Triple helix terminator for efficient RNA trans-splicing

Abstract

To provide a nucleic acid trans-splicing molecule that can replace an exon in a targeted mammalian ocular gene carrying a defect or mutation causing an ocular disease with an exon having the naturally-occurring sequence without the defect or mutation.SOLUTION: Disclosed is an RNA trans-splicing molecule useful for the treatment of diseases caused by the deletion of one or more exons of a coding sequence. The trans-splicing molecule includes a 3' transcription terminator domain that enhances the efficiency of trans-splicing. The 3' TTD comprises a triple helix domain and a tRNA-like domain.SELECTED DRAWING: None

Description

[Background technology]

[0001] Several inherited retinal diseases are caused by mutations, typically multiple mutations, throughout portions of large eye genes. One example is Stargardt disease, also known as Stargardt 1 (STGD1), which is an autosomal recessive form of retinal dystrophy typically characterized by progressive loss of central vision. Similar retinal diseases are caused by defects in other large eye genes, including CEP290 (7440 nucleotides), which contains a deletion or mutation that causes Leber congenital amaurosis, among other eye diseases, and MYO7A (7465 nucleotides), which contains a deletion or mutation that causes Usher disease.

[0002] The occurrence and location of multiple mutations in such a large eye gene, as well as in other genes, makes strategies for repairing the mutations extremely challenging. Despite the great promise of trans-splicing technology for over 20 years to address this challenge, it has yet to yield a meaningful approach for gene therapy. This is primarily, but not exclusively, due to the low efficiency of the trans-splicing reaction. It is important to recognize that trans-splicing is uncommon in higher eukaryotes, including humans. While there are few examples of endogenous trans-splicing, it is clear that cis-splicing predominates by a large margin. Simply put, trans-splicing in humans appears to be a novel class of alternative splicing that utilizes the same cellular factors and mechanisms that mediate the conventional cis-splicing pathway.

[0003] There remains a need for effective compositions and methods of treatment for such disorders. Summary of the Invention

[0004] Provided herein are RNA trans-splicing molecules (RTMs) useful for treating diseases caused by the deletion of one or more exons of a coding sequence, as well as methods and compositions that utilize these RTMs.

[0005] In one aspect, the invention includes a nucleic acid trans-splicing molecule (eg, RTM) that includes a triple helix-containing 3' transcription terminator domain (TTD). In some embodiments, the triple helix comprises at least 5 consecutive AU Hoogsteen base pairs (e.g., 4-20 consecutive AU Hoogsteen base pairs, 4-18 consecutive AU Hoogsteen base pairs, 4-15 consecutive AU Hoogsteen base pairs, 4-12 consecutive AU Hoogsteen base pairs, 4-11 consecutive AU Hoogsteen base pairs, or 4-10 consecutive AU Hoogsteen base pairs, e.g., 6-8 consecutive AU Hoogsteen base pairs, 8-10 consecutive AU Hoogsteen base pairs, 10-12 consecutive AU Hoogsteen base pairs, 12-14 consecutive AU Hoogsteen base pairs, 14-16 consecutive AU Hoogsteen base pairs, 16-18 consecutive AU Hoogsteen base pairs, or 18-20 consecutive AU Hoogsteen base pairs).

[0006] In some embodiments, the triple helix comprises an A-rich tract of 5 to 30 nucleic acids (e.g., 5 to 10 nucleic acids, 10 to 20 nucleic acids, or 20 to 30 nucleic acids). In some embodiments, the A-rich tract is at the 3' end of the TTD (e.g., at or within the polyA tail).

[0007] In some embodiments, the triple helix comprises a stretch of 10 consecutive nucleotides, Nine of the ten consecutive nucleotides are paired via Hoogsteen base pairing. In some embodiments, the TTD comprises a stem-loop motif.

[0008] In some embodiments, the 3'TTD comprises a 5'U-rich motif, a stem-loop motif, a t'U-rich motif, and an A-rich tract operably linked in the 5' to 3' direction.

[0009] In some embodiments, the 3'TTD is at least 95% homologous to SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, or SEQ ID NO:23 (e.g., at least 96% homologous to SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, or SEQ ID NO:23; at least 97% homologous to SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, or SEQ ID NO:23; at least 98% homologous to SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, or SEQ ID NO:23; at least 99% homologous to SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, or SEQ ID NO:23; or 100% homologous to SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, or SEQ ID NO:23).

[0010] In some embodiments, the 3'TTD is at least 95% homologous (e.g., at least 96%, at least 97%, at least 98%, or at least 99% homologous) to SEQ ID NO: 13, and the triple helix comprises Hoogsteen base pairing between U7-U11 and an A-rich tract of SEQ ID NO: 13. In some embodiments, the 3'TTD is PAN ENE+A.

[0011] In some embodiments, the 3'TTD is at least 95% homologous (e.g., at least 96%, at least 97%, at least 98%, at least 99% homologous) to SEQ ID NO: 15, and the triple helix comprises Hoogsteen base pairing between U6-10, C11, and U12-15 of SEQ ID NO: 15 and an A-rich tract. In some embodiments, the 3'TTD is MALAT1 ENE+A.

[0012] In some embodiments, the 3'TTD is at least 95% homologous (e.g., at least 96%, at least 97%, at least 98%, at least 99% homologous) to SEQ ID NO: 17, and the triple helix comprises Hoogsteen base pairing of U6-10, C11, and U12-15 of SEQ ID NO: 17 with an A-rich tract. In some embodiments, the 3'TTD is MALAT1 core ENE+A.

[0013] In some embodiments, the 3'TTD is at least 95% homologous to SEQ ID NO: 23, and the triple helix comprises Hoogsteen base pairing of U8-10, C11, and U12-15 with an A-rich tract of SEQ ID NO: 23. In some embodiments, the 3'TTD is MENβ ENE+A.

[0014] In one embodiment, a nucleic acid trans-splicing molecule is provided, wherein the RTM comprises, operably linked in a 5' to 3' direction, (a) a coding sequence domain (CDS) comprising one or more functional exon(s) of a selected gene; (b) linker sequences of various lengths and / or compositions that act as structural links between the coding domain and the binding domain, and that may function as splicing enhancers or have the ability to fold into complex secondary structures that act to minimize translation of the coding region before a trans-splicing event occurs, or that may contain motifs that encode degradation peptides in the event of premature RTM maturation; (c) Spliceosome recognition motifs (splice donor, SD, 5' splice site, 5' SS) organized to initiate spliceosome-mediated trans-splicing. ) also known as (d) Binding domains (BDs) of various lengths and sequences designed to hybridize to target introns of selected genes, where the genes have at least one deletion or mutation in an exon 5' to the target intron; (e) a 3' transcription terminator domain (TTD), The nucleic acid trans-splicing molecule is configured to trans-splice a coding domain into an endogenous exon of a selected gene adjacent to a target intron, thereby replacing the endogenous defective or mutated exon with a functional exon and correcting the mutation in the selected gene.

[0015] In one embodiment, the binding domain hybridizes to a target intron of a selected gene 3' to the mutation, and the coding domain comprises one or more exon(s) 5' to the target intron.

[0016] In another embodiment, the RTMs are operably linked in a 5' to 3' direction as shown below: (a) Binding domains (BDs) of various lengths and sequences designed to hybridize to a target intron of a selected gene, the gene having at least one deletion or mutation in an exon 3' to the targeted intron; (b) linker sequences of various lengths and compositions that act as structural links between the binding domain coding regions and contain motifs that function as splicing enhancers or fold into complex secondary structures that prevent translation of the coding regions as competing events for trans-splicing, or encode degradation peptides in the event of premature RTM maturation; (c) a 3' spliceosome recognition motif (also called a splice acceptor, SA, or 3' splice site, 3'SS) configured to mediate trans-splicing; (d) a coding sequence domain (CDS) containing one or more functional exon(s) of the selected gene; and (e) a 3' transcription terminator domain (TTD), The nucleic acid trans-splicing molecule is configured to trans-splice a coding domain into an endogenous exon of a selected gene adjacent to a target intron, thereby replacing the endogenous missing or mutated exon with a functional exon and correcting a mutation in the selected gene. In one embodiment, the binding domain binds to a target intron of the selected gene 3' to the mutation, and the coding domain includes one or more exons 5' to the target intron.

[0017] In one embodiment, the 3' transcription terminator domain is a sequence from one or more long non-coding RNAs (lncRNAs) or other nuclear RNA molecules that contain a 3' transcription terminator that condenses into a triple-helical 3' blunt-end cap.

[0018] In another aspect, a recombinant adeno-associated virus (rAAV) is provided that includes any of the RTMs described herein.

[0019] In another aspect, a method for treating a disease caused by a defect or mutation in a target gene is provided, comprising administering to cells of a subject having the disease a composition comprising a recombinant AAV comprising the nucleic acid trans-splicing molecule described herein.

[0020] In yet another aspect, a pharmaceutical formulation is provided comprising a physiologically acceptable carrier and a rAAV or RTM described herein.

[0021] Other aspects and embodiments are described in the detailed description that follows. [Brief explanation of the drawings]

[0022] [Figures 1A-1E]Maps and partial sequences of RTM luciferase reporter constructs targeting intron 26 from human CEP290 are shown. These encode the 5' half of the luciferase coding sequence (CDS) along with various transcription terminator sequences: poly(A)—an SV40-derived polyadenylation signal, which generates the 3' end after cleavage at the poly(A) signal and addition of a nontemplated poly(A) tail (Figure 1A); hhRz—a hammerhead ribozyme, which self-cleaves to generate the 3' end of RTM (Figure 1B); Comp14—a truncated MALAT1 triple-helix terminator structure, which generates the 3' end of RTM after RNase P cleavage (two versions—Figure 1C, 1D); and a hybrid in which the mascRNA domain of Comp14 is replaced by hhRz, which generates the 3' end of RTM after ribozyme self-cleavage (Figure 1E). For Figure 1A (391.poly(A)), SEQ ID NO: 31 nt 2081-2600 is shown. For Figure 1B (391.hhRz), SEQ ID NO: 32 nt 2081-2447 is shown. For Figure 1C (391.Comp14-v1), SEQ ID NO: 33 nt 2081-2470 is shown. For Figure 1D (391.Comp14-v2), SEQ ID NO: 34 nt 2081-2470 is shown. For Figure 1E (391.Comp14.hhRz), SEQ ID NO: 35 nt 2081-2470 is shown. [Figure 1F] The map and sequence of the minigene containing intron 26 from human CEP290 fused to the 3' half of the luciferase CDS is shown in Figure 1F (pcDNA_FRT.In26 target3'Luc), SEQ ID NO: 36 nt 6761-7280. [Figure 2A-2B] 1A-1D show luciferase levels measured for the constructs depicted in Figures 1A-1D, as described in Example 1. RTM is delivered to a cell line expressing a minigene containing intron 26 from human CEP290 fused to the 3' half of the luciferase CDS shown in Figure 1F. [Figure 3A-3C]Figure 3 shows a map and partial sequence of an RTM construct targeting intron 23 of human ABCA4. These include one of several terminator sequences tested for ABCA4 trans-splicing activity: hhz-hammerhead ribozyme, which self-cleaves to generate the 3' end of the RTM (Figure 3A); truncated derivatives of the C14 or Comp14-MALAT1 triple helix structure, which generate the 3' end of the RTM after RNase P cleavage (Figure 3B); and wt-native MALAT1 triple helix terminator, which generates the 3' end of the RTM after RNase P cleavage (Figure 3C). Figure 3A shows a portion of the sequence shown in SEQ ID NO:28, with the 5' SS (also called the SD or splicing domain) starting at nt 4311 and the insulator ending at nt 4591. Figure 3B shows a portion of the sequence shown in SEQ ID NO: 29, where the 5'SS (also called SD or splicing domain) starts at nt 4311 and the mascRNA ends at nt 4620. Figure 3C shows a portion of the sequence shown in SEQ ID NO: 30, where the 5'SS (also called SD or splicing domain) starts at nt 4311 and the mascRNA ends at nt 4654. [Figure 4A-4B] Western blot showing ABCA4 protein generated by RTM-mediated trans-splicing and its quantification. The RTMs tested in Figure 3 include the binding domains of ABCA4 intron 23 (motifs 27 and 81) and intron 22 (motifs 117 and 118). NB is a negative control, non-binding motif. [Figure 5A]Western blot analysis of RTMs containing different triple-helical terminators derived from lncRNAs is shown. These include wild-type sequences from MALAT1 and NEAT1 (MENβ), as well as chimeric forms in which the triple-helical domain from MALAT1 is fused to a tRNA-like motif from NEAT1 (termed menRNA) and a chimeric form in which the triple-helical domain from NEAT1 is fused to a mascRNA motif from MALAT1. The data suggest that trans-splicing activity is highest when the RTM contains the wild-type MALAT1 terminator. [Figure 5B] Figure 1 shows predicted base pairing of triple-helical terminators from three different lncRNAs, including MALAT1, MENβ (NEAT1), and PAN RNA (produced by Kaposi's sarcoma-associated herpesvirus, KSHV). Structural similarities between different lncRNAs suggest a common evolutionary strategy for protecting the 3' end of lncRNAs after transcription termination. However, X-ray crystallography of the MALAT1 triple-helical domain revealed that most known native triple-helical structures contain ten major and two minor groove triples (Brown, J.A. et al. 2014). This complex design may confer a greater level of structural stability than either NEAT1 or PAN, which may explain why the MALAT1 terminator appears to better support trans-splicing by protecting the RTM from degradation in the nucleus. Importantly, the blunt-ended triple helix of MALAT1 has been shown to inhibit rapid nuclear RNA decay, as demonstrated by in vivo decay assays (Brown, JA 2014). [Figure 6A]The highly conserved mascRNA sequence of MALAT1 from several species and its predicted folded conformation are shown. A single G-to-A point mutation, indicated by the red arrow, was inserted into the mascRNA sequence to test the importance of this domain for trans-splicing activity. As shown in Western blots (Figure 6B), the point mutation eliminated the trans-splicing activity of a validated RTM targeting ABCA4, likely due to the inability of the mutated sequence to adopt the correct conformation required for RNase P recognition and cleavage. [Figure 7]

[0023] Figure 1 shows a vector map of the vector containing the codon-optimized ABCA4 coding sequence and hammerhead ribozyme (hhRz). The sequence is shown in SEQ ID NO: 28. [Figure 8]

[0033] Figure 2 shows a vector map of a vector containing the codon-optimized ABCA4 coding sequence, MALAT1 for codons 1 to 23 and the truncated MALAT1 Comp14 3'TTD sequence. The sequence is shown in SEQ ID NO: 29. [Figure 9] Figure 1 shows the vector map of the vector containing the codon-optimized ABCA4 coding sequence, MALAT1 and wtMALAT1 3'TTD sequence for codons 1 to 23. The sequence is shown in SEQ ID NO: 30. [Figure 10] 1 shows a map and sequence of the triple helix region from human MALAT1 lncRNA. The sequence of MALAT1 is shown in SEQ ID NO: 7. The triple helix region begins at 8287 of SEQ ID NO: 7, and the lncRNA ends at 8437 of SEQ ID NO: 7. DETAILED DESCRIPTION OF THE INVENTION

[0023] Many experimental trans-splicing studies reported in the literature often fall short of therapeutically meaningful endpoints. This does not imply that these studies are not significant, as they always demonstrate the essential role of RTM binding domains and splice site signals. While these fundamental elements are certainly important, the complexity of RNA splicing involves an array of additional cis- and trans-acting factors for template recognition, the spliceosome, not to mention other non-splicing mechanisms that can directly affect the turnover or localization of RTM molecules. Because trans-splicing is competitively disadvantaged compared to cis-splicing, it is essential that the technical design of RNA trans-splicing molecules (RTMs) include features that increase the likelihood of favoring RTMs. One way to achieve this is to increase the effective concentration of RTMs in the nucleus or to make RTMs a more attractive target for the spliceosome (via cis-acting elements or localization).

[0024] At the heart of this disclosure is an RNA trans-splicing system designed to specifically target a gene of interest and deliver its genetic payload via a trans-splicing reaction. There are several RTM molecules (RTMs). Structurally, RTMs are organized into three core domains: 1) the protein-coding region; 2) the binding domain, which hybridizes to an intron within the target gene RNA transcript; and 3) a linker sequence with a splicing signal (5'SS or 3'SS) connecting the coding region to the binding domain. It is important to emphasize that each of these three regions also has a functional role. While modifications to any of these regions could theoretically affect RTM activity, the binding domain has received the most attention. In fact, most reports in the literature include some degree of screening to identify optimal binding sequences. Both the position and length of the target sequence have been shown to affect RTM activity. However, there is no evidence of sequence-specific features that could constitute a consensus motif or aid in the development of binding domain design rules that could be applicable across different gene targets. As a result, binding domains are always determined by trial and error.

[0025] The reasons why some binding domains perform better than others remain unclear. A likely explanation relates to RNA folding and how this can affect the availability of a given target sequence for RTM hybridization. RNA folding can also affect the RTM binding domain itself; if the binding domain adopts a complex secondary structure, it may be unavailable for hybridization with the target intron. Once an optimal binding domain is identified, the RTM follows the same rules as other RNAs in the nucleus. This may affect RTM activity independently of the binding reaction. Mechanistically, the RTM must have a half-life in the nucleus long enough for the binding reaction to occur. Trans-splicing efficiency decreases if the RTM is exported out of the nucleus or degraded by ubiquitous nuclear ribonucleases, two events that significantly reduce the effective RTM concentration.

[0026] The biology of long noncoding RNAs (lncRNAs) has recently become a topic of intense interest in biomedical research and medicine. This is largely due to the observation that lncRNAs have been shown to be upregulated in certain cancers. While this relationship does not appear to be causal, understanding the role of these enigmatic RNAs can shed light on their possible role in gene regulation. Like RTMs, lncRNAs are transcribed by RNA polymerase II. Both face the same challenge: 3'-end processing to ensure accurate polymerase termination and functionality of the mature transcript. In the case of RTMs, most literature reports use polyadenylation signals for 3'-end processing. However, this approach signals RTMs to the cytoplasm, effectively reducing their nuclear copy number and resulting in the expression of truncated proteins with unknown biological consequences. RTM expression, or sometimes referred to as RTM maturation, which produces truncated proteins, is an undesirable consequence / off-target effect with unknown biological consequences. In contrast, many lncRNAs lack polyadenylation signals and instead rely on non-canonical 3'-end processing for Pol II termination. Some of these adopt simple stem-loop structures at their 3' ends that are thought to help stabilize mature transcripts (e.g., histone mRNAs). Others, however, use significantly more complex secondary structures.

[0027] lncRNAs have evolved a blueprint for nuclear localization that is thought to include at least two features: 1) a nuclear localization signal, and 2) a mechanism for non-canonical 3'-end processing to avoid degradation by ribonucleases, thereby increasing their stability. A prototype lncRNA shown to contain both of these features is called MALAT1 (metastasis-associated lung adenocarcinoma transcript 1). Interestingly, the 3' end of MALAT1 is highly conserved across species and condenses into a triple-helical structure after recognition and cleavage of a tRNA-like structure by RNase P. (Wilutz et al. 2012. Genes and Develop. 26:(2392)-2407). This triple helix is thought to help stabilize the MALAT1 transcript in nucleases.

[0028] As described herein, a 3' triple helix from human MALAT1 was added to a research RNA targeting either the primary RNA transcript encoded by the CEP290-luciferase reporter or the primary RNA transcript encoded by the endogenous ABCA4 gene. In all cases, the presence of the 3' triple helix terminator significantly enhanced trans-splicing activity. This was first demonstrated with a 117-bp truncated version of the 3' triple helix (described in Wilutz et al. 2012 and called Comp14) and later with the 151-bp native sequence (NCBI REFSEQ: NR_002819).

[0029] In one aspect, the compositions and methods described herein employ adeno-associated virus (AAV)-based gene therapy as a means for treating inherited genetic disorders. More specifically, the methods and compositions described herein employ the use of pre-mRNA trans-splicing as a gene therapy, both ex vivo and in vivo, for the treatment of diseases caused by defects in large genes. In one embodiment, these compositions and methods overcome the problems caused by the 4700 nucleotide limit for packaging nucleic acids into AAV. When including sequences necessary for the production of effective rAAV therapeutics and expression of RNA-trans-splicing molecules (RTMs), the effective size constraint for RTMs containing ocular gene sequences is approximately 4000 nucleotides. These methods and compositions are particularly desirable for treating disorders caused by defects in genes that exceed the size required for integration and expression in AAVs, such as ABCA4, CEP290, and MYO7A, among others.

[0030] Unless otherwise defined, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs and by reference to published documents which provide those skilled in the art with general guidance to many of the terms used herein. The definitions used herein are provided for clarity only and are not intended to limit the claimed invention.

[0031] As used herein, "3' transcription terminator domain" or "3'TTD" refers to a long non-coding RNA (lncRNA) located at the 3' end of a trans-splicing molecule. In some cases, the 3'TTD increases trans-splicing efficiency. In some cases, the transcription terminator domain contains an expression and nuclear retention element (ENE), which can form an ENE+A when aligned with an A-rich tract (e.g., a polyA tail).

[0032] As used herein, "long non-coding RNA" or "lncRNA" refers to a non-protein-coding RNA transcript of more than 200 nucleotides (e.g., more than 300 nucleotides, more than 400 nucleotides, or more than 500 nucleotides). In some embodiments, the lncRNA is 200-300 nucleotides, 300-400 nucleotides, 400-500 nucleotides, or more than 500 nucleotides.

[0033] As used herein, the term "trans-splicing efficiency" refers to the number of trans-spliced RNA transcripts produced per trans-splicing molecule administered to a cell. Thus, trans-splicing efficiency reflects the stability, and nuclear localization and retention, of trans-splicing molecules.

[0034] As used herein, the terms "triple helix," "triple helix structure," and "triple strand," as well as their grammatical derivatives, are used interchangeably and refer to a region of a polynucleotide (e.g., RNA) characterized by stacked major groove triples formed by Hoogsteen base pairing. In some cases, a triple helix contains multiple (e.g., four or more) consecutive nucleotides paired via Hoogsteen base pairing. In some embodiments, a triple helix contains four or more consecutive adenosine nucleotides, with each consecutive adenine paired to a uracil via Hoogsteen base pairing (e.g., a polyA tract aligns with a U-rich motif, e.g., in a stacked major groove triple).

[0035] As used herein, the term "A-rich tract" refers to a contiguous stretch of nucleic acid in which at least 80% of the contiguous nucleic acid is adenine (A).

[0036] As used herein, the term "U-rich motif" refers to a contiguous stretch of nucleic acid in which at least 80% of the contiguous nucleic acid is uracil (U).

[0037] A "nucleic acid trans-splicing molecule" or "trans-splicing molecule" has three major elements: (a) a binding domain that confers specificity by linking the trans-splicing molecule to its target gene (e.g., pre-mRNA), (b) a splicing domain (e.g., a splicing domain with a 3' or 5' splice site), and (c) a coding sequence that is configured to be trans-spliced onto a target gene and can replace one or more exons (e.g., one or more mutated exons) in the target gene. A "pre-mRNA trans-splicing molecule" or "RTM" refers to a nucleic acid trans-splicing molecule that targets a pre-mRNA. In some embodiments, a trans-splicing molecule such as an RTM can include a cDNA as part of a functional exon, e.g., for replacing or correcting a mutated exon.

[0038] A nucleic acid is "operably linked" when it is placed into a structural or functional relationship with another nucleic acid sequence. For example, one nucleic acid sequence can be operably linked to another nucleic acid sequence when they are arranged relative to each other on the same contiguous polynucleotide and have a structural or functional relationship, such as forming a triple helix (e.g., through Hoogsteen base pairing). In some cases, operably linked nucleic acid sequences are directly linked (i.e., a nucleic acid sequence is directly covalently linked to another nucleic acid sequence, with no intervening nucleotides). In other cases, operably linked nucleic acid sequences are not directly linked. When operably linked nucleic acid sequences are not directly linked, they can be operably linked (indirectly) through a linker sequence. In some cases, the linker sequence may be 1 to 1,000 bases in length (e.g., 1 to 900, 1 to 800, 1 to 700, 1 to 600, 1 to 500, 1 to 400, 1 to 300, 1 to 250, 1 to 200, 1 to 150, 1 to 100, 1 to 90, 1 to 80, 1 to 70, 1 to 60, 1 to 50, 1 to 40, 1 to 30, 1 to 20, 1 to 10, 1 to 8, 1 to 6, 1 to 5, 1 to 4, or 1 to 3 bases in length, e.g., 1 to 10, 10 to 15, 15 to 20, 20 to 30, 30 to 40, 40 to 50, 50 to 100, 100 to 150, 150 to 200, or 200 to 500 bases in length). In some cases, the A-rich tract is operably linked 3' to the U-rich motif via a linker sequence.

[0039] As used herein, the term "mammalian subject" or "subject" includes any mammal in need of these therapeutic or prophylactic methods, and particularly includes humans. Other mammals in need of such treatment or prophylaxis include dogs, cats, or other domesticated animals, These include horses, farm animals, laboratory animals including non-human primates, etc. The subject may be male or female.

[0040] In one embodiment, the subject has or is at risk of developing a disorder caused by gene mutation.In one embodiment, the subject has or is at risk of developing an eye disorder.In another embodiment, the subject shows clinical signs of an eye disorder, particularly a disorder associated with the deficiency or mutation of ABCA4, CEP290 or MYO7A gene.

[0041] The term "ocular disorder" includes, but is not limited to, Stargardt disease (autosomal dominant or autosomal recessive), retinitis pigmentosa, rod-cone dystrophy, Leber congenital amaurosis, Usher syndrome, Bardet-Biedl syndrome, Best disease, retinoschisis, untreated retinal detachment, pattern dystrophy, cone-rod dystrophy, color vision deficiency, ocular albinism, S-cone enhancement syndrome, diabetic retinopathy, age-related macular degeneration, retinopathy of prematurity, sickle cell retinopathy, congenital stationary night blindness, glaucoma, or retinal vein occlusion. In another embodiment, the subject has or is at risk of developing glaucoma, Leber hereditary optic neuropathy, a lysosomal storage disorder, or a peroxisomal disease.

[0042] Clinical signs of eye disease include, but are not limited to, decreased peripheral vision, decreased central (reading) vision, decreased night vision, loss of color vision, decreased visual acuity, decreased photoreceptor cell function, and pigmentary changes. In another embodiment, the subject has been diagnosed with STGD1. In another embodiment, the subject has been diagnosed with early-onset macular degeneration, fundus flava. In another embodiment, the subject has been diagnosed with cone-rod dystrophy. In another embodiment, the subject has been diagnosed with retinitis pigmentosa. In another embodiment, the subject has been diagnosed with age-related macular degeneration (AMD). In another embodiment, the subject has been diagnosed with LCA10. In yet another embodiment, the subject does not yet exhibit clinical signs of these eye conditions.

[0043] As used herein, the term "treatment" or "treating" is defined as one or more of reducing the onset or progression of an ocular disease in a given subject, preventing the disease, reinducing the severity of or slowing the progression of disease symptoms, eliminating disease symptoms, delaying the onset of the disease, or monitoring the progression of the disease or the effectiveness of a treatment.

[0044] As used herein, the term "selected cells" refers to any cell or cell type to which an RTM is delivered (i.e., the intended target for modification using the compositions and methods provided herein). In certain embodiments, the selected cells are prokaryotic cells. In other embodiments, the selected cells are eukaryotic cells, non-limiting examples of which include plant cells and tissues, animal cells and tissues, and human cells and tissues. The cells may be derived from an established cell line, or they may be primary cells; "primary cells," "primary cell lines," and "primary cultures" are used interchangeably herein to refer to cells and cell cultures derived from a subject and grown in vitro for a limited number of culture passages. Without limitation, the selected cells may be cancerous, for example. In certain embodiments, the selected cells are engineered ex vivo and then administered to a subject. In yet other embodiments, the selected cells are targeted in vivo, for example, by delivery of a rAVV to a subject. In some embodiments, the term "selected cells" refers to ocular cells, which are any cells associated with ocular function, such as photoreceptor cells. In some embodiments, the term refers to rods, cones, photosensitive ganglion cells, retinal pigment epithelial (RPE) cells, Muller cells, bipolar cells, horizontal cells, or amacrine cells. Some gene targets are expressed in the eye and other organs. For example, CEP290 is expressed in kidney epithelium and the central nervous system, and MY07A is expressed in cochlear hair cells. Thus, the selected cells may include these extraocular cells. In certain embodiments, the selected cells may be expressed in the eye. The selected cells are skeletal muscle cells, e.g., red (slow) skeletal muscle cells, white (fast) skeletal muscle cells, or intermediate skeletal muscle cells. In certain embodiments, the selected cells are cardiomyocytes, e.g., cardiomyocytes or nodal cardiomyocytes. In certain embodiments, the selected cells are smooth muscle cells. In certain embodiments, the selected cells are muscle satellite cells or muscle stem cells.

[0045] As used herein, the term "host cell" can refer to a packaging cell line in which an rAAV is produced from a plasmid. Alternatively, the term "host cell" can refer to a target cell in which expression of a transgene is desired.

[0046] Codon optimization refers to modifying nucleic acid sequences to alter individual nucleic acids without changing the encoded amino acids. This process can be performed on any of the sequences described herein to improve expression or stability. Codon optimization can be performed, for example, as described in U.S. Patent Nos. 7,561,972, 7,561,973, and 7,888,112, which are incorporated herein by reference, as well as by converting the sequence surrounding the translation start site to a consensus Kozak sequence. Kozak et al., Nucleic Acids, vol. 1, pp. 111-113, 2002, which are incorporated herein by reference. See Re. 15(20):8125-8148. In one embodiment, the coding sequence is codon optimized.

[0047] The term "homology" refers to the degree of identity between two nucleic acid sequences. The homology of homologous sequences is determined by comparing two sequences aligned under optimal conditions for the sequences being compared. The sequences compared herein may have additions or deletions (e.g., gaps) in the optimal alignment of the two sequences. Such sequence homology can be calculated, for example, by creating an alignment using the ClustalW algorithm (Nucleic Acid Res., 22(22):4673-4680(1994)). Commonly available sequence analysis software, more specifically, Vector NTI, GENETYX, BLAST, or analysis tools provided by public databases, can also be used.

[0048] The term "pharmaceutically acceptable" means approved by a regulatory agency of the federal or state government or listed in the United States Pharmacopoeia or other generally recognized pharmacopeia for use in animals, and more specifically, in humans.

[0049] The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which a synthetic substance is administered. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by EW Martin.

[0050] The terms "a" or "an" refer to one or more, for example, "a gene" is understood to refer to one or more genes. Thus, the terms "a" (or "an"), "one or more," and "at least one" are used interchangeably herein.

[0051] As used herein, the term "about" means ±0.1 to 10% variability from a given reference, unless otherwise specified.

[0052] With respect to the following description, each of the compositions described herein is intended to be useful, in another embodiment, in the methods of treatment described herein. In addition, each of the compositions described herein as being useful in the methods is also intended to be an embodiment in itself. Various embodiments herein may be described as including, or comprising, other components or steps. Although some embodiments are shown using the term "consisting of" or "consisting essentially of," in other circumstances, it is intended that the relevant embodiments also be construed and described using the term "consisting of" or "consisting essentially of," excluding all or any component or step that would materially alter the embodiment.

[0053] Pre-mRNA trans-splicing methods and molecules Within cells, there exists a pre-mRNA intermediate that contains non-coding nucleic acid sequences, i.e., introns, and nucleic acid sequences that code for the amino acids that form the gene product. Introns are interspersed between the exons of genes within the pre-mRNA and are ultimately excised from the pre-mRNA molecule when the exons are joined by a protein complex known as the spliceosome. Spliceosome activity can be used to introduce alternative exons through the introduction of a second nucleic acid. Spliceosome-mediated RNA trans-splicing (SMaRT) has been described, which uses engineered pre-mRNA trans-splicing molecules (RTMs) that specifically bind to target pre-mRNAs in the nucleus and trigger trans-splicing in a process mediated by the spliceosome. This methodology is described, for example, in Puttaraju M, et al. 1999 Nat Biotechnol.,17:246-252; Gruber C et al., 2013 Dec., Mol. Oncol.7(6):1056; Avale ME, 2013 Jul., Hum. Mol. Genet.,22(13):2603-11; Rindt H et al., 2012 Dec., Cell Mol. Life Sci.,69(24):4191; U.S. Patent Application Publication Nos. 2006 / 0246422 and 2013 / 0059901, and U.S. Patent Nos. 6,083,702, 6,013,487, 6,280,978, 7,399,753, and 8,053,232. These documents are incorporated herein by reference.

[0054] The nucleic acid trans-splicing molecules disclosed herein may include any of the structural or functional features of nucleic acid trans-splicing molecules and related methods known in the art, such as those described in WO2017 / 087900 and WO2019 / 2045114, each of which is incorporated herein by reference in its entirety.

[0055] In some embodiments, the RNA trans-splicing molecules (RTMs) described herein have five major elements. In one embodiment, the elements are operably linked in a 5' to 3' direction: (a) a coding domain (CD) containing one or more functional exon(s) of a selected gene; (b) Linker domains (LDs) of various lengths and sequences that act as structural links between the coding and binding domains and have the ability to function as splicing enhancers or fold into complex secondary structures that act to minimize translation of the coding region before a trans-splicing event occurs, or that may contain motifs that encode degradation peptides in the event of premature RTM maturation; (c) a spliceosome recognition motif (splice donor, SD) configured to initiate spliceosome-mediated trans-splicing; (d) binding domains (BDs) of various lengths and sequences configured to hybridize to target introns of selected genes, the genes having at least one deletion or mutation in an exon 5' to the target intron; (e) a 3' transcription terminator domain (TTD) that increases the efficiency of trans-splicing.

[0056] Nucleic acid trans-splicing molecules splice the coding domain into a selected region adjacent to the target intron. It is configured to trans-splice into an endogenous exon of a selected gene, thereby replacing the endogenous deleted or mutated exon with a functional exon and correcting the mutation in the selected gene.

[0057] In another embodiment, the elements are operably linked in a 5' to 3' direction: (a) a binding domain (BD) configured to bind to a target intron of a selected gene, the gene having at least one deletion or mutation in an exon 3' to the target intron; (b) linker sequences of various lengths and compositions that act as structural links between the binding domain coding regions and contain motifs that function as splicing enhancers or fold into complex secondary structures that prevent translation of the coding regions as competing events for trans-splicing, or encode degradation peptides in the event of premature RTM maturation; (c) a 3′ spliceosome recognition motif (splice acceptor, SA) configured to mediate trans-splicing; (d) a coding domain (CD) containing one or more functional exon(s) of the selected gene; (e) a 3' transcription terminator domain (TTD) that increases the efficiency of trans-splicing.

[0058] Coding domain sequence (CDS) The coding domain of the RTM described herein comprises a portion of the wild-type coding sequence that is trans-spliced into the target pre-mRNA. By "wild-type coding sequence" is meant a sequence that, upon translation and assembly, provides a functional protein. Expression or function need not be at the same level as the wild-type protein. In one embodiment, the wild-type coding sequence is modified, for example, by codon optimization.

[0059] Pre-RNA trans-splicing molecules (RTMs) are configured to trans-splice a coding domain into an endogenous exon of a selected gene adjacent to a target intron, thereby replacing the endogenous missing or mutated exon with a functional exon and correcting the mutation in the selected gene. Depending on the configuration of the RTM, the CDS may provide a binding domain for some or all of the 3' or 5' exon of the selected gene. For example, in a 5' trans-splicing reaction, all or part of the exon 5' of the BD is replaced. In a 3' trans-splicing reaction, all or part of the exon 3' of the BD is replaced. The RTM can be designed to replace the missing or mutated portion of a pre-mRNA exon with a nucleic acid sequence, i.e., an exon with a normal sequence without the deletion or mutation. The "normal" sequence can be a wild-type, naturally occurring sequence, or a corrected sequence with some other modifications, such as codon modifications, that do not cause disease.

[0060] In one embodiment, the coding domain is a single exon of the target gene containing the normal wild-type sequence lacking a disease-causing mutation, e.g., exon 22 of ABCA4. In another embodiment, the coding domain contains multiple exons containing multiple disease-causing mutations, e.g., exons 1-22 of ABCA4. Depending on the location of the exons to be corrected, the RTM may contain multiple exons located at the 5' or 3' end of the target gene, or the RTM may be designed to replace an exon in the middle of the gene. For use and delivery in rAAV, the entire coding sequence of an eye gene is not useful as the coding domain for the RTM unless this technology is directed at small eye genes less than 3,000 nucleotides in length. As described herein, two RTMs, 3' and 5' RTMs, can be used in different rAAV particles to replace entire large genes.

[0061] The RTMs described herein can include coding domains encoding one or more exons characterized as containing genetic mutations or defects associated with the relevant disease identified herein; for example, exon 27 of ABCA4 can be the coding domain of an RTM designed for the treatment of Stargardt disease. Tables 1-3 herein identify target genes and exons containing mutations likely to cause disease.

[0062] In one embodiment, the coding domain of the 5' RTM is designed to replace an exon at the 5' end of the target gene. In another embodiment, the coding domain of the 3' RTM is designed to replace an exon at the 3' end of the gene. In another embodiment, the coding domain is one or more exons located within a gene, and the coding domain is located in a double trans-splicing RTM.

[0063] Thus, for example, three possible types of RTMs are useful for treating diseases caused by, for example, deficiencies of ABCA4: 5' trans-splicing RTMs containing a 5' splice site. After trans-splicing, the 5' RTM modifies the 5' region of the target mRNA, 3' RTMs containing a 3' splice site used for trans-splicing and replacing the 3' region of the target mRNA, and double trans-splicing RTMs carrying multiple binding domains along with the 3' and 5' splice sites. After trans-splicing, this RTM replaces an internal exon within the processed target mRNA. In other embodiments, the coding domain can include an exon containing a naturally occurring or artificially introduced stop codon to reduce gene expression, or the RTM can contain other sequences that produce an RNAi-like effect.

[0064] When used to treat Stargardt disease, the preferred coding region for ABCA4 is exons 1-22 or 27-50 in a separate RTM. When used to treat LCA10, the preferred coding region for CEP290 is exons 1-26 or exons 27-54 in a separate RTM. When used to treat Usher syndrome, the preferred coding region for MYO7A is exons 1-18 or 33-49 in a separate RTM.

[0065] Still other coding domains can be constructed by one skilled in the art, given the teachings provided herein, to replace the entire gene for fragments provided by the 5' and 3' RTMs, and / or double spliced RTMs.

[0066] Linker Domain (LD) In some embodiments, the RTMs described herein comprise linker domains (LDs) of various lengths and sequences that act as structural links between the coding domain and the binding domain. In one embodiment, the LD comprises one or more motifs that function as splicing enhancers. In one embodiment, the LD provides one or more motifs capable of folding into complex secondary structures that act to minimize translation of the coding region before a trans-splicing event occurs.

[0067] In one embodiment, the linker sequence is SEQ ID NO: 37: ccgaatacgacacgtagcaagatct.

[0068] Spliceosome recognition motifs (splice donor (SD) and splice acceptor (SA)) Depending on the orientation of the RTM (5'- or 3'), the RTM contains a spliceosome recognition motif, which is a splice donor (SD), a splice acceptor (SA), or both.

[0069] Introns always have two different nucleotides at each end. At the 5' end, the DNA nucleotides are GT [GU in pre-messenger RNA (pre-mRNA)] and at the 3' end, AG. These nucleotides are part of the splice sites. SD is the splice site at the beginning of the intron, at the 5' left end of the intron, and is sometimes referred to as the 5' splice site or 5' SS. SA is the splice site at the end of the intron, at the 3' right end of the intron, and is sometimes referred to as the 3' splice site or 3' SS. [ka]

[0070] Briefly, the splicing domain provides the essential consensus motif recognized by the spliceosome. The use of BP and PPT follows the consensus sequence required for the execution of the two phosphoryl transfer reactions involved in cis-splicing and possibly trans-splicing. In one embodiment, the branch point consensus sequence in mammals is YNYURAC (Y = pyrimidine; N = any nucleotide). The underlined A is the site of branch formation. The polypyrimidine tract is located between the branch point and the splice site acceptor and is important for differential branch point utilization and 3' splice site recognition. Consensus sequences for 5' splice donor sites and 3' splice regions used in RNA splicing are well known in the art. Furthermore, modified consensus sequences that maintain their ability to function as 5' donor splice sites and 3' splice regions may be used. Briefly, in one embodiment, the 5' splice site consensus sequence is the nucleic acid sequence AG / GURAGU (where / indicates the splice site). In another embodiment, endogenous splice sites corresponding to the exons proximal to the splice site can be used to maintain any splicing regulatory signals. In one embodiment, an ABCA4 5' RTM containing a coding region encoding exons 1-22 with a binding domain complementary to a region of intron 22 uses the endogenous intron 22 5' splice site. In another embodiment, an ABCA4 3' RTM encoding exons 27-50 with a binding domain complementary to intron 26 uses the endogenous intron 26 3' splice site.

[0071] In one embodiment, a suitable 5' splice site with a spacer is as follows: 5'-GTA AGA GAG CTC GTT GCG ATA TTA T-3' SEQ ID NO: 1. In one embodiment, the preferred 5' splice site is AGGT.

[0072] In one embodiment, a suitable 3' RTM BP is 5'-TACTAAC-3' (SEQ ID NO: 2). In one embodiment, a suitable 3' splice site is as follows: 5'-TAC TAA CTG GTA CCT CTT CTT TTT TTT CTG CAG-3' SEQ ID NO: 2, or 5'-CAGGT-3' (SEQ ID NO: 4). A suitable 3' RTM PPT is 5'-TGG TAC CTC TTC TTT TTT TTC TG-3' SEQ ID NO:5.

[0073] Binding domain (BD) The RTM comprises a binding domain (BD) of various lengths and sequences configured to hybridize to a target intron of a selected gene. In one embodiment, the binding domain is a nucleic acid sequence complementary to the sequence of the target pre-mRNA, e.g., to create a chimeric molecule having a portion of an endogenous mRNA and a coding domain with one or more functional exons, while suppressing endogenous target cis-splicing while enhancing trans-splicing between the trans-splicing molecule and the target pre-mRNA. In some embodiments, the binding domain is in an antisense orientation relative to the sequence of the target intron.

[0074] 5' trans-splicing molecules generally bind to the target intron 3' to the mutation, while 3' trans-splicing molecules generally bind to the target intron 5' to the mutation. In one embodiment, the binding domain comprises a portion of the sequence complementary to the target intron. In one embodiment herein, the binding domain is a nucleic acid sequence complementary to the intron closest (i.e., adjacent) to the exon sequence being corrected.

[0075] In another embodiment, the binding domain targets an intron sequence adjacent to the 3' or 5' splice signal of the target intron. In yet another embodiment, the binding domain sequence can bind to the target intron in addition to a portion of the adjacent exon.

[0076] Thus, in some cases, the binding domain specifically binds to the mutated endogenous target pre-mRNA, anchoring the coding domain of the trans-splicing molecule to the pre-mRNA and allowing trans-splicing to occur at the correct location within the target gene. The nuclear spliceosome processing machinery can then mediate successful trans-splicing of the corrected exon relative to the disease-causing mutant exon.

[0077] In certain embodiments, the trans-splicing molecule is characterized by a binding domain that contains a sequence on the target pre-mRNA that binds at two or more locations.The binding domain may contain any number of nucleotides required to stably bind to the target pre-mRNA and allow trans-splicing to occur in the coding domain.In one embodiment, the binding domain is selected using mFOLD structural analysis for accessible loops (Zuker, Nucleic Acids Res 2003,31(13):3406-3415).

[0078] A suitable target binding domain can be 10 to 500 nucleotides in length. In some embodiments, the binding domain is 20 to 400 nucleotides in length. In some embodiments, the binding domain is 50 to 300 nucleotides in length. In some embodiments, the binding domain is 100 to 200 nucleotides in length. In some embodiments, the binding domain is 10 to 20 nucleotides in length (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length), 20 to 30 nucleotides in length (e.g., 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length), 30 to 40 nucleotides in length (e.g., 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides in length), 40 to 50 nucleotides in length, or 50 to 60 nucleotides in length. 0 nucleotides in length (e.g., 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 nucleotides in length), 50-60 nucleotides in length (e.g., 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 nucleotides in length), 60-70 nucleotides in length (e.g., 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or 70 nucleotides in length), 70-80 nucleotides in length (e.g., 70, 71, 72, 73, 74, 75 , 76, 77, 78, 79, or 80 nucleotides in length), 80-90 nucleotides in length (e.g., 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, or 90 nucleotides in length), 90-100 nucleotides in length (e.g., 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 nucleotides in length), 100-110 nucleotides in length (e.g., 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, or 110 nucleotides in length), 110-120 nucleotides in length (e.g., 110, 111 , 112, 113, 114, 115, 116, 117, 118, 119, or 120 nucleotides in length), 120-130 nucleotides in length (e.g., 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, or 130 nucleotides in length), 130-140 nucleotides in length (e.g., 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, or 140 nucleotides in length), 140-150 nucleotides in length (e.g., 140, 141, 142, 143, 144, 145, 146, 147, 148 , 149, or 150 nucleotides in length), 150-160 nucleotides in length (e.g., 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, or 160 nucleotides in length), 160-170 nucleotides in length (e.g., 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, or 170 nucleotides in length), 170-180 nucleotides in length (e.g., 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, or 180 nucleotides in length), 180-19 0 nucleotide length (e.g., 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, or 190 nucleotides), 190 to 200 nucleotide length (e.g., 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, or 200 nucleotides), 200 to 210 nucleotide length, 210 to 220 nucleotide length, 220 to 230 nucleotide length, 230 to 240 nucleotide length, 240 to 250 nucleotide length, 250 to 260 nucleotide length, 260 to 270 nucleotide length,The length of the target binding domain may be 270-280 nucleotides, 280-290 nucleotides, 290-300 nucleotides, 300-350 nucleotides, 350-400 nucleotides, 400-450 nucleotides, or 450-500 nucleotides. In some embodiments, the binding domain is approximately 150 nucleotides in length. In other embodiments, the target binding domain may comprise a nucleic acid sequence up to 750 nucleotides in length. In other embodiments, the target binding domain may comprise a nucleic acid sequence up to 1000 nucleotides in length. In other embodiments, the target binding domain may comprise a nucleic acid sequence up to 2000 nucleotides or more in length.

[0079] In some embodiments, the specificity of the trans-splicing molecule can be increased by increasing the length of the target binding domain. Other lengths may be used depending on the lengths of the other components of the trans-splicing molecule.

[0080] The binding domain may be 80% to 100% complementary to the target intron so that it can stably hybridize with the target intron. For example, in some embodiments, the binding domain is 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to the target intron. The degree of complementarity is selected by those skilled in the art based on the need to maintain a nucleic acid construct containing the trans-splicing molecule and sequences necessary for expression and inclusion in an rAAV, and to remain within the 3,000 or maximum 4,000 nucleotide base limit. The sequence selection and strength of hybridization depend on the complementarity and length of the nucleic acid.

[0081] In one embodiment, the BD targets intron 23 of ABCA4, motif 81. In one embodiment, the sequence is as follows: SEQ ID NO: 6: TCACTGTTTAATCTGTTAATTCATCTGAGCATTTTGAGGGTGTAGTCGCTTGA TTTTATCCTAGAGAGTGTGTGAGTCACACACAGAGAGGAGCAGAACCTCCAAGGGTCCCTTTGGCTTGTCATCAATTATGTGGCAGCTGTAGGTTCT.

[0082] 3' transcription terminator domain (TTD) The RTMs described herein include a 3' transcription terminator domain (TTD), e.g., a 3'TTD that increases the efficiency of trans-splicing. In one embodiment, the TTD includes one or more of the following sequences: a sequence involved in triplex formation (also referred to herein as a "triple helix" or "triple helix structure"), an RNase P cleavage site, a tRNA-like structure (also referred to herein as a tRNA-like domain, structure, or sequence) that serves as a template for RNase P cleavage, and any flanking sequences that may independently or collectively facilitate the folding of these domains. Such flanking sequences may be artificial linkers, linkers derived from another sequence, or flanking sequences derived from natural lncRNAs. In one embodiment, the 3' transcription terminator domain forms a triple helix structure that effectively caps the 3' end or protects the 3' end from nuclease degradation. As discussed herein, the tRNA-like domain may also include an RNase P cleavage site.

[0083] Long non-coding RNAs function as important regulatory mediators in gene expression. Some lncRNAs have been shown to have 3' ends generated by non-canonical recognition and cleavage of tRNA-like structures by RNase P. In some cases, some lncRNAs have been shown to be protected from 3'-5' endonucleases by a highly conserved triple-helical structure. As provided herein, the 3' end of certain lncRNAs can be incorporated into the RTM as a terminal domain (TTD), which can increase the efficiency of trans-splicing. In one embodiment, the TTD is a sequence from one or more long non-coding RNAs (lncRNAs) or other nuclear RNA molecules that contain a 3' transcriptional terminator that condenses into a triple-helical 3'-end cap. In one embodiment, the TTD sequence is derived from the human long non-coding RNA MALAT1. In another embodiment, the TTD sequence is derived from the human lncRNA MENβ. In one embodiment, the TTD comprises nucleotides 8287 to 8437 of human MALAT1 (SEQ ID NO: 7). In another embodiment, the TTD comprises, in 5' to 3' order, a triplex-forming sequence comprising nucleotides 8287 to 8379 of SEQ ID NO: 7, an RNase P cleavage site comprising nucleotides 8379 to 8380 of SEQ ID NO: 7, and a tRNA-like sequence comprising nucleotides 8380 to 8437 of SEQ ID NO: 7.

[0084] In some embodiments, the 3'TTD comprises, in the 5' to 3' direction (directly or indirectly linked), a 5' U-rich motif, a stem-loop motif, a 3' U-rich motif, and an A-rich tract (e.g., a polyA tail). In some cases, the A-rich tract is capable of Hoogsteen base pairing with the 5' U-rich motif. In some embodiments, one or both stem strands are about 8 to 20 base pairs in length (e.g., 9 to 16, 10 to 14, or 11 to 23 base pairs in length). In some embodiments, the 5' U-rich motif and the 3' U-rich motif each comprise at least five consecutive uracils. In some embodiments, the 5' U-rich motif and the 3' U-rich motif each are 5 to 15 base pairs in length.

[0085] In some embodiments, the 3'TTD comprises, from 5' to 3', a 5'U-rich motif comprising five consecutive uracils, a stem-loop motif in which at least one stem strand has a length of about 16 base pairs, a 3'U-rich motif comprising five consecutive uracils, and an A-rich tract comprising at least 18 adenines. In some embodiments, the 3'TTD comprises SEQ ID NO: 14. In some embodiments, the 3'TTD comprises SEQ ID NO: Includes 13.

[0086] In some embodiments, the 3'TTD comprises, from 5' to 3', a 5' U-rich motif comprising SEQ ID NO: 18, a stem-loop motif wherein at least one stem strand has a length of about 13 nucleotides, a 3' U-rich motif comprising SEQ ID NO: 19, and an A-rich tract comprising SEQ ID NO: 20. In some embodiments, the 3'TTD comprises SEQ ID NO: 16. In some embodiments, the 3'TTD comprises SEQ ID NO: 15.

[0087] In some embodiments, the 3'TTD comprises, from 5' to 3', SEQ ID NO: 18, SEQ ID NO: 19, and SEQ ID NO: 20. In some embodiments, the 3'TTD comprises SEQ ID NO: 17.

[0088] In some embodiments, the 3'TTD comprises, from 5' to 3', a 5' U-rich motif comprising SEQ ID NO: 23, a stem-loop motif wherein at least one stem strand has a length of about 13 nucleotides, a 3' U-rich motif comprising SEQ ID NO: 24, and an A-rich tract comprising SEQ ID NO: 25. In some embodiments, the 3'TTD comprises SEQ ID NO: 24. In some embodiments, the 3'TTD comprises SEQ ID NO: 23.

[0089] In some embodiments, the 3'TTD is 200 to 1000 nucleotides in length (e.g., 200 to 900, 200 to 800, 200 to 700, 200 to 600, 200 to 500, 200 to 400, or 200 to 300 nucleotides in length).

[0090] Triplex forming structure The triple helix structure is formed, in one embodiment, from an A-rich motif (e.g., an A-rich tract) along with two upstream (e.g., 5') U-rich motifs and a stem-loop structure. As exemplified herein, these sequences are evolutionarily highly conserved in metastasis-associated lung adenocarcinoma transcript 1 (MALAT1), a lncRNA associated with certain cancers. A similar highly conserved A- and U-rich motif is present at the 3' end of the MENβ long nuclear-retained non-coding RNA, also known as NEAT1_2, which is also processed at its 3' end by RNase P. These highly conserved A- and U-rich motifs have been shown to form a triple helix structure important for protecting the 3' end of MALAT1 from 3'-5' exonucleases.

[0091] Some triple helices are useful in engineering any of the constructs described herein. Such triple helices include ENE+A, riboswitch, and telomerase triple helices (see, for example, Brown et al. Nature Structural and Molecular Biology, 21, 633-642, 2014, which is incorporated herein by reference). For example, the ENE+A triple helix is present in human MALAT1 (Brown et al. Nat. Struct. Mol. Biol., 7, 633-40, 2014.), KSHV PAN (Mitton-Fry et al. al.Proc.Natl.Acad.Sci.USA,109,19202-7,2012), Acanthamoeba polyphaga mimivirus(Tycowski et al.Cell Rep.,2,26-32,2012), Cotesia congregata bracovirus(Tycowski et al.Cell Rep.,2,26-32,2012), Cotesia sesamiae bracovirus(Tycowski et al.Cell Rep.,2,26-32,2012), Equine herpesvirus 2(EHV2)(Tycowski et al.Cell Rep.,2,26- 32, 2012), Plautia stali intestine virus (PSIV) (Tycowski et al. Cell Rep., 2, 26-32, 2012), and Rhesus rhadinovirus PAN (RRV) (Tycowski et al. Cell Rep., 2, 26-32, 2012). Other exemplary triple helices include those described for the PreQ1-II riboswitch from Lactobacillales rhamnosus (Liberman et al. Nat. Chem. Biol., 9, 353-5, 2013) and the SAM-II riboswitch found in the Sargasso Sea metagenome (Gilbert et al. Nat. Struct. Mol. Biol., 15, 177-82, 2008). In yet another example, the telomerase triple helix has been described for humans (Theimer et al. Mol Cell, 17, 671-82, 2005) and for Kluyveromyces lactis (Cash et al. Proc. Natl. Acad. Sci USA, 110, 10970-5, 2013).

[0092] In one embodiment, the RTM contains a triplex-forming sequence consisting of a U-rich motif 1 (e.g., a 5' U-rich motif), a conserved stem-loop, a U-rich motif 2 (e.g., a 3' U-rich motif), and an A-rich tract (e.g., as part of a poly-A tail), where the A-rich tract and the U-rich motif 2 form a Watson-Crick stem duplex, and the U-rich motif 1 aligns with the A-rich tract to form a Hoogsteen base pair (Buske et al. 2012; Beal and Dervan, 1991), which are incorporated herein by reference. In one embodiment, the sequence is derived from human MALAT1. Thus, in one embodiment, the RTM contains a triplex-forming sequence consisting of U-rich motif 1 (8292-8301 of human MALAT1), a conserved stem-loop (8302-8333 of human MALAT1), U-rich motif 2 (8334-8343 of human MALAT1), and an A-rich tract (8369-8379 of human MALAT1), wherein the A-rich tract and U-rich motif 2 form a Watson-Crick stem duplex, and U-rich motif 1 aligns with the A-rich tract to form a Hoogsteen base pair.

[0093] In another embodiment, the 3'TTD described herein is a novel design derived from theoretical modeling and / or by extension of naturally occurring sequences. In one embodiment, the TTD comprises, in 5' to 3' order, a triplex-forming sequence of varying length and composition, an RNase P cleavage site, and a tRNA-like sequence of varying length and composition. In one embodiment, the triplex-forming sequence conforms to one of three known basic "motifs," referred to as the base compositions of the third strand of a triple helix: the pyrimidine motif (T,C), the purine motif (G,A), and the purine-pyrimidine motif (G,T) (Buske FA, Bauer DC, Mattick JS, Bailey TL. 2012. Triplexator: Detecting nucleic acid triple helices in genomic and transcriptomic data. Genome Res. 22:1372-1382; Beal PA, Dervan PB. 1991. Second structural motif for recognition of DNA by oligonucleotide-directed triple-helix formation. Science. 251:1360-1363, both of which are incorporated herein by reference).

[0094] In another embodiment, the TTD is a truncated version of the human MALAT1 triple helix. In one embodiment, the TTD contains U-rich motif 1 (8292-8301 of human MALAT1), conserved stem-loop (8302-8310 and 8325-8333 of human MALAT1), U-rich motif 2 (8334-8334 of human MALAT1), and U-rich motif 3 (8335-8336 of human MALAT1). 43), containing a triplex-forming sequence consisting of an A-rich tract (nucleotides 8369-8379 in human MALAT1) and a deletion spanning nucleotides 8345-8364 in human MALAT1 in the intervening sequence between U-rich motif 2 and the A-rich tract; the A-rich tract and U-rich motif 2 form a Watson-Crick stem duplex, and U-rich motif 1 aligns with the A-rich tract to form a Hoogsteen base pair.

[0095] In one embodiment, the triple helix structure is derived from an lncRNA. In one embodiment, the triple helix structure is derived from MALAT1. Because MALAT1 sequences are highly evolutionarily conserved, the MALAT1 sequence can be derived from any species. In one embodiment, the MALAT1 sequence is derived from a human. In another embodiment, the MALAT1 sequence is derived from a mouse. In another embodiment, the MALAT1 sequence is derived from a non-human primate. In another embodiment, the MALAT1 sequence is derived from a dog. In another embodiment, the MALAT1 sequence is derived from an elephant. In another embodiment, the MALAT1 sequence is derived from an opossum. In another embodiment, the MALAT1 sequence is derived from a fish. Such sequences are known in the art and can be found, for example, in GenBank. In one embodiment, the MALAT1 sequence is SEQ ID NO: 7.

[0096] In another embodiment, the triple helix sequences are provided as truncated or modified versions of the native sequences, so long as the sequences retain the ability to fold into the required triple helix structure.

[0097] In one embodiment, the triple helix structure is derived from MEN beta. The MEN beta sequence can be from any species. In one embodiment, the MEN beta sequence is from a human. In another embodiment, the MEN beta sequence is from a mouse. In another embodiment, the MEN beta sequence is from a non-human primate. In another embodiment, the MEN beta sequence is from a dog. In another embodiment, the MEN beta sequence is from an elephant. In another embodiment, the MEN beta sequence is from an opossum. In another embodiment, the MEN beta sequence is from a fish. Such sequences are known in the art and can be found, for example, in GenBank.

[0098] In another embodiment, the triple helix sequence is provided as a truncated or modified version of the native sequence, so long as the sequence retains the ability to fold into the required triple helix structure. In one embodiment, the MENβ sequence is SEQ ID NO:8.

[0099] In some embodiments, the triple helix includes 4 to 100 consecutive adenosines paired via Hoogsteen base pairing (e.g., 4 to 80 consecutive adenosines paired via Hoogsteen base pairing, 4 to 60 consecutive adenosines paired via Hoogsteen base pairing, 4 to 50 consecutive adenosines paired via Hoogsteen base pairing, 4 to 40 consecutive adenosines paired via Hoogsteen base pairing, 4 to 30 consecutive adenosines paired via Hoogsteen base pairing, 4 to 20 consecutive adenosines paired via Hoogsteen base pairing, 4 to 18 consecutive adenosines paired via Hoogsteen base pairing, 4 to 15 consecutive adenosines paired via Hoogsteen base pairing). adenosine, 4 to 12 consecutive adenosines paired via Hoogsteen base pairing, 4 to 11 consecutive adenosines paired via Hoogsteen base pairing, 4 to 10 consecutive adenosines paired via Hoogsteen base pairing, 4 to 9 consecutive adenosines paired via Hoogsteen base pairing, 4 to 8 consecutive adenosines paired via Hoogsteen base pairing, 4 to 7 consecutive adenosines paired via Hoogsteen base pairing, or 4 to 6 consecutive adenosines paired via Hoogsteen base pairing, e.g., 5 to 50 consecutive adenosines paired via Hoogsteen base pairing, 5 to 40 consecutive adenosines paired via Hoogsteen base pairing, 5 to 30 consecutive adenosines paired via Hoogsteen base pairing, 5 to 20 consecutive adenosines paired via Hoogsteen base pairing, 5 to 18 consecutive adenosines paired via Hoogsteen base pairing, 5 to 15 consecutive adenosines paired via Hoogsteen base pairing, 5 to 12 consecutive adenosines paired via Hoogsteen base pairing, 5 to 10 consecutive adenosines paired via Hoogsteen base pairing, 5 to 9 consecutive adenosines paired via Hoogsteen base pairing, 5 to 8 consecutive adenosines paired via Hoogsteen base pairing, 5 to 7 consecutive adenosines paired via Hoogsteen base pairing, or 5 to 6 consecutive adenosines paired via Hoogsteen base pairing, e.g., Hoogsteen base pairing. 6–8 consecutive adenosines paired via Hoogsteen base pairing, 8–10 consecutive adenosines paired via Hoogsteen base pairing, 10–12 consecutive adenosines paired via Hoogsteen base pairing, 12–14 consecutive adenosines paired via Hoogsteen base pairing, 14–16 consecutive adenosines paired via Hoogsteen base pairing, 16–18 consecutive adenosines paired via Hoogsteen base pairing, 18–20 consecutive adenosines paired via Hoogsteen base pairing, 20–30 consecutive adenosines paired via Hoogsteen base pairing, 30–40 consecutive adenosines paired via Hoogsteen base pairing, or 40–50 consecutive adenosines paired via Hoogsteen base pairing.

[0100] In some embodiments, a triple helix comprises a chain of contiguous nucleotides, wherein at least 90% of the nucleotides are paired via Hoogsteen base pairing (e.g., at least 90% of the nucleotides are paired via Hoogsteen base pairing, at least 91% of the nucleotides are paired via Hoogsteen base pairing, at least 92% of the nucleotides are paired via Hoogsteen base pairing, at least 93% of the nucleotides are paired via Hoogsteen base pairing, at least 94% of the nucleotides are paired via Hoogsteen base pairing, at least 95% of the nucleotides are paired via Hoogsteen base pairing, at least 96% of the nucleotides are paired via Hoogsteen base pairing, at least 97% of the nucleotides are paired via Hoogsteen base pairing, at least 98% of the nucleotides are paired via Hoogsteen base pairing, at least 99% of the nucleotides are paired via Hoogsteen base pairing, or 100% of the nucleotides are paired via Hoogsteen base pairing).

[0101] Domain 2 - tRNA-like structure The tRNA-like structures described herein are sequences that form tRNA-like cloverleaf secondary structures and allow recognition by one or more of RNase P, RNase Z, and CCA-adding enzymes.

[0102] The tRNA-like structure of MALAT1 is called mascRNA (MALAT1-associated small cytoplasmic RNA). This sequence is 61 nt long and is shown in SEQ ID NO: 9. The tRNA-like structure of mascRNA has been conserved throughout evolution, as four mismatches between mouse and human orthologs maintain the cloverleaf secondary structure. While structurally similar to tRNA and containing a well-conserved B box, the 61-nt mascRNA transcript is smaller than most tRNAs (approximately 76 nt) and has a relatively less conserved small anticodon loop. Wilusz et al., Cell. 2008 Nov 28;135(5):919-932, incorporated herein by reference. The tRNA-like structure of MENβ is called menRNA. Zhang et al., 2017, Cell Reports 19, 1723-1738, incorporated herein by reference.

[0103] In one embodiment, the tRNA-like structure is derived from a lncRNA. In one embodiment, the tRNA-like structure is derived from MALAT1. Because MALAT1 sequences are highly evolutionarily conserved, the MALAT1 sequence can be derived from any species. In one embodiment, the MALAT1 sequence is derived from a human. In another embodiment, the MALAT1 sequence is derived from a mouse. In another embodiment, the MALAT1 sequence is derived from a non-human primate. In another embodiment, the MALAT1 sequence is derived from a dog. In another embodiment, the MALAT1 sequence is derived from an elephant. In another embodiment, the MALAT1 sequence is derived from an opossum. In another embodiment, the MALAT1 sequence is derived from a fish. Such sequences are known in the art and can be found, for example, in GenBank.

[0104] In another embodiment, the tRNA-like sequence is provided as a truncated or modified version of the native sequence, so long as the sequence retains the ability to fold into the required tRNA-like structure.

[0105] In one embodiment, the tRNA-like structure is derived from MENβ. The MENβ sequence can be from any species. In one embodiment, the MENβ sequence is from a human. In another embodiment, the MENβ sequence is from a mouse. In another embodiment, the MENβ sequence is from a non-human primate. In another embodiment, the MENβ sequence is from a dog. In another embodiment, the MENβ sequence is from an elephant. In another embodiment, the MENβ sequence is from an opossum. In another embodiment, the MENβ sequence is from a fish. Such sequences are known in the art and can be found, for example, in GenBank.

[0106] In another embodiment, the tRNA-like sequence is provided as a truncated or modified version of the native sequence, so long as the sequence retains the ability to fold into the required tRNA-like structure.

[0107] The components of TTD can be derived from the same or different lncRNAs, including lncRNA homologs from different species. For example, the triple helix domain and the tRNA-like domain can be derived from the same long non-coding RNA or different combinations of long non-coding RNA domains from humans or any other species. In one embodiment, the triple helix domain and the tRNA-like domain are derived from MALAT1 or NEAT1 / MENβ.

[0108] Target gene The target gene is a gene that contains one or more defects or mutations that cause eye disease. In one embodiment described herein, the target gene is a mammalian gene that has a defect that is known to cause a disease or disorder.

[0109] The wild-type sequences and / or genome and chromosomal sequences of genes and encoded proteins are available from public databases, and their accession numbers are provided herein.In addition to these published sequences, all subsequent modifications or naturally occurring conservative and disease-free variant sequences occurring in human or other mammalian populations are also included.In addition, conservative nucleotide substitutions or codon optimization are also included.The sequences provided by database accession numbers can be used to search for homologous sequences in the same or other mammalian organisms.

[0110] It is anticipated that the target ocular nucleic acid sequences and resulting protein truncates or amino acid fragments identified herein may tolerate certain minor modifications at the nucleic acid level, e.g., to include modifications to nucleotide bases that are silent, e.g., preferred codons. In other embodiments, amino acids may be altered, e.g., to improve expression of the resulting peptide / protein. Nucleobase modifications that occur due to the fragments are expected. Also likely modifications of the fragments include allelic variations caused by the natural degeneracy of the genetic code.

[0111] Modifications of selected genes also include analogs or modified versions of the encoded protein fragments provided herein. Typically, such analogs differ from the specifically identified protein by only one to four codon changes. Conservative substitutions are substitutions made within a family of amino acids that are related in their side chains and chemical properties.

[0112] The nucleic acid sequence encoding the normal gene can be derived from any mammal that naturally expresses the gene or its homologue. In another embodiment, the gene sequence is derived from the same mammal that the composition is intended to treat. In another embodiment, the gene sequence is derived from a human. In other embodiments, specific modifications are made to the gene sequence to enhance expression in target cells. Such modifications include codon optimization.

[0113] In one embodiment, the gene is ABCA4, which is shown to be associated with Stargardt disease. The genomic DNA sequence of this gene can be found in the NCBI reference sequence (135,313 bp) for chromosome 1 at NG_009073.1. The mRNA and exon locations of the gene are shown in the NCBI report. The DNA sequence of ABCA4 is provided as NCBI reference sequence: NM_000350.2. The amino acid sequence is provided as NCBI reference sequence: NP000341.2.

[0114] In another embodiment, the gene is CEP290. Leber congenital amaurosis comprises a group of early-onset childhood retinal dystrophies characterized by reduced visual acuity, nystagmus, and severe retinal dysfunction. Patients typically present at birth with severely reduced visual acuity and pendular nystagmus. Electroretinogram (ERG) responses are usually unrecordable. Other clinical findings may include hyperopia, photodysphoria, oculo-phalangeal signs, keratoconus, cataracts, and variable fundus appearance. LCA10 is caused by mutations in the CEP290 gene on chromosome 12q21 and may account for up to 21% of LCA cases. CEP290 mutations can also result in extraocular findings, including renal and CNS abnormalities, and thus may result in syndromes (Senior Loken syndrome, Joubert syndrome, Bardet-Biedl syndrome).

[0115] The genomic DNA sequence for this gene can be found in the NCBI reference sequence for chromosome 12, from nt 88049013 to 88142216 (93,204 bp) in NC_000012.12. The mRNA and exons are identified in the NCBI report. The DNA sequence for CEP290 is provided as NCBI reference sequence: NM_025114.3. The amino acid sequence is provided as NCBI reference sequence: NP0789390.3. The mRNA contains 54 exons and 59 introns (due to alternative splicing). Many mutations in CEP290 and their locations within the nucleotide sequence are known.

[0116] In another embodiment, the gene is MYO7A. Mutations in this gene are associated with Usher syndrome. Usher syndrome is a disease characterized by hearing loss and progressive vision loss. The vision loss is caused by an eye disease called retinitis pigmentosa (RP), which affects the light-sensitive layers of the retina. Vision loss occurs when the light-sensing cells in the retina gradually deteriorate. Over time, these blind spots enlarge and merge, creating a narrowed field of vision. In some cases of Usher syndrome, vision is further impaired by clouding of the eye's lens (cataracts). Many people with retinitis pigmentosa retain central vision throughout their lives. Hearing loss is caused by a disease of the cochlear hair cells, which also gradually worsens. Usher syndrome I The form can result from mutations in the CDH23, MYO7A, PCDH15, USH1C, or USH1G genes.

[0117] More than 250 mutations in the MYO7A gene have been identified in people with Usher syndrome type 1B. Many of these genetic changes alter a single protein building block (amino acid) in a critical region of the myosin VIIA protein. Other mutations introduce a premature stop signal into the myosin VIIA protein's instructions, resulting in the production of an abnormally small version of the protein. Some mutations insert or delete small amounts of DNA in the MYO7A gene, altering the protein. All of these changes result in the production of nonfunctional myosin VIIA protein, adversely affecting the development and function of cells in the inner ear and retina, resulting in Usher syndrome.

[0118] The genomic DNA sequence for this gene can be found in the NCBI Reference Sequence for chromosome 11, from nt 77,128,255 to 77,215,240 (86,986 bp) in NC_000011.9. The DNA sequence for MYO7A is provided as NCBI Reference Sequence: NM_000260.3. The amino acid sequence is provided as NCBI Reference Sequence: NP000251.1. The DNA, amino acid, exon, and intron sequences for MYO7A are provided online at https: / / grenada.lumc.nl / LOVD2 / Usher_montpellier / refseq / MYO7A_codingDNA.html, last updated February 17, 2010. The mRNA contains 49 exons and 61 introns. Many mutations in MYO7A can be found in the CCHMC Molecular Genetics Laboratory Mutation Database, LOVD v.2.0.

[0119] RTM target gene coding sequence In one embodiment, the coding domain is a single exon of the target gene, containing the normal wild-type sequence lacking the disease-causing mutation (e.g., exon 27 of ABCA4). In another embodiment, the coding domain includes multiple exons containing multiple disease-causing mutations, e.g., exons 1-22 of ABCA4. Depending on the location of the exons to be corrected, the RTM may contain multiple exons located at the 5' or 3' end of the target gene, or the RTM may be designed to replace an exon in the middle of the gene. For use and delivery in rAAV, the entire coding sequence of a gene is not useful as the coding domain for the RTM unless this technology is directed at small genes less than 3,000 nucleotides in length. As described herein, two RTMs, 3' and 5' RTMs, can be used in different rAAV particles to replace entire large genes.

[0120] In one embodiment, the coding domain of the 5' RTM is designed to replace an exon at the 5' end of the target gene. In another embodiment, the coding domain of the 3' RTM is designed to replace an exon at the 3' end of the gene. In another embodiment, the coding domain is one or more exons located within a gene, and the coding domain is located in a double trans-splicing RTM.

[0121] Thus, for example, three possible types of RTMs are useful for treating diseases caused by, for example, deficiencies of ABCA4: 5' trans-splicing RTMs containing a 5' splice site, which after trans-splicing, alters the 5' region of the target mRNA, 3' RTMs containing a 3' splice site that is used to trans-splice and replace the 3' region of the target mRNA, and double trans-splicing RTMs carrying multiple binding domains along with 3' and 5' splice sites. After trans-splicing, this RTM replaces an internal exon within the processed target mRNA. In other embodiments, the coding domain can include exons containing naturally occurring or artificially introduced stop codons to reduce gene expression, or the RTM can contain other sequences that produce an RNAi-like effect.

[0122] For use in treating Stargardt disease, the preferred coding region for ABCA4 is exons 1-22 or 27-50 in a separate RTM. For use in treating LCA10, the preferred coding region for CEP290 is exons 1-26 or exons 27-54 in a separate RTM. For use in treating Usher syndrome, the preferred coding region for MYO7A is exons 1-18 or 33-49 in a separate RTM.

[0123] RTM optional components or modifications An optional spacer region can be used to separate the splicing domain from the target binding domain in the RTM. The spacer region can be designed to include features such as (i) a stop codon, which functions to block translation of any unspliced RTM, and / or (ii) a sequence that enhances trans-splicing into the target pre-mRNA. The spacer can be 3 to 25 nucleotides or more, depending on the length of the other components of the RTM and the rAAV constraints. In one embodiment, a suitable 5' RTM spacer is AGA TCT CGT TGC GAT ATT AT (SEQ ID NO: 10). In one embodiment, a suitable 3' spacer is as follows: 5'-GAG AAC ATT ATT ATA GCG TTG CTC GAG-3'SEQ ID NO: 11.

[0124] Further optional components of RTM include mini-introns and intronic or exonic enhancers or silencers that regulate trans-splicing (see, e.g., the descriptions of RTM technical publications cited herein).

[0125] In another embodiment, the RTM further comprises at least one safety sequence incorporated into the spacer, binding domain, or elsewhere in the RTM to prevent nonspecific trans-splicing. This is a region of the RTM that covers the 3' and / or 5' splice site elements of the RTM with relatively weak complementarity, preventing nonspecific trans-splicing. The RTM is designed so that upon hybridization of the binding / targeting moiety(ies) of the RTM, the 3' and / or 5' splice sites are not covered and the RTM is fully active. Such "safety" sequences include complementary stretches of cis sequences (or may be a second, separate strand of nucleic acid) that can bind to the RTM branch point, pyrimidine tract, one or both sides of the 3' and / or 5' splice site (splice element), or to a portion of the splice element itself. "Safety" binding can be disrupted by the target binding region of the RTM binding to the target pre-mRNA, thus exposing and activating the RTM splicing elements (making them available for trans-splicing into the target pre-mRNA). In another embodiment, the RTM has a ribozyme sequence added to the 3'UTR sequence or the 3' or 5' end.

[0126] In one embodiment, a splicing enhancer, such as a sequence referred to as an exonic splicing enhancer, can also be included in the structure of the synthetic RTM. Additional features can be added to the RTM molecule, such as a polyadenylation signal to modify RNA expression / stability, a 5' splice sequence to enhance splicing, an additional binding region, a "safety" self-complementary region, an additional splice site, or a protecting group to regulate the stability of the molecule and prevent degradation. Furthermore, a stop codon can be included in the RTM structure to prevent translation of non-spliced RTM. Additional elements, such as a 3' hairpin structure, a circularized RNA, a nucleotide base modification, or a synthetic analog, can be incorporated into the RTM to promote or facilitate nuclear localization, spliceosome incorporation, and intracellular stability.

[0127] Binding of an RTM nucleic acid molecule to a target pre-mRNA is mediated by complementarity (i.e., based on the base-pairing properties of nucleic acids), triple helix formation, or protein-nucleic acid interactions (as described in the documents cited herein). In one embodiment, the RTM nucleic acid molecule consists of DNA, RNA, or a DNA / RNA hybrid molecule, where the DNA or RNA is either single-stranded or double-stranded. Also included are RNAs or DNAs that hybridize to one of the aforementioned RNAs or DNAs under stringent conditions, e.g., hybridization in 2.5x SSC buffer at 60°C and several washes at 37°C in a lower buffer concentration (e.g., 0.5x SSC buffer), and encode proteins that exhibit lipid phosphate phosphatase activity and / or association with plasma membranes. When an RTM is synthesized in vitro (synthetic RTM), such an RTM can be modified at the base moiety, sugar moiety, or phosphate backbone to improve, for example, the molecule's stability, hybridization to target mRNA, transport into cells, intracellular stability against enzymatic cleavage, etc. For example, modifying an RTM to reduce its overall charge can enhance the molecule's cellular uptake. Additionally, modifications can be made to reduce susceptibility to nucleases or chemical degradation. Nucleic acid molecules can be synthesized in such a way that they are conjugated to another molecule, for example, a peptide, a hybridization-triggered crosslinking agent, a transport agent, a hybridization-triggered cleavage agent, etc.

[0128] Various other well-known modifications can be introduced to nucleic acid molecules as a means of increasing intracellular stability and half-life (for oligonucleotides, see also above).Possible modifications are known in the art (see the documents cited herein).The modifications that can be made to the structure of synthetic RTM include but are not limited to backbone modifications as described in the RTM technical documents cited.

[0129] Recombinant AAV molecules Various known nucleic acid vectors can be used in these methods to design and assemble the components of RTM and recombinant adeno-associated virus (AAV), which are intended to deliver RTM to target cells.A wealth of publications known to those skilled in the art discuss the use of various such vectors for gene delivery (see, for example, Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989; Kay, MA et al., 2001 Nat.Medic., 7(1):33-40; and Walther W. and Stein U., 2000 Drugs, 60(2):249-71).In one embodiment described herein, the vector is a recombinant AAV that carries RTM and is driven by a promoter that expresses RTM in the selected target cells of affected subjects. Methods for constructing recombinant vectors are well known (see, eg, International Patent Publication No. WO 00 / 15822, published March 23, 2000, and other references cited therein).

[0130] In certain embodiments described herein, RTM(s) carrying selected gene binding and coding sequences are delivered to target cells requiring treatment, such as photoreceptor cells, via adeno-associated virus vectors. AAVs of 30 naturally occurring serotypes are available. Many natural variants exist in the AAV capsid, allowing for the identification and use of AAVs with properties specifically suited to ocular cells. AAV viruses can be engineered using conventional molecular biology techniques, allowing these particles to be optimized for cell-specific delivery of RTM nucleic acid sequences, minimizing immunogenicity, adjusting stability and particle lifespan, efficient degradation, precise delivery to the nucleus, and so on.

[0131] Expression of the RTMs described herein can be achieved in selected cells through delivery by recombinantly engineered or engineered AAVs containing sequences encoding the desired RTMs. The use of AAVs is a common mode of exogenous DNA delivery because they are relatively non-toxic, provide efficient gene transfer, and can be easily optimized for specific purposes. Among the well-characterized AAV serotypes isolated from humans or non-human primates (NHPs), human serotype 2 has been widely used for efficient gene transfer experiments in different target tissues and animal models. Other AAV serotypes include, but are not limited to, AAV1, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, and AAV9. Unless otherwise specified, AAV ITRs and other selected AAV components described herein can be readily selected from any AAV serotype, including, but not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh.10, AAV8bp, AAV7m8, or other known and unknown AAV serotypes. These ITRs or other AAV components can be readily isolated from AAV serotypes using techniques available to those of skill in the art. Such AAVs can be isolated or obtained from academic, commercial, or public sources (e.g., American Type Culture Collection, Manassas, VA). Alternatively, AAV sequences can be obtained through synthesis or other suitable means by reference to published sequences, such as those available in the literature or databases, e.g., GenBank, PubMed, etc. For a discussion of various AAV serotypes, see, e.g., WO2005 / 033321 or WO2014 / 124282 (hereby incorporated by reference).

[0132] Desirable AAV fragments for assembly into vectors include cap proteins, including vp1, vp2, vp3, and hypervariable regions; rep proteins, including rep78, rep68, rep52, and rep40; and sequences encoding these proteins. These fragments can be easily utilized in a variety of vector systems and host cells. Such fragments can be used alone, in combination with other AAV serotype sequences or fragments, or in combination with elements derived from other AAV or non-AAV viral sequences. As used herein, artificial AAV serotypes include, but are not limited to, AAVs with non-native capsid proteins. Such artificial capsids can be generated by any suitable technique using selected AAV sequences (e.g., fragments of the vp1 capsid protein) in combination with heterologous sequences (which can be obtained from different selected AAV serotypes, non-contiguous portions of the same AAV serotype, non-AAV viral sources, or non-viral sources). Artificial AAV serotypes can be, but are not limited to, pseudotyped AAV capsids, chimeric AAV capsids, recombinant AAV capsids, or "humanized" AAV capsids. Pseudotyped vectors in which one AAV capsid protein is replaced with a heterologous capsid protein are useful in the present invention. In one embodiment, AAV2 / 5 is a useful pseudotyped vector. In another embodiment, the AAV is AAV2 / 8.

[0133] In one embodiment, vectors useful for preparing the compositions and methods described herein contain at least a sequence encoding a selected AAV serotype capsid, e.g., an AAV2 capsid, or a fragment thereof. In another embodiment, useful vectors contain at least a sequence encoding a selected AAV serotype rep protein, e.g., an AAV2 rep protein, or a fragment thereof. Optionally, such vectors may contain both AAV cap and rep proteins. In vectors in which both AAV rep and cap are provided, the AAV rep and AAV cap sequences may both be of one serotype origin, e.g., all AAV2 origin. Alternatively, vectors may be used in which the rep sequence is derived from a different AAV serotype than that providing the cap sequence. In one embodiment, the rep and cap sequences are expressed from separate sources (e.g., separate vectors, or a host cell and a vector). In another embodiment, these rep sequences are derived from different AAV serotypes. The cap sequence of the AAV serotype may be fused in-frame to the cap sequence of a corresponding AAV serotype to form a chimeric AAV vector, such as AAV2 / 8, as described in US Pat. No. 7,282,199, incorporated herein by reference.

[0134] Suitable recombinant adeno-associated viruses (AAV) are produced by culturing host cells containing a nucleic acid sequence encoding an adeno-associated virus (AAV) serotype capsid protein or fragment thereof as defined herein, a functional rep gene, a minigene composed, at a minimum, of AAV inverted terminal repeat (ITR) and RTM nucleic acid sequences, and sufficient helper functions to allow packaging of the minigene into AAV capsid proteins. The components required for culturing within the host cell to package the AAV minigene into an AAV capsid can be provided in trans to the host cell. Alternatively, any one or more of the required components (e.g., minigene, rep sequence, cap sequence, and / or helper functions) can be provided by a stable host cell engineered to contain one or more of the required components using methods known to those skilled in the art.

[0135] In one embodiment, the rAAV comprises a promoter (or a functional fragment of a promoter). The promoter used in the rAAV can be selected from among numerous constitutive or inducible promoters capable of directing the expression of a selected transgene in the desired target cell. See, for example, the list of promoters identified in International Patent Publication No. WO2014 / 12482, published August 14, 2014, which is incorporated herein by reference. In one embodiment, the promoter is "cell-specific." The term "cell-specific" means that the particular promoter selected for the recombinant vector is capable of directing the expression of a selected transgene in a particular cell or ocular cell type. In one embodiment, the promoter is specific for expression of the transgene in photoreceptor cells. In another embodiment, the promoter is specific for expression in rods and / or cones. In another embodiment, the promoter is specific for expression of the transgene in RPE cells. In another embodiment, the promoter is specific for expression of the transgene in ganglion cells. In another embodiment, the promoter is specific for expression of the transgene in Muller cells. In another embodiment, the promoter is specific for expression of the transgene in bipolar cells, hi another embodiment, the transgene is expressed in any of the above ocular cells.

[0136] In another embodiment, the promoter is the native promoter of the target ocular gene to be expressed. Useful promoters include rod opsin promoter, red-green opsin promoter, blue opsin promoter, cGMP-β-phosphodiesterase promoter, mouse opsin promoter (Beltran et al. 2010, cited above), rhodopsin promoter (Mussolino et al., Gene Ther, July 2011, 18(7):637-45), α subunit of cone transducin (Morrissey et al., BMC Dev. Biol, Jan 2011, 11:3), β phosphodiesterase (PDE) promoter, retinitis pigmentosa (RP1) promoter (Nicord et al., J. Gene Med, Dec 2007, 9(12):1015-23), NXNL2 / NXNL1 promoter (Lambard et al., PLoS One, Oct. 2010, 5(10):e13025), RPE65 promoter, retinal degeneration slow / peripherin 2 (Rds / perph2) promoter (Cai et al., Exp Eye Res. 2010 Aug;91(2):186-94), and VMD2 promoter (Kachi et al., Human Gene Therapy, 2009(20:31-9)). Each of these documents is incorporated herein by reference.

[0137] Other conventional regulatory sequences that may be included in minigenes or rAAVs are also disclosed in documents such as WO2014 / 124282 and other documents, which are incorporated herein by reference. Those of skill in the art can select from among these and other expression control sequences without departing from the scope described herein.

[0138] The desired AAV minigene is composed, at a minimum, of the RTM described herein, and its regulatory sequences, and 5' and 3' AAV inverted terminal repeats (ITRs). In one embodiment, the ITRs of AAV serotype 2 are used. In another embodiment, the ITRs of AAV serotypes 5 or 8 are used. However, ITRs from other suitable serotypes may be selected. The minigene is packaged into an AAV capsid and delivered to a selected host cell.

[0139] The minigene, rep sequence, cap sequence, and helper functions required for rAAV production can be delivered to packaging host cells in the form of any genetic element that transfers the sequences carried thereon. The selected genetic element can be delivered by any suitable method, including those described herein. The methods used to construct any of the embodiments described herein are known to those skilled in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY. Similarly, methods for producing rAAV virions are well known, and the selection of an appropriate method is not a limitation of the present invention. See, e.g., K. Fisher et al., 1993 J. Virol., 70:520-532, and U.S. Patent No. 5,478,745, among others. These publications are incorporated herein by reference.

[0140] A suitable producer cell line can be easily selected by one skilled in the art. For example, suitable host cells can be selected from any biological organism, including prokaryotic (e.g., bacterial) cells and eukaryotic cells, including insect cells, yeast cells, and mammalian cells. Briefly, an AAV production plasmid carrying a minigene is transfected into a selected packaging cell, where it can exist transiently. Alternatively, the minigene or gene expression cassette with its flanking ITRs is stably integrated into the genome of the host cell, either chromosomally or episomally. Suitable transfection techniques are known and can be easily utilized to deliver the recombinant AAV genome into host cells. Typically, the production plasmid is cultured in a host cell that expresses cap and / or rep proteins. In the host cell, a minigene consisting of an RTM with flanking AAV ITRs is rescued and packaged into capsid or envelope proteins to form infectious viral particles. Thus, recombinant AAV infectious particles are produced by culturing packaging cells carrying the proviral plasmid in the presence of sufficient viral sequences to allow packaging of the gene expression cassette viral genome into an infectious AAV envelope or capsid.

[0141] Pharmaceutical Carriers and Pharmaceutical Compositions Compositions containing a recombinant viral vector, e.g., AAV, described herein, containing a desired RTM minigene for use in selected target cells, e.g., photoreceptor cells for the treatment of Stargardt disease, as detailed above, are preferably evaluated for contamination by conventional methods and then formulated into pharmaceutical compositions intended for a suitable route of administration. Additionally, other compositions containing RTM, e.g., as naked DNA or protein, can similarly be formulated with a suitable carrier. Such formulations involve the use of a pharmaceutically and / or physiologically acceptable vehicle or carrier specifically intended for administration to target cells. In one embodiment, carriers suitable for administration to ocular cells include buffered saline, isotonic sodium chloride solution, or other buffers to maintain pH at appropriate physiological levels, e.g., HEPES, and optionally other agents, pharmaceuticals, stabilizers, buffers, carriers, etc. Examples of such agents include antibodies, adjuvants, diluents, etc.

[0142] For injection, the carrier is usually liquid.Exemplary physiologically acceptable carriers include sterile, pyrogen-free water and sterile, pyrogen-free phosphate-buffered saline.Such a variety of known carriers are presented in U.S. Patent No. 7,629,322, which is incorporated herein by reference.In one embodiment, the carrier is an isotonic sodium chloride solution.In another embodiment, the carrier is a balanced salt solution.In one embodiment, the carrier comprises Tween.For long-term storage of the virus, it can be frozen in the presence of glycerol or Tween 20.

[0143] In other embodiments, for example, compositions containing the RTM described herein include a surfactant. Useful surfactants, such as Pluronic F68 ((Poloxamer 188), also known as Lutrol® F68), can be included to prevent AAV from adhering to inert surfaces, thus ensuring delivery of the desired dose.

[0144] For example, one exemplary composition designed for the treatment of the ocular diseases described herein comprises a recombinant adeno-associated vector carrying a nucleic acid sequence encoding a 3' RTM as described herein, under the control of a regulatory sequence that expresses the RTM in ocular cells of a mammalian subject, and a pharmaceutically acceptable carrier. The carrier is an isotonic sodium chloride solution containing the surfactant Pluronic F68. In one embodiment, the RTM is as described in the Examples. In another embodiment, the RTM contains the binding and coding regions of CEP290 or MYO7A.

[0145] In yet another exemplary embodiment, the composition comprises a recombinant AAV2 / 5 pseudotyped adeno-associated virus carrying a 3' or 5' or RTM for internal gene replacement, wherein the nucleic acid sequence is under the control of a promoter that directs expression of the RTM in target cells, wherein the composition is formulated with a carrier and additional components suitable for injection.

[0146] In yet another embodiment, the compositions or components for manufacturing or assembling the compositions, including carriers, rAAV particles, surfactants, and / or components for generating rAAV, as well as appropriate laboratory hardware for preparing the compositions, can be incorporated into a kit.

[0147] How to treat the disorder Thus, the compositions described above are useful in methods for treating one or more diseases associated with selected genes. In one embodiment, the disease is an ocular disease (e.g., Stargardt disease, Leber congenital amaurosis, cone-rod dystrophy, fundus flava, retinitis pigmentosa, age-related macular degeneration, Senior-Loken syndrome, Joubert syndrome, or Usher syndrome, among others). In one embodiment, the treatment involves delaying or ameliorating symptoms associated with an ocular disease described herein. Such methods include contacting a target pre-mRNA (e.g., ABCA4, CEP290, MYO7A) with one or more of the 3' RTM, 5' RTM, both the 3' RTM and 5' RTM, or dual trans-splicing RTMs described herein under conditions that splice a portion of the RTM into the target pre-mRNA to replace all or part of the target gene having one or more defects or mutations with a "healthy," or normal, wild-type, or corrected mRNA of the target gene, to correct expression of that gene in the target cell. Alternatively, pre-miRNAs (see RTM documents cited herein) can be created that are designed to reduce expression of target mRNAs. Thus, the methods and compositions are used to treat ocular diseases / conditions associated with specific mutations and / or gene expression.

[0148] In one embodiment, the contacting comprises direct administration to the affected subject. In another embodiment, the contacting can occur ex vivo on cultured cells and treated cells that are reimplanted into the subject. In one embodiment, the method comprises administering rAAV particles carrying a 3' RTM. In another embodiment, the method comprises administering rAAV particles carrying a 5' RTM. In another embodiment, the method comprises administering rAAV particles carrying a double trans-splicing RTM. In yet another embodiment, the method comprises administering a mixture of rAAV particles carrying a 3' RTM and rAAV particles carrying a 5' RTM. In yet another embodiment, the method comprises administering a mixture of rAAV particles carrying a 3' RTM and rAAV particles carrying a double trans-splicing RTM. In yet another embodiment, the method comprises administering a mixture of rAAV particles carrying a 5' RTM and rAAV particles carrying a double trans-splicing RTM. In yet another embodiment, the method comprises administering a mixture of rAAV particles carrying a 3' RTM, rAAV particles carrying a 5' RTM, and rAAV particles carrying a double trans-splicing RTM.

[0149] These methods include administering to a subject in need thereof an effective concentration of any of the compositions described herein.

[0150] In one exemplary embodiment, such a method is provided for preventing, halting, or alleviating vision loss associated with Stargardt disease in a subject, the method comprising administering to an ocular cell, e.g., a photoreceptor cell, of a mammalian subject in need thereof, an effective concentration of a composition comprising a recombinant adeno-associated virus (AAV) carrying a 3' RTM as described above and in the Examples, under the control of regulatory sequences that enable the RTM to function and cause trans-splicing of a defective target gene in the mammalian subject's ocular cell, e.g., a photoreceptor cell. In yet another embodiment, the method comprises administering two rAAV particles, one carrying a 5' RTM and one carrying a 3' RTM, e.g., as described in the Examples, that replace a large portion of a large gene.

[0151] As used in this method, "administration" refers to delivering the composition to a target selected cell characterized by a disease caused by a mutation or defect in the target gene. For example, in one embodiment, the method comprises delivering the composition to a photoreceptor cell or other ocular cell by subretinal injection. In another embodiment, intravitreal injection into ocular cells or injection into ocular cells via the palpebral vein may be used. In another embodiment, the method comprises delivering the composition by direct injection into a designated organ, for example, the liver. In yet another embodiment, the method comprises delivering the composition by intravenous injection. Still other administration methods can be selected by those skilled in the art given this disclosure.

[0152] Additionally, in certain embodiments, it may be desirable to perform noninvasive retinal imaging and functional studies to identify the region of preserved photoreceptors to target for treatment. In these embodiments, clinical diagnostic tests are used to determine the precise location(s) of one or more subretinal injection(s). These tests may include electroretinogram (ERG), perimetry, topographical mapping of retinal layers and their thickness measurement via confocal scanning laser ophthalmoscopy (cSLO) and optical coherence tomography (OCT), topographical mapping of cone density via adaptive optics (AO), functional eye testing, and the like. In terms of imaging and functional studies, in some embodiments, one or more injections are performed in the same eye to target different regions of preserved photoreceptors.

[0153] For use in these methods, the volume and viral titer of each injection is determined individually, as further described below, and may be the same or different from other injections administered in the same subject. In another embodiment, a single, larger volume injection is administered to treat the entire eye. Dosage, administration, and regimen can be determined by the attending physician in light of the teachings herein.

[0154] In one embodiment, the volume and concentration of the rAAV composition are selected so that only specific regions of photoreceptors or other ocular cells are affected. In another embodiment, the volume and / or concentration of the rAAV composition is greater to reach a larger portion of the eye. Similarly, the dosage is adjusted for administration to other organs.

[0155] The effective concentration of recombinant adeno-associated virus carrying the RTM described herein is approximately 10 per milliliter. 8 ~10 13 In another embodiment, the concentration is in the range of 10 vector genomes per milliliter (vg / mL). rAAV infectious units are measured as described in SK McLaughlin et al., 1988 J. Virol., 62:1963. In another embodiment, the concentration is in the range of 10 9 ~10 13In another embodiment, the effective concentration is in the range of about 1.5 x 10 vector genomes (vg / mL). 11 In one embodiment, the effective concentration is about 1.5 x 10 10 In another embodiment, the effective concentration is about 2.8 x 10 11 In yet another embodiment, the effective concentration is about 1.5 x 10 12 In another embodiment, the effective concentration is about 1.5 x 10 13 The effective concentration of the virus is vg / mL.It is desirable to use the lowest effective concentration of the virus in order to reduce the risk of undesirable effects such as toxicity and other problems associated with ocular administration, such as retinal dysplasia and detachment.Other dosages in these ranges or other units can be selected by the attending physician, taking into account the physical condition of the subject, preferably human, being treated, including the subject's age; the composition being administered and the specific disorder; target cells, and if progressive, the degree of the disorder's onset.

[0156] The composition may be administered in a volume of about 50 μL to about 1 mL, including all volumes within the range, depending on the size of the area to be treated, the viral titer used, the route of administration, and the desired effect of the method. In one embodiment, the volume is about 50 μL. In another embodiment, the volume is about 70 μL. In another embodiment, the volume is about 100 μL. In another embodiment, the volume is about 125 μL. In another embodiment, the volume is about 150 μL. In another embodiment, the volume is about 175 μL. In yet another embodiment, the volume is about 200 μL. In another embodiment, the volume is about 250 μL. In another embodiment, the volume is about 300 μL. In another embodiment, the volume is about 450 μL. In another embodiment, the volume is about 500 μL. In another embodiment, the volume is about 600 μL. In another embodiment, the volume is about 750 μL. In another embodiment, the volume is about 850 μL. In another embodiment, the volume is about 1000 μL.

[0157] The following examples do not limit the scope of the embodiments described herein. Those of skill in the art will understand that modifications can be made in the following examples that are intended to be within the spirit and scope of the present invention.

[0158] Example 1: Splicing-dependent reporter RTM The RTM shown in Figures 1A-1D was delivered into a cell line expressing a minigene (Figure 1F) containing intron 26 from CEP290 fused to the 3' half of the luciferase ORF. The RTM binds to the target sequence in intron 26 (via the binding domain), bringing the 5' splice site (5' SS) within the RTM into close proximity with the 3' splice site (3' SS) of the CEP290 minigene. Spliceosome-mediated splicing occurs, resulting in luciferase expression as a direct measure of trans-splicing activity (Figure 2A). Two reference RTMs containing either a polyadenylation signal (polyA) or a hammerhead ribozyme (hhRz) constitute prior art transcription termination elements and serve here to establish a baseline of activity. Data are presented for the reference RTM containing hhRz for transcription termination. We suggest that the Comp14 derivative of the MALAT1 transcription terminator enhances trans-splicing compared with the RTM. Furthermore, this activity appears to be dependent on the mascRNA domain and its associated RNase P cleavage, as evidenced by the loss of activity when the mascRNA domain is replaced with hhRz.

[0159] In Figure 2B, the experiment was designed to measure luciferase RNA and protein by TaqMan and Western blotting, respectively. N=4 experimental replicates were tested for each construct, revealing an increase in luciferase protein when hhRz was replaced with the Comp14 Malat1 derivative, which was consistent with the luciferase activity shown in Figure 2A. TaqMan analysis of RNA extracted from treated cells showed a similar increase in trans-spliced luciferase RNA when the RTM contained the Comp14 derivative of the Malat1 terminator, according to two different primer probe sets (S2 and S4). Because the RTM in these studies used a binding domain targeting intron 26 of the CEP290 gene, it was also possible to measure RTM trans-splicing activity against the endogenous CEP290 transcript. As shown in Figure 2B , RTMs carrying the Comp14 derivative of the Malat1 terminator produced higher levels of chimeric Luc-CEP290 RNA compared with RTMs with the hhRz terminator, according to two different TaqMan primer probe sets (S2 and S3).

[0160] Example 2: Comparison of 3' terminator sequences Several terminator sequences were tested for ABCA4 expression in RTM constructs: hhz-hammerhead ribozyme, which self-cleaves to create the 3' end of the RTM (Figure 3A); C14- or Comp14-truncated MALAT1 triple helix structure (SEQ ID NO: 12), which creates the 3' end of the RTM after RNase P cleavage (Figure 3B); and wt-native MALAT1 triple helix, which creates the 3' end of the RTM after RNase P cleavage (Figure 3C).

[0161] Figure 4A and Figure 4B are Western blots showing the ABCA4 protein produced by RTM-mediated trans-splicing and its quantification. The RTMs tested in Figure 3 include the binding domains of ABCA4 intron 23 (motifs 27 and 81) and intron 22 (motifs 117 and 118). NB indicates a negative control, no binding motif. The data in Figure 4A show a significant increase in ABCA4 protein when the hhRz terminator was replaced with a Comp14 derivative. In Figure 4B, Comp14 derivatives were compared with the wild-type MALAT1 triple helix terminator, revealing an even greater increase in trans-splicing activity with the latter, ranging from 5- to 10-fold depending on the binding domain. In Figure 4C, the predicted base pairing of the wild-type MALAT1 triple helix terminator and Comp14 derivatives is shown. Wilusz et al. suggested that Comp14 derivatives should have the same base-pairing properties between the A-rich and U-rich domains as the wild-type MALAT1 sequence, but with truncated flanking stem-loop domains. However, this assumption ignores the possible role of the flanking stem-loop for proper base-pairing, which could explain the lower ENE activity of Comp14 compared to the wild-type MALAT1 triple-helix terminator. The higher level of trans-splicing activity observed with the wild-type MALAT1 sequence compared to the Comp14 derivative indicates important features of triple-helix terminator structure and ENE function.

[0162] Figure 5A shows Western blot analysis of RTMs containing different triple helix terminators from lncRNAs, including wild-type sequences from MALAT1 and NEAT1 (MENβ), and the triple helix domain from MALAT1, which was fused to the wild-type sequence from NEAT1. These include a chimeric form in which the triple helix domain from NEAT1 is fused to a tRNA-like motif (termed menRNA), and a chimeric form in which the triple helix domain from NEAT1 is fused to a mascRNA motif from MALAT1. The data suggest that trans-splicing activity is highest when the RTM contains the wild-type MALAT1 terminator.

[0163] Figure 5B shows the predicted base pairing of triple-helix terminators from three different lncRNAs, including MALAT1, MENβ (NEAT1), and PAN RNA (produced by Kaposi's sarcoma-associated herpesvirus KSHV). Structural similarities between different lncRNAs suggest a common evolutionary strategy for protecting the 3' end of lncRNAs after transcription termination. However, X-ray crystallography of the MALAT1 triple-helical domain revealed that most known native triple-helical structures contain ten major grooves and two minor groove triples (Brown, J.A. et al. 2014). This complex design may confer a greater level of structural stability than either NEAT1 or PAN, which may explain why the MALAT1 terminator appears to better support trans-splicing by protecting the RTM from degradation in the nucleus. Importantly, the blunt-ended triple helix of MALAT1 has been shown to inhibit rapid nuclear RNA decay, as demonstrated by in vivo decay assays (Brown, JA 2014).

[0164] Figure 6A shows the highly conserved mascRNA sequence of MALAT1 from several species and its predicted folded conformation. A single G-to-A point mutation, indicated by the red arrow, was inserted into the mascRNA sequence to test the importance of this domain for trans-splicing activity. As shown in Western blot (Figure 6B), the point mutation eliminated the trans-splicing activity of a validated RTM targeting ABCA4. This is likely due to the inability of the mutated sequence to adopt the correct conformation required for RNase P recognition and cleavage.

[0165] The following additional numbered paragraphs further define some embodiments of the invention described herein.

[0166] 1. A triple helix-containing nucleic acid trans-splicing molecule containing a 3' transcription terminator domain (TTD).

[0167] 2. The nucleic acid trans-splicing molecule of claim 1, wherein the triple helix comprises at least five consecutive AU Hoogsteen base pairs.

[0168] 3. The nucleic acid trans-splicing molecule of claim 1 or 2, wherein the triple helix comprises an A-rich tract of 5 to 30 nucleic acids.

[0169] 4. The nucleic acid trans-splicing molecule of claim 3, wherein the A-rich tract is at the 3' end of the TTD.

[0170] 5. A nucleic acid trans-splicing molecule according to any one of claims 1 to 4, wherein the triple helix comprises a chain of 10 consecutive nucleotides, 9 of the 10 consecutive nucleotides being paired via Hoogsteen base pairing.

[0171] 6. A nucleic acid trans-splicing molecule according to any one of claims 1 to 5, wherein the TTD comprises a stem-loop motif.

[0172] 7. A 5' U-rich motif in which the 3' TTD is operably linked in the 5' to 3' direction. 7. The nucleic acid trans-splicing molecule of claim 1, comprising a stem-loop motif, a 3'U-rich motif, and an A-rich tract.

[0173] 8. The nucleic acid trans-splicing molecule of any one of claims 1 to 4, wherein the 3'TTD is at least 95% homologous to SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, or SEQ ID NO: 23.

[0174] 9. The nucleic acid trans-splicing molecule of claim 8, wherein the 3'TTD is at least 95% homologous to SEQ ID NO: 13 and the triple helix comprises Hoogsteen base pairing between U7 to U11 of SEQ ID NO: 13 and an A-rich tract.

[0175] 10. The nucleic acid of claim 9, wherein the 3'TTD is PAN ENE+A.

[0176] 11. The nucleic acid trans-splicing molecule of any one of claims 1 to 8, wherein the 3'TTD is at least 95% homologous to SEQ ID NO: 15 and the triple helix comprises Hoogsteen base pairing between U6-10, C11, and U12-15 of SEQ ID NO: 15 and an A-rich tract.

[0177] 12. The nucleic acid of claim 11, wherein the 3'TTD is MALAT1 ENE+A.

[0178] 13. The nucleic acid trans-splicing molecule of claim 8, wherein the 3'TTD is at least 95% homologous to SEQ ID NO: 17 and the triple helix comprises Hoogsteen base pairing between U6-10, C11, and U12-15 of SEQ ID NO: 17 and an A-rich tract.

[0179] 14. The nucleic acid of claim 13, wherein the 3'TTD is MALAT1 core ENE+A.

[0180] 15. The nucleic acid trans-splicing molecule of claim 8, wherein the 3'TTD is at least 95% homologous to SEQ ID NO: 23 and the triple helix comprises Hoogsteen base pairing between U8-10, C11, and U12-15 of SEQ ID NO: 23 and an A-rich tract.

[0181] 16. The nucleic acid trans-splicing molecule of claim 15, wherein the 3'TTD is MENβ ENE+A.

[0182] 17. A nucleic acid trans-splicing molecule, operably linked in a 5' to 3' direction: (a) a coding domain sequence (CDS) containing one or more functional exon(s) of a selected gene; and (b) Linker domain sequences (LDS) of various lengths that act as structural links between the coding domain and the binding domain; (c) a spliceosome recognition motif (5' splice site) configured to initiate spliceosome-mediated trans-splicing; (d) binding domains (BDs) of various lengths and sequences configured to hybridize to target introns of selected genes, the genes having at least one deletion or mutation in an exon 5' to the target intron; (e) a 3' transcription terminator domain (TTD) that increases the efficiency of trans-splicing; The nucleic acid trans-splicing molecule is configured to trans-splice a coding domain to an endogenous exon of a selected gene adjacent to a target intron, thereby replacing the endogenous defective or mutated exon with a functional exon and correcting a mutation in the selected gene.

[0183] 18. The nucleic acid trans-splicing molecule of claim 17, wherein the binding domain hybridizes to a target intron of a selected gene 3' to the mutation and the coding domain comprises one or more exon(s) 5' to the target intron.

[0184] 19. A nucleic acid trans-splicing molecule, operably linked in a 5' to 3' direction: (a) a binding domain (BD) configured to bind to a target intron of a selected gene, the gene having at least one deletion or mutation in an exon 3' to the target intron; (b) linker sequences of various lengths and compositions that act as structural links between the binding domain coding regions; (c) a 3' spliceosome recognition motif (3' splice site) configured to mediate trans-splicing; (d) a coding domain sequence (CDS) containing one or more functional exon(s) of the selected gene; and (e) a 3' transcription terminator domain (TTD) that increases the efficiency of trans-splicing; The nucleic acid trans-splicing molecule is configured to trans-splice a coding domain to an endogenous exon of a selected gene adjacent to a target intron, thereby replacing the endogenous defective or mutated exon with a functional exon and correcting a mutation in the selected gene.

[0185] 20. The nucleic acid trans-splicing molecule of claim 19, wherein the binding domain binds to a target intron of a selected gene 3' to the mutation and the coding domain comprises one or more exons 5' to the target intron.

[0186] 21. A nucleic acid trans-splicing molecule according to any one of claims 17 to 20, wherein the 3' transcription terminator domain forms a triple helix structure that effectively caps the 3' end.

[0187] 22. A nucleic acid trans-splicing molecule according to any one of the preceding claims, wherein the 3' transcription terminator domain is a sequence from one or more long non-coding RNAs (lncRNAs) or other nuclear RNA molecules containing 3' transcription terminators that condense into a triple-helical blund-end structure.

[0188] 23. The nucleic acid trans-splicing molecule of any one of claims 17 to 22, wherein the 3' transcription terminator domain is derived from human long non-coding RNA MALAT1.

[0189] 24. The nucleic acid trans-splicing molecule of claim 23, wherein the 3' transcription terminator domain comprises nucleotides 8287 to 8437 of human MALAT1.

[0190] 25. The nucleic acid trans-splicing molecule of claim 23, wherein the 3' transcription terminator domain comprises, in 5' to 3' order, a triplex-forming sequence comprising nucleotides 8287 to 8379, an RNase P cleavage site comprising nucleotides 8379 to 8380, and a tRNA-like sequence comprising nucleotides 8380 to 8437.

[0191] 26. The 3' transcription terminator domain contains U-rich motif 1 (8292-8301), a conserved stem-loop (8302-8333), and U-rich motif 2 (8334-8335). 343), and an A-rich tract (8369-8379), wherein the A-rich tract and U-rich motif 2 form a Watson-Crick stem duplex, and the U-rich motif 1 aligns with the A-rich tract to form a Hoogsteen base pair.

[0192] 27. The nucleic acid trans-splicing molecule of claim 23, wherein the 3' transcription terminator domain is a truncated version of the human MALAT1 triple helix.

[0193] 28. The nucleic acid trans-splicing molecule of claim 27, wherein the 3' transcription terminator domain contains a triplex-forming sequence consisting of U-rich motif 1 (8292-8301), a conserved stem-loop (8302-8310 and 8325-8333), U-rich motif 2 (8334-8343), an A-rich tract (8369-8379), and a deletion spanning nucleotides 8345-8364 of the intervening sequence between U-rich motif 2 and the A-rich tract, wherein the A-rich tract and U-rich motif 2 form a Watson-Crick stem duplex, and U-rich motif 1 aligns with the A-rich tract to form a Hoogsteen base pair.

[0194] 29. The nucleic acid trans-splicing molecule of claim 27, wherein the 3' transcription terminator domain comprises, in 5' to 3' order, a triplex-forming sequence of various lengths and compositions, an RNase P cleavage site, and a tRNA-like sequence of various lengths and compositions.

[0195] 30. The nucleic acid trans-splicing molecule of claim 27, wherein the 3' transcription terminator domain contains a triplex-forming sequence that fits one of three known basic "motifs," referred to as the pyrimidine motif (T,C), the purine motif (G,A), and the purine-pyrimidine motif (G,T), depending on the base composition of the third strand of the triple helix.

[0196] 31. The nucleic acid trans-splicing molecule of claim 22, wherein the 3' transcription terminator domain comprises a triple helix domain and a tRNA-like domain.

[0197] 32. The nucleic acid trans-splicing molecule of claim 31, wherein the triple helix domain and the tRNA-like domain originate from the same long non-coding RNA or different combinations of long non-coding RNA domains from human or any other species.

[0198] 33. The nucleic acid trans-splicing molecule of claim 31, wherein the triple helix domain and the tRNA-like domain are derived from MALAT1 or NEAT1 / MENβ.

[0199] 34. The nucleic acid trans-splicing molecule of any one of the preceding claims 17, wherein the target mammalian gene is ABCA4, CEP290, or MYO7A.

[0200] 35. A nucleic acid trans-splicing molecule according to any one of the preceding claims, wherein the gene is ABCA4 and the deletion or mutation is in any of exons 1 to 23.

[0201] 36. A nucleic acid trans-splicing molecule according to any one of the preceding claims, further comprising one or more linker sequences.

[0202] 37. The nucleic acid trans-splicing molecule of claim 26, comprising a linker between the splicing domain and the binding domain.

[0203] 38. A nucleic acid trans-splicing molecule according to claim 36 or 37, comprising a linker between the binding domain and the 3'-terminal domain.

[0204] 39. A recombinant adeno-associated virus (rAAV) comprising a nucleic acid molecule according to any one of claims 1 to 38.

[0205] 40. The rAAV of claim 39, wherein the AAV preferentially targets photoreceptor cells.

[0206] 41. The rAAV of claim 39 or 40, wherein the AAV comprises an AAV5 capsid protein, an AAV8 capsid protein, an AAV8(b) capsid protein, or an AAV9 capsid protein.

[0207] 42. A method for treating a disease caused by a defect or mutation in a target gene, comprising administering to cells of a subject having the disease a composition comprising a recombinant AAV containing a nucleic acid trans-splicing molecule described in any one of claims 1 to 38.

[0208] 43. A method for treating an eye disease caused by a defect or mutation in a target gene, the method comprising administering to ocular cells of a subject having the eye disease a composition comprising a recombinant AAV containing a nucleic acid trans-splicing molecule described in any one of claims 1 to 38.

[0209] 44. The method of claim 43, wherein the disease is Stargardt disease, Leber congenital amaurosis (LCA), cone-rod dystrophy, fundus flava, retinitis pigmentosa, age-related macular degeneration, or Usher syndrome.

[0210] 45. The method of claim 43 or 44, wherein the composition is administered by subretinal injection.

[0211] 46. The method of claim 43, wherein the disease is Stargardt disease, the cell is a photoreceptor cell, the eye gene is ABCA4, and the corrected exon sequence is exons 1-19, exons 1-22, exons 1-23, or exons 1-24.

[0212] 47. A pharmaceutical formulation comprising a physiologically acceptable carrier and an rAAV described in any one of claims 39 to 41.

[0213] All publications cited herein are incorporated herein by reference in their entirety. Additionally, U.S. Provisional Patent Application No. 62 / 835,164, filed April 17, 2019, is incorporated herein by reference in its entirety. Similarly, the sequence numbers referenced herein and appearing in the attached sequence listing are incorporated by reference. Although the present invention has been described with reference to specific embodiments, it will be understood that modifications can be made without departing from the spirit of the invention. Such modifications are intended to fall within the scope of the appended claims.

Claims

1. A nucleic acid trans-splicing molecule, operably linked in a 5' to 3' direction, (a) a coding domain sequence (CDS) comprising one or more functional exon(s) of a selected gene; (b) Linker domain sequences (LDS) of various lengths and sequences that act as structural links between the coding domain and the binding domain and may contain motifs capable of folding into complex secondary structures that function as splicing enhancers or act to minimize translation of the coding region before a trans-splicing event occurs; (c) a spliceosome recognition motif (5' splice site, splice donor, SD) configured to initiate spliceosome-mediated trans-splicing; (d) binding domains (BDs) of various lengths and sequences configured to hybridize to target introns of the selected genes, wherein the genes have at least one deletion or mutation in an exon 5' to the target intron; (e) a 3′ transcription terminator domain (TTD); The nucleic acid trans-splicing molecule is configured to trans-splice the coding domain to an endogenous exon of the selected gene adjacent to the target intron, thereby replacing the endogenous defective or mutated exon with the functional exon and correcting a mutation in the selected gene.

2. 2. The nucleic acid trans-splicing molecule of claim 1, wherein the binding domain hybridizes to the target intron of the selected gene 3' to the mutation and the coding domain comprises one or more exon(s) 5' to the target intron.

3. A nucleic acid trans-splicing molecule, operably linked in a 5' to 3' direction, (a) a binding domain (BD) configured to bind to a target intron of a selected gene, wherein the gene has at least one deletion or mutation in an exon 3′ to the target intron; (b) linker sequences of various lengths and compositions that act as structural links between the binding domain coding regions and contain motifs that fold into complex secondary structures that function as splicing enhancers or that prevent translation of the coding regions as competing trans-splicing events; (c) a 3' spliceosome recognition motif (3' splice site) (splice acceptor, SA) configured to mediate trans-splicing; (d) a coding domain sequence (CDS) comprising one or more functional exon(s) of the selected gene; and (e) a 3′ transcription terminator domain (TTD); The nucleic acid trans-splicing molecule is configured to trans-splice a coding domain to an endogenous exon of the selected gene adjacent to the target intron, thereby replacing the endogenous defective or mutated exon with the functional exon and correcting a mutation in the selected gene.

4. 4. The nucleic acid trans-splicing molecule of claim 3, wherein the binding domain binds to the target intron of the selected gene 3' to the mutation and the coding domain comprises one or more exons 5' to the target intron.

5. 5. The nucleic acid trans-splicing molecule of claim 1, wherein the 3' transcription terminator domain forms a triple helix structure that effectively caps the 3' end.

6. 10. The nucleic acid trans-splicing molecule of any one of the preceding claims, wherein the 3' transcription terminator domain is a sequence from one or more long non-coding RNAs (lncRNAs) or other nuclear RNA molecules containing 3' transcription terminators that condense into a triple helix 3' end-capped triple helix blund-ended structure.

7. The nucleic acid trans-splicing molecule according to any one of claims 1 to 7, wherein the 3' transcription terminator domain is derived from the human long non-coding RNA MALAT1.

8. 8. The nucleic acid trans-splicing molecule of claim 7, wherein the 3' transcription terminator domain comprises nucleotides 8287 to 8437 of human MALAT1.

9. 8. The nucleic acid trans-splicing molecule of claim 7, wherein the 3' transcription terminator domain comprises, in 5' to 3' order, a triplex-forming sequence comprising nucleotides 8287 to 8379, an RNase P cleavage site comprising nucleotides 8379 to 8380, and a tRNA-like sequence comprising nucleotides 8380 to 8437.

10. 8. The nucleic acid trans-splicing molecule of claim 7, wherein the 3' transcription terminator domain contains a triplex-forming sequence consisting of U-rich motif 1 (8292-8301), a conserved stem-loop (8302-8333), U-rich motif 2 (8334-8343), and an A-rich tract (8369-8379), wherein the A-rich tract and the U-rich motif 2 form a Watson-Crick stem duplex, and the U-rich motif 1 aligns with the A-rich tract to form a Hoogsteen base pair.

11. 8. The nucleic acid trans-splicing molecule of claim 7, wherein the 3' transcription terminator domain is a truncated version of the human MALAT1 triple helix.

12. 12. The nucleic acid trans-splicing molecule of claim 11, wherein the 3' transcription terminator domain contains a triplex-forming sequence consisting of U-rich motif 1 (8292-8301), a conserved stem-loop (8302-8310 and 8325-8333), U-rich motif 2 (8334-8343), an A-rich tract (8369-8379), and a deletion spanning nucleotides 8345-8364 of the intervening sequence between U-rich motif 2 and the A-rich tract, wherein the A-rich tract and the U-rich motif 2 form a Watson-Crick stem duplex, and the U-rich motif 1 aligns with the A-rich tract to form a Hoogsteen base pair.

13. The nucleic acid trans-splicing molecule of claim 11, wherein the 3' transcription terminator domain comprises, in 5' to 3' order, a triplex-forming sequence of various lengths and compositions, an RNase P cleavage site, and a tRNA-like sequence of various lengths and compositions.

14. 12. The nucleic acid trans-splicing molecule of claim 11, wherein the 3' transcription terminator domain contains a triplex-forming sequence that fits one of three known basic "motifs," designated by the base composition of the third strand of the triple helix: the pyrimidine motif (T,C), the purine motif (G,A), and the purine-pyrimidine motif (G,T).

15. the 3' transcription terminator domain comprises a triple helix domain and a tRNA-like domain The nucleic acid trans-splicing molecule of claim 6, comprising:

16. 16. The nucleic acid trans-splicing molecule of claim 15, wherein the triple helix domain and the tRNA-like domain originate from the same long non-coding RNA or different combinations of long non-coding RNA domains derived from human or any other species.

17. The nucleic acid trans-splicing molecule of claim 15, wherein the triple helix domain and the tRNA-like domain are derived from MALAT1 or NEAT1 / MENβ.

18. 2. The nucleic acid trans-splicing molecule of any one of the preceding claims, wherein the target mammalian gene is ABCA4, CEP290, or MYO7A.

19. 10. A nucleic acid trans-splicing molecule according to any one of the preceding claims, wherein the gene is ABCA4 and the deletion or mutation is in any of exons 1 to 23.

20. 10. A nucleic acid trans-splicing molecule according to any one of the preceding claims, further comprising one or more linker sequences.

21. 21. The nucleic acid trans-splicing molecule of claim 20, comprising a linker between the splicing domain and the binding domain.

22. 22. The nucleic acid trans-splicing molecule of claim 20 or 21, comprising a linker between the binding domain and the 3'-terminal domain.

23. A recombinant adeno-associated virus (rAAV) comprising a nucleic acid molecule according to any one of claims 1 to 22.

24. 24. The rAAV of claim 23, wherein the AAV preferentially targets photoreceptor cells.

25. 25. The rAAV of claim 23 or 24, wherein the AAV comprises an AAV5 capsid protein, an AAV8 capsid protein, an AAV8(b) capsid protein, or an AAV9 capsid protein.

26. A method for treating a disease caused by a defect or mutation in a target gene, comprising administering to cells of a subject having the disease a composition comprising a recombinant AAV comprising the nucleic acid trans-splicing molecule of any one of claims 1 to 22.

27. A method for treating an eye disease caused by a defect or mutation in a target gene, the method comprising administering to ocular cells of a subject having the eye disease a composition comprising a recombinant AAV comprising the nucleic acid trans-splicing molecule of any one of claims 1 to 22.

28. 28. The method of claim 27, wherein the disease is Stargardt disease, Leber congenital amaurosis (LCA), cone-rod dystrophy, fundus flava, retinitis pigmentosa, age-related macular degeneration, or Usher syndrome.

29. 29. The method of claim 27 or 28, wherein the composition is administered by subretinal injection.

30. 28. The method of claim 27, wherein the disease is Stargardt disease, the cell is a photoreceptor cell, the eye gene is ABCA4, and the corrected exon sequence is exons 1-19, exons 1-22, exons 1-23, or exons 1-24.

31. A pharmaceutical formulation comprising a physiologically acceptable carrier and the rAAV of any one of claims 23 to 25.

Images