells during EAU via the paracrine effect of secreted IL-27.

[0127] The data show that co-culture of B-1a cells with uveitogenic T cells IL-27-dependently, inhibits the inhibitory receptor LAG-3 (LAG-3 + CD4 + T cells) expressing CD4 +It is shown that the proliferation of T cells (Figs. 91 - 93) and i35 - Bregs (Figs. 94 - 96) was induced. Interestingly, most of the IL - 35 - producing cells induced by IL - 27 were Foxp3 - negative (Figs. 97 - 99). These results suggest that i27 - Breg can at least partially suppress intraocular inflammation by causing effector T cells to acquire a regulatory phenotype and function.

[0128] Example 6 This example shows that IL - 27 regulates B1 cells and B2 cells in different ways.

[0129] In this study, it was investigated whether B - 1a cells, which suppress EAU and EAE through the production of IL - 27, also suppress inflammation by expressing inhibitory molecules. B - 1a cells were isolated from the mouse peritoneal cavity by sorting. Next, the cells were stimulated with LPS for 48 hours, and their ability to produce IgM was used to show that they were B - 1a cells (Fig. 100). Analysis of cDNA prepared from the cells by qPCR revealed that B - 1a cells could actually express Lag3 and Pdl (Fig. 100). Using an in vivo LPS model, it was investigated whether natural immune B - 1a cells also express these inhibitory receptors in response to an inflammatory challenge as occurs during EAE, EAU, or sepsis. C57BL / 6J mice were injected with LPS (i.v.), and purified B - 1a cells were isolated from the peritoneal cavity by magnetic bead sorting. The results of qPCR analysis of cDNA derived from the cells 48 hours after LPS administration confirmed that the transcription of Lag3 and Pdl was up - regulated by B - 1a cells in the peritoneal cavity (Fig. 101). Natural LAG - 3 + CD138 +As regulatory plasma cells develop via antigen-specific mechanisms, B-1a and B2 cells sorted from mouse peritoneal cavity or spleen, and cells stimulated with anti-IgM / anti-CD40, upregulate the transcription of Lag3 and Pd1 in response to BCR signaling, as shown by qPCR analysis for both B-1a and plasma cells (Figures 102-104). Collectively, these observations suggest that B-1a cells can acquire the ability to express inhibitory molecules that enhance their immunomodulatory activity in response to stimulation by pathogens (such as TLR agonists) or self-antigens.

[0130] Previous reports have shown that B cells producing IL-35 are exclusively B2 CD138 + plasma cells (Shen et al., Nature, 507:366-370 (2014)). However, this study shows that IL-27-producing B cells are derived from the B1 compartment. To understand the mechanism that biases activated B cells towards the i27-Breg developmental program, activated CD19 stimulated with IL-27 +The transcriptome profile of B cells was generated. By qPCR (Figure 105) and NanoString (Figure 106) RNA analyses, several genes (Irf8, Irfl, Tbx21, Nfll3, Irf7, Xbpl, and Batf) specifically activated by IL-27 were identified, some of which are known to regulate important pathways in B cells. Of particular interest were the differential upregulations of IRF-8 and IRF-4. This is because these transcription factors are involved in B cell development and effector functions. Considering the report that the mutual antagonism between IRF-4 and IRF-8 regulates B-, the generation of cells with an increased IL-4 that is favorable for the generation of plasma cells increases (see, for example, Xu et al., Nat. Immunol., 16:1274-1281 (2015)). Therefore, the preferential upregulation of Irf8 by B-1a cells may promote the i27-Breg development program. Since IL-27 induces the proliferation of i27-Bregs, it was investigated whether IRF-8 activates the transcription of 1127a, which encodes the IL-27p28 subunit protein. Therefore, it should be noted that IRF-8 and IRF-4 activate transcription by heterodimerization with transcription factors of the ETS / PU-1 or BATF family and are recruited to the composite elements of the ETS-IRF (EICE) or AP1-IRF (AICE) immunoregulatory genes. EMSA and supershift analyses using the validated AICE sites associated with the expression of Il27a or Ctla4 showed that IL-27 induces the formation of the AICE complex in activated B cells in vivo or in vitro conditions. Furthermore, both IRF-4 and IRF-8 were recruited to the AICE of Ctla4, and IRF-8 but not IRF-4 was recruited to the AICE of i / 27a. This suggests that IRF-8 promotes the expression of IL-27 in B cells.Western blot analysis confirmed that IL-27 upregulates IRF-8 in B cells (Figure 107), and RNA analysis showed upregulated transcription of Irf8 by B-1a cells isolated from LPS-injected mice (Figure 108), suggesting an IRF-8 / IL-27 axis that may regulate a mutual autoregulatory loop promoting the expression of IRF-8 and IL-27 in B-1a cells. A significant decrease in IL-27-producing B-1a cells in CD19-IRF8KO mice (Figure 108-. 111) was also observed, further highlighting the role of IRF-8 in promoting the proliferation of i27-Breg cells. These results suggest that preferential activation of the IRF-8 / IL-27 axis in the B1 compartment may bias activated B-1a cells toward the i27-Breg developmental program.

[0131] Example 7 This example demonstrated that i27-Breg cells exist in humans and can proliferate in response to inflammatory stimuli.

[0132] In this study, healthy human PBMCs were cultured with TLR agonist CpG and BCR (anti-CD40 or anti-IgM) for 3 days to examine whether i27-Breg cells exist in humans and can proliferate in response to inflammatory stimuli. Gating of human B-1 cells (CD19 + CD20 + CD27 + CD43 + ) revealed that 19.9% of BCR-activated B cells in human PBMCs produce IL-27 (Figures 114 and 115). CD19 + CD20 + CD27 + CD43 + CD11 +The B-1 cells represent a cell population that, in response to appropriate stimuli and gating thereto, is a subset of B-1a cells that are ready to migrate to the spleen and other sites of antibody production. It has been revealed that 35% of BCR-activated human B-1a cells may be mobilized to the spleen and inflammatory sites during inflammatory diseases (Figures 116-118). Analysis of human umbilical cord blood from healthy human donors revealed that 18.1% of resting B-1a cells constitutively produce IL-27, and that stimulation of BCR-activated cord blood B cells with IL-27 increases the proportion of cord blood i27- to 73.9% (Figures 119-121). To determine the relative abundance of i27-Bregs relative to other Breg subtypes (IL-10-producing Bregs and i35-Bregs), activated cord blood cells were grown for 6 days. Most of the Breg cells were i27-Bregs, but low levels of IL-10-producing Bregs and i35-Bregs were detected, and their levels increased over time (Figure 122). Similar analysis of B-2 cells revealed that most i27-Bregs are in either the naive or memory B cell pool (Figure 123). Similar to the mouse species, human i27-Breg cells constitutively express the inhibitory receptors PD-1 and LAG3 (Figures 124-126) and suppressed the proliferative responses of inflammation-inducing CD4 + T cells producing TNF-α, IL-17, and / or IFN-γ (Figures 127-131). Since umbilical cord blood is a preferred source of hematopoietic stem cells for allogeneic (non-self) transplantation for patients with significant mismatches of human leukocyte antigen (HLA; the gene complex encoding the major histocompatibility complex (MHC) proteins in humans), the enrichment of umbilical cord blood i27-Bregs is of clinical interest. Therefore, umbilical cord blood i27-Bregs can be utilized to suppress alloreactive responses after allogeneic hematopoiesis and protect from GVHD.

[0133] Example 8 This example demonstrates that human i27-Breg cells can be used to successfully treat humans suffering from, or at risk of suffering from, a disease.

[0134] Human i27-Breg cells are administered by injection or intravenous administration to a human suffering from a disease such as uveitis, MS, AMD, and / or GVHD, or a human in need of prevention of a disease such as GVHD. After administration of the human i27-Breg cells, the severity and / or symptoms of the disease are reduced and / or prevented.

[0135] Example 9 This example shows that i27-Breg has its own transcriptome.

[0136] Using peritoneal B-1a cells enriched for i27-Breg cells by activation with BCR and IL-27, the gene expression program required for the generation of i27-Breg cells was determined. Characterization of highly enriched IL-27-producing B-1a cells (>83% i27-Bregs) revealed that while B-1a cells constitutively secrete natural IgM antibodies, the development into the i27-Breg cell phenotype coincides with the loss of IgM antibody production capacity (Figures 135A-135B). In addition to unchallenged B-1a cells, conventional B-2 and IL-35-producing B-2 cells (>57% i35-Breg) from mouse spleen were used as comparators for RNA-seq analysis. Principal component analysis (PCA) of differentially regulated genes clearly separated B cells into four distinct populations (Figure 136). Gene ontology (GO) analysis identified highly enriched genes encoding proteins that further characterize the unique immunosuppressive activity of i27-Breg cells and enhance the molecular processes and pathways (Figure 137). The heatmap obtained from global RNA-Seq analysis identified 1,998 genes upregulated and 1,179 genes downregulated in i27-Breg (Figure 137). Genes differentially induced in i27-Breg (>2-fold higher expression) include genes encoding cytokines, cytokine receptors and chemokine receptors (Il127, Ebi3, Il110, Il17r, Il121r, Cxcr3, Cxcr5), inhibitory receptors (Pdcd1, Lag3), signaling molecules (Notch4, Stat1, Stat3, Stat5, Akt1, Akt2), transcription factors (Irf8, Irf1, Batf, Bhlhe40, Xbp1, Arid3a, Ikzf1, Ikzf2, Ikzf4). Suppressed genes include genes encoding Il112a, Notch2, Cxcr4, Ccr2, Ccr7, inhibitory receptors (Pdcd2, Cdld1, Ctla4) and transcription factors (Irf4, Ikzf3, Bach2, Pax5, Ebf1, Runx1, Foxo1, Ets1) (Figure 139).To further verify that IL-27 is required for the maintenance of the i27-Breg transcriptome, IL-27-deficient B-1a cells express IL-35 (p35 and EBi3), but are defective in the expression of inhibitory receptor genes (Lag3, Pdl, as well as Pd-11, Pd-12) (Figure 140). Collectively, these results suggest that the i27-Breg transcriptome shows a significant increase in genes (Bhlhe40, Arid3a, and Cd5) required for B-1a development, highlighting the developmental origin of i27-Bregs from innate immune B-1 cells. However, i27-Breg cells show the characteristic properties of transcription in differentiating germinal center B cells (Irf8↑, Batf↑, Pax5↑, Bach2↑, Ebfl↑), but do not show the characteristic properties of transcription in terminally differentiated plasma cells (Prdml↑, Bach2↑, Pax5↑, Ebfl↑). This proves that i27-Bregs have a unique transcriptome.

[0137] Example 10 This example demonstrates that i27-Bregs and i35-Bregs in human umbilical cord blood and PBMC have different transcriptome profiles.

[0138] Human PBMC and cord blood (CB) B cells produce IL-27, and in PBMC, approximately 19.9% of activated B-1-like cells (CD19 + CD20 + CD27 + CD43 + ) are i27-bregs (Figures 141A and 141B). More than 40% of i27-Breg cells are CD19 + CD20 + CD27 + CD43 + CD11b +Shows the B-1a subset in the body cavity that is known to redistribute to local lymph nodes in response to phenotype and inflammation (Figures 142A - 142C). On the other hand, approximately 18.1% of resting B-1a cells in CB constitutively secrete IL-27, and when activated in the presence of IL-27, the percentage of CB i27-Breg dramatically increases to 73.9% (Figures 143A - 143C), suggesting that i27-Breg functions as a natural Breg in human CB and is ready to be rapidly mobilized to local lymph nodes in response to inflammation. t-SNE clustering analysis grouped Breg cells in CB into three spatially distinct subsets: B10, i27-Breg and also i35-Breg. i27-Breg was the most abundant, containing more than 85% of Breg in 3-day culture, but decreased to less than 61% in 6-day culture (Figure 144). B10 and i35-Breg cells were relatively scarce in 3-day culture, but i35-Breg substantially increased (32%) by day 6 (Figure 144). Interestingly, B cells at all stages of development were able to produce IL-10, IL-27, or IL-35, but i27-Breg was most abundant in immature and memory B cells (Figure 145). Principal component analysis and RNA-seq analysis revealed that i27-Breg and i35-Breg have different transcriptome profiles (Figure 146). Of the 3,744 differentially expressed genes, 1,575 were upregulated in i27-Breg and 2,169 were downregulated (Figure 147). CD19 + A similar comparison between CD19 B cells and i27-Breg showed that 3,207 of the 6,159 differentially expressed genes were upregulated in i27-Breg (Figure 148). Therefore, the analysis results of human PBMC or CB suggest that different Breg subsets are induced during the inflammatory response and the relative abundance of each subset varies depending on the nature of the inflammatory challenge.

[0139] Example 11 This example demonstrates that natural immune i27-Bregs suppress CNS autoimmune diseases through a BCR-independent mechanism.

[0140] Intraperitoneal B-1 cells mostly do not respond to signals induced by BCR, but are highly responsive to innate immune signals induced by pathogens or TLR agonists, suggesting the immunosuppressive activity of i27-Bregs. To clarify whether prior activation by IRBP or MOG autoantigens is required for the suppression of EAU or EAE via i27-Bregs, LPS injection was used to induce "sepsis" in CD45.2 + C57BL / 6J mice, and sorted B-1a cells (>83.5% i27-Bregs) derived from the peritoneal cavity and cells enriched with i27-Bregs (5×l0 5 cells / mouse) were adoptively transferred into naive CD45.1 + congenic mice. Twenty-four hours later, the mice were challenged by EAE induction. Clinical evaluation of the mice revealed significant suppression of EAE (Figure 150) or EAU compared to control mice administered with an equal number of B-1a cells (<7% i27-Breg). The improvement of the disease was correlated with a decrease in IL-17-single positive and IL-17 / IFN-γ-double positive Th17 cells, as well as an increase in Tregs in the brain and spinal cord (Figure 151A-151B), an increase in B-1a i27Breg cells in the spinal cord (Figure 152A-152B), the brain (Figure 153A-153B), and the peritoneal cavity (Figure 154A-154B). These results support the possibility that adoptive transfer i27-Breg therapy may be useful for the treatment of autoimmune diseases.

[0141] In summary, the above examples showed that natural immune IL-27-producing Breg populations exist not only in the brains, spinal cords, retinas, and peritoneal cavities of mice suffering from experimental autoimmune encephalomyelitis (EAE) or experimental autoimmune uveitis (EAU), which are models of multiple sclerosis and uveitis, respectively, but also in human umbilical cord blood and PBMC. In vitro experimental systems including confocal microscopy, FACS-utilized cell sorting, RNA-seq, Chip assay, and immunohistochemistry indicate that Bregs producing IL-27 have unique transcriptomes and are functionally different from other Bregs. Adoptive transfer of i27-Bregs transported to the uvea, brain, and spinal cord and reprogramming resting B cells into i35-Breg cells that suppressed pathogenic T cells improved EAE and EAU, indicating the effectiveness of i27-Breg immunotherapy.

[0142] All documents, including publications, patent applications, and patents cited herein, are hereby incorporated by reference in their entirety to the same extent as if each document were individually and specifically indicated to be incorporated by reference and were set forth in full herein. They are incorporated herein by reference to the extent that they are so described.

[0143] In the context of describing the present invention (particularly in the context of the following claims), the use of the terms "a", "an", and "the" and similar referents should be construed to cover both the singular and the plural. Otherwise, it is inconsistent with what is shown in this document or is clearly contradicted by the context. The terms "comprising", "having", "including", and "containing" should be construed as open-ended terms (i.e., meaning "including, but not limited to") unless specifically stated otherwise. The recitation of numerical ranges herein is merely intended to serve as a shorthand reference to each individual numerical value within the range, and each individual numerical value is incorporated into the specification as if it were specifically recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or clearly contradicted by the context. The use of any examples provided herein, or of exemplary language (e.g., "such as") is merely intended to better clarify the present invention and does not limit the scope of the present invention unless otherwise claimed. No language in the specification should be construed as indicating that any element not recited in the claims is essential to the practice of the invention.

[0144] Preferred embodiments of the invention are described herein, including the best mode known to the inventors for practicing the invention. Variations of these preferred embodiments may become apparent to those skilled in the art upon reading the foregoing description. The inventors expect those skilled in the art to appropriately use such variations, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, the invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Furthermore, any combination of the above-described elements in all possible variations thereof is included in the invention unless otherwise indicated herein or clearly contradicted by the context.

Claims

**Claim 1** An isolated population of mammalian cells comprising at least about 75% B-1a regulatory cells, (a) expressing inhibitory cell surface receptor lymphocyte activation gene 3 (LAG-3), programmed cell death protein 1 (PD-1), and C-X-C chemokine receptor type 4 (CXCR4), and (b) secreting interleukin-27 (IL-27). Population. **Claim 2** The population of mammalian cells according to claim 1, wherein the regulatory cells further express inhibitory cell surface receptor glucocorticoid-induced TNF receptor-related protein (GITR). **Claim 3** The population of mammalian cells according to claim 1 or 2, wherein the regulatory cells further express inhibitory cell surface receptor OX40. **Claim 4** The population of mammalian cells according to any one of claims 1 to 3, wherein the regulatory cells further express inhibitory cell surface receptor cytotoxic T lymphocyte-associated protein 4 (CTLA4). **Claim 5** A method for preparing the population of mammalian cells according to any one of claims 1 to 4, comprising: (a) using fluorescence-activated cell sorting (FACS) to isolate cluster of differentiation 5 positive (CD5+) expressing cells from a sample of mammalian peripheral lymphoid tissue, mammalian cord blood, mammalian ascites, induced pluripotent stem cells (iPSCs), or mammalian bone marrow to provide isolated CD5+ expressing cells; (b) culturing the isolated CD5+ expressing cells in a cell culture medium to provide cultured cells; (c) activating the cultured cells with a BCR (B cell receptor) or TLR (Toll-like receptor) agonist to provide activated cells; and (d) exposing the activated cells to IL-27. Method. **Claim 6** The population of mammalian cells according to any one of claims 1 to 4 for use in suppressing the immune system of a mammal. **Claim 7** The population of mammalian cells for use according to claim 6, further comprising sequentially or simultaneously administering to the mammal B cells that produce interleukin-35 (IL-35). **Claim 8** The population of mammalian cells for use according to claim 6 or 7, wherein the mammal is being treated for a disease. **Claim 9** The population of mammalian cells for use according to any one of claims 6 to 8, wherein the mammal has an autoimmune disease. **Claim 10** The population of mammalian cells for use according to claim 9, wherein the autoimmune disease is an eye disease. **Claim 11** A population of mammalian cells for use according to claim 9, wherein the autoimmune disease is a disease of the central nervous system.

12. A population of mammalian cells for use according to claim 9, wherein the autoimmune disease is a disease of the brain.

13. A population of mammalian cells for use according to claim 9, wherein the autoimmune disease is uveitis.

14. A population of mammalian cells for use according to claim 9, wherein the autoimmune disease is encephalomyelitis.

15. A population of mammalian cells for use according to any one of claims 6 to 8, wherein the mammal has multiple sclerosis.

16. A population of mammalian cells for use according to any one of claims 6 to 8, wherein administration suppresses inflammation of the pancreas.

17. A population of mammalian cells for use according to claim 6 or 7, wherein the mammal has received an allogeneic bone marrow or hematopoietic stem cell graft.

18. A population of mammalian cells for use according to claim 6 or 7, wherein the mammal has received an allogeneic solid organ graft.

19. A population of mammalian cells for use according to claim 17 or 18, wherein the mammal has graft-versus-host disease (GVHD).

20. A population of mammalian cells for use according to any one of claims 6 to 8, wherein the mammal has age-related macular degeneration (AMD).

21. A population of mammalian cells according to any one of claims 1 to 4 for use in the treatment of a mammal having graft-versus-host disease.

22. A population of mammalian cells for use according to claim 21, wherein the mammal has received an allogeneic bone marrow or hematopoietic stem cell graft prior to administration of the population of mammalian cells.

23. A population of mammalian cells for use according to claim 21, wherein the mammal has received an allogeneic solid organ graft prior to administration of the population of mammalian cells.

24. A population of mammalian cells according to any one of claims 1 to 4 for use in preventing or reducing the severity of graft-versus-host disease in a mammal.

25. The method according to claim 24, wherein the allogeneic graft is an allogeneic bone marrow or hematopoietic stem cell graft.

26. A population of mammalian cells for use according to claim 22, wherein the allogeneic graft is an allogeneic solid organ graft.

27. The mammalian cell population according to any one of claims 1 to 4, or the use according to any one of claims 5 to 26, wherein the mammal is a human.

Citation Information

Patent Citations

  • Regulatory b cells (tbregs) and their use

    US20120308563A1