Antibodies against PD-1 and methods of use thereof
Isolated monoclonal antibodies targeting PD-1 with tailored CDR sequences enhance therapeutic efficacy for cancer and chronic viral infections by specifically binding to PD-1 and potentially engaging additional immune cell molecules, addressing limitations of current therapies.
Patent Information
- Application Number
- JP2025078346
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2019-06-14
- Filing Date
- 2025-05-09
- Publication Date
- 2025-08-20
AI Technical Summary
Current therapies targeting PD-1 for cancer and chronic viral infections are limited in efficacy and specificity, necessitating the development of more effective and targeted antibody compositions.
Development of isolated monoclonal antibodies or antigen-binding fragments that specifically bind to human programmed cell death 1 (PD-1) protein, with varying CDR sequences and configurations, including fully human or humanized forms, capable of binding to specific epitopes on PD-1 while avoiding the C'D loop, and potentially bispecific or multispecific configurations to target additional immune cell molecules.
Enhances therapeutic efficacy by specifically modulating PD-1 signaling, offering potential treatments for cancer and chronic viral infections with improved specificity and effectiveness.
Smart Images

Figure 2025121996000001_ABST
Abstract
Description
[Technical Field]
[0001] This application is an international application claiming the benefit of priority from U.S. Provisional Patent Application No. 62 / 861,643, filed June 14, 2019, the entire contents of which are incorporated herein by reference in their entirety.
[0002] All patents, patent applications, and publications cited herein are incorporated by reference in their entirety, and the disclosures of these publications are incorporated by reference into this application in order to more fully describe the state of the art known to those skilled in the art at the date of the invention described and claimed herein.
[0003] This patent disclosure contains material that is subject to copyright protection. The copyright owner has no objection to the facsimile reproduction of either the patent document or the patent disclosure, as it appears in the U.S. Patent and Trademark Office patent file or records, but otherwise reserves all copyright rights whatsoever.
[0004] FIELD OF THE INVENTION The present invention relates to antibodies against PD-1 and methods of using the same. [Background technology]
[0005] Background of the Invention Programmed cell death-1 (PD-1) is a cell surface membrane protein of the immunoglobulin superfamily. This protein is expressed on pro-B cells and is thought to play a role in their differentiation. PD-1, a member of the CD28 family, is upregulated on activated T cells, B cells, and monocytes. PD-1 has two identified ligands in the B7 family: PD-L1 (programmed cell death-1 ligand 1; also known as cluster of differentiation 274 (CD274) or B7 homolog 1 (B7-H1)) and PD-L2. PD-L1 is a 40 kDa type I transmembrane protein. Binding of PD-L1 to PD-1 or B7.1 transmits an inhibitory signal that reduces the proliferation of CD8+ T cells in lymph nodes. Additionally, PD-1 can also control the accumulation of foreign antigen-specific T cells in lymph nodes through apoptosis, which is further mediated by downregulation of the Bcl-2 gene. PD-L2 expression tends to be more restricted and is found primarily on activated antigen-presenting cells (APCs), whereas PD-L1 expression is more widespread, including hematopoietic cells (such as activated T cells, B cells, monocytes, dendritic cells, and macrophages) and peripheral non-lymphoid tissues (such as cardiac, skeletal, muscle, placental, lung, kidney, and liver tissues). The widespread expression of PD-L1 indicates a significant role in regulating PD-1 / PD-L1-mediated peripheral tolerance. Summary of the Invention
[0006] The present invention provides PD-1 antibody compositions and methods of use thereof.
[0007] One aspect of the present invention relates to an isolated monoclonal antibody or antigen-binding fragment thereof that binds to human programmed cell death 1 (PD-1) protein. In one embodiment, the isolated monoclonal PD-1 antibody or antigen-binding fragment thereof comprises a heavy chain, a light chain, or a combination thereof. In some embodiments, the heavy chain comprises a CDR1 comprising G-(X1)-TF-(X2X3)-Y-(X4) (SEQ ID NO: 81), G-(X5)-TF-(X6X7X8)-A (SEQ ID NO: 82), GDSVSSDNYF (SEQ ID NO: 43), or GYTFNRFG (SEQ ID NO: 55); ISWNSGSI (SEQ ID NO: 19), IYPDDSDT (SEQ ID NO: 33), VYYNGNT (SEQ ID NO: 45), TNPYNGNT (SEQ ID NO: 57), or In other embodiments, the light chain comprises a CDR1 comprising SSNIGSNT (SEQ ID NO: 24), SSNIGAGYV (SEQ ID NO: 37), SNNVGAHG (SEQ ID NO: 49), SGSIAAYY (SEQ ID NO: 61), or NIGSKS (SEQ ID NO: 73); (X9)-DN (SEQ ID NO: 83), (X 10)-NN (SEQ ID NO:84) or DDS (SEQ ID NO:75); CDR3 comprising AAWDGGLNGRGV (SEQ ID NO:28), AAWDDSLNAPV (SEQ ID NO:41), SSWDSSLSGYV (SEQ ID NO:53), QSYDSSNLWV (SEQ ID NO:65), or QVWHSVSDQGV (SEQ ID NO:77); or a combination of these CDRs. In some embodiments, the isolated monoclonal PD-1 antibody or antigen-binding fragment thereof comprises a heavy chain and a light chain comprising the CDRs described herein. In further embodiments, the isolated monoclonal PD-1 antibody or antigen-binding fragment thereof is fully human or humanized. In further embodiments, the isolated monoclonal PD-1 antibody or antigen-binding fragment thereof is monospecific, bispecific, or multispecific. In further embodiments, the isolated monoclonal PD-1 antibody or antigen-binding fragment thereof is a single-chain antibody. In other embodiments, the isolated monoclonal PD-1 antibody or antigen-binding fragment thereof has a molecular weight of at least 1.0 x 10 -9and has a binding affinity of M. In other embodiments, the isolated monoclonal PD-1 antibody or antigen-binding fragment thereof further comprises a heavy chain constant region, a light chain constant region, an Fc region, or a combination thereof. In some embodiments, the X1, X4, X5, or X8 amino acid residue of the CDR derived from the isolated monoclonal PD-1 antibody or antigen-binding fragment thereof is a nonpolar amino acid residue. In some embodiments, the X1, X4, X5, or X8 amino acid residue of the CDR derived from the isolated monoclonal PD-1 antibody or antigen-binding fragment thereof is tyrosine (Y), phenylalanine (F), or alanine (A). In some embodiments, the X2, X3, X4, X6, X7, or X8 amino acid residue of the CDR derived from the isolated monoclonal PD-1 antibody or antigen-binding fragment thereof is a polar amino acid residue. In some embodiments, the X2, X3, X4, X6, X7, or X8 amino acid residue of a CDR derived from an isolated monoclonal PD-1 antibody or antigen-binding fragment thereof is aspartic acid (D), threonine (T), serine (S), or tryptophan (W). In other embodiments, the X1 amino acid residue of a CDR derived from an isolated monoclonal PD-1 antibody or antigen-binding fragment thereof is tyrosine (Y) or phenylalanine (F). In other embodiments, the X2 amino acid residue of a CDR derived from an isolated monoclonal PD-1 antibody or antigen-binding fragment thereof is aspartic acid (D), threonine (T), or serine (S). In other embodiments, the X3 amino acid residue of a CDR derived from an isolated monoclonal PD-1 antibody or antigen-binding fragment thereof is aspartic acid (D), threonine (T), or serine (S). In another embodiment, the X4 amino acid residue of the CDR derived from the isolated monoclonal PD-1 antibody or antigen-binding fragment thereof is alanine (A) or tryptophan (W). In another embodiment, the X5 amino acid residue of the CDR derived from the isolated monoclonal PD-1 antibody or antigen-binding fragment thereof is phenylalanine (F) or tyrosine (Y). In another embodiment, the X6 amino acid residue of the CDR derived from the isolated monoclonal PD-1 antibody or antigen-binding fragment thereof is aspartic acid (D) or serine (S).In another embodiment, the X7 amino acid residue of the CDR derived from the isolated monoclonal PD-1 antibody or antigen-binding fragment thereof is aspartic acid (D) or serine (S). In another embodiment, the X8 amino acid residue of the CDR derived from the isolated monoclonal PD-1 antibody or antigen-binding fragment thereof is phenylalanine (F) or tyrosine (Y). In another embodiment, the X9 amino acid residue of the CDR derived from the isolated monoclonal PD-1 antibody or antigen-binding fragment thereof is a polar hydrophilic amino acid residue. In another embodiment, the X9 amino acid residue of the CDR derived from the isolated monoclonal PD-1 antibody or antigen-binding fragment thereof is glutamic acid (E), asparagine (N), or aspartic acid (D). In another embodiment, the X of the CDR derived from the isolated monoclonal PD-1 antibody or antigen-binding fragment thereof. 10 In another embodiment, the X amino acid residues of the CDRs from an isolated monoclonal PD-1 antibody or antigen-binding fragment thereof are polar hydrophilic amino acid residues. 10 The amino acid residue is serine (S) or arginine (R).
[0008] One aspect of the present invention relates to an antibody composition comprising at least one antibody, the at least one antibody comprising two heavy chains and two light chains. In some embodiments, the heavy chain CDRs are selected from residues 27-38, 56-65, and 105-119 according to the IMGT numbering of SEQ ID NO: 1; or residues 27-38, 56-65, and 105-119 according to the IMGT numbering of SEQ ID NO: 3; or residues 27-38, 56-65, and 105-121 according to the IMGT numbering of SEQ ID NO: 5; or residues 27-38, 56-65, and 105-115 according to the IMGT numbering of SEQ ID NO: 7; or residues 27-38, 56-65, and 105-114 according to the IMGT numbering of SEQ ID NO: 9; or residues 27-38, 56-65, and 105-114 according to the IMGT numbering of SEQ ID NO: 9. or residues 27-38, 56-65, and 105-119 according to the IMGT numbering of SEQ ID NO: 12 (e.g., an HL-14 mutant described herein); or residues 27-38, 56-65, and 105-119 according to the IMGT numbering of SEQ ID NO: 13 (e.g., an HLkin-1 mutant described herein); or residues 27-38, 56-65, and 105-119 according to the IMGT numbering of SEQ ID NO: 15 (e.g., a mut-3 mutant described herein), but at least one of the heavy chain CDRs differs by a single amino acid substitution compared to that reference CDR.In some embodiments, the light chain CDRs are residues 27-38, residues 56-65, and residues 105-116 according to the IMGT numbering of SEQ ID NO:2; or residues 27-38, residues 56-65, and residues 105-115 according to the IMGT numbering of SEQ ID NO:4; or residues 27-38, residues 56-65, and residues 105-115 according to the IMGT numbering of SEQ ID NO:6; or residues 27-38, residues 56-65, and residues 105-115 according to the IMGT numbering of SEQ ID NO:8. or residues 27-38, 56-65, and 105-114 according to the IMGT numbering of SEQ ID NO: 10; or residues 27-38, 56-65, and 105-116 according to the IMGT numbering of SEQ ID NO: 11 (e.g., the HL-7 variants described herein), except that at least one of the light chain CDRs differs by a single amino acid substitution compared to the reference CDR. In some embodiments, the antibody composition binds to an epitope comprising amino acid residues within the face of PD-1 generated by the FCC' chain but does not contact the C'D loop of PD-1 comprising non-adjacent amino acids in SEQ ID NO: XX.
[0009] One aspect of the present invention relates to an isolated antibody or fragment thereof that binds to human programmed cell death 1 (PD-1) protein. In one embodiment, the isolated antibody or fragment thereof that binds to PD-1 comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28. In one embodiment, the isolated antibody or fragment thereof that binds to PD-1 comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 31, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 33, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 35, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 37, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 39, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 41. In one embodiment, the isolated antibody or fragment thereof that binds to PD-1 comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 43, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 45, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 47, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 49, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 51, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 53. In one embodiment, the isolated antibody or fragment thereof that binds to PD-1 comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 55, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 57, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 59, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 61, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 63, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 65. In one embodiment, the isolated antibody or fragment thereof that binds to PD-1 comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 67, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 69, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 71, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 73, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 75, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 77.In one embodiment, an isolated antibody or fragment thereof that binds to PD-1 comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28 (e.g., an HL-7 variant described herein). In one embodiment, an isolated antibody or fragment thereof that binds to PD-1 comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 79, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28 (e.g., an HL-14 variant described herein). In one embodiment, an isolated antibody or fragment thereof that binds to PD-1 comprises a VH CDR1 comprising the amino acids of SEQ ID NO: 78, a VH CDR2 comprising the amino acids of SEQ ID NO: 19, a VH CDR3 comprising the amino acids of SEQ ID NO: 21, a VL CDR1 comprising the amino acids of SEQ ID NO: 24, a VL CDR2 comprising the amino acids of SEQ ID NO: 26, and a VL CDR3 comprising the amino acids of SEQ ID NO: 28 (e.g., an HLkin-1 variant described herein). In one embodiment, an isolated antibody or fragment thereof that binds to PD-1 comprises a VH CDR1 comprising the amino acids of SEQ ID NO: 78, a VH CDR2 comprising the amino acids of SEQ ID NO: 19, a VH CDR3 comprising the amino acids of SEQ ID NO: 21, a VL CDR1 comprising the amino acids of SEQ ID NO: 24, a VL CDR2 comprising the amino acids of SEQ ID NO: 80, and a VL CDR3 comprising the amino acids of SEQ ID NO: 28 (e.g., an HLkin-1 HL-7 mut2 variant described herein).In one embodiment, the isolated antibody or fragment thereof that binds to PD-1 comprises a VH CDR1 comprising amino acids of SEQ ID NO: 78, a VH CDR2 comprising amino acids of SEQ ID NO: 19, a VH CDR3 comprising amino acids of SEQ ID NO: 79, a VL CDR1 comprising amino acids of SEQ ID NO: 24, a VL CDR2 comprising amino acids of SEQ ID NO: 80, and a VL CDR3 comprising amino acids of SEQ ID NO: 28 (e.g., the HLkin-1 HL-7 HL-14 mut3 mutant described herein).
[0010] One aspect of the present invention relates to an isolated antibody or fragment thereof that binds to human programmed cell death 1 (PD-1) protein. In one embodiment, the isolated antibody or fragment thereof that binds to human PD-1 protein comprises a heavy chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 1, 3, 5, 7, 9, 12, 13, and 15, and a light chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, and 11.
[0011] In other embodiments, the isolated antibody or fragment thereof that binds to a human PD-1 protein comprises:
[0012] In another embodiment, the isolated antibody or fragment thereof that binds to human PD-1 protein comprises: In another embodiment, the isolated antibody or fragment thereof that binds to human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 1 and the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 2. In another embodiment, the isolated antibody or fragment thereof that binds to human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 3 and the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 4. In another embodiment, the isolated antibody or fragment thereof that binds to human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 5 and the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 6. In another embodiment, the isolated antibody or fragment thereof that binds to human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 7 and the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 8. In another embodiment, the isolated antibody or fragment thereof that binds to human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 9 and the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 10. In another embodiment, the isolated antibody or fragment thereof that binds to human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 1 and the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 11. In other embodiments, the isolated antibody or fragment thereof that binds to human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO:12 and the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO:2.In another embodiment, the isolated antibody or fragment thereof that binds to human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 13, and the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 2. In another embodiment, the isolated antibody or fragment thereof that binds to human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 13, and the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 11. In another embodiment, the isolated antibody or fragment thereof that binds to human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 15, and the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 11.
[0013] One aspect of the present invention relates to an isolated bispecific antibody comprising a first antibody fragment that binds to human PD-1 protein and a second antigen-binding fragment having specificity for a molecule on an immune cell. In one embodiment, the isolated bispecific antibody comprises a fragment of a human antibody against the PD-1 protein described herein. In some embodiments, the molecule on the immune cell comprises B7H3, B7H4, CD27, CD28, CD40, CD40L, CD47, CD122, CTLA-4, GITR, GITRL, ICOS, ICOSL, LAG-3, LIGHT, OX-40, OX40L, PD-1, TIM3, 4-1BB, TIGIT, VISTA, HEVM, BTLA, or KIR. In some embodiments, the antibody fragment that binds to human PD-1 protein comprises a Fab fragment, a single-chain variable fragment (scFv), or a single-domain antibody. In other embodiments, the second antigen-binding fragment having specificity for a molecule on an immune cell comprises a Fab fragment, a single-chain variable fragment (scFv), or a single-domain antibody. In some embodiments, the bispecific antibody comprises an Fc fragment.
[0014] One aspect of the present invention relates to an isolated multispecific antibody comprising a first antibody fragment that binds to human PD-1 protein and second and third antigen-binding fragments having specificity for a molecule on an immune cell. In one embodiment, the isolated multispecific antibody comprises fragments of a human antibody against the PD-1 protein described herein. In some embodiments, the molecule on an immune cell comprises B7H3, B7H4, CD27, CD28, CD40, CD40L, CD47, CD122, CTLA-4, GITR, GITRL, ICOS, ICOSL, LAG-3, LIGHT, OX-40, OX40L, PD-1, TIM3, 4-1BB, TIGIT, VISTA, HEVM, BTLA, or KIR. In some embodiments, the antibody fragment that binds to human PD-1 protein comprises a Fab fragment, a single-chain variable fragment (scFv), or a single-domain antibody. In other embodiments, the second and third antigen-binding fragments with specificity for a molecule on an immune cell comprise a Fab fragment, a single-chain variable fragment (scFv), or a single-domain antibody. In some embodiments, the multispecific antibody comprises an Fc fragment. In some embodiments, the multispecific antibody further comprises a fourth and / or fifth antigen-binding fragment with specificity for a molecule on an immune cell.
[0015] One aspect of the present invention relates to a nucleic acid encoding an isolated monoclonal antibody or antigen-binding fragment thereof that binds to the human programmed cell death 1 (PD-1) protein described herein. One aspect of the present invention relates to a nucleic acid encoding an isolated antibody or fragment thereof that binds to the human PD-1 protein described herein. One aspect of the present invention relates to a nucleic acid encoding a bispecific antibody described herein. One aspect of the present invention relates to a nucleic acid encoding a multispecific antibody described herein. In some embodiments, the present invention relates to a vector comprising a nucleic acid described herein. In some embodiments, the present invention relates to a cell comprising a vector described herein.
[0016] One aspect of the present invention relates to pharmaceutical compositions comprising an antibody or fragment that binds to human PD-1 protein as described herein and a pharmaceutically acceptable carrier or excipient. In some embodiments, the pharmaceutical composition further comprises at least one additional therapeutic agent. In other embodiments, the therapeutic agent is a toxin, a radiolabel, an siRNA, a small molecule, or a cytokine.
[0017] One aspect of the present invention relates to pharmaceutical compositions comprising a bispecific antibody or fragment that binds to human PD-1 protein and a second antigen-binding fragment having specificity for a molecule on an immune cell as described herein, and a pharmaceutically acceptable carrier or excipient. In some embodiments, the pharmaceutical composition further comprises at least one additional therapeutic agent. In other embodiments, the therapeutic agent is a toxin, a radiolabel, an siRNA, a small molecule, or a cytokine.
[0018] One aspect of the present invention relates to a pharmaceutical composition comprising a bispecific antibody or fragment that binds to human PD-1 protein, in addition to a second, third, fourth, or fifth antigen-binding fragment having specificity for a molecule on an immune cell as described herein, and a pharmaceutically acceptable carrier or excipient. In some embodiments, the pharmaceutical composition further comprises at least one additional therapeutic agent. In other embodiments, the therapeutic agent is a toxin, a radiolabel, an siRNA, a small molecule, or a cytokine.
[0019] One aspect of the invention relates to an isolated cell comprising one or more polynucleotides encoding a PD-1 antibody or fragment thereof described herein. One aspect of the invention relates to an isolated cell comprising one or more polynucleotides encoding a bispecific antibody or fragment thereof described herein. One aspect of the invention relates to an isolated cell comprising one or more polynucleotides encoding a multispecific antibody or fragment thereof described herein.
[0020] One aspect of the present invention pertains to a kit comprising a pharmaceutical composition described herein; a syringe, needle, or applicator for administration of the pharmaceutical composition to a subject; and instructions for use.
[0021] One aspect of the present invention relates to engineered cells comprising a chimeric antigen receptor, the chimeric antigen receptor comprising an extracellular ligand-binding domain specific for an antigen on the surface of a cancer cell, the antigen comprising PD-1. Another aspect of the present invention relates to engineered cells comprising a chimeric antigen receptor, the chimeric antigen receptor comprising an extracellular ligand-binding domain specific for a first antigen and a second antigen on the surface of a cancer cell, the first antigen comprising PD-1, and the second antigen comprising a tumor-specific surface antigen described herein. In one embodiment, the extracellular ligand-binding domain comprises an antibody or fragment thereof. In another embodiment, the antibody comprises a VH and / or VL according to Tables 1-11, or any combination of heavy or light chains described herein. In one embodiment, the antibody comprises CDR1, CDR2, and / or CDR3 of Table 12, or any combination of CDRs described herein. In one embodiment, the engineered cell is a T cell, NK cell, or NKT cell. In one embodiment, the T cells are CD4+, CD8+, CD3+ panT cells, or any combination thereof.
[0022] One aspect of the present invention relates to a method of treating cancer in a subject. In some embodiments, the method comprises administering to a subject in need thereof a therapeutically effective amount of a composition comprising a PD-1 antibody described herein. In some embodiments, the method comprises administering to a subject in need thereof a therapeutically effective amount of a composition comprising a pharmaceutical composition described herein. In some embodiments, the method comprises administering to a subject in need thereof a therapeutically effective amount of a composition comprising a CAR composition described herein. In one embodiment, the cancer expresses PD-1. In another embodiment, the cancer comprises non-small cell lung cancer, melanoma, ovarian cancer, lymphoma, or renal cell carcinoma. In some embodiments, the method further comprises administering to the subject a chemotherapeutic agent.
[0023] [The present invention 1001] 1. An isolated monoclonal antibody or antigen-binding fragment thereof that binds to human programmed cell death 1 (PD-1) protein, comprising a heavy chain, a light chain, or a combination thereof, The heavy chain CDR1 comprising G-(X1)-TF-(X2X3)-Y-(X4) (SEQ ID NO: 81), G-(X5)-TF-(X6X7X8)-A (SEQ ID NO: 82), GDSVSSDNYF (SEQ ID NO: 43), or GYTFNRFG (SEQ ID NO: 55), CDR2 comprising ISWNSGSI (SEQ ID NO: 19), IYPDDSDT (SEQ ID NO: 33), VYYNGNT (SEQ ID NO: 45), TNPYNGNT (SEQ ID NO: 57), or ISYDGSNK (SEQ ID NO: 69), CDR3 comprising ASDYGDKYYYYGMDV (SEQ ID NO: 21), AFWGASGAPVNGFDI (SEQ ID NO: 35), ATETPPTSYFNSGPFDS (SEQ ID NO: 47), ARVVAVNGMDV (SEQ ID NO: 59), ASQTVAGSDY (SEQ ID NO: 71), or ASDYGDKYYYGMDV (SEQ ID NO: 79), or a combination of these CDRs and The light chain CDR1 comprising SSNIGSNT (SEQ ID NO: 24), SSNIGAGYV (SEQ ID NO: 37), SNNVGAHG (SEQ ID NO: 49), SGSIAAYY (SEQ ID NO: 61), or NIGSKS (SEQ ID NO: 73), (X9)-DN (SEQ ID NO: 83), (X 10 )-NN (SEQ ID NO: 84), or DDS (SEQ ID NO: 75), CDR3 comprising AAWDGGLNGRGV (SEQ ID NO: 28), AAWDDSLNAPV (SEQ ID NO: 41), SSWDSSLSGYV (SEQ ID NO: 53), QSYDSSNLWV (SEQ ID NO: 65), or QVWHSVSDQGV (SEQ ID NO: 77), or a combination of these CDRs Including, An isolated monoclonal antibody or antigen-binding fragment thereof. [The present invention 1002] 1001. An antibody of the invention which is fully human or humanized. [The present invention 1003] The antibody of the present invention 1001, which is monospecific, bispecific, or multispecific. [The present invention 1004] The antibody of the present invention, which is a single-chain antibody. [The present invention 1005] At least 1.0 x 10 -6 1001. An antibody of the present invention having a binding affinity of M. [The present invention 1006] The antibody or fragment of the present invention 1001 further comprising a heavy chain constant region, a light chain constant region, an Fc region, or a combination thereof. [The present invention 1007] 1001. The antibody of the present invention, wherein X1, X4, X5, or X8 is a non-polar amino acid residue. [The present invention 1008] 1007. The antibody of the present invention, wherein X1, X4, X5, or X8 is tyrosine (Y), phenylalanine (F), or alanine (A). [The present invention 1009] 1001. The antibody of the present invention, wherein X2, X3, X4, X6, X7, or X8 is a polar amino acid residue. [The present invention 1010] 1009. The antibody of the present invention, wherein X2, X3, X4, X6, X7, or X8 is aspartic acid (D), threonine (T), serine (S), or tryptophan (W). [The present invention 1011] 1001. The antibody of the present invention, wherein X1 is phenylalanine (F) or tyrosine (Y). [The present invention 1012] 1001. The antibody of the present invention, wherein X2 is aspartic acid (D), threonine (T), or serine (S). [The present invention 1013] 1001. The antibody of the present invention, wherein X3 is aspartic acid (D), threonine (T), or serine (S). [The present invention 1014] 1001. The antibody of the present invention, wherein X4 is alanine (A) or tryptophan (W). [The present invention 1015] 1001. The antibody of the present invention, wherein X5 is phenylalanine (F) or tyrosine (Y). [The present invention 1016] 1001. The antibody of the present invention, wherein X6 is aspartic acid (D) or serine (S). [The present invention 1017] 1001. The antibody of the present invention, wherein X7 is aspartic acid (D) or serine (S). [The present invention 1018] 1001. The antibody of the present invention, wherein X8 is phenylalanine (F) or tyrosine (Y). [The present invention 1019] 1001. The antibody of the present invention, wherein X9 is a polar hydrophilic amino acid residue. [The present invention 1020] The antibody of the present invention, wherein X9 is glutamic acid (E), asparagine (N), or aspartic acid (D). [The present invention 1021] X 10 is a polar hydrophilic amino acid residue. [The present invention 1022] X 10 is serine (S) or arginine (R). [The present invention 1023] An antibody composition comprising at least one antibody, said at least one antibody comprising two heavy chains and two light chains; The heavy chain CDRs comprise residues 27-38, 56-65, and 105-119 according to the IMGT numbering of SEQ ID NO: 1; or residues 27-38, 56-65, and 105-119 according to the IMGT numbering of SEQ ID NO: 3; or residues 27-38, 56-65, and 105-121 according to the IMGT numbering of SEQ ID NO: 5; or residues 27-38, 56-65, and 105-115 according to the IMGT numbering of SEQ ID NO: 7; or residues 27-38, 56-65, and 105-115 according to the IMGT numbering of SEQ ID NO: 9. or residues 27-38, 56-65, and 105-114 according to the IMGT numbering of SEQ ID NO: 12; or residues 27-38, 56-65, and 105-119 according to the IMGT numbering of SEQ ID NO: 13; or residues 27-38, 56-65, and 105-119 according to the IMGT numbering of SEQ ID NO: 15, but at least one of said heavy chain CDRs differs by a single amino acid substitution compared to the reference CDR, and The light chain CDRs are residues 27-38, 56-65, and 105-116 according to the IMGT numbering of SEQ ID NO: 2; or residues 27-38, 56-65, and 105-115 according to the IMGT numbering of SEQ ID NO: 4; or residues 27-38, 56-65, and 105-115 according to the IMGT numbering of SEQ ID NO: 6; or residues 27-38, 56-65, and 105-115 according to the IMGT numbering of SEQ ID NO: 8. or residues 27-38, 56-65, and 105-114 according to the IMGT numbering of SEQ ID NO: 10; or residues 27-38, 56-65, and 105-116 according to the IMGT numbering of SEQ ID NO: 11, but at least one of said light chain CDRs differs by a single amino acid substitution compared to the reference CDR; and the antibody composition binds to an epitope comprising amino acid residues within the face of PD-1 generated by the FCC' chain but does not contact the C'D loop of PD-1 comprising non-adjacent amino acids in SEQ ID NO:XX; Antibody composition. [The present invention 1024] 1. An isolated antibody or fragment thereof that binds to human programmed cell death 1 (PD-1) protein, (a) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28, or (b) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 31, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 33, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 35, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 37, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 39, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 41, or (c) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 43, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 45, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 47, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 49, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 51, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 53, or (d) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 55, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 57, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 59, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 61, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 63, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 65; or (e) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 67, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 69, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 71, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 73, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 75, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 77, or (f) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28, or (g) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 79, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28, or (h) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28, or (i) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28, or (j) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 79, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28 An isolated antibody or fragment thereof comprising: [The present invention 1025] An isolated antibody or fragment thereof that binds to human PD-1 protein, comprising a heavy chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 1, 3, 5, 7, 9, 12, 13, and 15, and a light chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, and 11. [The present invention 1026] An isolated monoclonal antibody or antigen-binding fragment thereof that binds to PD-1, comprising a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:1, and the light chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:2. [The present invention 1027] An isolated monoclonal antibody or antigen-binding fragment thereof that binds to PD-1, comprising a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:3, and the light chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:4. [The present invention 1028] An isolated monoclonal antibody or antigen-binding fragment thereof that binds to PD-1, comprising a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:5, and the light chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:6. [The present invention 1029] An isolated monoclonal antibody or antigen-binding fragment thereof that binds to PD-1, comprising a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:7, and the light chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:8. [The present invention 1030] An isolated monoclonal antibody or antigen-binding fragment thereof that binds to PD-1, comprising a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:9, and the light chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:10. [The present invention 1031] An isolated monoclonal antibody or antigen-binding fragment thereof that binds to PD-1, comprising a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:1, and the light chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:11. [The present invention 1032] An isolated monoclonal antibody or antigen-binding fragment thereof that binds to PD-1, comprising a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO: 12, and the light chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO: 2. [The present invention 1033] An isolated monoclonal antibody or antigen-binding fragment thereof that binds to PD-1, comprising a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO: 13, and the light chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO: 2. [The present invention 1034] 1. An isolated monoclonal antibody or antigen-binding fragment thereof that binds to PD-1, comprising a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO: 13, and the light chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO: 11. [This invention 1035] An isolated monoclonal antibody or antigen-binding fragment thereof that binds to PD-1, comprising a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO: 15, and the light chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO: 11. [The present invention 1036] 1. An isolated bispecific antibody comprising a fragment of 1001, 1023, 1024, 1025, 1026, 1027, 1028, 1029, 1030, 1031, 1032, 1033, 1034, or 1035 of the present invention and a second antigen-binding fragment having specificity for a molecule on an immune cell. [This invention 1037] 1036. A bispecific antibody of the invention, wherein said molecule is selected from the group consisting of B7H3, B7H4, CD27, CD28, CD40, CD40L, CD47, CD122, CTLA-4, GITR, GITRL, ICOS, ICOSL, LAG-3, LIGHT, OX-40, OX40L, PD-1, TIM3, 4-1BB, TIGIT, VISTA, HEVM, BTLA, and KIR. [The present invention 1038] The bispecific antibody of the invention 1036, wherein each of said fragment and second fragment is independently selected from a Fab fragment, a single chain variable fragment (scFv), or a single domain antibody. [This invention 1039] The bispecific antibody of the present invention 1036, further comprising an Fc fragment. [The present invention 1040] A nucleic acid encoding any one of the antibodies 1001 to 1035 of the present invention. [This invention 1041] A nucleic acid encoding the bispecific antibody according to any one of 1036 to 1039 of the present invention. [The present invention 1042] A pharmaceutical composition comprising any one of the antibodies of the present invention 1001 to 1035 or a fragment thereof, and a pharmaceutically acceptable carrier or excipient. [This invention 1043] The pharmaceutical composition of claim 1042, further comprising at least one additional therapeutic agent. [This invention 1044] The pharmaceutical composition of claim 1043, wherein the therapeutic agent is a toxin, a radiolabel, an siRNA, a small molecule, or a cytokine. [This invention 1045] A pharmaceutical composition comprising any one of the bispecific antibodies of the present invention 1036 to 1039 and a pharmaceutically acceptable carrier or excipient. [The present invention 1046] The pharmaceutical composition of the present invention 1045 further comprising at least one additional therapeutic agent. [This invention 1047] The pharmaceutical composition of claim 1046, wherein said therapeutic agent is a toxin, a radiolabel, an siRNA, a small molecule, or a cytokine. [This invention 1048] An isolated cell comprising one or more polynucleotides encoding any one of the antibodies or fragments thereof of the present invention 1001 to 1035. [This invention 1049] An isolated cell comprising one or more polynucleotides encoding the bispecific antibody or fragment thereof of any one of 1036 to 1039 of the present invention. [The present invention 1050] A vector comprising the nucleic acid of the present invention 1040 or 1041. [This invention 1051] A cell comprising a vector of the present invention. [This invention 1052] A kit comprising at least one antibody composition of the invention 1042 or 1045, a syringe, needle, or applicator for administering the at least one antibody to a subject, and instructions for use. [This invention 1053] An engineered cell comprising a chimeric antigen receptor, the chimeric antigen receptor comprising an extracellular ligand-binding domain specific for an antigen on the surface of a cancer cell, the antigen comprising PD-1. [This invention 1054] 1053. The engineered cell of claim 1053, wherein said extracellular ligand-binding domain comprises an antibody or a fragment thereof. [This invention 1055] The engineered cell of the present invention 1053, wherein the antibody comprises a VH and / or VL according to Tables 1 to 11, or any combination thereof. [This invention 1056] 1054. The engineered cell of the present invention, wherein said antibody comprises CDR1, CDR2, and / or CDR3 of Table 12, or any combination thereof. [This invention 1057] The engineered cell of claim 1053, wherein the engineered cell comprises a T cell, an NK cell, or an NKT cell. [This invention 1058] 1057. The engineered cell of the present invention, wherein said T cells are CD4+, CD8+, CD3+ panT cells, or any combination thereof. [This invention 1059] A method for treating cancer in a subject, comprising administering to a subject in need thereof a therapeutically effective amount of an antibody of any one of 1001 to 1039 of the present invention, a pharmaceutical composition of any one of 1042 to 1046 of the present invention, or a composition comprising a CAR composition of any one of 1053 to 1058 of the present invention. [The present invention 1060] The method of claim 1059, wherein said cancer expresses PD-1. [This invention 1061] 1059. The method of claim 1059, wherein said cancer comprises non-small cell lung cancer, melanoma, ovarian cancer, lymphoma, or renal cell carcinoma. [This invention 1062] The method of claim 1059, further comprising administering a chemotherapeutic agent to the subject. Other objects and advantages of the present invention will become readily apparent from the following description. [Brief explanation of the drawings]
[0024] The patent or application contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) may be obtained from the Office upon request and payment of the necessary fee.
[0025] [Figure 1]1 shows a schematic diagram of the PMPL panning strategy for antibody discovery (e.g., PD-1 antibodies of the present invention). [Figure 2-1] Figure 2 is a schematic diagram of the VH and VL sequences of the anti-PD-1 antibody, P4-B3. [Figure 2-2] See description of Figure 2-1. [Figure 3-1] Figure 3 shows the 3D protein structure of human PD-1, with differences between human and cynomolgus PD-1 highlighted in red. The corresponding amino acid sequences are aligned below. A high degree of similarity is observed between human and cynomolgus PD-1. The 3D protein structure of PD-1 bound to nivolumab is also shown. [Figure 3-2] See description of Figure 3-1. [Figure 4] 1 is a graph showing binding curves of the P4-B3 minibody to human and cynomolgus monkey PD-1. [Figure 5] 1 shows a graph of the octet binding curves for different forms of P4-B3. [Figure 6] Binding curves for PD-L1 competition assays using PD-1 antibodies are shown. [Figure 7] Binding curves for IgG ELISA are shown. [Figure 8-1] FIG. 8 shows the FACS analysis plots for PD1 FACS performed with anti-PD1 IgG. [Figure 8-2] See description of Figure 8-1. [Figure 9] FIG. 1 is a schematic diagram of the PD1-PDL1 bioassay. [Figure 10A] Figure 10 shows graphs of induction curves from a commercially available PD1-PDL1 bioassay. (A) IgG1 wild-type monomer version of P4-B3 versus pembro and nivo. As shown in the figure, the P4-B3 anti-PD1 antibody achieves approximately half the signal of pembro and nivo. [Figure 10B]Figure 10 shows a graph of induction curves from a commercially available PD1-PDL1 bioassay. (B) Comparison of hexamers in the IgG1 LALA configuration. The hexamer configuration shows an approximately 2-3 fold shift in the dose-response curve. [Figure 10C] Figure 10 shows a graph of the induction curve from a commercially available PD1-PDL1 bioassay. (C) Direct comparison of IgG4 constructs (monomer and hexamer) with nivo. Here, a similar trend to Figures 10A and 10B is observed. The commercially available antibody is 2-fold more potent than P4-B3, with the hexamer having an approximately 2-3 fold shift compared to the monomer. [Figure 11] Schematic of a ribbon diagram of human PD-1 (see Cheng, X et al., (2013). JBC doi.org / 10.1074 / jbc.M112.448126). PD-1 is an antiparallel B-sandwich. The antiparallel B-sandwich is shown. The front sheet of the PD-1 ribbon diagram includes G, F, C, and C', and the back sheet of the PD-1 ribbon diagram includes A, B, E, and D. PD-1 lacks cysteines in the stalk region, which prevents PD-1 from homodimerizing. [Figure 12-1] Figure 12 is a schematic diagram of the protein structure showing the interaction of PD-1 with its ligands, PDL-1 and PDL-2. See Cheng et al., Structure and Interactions of the Human Programmed Cell Death 1 Receptor, JBC 2013; Tan et al. (2016) Protein Cell DOI:10.1007 / s13238-016-0337-7; and Yan et al. (2008) PNAS, DPO:10.1073 / pnas.0804453105. [Figure 12-2] See description of Figure 12-1. [Figure 13-1]Figure 13 shows ribbon diagrams of PD-1 binding to commercially available antibodies. (A) Nivo blocks PD-L1 by binding to the FG loop. (B) Pembro blocks by binding to the C and C' strands. See Fessas et al, Seminars in Oncology, 2017. [Figure 13-2] See description of Figure 13-1. [Figure 14] Protein model overlay and amino acid sequence comparison of human and mouse PD-1. The degree of similarity between human and mouse PD-1 is approximately 64%. See Cheng, X et al., (2013). JBC doi.org / 10.1074 / jbc.M112.448126. [Figure 15] Protein model overlay and amino acid sequence comparison of human versus mouse PD-1. Amino acid residue P110 (purple) introduces a kink into the FG loop. In mouse PD-1, this residue directs the BC loop toward the DE loop due to hydrophobic interactions with Arg83 and Trp39. Amino acid residue P63 (blue) in human PD-1 moves the loop away from the C' strand, creating a more flexible loop. Without wishing to be bound by theory, these two structural differences may play a role in the lack of cross-reactivity of Pembro and Nivo with mouse PD-1. See Cheng, X et al., (2013). JBC doi.org / 10.1074 / jbc.M112.448126. [Figure 16] 1 is a graph showing P4-B3 binding to mouse PD-1. P4-B3 has moderate affinity for mouse PD-1, setting it apart from Pembro and Nivo. [Figure 17]
[0023] Figure 1 is a schematic diagram of a staining strategy that can be used to differentially label displayed yeast libraries prior to screening by FACS. See Cherf and Cochran, 2015, Methods Mol Biol. [Figure 18]Figure 1 shows a plot of a FACS analysis. Standard staining sorting is shown, with the blue gate representing positive hits and the green gate representing negatives. The blue gate is shifted upward along the x=y axis. Without wishing to be bound by theory, PD-1 antibody clones bind to PD-1 with higher affinity. [Figure 19] A plot of the FACS analysis of dynamic staining is shown. Collected cells are in the blue gate, and examples of interest are circled in red. The collection gate was kept wide to allow for more samples. [Figure 20] 1 is a graph of the binding curve of P4-B3 mutants. [Figure 21] 1 is a graph of the binding curve of P4-B3 mutants. [Figure 22-1] FIG. 22 is a schematic representation of the P4-B3 (anti-PD1) germline alignment and a diagram of the amino acid residues that were changed in the P4-B3 mutants that were generated. [Figure 22-2] See description of Figure 22-1. [Figure 22-3] See description of Figure 22-1. [Figure 23] Figure 1 shows a graph of the octet binding curves of different P4-B3 mutants. SA sensors were coated with 2.5ug / ml of biotinylated PD-1. [Figure 24] Binding curves for PD-L1 competition assays using PD-1 antibodies (various P4-B3 mutants) are shown. [Figure 25] FIG. 1 is a schematic diagram of the amino acid residues that were changed in the P4-B3 mutants that were generated. [Figure 26-1] Figure 26 is a schematic diagram of the germline alignment of anti-PD1 antibody clones. These candidates were discovered by soluble protein panning (PD1-hFc). [Figure 26-2] See description of Figure 26-1. [Figure 26-3] See description of Figure 26-1. [Figure 26-4] See description of Figure 26-1. [Figure 27]Graphs of octet binding curves are shown. Both PD1 and PDL1 are tagged. As can be seen from sensor H4, the sensor was not saturated before adding PDL1. Further sequencing confirmed that PD1#5 was not an antibody. A4: R&D anti-PD1 (AF1086); B4: PD1 mini3; C4: PD1 mini4; D4: PD1 mini5; E4: PD1 mini7; F4: PD1 mini13; G4: TIG1 (control ab) + PDL1; H4: No antibody + PD1 to see if the sensor was saturated. [Figure 28] Graphs of octet binding curves are shown. As can be seen from sensor H4, both PD1 and PDL1 are tagged. The sensor was not saturated before adding PDL1. PD1 and PDL1 were used at 2.5 μg / ml. Antibodies were used at 2 μg / ml. All samples were diluted in 1xPBST. The novel PD-1 antibodies were used in scFv-Fc format; Nivo and Pembro are commercially available preparations. A6: Nivo; B6: Pembro; C6: PD1#3; D6: PD1#4; E6: PD1#5; F6: PD1#7; G6: PD1#13; H6: TIG1(-). [Figure 29] Octet binding curve graphs are shown. SA sensors were loaded with 2.5µg of expi293-expressed soluble PD1-avi and biotinylated via Avidity's biotinylation kit. PD1#3 exhibited a high off-rate. [Figure 30-1] Figure 30 is a schematic diagram of the germline alignment of the anti-PD1 antibody clone, P4-B7. [Figure 30-2] See description of Figure 30-1. [Figure 31] Figure 1 shows a graph of the P4-B7 minibody binding curve to human and cynomolgus monkey PD-1. Curves were generated using expi293 cells 48 hours after transfection. The human variant was normalized to expression levels via a commercially available antibody, but the cynomolgus monkey variant was not. The cynomolgus monkey variant was not normalized because the commercially available antibody used has not been reported to bind to cynomolgus monkey PD#1. [Figure 32] This graph shows the binding curve for an IgG ELISA using P4-B7. P4-B7 exhibits a kinetic shift to the right that is inappropriate for the reaction to proceed. In the top panel, an ELISA plate was coated with soluble PD1 at 1 μg / ml for 2 hours at 37°C. The plate was then washed and blocked with 2% BSA / PBS for 1 hour at 37°C. The blocking solution was removed, and a 3x serial dilution of antibody, starting at 6 μg / ml, was added to each well (100 μl) in 2% milk-PBST. The plate was then incubated at room temperature with gentle shaking, washed six times with PBS-T, and a secondary anti-human Fc-HRP (1:150kJ, Bethyl) was added. The plate was again incubated at room temperature with gentle shaking for 1 hour, followed by six washes with PBS-T. TMB substrate was added, and the plate was incubated at 30°C for 10 minutes to accelerate the HRP reaction. The signal was then quenched with TMB stop solution and read at 450 nm. The protocol for the data obtained in the bottom graph was the same as that for the data obtained in the top graph, except that plates were coated with 3x serial dilutions of antigen starting at 6ug / ml. Antibody was then added to all wells at a constant concentration of 1ug / ml. [Figure 33] 1 shows a graph of the induction curve from a commercially available PD1-PDL1 bioassay. [Figure 34] A schematic diagram of the Promega PD1-PDL1 bioassay (J1250) is shown. The Promega PD1-PDL1 bioassay (J1250) was performed using wild-type aPD-1 scFv-Fc (P4-B3) and mutant single and combo variants generated from a random mutagenesis yeast library. Nivolumab was used as a benchmark control. [Figure 35]The P4-B3 mutants in the Promega bioassay (scFv-Fc bioassay) are shown. Nivo (filled circle) reached an induction fold of approximately 6, which is similar to our previous experiments. The single mutants HLkin-1 and HL-7 and the combo mutants Mut+2 and Mut+3 showed higher or equal levels of PD-1 / PD-L1 blockade compared to Nivo. This is reflected in the EC50 values, with Mut+2 having an EC50 value approximately half that of Nivo. P4-B3 wild-type showed lower levels of blockade and also had an EC50 value 1.75-fold higher than Nivo. The point mutations identified by our random mutagenesis yeast display library appear to have significant effects on binding and checkpoint blockade capacity. All P4-B3 samples used in this assay were in scFv-Fc format. Only Nivo and F10 were used as full IgG. [Figure 36] Octet binding curves for P4-B3 wild-type / mutant IgG are shown. SA sensors were coated with biotinylated PD-1 and then immersed in various concentrations of anti-PD-1 antibody. The first step after baseline indicates antibody binding, and the second step indicates dissociation. As can be seen in this figure, P4-B3 wild-type has a rapid off-rate, while the mutant and Pembro have much slower off-rates. [Figure 37] Binding curves of P4-B3 single vs. combo mutants to mouse PD-1 (mPD-1) are shown (scFv-Fc format). [Figure 38] Binding curves of P4-B3 single vs. combo mutants with hPD1 are shown (scFv-Fc format unless otherwise stated). [Figure 39] Binding curves of P4-B3 single vs. combo mutants with hPD1 are shown (scFv-Fc format except for pembro / nivo / wild-type IgG1). [Figure 40] FIG. 1 is a schematic diagram of the amino acid residues that were changed in the P4-B3 mutants that were generated. [Figure 41]Schematic diagram of a mixed lymphocyte reaction (MLR) assay. CD4+ T cells express high levels of PD-1 upon activation. DCs express high levels of PD-L1 to improve self-tolerance in the body. T cell activation through MHC mismatch is limited due to PD-1 / PD-L1 blockade. Addition of anti-PD-1 antibodies removes this inhibitory signal, resulting in increased T cell activation (measured by cytokine release). [Figure 42-1] FIG. 42 shows a graph of the MLR assay showing cytokine production, as indicated in the graph title. [Figure 42-2] See description of Figure 42-1. [Figure 43-1] FIG. 43 shows a graph of the MLR assay showing cytokine production, as indicated in the graph title. [Figure 43-2] See description of Figure 43-1. [Figure 44-1] Figure 44 shows a statistical data table of the MLR assay for Pembro versus P4B3mut+3 IgG4. [Figure 44-2] See description of Figure 44-1. [Figure 45-1] Figure 45 shows a statistical data table of the MLR assay for Pembro versus P4B3mut+3 IgG4. [Figure 45-2] See description of Figure 45-1. [Figure 46-1] Figure 46 shows a statistical data table of the MLR assay for Pembro versus P4B3mut+3 IgG4. [Figure 46-2] See description of Figure 46-1. [Figure 47-1] Figure 47 shows a statistical data table of the MLR assay for Pembro versus P4B3mut+3 IgG4. [Figure 47-2] See description of Figure 47-1. DETAILED DESCRIPTION OF THE INVENTION
[0026] Detailed Description of the Invention Abbreviations and Definitions A detailed description of one or more embodiments is provided herein. However, it is understood that the present invention can be embodied in various forms. Therefore, the specific details disclosed herein should not be construed as limiting, but as a basis for the claims and as a representative basis for teaching one skilled in the art how to use the present invention in any suitable manner.
[0027] The singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. The use of the words "a" or "an" when used in conjunction with the word "comprising" in the claims and / or specification can mean "one," but is also consistent with the meaning of "one or more," "at least one," and "one or more."
[0028] Whenever the phrases "for example," "such as," "including," and the like are used herein, unless expressly stated otherwise, it is understood that they are accompanied by the phrase "without limitation." Similarly, "one example," "exemplary," and the like are understood to be non-limiting.
[0029] The term "substantially" permits deviations from the descriptor that do not adversely affect the intended purpose. It is understood that a descriptor is modified by the term "substantially" even if the word "substantially" is not expressly recited.
[0030] The terms "comprising" and "including," as well as "having" and "involving" (and similarly, "comprises," "includes," "has," and "involves"), etc., are used interchangeably and have the same meaning. Specifically, each term is defined consistent with the general U.S. patent law definition of "comprising," and therefore should be interpreted as having the open term meaning "at least the following," and not excluding additional features, limitations, embodiments, etc. Thus, for example, "a process involving steps a, b, and c" means that the process includes at least steps a, b, and c. Whenever the terms "a" and "an" are used, they should be understood to mean "one or more," unless such interpretation is meaningless in the context.
[0031] The term "about" is used herein to mean approximately, roughly, around, or within a range. When the term "about" is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the stated numerical values. In general, the term "about" is used herein to modify a numerical value above and below the stated value by a variance of 20 percent (up and down).
[0032] PD-1 Programmed T-cell death 1 (PD-1) is a transmembrane protein found on the surface of T cells, which, when bound to programmed T-cell death ligand 1 (PD-L1) on tumor cells, suppresses T-cell activity and reduces T-cell-mediated cytotoxicity. Thus, PD-1 and PD-L1 are immune downregulators or immune checkpoint "off switches." Examples of PD-1 inhibitors include, but are not limited to, nivolumab, (Opdivo) (BMS-936558), pembrolizumab (Keytruda), pidilizumab, AMP-224, MEDI0680 (AMP-514), PDR001, MPDL3280A, MEDI4736, BMS-936559, and MSB0010718C.
[0033] The immune system must achieve a balance between effective responses to eliminate pathogens and maintaining tolerance to prevent autoimmune disease. T cells play a central role in maintaining this balance, and their appropriate regulation is primarily mediated by molecules of the B7-CD28 family. Interactions between B7 family members, acting as ligands, and CD28 family members, acting as receptors, provide critical positive signals that not only initiate, amplify, and sustain T cell responses, but also contribute important negative signals that limit, terminate, and / or attenuate T cell responses when appropriate. PD-1 is a member of the CD28 family.
[0034] Binding between PD-L1 and PD-1 has profound effects on regulating T cell responses. Specifically, PD-L1 / PD-1 interaction inhibits T cell proliferation and the production of effector cytokines, such as IL-2 and IFN-γ, which mediate T cell activity and immune responses. This negative regulatory function is important for preventing T cell-mediated autoimmunity and immunopathology. However, the PD-1 / PD-L1 axis has also been shown to play a role in T cell exhaustion, thereby inhibiting T cell responses to host damage. Prolonged or chronic antigen stimulation of T cells can induce a negative immunological feedback mechanism that inhibits antigen-specific responses and leads to immune evasion of pathogens. T cell exhaustion can also lead to the progressive physical loss of antigen-specific T cells themselves. T cell expression of PD-1 is upregulated during chronic antigen stimulation, and binding to PD-L1 results in blockade of effector function in both CD4+ (T helper cells) and CD8+ (cytotoxic T lymphocytes or CTL) T cells, thus implicating PD-1 / PD-L1 interaction in the induction of T cell exhaustion.
[0035] Recently, studies have demonstrated that several chronic viral infections and cancers have developed immune evasion strategies that specifically exploit the PD-1 / PD-L1 axis by inducing PD-1 / PD-L1-mediated T cell exhaustion. Many human tumor cells and tumor-associated antigen-presenting cells express high levels of PD-L1, suggesting that tumors induce T cell exhaustion to evade antitumor immune responses. For example, during chronic HIV infection, HIV-specific CD8+ T cells are functionally impaired, exhibiting a reduced ability to produce cytokines and effector molecules and exhibiting reduced proliferative capacity. Studies have shown that PD-1 is highly expressed on HIV-specific CD8+ T cells in HIV-infected individuals, suggesting that blocking the PD-1 / PD-L1 pathway may have therapeutic potential for the treatment of HIV infection and AIDS patients. Collectively, agents that block the PD-1 / PD-L1 pathway may provide novel therapeutic approaches for various cancers, HIV infection, and / or other diseases and conditions associated with T cell exhaustion. Therefore, there is an urgent need for agents that can block or prevent PD-1 / PD-L1 interaction.
[0036] Overexpression of PD-L1 has been detected in various cancers. For example, overexpression of PD-L1 in breast cancer is associated with high-risk prognosis. PD-L1 is upregulated in renal cell carcinoma, and increased PD-1 expression has also been found on tumor-infiltrating leukocytes. Anti-PD-L1 and anti-PD-1 antibodies have demonstrated some clinical efficacy in phase I trials for renal cell carcinoma. Therapeutic agents capable of binding to PD-1 or PD-L1 may be useful for specifically targeting tumor cells. Agents capable of blocking the PD-1 / PD-L1 interaction may be even more useful in treating cancers that induce T cell exhaustion to evade anti-tumor T cell activity. The use of such agents alone or in combination with other anti-cancer therapeutics can effectively target tumor cells that overexpress PD-L1, increase anti-tumor T cell activity, and thereby enhance the immune response against targeted tumor cells.
[0037] PD-1 and PD-L1 can also be upregulated by T cells after chronic antigen stimulation, for example, due to chronic infection. During chronic HIV infection, HIV-specific CD8+ T cells are functionally impaired, exhibiting reduced ability to produce cytokines and effector molecules and reduced proliferation capacity. PD-1 is highly expressed on HIV-specific CD8+ T cells in HIV-infected individuals. Therefore, blocking this pathway can enhance the ability of HIV-specific T cells to proliferate and produce cytokines in response to stimulation with HIV peptides, thereby enhancing the immune response against HIV. Other chronic infections, such as chronic viral, bacterial, or parasitic infections, can also benefit from the use of PD-1 / PD-L1 blocking agents.
[0038] An embodiment of the present invention provides an isolated monoclonal antibody specific for PD-1. As used herein with respect to cells, nucleic acids (e.g., DNA or RNA), the term "isolated" refers to a molecule separated from other DNA or RNA, respectively, present in the natural source of the macromolecule. The term "isolated" can also refer to a nucleic acid or peptide that is substantially free of cellular material, viral material, or culture medium when produced by recombinant DNA technology, or chemical precursors or other chemicals when chemically synthesized. For example, an "isolated nucleic acid" can include a nucleic acid fragment that is not naturally occurring as a fragment and would not be found in its natural state. "Isolated" can also refer to a cell or polypeptide that has been isolated from other cellular proteins or tissues. An isolated polypeptide can include both purified and recombinant polypeptides. The isolated antibody was identified using a 27 billion human single-chain antibody (scFv) phage display library via paramagnetic proteoliposomes, using PD-1 as the library selection target. These antibodies represent a novel class of monoclonal antibodies against PD-1 that can compete with PD-L1, pembrolizumab, and nivolumab binding. Furthermore, the monoclonal PD-1 antibodies discussed herein cross-react with cynomolgus monkey (Macaca fascicularis) PD-1 protein. The monoclonal PD-1 antibodies discussed herein can also be used in the construction of multispecific antibodies or as payloads for CAR-T cells.
[0039] Ten unique recombinant monoclonal PD-1 antibodies are described herein. These include P4-B3, P4-B7, PD1#2, PD1#3, PD1#13, P4-B3-HLkin1, P4-B3-HL-7, P4-B3-HL-14, P4-B3 HLkin-1 HL-7 mut2, and P4-B3 HLkin-1 HL-7 HL-14 mut3. The term "recombinant," with respect to a polypeptide (such as an antibody) or polynucleotide, refers to a form of a polypeptide or polynucleotide that is not naturally occurring, a non-limiting example of which can be made by combining polynucleotides or polypeptides that do not normally occur together.
[0040] Nucleic acid and amino acid sequences of monoclonal PD-1 antibodies are provided below, along with exemplary wild-type IgG constant regions (see Table 2) useful in combination with the VH and VL sequences provided herein. TIFF2025121996000002.tif18154
[0041] (Table 1A) Ab P4-B3 variable region nucleic acid sequence TIFF2025121996000003.tif77152
[0042] Table 1B: Ab P4-B3 variable region amino acid sequence TIFF2025121996000004.tif44152
[0043] Table 2A. Ab P4-B3 constant region nucleic acid sequence - wild-type IgG monomer TIFF2025121996000005.tif153152
[0044] Table 2B. Ab P4-B3 constant region amino acid sequence—wild-type IgG monomer TIFF2025121996000006.tif86152
[0045] (Table 3A) Ab P4-B7 variable region nucleic acid sequence TIFF2025121996000007.tif77152
[0046] Table 3B. Ab P4-B7 variable region amino acid sequences TIFF2025121996000008.tif44152
[0047] Table 4A: PD1#2 variable region nucleic acid sequences TIFF2025121996000009.tif77152
[0048] Table 4B: Ab PD1#2 variable region amino acid sequence TIFF2025121996000010.tif44152
[0049] Table 5A: PD1#3 variable region nucleic acid sequences TIFF2025121996000011.tif77152
[0050] Table 5B: Ab PD1#3 variable region amino acid sequence TIFF2025121996000012.tif43152
[0051] Table 6A: Ab PD1#13 variable region nucleic acid sequences TIFF2025121996000013.tif73152
[0052] Table 6B: Ab PD1#13 variable region amino acid sequence TIFF2025121996000014.tif39152
[0053] TIFF2025121996000015.tif11156
[0054] Table 7A: Ab P4-B3-HLkin1 variable region nucleic acid sequences TIFF2025121996000016.tif77152
[0055] Table 7B: Ab HLKin1 variable region amino acid sequences TIFF2025121996000017.tif43152
[0056] (Table 8A) Ab P4-B3-HL-7 variable region nucleic acid sequence TIFF2025121996000018.tif81152
[0057] Table 8B: Ab HL-7 variable region amino acid sequences TIFF2025121996000019.tif43152
[0058] (Table 9A) Ab P4-B3-HL-14 variable region nucleic acid sequence TIFF2025121996000020.tif77152
[0059] Table 9B: Ab HL-14 variable region amino acid sequences TIFF2025121996000021.tif48152
[0060] Table 10A: Ab HLkin-1 HL-7 mut2 variable region nucleic acid sequences TIFF2025121996000022.tif77152
[0061] Table 10B: Ab HLkin-1 HL-7 mut2 variable region amino acid sequence TIFF2025121996000023.tif44152
[0062] Table 11A: Ab HLkin-1 HL-7 HL-14 mut3 variable region nucleic acid sequences TIFF2025121996000024.tif77152
[0063] Table 11B: Ab HLkin-1 HL-7 HL-14 mut3 variable region amino acid sequences TIFF2025121996000025.tif43152
[0064] The amino acid sequences of the heavy and light chain complementarity determining regions of the PD-1 antibody are shown in Tables 12A-B below.
[0065] Table 12A. Heavy chain (V) of PD-1 antibody H ) complementarity-determining regions (CDRs) TIFF2025121996000026.tif114134
[0066] Table 12B. Light chain (V) of PD-1 antibody L ) complementarity-determining regions (CDRs) TIFF2025121996000027.tif114134
[0067] The amino acid sequences of the heavy and light chain framework regions of the PD-1 antibody are shown in Tables 13A-B below.
[0068] Table 13A. PD-1 antibody heavy chain (V H ) Framework region (FR) TIFF2025121996000028.tif202155
[0069] Table 13B. Light chain (V) of PD-1 antibody L ) Framework region (FR) TIFF2025121996000029.tif202155
[0070] The PD-1 antibodies described herein bind to PD-1. In one embodiment, the PD-1 antibodies have high affinity and specificity for PD-1. Some embodiments also feature antibodies that share a certain percentage of identity or similarity with the amino acid or nucleotide sequence of the anti-PD-1 antibodies described herein. For example, "homology" or "identity" or "similarity" refers to the sequence similarity between two peptides or two nucleic acid molecules. Homology can be determined by comparing positions in each sequence that can be aligned for comparison. If a position in the compared sequences is occupied by the same base or amino acid, the molecules are homologous at that position. The degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. For example, an antibody can have 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more amino acid sequence identity when compared to a specific region or the full length of any one of the anti-PD-1 antibodies described herein. For example, an antibody can have 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more nucleic acid identity when compared to a specific region or the full length of any one of the anti-PD-1 antibodies described herein. Sequence identity or similarity for the nucleic acids and proteins of the present invention can be determined by sequence comparison and / or alignment using methods known in the art, for example, as described in Ausubel et al., eds. (2007) Current Protocols in Molecular Biology, using software programs known in the art. For example, sequence comparison algorithms (i.e., BLAST or BLAST 2.0), manual alignment, or visual inspection can be used to determine percent sequence identity or similarity for the nucleic acids and proteins of the present invention.
[0071] As used herein, "polypeptide" can encompass a single "polypeptide" as well as multiple "polypeptides" and refers to a molecule composed of monomers (amino acids) linearly linked by amide bonds (also known as peptide bonds). The term "polypeptide" refers to any chain of two or more amino acids and does not refer to a specific length of the product. Thus, peptide, dipeptide, tripeptide, oligopeptide, "protein," "amino acid chain," or any other term used to refer to a chain of two or more amino acids can refer to a "polypeptide" herein, and the term "polypeptide" can be used in place of or interchangeably with any of these terms. "Polypeptide" can also refer to the product of post-expression modifications of a polypeptide, including, but not limited to, glycosylation, acetylation, phosphorylation, amidation, derivatization with known protecting / blocking groups, proteolytic cleavage, or modification with non-naturally occurring amino acids. A polypeptide can be derived from a natural biological source or produced by recombinant technology, but is not necessarily translated from a designated nucleic acid sequence. It can be produced in any manner, including chemical synthesis. With respect to amino acid sequences, those skilled in the art will readily recognize that individual substitutions, deletions, or additions to nucleic acid, peptide, polypeptide, or protein sequences that modify, add, delete, or substitute a single amino acid or a small percentage of amino acids in the encoded sequence are collectively referred to herein as "conservatively modified variants." In some embodiments, the modification results in the replacement of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. Such conservatively modified variants of the anti-PD-1 antibodies disclosed herein may exhibit increased cross-reactivity to PD-1 compared to unmodified PD-1 antibodies.
[0072] For example, a "conservative amino acid substitution" is one in which an amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues with similar side chains have been defined in the art and include basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, a non-essential amino acid residue in an immunoglobulin polypeptide is replaced with another amino acid residue from the same side chain family. In another embodiment, the string of amino acids can be replaced with a structurally similar string that differs in the order and / or composition of the side chain family members.
[0073] antibody As used herein, "antibody" or "antigen-binding polypeptide" can refer to a polypeptide or polypeptide complex that specifically recognizes and binds to an antigen. An antibody can be a whole antibody or any antigen-binding fragment or single chain thereof. For example, "antibody" can include any protein- or peptide-containing molecule containing at least a portion of an immunoglobulin molecule that has the biological activity of binding to an antigen. Non-limiting examples include the complementarity-determining regions (CDRs) of a heavy or light chain or its ligand-binding portion, a heavy or light chain variable region, a heavy or light chain constant region, a framework (FR) region or any portion thereof, or at least a portion of a binding protein. As used herein, the term "antibody" can refer to immunoglobulin molecules and immunologically active portions of immunoglobulin (Ig) molecules, i.e., molecules containing an antigen-binding site that specifically binds (immunoreacts with) an antigen. "Specifically binds" or "immunoreacts" refers to an antibody that reacts with one or more antigenic determinants of a desired antigen and does not react with other polypeptides.
[0074] As used herein, the term "antibody fragment" or "antigen-binding fragment" refers to an antibody fragment (ab ' )2 , F (ab)2 , F ab ', F abAntibody fragments are portions of antibodies, such as Fvs, scFvs, etc. Regardless of structure, antibody fragments bind to the same antigen recognized by the intact antibody. The term "antibody fragment" includes aptamers (e.g., spiegelmers), minibodies, and diabodies. The term "antibody fragment" also includes any synthetic or genetically engineered protein that acts like an antibody by binding to a specific antigen to form a complex. Antibodies, antigen-binding polypeptides, variants, or derivatives described herein include, but are not limited to, polyclonal, monoclonal, multispecific, human, humanized, or chimeric antibodies, single-chain antibodies, epitope-binding fragments such as Fab, Fab', and F(ab'), Fd, Fvs, single-chain Fvs (scFvs), single-chain antibodies, dAbs (domain antibodies), minibodies, disulfide-linked Fvs (sdFvs), fragments containing either the VL or VH domain, Fab expression libraries, and fragments produced by anti-idiotypic (anti-Id) antibodies.
[0075] A "single-chain variable fragment" or "scFv" is a fragment of an immunoglobulin heavy chain (V H ) and light chain (V L (ScFv) refers to a fusion protein of the variable regions of a single-chain Fv ("scFv") polypeptide molecule, a covalently linked VH:VL heterodimer, which can be expressed from a gene fusion comprising a VH-encoding gene and a VL-encoding gene joined by a peptide-encoding linker. (See Huston et al. (1988) Proc Nat Acad Sci USA 85(16):5879-5883.) In some embodiments, the regions are joined by a short linker peptide of 10 to about 25 amino acids. The linker can be rich in glycine for flexibility and serine or threonine for solubility, and the V H N-terminus of V LThe C-terminus of the scFv fragment may be linked to the C-terminus of the antibody V region of the scFv fragment, or vice versa. This protein retains the specificity of the original immunoglobulin despite the removal of the constant region and the introduction of the linker. Many methods have been described for identifying chemical structures for converting naturally aggregated but chemically separated light and heavy polypeptide chains from antibody V regions into scFv molecules that fold into a three-dimensional structure substantially similar to that of an antigen-binding site. See, e.g., U.S. Patent Nos. 5,091,513; 5,892,019; 5,132,405; and 4,946,778, each of which is incorporated by reference in its entirety.
[0076] To provide a large source of rearranged antibody genes against many target molecules, very large naive human scFv libraries have been and can be generated. To isolate disease-specific antibodies, smaller libraries can be constructed from individuals with infectious diseases. (See Barbas et al., Proc. Natl. Acad. Sci. USA 89:9339-43 (1992); Zebedee et al., Proc. Natl. Acad. Sci. USA 89:3 175-79 (1992)).
[0077] Antibody molecules obtained from humans belong to one of five classes: IgG, IgM, IgA, IgE, and IgD, which differ from one another in the nature of the heavy chains present in the molecule. Those skilled in the art will understand that heavy chains are classified as gamma, mu, alpha, delta, or epsilon (γ, μ, α, δ, ε), with several subclasses (e.g., γ1-γ4) within each. Certain classes also have subclasses, such as IgG1, IgG2, IgG3, and IgG4. Immunoglobulin subclasses (isotypes), such as IgG1, IgG2, IgG3, IgG4, and IgG5, are well characterized and are known to confer functional specialization. Regarding IgG, a standard immunoglobulin molecule contains two identical light chain polypeptides with a molecular weight of approximately 23,000 daltons and two identical heavy chain polypeptides with a molecular weight of 53,000-70,000. The four chains are typically joined by disulfide bonds in a "Y" configuration, with the light chains surrounding the heavy chains, which begin at the mouth of the "Y" and continue through the variable region. The immunoglobulin or antibody molecules described herein can be of any type (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) or subclass of immunoglobulin molecule.
[0078] Light chains are classified as either kappa or lambda (κ, λ). Each heavy chain class can be associated with either a kappa or lambda light chain. Generally, light and heavy chains are covalently linked to each other, and when immunoglobulins are produced by either hybridomas, B cells, or genetically engineered host cells, the "tail" portions of the two heavy chains are linked to each other by covalent disulfide bonds or non-covalent bonds. In the heavy chain, the amino acid sequence ranges from the N-terminus at the forked ends of the Y configuration to the C-terminus at the base of each chain.
[0079] Both light and heavy chains are divided into regions of structural and functional homology. The terms "constant" and "variable" are used functionally. The variable domains of both the light (VL) and heavy (VH) chains determine antigen recognition and specificity. Conversely, the constant domains of the light (CL) and heavy (VH) chains (CH1, CH2, or CH3) confer important biological properties, such as secretion, transplacental mobility, Fc receptor binding, and complement binding. The term "antigen-binding site" or "binding portion" can refer to the portion of an immunoglobulin molecule involved in antigen binding. The antigen-binding site is formed by amino acid residues in the N-terminal variable (V) regions of the heavy (H) and light (L) chains. Three highly divergent stretches within the V regions of the heavy and light chains, called "hypervariable regions," are interspersed with more conserved adjacent stretches known as "framework regions" or "FRs." Thus, the term "FR" can refer to the amino acid sequences naturally found between and adjacent to the hypervariable regions of immunoglobulins. In an antibody molecule, the three hypervariable regions of the light chain and the three hypervariable regions of the heavy chain are arranged relative to each other in three-dimensional space to form an antigen-binding surface. The antigen-binding surface is complementary to the three-dimensional surface of a bound antigen, and the three hypervariable regions of each of the heavy and light chains are referred to as "complementarity-determining regions," or "CDRs." The VH and VL regions containing the CDRs and the framework regions (FRs) of the PD-1 antibody are shown in Tables 1A-15B.
[0080] The six CDRs present in each antigen-binding domain are short, noncontiguous sequences of amino acids specifically arranged to form the antigen-binding domain as the antibody assumes its three-dimensional configuration in an aqueous environment. The remaining amino acids in the antigen-binding domain, the FR regions, show little inter-molecular variability. The framework regions primarily adopt a beta-sheet structure, while the CDRs form loops that connect to and, in some cases, form part of the beta-sheet structure. The framework regions act as a scaffold that orients the CDRs through interchain non-covalent interactions. The antigen-binding domain formed by the arranged CDRs provides a surface complementary to the epitope on the immunoreactive antigen, facilitating non-covalent binding of the antibody to its cognate epitope. The amino acids comprising the CDRs and framework regions, respectively, can be readily identified for heavy or light chain variable regions by one of ordinary skill in the art as they have been previously defined (see "Sequences of Proteins of Immunological Interest," Kabat, E. et al., USDapartment of Health and Human Services, (1983); and Chothia and Lesk, J. Mol. Biol., 196:901-917 (1987)).
[0081] Where there is more than one definition of a term used and / or accepted in the art, the definition of the term used herein is intended to encompass all such meanings unless expressly stated otherwise. A specific example is the use of the term "complementarity-determining region" ("CDR") to describe the non-contiguous antigen-binding sites found within the variable regions of both heavy and light chain polypeptides. This particular region is described by Kabat et al., US Department of Health and Human Services, "Sequences of Proteins of Immunological Interest" (1983) and Chothia et al., Mol. Biol. 196:901-917 (1987), which are incorporated herein by reference in their entireties. The CDR definitions by Kabat and Chothia include overlapping or subsets of amino acid residues when compared with each other. Nevertheless, application of either definition to refer to the CDR of an antibody or variant thereof is intended to be within the scope of the term as defined and used herein. The appropriate amino acid residues encompassing the CDRs defined by each of the above cited references are set forth in the following table for comparison: The exact residue numbers which encompass a particular CDR will vary depending on the sequence and size of the CDR. One skilled in the art can routinely determine which residues comprise a particular CDR, given the variable region amino acid sequence of an antibody. TIFF2025121996000030.tif48128
[0082] Kabat et al. defined a numbering system for variable domain sequences that is applicable to any antibody. One of skill in the art can unambiguously assign this "Kabat numbering" system to any variable domain sequence without relying on any experimental data other than the sequence itself. As used herein, "Kabat numbering" refers to the numbering system set forth by Kabat et al., U.S. Department of Health and Human Services, "Sequence of Proteins of Immunological Interest" (1983).
[0083] In addition to the above table, the Kabat numbering system describes the CDR regions as follows: CDR-H1 begins at about amino acid 31 (i.e., approximately 9 residues after the first cysteine residue), includes approximately 5-7 amino acids, and ends at the next tryptophan residue. CDR-H2 begins at the 15th residue after the end of CDR-H1, includes approximately 16-19 amino acids, and ends at the next arginine or lysine residue. CDR-H3 begins at about amino acid 33 after the end of CDR-H2, includes 3-25 amino acids, and ends with the sequence WGXG (where X is any amino acid). CDR-L1 begins at about residue 24 (i.e., following the cysteine residue), includes approximately 10-17 residues, and ends at the next tryptophan residue. CDR-L2 begins at about residue 16 after the end of CDR-L1 and includes approximately 7 residues. CDR-L3 begins at approximately the 33rd residue after the end of CDR-L2 (i.e., following the cysteine residue), includes approximately 7-11 residues, and ends with the sequence F or WGXG (where X is any amino acid).
[0084] As used herein, the term "epitope" can include any protein determinant capable of specific binding to an immunoglobulin, scFv, or T-cell receptor. The variable region enables an antibody to selectively recognize and specifically bind to an epitope on an antigen. For example, the VL and VH domains of an antibody, or a subset of complementarity-determining regions (CDRs), combine to form the variable regions that define a three-dimensional antigen-binding site. This quaternary antibody structure forms the antigen-binding site present at the end of each arm of the Y. Epitope determinants typically consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and typically have specific three-dimensional structural characteristics as well as specific charge characteristics. For example, antibodies can be raised against N- or C-terminal peptides of a polypeptide. More specifically, the antigen-binding site is defined by three CDRs (i.e., CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3) on each of the VH and VL chains. In one embodiment, the antibody may be directed to PD-1 comprising the amino acid sequence of SEQ ID NO:XX (Genbank accession number NP_005009; having a length of 288 amino acid residues). TIFF2025121996000031.tif18137
[0085] As used herein, the terms "immunological binding" and "immunological binding properties" can refer to the type of non-covalent interactions that occur between an immunoglobulin molecule and an antigen for which the immunoglobulin is specific. The strength or affinity of an immunological binding interaction is determined by the equilibrium binding constant (K D ) and K D A smaller K represents a greater affinity. The immunological binding properties of a selected polypeptide can be quantified using methods well known in the art. One such method involves measuring the rates of formation and dissociation of the antigen-binding site / antigen complex; these rates depend on the concentrations of the complex partners, the affinity of the interaction, and geometric parameters that affect the rates in both directions equally. Thus, the "on-rate constant" (K on) and "off rate constant" (K off Both K and K can be determined by calculation of the concentration and the actual rates of association and dissociation. (See Nature 361:186-87 (1993)). off / K on The ratio of α to β allows for the cancellation of all parameters not related to affinity, yielding the equilibrium binding constant K D (See generally Davies et al. (1990) Annual Rev Biochem 59:439-473.) The antibodies of the present invention have an equilibrium binding constant (K D ) is ≦1 μM, ≦10 μM, ≦10 nM, ≦10 pM, or ≦100 pM to about 1 pM, as measured by a kinetic assay such as a radioligand binding assay, or a similar assay known to those skilled in the art, such as BIAcore or Octet (BLI). For example, in some embodiments, K D is about 1E-12M to about 1E-11M K D In some embodiments, K D is about 1E-11M to about 1E-10M K D In some embodiments, K D is about 1E-10M to about 1E-9M K D In some embodiments, K D is about 1E-9M to about 1E-8M K D In some embodiments, K D is about 1E-8M to about 1E-7M K D In some embodiments, K D is about 1E-7M to about 1E-6M K D For example, in some embodiments, K D is about 1E-12M, but in other embodiments, K D is about 1E-11M. In some embodiments, K D is about 1E-10M, but in other embodiments, K D is about 1E-9M. In some embodiments, K D is about 1E-8M, but in other embodiments, K Dis about 1E-7M. In some embodiments, K D is about 1E-6M, but in other embodiments, K D is about 1E-5M. In some embodiments, for example, K D is about 3E-11M, but in other embodiments, K D is about 3E-12M. In some embodiments, K D is approximately 6E-11M. "Specifically binds" or "having specificity" can refer to an antibody that binds to an epitope via its antigen-binding domain, and the binding involves a degree of complementarity between the antigen-binding domain and the epitope. For example, an antibody is said to "specifically bind" if it binds to an epitope via its antigen-binding domain more readily than it would bind to a random, unrelated epitope.
[0086] For example, PD-1 antibodies can be monovalent or bivalent, and include single or double chains. Functionally, the binding affinity of PD-1 antibodies can be greater than or equal to 10 -5 M~10 -12 For example, the binding affinity of PD-1 antibodies is in the range of 10 -6 M~10 -12 M, 10 -7 M~10 -12 M, 10 -8 M~10 -12 M, 10 -9 M~10 -12 M, 10 -5 M~10 -11 M, 10 -6 M~10 -11 M, 10 -7 M~10 -11 M, 10 -8 M~10 -11 M, 10 -9 M~10 -11 M, 10 -10 M~10 -11 M, 10 -5 M~10 -10 M, 10 -6 M~10 -10 M, 10 -7 M~10 -10 M, 10 -8 M~10 -10M, 10 -9 M~10 -10 M, 10 -5 M~10 -9 M, 10 -6 M~10 -9 M, 10 -7 M~10 -9 M, 10 -8 M~10 -9 M, 10 -5 M~10 -8 M, 10 -6 M~10 -8 M, 10 -7 M~10 -8 M, 10 -5 M~10 -7 M, 10 -6 M~10 -7 M, 10 -5 M~10 -6 It's M.
[0087] The PD-1 proteins of the present invention, or derivatives, fragments, analogs, homologs, or orthologs thereof, can be used as immunogens in the generation of antibodies that immunospecifically bind to these protein components, e.g., amino acid residues comprising SEQ ID NO: X. The PD-1 proteins, or derivatives, fragments, analogs, homologs, or orthologs thereof, bound to proteoliposomes can be used as immunogens in the generation of antibodies that immunospecifically couple to these protein components.
[0088] Those skilled in the art will recognize that it is possible, without undue experimentation, to determine whether a human monoclonal antibody has the same specificity as a human monoclonal antibody of the invention by determining whether the former interferes with the latter's binding to PD-1. If the human monoclonal antibody being tested competes with the human monoclonal antibody of the invention, as indicated, for example, by reduced binding by the human monoclonal antibody of the invention, then the two monoclonal antibodies likely bind to the same epitope or closely related epitopes.
[0089] Another method for determining whether a human monoclonal antibody has the specificity of a human monoclonal antibody of the present invention is to preincubate the human monoclonal antibody of the present invention with the PD-1 protein with which it is normally reactive, then add the human monoclonal antibody to be tested to determine whether the human monoclonal antibody to be tested is inhibited in its ability to bind to PD-1. If the human monoclonal antibody to be tested is inhibited, it likely has the same, or a functionally equivalent, epitope specificity as the monoclonal antibody of the present invention. Screening of the human monoclonal antibodies of the present invention can also be performed by utilizing PD-1 to determine whether the test monoclonal antibody can neutralize PD-1.
[0090] Various procedures known in the art can be used for the production of polyclonal or monoclonal antibodies to a protein of the invention, or to derivatives, fragments, analogs, homologs, or orthologs thereof (see, e.g., Antibodies: A Laboratory Manual, Harlow E, and Lane D, 1988, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, incorporated herein by reference).
[0091] Antibodies can be purified by well-known techniques, such as affinity chromatography using protein A or protein G, which primarily provides the IgG fraction of immune serum. Subsequently, or alternatively, the specific antigen or epitope targeted by the desired immunoglobulin can be immobilized on a column, and the immune-specific antibody can be purified by immunoaffinity chromatography. Immunoglobulin purification is discussed, for example, by D. Wilkinson (The Scientist, published by The Scientist, Inc., Philadelphia, PA, Vol. 14, No. 8 (April 17, 2000), pp. 25-28).
[0092] As used herein, the term "monoclonal antibody" or "mAb" or "Mab" or "monoclonal antibody composition" can refer to a population of antibody molecules that contain only one molecular species of antibody molecule, consisting of a unique light chain gene product and a unique heavy chain gene product. In particular, the complementarity-determining regions (CDRs) of a monoclonal antibody are identical in all molecules of the population. MAbs contain an antigen-binding site capable of immunoreacting with a particular epitope of an antigen characterized by a unique binding affinity for it.
[0093] Monoclonal antibodies can be prepared using hybridoma methods, such as those described by Kohler and Milstein, Nature, 256:495 (1975). In the hybridoma method, a mouse, hamster, or other suitable host animal is typically immunized with an immunizing agent to elicit lymphocytes that produce, or are capable of producing, antibodies that specifically bind to the immunizing agent. Alternatively, lymphocytes can be immunized in vitro.
[0094] The immunizing agent can contain a protein antigen, a fragment thereof, or a fusion protein thereof. For example, if cells of human origin are desired, peripheral blood lymphocytes can be used, or if non-human mammalian sources are desired, spleen cells or lymph node cells can be used. The lymphocytes are then fused with an immortalized cell line using a suitable fusing agent, such as polyethylene glycol, to form hybridoma cells (see Goding, Monoclonal Antibodies: Principles and Practice, Academic Press, (1986) pp. 59-103). The immortalized cell line can be a transformed mammalian cell, particularly a myeloma cell of rodent, bovine, or human origin. For example, a rat or mouse myeloma cell line can be used. The hybridoma cells can be cultured in a suitable culture medium containing one or more substances that inhibit the growth or survival of unfused immortalized cells. For example, if the parent cells lack the enzyme hypoxanthine guanine phosphoribosyltransferase (HGPRT or HPRT), the culture medium for the hybridoma typically contains hypoxanthine, aminopterin, and thymidine ("HAT medium"), which substances prevent the growth of HGPRT-deficient cells.
[0095] Useful immortalized cell lines are those that fuse efficiently, support stable high-level expression of antibody by the selected antibody-producing cells, and are sensitive to a medium such as HAT medium. For example, immortalized cell lines may be mouse myeloma lines, which can be obtained from, for example, the Salk Institute Cell Distribution Center (San Diego, California) and the American Type Culture Collection (Manassas, Virginia). Human myeloma and mouse-human heteromyeloma cell lines have also been described for the production of human monoclonal antibodies. (See Kozbor, J. Immunol., 133:3001 (1984); Brodeur et al., Monoclonal Antibody Production Techniques and Applications, Marcel Dekker, Inc., New York, (1987) pp. 51-63.)
[0096] The culture medium in which hybridoma cells are cultured can then be assayed for the presence of monoclonal antibodies against the antigen.For example, the binding specificity of the monoclonal antibodies produced by hybridoma cells can be determined by immunoprecipitation or by in vitro binding assays such as radioimmunoassay (RIA) or enzyme-linked immunosorbent assay (ELISA).Such techniques and assays are known in the art.The binding affinity of monoclonal antibodies can be determined, for example, by the Scatchard analysis of Munson and Pollard, Anal.Biochem.,107:220(1980).In addition, in the therapeutic use of monoclonal antibodies, it is important to identify antibodies that have high specificity and high binding affinity for target antigens.
[0097] After the desired hybridoma cells are identified, the clones can be subcloned by limiting dilution procedures and grown by standard methods. (See Goding, Monoclonal Antibodies: Principles and Practice, Academic Press, (1986) pp. 59-103.) Suitable culture media for this purpose include, for example, Dulbecco's modified Eagle's medium and RPMI-1640 medium. Alternatively, the hybridoma cells can be grown in vivo as ascites in a mammal.
[0098] The monoclonal antibodies secreted by the subclones can be isolated or purified from the culture medium or ascites fluid by conventional immunoglobulin purification procedures such as, for example, protein A-Sepharose, hydroxylapatite chromatography, gel electrophoresis, dialysis, or affinity chromatography.
[0099] Monoclonal antibodies can also be produced by recombinant DNA methods, such as those described in U.S. Patent No. 4,816,567 (incorporated herein by reference in its entirety). DNA encoding the monoclonal antibodies of the present invention can be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes capable of specifically binding to genes encoding the heavy and light chains of mouse antibodies). The hybridoma cells of the present invention serve as a source of such DNA. Once isolated, the DNA can be placed into an expression vector and then transfected into host cells such as monkey COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not produce immunoglobulin protein, to obtain the synthesis of the monoclonal antibody in the recombinant host cells. The DNA can also be modified, for example, by substituting the coding sequence for human heavy and light chain constant domains for the homologous murine sequences (see U.S. Pat. No. 4,816,567; Morrison, Nature 368, 812-13 (1994)), or by covalently linking all or part of the coding sequence for a non-immunoglobulin polypeptide to the immunoglobulin coding sequence. Such a non-immunoglobulin polypeptide can be substituted for the constant domains of an antibody of the invention, or for the variable domains of one antigen-binding site of an antibody of the invention to create a chimeric bivalent antibody.
[0100] A fully human antibody is an antibody molecule in which the entire sequences of both the light and heavy chains, including, for example, the CDRs, originate from human genes. Such antibodies are referred to as "human antibodies" or "fully human antibodies." A "humanized antibody" can be an antibody derived from a non-human species in which the light and heavy chain protein sequences have been modified to increase similarity with antibody variants produced in humans. A humanized antibody is an antibody molecule derived from a non-human species antibody that binds to a desired antigen, having one or more complementarity-determining regions (CDRs) from the non-human species and framework regions from a human immunoglobulin molecule. Often, framework residues in the human framework regions are substituted with corresponding residues from the CDR donor antibody to alter (e.g., improve) antigen binding. These framework substitutions are identified by methods well known in the art, such as modeling the interactions between CDRs and framework residues to identify framework residues important for antigen binding and sequence comparison to identify unusual framework residues at specific positions. (See, e.g., Queen et al., U.S. Pat. No. 5,585,089; Riechmann et al., Nature 332:323 (1988), which are incorporated by reference in their entireties.) For example, the non-human portions of the antibody (light chain, CDRs of the light chain and / or heavy chain) can bind to the target antigen. Humanized monoclonal antibodies are sometimes referred to herein as "human monoclonal antibodies."
[0101] Antibodies can be humanized using various techniques known in the art, such as, for example, CDR grafting (EP 239,400; PCT Publication WO 91 / 09967; U.S. Patent Nos. 5,225,539; 5,530,101; and 5,585,089), veneering or resurfacing (EP 592,106; EP 519,596; Padlan, Molecular Immunology 28(4 / 5):489-498 (1991); Studnicka et al., Protein Engineering 7(6):805-814 (1994); Roguska et al., Proc. Natl. Sci. USA 91:969-973 (1994)), and chain shuffling (U.S. Patent No. 5,565,332, incorporated by reference in its entirety). "Humanization" (also called reshaping or CDR grafting) is a well-established technique understood by those skilled in the art to reduce the immunogenicity of monoclonal antibodies (mAbs) from xenogeneic sources (generally rodents) and improve activation of the human immune system (see, e.g., Hou S, Li B, Wang L, Qian W, Zhang D, Hong X, Wang H, Guo Y (July 2008). "Humanization of an anti-CD34 monoclonal antibody by complementarity-determining region grafting based on computer-assisted molecular modeling". J. Biochem. 144(1):115-20).
[0102] Human monoclonal antibodies (e.g., fully human antibodies and humanized antibodies) can be prepared by using trioma technology; human B-cell hybridoma technology (see Kozbor, et al., 1983 Immunol Today 4:72); and EBV hybridoma technology to produce human monoclonal antibodies (see Cole, et al., 1985 "MONOCLONAL ANTIBODIES AND CANCER THERAPY", Alan R. Liss, Inc., pp. 77-96). Human monoclonal antibodies can be used and can be produced using human hybridomas (see Cote, et al., 1983. Proc Natl Acad Sci USA 80:2026-2030) or by transforming human B cells in vitro with Epstein-Barr virus (see Cole, et al., 1985 "MONOCLONAL ANTIBODIES AND CANCER THERAPY", Alan R. Liss, Inc., pp. 77-96).
[0103] Additionally, antibodies can also be produced using other techniques, including phage display libraries. (See Hoogenboom and Winter, J. Mol. Biol, 227:381 (1991); Marks et al., J. Mol. Biol, 222:581 (1991)). Similarly, human antibodies can be made by introducing human immunoglobulin loci into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon challenge, human antibody production is observed, which closely resembles that seen in humans in all respects, including gene rearrangement, assembly, and antibody repertoire. This approach is described, for example, in U.S. Patent Nos. 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016; and Marks et al., Bio / Technology 10, 779-783 (1992); Lonberg et al., Nature 368, 856-859 (1994); Morrison, Nature 368, 812-13 (1994); Fishwild et al., Nature Biotechnology 14, 845-51 (1996); Neuberger, Nature Biotechnology 14, 826 (1996); and Lonberg and Huszar, Intern. Rev. Immunol. 13, 65-93 (1995).
[0104] Human antibodies can also be produced using transgenic non-human animals engineered to produce fully human antibodies in response to antigen challenge rather than the animal's endogenous antibodies. (See PCT Publication No. WO 94 / 02602 and U.S. Patent No. 6,673,986.) The endogenous genes encoding heavy and light immunoglobulin chains in the non-human host are disabled, and active loci encoding human heavy and light immunoglobulin chains are inserted into the host's genome. Human genes are incorporated, for example, using yeast artificial chromosomes containing the necessary human DNA fragments. Animals providing all the desired modifications are then obtained as progeny by breeding intermediate transgenic animals containing less than the full complement of modifications. A non-limiting example of such a non-human animal is a mouse, referred to as the Xenomouse™, as disclosed in PCT Publications WO 96 / 33735 and WO 96 / 34096. The animal produces B cells that secrete fully human immunoglobulins. Antibodies can be obtained directly from animals after immunization with an immunogen of interest, e.g., as polyclonal antibody preparations, or from immortalized B cells derived from animals, such as hybridomas, that produce monoclonal antibodies. Furthermore, genes encoding immunoglobulins with human variable regions can be recovered and expressed to obtain antibodies directly or further modified to obtain antibody analogs, such as single-chain Fv (scFv) molecules. Thus, such techniques can be used to produce therapeutically useful IgG, IgA, IgM, and IgE antibodies. For an overview of this technology for producing human antibodies, see Lonberg and Huszar Int. Rev. Immunol. 73:65-93 (1995).For a detailed discussion of this technology for producing human antibodies and human monoclonal antibodies and protocols for producing such antibodies, see, e.g., PCT Publication Nos. WO 98 / 24893, WO 96 / 34096; WO 96 / 33735; U.S. Patent Nos. 5,413,923; 5,625,126; 5,633,425; 5,569,825; 5,661,016; 5,545,806; 5,814,318; and 5,939,598, which are incorporated by reference in their entireties. Additionally, companies such as Creative BioLabs (Shirley, NY) can be engaged to provide human antibodies directed against a selected antigen using technology similar to that described above.
[0105] An example of a method for producing a non-human host, exemplified as a mouse, lacking expression of endogenous immunoglobulin heavy chains is disclosed in U.S. Patent No. 5,939,598. This can be obtained by a method comprising deleting a J segment gene from at least one endogenous heavy chain locus in embryonic stem cells to prevent rearrangement of the locus and the formation of transcripts of the rearranged immunoglobulin heavy chain locus (the deletion is effected by a targeting vector containing a gene encoding a selection marker); and producing a transgenic mouse from the embryonic stem cells whose somatic and germ cells contain the gene encoding the selection marker.
[0106] One method for producing a desired antibody, such as a human antibody, is disclosed in U.S. Patent No. 5,916,771. This method involves introducing an expression vector containing a nucleotide sequence encoding a heavy chain into one mammalian host cell in culture, introducing an expression vector containing a nucleotide sequence encoding a light chain into another mammalian host cell, and fusing the two cells to form a hybrid cell. The hybrid cell expresses the antibody containing the heavy and light chains.
[0107] In a further improvement of this procedure, methods for identifying clinically relevant epitopes on immunogens and correlative methods for selecting antibodies that immunospecifically bind with high affinity to the relevant epitopes are disclosed in PCT Publication WO 99 / 53049.
[0108] The antibody of interest can also be expressed by a vector containing a DNA fragment encoding the single-chain antibody. Examples of vectors include, but are not limited to, chemical conjugates such as those described in WO93 / 64701, which contain a targeting moiety (e.g., a ligand for a cell surface receptor) and a nucleic acid-binding moiety (e.g., polylysine), viral vectors (e.g., DNA or RNA viral vectors), fusion proteins such as those described in PCT / US95 / 02140 (WO95 / 22618), which contain a targeting moiety (e.g., an antibody specific for a target cell) and a nucleic acid-binding moiety (e.g., protamine), plasmids, phages, viral vectors, and the like. Vectors may be chromosomal, non-chromosomal, or synthetic. Retroviral vectors may also be used, including Moloney murine leukemia viruses. DNA viral vectors may also be used, including pox vectors such as orthopox or avipox vectors, and herpes virus vectors such as herpes simplex virus type I (HSV) vectors (Geller, AI et al, J. Neurochem, 64:487 (1995); Lim, F., et al, "DNA Cloning: Mammalian Systems", D. Glover, Ed. (Oxford Univ. Press, Oxford England) (1995); Geller, AI et al, Proc Natl. Acad. Sci.: USA 90:7603 (1993); Geller, AI, et al, Proc Natl. Acad. Sci USA 87:1149 (1990)), adenovirus vectors (see LeGal LaSalle et al, Science, 259:988 (1993); Davidson, et al, al, Nat. Genet. 3:219 (1993); Yang, et al, J. Virol. 69:2004 (1995) and Adeno-associated Virus Vectors (see Kaplitt, MG. et al, Nat. Genet. 8:148 (1994)).
[0109] Poxvirus vectors deliver genes into the cytoplasm. Avipoxvirus vectors only result in short-term expression of nucleic acids. Adenovirus vectors, adeno-associated virus vectors, and herpes simplex virus (HSV) vectors can be used to deliver nucleic acids into neural cells. Adenovirus vectors deliver shorter-term expression (approximately 2 months) than adeno-associated virus (approximately 4 months), which in turn delivers shorter expression than HSV vectors. The specific vector selected depends on the target cell and the condition being treated. Introduction can be by standard techniques (e.g., infection, transfection, transduction, or transformation). Examples of gene transfer methods include naked DNA, CaP04 precipitation, DEAE-dextran, electroporation, protoplast fusion, lipofection, cell microinjection, and viral vectors.
[0110] Vectors can be used to target essentially any desired target cell. For example, stereotactic injection can be used to direct vectors (e.g., adenovirus, HSV) to the desired location. Furthermore, particles can be delivered by intracerebroventricular (icv) injection using a minipump infusion system (e.g., SynchroMed Infusion System). A bulk flow-based method called convection has also proven effective in delivering large molecules to widespread areas of the brain and can be useful for delivering vectors to target cells. (See Bobo et al., Proc. Natl. Acad. Sci. USA 91:2076-2080 (1994); Morrison et al., Am. J. Physiol. 266:292-305 (1994)). Other methods that can be used include catheter, intravenous, parenteral, intraperitoneal, and subcutaneous injection, as well as oral or other known administration routes.
[0111] These vectors can be used to express large amounts of antibodies that can be used in a variety of ways, such as to detect the presence of PD-1 in a sample. The antibodies can also be used to attempt to bind to and disrupt PD-1 activity.
[0112] Techniques can be adapted for the production of single chain antibodies specific to the antigenic proteins of the present invention (see, e.g., U.S. Pat. No. 4,946,778). In addition, methods can be used to generate monoclonal antibodies with the desired specificity for the protein or its derivatives, fragments, analogs, or homologs. ab To allow for rapid and effective identification of fragments, F ab Methods can be adapted for the construction of expression libraries (see, e.g., Huse, et al., 1989 Science 246:1275-1281). Antibody fragments containing the idiotype to a protein antigen can be prepared by (i) pepsin digestion of the antibody molecule, followed by F (ab ' )2 Fragment;(ii)F (ab ' )2 F generated by reducing the disulfide bridges of the fragment ab (iii) F fragments produced by treating antibody molecules with papain and a reducing agent. ab fragments, and (iv) F v These fragments can be produced by techniques known in the art, including but not limited to, recombinant human genomic DNA fragments.
[0113] Heteroconjugate antibodies are also within the scope of the present invention. Heteroconjugate antibodies are composed of two covalently linked antibodies. Such antibodies can, for example, target immune system cells to unwanted cells (see U.S. Pat. No. 4,676,980) and can be used to treat HIV infection (see PCT Publication Nos. WO91 / 00360 and WO92 / 20373). Antibodies can be prepared in vitro using known methods in synthetic protein chemistry, including those involving crosslinking agents. For example, immunotoxins can be constructed using a disulfide exchange reaction or by forming a thioether bond. Examples of suitable reagents for this purpose include iminothiolate and methyl-4-mercaptobutyrimidate, and those disclosed, for example, in U.S. Pat. No. 4,676,980.
[0114] The antibodies of the present invention can be modified with respect to effector function, for example, to enhance the effectiveness of the antibody in treating cancer. For example, cysteine residues can be introduced into the Fc region, thereby allowing interchain disulfide bond formation in this region. The homodimeric antibody thus generated may have improved internalization capability and / or increased complement-mediated cell killing and antibody-dependent cellular cytotoxicity (ADCC). (See Caron et al., J. Exp Med., 176:1191-1195 (1992) and Shopes, J. Immunol., 148:2918-2922 (1992)). Alternatively, antibodies can be engineered with dual Fc regions, thereby enhancing complement lysis and ADCC capabilities. (See Stevenson et al., Anti-Cancer Drug Design, 3:219-230 (1989)).
[0115] In certain embodiments, antibodies of the present invention can comprise Fc variants containing amino acid substitutions that alter the antigen-independent effector function of the antibody, particularly its circulating half-life. Such antibodies exhibit increased or decreased binding to FcRn, and therefore increased or decreased serum half-life, compared to antibodies lacking these substitutions. Fc variants with improved affinity for FcRn are expected to have longer serum half-lives, and such molecules have useful applications in methods of treating mammals where a long half-life of the administered antibody is desired, for example, to treat chronic diseases or disorders. In contrast, Fc variants with reduced FcRn binding affinity are expected to have shorter resting periods, and such molecules may also be useful, for example, for administration to mammals where a shortened circulation time may be advantageous, for example, in in vivo imaging, or in situations where the starting antibody has toxic side effects if present in the circulation for an extended period of time. Fc variants with reduced FcRn binding affinity are also useful in treating diseases or disorders in pregnant women, as they are less likely to cross the placenta. Additionally, other applications in which decreased FcRn binding affinity may be desirable include applications in which localization to the brain, kidney, and / or liver is desired. In one embodiment, Fc variant-containing antibodies may exhibit decreased transport across the epithelium of renal glomeruli from the vasculature. In another embodiment, Fc variant-containing antibodies may exhibit decreased transport across the blood-brain barrier (BBB) from the brain to the vascular space. In one embodiment, antibodies with altered FcRn binding comprise an Fc domain with one or more amino acid substitutions within the "FcRn-binding loop" of the Fc domain. The FcRn-binding loop is composed of amino acid residues 280-299 (EU numbering). Exemplary amino acid substitutions that result in altered FcRn-binding activity are disclosed in PCT Publication WO 05 / 047327, incorporated herein by reference. In certain exemplary embodiments, an antibody or fragment thereof of the invention comprises an Fc domain with one or more of the following substitutions: V284E, H285E, N286D, K290E and S304D (EU numbering).
[0116] In some embodiments, mutations are introduced into the constant region of the mAb to alter the antibody-dependent cell-mediated cytotoxicity (ADCC) activity of the mAb. For example, the mutation is a LALA mutation in the CH2 domain. In one embodiment, an antibody (e.g., a human mAb or a bispecific Ab) contains a mutation in one scFv unit of the heterodimeric mAb that reduces ADCC activity. In another embodiment, the mAb contains mutations in both chains of the heterodimeric mAb that completely eliminate ADCC activity. For example, the mutation introduced into one or both scFv units of the mAb is a LALA mutation in the CH2 domain. These mAbs with variable ADCC activity can be optimized so that the mAb exhibits maximum selective killing against cells expressing one antigen recognized by the mAb, but minimal killing against a second antigen recognized by the mAb.
[0117] In other embodiments, antibodies of the invention for use in the diagnostic and therapeutic methods described herein have constant regions, e.g., IgG1 or IgG4 heavy chain constant regions, that can be modified to reduce or eliminate glycosylation. For example, antibodies of the invention can also include Fc variants containing amino acid substitutions that alter the glycosylation of the antibody. For example, Fc variants can have reduced glycosylation (e.g., N- or O-linked glycosylation). In some embodiments, Fc variants contain reduced glycosylation of the N-linked glycan normally found at amino acid position 297 (EU numbering). In another embodiment, the antibody contains an amino acid substitution near or within a glycosylation motif, e.g., an N-linked glycosylation motif containing the amino acid sequence NXT or NXS. In a specific embodiment, the antibody contains an Fc variant with an amino acid substitution at amino acid position 228 or 299 (EU numbering). In a more specific embodiment, the antibody contains an IgG1 or IgG4 constant region containing S228P and T299A mutations (EU numbering).
[0118] Exemplary amino acid substitutions that confer reduced or altered glycosylation are described in PCT Publication WO 05 / 018572, which is incorporated herein by reference in its entirety. In some embodiments, antibodies or fragments thereof of the present invention are modified to eliminate glycosylation. Such antibodies or fragments thereof may be referred to as "agly" antibodies or fragments thereof (e.g., "agly" antibodies). Without wishing to be bound by theory, "agly" antibodies or fragments thereof may have improved safety and stability profiles in vivo. Exemplary agly antibodies or fragments thereof comprise an aglycosylated Fc region of an IgG4 antibody lacking Fc-effector function, thereby eliminating the potential for Fc-mediated toxicity to normal vital tissues and cells that express PD-1. In yet other embodiments, antibodies or fragments thereof of the present invention comprise an altered glycan. For example, the antibody has a reduced number of fucose residues on the N-glycan at Asn297 of the Fc region, i.e., is defucosylated. In another embodiment, the antibody may have an altered number of sialic acid residues on the N-glycan at Asn297 of the Fc region.
[0119] The present invention is also directed to immunoconjugates comprising an antibody conjugated to a cytotoxic agent such as a toxin (e.g., an enzymatically active toxin of bacterial, fungal, plant, or animal origin, or a fragment thereof), or a radioactive isotope (i.e., a radioconjugate).
[0120] Enzymatically active toxins and fragments thereof that can be used include diphtheria A chain, nonbinding active fragments of diphtheria toxin, exotoxin A chain (from Pseudomonas aeruginosa), ricin A chain, abrin A chain, modeccin A chain, α-sarcin, Aleurites fordii protein, dianthin protein, Phytolaca americana proteins (PAPI, PAPII, and PAP-S), momordica charantia inhibitor, curcin, crotin, sapaonaria officinalis inhibitor, gelonin, mitogenin, restrictocin, phenomycin, enomycin, and the trichothecenes. A variety of radionuclides are available for the production of radioconjugated antibodies. Non-limiting examples include: 212 Bi, 131 I, 131 In, 90 Y, and 186 Re is an example.
[0121] Conjugates of antibodies and cytotoxic drugs are prepared using a variety of bifunctional protein coupling agents, such as N-succinimidyl-3-(2-pyridyldithiol)propionate (SPDP), iminothiolane (IT), bifunctional derivatives of imidoesters (such as dimethyl adipimidate HCl), active esters (such as disuccinimidyl suberate), aldehydes (such as glutaraldehyde), bis-azido compounds (such as bis(p-azidobenzoyl)hexanediamine), bis-diazonium derivatives (such as bis-(p-diazoniumbenzoyl)ethylenediamine), diisocyanates (such as trimethylene 2,6-diisocyanate), and bis-active fluorine compounds (such as 1,5-difluoro-2,4-dinitrobenzene). For example, ricin immunotoxins can be prepared as described in Vitetta et al., Science 238:1098 (1987). Carbon-14 labeled 1-isothiocyanatobenzyl-3-methyldiethylenetriaminepentaacetic acid (MX-DTPA) is an exemplary chelating agent for attaching radionucleotides to antibodies (see PCT Publication No. WO 94 / 11026 and U.S. Patent No. 5,736,137).
[0122] Those skilled in the art will appreciate that a wide variety of possible moieties can be attached to a given antibody or other molecule of the invention. (See, e.g., "Conjugate Vaccines," Contributions to Microbiology and Immunology, JM Cruse and RE Lewis, Jr (eds), Carger Press, New York, (1989), which is incorporated herein by reference in its entirety.
[0123] Coupling can be achieved by any chemical reaction that bonds two molecules, so long as the antibody and other moiety retain their respective activities. This binding can occur via many chemical mechanisms, including covalent bonding, affinity bonding, intercalation, coordinate bonding, and complex formation. In one embodiment, the binding is covalent. Covalent binding can be achieved either by direct condensation of existing side chains or by incorporating an external crosslinking molecule. Many bivalent or polyvalent linking agents are useful in coupling protein molecules (e.g., antibodies of the present invention) to other molecules. For example, representative coupling agents include organic compounds (e.g., thioesters, carbodiimides, succinimide esters, diisocyanates, glutaraldehyde, diazobenzene, and hexamethylenediamine). This list is not intended to be exhaustive of the various classes of coupling agents known in the art, but rather is illustrative of the more common coupling agents. (See Killen and Lindstrom, Jour. Immun. 133:1335-2549 (1984); Jansen et al., Immunological Reviews 62:185-216 (1982); and Vitetta et al., Science 238:1098 (1987)). Non-limiting examples of linkers are described in the literature. (See, for example, Ramakrishnan, S. et al., Cancer Res. 44:201-208 (1984), which describes the use of MBS (M-maleimidobenzoyl-N-hydroxysuccinimide ester).) See also U.S. Pat. No. 5,030,719, which describes the use of halogenated acetylhydrazide derivatives coupled to antibodies via oligopeptide linkers.Non-limiting examples of useful linkers that can be used with the antibodies of the invention include: (i) EDC (1-ethyl-3-(3-dimethylamino-propyl)carbodiimide hydrochloride); (ii) SMPT (4-succinimidyloxycarbonyl-α-methyl-α-(2-pyridyl-dithio)-toluene (Pierce Chem. Co., Catalog No. 21558G); (iii) SPDP (succinimidyl-6[3-(2-pyridyldithio)propionamido]hexanoate (Pierce Chem. Co., Catalog No. 21651G); (iv) sulfo-LC-SPDP (sulfosuccinimidyl-6[3-(2-pyridyldithio)-propionamido]hexanoate (Pierce Chem. Co., Catalog No. 2165-G); and (v) sulfo-NHS (-hydroxysulfo-succinimide) coupled to EDC (Pierce Chem. Co., Catalog No. 2165-G). Chem. Co., catalog number 24510).
[0124] The linkers described herein contain components with different attributes, thus resulting in conjugates with different physicochemical properties. For example, sulfo-NHS esters of alkyl carboxylates are more stable than sulfo-NHS esters of aromatic carboxylates. NHS-ester-containing linkers are less soluble than sulfo-NHS esters. Furthermore, the linker SMPT contains a sterically hindered disulfide bond, allowing for the formation of conjugates with increased stability. Disulfide bonds are generally less stable than other bonds because they are cleaved in vitro, resulting in fewer available conjugates. Sulfo-NHS, in particular, can enhance the stability of carbodiimide coupling. Carbodiimide coupling (such as EDC) when used with sulfo-NHS forms esters that are more resistant to hydrolysis than carbodiimide coupling reactions alone.
[0125] The antibody disclosed herein can also be formulated as immunoliposome.Liposomes containing antibody can be prepared by methods known in the art, such as those described in Epstein et al., Proc.Natl.Acad.Sci.USA, 82:3688 (1985); Hwang et al., Proc.Natl.Acad.Sci.USA, 77:4030 (1980); and U.S. Patent No. 4,485,045 and U.S. Patent No. 4,544,545.Liposomes with enhanced circulation time are disclosed in U.S. Patent No. 5,013,556.
[0126] A non-limiting example of a useful liposome can be generated by the reverse-phase evaporation method using a lipid composition containing phosphatidylcholine, cholesterol, and PEG-derivatized phosphatidylethanolamine (PEG-PE). Liposomes are extruded through filters of defined pore size to generate liposomes with the desired diameter. Fab' fragments of the antibody of the present invention can be conjugated to liposomes via a disulfide exchange reaction as described in Martin et al., J. Biol. Chem., 257:286-288 (1982).
[0127] bispecific antibody Bispecific antibodies (bsAbs) are antibodies containing two variable domains or scFv units, and the resulting antibody recognizes two different antigens. The present invention provides bispecific antibodies that recognize PD-1 and a second antigen. Exemplary second antigens include tumor-associated antigens (e.g., LINGO1), cytokines, and cell surface receptors. Non-limiting examples of second antigens include CTLA-4, LAG-3, CD28, CD122, 4-1BB, TIM3, OX-40, OX40L, CD40, CD40L, LIGHT, ICOS, ICOSL, GITR, GITRL, TIGIT, CD27, VISTA, B7H3, B7H4, HEVM (or BTLA), CD47, and CD73. Different types of bispecific antibodies are also provided herein. In some embodiments, the anti-PD1 fragment and the second fragment are independently selected from a Fab fragment, a single-chain variable fragment (scFv), or a single-domain antibody. In some embodiments, the bispecific antibody further comprises an Fc fragment. The bispecific antibody of the invention comprises a heavy and light chain combination or scFv of a PD-1 antibody disclosed herein.
[0128] Bispecific antibodies of the present invention can be constructed using methods known in the art. In some embodiments, bispecific antibodies are single polypeptides in which two scFv fragments are linked by a long linker polypeptide that is long enough to allow intramolecular association between the two scFv units to form the antibody. In other embodiments, bispecific antibodies are two or more polypeptides linked by covalent or non-covalent bonds.
[0129] In another embodiment, bispecific antibodies are constructed using the "knobs-into-holes" method (Ridgway et al., Protein Eng 7:617-621 (1996)). In this method, Ig heavy chains of two different variable domains are reduced to selectively disrupt heavy chain pairing while preserving heavy chain-light chain pairing. Two heavy chain-light chain heterodimers that recognize two different antigens are mixed to promote heteroligation mediated through engineered "knobs-into-holes" in the CH3 domains.
[0130] In another embodiment, bispecific antibodies can be constructed by exchanging heavy-light chain dimers from two or more different antibodies to generate hybrid antibodies, with the first heavy-light chain dimer recognizing PD-1 and the second heavy-light chain dimer recognizing a second antigen. The mechanism of heavy-light chain dimerization is similar to the formation of human IgG4, which also functions as a bispecific molecule. Dimerization of IgG heavy chains is promoted by intramolecular forces such as the pairing of the CH3 domains of each heavy chain with disulfide bridges. The presence of a specific amino acid (R409) in the CH3 domain has been shown to promote dimer exchange and the assembly of IgG4 molecules. Heavy chain pairing is also further stabilized by inter-heavy chain disulfide bridges in the antibody hinge region. Specifically, in IgG4, the hinge region contains the amino acid sequence Cys-Pro-Ser-Cys at amino acids 226-230 (compared to the stable IgG1 hinge region, which contains the sequence Cys-Pro-Pro-Cys). This sequence difference at serine 229 is associated with the tendency of IgG4 to form intrachain disulfides in the hinge region (Van der Neut Kolfschoten, M. et al., 2007, Science 317:1554-1557 and Labrijn, A. F. et al., 2011, Journal of Immunol 187:3238-3246).
[0131] Thus, bispecific antibodies of the present invention can be generated by introducing the R409 residue in the CH3 domain of an antibody that recognizes PD-1 or a second antigen and a Cys-Pro-Ser-Cys sequence in the hinge region, resulting in an exchange of heavy-light chain dimers to generate an antibody molecule having one heavy-light chain dimer that recognizes PD-1 and a second heavy-light chain dimer that recognizes a second antigen (wherein the second antigen is any antigen disclosed herein). Known IgG4 molecules can also be modified so that the heavy and light chains recognize PD-1 or a second antigen, as disclosed herein. The use of this method to construct bispecific antibodies of the present invention can be beneficial due to the unique characteristics of IgG4 molecules, in which the Fc region differs from other IgG subtypes in that it interacts little with effector systems of the immune response (e.g., complement and Fc receptors expressed by certain leukocytes). This unique property makes these IgG4-based bispecific antibodies attractive for therapeutic applications where the antibody must bind to the target and functionally modify the target-associated signaling pathway, but does not induce effector activity.
[0132] In some embodiments, mutations are introduced into the constant region of the bsAb to alter its antibody-dependent cell-mediated cytotoxicity (ADCC) activity. For example, the mutation is a LALA mutation in the CH2 domain. In one aspect, the bsAb contains a mutation on one scFv unit of the heterodimeric bsAb that reduces ADCC activity. In another aspect, the bsAb contains mutations on both chains of the heterodimeric bsAb that completely eliminate ADCC activity. For example, the mutation introduced into one or both scFv units of the bsAb is a LALA mutation in the CH2 domain. These bsAbs with variable ADCC activity can be optimized so that the bsAb exhibits maximum selective killing of cells expressing one antigen recognized by the bsAb, but minimal killing of a second antigen recognized by the bsAb.
[0133] The bispecific antibodies disclosed herein may be useful in the treatment of chronic infections, diseases, or medical conditions, such as cancer.
[0134] Use of antibodies against PD-1 The antibodies of the present invention that specifically bind to the PD-1 protein or a fragment thereof can be administered to treat a PD-1-associated disease or disorder. A "PD-1-associated disease or disorder" includes disease states and / or symptoms associated with disease states in which elevated levels of PD-1 and / or activation of cell signaling pathways involving PD-1 are observed. Exemplary PD-1-associated diseases or disorders include, but are not limited to, diseases in which T cells are suppressed, such as cancer and infectious diseases. In some embodiments, the infectious disease may be caused by a microorganism, such as a DNA virus, an RNA virus, or a reverse-transcription virus. Non-limiting examples of viruses include adenovirus, coxsackievirus, Epstein-Barr virus, hepatitis A virus, hepatitis B virus, hepatitis C virus, herpes simplex virus type 1, herpes simplex virus type 2, cytomegalovirus, human herpes virus type 8, HIV, influenza virus, measles virus, mumps virus, human papillomavirus, parainfluenza virus, poliovirus, rabies virus, respiratory syncytial virus, rubella virus, varicella-zoster virus. In some embodiments, the infectious disease may be caused by a microorganism such as a gram-positive bacterium, a gram-negative bacterium, a protozoan, or a fungus.
[0135] Non-limiting examples of disease-causing bacteria include Bacillus anthracis, Bacillus cereus, Bartonella henselae, Bartonella quintana, Bordetella pertussis, Borrelia burgdorferi, Borrelia garinii, Borrelia afzelii, Borrelia recurrentis, Brucella abortus, Brucella canis, Brucella melitensis, Brucella suis, Campylobacter jejuni, and the like. jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Chlamydophila psittaci, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Clostridium tetani, Corynebacterium diphtheria, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Francisella tularensis, Haemophilus influenzae influenza, Helicobacter pylori, Legionella pneumophila, Leptospira interrogansinterrogans, Leptospira santarosai, Leptospira weilii, Leptospira noguchii, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Mycobacterium ulcerans, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitides, Pseudomonas aeruginosa, Rickettsia rickettsia, Salmonella typhi, Salmonella typhi typhimurium, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus saprophyticus, Streptococcus agalactiae, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholera, Yersinia pestis, Yersinia enterocolitica enterocolitica, and Yersinia pseudotuberculosis.
[0136] Non-limiting examples of disease-causing protozoa include Plasmodium falciparum (malaria), Toxoplasma gondii (toxoplasmosis), Leishmania species (leishmaniasis), Trypanosoma brucei (African sleeping sickness), Trypanosoma cruzi (Chagas disease), and Giardia intestinalis (giardiasis).
[0137] Non-limiting examples of disease-causing fungi include Candida albicans, Aspergillus fumigatus, Aspergillus flavus, Cryptococcus neoformans, Cryptococcus gattii, Histoplasma capsulatum, Pneumocystis carinii, and Stachybotrys chartarum.
[0138] The antibodies of the present invention, including bispecific, polyclonal, monoclonal, humanized, and fully human antibodies, can be used as therapeutic agents. Such agents are generally used to treat cancer in a subject, to improve the efficacy of vaccines, or to enhance natural immune responses. Antibody preparations (e.g., those with high specificity and high affinity for their target antigens) are administered to a subject and generally have an effect due to binding to the target. Administration of the antibody can neutralize, inhibit, or block the activity of PD-1 protein.
[0139] The antibodies of the present invention that specifically bind to the PD-1 protein or a fragment thereof can be administered for the treatment of cancer in the form of a pharmaceutical composition. Principles and considerations related to the preparation of therapeutic pharmaceutical compositions containing antibodies, as well as guidance regarding the selection of ingredients, are provided, for example, in Remington: The Science and Practice of Pharmacy, 20th ed. (Alfonso R. Gennaro, et al., editors). Mack Pub. Co., Easton, Pa., 2000; Drug Absorption Enhancement: Concepts, Possibilities, Limitations, and Trends, Harwood Academic Publishers, Langhorne, Pa., 1994; and Peptide And Protein Drug Delivery (Advances In Parenteral Sciences, Vol. 4), 1991, M. Dekker, New York.
[0140] The specific dosage and treatment regimen for any particular patient depends on various factors, such as the specific antibody, its variant or derivative used, the patient's age, weight, general health, sex, and diet, as well as administration time, excretion rate, drug combination, and the severity of the specific disease being treated.The judgment of such factors by medical caregivers is within the scope of those skilled in the art.This amount also depends on the individual patient being treated, administration route, type of formulation, characteristics of the compound being used, the severity of the disease, and the desired effect.The amount used can be determined by pharmacological and pharmacokinetic principles well known in the art.
[0141] A therapeutically effective amount of an antibody of the present invention may be the amount necessary to achieve a therapeutic goal. As described herein, this may be a binding interaction between the antibody and its target antigen, which, in certain cases, interferes with the function of the target. The amount required to be administered further depends on the binding affinity of the antibody for its specific antigen and the rate at which the administered antibody is depleted from the free volume of the subject to which it is administered. The dosage of an antigen-binding polypeptide described herein administered to a subject (e.g., a patient) is typically 0.1 mg / kg to 100 mg / kg of the patient's body weight, 0.1 mg / kg to 20 mg / kg of the patient's body weight, or 1 mg / kg to 10 mg / kg of the patient's body weight. Human antibodies have a longer half-life in the human body than antibodies from other species due to the immune response to the foreign polypeptide. Therefore, lower dosages and less frequent administration of human antibodies are often possible. Furthermore, the dosage and frequency of administration of the antibodies of the present disclosure can be reduced by enhancing antibody uptake and tissue penetration (e.g., into the brain) through modifications such as lipidation. A typical therapeutically effective dose of an antibody or antibody fragment of the present invention may range, for example and without limitation, from about 0.1 mg / kg (body weight) to about 50 mg / kg (body weight). Typical administration frequencies may range, for example, from twice daily to once weekly.
[0142] When an antibody fragment is used, the smallest inhibitory fragment that specifically binds to the binding domain of the target protein is preferred. For example, peptide molecules that retain the ability to bind to the target protein sequence can be designed based on the variable region sequence of the antibody. Such peptides can be chemically synthesized and / or produced by recombinant DNA technology. (See, for example, Marasco et al., Proc. Natl. Acad. Sci. USA, 90:7889-7893 (1993)). The formulation can also contain more than one active compound necessary for the particular indication being treated, for example, those with complementary activities that do not adversely affect each other. Alternatively, or in addition, the composition can contain an agent that enhances its function (e.g., a cytotoxic agent, a cytokine (e.g., IL-15), a chemotherapeutic agent, or a growth inhibitor, etc.). Such molecules are suitably present in combination in amounts effective for the intended purpose.
[0143] The active ingredient can also be encapsulated in microcapsules prepared, for example, by coacervation techniques or interfacial polymerization (e.g., hydroxymethylcellulose or gelatin-microcapsules and poly-(methyl methacrylate) microcapsules, respectively), in colloidal drug delivery systems (e.g., liposomes, albumin microspheres, microemulsions, nanoparticles, and nanocapsules), or in macroemulsions.
[0144] Formulations to be used for in vivo administration must be sterile, which is readily accomplished by filtration through sterile filtration membranes.
[0145] Sustained-release preparations can be prepared. Suitable examples of sustained-release preparations include semipermeable matrices of solid hydrophobic polymers containing antibodies, which matrices are in the form of shaped articles (e.g., films or microcapsules). Examples of sustained-release matrices include polyesters, hydrogels (e.g., poly(2-hydroxyethyl-methacrylate) or poly(vinyl alcohol)), polylactides (U.S. Pat. No. 3,773,919), copolymers of L-glutamic acid and γ-ethyl-L-glutamate, non-degradable ethylene-vinyl acetate, degradable lactic acid-glycolic acid copolymers, such as LUPRON DEPOT™ (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate), and poly-D-(-)-3-hydroxybutyric acid. Polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid allow the release of molecules for over 100 days, while certain hydrogels release proteins for shorter periods.
[0146] The antibodies according to the present invention can be used as agents for detecting the presence of PD-1 (or a protein fragment thereof) in a sample. For example, the antibody can contain a detectable label. The antibody can be polyclonal or monoclonal. An intact antibody or a fragment thereof (e.g., F ab , scFv, or F (ab)2) may be used. With respect to a probe or antibody, the term "labeled" can encompass direct labeling of the probe or antibody by coupling (i.e., physically linking) a detectable substance to the probe or antibody, as well as indirect labeling of the probe or antibody by reactivity with another reagent that is directly labeled. Examples of indirect labeling include detection of a primary antibody using a fluorescently labeled secondary antibody and end-labeling of a DNA probe with biotin so that it can be detected with fluorescently labeled streptavidin. The term "biological sample" can include tissues, cells, and fluids isolated from a subject, as well as tissues, cells, and fluids present within a subject. Thus, included in the use of the term "biological sample" are blood and fractions or components of blood, such as serum, plasma, or lymph. That is, the detection methods of the present invention can be used in vitro and in vivo to detect analyte mRNA, protein, or genomic DNA in biological samples. For example, in vitro techniques for detecting analyte mRNA include Northern hybridization and in situ hybridization. In vitro techniques for detection of an analyte protein include enzyme linked immunosorbent assays (ELISAs), Western blots, immunoprecipitations, and immunofluorescence. In vitro techniques for detection of an analyte genomic DNA include Southern hybridizations.
[0147] Procedures for performing immunoassays are described, for example, in "ELISA: Theory and Practice: Methods in Molecular Biology", Vol. 42, J.R.Crowther (Ed.) Human Press, Totowa, NJ, 1995; "Immunoassay", E. Diamandis and T. Christopoulus, Academic Press, Inc., San Diego, CA, 1996; and "Practice and Theory of Enzyme Immunoassays", P. Tijssen, Elsevier Science Publishers, Amsterdam, 1985. Further, in vivo techniques for detecting an analyte protein include introducing a labeled anti-analyte protein antibody into a subject. For example, the antibody can be labeled with a radioactive marker whose presence and location in a subject can be detected by standard imaging techniques.
[0148] Antibodies to the PD-1 protein (or fragments thereof) can be used in methods known in the art for localizing and / or quantitating PD-1 protein (e.g., for use in measuring levels of PD-1 protein in an appropriate physiological sample, for use in diagnostic methods, for use in protein imaging, etc.). In certain embodiments, antibodies specific for the PD-1 protein, or derivatives, fragments, analogs, or homologs thereof, comprising an antibody-derived antigen-binding domain, are utilized as pharmacologically active compounds (referred to herein as "therapeutic agents").
[0149] Antibodies of the invention specific for the PD-1 protein can be used to isolate PD-1 polypeptides by standard techniques, such as immunoaffinity, chromatography, or immunoprecipitation. Antibodies to the PD-1 protein (or fragments thereof) can be used diagnostically to monitor protein levels in tissues as part of a clinical testing procedure, e.g., to determine the efficacy of a given therapeutic regimen.
[0150] Detection can be facilitated by coupling (i.e., physically linking) the antibody to a detectable substance. Examples of detectable substances include, but are not limited to, various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. Non-limiting examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin / biotin and avidin / biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride, or phycoerythrin; an example of a luminescent material includes luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin; and examples of suitable radioactive materials include fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride, or phycoerythrin. 125 I, 131 I, 35 S, 32 P, or 3 H is one example.
[0151] The antibodies or agents of the present invention (also referred to herein as "active compounds"), as well as their derivatives, fragments, analogs, and homologs, can be incorporated into pharmaceutical compositions suitable for administration. Such pharmaceutical compositions can comprise the antibodies or agents and a pharmaceutically acceptable carrier. As used herein, the term "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Suitable carriers are described in the most recent edition of Remington's Pharmaceutical Sciences, a standard reference text incorporated herein by reference. Non-limiting examples of such carriers or diluents include water, saline, Ringer's solution, dextrose solution, and 5% human serum albumin. Non-aqueous vehicles, such as liposomes and fixed oils, can also be used. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, its use in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions.
[0152] The pharmaceutical composition of the present invention can be formulated to suit its intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (i.e., topical), transmucosal, and rectal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application may contain the following components: a sterile diluent (e.g., water for injection, saline, fixed oils, polyethylene glycol, glycerin, propylene glycol, or other synthetic solvents); an antibacterial agent (e.g., benzyl alcohol or methylparaben); an antioxidant (e.g., ascorbic acid or sodium bisulfite); a chelating agent (e.g., ethylenediaminetetraacetic acid (EDTA)); a buffer (e.g., acetate, citrate, or phosphate), and an agent for adjusting tonicity (e.g., sodium chloride or dextrose). pH can be adjusted with acids or bases such as hydrochloric acid or sodium hydroxide. Parenteral preparations can be enclosed in ampoules, disposable syringes, or multiple-dose vials made of glass or plastic.
[0153] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions, and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, NJ), or phosphate-buffered saline (PBS). In embodiments, the composition is sterile and fluid to the extent that easy syringability exists. It may be stable under the conditions of manufacture and storage and may be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. Prevention of microbial action can be achieved by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, etc. In many cases, it may be useful to include isotonic agents, for example, sugars, polyalcohols such as mannitol and sorbitol, sodium chloride. Prolonged absorption of injectable compositions can be achieved by including in the composition an agent that delays absorption, for example, aluminum monostearate and gelatin.
[0154] Sterile injectable solution can be prepared by incorporating the required amount of active compound into the appropriate solvent with one or combination of the components listed above as necessary, and then sterilize by filtration.For example, dispersion is prepared by incorporating active compound into the sterile vehicle that contains basic dispersion medium and other components required from the components listed above.For the sterile powder that is used to prepare sterile injectable solution, the preparation method is vacuum drying and freeze-drying, which produces powder of active ingredient and any additional desired components from the solution that has been previously sterile filtered.
[0155] Oral compositions include inert diluents or edible carriers.They can be enclosed in gelatin capsules or compressed into tablets.For oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, lozenges, or capsules.Oral compositions can also be prepared using fluid carriers for use as mouthwash, where the compound in the fluid carrier is orally applied, rolled in the mouth and expectorated, or swallowed.Pharmaceutically compatible binding agents and / or adjuvants can be included as part of the composition. The tablets, pills, capsules, troches and the like may contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate or orange flavoring.
[0156] For administration by inhalation, the compounds are delivered in the form of an aerosol spray from pressured container or dispenser which contains a suitable propellant, eg, a gas such as carbon dioxide, or a nebulizer.
[0157] Systemic administration can also be by transmucosal or transdermal means.For transmucosal or transdermal administration, a penetrant suitable for the barrier to be permeated is used in the formulation.Such penetrants are generally known in the art, and for example, for transmucosal administration, include detergents, bile salts, and fusidic acid derivatives.Transmucosal administration can be achieved through the use of nasal sprays or suppositories.For transdermal administration, active compounds are formulated into ointments, salves, gels, or creams generally known in the art.
[0158] The compounds can also be prepared in the form of suppositories (eg, with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.
[0159] In one embodiment, the active compound is prepared with a carrier that protects the compound against rapid elimination from the body, such as a controlled-release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. Methods for preparing such formulations are clear to those skilled in the art. Materials are also commercially available from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies against viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.
[0160] Oral or parenteral compositions can be formulated in dosage unit form to facilitate administration and ensure uniform dosage.As used herein, dosage unit form refers to a physically separate unit that is suitable as a unit dose for the subject to be treated, and each unit contains a predetermined amount of active compound calculated to produce desired therapeutic effect in association with required pharmaceutical carrier.The specification of dosage unit form of the present invention is determined by and directly depends on the inherent characteristics of active compound and the specific therapeutic effect to be achieved, and the inherent limitations of the technical field of compounding such active compound for individual treatment.
[0161] The pharmaceutical compositions can be included in a container, pack, or dispenser together with instructions for administration.
[0162] treatment As used herein, the term "treatment" or "treatment" refers to both therapeutic treatment and prophylactic or preventative measures, the purpose of which is to prevent or slow (alleviate) undesirable physiological changes or disorders, such as the progression of cancer. Beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, whether detectable or undetectable, reduction in the extent of disease, stable (i.e., not worsening) state of disease, delay or slowing of disease progression, improvement or palliation of disease state, and remission (partial or total). "Treatment" refers to prolonging survival as compared to expected survival if not receiving treatment. Those in need of treatment include those already with the condition or disorder, as well as those prone to have the condition or disorder, or those in whom the condition or disorder is to be prevented.
[0163] The present invention provides both preventative and therapeutic methods for treating subjects at risk for (or susceptible to) cancer (e.g., when an early detection cancer biomarker is identified in such a subject) or other cell proliferation-related diseases or disorders. Such diseases or disorders include, but are not limited to, diseases or disorders associated with aberrant expression of PD-1. For example, these methods are used to treat, prevent, or alleviate the symptoms of cancer. In one embodiment, the method is used to treat, prevent, or alleviate the symptoms of solid tumors. Non-limiting examples of other tumors that can be treated by embodiments herein include lung cancer, ovarian cancer, prostate cancer, colon cancer, cervical cancer, brain cancer, skin cancer, liver cancer, pancreatic cancer, or gastric cancer. Furthermore, the methods of the present invention can be used to treat blood cancers such as leukemia and lymphoma. Alternatively, these methods can be used to treat, prevent, or alleviate the symptoms of metastatic cancer. For example, cancers that can be treated or prevented or whose symptoms can be alleviated include B-cell chronic lymphocytic leukemia (CLL), non-small cell lung cancer, melanoma, ovarian cancer, lymphoma, or renal cell carcinoma.Cancers that can also be treated or prevented or whose symptoms can be alleviated include solid tumors with high mutational burden and WBC in the filtrate. Cancers that can be treated or prevented, or whose symptoms can be alleviated, include cancers in which signals in the PD-1 / PD-L1 axis are modulated, including, but not limited to, breast cancer, lung cancer (e.g., non-small cell lung cancer or lung adenocarcinoma), gastric cancer, colorectal cancer, bladder cancer, pancreatic cancer, prostate cancer, esophageal squamous cell carcinoma, nasopharyngeal carcinoma, and liquid tumors in which the PD1 / PD-L1 axis is active (e.g., diffuse large B-cell lymphoma (DLBCL) and B-cell chronic lymphocytic leukemia (B-CLL)) (see, e.g., Han et al., PD-1 / PD-L1 pathway: current researches in cancer, Am J Cancer Res 2020;10(3):727-742).
[0164] Thus, in one aspect, the invention provides a method for preventing, treating, or alleviating symptoms of cancer or a cell proliferative disease or disorder in a subject by administering to the subject a monoclonal antibody, scFv antibody, or bispecific antibody of the invention. For example, an anti-PD-1 antibody can be administered in a therapeutically effective amount.
[0165] Subjects at risk for cancer or cell proliferation-related diseases or disorders can include patients with a family history of cancer or subjects who have been exposed to a known or suspected cause of cancer. Administration of a prophylactic agent can occur prior to the onset of cancer, such that the disease is prevented or, alternatively, its progression is delayed.
[0166] In another embodiment, the growth of tumor cells is inhibited by contacting the cells with an anti-PD-1 antibody of the invention. The cells can be any cell that expresses PD-1.
[0167] The present invention further provides both preventive and therapeutic methods for treating subjects at risk (or susceptible) to chronic or acute viral, bacterial, or parasitic infections. The present invention also provides therapeutic methods for both preventive and therapeutic methods for treating subjects at risk of a disease, disorder, or condition associated with T cell exhaustion, or at risk of developing T cell exhaustion. The present invention also provides therapeutic methods for both preventive and therapeutic methods for treating subjects at risk of a disease, disorder, or condition associated with T cell exhaustion, or at risk of developing T cell exhaustion. Such diseases or disorders include, but are not limited to, HIV, AIDS, and chronic or acute bacterial, viral, or parasitic infections. For example, other such chronic infections include those caused by hepatitis B virus (HBV), hepatitis C virus (HCV), herpes simplex virus type 1 (HSV-1), H. pylori, or Toxoplasma gondii. Other acute infections include those caused by microorganisms such as gram-positive bacteria, gram-negative bacteria, protozoa, or fungi, for example, as described herein.
[0168] The present invention also encompasses methods for increasing or enhancing the immune response to an antigen. The immune response is increased or enhanced by administering a monoclonal antibody, scFv antibody, or bispecific antibody of the present invention to a subject. The immune response is enhanced, for example, by enhancing antigen-specific T effector function. The antigen is a viral (e.g., HIV), bacterial, parasitic, or tumor antigen. The immune response is an innate immune response. An innate immune response refers to an immune response that is the result of infection. The infection is a chronic infection. The increase or enhancement of the immune response to an antigen can be measured by many methods known in the art. For example, the immune response can be measured by measuring any one of T cell activity, T cell proliferation, T cell activation, effector cytokine production, and T cell transcriptional profile. Alternatively, the immune response is a response induced by vaccination.
[0169] Thus, in another aspect, the present invention provides a method for enhancing vaccine efficacy by administering to a subject a monoclonal antibody or scFv antibody of the present invention and a vaccine, wherein the antibody and vaccine are administered sequentially or simultaneously, and the vaccine is a tumor vaccine, a bacterial vaccine, or a viral vaccine.
[0170] Combination Method The compositions of the present invention described herein can be administered in combination with chemotherapeutic agents. Chemotherapeutic agents that can be administered with the compositions of the present disclosure include, but are not limited to, antibiotic derivatives (e.g., doxorubicin, bleomycin, daunorubicin, and dactinomycin); antiestrogens (e.g., tamoxifen); antimetabolites (e.g., fluorouracil, 5-FU, methotrexate, floxuridine, interferon α-2b, glutamic acid, plicamycin, mercaptopurine, and 6-thioguanine); cytotoxic drugs (e.g., carmustine, BCNU, lomustine, CCNU, cytosine arabinoside, cyclophosphamide, estramustine, hydroxyurea, procarbazine, mitomycin, busulfan, cis-platinum, etc.). and vincristine sulfate); hormones (e.g., medroxyprogesterone, estramustine sodium phosphate, ethinyl estradiol, estradiol, megestrol acetate, methyltestosterone, diethylstilbestrol diphosphate, chlorotrianisene, and testolactone); nitrogen mustard derivatives (e.g., mephalen, chlorambucil, mechlorethamine (nitrogen mustard) and thiotepa); steroids and combinations (e.g., betamethasone sodium phosphate); and others (e.g., dicarbazine, asparaginase, mitotane, vincristine sulfate, vinblastine sulfate, and etoposide).
[0171] In further embodiments, the compositions of the invention described herein can be administered in combination with cytokines, including, but not limited to, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-10, IL-13, IL-15, anti-CD40, CD40L, and TNF-α.
[0172] In further embodiments, the compositions described herein can be administered in combination with other therapeutic or prophylactic regimens, such as, for example, radiation therapy.
[0173] In some embodiments, the compositions described herein can be administered in combination with other immunotherapeutic agents, including, but not limited to, simtuzumab, abagovomab, adecatumumab, afutuzumab, alemtuzumab, altumomab, amatuximab, anatumomab, arcitumomab, bavituximab, bectumomab, and the like. b), bevacizumab, bivatuzumab, blinatumomab, brentuximab, cantuzumab, catumaxomab, cetuximab, sitatuzumab, cixutumumab, clivatuzumab, conatumumab, daratumumab daratumumab, drozitumab, duligotumab, dusigitumab, detumomab, dacetuzumab, dalotuzumab, ecromeximab, elotuzumab, ensituximab, ertumaxomab, etaracizumab zumab, farletuzumab, ficlatuzumab, figitumumab, flanvotumab, futuximab, ganitumab, gemtuzumab, girentuximab, glembatumumab, ibritumomab, igovomab,Imgatuzumab, indatuximab, inotuzumab, intetumumab, ipilimumab, iratumumab, labetuzumab, lexatumumab, lintuzumab, lorvotuzumab, lucatumumab, mapatumumab, matuzumab (matuzumab), milatuzumab, minretumomab, mitumomab, moxetumomab, narnatumab, naptumomab, necitumumab, nimotuzumab, nofetumomab, ocaratuzumab, ofatumumab, olaratumab b), onartuzumab, oportuzumab, oregovomab, panitumumab, parsatuzumab, patritumumab, pemtumomab, pertuzumab, pintumomab, pritumumab, racotumomab, radretumab, rilotumumab lotumumab, rituximab, lobatumumab, satumomab, sibrotuzumab, siltuximab, solitomab, tacatuzumab, taplitumomab, tenatumomab, teprotumumab, tigatuzumab, tositumomab,These include trastuzumab, tucotuzumab, ublituximab, veltuzumab, vorsetuzumab, votumumab, zalutumumab, CC49, and 3F8.
[0174] The present invention provides a method for treating cancer in a patient by administering two antibodies that bind to the same epitope on the PD-1 protein or two different epitopes on the PD-1 protein. Alternatively, cancer can be treated by administering a first antibody that binds to PD-1 and a second antibody that binds to a protein other than PD-1. In other embodiments, cancer can be treated by administering a bispecific antibody that binds to both PD-1 and a protein other than PD-1. For example, the protein other than PD-1 includes, but is not limited to, IL-2, IL-2R, IL-15, IL-15R, IL-7, IL-7R, IL-21, or IL-21R. For example, the protein other than PD-1 can be a tumor-associated antigen; the protein other than PD-1 can also be a cytokine.
[0175] In some embodiments, the invention provides for the administration of anti-PD-1 antibodies, alone or in combination with an additional antibody that recognizes another protein other than PD-1, along with cells capable of achieving or enhancing an immune response. For example, these cells can be peripheral blood mononuclear cells (PBMCs), or any cell type found in PBMCs, such as cytotoxic T cells, macrophages, and natural killer (NK) cells.
[0176] Additionally, the present invention provides for the administration of antibodies that bind to PD-1 protein and other therapeutic agents, including anti-neoplastic agents, such as small molecules, growth factors, cytokines, or biomolecules, such as peptides, peptidomimetics, peptoids, polynucleotides, lipid-derived mediators, small biogenic amines, hormones, neuropeptides, and proteases. Small molecules include, but are not limited to, inorganic and organic small molecules. Suitable growth factors or cytokines include IL-2, GM-CSF, and TNF-α. Small molecule libraries are known in the art. (See Lam, Anticancer Drug Des., 12:145, 1997.)
[0177] Chimeric antigen receptor (CAR) T-cell therapy Also provided herein are cell therapies such as chimeric antigen receptor (CAR) T cell therapy. CAR T cell therapy redirects a patient's T cells to kill tumor cells, for example, by exogenously expressing a CAR on the T cells. CARs can be transmembrane fusion proteins linking the antigen recognition domain of an antibody to the intracellular signaling domain of a T cell receptor and co-receptor. Suitable cells capable of secreting the anti-PD-1 antibodies of the present invention (or engineered to express the anti-PD-1 antibodies as described herein so that they are secreted) can be used. The secreted anti-PD-1 "payload" can be, for example, a minibody, ScFv, IgG molecule, bispecific fusion molecule, and other antibody fragments described herein.
[0178] Solid tumors present unique challenges for CAR-T therapy. Some barriers to CAR-T efficacy in solid tumors include heterogeneous antigen expression, poor tissue homing, activation, persistence, and an immunosuppressive tumor microenvironment. Unlike hematological cancers, tumor-associated target proteins are overexpressed between tumors and healthy tissues, resulting in on-target / off-tumor T cell killing of healthy tissues. Furthermore, immunosuppression in the tumor microenvironment (TME) limits CAR-T cell activation toward tumor killing. Through such contact or manipulation, the cells can then be introduced into a cancer patient in need of treatment. The cancer patient may have any of the types of cancer disclosed herein. The cells (e.g., T cells) may be, for example, but are not limited to, tumor-infiltrating T lymphocytes, CD4+ T cells, CD8+ T cells, or a combination thereof.
[0179] Exemplary CARs and CAR factories useful in embodiments of the present invention include those disclosed in, for example, PCT / US2015 / 067225 and PCT / US2019 / 022272, each of which is incorporated herein by reference in its entirety. For example, CAR-T cells can be generated according to methods known in the art using lentiviral systems (by transduction), retroviral systems (by transfection (electroporation)), and transposon systems (by PiggyBac). Useful promoters for payloads that can be used to generate CAR-Ts include, for example, constitutive promoters (the promoter is the same as that of the CAR-T, such as EF1α followed by IRES or 2A); inducible promoters (the promoter is different from that of the CAR-T, such as NFAT, IL-2prom); and genetically engineered promoters (such as a cytokine PD-1 locus "knock-in" and / or a promoter under the control of an endogenous promoter). In one embodiment, the PD-1 antibodies discussed herein can be used in the construction of multispecific antibodies or as a payload for CAR-T cells. For example, in one embodiment, the anti-PD-1 antibodies discussed herein can be used for targeting CARS (i.e., as a targeting moiety). In one embodiment, the anti-PD-1 antibodies discussed herein can be used as a payload secreted by CAR-T cells. In another embodiment, the anti-PD-1 antibodies discussed herein can be used as a targeting moiety, and a different PD-1 antibody targeting a different epitope can be used as the payload. In another embodiment, the payload can be an immunomodulatory antibody payload. In some embodiments, for use in CAR-T compositions, the PD-1 antibodies described herein are not high-affinity PD-1 antibodies (e.g., the antibodies therefore do not bind strongly to the PD-1 target).For example, the PD-1 antibodies described herein can be used as payloads secreted by CAR-T cells along with two targeting moieties (e.g., tumor-associated surface antigens) selected for a particular cancer (i.e., MSLN and MUC1 in ovarian cancer). Non-limiting examples of tumor-associated surface antigens include ErbB2 (HER2 / neu), carcinoembryonic antigen (CEA), epithelial cell adhesion molecule (EpCAM), epidermal growth factor receptor (EGFR), MUC1, MSLN, CD19, CD20, CD30, CD40, CD22, RAGE-1, MN-CA, and IL-1. IX, RET1, RET2 (AS), prostate-specific antigen (PSA), TAG-72, PAP, p53, Ras, prostein, PSMA, survivin, 9D7, prostate cancer tumor antigen-1 (PCTA-1), GAGE, MAGE, mesothelin, betaine-catenin, TGF-betaine RII, BRCA1 / 2, SAP-1, HPV-E6, HPV-E7 (for additional tumor-associated surface antigens, see also PCT / US2015 / 067225 and PCT / US2019 / 022272, which are incorporated by reference in their entireties).
[0180] Diagnostic Assays Anti-PD-1 antibodies can be used diagnostically, e.g., to monitor the development or progression of cancer, e.g., as part of a clinical trial procedure to determine the effectiveness of a given therapeutic and / or prophylactic regimen.
[0181] In some embodiments, for diagnostic purposes, the anti-PD-1 antibodies of the invention are conjugated to a detectable moiety to provide a method for detecting cancer cells, e.g., in a subject at risk for or afflicted with cancer.
[0182] The detectable moiety can be directly bound to the antibody or fragment, or indirectly bound, for example, by using a fluorescent secondary antibody. Direct binding can be achieved, for example, by standard chemical coupling of a fluorophore to the antibody or antibody fragment, or through genetic engineering. Chimeric or fusion proteins can be constructed containing an antibody or antibody fragment coupled to a fluorescent or bioluminescent protein. For example, Casadei, et al. (Proc Natl Acad Sci USA. 1990 Mar; 87(6):2047-51) describe a method for creating a vector construct capable of expressing a fusion protein of aequorin and antibody genes in mammalian cells.
[0183] As used herein, the term "labeled" with respect to a probe or antibody can encompass both direct labeling of the probe or antibody by coupling (i.e., physically linking) a detectable substance to the probe or antibody, as well as indirect labeling of the probe or antibody by reactivity with another directly labeled reagent. Examples of indirect labeling include detection of a primary antibody using a fluorescently labeled secondary antibody and end-labeling of a DNA probe with biotin so that it can be detected with fluorescently labeled streptavidin. The term "biological sample" is intended to include tissues, cells, and fluids isolated from a subject (e.g., biopsy), as well as tissues, cells, and fluids present within a subject. That is, the detection methods of the present invention can be used in vitro and in vivo to detect cells expressing PD-1 in biological samples. For example, in vitro techniques for detecting PD-1 include enzyme-linked immunosorbent assay (ELISA), Western blot, immunoprecipitation, and immunofluorescence. Additionally, in vivo techniques for detecting PD-1 involve introducing a labeled anti-PD-1 antibody into a subject. For example, the antibody can be labeled with a radioactive marker whose presence and location in a subject can be detected by standard imaging techniques.
[0184] In the case of "targeted" conjugates, i.e., conjugates containing a targeting moiety, which is a molecule or feature designed to localize the conjugate within a subject or animal at a specific site or sites, localization can refer to a state in which equilibrium between the bound, "localized" entity and the unbound, "free" entity within the subject is essentially achieved. The rate at which such equilibrium is achieved depends on the route of administration. For example, a conjugate administered by intravenous injection may achieve localization within minutes of injection, whereas an orally administered conjugate may take several hours to achieve localization. Alternatively, localization can simply refer to the location of an entity within a subject or animal at a selected period of time after the entity is administered. As another example, localization is achieved when the moiety becomes distributed after administration.
[0185] It is understood that reasonable estimates of the time to achieve localization can be made by one skilled in the art. Furthermore, the state of localization as a function of time can be tracked in accordance with the methods of the present invention by imaging the detectable moiety (e.g., luminescent conjugate) using, for example, a photodetector device. The "photodetector device" used should be sensitive enough to allow imaging of weak light from within the mammal in a reasonable amount of time and to construct an image using the signal from such a device.
[0186] If it is possible to use a very bright light-generating moiety and / or to detect a light-generating fusion protein localized near the surface of the object or animal being imaged, a pair of "night vision" goggles or a standard, highly sensitive video camera (e.g., a Silicon Intensified Tube (SIT) camera (e.g., Hamamatsu Photonic Systems, Bridgewater, NJ)) can be used. More typically, however, a more sensitive light detection method is required.
[0187] At extremely low light levels, the photon flux per unit area becomes so low that the scene being imaged no longer appears continuous. Instead, it is represented by individual photons that are distinct from one another both in time and space. When viewed on a monitor, such an image appears as scintillating dots of light, each representing a single detected photon. By accumulating these detected photons over time in a digital image processor, an image can be acquired and constructed. In contrast to conventional cameras, where the signal at each image point is assigned an intensity value, in photon-counting imaging, the amplitude of the signal is not important. The objective is simply to detect the presence of a signal (photon) and count its occurrences relative to its location over time.
[0188] At least two types of photodetector devices, described below, can detect individual photons and generate a signal that can be analyzed by an image processor. Noise-reducing photodetector devices achieve sensitivity by reducing the background noise of the photon detector rather than amplifying the photon signal. Noise is reduced primarily by cooling the detector array. These devices include charge-coupled device (CCD) cameras called "back-thinned" cooled CCD cameras. In more sensitive instruments, cooling is achieved using, for example, liquid nitrogen to bring the temperature of the CCD array to approximately -120°C. "Back-thinned" refers to an ultra-thin backplate, which reduces the path length that photons must take to be detected, thereby increasing quantum efficiency. A particularly sensitive back-thinned cryogenic CCD camera is the "TECH 512," a Series 200 camera available from Photometries, Ltd. (Tucson, Arizona).
[0189] "Photon amplification devices" amplify photons before they hit the detection screen. This class includes CCD cameras equipped with intensifiers, such as microchannel intensifiers. Microchannel intensifiers typically contain a metal array of channels perpendicular to and coextensive with the camera's detection screen. The microchannel array is placed between the sample, subject, or animal being imaged and the camera. Most photons entering the channels of the array contact the sides of the channels before exiting. When a voltage is applied to the array, many electrons are released from each photon collision. Electrons from such collisions exit their originating channels in a "shotgun" pattern and are detected by the camera.
[0190] Even greater sensitivity can be achieved by arranging intensifying microchannel arrays in series, so that electrons generated in the first stage produce an amplified signal of electrons in the second stage. However, the increased sensitivity is achieved at the expense of spatial resolution, which decreases with each additional stage of amplification. An exemplary microchannel intensifier-based single-photon detection device is the C2400 series, available from Hamamatsu.
[0191] The image processor processes the signals generated by the photon-counting photodetector device to construct an image that can be displayed on a monitor or printed on a video printer, for example. Such image processors are typically sold as part of a system that includes the high-sensitivity photon-counting camera described above, and are therefore available from the same sources. The image processor is usually connected to a personal computer, such as an IBM-compatible PC or an Apple Macintosh (Apple Computer, Cupertino, CA), and may or may not be included as part of a purchased imaging system. Once the image is in the form of a digital file, it can be manipulated and printed using various image processing programs (e.g., "ADOBE PHOTOSHOP," Adobe Systems, Mt. View, CA).
[0192] In one embodiment, the biological sample contains protein molecules from a test subject. One exemplary biological sample is a peripheral blood leukocyte sample isolated by conventional means from a subject.
[0193] The present invention also encompasses kits for detecting the presence of PD-1 or PD-1-expressing cells in a biological sample. For example, the kit can include a labeled compound or agent (e.g., an anti-PD-1 scFv or monoclonal antibody) capable of detecting cancer or tumor cells in a biological sample; a means for determining the amount of PD-1 in the sample; and a means for comparing the amount of PD-1 in the sample with a standard. In some embodiments, the standard is a non-cancerous cell or a cellular extract thereof. The compound or agent can be packaged in a suitable container. The kit can further include instructions for using the kit to detect cancer in a sample.
[0194] Other embodiments While the present invention has been described in conjunction with its detailed description, the foregoing description is intended to be illustrative, but not limiting, of the scope of the invention, which is defined by the appended claims. Other aspects, advantages, and modifications are within the scope of the appended claims.
[0195] The present invention is further described in the following examples, which do not limit the scope of the invention described in the claims. [Example]
[0196] Examples are provided below to facilitate a more complete understanding of the present invention. The following examples illustrate exemplary modes of making and practicing the present invention. However, the scope of the present invention is not limited to the specific embodiments disclosed in these examples, which are for illustrative purposes only, as alternative methods may be used to obtain similar results.
[0197] Example 1 - PMPL Panning The PD-1 antibodies of the present invention (e.g., P4-B3 and P4-B7) were discovered by PMPL panning. Briefly, PD-1 was expressed genetically fused to a C-terminal C9 tag (TETSQVAPA). Expi293 cells were transiently transfected and then lysed. The lysate was clarified, and PD-1 protein was captured using 1D4 (anti-C9 tag)-conjugated magnetic beads. The beads were then dialyzed in a lipid solution, which formed a lipid bilayer around the beads, simulating the cell membrane and aiding in protein stability. These beads were then used for panning.
[0198] Example 2 - Minibody Binding Curves Minibody binding curves were performed using transfected cells (see Figure 4). Binding curves for the P4-B3 minibody were generated using cells transfected with human or cynomolgus PD1. The human variant was performed twice, while the negative and cynomolgus variants were performed once. Curves were generated using Expi293 cells 48 hours after transfection. The human variant curves were normalized based on expression levels using commercial antibody staining, but the cynomolgus variants were not. The cynomolgus variants were not normalized because the commercial antibody used has not been reported to bind to cynomolgus PD-1.
[0199] Example 3 - Octet binding curves of different antibody types of P4-B3 The streptavidin sensor was loaded with 3 μg / ml of biotinylated PD-1. The highest concentration of all forms of P4-B3 was 50 nM, and a 3 / 4 serial dilution was performed. Kinetic calculations were performed using Octet Red software and are shown in Figure 5. According to the EMEA Assessment Report (EMEA / H / C / 003820 / 0000), the KD of Pembro is reported to be 2.9E-11 M, which is comparable to the results obtained for Pembro from experiments.
[0200] Example 4 - PD-L1 competition assay SA sensors were loaded with 3 μg / ml PD-1 and then incubated with various concentrations (50–0 nM) of either Pembro (IgG) or P4-B3 (IgG or minibody), followed by 5 μg / ml PD-L1. In Figure 6, the red curve represents the maximum amount of PD-L1 binding to an unloaded, PD-1-functionalized sensor. As shown in Figure 6, the P4-B3 antibody appears to block a significant portion of PD-L1 binding, although there is a slight shift upon addition of PD-L1. The curve does not include the antibody loading step; instead, it shows only the PD-L1 binding step. The original antibody binding step is detailed in Figure 5.
[0201] Example 5 - IgG ELISA ELISA plates were coated with 1 μg / ml soluble PD1 for 2 hours at 37°C. Plates were then washed and blocked with 2% BSA / PBS for 1 hour at 37°C. The blocking solution was removed, and 3x serial dilutions of antibody, starting at 6 μg / ml, were added to each well (100 μl) in 2% milk-PBST. Plates were then incubated at room temperature with gentle shaking, washed six times with PBS-T, and secondary anti-human Fc-HRP (1:150k, Bethyl) was added. Plates were again incubated at room temperature with gentle shaking for 1 hour, then washed six times with PBS-T. TMB substrate was added, and the plate was incubated at 30°C for 10 minutes to promote the HRP reaction. The signal was then quenched with TMB stop solution and read at 450 nm. See the top graph in Figure 7.
[0202] The same protocol as described herein was performed for the bottom graph of Figure 7, except plates were coated with 3x serial dilutions of antigen starting at 6ug / ml. Antibody was then added to all wells at a constant concentration of 1ug / ml.
[0203] Example 6 - PD1 FACS with anti-PD1 IgG T cells were cultured in complete DMEM (293FT medium) with or without 5 μg / ml PHA for 48 hours. Pembrolizumab and P4-B3 antibodies were detected with Biolegend's anti-human IgG Fc APC (Cat. No. 409306). As shown in Figure 8, the P4-B3 PD-1 antibody exhibits a binding pattern similar to that of pembrolizumab and a control anti-PD1 antibody.
[0204] Example 7 - PD1-PDL1 Bioassay A Promega PD1-PDL1 bioassay (J1250) was performed using a PD-1 antibody of the invention (P4-B3) and the commercially available antibodies pembrolizumab and nivolumab (Figure 9).
[0205] The constructs tested included: (a) IgG1: wild-type monomer; (b) LALA: monomer, hexamer, and mutant 3; (c) sIgG4: monomer and hexamer; control: mAb11 LALA monomer.
[0206] All samples were performed in triplicate except for mAb11.
[0207] Fold induction: RLU stimulated / RLU unstimulated (no Ab) (Figure 10).
[0208] Example 8 - Anti-PD-1 cross-reactivity Many anti-PD-1 antibodies cannot cross-react with mouse and human PD-1 (Pembro and Nivo are not cross-reactive). See Fessas, Petros et al., "A molecular and preclinical comparison of the PD-1-targeted T-cell checkpoint inhibitors nivolumab and pembrolizumab," Seminars in Oncology, vol. 44, 2 (2017): 136-140. Also see Tan JBL, Chen C, Chen K, "Preclinical Characterization of GLS-010 (AB122): A Fully Human Clinical-Stage Anti-PD-1 Antibody," Poster, Arcus Biosciences; Burova, Elena et al., "Characterization of the Anti-PD-1 Antibody REGN2810 and Its Antitumor Activity in Human PD-1 Knock-In Mice," Large Molecule Therapeutics, 2017. See also Li, Dong et al., "Epitope mapping reveals the binding mechanism of a functional antibody cross-reactive to both human and murine programmed death1," mAbs, vol. 9, 4 (2017): 628-637.
[0209] The antibodies of the present invention (eg, P4-B3) are cross-reactive.
[0210] Expi293 cells transiently transfected with 3E5 were suspended in 100 μl of MACS buffer and added to each well. Next, 50 μl of each antibody dilution was mixed with the cells, and the plate was incubated at 4°C for 30 minutes. After incubation, the plate was washed twice with MACS buffer and then incubated with 1 μl / well of anti-human Fc-APC (Biolegend #409306). The plate was incubated at 4°C for 25 minutes and washed three times before analyzing the samples.
[0211] As shown in Figure 16, P4-B3 has moderate affinity for mouse PD-1, setting it apart from Pembro and Nivo.
[0212] Example 9 - Affinity Maturation Yeast library generation First, the P4-B3 scFv from the pFarber vector (phage display) is excised and pasted into the pCTCON2 vector (yeast display). Then, the library is generated according to two methods implemented in the art: (1) digestion / ligation in bacteria and transformation of the intact plasmid into yeast; and (2) linearized vector + PCR fragment for homologous recombination in yeast. The digestion / ligation method (method (1) described herein) resulted in a very low library size, low efficiency of ligation / bacterial transformation, and very low efficiency of transformation into yeast. However, homologous recombination (method (2) described herein) resulted in a high library size of approximately 10 6 ~10 7 This resulted in a library with mutants.
[0213] Error-prone mutagenesis The Agilent GeneMorph II random mutagenesis kit was used, which is designed to vary the mutation rate based on the initial template DNA. TIFF2025121996000032.tif41128
[0214] External primers (approximately 50-60 bp overlap with the pCTCON2 vector): (a) pCTCON2-HR-Fwd: GAGGAGGCTCTGGTGGAGGCGGTAGCGGAGGCGGAGGGTCGGCTAGCTGGGCCCAGCCGG (b) pCTCON2-HR-Rev: ACACTGTTGTTATCAGATCTCGAGCTATTACAAGTCCTCTTCAGAAATAAGCTTTTGTTC
[0215] Internal primers (45 bp overlap with heavy or light chain fragment): (a) G4S-Fwd: GGTGGCGGCGGTTCCGGAGGTGGTGGTTCTGGCGGTGGTGGCAGC (b) G4S-Rev: GCTGCCACCACCGCCAGAACCACCACCTCCGGAACCGCCGCCACC
[0216] Error-prone mutagenesis strategies (a) PCR of the entire scFv fragment using external primers. This strategy allows for mutations in the linker region, which is undesirable. (b) PCR of the heavy and light chains using external and G4S primers separately, using the G4S linker as the third overlap point for three-piece homologous recombination. This strategy protects the linker from mutations but requires three-piece homologous recombination, which may be less efficient than two-piece.
[0217] Both techniques were used with various amounts of template DNA. The template for the whole scFv PCR was the pCTCON4 vector into which P4-B3 had been cloned (approximately 1 / 10 of the template was the target sequence). The template for the separate heavy / light chain PCRs was the P4-B3 PCR fragment (approximately 1 / 2 of the template was the target sequence).
[0218] Templates used - PCR of whole scFv: 4ug, 2ug, 1ug, 0.5ug; separate PCR of heavy / light chain: 450ng, 50ng (each in duplicate).
[0219] * PCR was performed for 33 cycles to increase DNA yield.
[0220] Generating the library The protocol described in Benatuil et al., "An improved yeast transformation method for the generation of very large human antibody libraries," Protein Eng Des Sel. 2010 Apr;23(4):155-9 was followed.
[0221] General protocol: EBY100 yeast cells were inoculated into 100 ml of YPD medium at an OD600 of 0.3 and grown at 30°C for approximately 5-6 hours until an OD600 of 1.6 was reached. Cells were collected by centrifugation, washed twice with 50 ml of cold ddH2O, and once with 50 ml of cold electroporation buffer (1 M sorbitol / 1 mM CaCl2). Cells were then conditioned by shaking in 20 ml of 0.1 M LiAc / 10 mM DTT at 30°C for 30 minutes. Cells were harvested and washed with 50 ml of cold electroporation buffer. After pelleting, cells were resuspended in a final volume of 1 ml, suitable for two transformations.
[0222] Whole scFv PCR: 4.8 ug of insert was obtained and mixed with 4 ug of linearized vector (NcoI / BamHI).
[0223] Heavy / light chain PCR: 4.1 μg of HC and 3.5 μg of LC were obtained, which were reduced to 3 μg of linearized vector (NcoI / BamHI).
[0224] The vector and desired fragment were mixed and then EtOH precipitated to reduce the volume (to less than 50 ul). 400 ul of electrocompetent yeast cells were transformed using a Biorad at 2.5 kV and 25 uF. After the cells were allowed to recover in 1:1 YPD:1 M sorbitol for 1 hour, the cells were spun down, washed with SDCAA, and resuspended in 250 ml of SDCAA for each transformation.
[0225] Titers: (a) whole scFv library: approx. 5.2E6 members; (b) separate H / L chains: approx. 5.8E6 members.
[0226] After two passages, colonies were plated for sequencing (96 colonies per library). Overall scFv library: 56 / 96 (58.33%) had at least one mutation. Separate H / L chain libraries: 42 / 96 (43.75%) had at least one mutation.
[0227] Effective library size: (a) total scFv library: approximately 2.9E6 members; (b) separate H / L chains: approximately 2.1E6 members.
[0228] Library selection strategies Two staining methods were used: (1) standard staining, which looks for improved binding (shift to the upper right quadrant during FACS analysis); and (2) a kinetic strategy, which looks for improved off-rates.
[0229] In dynamic staining, the library is stained with labeled antigen at a concentration 10 times the Kd, washed, and then incubated with an increasing volume of unlabeled antigen at a concentration 100 times the Kd. Incubating the sample in a larger volume prevents dissociating antigen from rebinding to yeast. Furthermore, adding a higher concentration of unlabeled antigen means that any released labeled antigen will be replaced by unlabeled antigen.
[0230] In dynamic staining, the staining time depends on the time constant (τ). τ=(k on [Ag]0+k off )-1
[0231] where k = on rate (M^-1s^-1); k = off rate (s^-1); and [Ag] = initial antigen concentration (M).
[0232] From octet measurements, the P4-B3 scfv has k=6.85E4, koff=6.45E-5, and Kd=9.4E10.
[0233] At 95% of equilibrium binding, the binding is 3τ, and at 99% the binding is 5τ.
[0234] The staining protocol was performed according to Cherf and Cochran, "Applications of Yeast Surface Display for Protein Engineering", Methods Mol Biol. 2015;1319:155-75.
[0235] Briefly, high-affinity protein variants were isolated from yeast display libraries by FACS. Following transformation of yeast cells with the gene library and induction of surface expression, two main strategies are used to differentially label the displayed library prior to screening: (1) an equilibrium binding strategy, in which the library is screened based on the expected K of the highest affinity variants; D (2) a kinetic binding strategy (where the library is incubated with the ligand as described for the equilibrium binding strategy, but unbound ligand is removed by washing, and the library is then incubated with a 100-fold excess of unlabeled ligand or in a large enough volume of buffer to prevent rebinding of dissociated ligand).
[0236] During this second incubation step, excess unlabeled ligand or a large incubation volume prevents dissociated labeled ligand from rebinding. Proteins are therefore differentiated based on their dissociation rate constant (koff), with mutants with the slowest koff retaining the greatest percentage of pre-bound labeled ligand. Addition of a fluorescently labeled anti-epitope tag antibody allows normalization of yeast surface expression levels by binding, allowing the isolation of the highest affinity mutants by FACS. The selected pool of yeast clones can be expanded in culture for either analysis or subsequent selection, or DNA from these clones can be isolated, subjected to mutagenesis, and used to transform new batches of yeast for further protein evolution. Components of the yeast display platform, such as the Aga1p, Aga2p, HA, and c-myc epitope tags, as well as the detection antibodies shown in Figure 17, are omitted for clarity.
[0237] Library Selection Libraries were sorted on a Sony SH800, recovering approximately 1,000 clones per sample. Samples were sorted for clones with increased or decreased binding (critical residues were mapped). Sorted cells were plated, and only a few dozen grew, all of which were sequenced. Standard and dynamic staining were used to focus on separate heavy and light chain libraries. TIFF2025121996000033.tif42128
[0238] Sorted cells were plated onto SDCAA plates and incubated at 30°C for 3 days. Colonies were then picked, grown in fresh SDCAA medium, and sequenced to identify significant mutations. Unique clones from sequencing were then inoculated into fresh SGCAA (induced with galactose), and 36 hours later, samples were stained to generate binding curves.
[0239] EBY100 yeast cultures were induced for 1.5 days at 30°C. 1E6 cells were spun down and placed into wells containing various dilutions of antigen in PBS. Plates were incubated for 2 hours at room temperature with shaking. Plates were washed with PBS and 0.1 μg / ml streptavidin-APC (biolegend) was added to each well. Plates were incubated for 25 minutes at room temperature with shaking, then washed and read on a FACSCalibur.
[0240] Clones 2, 7, 10, and 14 were derived from a random mutagenesis library of P4-B3 (anti-PD1) and selected for higher binding (shifted on the x-axis). HL clones were generated separately by error-prone heavy and light chain mutations before being recombined by homologous recombination via linker sequences. HL Dynamic 1 was derived from a dynamic staining approach in which the library was incubated with 10×Kd labeled antigen, followed by a prolonged incubation with a 100-fold excess of unlabeled antigen (10 times the original chromosome volume). P4-B3 wild-type was not positive at this stage, but only a few clones in the library popped up (see Figure 20). The experiment was repeated at appropriate concentrations, and only clones that shifted the curve to the left were used (see Figure 21).
[0241] Other clones identified but not yet characterized TIFF2025121996000034.tif60133
[0242] scFv positives were primarily clones that expressed lower amounts of cMyc but showed some increased binding by binding higher amounts of PD-1 (none were shifted upwards on the x=y axis).
[0243] scFv negatives are clones that showed reduced binding compared to wild type.
[0244] In addition to cloning HLkin1, HL-7, and HL-14 into the minibody vector, double (Mut+2:HLkin1+HL-7) and triple (Mut+3:HLkin1+HL-7+HL-14) combination mutants were generated to determine whether additive effects were observed (see Figures 23 and 24).
[0245] For example, the following K D are being measured: PD1#3 approx. 1E-10M P4-B3 wild type approximately 1E-9M Mut+2 (HLkin1+HL-7) approx. 3E-11M Mut+3(HLkin1+HL-7+HL-14) approx. 3E-12M HLkin-1 approx. 6E-11M
[0246] Example 10 - PD1 bioassay using IgG A Promega PD1-PDL1 bioassay (J1250) was performed using PD-1 antibodies of the invention (e.g., P4-B3 and variants described herein) and the commercially available antibodies pembrolizumab and nivolumab (Figure 33).
[0247] Nivo (green triangle) reached an induction fold of approximately 5–6, similar to previous experiments. In the scFv-Fc experiments, Mut+2, Mut+3, HLkin-1, and HL-7 all showed increased induction compared to Nivo. When converted to IgG, the combo mutant (Mut+2 / Mut+3) continued to function better than Nivo and at a level comparable to Pembro, while the single mutant (HLkin-1 / HL-7) showed slightly reduced activity. The original P4-B3 IgG was significantly lower than that of all antibodies. Clone scFv-6 is a double mutant derived from a yeast library and contains two light chain mutations. As can be seen, this is an improvement over the P4-B3 wild-type antibody, but is significantly worse than the commercially available antibody and other mutant antibodies.
[0248] Example 11 - Mixed Lymphocyte Reaction (MLR) Protocol CD14+ monocytes were isolated using Miltenyi CD14+ microbeads. Cells were cultured in Miltenyi Mo-DC medium (prepared medium containing GM-CSF and IL4). After 5 days of culture, TNF-α (1000 U / ml), IL-1β (5 ng / ml), IL-6 (10 ng / ml), and prostaglandin E2 (PGE2) (1 μM) were added, and the cells were cultured for 2 days to mature DCs. T cells were isolated on the day of the MLR experiment (CD4+ negative selection kit, StemCell). 100,000 T cells and 10,000 MoDC cells were used per well in the MLR. Antibodies were added at various concentrations, and the cultures were incubated for 5 days.
[0249] The supernatant was saved for ELISA screening (e.g., IL2 and IFNγ). For FACS analysis, cells were stained with CD4-FITC, PD1-PE, LAG3-BV421, TIM3-APCCy7.
[0250] MLR Pembro vs. P4-B3mut+3 IgG4. Two T cell donors and two DC donors were used. Graph titles in Figures 42 and 43 indicate the cytokine measured, T cell donor, and DC donor. IL2 T2 DCV Untreated corresponds to IL2 assay, T cell donor 2, DC donor V.
[0251] The sIgG4 version of the P4-B3mut+3 antibody was tested against pembrolizumab and a commercially available preparation of F10-sIgG4 (negative control). As shown in Figures 42 and 43, the addition of either P4-B3mut+3 or pembrolizumab results in a significant increase in cytokine production compared to that of F10.
[0252] equivalent Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, numerous equivalents to the specific substances and procedures specifically described herein which equivalents are considered to be within the scope of this invention and covered by the following claims.
[0253] Sequence information SEQUENCE LISTING <110> DANA-FARBER CANCER INSTITUTE, INC. <120> ANTIBODIES AGAINST PD-1 AND METHODS OF USE THEREOF <150> US 62 / 861,643 <151> 2019-06-14 <160> 140 <170> PatentIn version 3.5 <210> 1 <211> 122 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic Polyp <400> 1 Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr 20 25 30 Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Gly Ile Ser Trp Asn Ser Gly Ser Ile Gly Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Val Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ser Asp Tyr Gly Asp Lys Tyr Tyr Tyr Tyr Gly Met Asp Val Trp 100 105 110 Gly Lys Gly Thr Thr Val Thr Val Ser Ser 115 120 <210> 2 <211> 111 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 2 Gln Pro Gly Leu Thr Gln Pro Pro Ser Ala Ser Gly Thr Pro Gly Gln 1 5 10 15 Arg Val Thr Ile Ser Cys Ser Gly Ser Ser Ser Asn Ile Gly Ser Asn 20 25 30 Thr Val Asn Trp Tyr Gln Gln Phe Pro Gly Lys Ala Pro Lys Leu Leu 35 40 45 Ile Phe Asn Asp Asn Gln Arg Pro Ser Gly Val Pro Asp Arg Phe Ser 50 55 60 Ala Ser Lys Ser Gly Thr Ser Ala Ser Leu Ala Ile Ser Gly Leu Gln 65 70 75 80 Ser Glu Asp Glu Ala Asp Tyr Tyr Cys Ala Ala Trp Asp Gly Gly Leu 85 90 95 Asn Gly Arg Gly Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 110 <210> 3 <211> 122 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 3 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Glu 1 5 10 15 Ser Leu Lys Ile Ser Cys Lys Asp Ser Gly Tyr Thr Phe Thr Thr Tyr 20 25 30 Trp Ile Gly Trp Val Arg Gln Leu Pro Gly Lys Gly Leu Glu Leu Met 35 40 45 Gly Ile Ile Tyr Pro Asp Asp Ser Asp Thr Thr Tyr Ser Pro Ser Phe 50 55 60 Gln Gly His Val Thr Ile Ser Ala Asp Lys Ser Ile Asn Thr Ala Tyr 65 70 75 80 Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp Thr Ala Met Tyr Tyr Cys 85 90 95 Ala Phe Trp Gly Ala Ser Gly Ala Pro Val Asn Gly Phe Asp Ile Trp 100 105 110 Gly Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 4 <211> 112 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 4 Leu Pro Val Leu Thr Gln Pro Pro Ser Ala Ser Gly Thr Pro Gly Gln 1 5 10 15 Arg Val Thr Ile Ser Cys Thr Gly Ser Ser Ser Asn Ile Gly Ala Gly 20 25 30 Tyr Val Val His Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu 35 40 45 Leu Ile Tyr Ser Asn Asn Gln Arg Pro Ser Gly Val Pro Asp Arg Phe 50 55 60 Ser Gly Ser Lys Ser Gly Thr Ser Ala Ser Leu Ala Ile Ser Gly Leu 65 70 75 80 Gln Ser Glu Asp Glu Ala Asp Tyr Tyr Cys Ala Ala Trp Asp Asp Ser 85 90 95 Leu Asn Ala Pro Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Leu 100 105 110 <210> 5 <211> 125 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 5 Gln Val Gln Leu Gln Gln Ser Gly Pro Gly Leu Val Arg Pro Ser Ala 1 5 10 15 Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Asp Ser Val Ser Ser Asp 20 25 30 Asn Tyr Phe Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Pro Leu Glu 35 40 45 Trp Ile Gly Tyr Val Tyr Tyr Asn Gly Asn Thr Asn Tyr Asn Pro Ser 50 55 60 Phe Asn Ser Arg Val Thr Met Ser Leu Asp Thr Ser Lys Asn Gln Phe 65 70 75 80 Ser Leu Lys Leu Arg Ser Val Thr Ala Ala Asp Thr Ala Phe Tyr Tyr 85 90 95 Cys Ala Thr Glu Thr Pro Pro Thr Ser Tyr Phe Asn Ser Gly Pro Phe 100 105 110 Asp Ser Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 125 <210> 6 <211> 110 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 6 Gln Pro Gly Leu Thr Gln Pro Pro Ser Val Ser Lys Gly Leu Arg Gln 1 5 10 15 Thr Ala Thr Leu Thr Cys Thr Gly Ser Ser Asn Asn Val Gly Ala His 20 25 30 Gly Ala Ala Trp Leu Gln Gln His Gln Gly His Pro Pro Lys Leu Leu 35 40 45 Ala Tyr Arg Asn Asn Asn Arg Pro Ser Gly Ile Ser Glu Arg Phe Ser 50 55 60 Ala Ser Arg Ser Gly Asn Thr Ala Ser Leu Thr Ile Ile Gly Leu Gln 65 70 75 80 Pro Glu Asp Glu Gly Asp Tyr Tyr Cys Ser Ser Trp Asp Ser Ser Leu 85 90 95 Ser Gly Tyr Val Phe Gly Pro Gly Thr Lys Val Thr Val Leu 100 105 110 <210> 7 <211> 118 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 7 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser 1 5 10 15 Ser Val Lys Val Ser Cys Lys Thr Ser Gly Tyr Thr Phe Asn Arg Phe 20 25 30 Gly Leu Thr Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45 Gly Trp Thr Asn Pro Tyr Asn Gly Asn Thr Arg Tyr Ala Gln Lys Phe 50 55 60 Gln Gly Arg Val Thr Met Thr Thr Asp Thr Ser Thr Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Arg Ser Leu Arg Ser Asp Asp Thr Ala Met Tyr Phe Cys 85 90 95 Ala Arg Val Val Ala Val Asn Gly Met Asp Val Trp Gly Gln Gly Thr 100 105 110 Thr Val Thr Val Ser Ser 115 <210> 8 <211> 111 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 8 Asn Phe Met Leu Thr Gln Pro His Ser Val Ser Glu Ser Pro Gly Lys 1 5 10 15 Thr Val Thr Ile Ser Cys Thr Arg Asn Ser Gly Ser Ile Ala Ala Tyr 20 25 30 Tyr Val Gln Trp Tyr Gln Gln Arg Pro Gly Ser Ser Pro Thr Thr Val 35 40 45 Ile Tyr Glu Asp Asn Gln Arg Pro Ser Gly Val Pro Asp Arg Phe Ser 50 55 60 Gly Ser Ile Asp Ser Ser Ser Asn Ser Ala Ser Leu Thr Ile Ser Gly 65 70 75 80 Leu Lys Thr Glu Asp Glu Ala Asp Tyr Tyr Cys Gln Ser Tyr Asp Ser 85 90 95 Ser Asn Leu Trp Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 110 <210> 9 <211> 117 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 9 Glu Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ser Gln Thr Val Ala Gly Ser Asp Tyr Trp Gly Gln Gly Thr Leu 100 105 110 Val Thr Val Ser Ser 115 <210> 10 <211> 108 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 10 Gln Pro Gly Leu Thr Gln Pro Pro Ser Val Pro Val Ala Pro Gly Gln 1 5 10 15 Thr Ala Arg Ile Thr Cys Gly Gly Asn Asn Ile Gly Ser Lys Ser Val 20 25 30 His Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val Leu Val Val Tyr 35 40 45 Asp Asp Ser Asp Arg Pro Ser Gly Ile Pro Glu Arg Phe Ser Gly Ser 50 55 60 Asn Ser Gly Asn Thr Ala Thr Leu Thr Ile Ser Arg Val Glu Ala Gly 65 70 75 80 Asp Glu Ala Asp Tyr Tyr Cys Gln Val Trp His Ser Val Ser Asp Gln 85 90 95 Gly Val Phe Gly Thr Gly Thr Lys Val Thr Val Leu 100 105 <210> 11 <211> 111 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 11 Gln Pro Gly Leu Thr Gln Pro Pro Ser Ala Ser Gly Thr Pro Gly Gln 1 5 10 15 Arg Val Thr Ile Ser Cys Ser Gly Ser Ser Ser Asn Ile Gly Ser Asn 20 25 30 Thr Val Asn Trp Tyr Gln Gln Phe Pro Gly Lys Ala Pro Lys Leu Leu 35 40 45 Ile Phe Asp Asp Asn Gln Arg Pro Ser Gly Val Pro Asp Arg Phe Ser 50 55 60 Ala Ser Lys Ser Gly Thr Ser Ala Ser Leu Ala Ile Ser Gly Leu Gln 65 70 75 80 Ser Glu Asp Glu Ala Asp Tyr Tyr Cys Ala Ala Trp Asp Gly Gly Leu 85 90 95 Asn Gly Arg Gly Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 110 <210> 12 <211> 122 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 12 Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr 20 25 30 Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Gly Ile Ser Trp Asn Ser Gly Ser Ile Gly Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Val Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ser Asp Tyr Gly Asp Lys Tyr Ser Tyr Tyr Gly Met Asp Val Trp 100 105 110 Gly Lys Gly Thr Thr Val Thr Val Ser Ser 115 120 <210> 13 <211> 122 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 13 Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Phe 20 25 30 Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Gly Ile Ser Trp Asn Ser Gly Ser Ile Gly Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Val Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ser Asp Tyr Gly Asp Lys Tyr Tyr Tyr Tyr Gly Met Asp Val Trp 100 105 110 Gly Lys Gly Thr Thr Val Thr Val Ser Ser 115 120 <210> 14 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 14 Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 1 5 10 <210> 15 <211> 122 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 15 Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Phe 20 25 30 Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Gly Ile Ser Trp Asn Ser Gly Ser Ile Gly Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Val Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ser Asp Tyr Gly Asp Lys Tyr Ser Tyr Tyr Gly Met Asp Val Trp 100 105 110 Gly Lys Gly Thr Thr Val Thr Val Ser Ser 115 120 <210> 16 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 16 Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser 20 25 <210> 17 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 17 Gly Phe Thr Phe Asp Asp Tyr Ala 1 5 <210> 18 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 18 Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser 1 5 10 15 Gly <210> 19 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 19 Ile Ser Trp Asn Ser Gly Ser Ile 1 5 <210> 20 <211> 38 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 20 Gly Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Val Ser Arg Asp Asn 1 5 10 15 Ala Lys Asn Ser Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp 20 25 30 Thr Ala Val Tyr Tyr Cys 35 <210> 21 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 21 Ala Ser Asp Tyr Gly Asp Lys Tyr Tyr Tyr Tyr Gly Met Asp Val 1 5 10 15 <210> 22 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 22 Trp Gly Lys Gly Thr Thr Val Thr Val Ser Ser 1 5 10 <210> 23 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 23 Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser 1 5 10 <210> 24 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 24 Ser Ser Asn Ile Gly Ser Asn Thr 1 5 <210> 25 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 25 Gln Pro Gly Leu Thr Gln Pro Pro Ser Ala Ser Gly Thr Pro Gly Gln 1 5 10 15 Arg Val Thr Ile Ser Cys Ser Gly Ser 20 25 <210> 26 <211> 3 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 26 Asn Asp Asn 1 <210> 27 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 27 Val Asn Trp Tyr Gln Gln Phe Pro Gly Lys Ala Pro Lys Leu Leu Ile 1 5 10 15 Phe <210> 28 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 28 Ala Ala Trp Asp Gly Gly Leu Asn Gly Arg Gly Val 1 5 10 <210> 29 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 29 Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 1 5 10 <210> 30 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 30 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Glu 1 5 10 15 Ser Leu Lys Ile Ser Cys Lys Asp Ser 20 25 <210> 31 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 31 Gly Tyr Thr Phe Thr Thr Tyr Trp 1 5 <210> 32 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 32 Ile Gly Trp Val Arg Gln Leu Pro Gly Lys Gly Leu Glu Leu Met Gly 1 5 10 15 Ile <210> 33 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 33 Ile Tyr Pro Asp Asp Ser Asp Thr 1 5 <210> 34 <211> 38 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 34 Thr Tyr Ser Pro Ser Phe Gln Gly His Val Thr Ile Ser Ala Asp Lys 1 5 10 15 Ser Ile Asn Thr Ala Tyr Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp 20 25 30 Thr Ala Met Tyr Tyr Cys 35 <210> 35 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 35 Ala Phe Trp Gly Ala Ser Gly Ala Pro Val Asn Gly Phe Asp Ile 1 5 10 15 <210> 36 <211> 35 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 36 Leu Pro Val Leu Thr Gln Pro Pro Ser Ala Ser Gly Thr Pro Gly Gln 1 5 10 15 Arg Val Thr Ile Ser Cys Thr Gly Ser Phe Gly Gly Gly Thr Lys Leu 20 25 30 Thr Val Leu 35 <210> 37 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 37 Ser Ser Asn Ile Gly Ala Gly Tyr Val 1 5 <210> 38 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 38 Val His Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu Leu Ile 1 5 10 15 Tyr <210> 39 <211> 3 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 39 Ser Asn Asn 1 <210> 40 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 40 Gln Arg Pro Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Lys Ser Gly 1 5 10 15 Thr Ser Ala Ser Leu Ala Ile Ser Gly Leu Gln Ser Glu Asp Glu Ala 20 25 30 Asp Tyr Tyr Cys 35 <210> 41 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 41 Ala Ala Trp Asp Asp Ser Leu Asn Ala Pro Val 1 5 10 <210> 42 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 42 Gln Val Gln Leu Gln Gln Ser Gly Pro Gly Leu Val Arg Pro Ser Ala 1 5 10 15 Thr Leu Ser Leu Thr Cys Thr Val Ser 20 25 <210> 43 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 43 Gly Asp Ser Val Ser Ser Asp Asn Tyr Phe 1 5 10 <210> 44 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 44 Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Pro Leu Glu Trp Ile Gly 1 5 10 15 Tyr <210> 45 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 45 Val Tyr Tyr Asn Gly Asn Thr 1 5 <210> 46 <211> 38 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 46 Asn Tyr Asn Pro Ser Phe Asn Ser Arg Val Thr Met Ser Leu Asp Thr 1 5 10 15 Ser Lys Asn Gln Phe Ser Leu Lys Leu Arg Ser Val Thr Ala Ala Asp 20 25 30 Thr Ala Phe Tyr Tyr Cys 35 <210> 47 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 47 Ala Thr Glu Thr Pro Pro Thr Ser Tyr Phe Asn Ser Gly Pro Phe Asp 1 5 10 15 Ser <210> 48 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 48 Gln Pro Gly Leu Thr Gln Pro Pro Ser Val Ser Lys Gly Leu Arg Gln 1 5 10 15 Thr Ala Thr Leu Thr Cys Thr Gly Ser 20 25 <210> 49 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 49 Ser Asn Asn Val Gly Ala His Gly 1 5 <210> 50 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 50 Ala Ala Trp Leu Gln Gln His Gln Gly His Pro Pro Lys Leu Leu Ala 1 5 10 15 Tyr <210> 51 <211> 3 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 51 Arg Asn Asn 1 <210> 52 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 52 Asn Arg Pro Ser Gly Ile Ser Glu Arg Phe Ser Ala Ser Arg Ser Gly 1 5 10 15 Asn Thr Ala Ser Leu Thr Ile Ile Gly Leu Gln Pro Glu Asp Glu Gly 20 25 30 Asp Tyr Tyr Cys 35 <210> 53 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 53 Ser Ser Trp Asp Ser Ser Leu Ser Gly Tyr Val 1 5 10 <210> 54 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 54 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser 1 5 10 15 Ser Val Lys Val Ser Cys Lys Thr Ser 20 25 <210> 55 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 55 Gly Tyr Thr Phe Asn Arg Phe Gly 1 5 <210> 56 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 56 Leu Thr Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met Gly 1 5 10 15 Trp <210> 57 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 57 Thr Asn Pro Tyr Asn Gly Asn Thr 1 5 <210> 58 <211> 38 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 58 Arg Tyr Ala Gln Lys Phe Gln Gly Arg Val Thr Met Thr Thr Asp Thr 1 5 10 15 Ser Thr Ser Thr Ala Tyr Met Glu Leu Arg Ser Leu Arg Ser Asp Asp 20 25 30 Thr Ala Met Tyr Phe Cys 35 <210> 59 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 59 Ala Arg Val Val Ala Val Asn Gly Met Asp Val 1 5 10 <210> 60 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 60 Asn Phe Met Leu Thr Gln Pro His Ser Val Ser Glu Ser Pro Gly Lys 1 5 10 15 Thr Val Thr Ile Ser Cys Thr Arg Asn 20 25 <210> 61 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 61 Ser Gly Ser Ile Ala Ala Tyr Tyr 1 5 <210> 62 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 62 Val Gln Trp Tyr Gln Gln Arg Pro Gly Ser Ser Pro Thr Thr Val Ile 1 5 10 15 Tyr <210> 63 <211> 3 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 63 Glu Asp Asn 1 <210> 64 <211> 38 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 64 Gln Arg Pro Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Ile Asp Ser 1 5 10 15 Ser Ser Asn Ser Ala Ser Leu Thr Ile Ser Gly Leu Lys Thr Glu Asp 20 25 30 Glu Ala Asp Tyr Tyr Cys 35 <210> 65 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 65 Gln Ser Tyr Asp Ser Ser Asn Leu Trp Val 1 5 10 <210> 66 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 66 Glu Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser 20 25 <210> 67 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 67 Gly Phe Thr Phe Ser Ser Tyr Ala 1 5 <210> 68 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 68 Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ala 1 5 10 15 Val <210> 69 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 69 Ile Ser Tyr Asp Gly Ser Asn Lys 1 5 <210> 70 <211> 38 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 70 Tyr Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn 1 5 10 15 Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp 20 25 30 Thr Ala Val Tyr Tyr Cys 35 <210> 71 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 71 Ala Ser Gln Thr Val Ala Gly Ser Asp Tyr 1 5 10 <210> 72 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 72 Gln Pro Gly Leu Thr Gln Pro Pro Ser Val Pro Val Ala Pro Gly Gln 1 5 10 15 Thr Ala Arg Ile Thr Cys Gly Gly Asn 20 25 <210> 73 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 73 Asn Ile Gly Ser Lys Ser 1 5 <210> 74 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 74 Val His Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val Leu Val Val 1 5 10 15 Tyr <210> 75 <211> 3 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 75 Asp Asp Ser 1 <210> 76 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 76 Asp Arg Pro Ser Gly Ile Pro Glu Arg Phe Ser Gly Ser Asn Ser Gly 1 5 10 15 Asn Thr Ala Thr Leu Thr Ile Ser Arg Val Glu Ala Gly Asp Glu Ala 20 25 30 Asp Tyr Tyr Cys 35 <210> 77 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 77 Gln Val Trp His Ser Val Ser Asp Gln Gly Val 1 5 10 <210> 78 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 78 Gly Phe Thr Phe Asp Asp Phe Ala 1 5 <210> 79 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 79 Ala Ser Asp Tyr Gly Asp Lys Tyr Ser Tyr Tyr Gly Met Asp Val 1 5 10 15 <210> 80 <211> 3 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 80 Asp Asp Asn 1 <210> 81 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <220> <221> MOD_RES <222> (2)..(2) <223> Any amino acid <220> <221> MOD_RES <222> (5)..(6) <223> Any amino acid <220> <221> MOD_RES <222> (8)..(8) <223> Any amino acid <400> 81 Gly Xaa Thr Phe Xaa Xaa Tyr Xaa 1 5 <210> 82 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <220> <221> MOD_RES <222> (2)..(2) <223> Any amino acid <220> <221> MOD_RES <222> (5)..(7) <223> Any amino acid <400> 82 Gly Xaa Thr Phe Xaa Xaa Xaa Ala 1 5 <210> 83 <211> 3 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <220> <221> MOD_RES <222> (1)..(1) <223> Any amino acid <400> 83 Xaa Asp Asn 1 <210> 84 <211> 3 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <220> <221> MOD_RES <222> (1)..(1) <223> Any amino acid <400> 84 Xaa Asn Asn 1 <210> 85 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 85 Gln Arg Pro Ser Gly Val Pro Asp Arg Phe Ser Ala Ser Lys Ser Gly 1 5 10 15 Thr Ser Ala Ser Leu Ala Ile Ser Gly Leu Gln Ser Glu Asp Glu Ala 20 25 30 Asp Tyr Tyr Cys 35 <210> 86 <211> 333 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 86 cagcctgggc tgactcagcc accctcagcg tctgggaccc ccgggcagag ggtcaccatc tcttgttctg gaagcagctc caacatcgga agtaatactg tcaactggta tcagcaattc cccggaagg cccccaaact cctcatcttt gatgataatc agcggccctc aggggtccct 240. gaccgcttct ctgcttccaa gtctggcacc tcagcctccc tggccattag tggcctccag tctgaggatg aggctgacta ttactgtgcg gcatgggatg gcggtctgaa tggtcgaggg 300 gtgttcggcg actgaccgtc cta 333 <210> 87 <211> 288 <212> PRT <213> Homo sapiens <400> 87 Met Gln Ile Pro Gln Ala Pro Trp Pro Val Val Trp Ala Val Leu Gln 1 5 10 15 Leu Gly Trp Arg Pro Gly Trp Phe Leu Asp Ser Pro Asp Arg Pro Trp 20 25 30 Asn Pro Pro Thr Phe Ser Pro Ala Leu Leu Val Val Thr Glu Gly Asp 35 40 45 Asn Ala Thr Phe Thr Cys Ser Phe Ser Asn Thr Ser Glu Ser Phe Val 50 55 60 Leu Asn Trp Tyr Arg Met Ser Pro Ser Asn Gln Thr Asp Lys Leu Ala 65 70 75 80 Ala Phe Pro Glu Asp Arg Ser Gln Pro Gly Gln Asp Cys Arg Phe Arg 85 90 95 Val Thr Gln Leu Pro Asn Gly Arg Asp Phe His Met Ser Val Val Arg 100 105 110 Ala Arg Arg Asn Asp Ser Gly Thr Tyr Leu Cys Gly Ala Ile Ser Leu 115 120 125 Ala Pro Lys Ala Gln Ile Lys Glu Ser Leu Arg Ala Glu Leu Arg Val 130 135 140 Thr Glu Arg Arg Ala Glu Val Pro Thr Ala His Pro Ser Pro Ser Pro 145 150 155 160 Arg Pro Ala Gly Gln Phe Gln Thr Leu Val Val Gly Val Val Gly Gly 165 170 175 Leu Leu Gly Ser Leu Val Leu Leu Val Trp Val Leu Ala Val Ile Cys 180 185 190 Ser Arg Ala Ala Arg Gly Thr Ile Gly Ala Arg Arg Thr Gly Gln Pro 195 200 205 Leu Lys Glu Asp Pro Ser Ala Val Pro Val Phe Ser Val Asp Tyr Gly 210 215 220 Glu Leu Asp Phe Gln Trp Arg Glu Lys Thr Pro Glu Pro Pro Val Pro 225 230 235 240 Cys Val Pro Glu Gln Thr Glu Tyr Ala Thr Ile Val Phe Pro Ser Gly 245 250 255 Met Gly Thr Ser Ser Pro Ala Arg Arg Gly Ser Ala Asp Gly Pro Arg 260 265 270 Ser Ala Gln Pro Leu Arg Pro Glu Asp Gly His Cys Ser Trp Pro Leu 275 280 285 <210> 88 <211> 4 <212> PRT <213> Homo sapiens <400> 88 Cys Pro Ser Cys 1 <210> 89 <211> 4 <212> PRT <213> Homo sapiens <400> 89 Cys Pro Pro Cys 1 <210> 90 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 90 Thr Glu Thr Ser Gln Val Ala Pro Ala 1 5 <210> 91 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 91 gaggaggctc tggtggaggc ggtagcggag gcggagggtc ggctagctgg gcccagccgg 60 <210> 92 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 92 acactgttgt tatcagatct cgagctatta caagtcctct tcagaaataa gcttttgttc 60 <210> 93 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 93 ggtggcggcg gttccggagg tggtggttct ggcggtggtg gcagc 45 <210> 94 <211> 366 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 94 caggtgcagc tggtgcagtc tgggggaggc ttggtacagc ctggcaggtc cctgagactc 60 tcctgtgcag cctctggatt cacctttgat gattatgcca tgcactgggt ccggcaagct 120 ccagggaagg gcctggagtg ggtctcaggt attagttgga atagtggtag cataggctat 180 gcggactctg tgaagggccg attcaccgtc tccagagaca acgccaagaa ctcactgtat 240 ctgcaaatga acagcctgag agccgaggac acggctgtgt attactgtgc gagtgactac 300 ggtgacaaat actactacta cggtatggac gtctggggca aagggaccac ggtcaccgtc 360 tcctca 366 <210> 95 <211> 333 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 95 cagcctgggc tgactcagcc accctcagcg tctgggaccc ccgggcagag ggtcaccatc 60 tcttgttctg gaagcagctc caacatcgga agtaatactg tcaactggta tcagcaattc 120 cccggaaagg cccccaaact cctcatcttt aatgataatc agcggccctc aggggtccct 180 gaccgcttct ctgcttccaa gtctggcacc tcagcctccc tggccattag tggcctccag 240 tctgaggatg aggctgacta ttactgtgcg gcatgggatg gcggtctgaa tggtcgaggg 300 gtgttcggcg gagggaccaa actgaccgtc cta 333 <210> 96 <211> 366 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 96 caggtgcagc tggtgcagtc tggagcagag gtgaagaagc ccggggagtc tctgaagatc 60 tcctgtaagg attctggata cacctttacc acctactgga tcggctgggt gcgccagctg 120 cccgggaaag gcctggagtt gatggggatc atctatcctg atgactctga taccacatac 180 agcccgtcct tccaaggcca tgtcaccatc tcagccgaca agtccatcaa caccgcctac 240 ctgcagtgga gcagcctgaa ggcctcggac accgccatgt attactgtgc gttttggggt 300 gcgagtggag cgccagtgaa tggttttgat atctggggcc aaggcaccct ggtcaccgtc 360 tcctca 366 <210> 97 <211> 333 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 97 ctgcctgtgc tgactcagcc accctcagcg tctgggaccc ccgggcagag ggtcaccatc 60 tcctgcactg ggagcagctc caacatcggg gcaggttatg ttgtacactg gtaccagcag 120 ctcccaggaa cggcccccaa actcctcatc tatagtaata atcagcggcc ctcaggggtc 180 cctgaccgat tctctggctc caagtctggc acctcagcct ccctggccat cagtgggctc 240 cagtctgagg atgaggctga ttattactgt gcagcatggg atgacagcct gaatgctccg 300 gtgttcggcg gagggaccaa gctgaccgtc cta 333 <210> 98 <211> 375 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 98 caggtacagc tgcagcagtc aggcccagga ctggtgaggc cttcggcgac cctgtccctc 60 acctgcactg tctctggtga ctccgtcagc agtgataatt acttctggag ttggattcgg 120 cagcccccag ggaagccact ggagtggatt ggctatgtct attacaatgg gaacaccaac 180 tacaacccct ccttcaacag tcgagtcacc atgtcacttg acacgtccaa gaaccagttc 240 tccttgaagc tgaggtctgt gaccgccgcg gacacggcct tttattactg tgcgacagag 300 acgcccccaa ccagctattt taatagtgga ccctttgact cctggggcca gggcaccctg 360 gtcaccgtct cctcg 375 <210> 99 <211> 330 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 99 cagcctgggc tgactcagcc accctcggtg tccaagggct tgagacagac cgccacactc 60 acctgcactg ggagcagcaa caatgtaggc gcccacggag cagcttggct gcagcagcac 120 cagggccacc ctcccaaact ccttgcctac aggaataaca accggccctc agggatctca 180 gagagattct ctgcatccag gtcaggaaac acagcctccc tgaccattat tggactccag 240 cctgaggacg agggtgacta ttactgctca tcatgggaca gcagcctcag tggttatgtc 300 ttcggacctg ggaccaaagt caccgtccta 330 <210> 100 <211> 354 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 100 caggtgcagc tggtgcagtc tggggctgag gtgaagaagc ctgggtcctc agtgaaggtc 60 tcctgcaaga cttctggcta cacctttaac aggtttggtc tcacctgggt gcgacaggcc 120 cctggacaag ggcttgagtg gatgggatgg accaaccctt acaatggtaa cacaaggtat 180 gcacagaagt tccagggcag agtcaccatg accacagaca catccacgag cacagcctac 240 atggagctga ggagcctgag atctgacgac acggccatgt atttctgtgc gagagtcgta 300 gccgtaaacg gtatggacgt ctggggccaa gggaccacgg tcaccgtctc ctca 354 <210> 101 <211> 333 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 101 aattttatgc tgactcagcc ccactctgtg tcggagtctc cggggaagac ggttaccatc 60 tcctgcaccc gcaacagtgg cagcattgcc gcctactatg tgcagtggta ccagcagcgc 120 ccgggcagtt cccccaccac tgtgatctat gaagataacc aaagaccctc tggggtccct 180 gatcggttct ctggctccat cgacagctcc tccaactctg cctccctcac catctctgga 240 ctgaagactg aggacgaggc tgactactac tgtcagtctt atgatagcag caatctttgg 300 gtgttcggcg gagggaccaa gctgaccgtc cta 333 <210> 102 <211> 351 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 102 gaggtgcagc tggtgcagtc tgggggaggc gtggtccagc ctgggaggtc cctgagactc 60 tcctgtgcag cctctggatt caccttcagt agctatgcta tgcactgggt ccgccaggct 120 ccaggcaagg ggctggagtg ggtggcagtt atatcatatg atggaagcaa taaatactac 180 gcagactccg tgaagggccg attcaccatc tccagagaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgag agctgaggac acggctgtgt attactgtgc gagccaaaca 300 gtggctggaa gtgactactg gggccagggc accctggtca ccgtctcctc a 351 <210> 103 <211> 324 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 103 cagcctgggc tgactcagcc accctcggtg ccagtggccc caggacagac ggccaggatt 60 acctgtgggg gaaacaacat tggaagtaaa agtgtgcact ggtaccagca gaagccaggc 120 caggcccctg tgctggtcgt ctatgatgat agcgaccggc cctcagggat ccctgagcga 180 ttctctggct ccaactctgg gaacacggcc accctgacca tcagcagggt cgaagccggg 240 gatgaggccg actattactg tcaggtgtgg catagtgtta gtgatcaagg ggtcttcgga 300 actgggacca aagtcaccgt ccta 324 <210> 104 <211> 366 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 104 caggtgcagc tggtgcagtc tgggggaggc ttggtacagc ctggcaggtc cctgagactc 60 tcctgtgcag cctctggatt cacctttgat gattttgcca tgcactgggt ccggcaagct 120 ccagggaagg gcctggagtg ggtctcaggt attagttgga atagtggtag cataggctat 180 gcggactctg tgaagggccg attcaccgtc tccagagaca acgccaagaa ctcactgtat 240 ctgcaaatga acagcctgag agccgaggac acggctgtgt attactgtgc gagtgactac 300 ggtgacaaat actactacta cggtatggac gtctggggca aagggaccac ggtcaccgtc 360 tcctca 366 <210> 105 <211> 333 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 105 cagcctgggc tgactcagcc accctcagcg tctgggaccc ccgggcagag ggtcaccatc 60 tcttgttctg gaagcagctc caacatcgga agtaatactg tcaactggta tcagcaattc 120 cccggaaagg cccccaaact cctcatcttt aatgataatc agcggccctc aggggtccct 180 gaccgcttct ctgcttccaa gtctggcacc tcagcctccc tggccattag tggcctccag 240 tctgaggatg aggctgacta ttactgtgcg gcatgggatg gcggtctgaa tggtcgaggg 300 gtgttcggcg gagggaccaa actgaccgtc cta 333 <210> 106 <211> 366 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 106 caggtgcagc tggtgcagtc tgggggaggc ttggtacagc ctggcaggtc cctgagactc 60 tcctgtgcag cctctggatt cacctttgat gattatgcca tgcactgggt ccggcaagct 120 ccagggaagg gcctggagtg ggtctcaggt attagttgga atagtggtag cataggctat 180 gcggactctg tgaagggccg attcaccgtc tccagagaca acgccaagaa ctcactgtat 240 ctgcaaatga acagcctgag agccgaggac acggctgtgt attactgtgc gagtgactac 300 ggtgacaaat actactacta cggtatggac gtctggggca aagggaccac ggtcaccgtc 360 tcctca 366 <210> 107 <211> 333 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 107 cagcctgggc tgactcagcc accctcagcg tctgggaccc cagggcagag ggtcaccatc 60 tcttgttctg gaagcagctc caacatcgga agtaatactg tcaactggta tcagcaattc 120 cccggaaagg cccccaaact cctcatcttt gatgataatc agcggccctc aggggtccct 180 gaccgcttct ctgcttccaa gtctggcacc tcagcctccc tggccattag tggcctccag 240 tctgaggatg aggctgacta ttactgtgcg gcatgggatg gcggtctgaa tggtcgaggg 300 gtgttcggcg gagggaccaa actgaccgtc cta 333 <210> 108 <211> 366 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 108 caggtgcagc tggtgcagtc tgggggaggc ttggtacagc ctggcaggtc cctgagactc 60 tcctgtgcag cctctggatt cacctttgat gattatgcca tgcactgggt ccggcaagct 120 ccagggaagg gcctggagtg ggtctcaggt attagttgga atagtggtag cataggctat 180 gcggactctg tgaagggccg attcaccgtc tccagagaca acgccaagaa ctcactgtat 240 ctgcaaatga acagcctgag agccgaggac acggctgtgt attactgtgc gagtgactac 300 ggtgacaaat actcctacta cggtatggac gtctggggca aagggaccac ggtcaccgtc 360 tcctca 366 <210> 109 <211> 333 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 109 cagcctgggc tgactcagcc accctcagcg tctgggaccc ccgggcagag ggtcaccatc 60 tcttgttctg gaagcagctc caacatcgga agtaatactg tcaactggta tcagcaattc 120 cccggaaagg cccccaaact cctcatcttt aatgataatc agcggccctc aggggtccct 180 gaccgcttct ctgcttccaa gtctggcacc tcagcctccc tggccattag tggcctccag 240 tctgaggatg aggctgacta ttactgtgcg gcatgggatg gcggtctgaa tggtcgaggg 300 gtgttcggcg gagggaccaa actgaccgtc cta 333 <210> 110 <211> 366 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 110 caggtgcagc tggtgcagtc tgggggaggc ttggtacagc ctggcaggtc cctgagactc 60 tcctgtgcag cctctggatt cacctttgat gattttgcca tgcactgggt ccggcaagct 120 ccagggaagg gcctggagtg ggtctcaggt attagttgga atagtggtag cataggctat 180 gcggactctg tgaagggccg attcaccgtc tccagagaca acgccaagaa ctcactgtat 240 ctgcaaatga acagcctgag agccgaggac acggctgtgt attactgtgc gagtgactac 300 ggtgacaaat actcctacta cggtatggac gtctggggca aagggaccac ggtcaccgtc 360 tcctca 366 <210> 111 <211> 97 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 111 Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys 1 5 10 15 Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr 20 25 30 Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser 35 40 45 Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser 50 55 60 Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr 65 70 75 80 Tyr Ile Cys Asn Val Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys 85 90 95 Lys <210> 112 <211> 16 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 112 Ala Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro 1 5 10 15 <210> 113 <211> 110 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 113 Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys 1 5 10 15 Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val 20 25 30 Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr 35 40 45 Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu 50 55 60 Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His 65 70 75 80 Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys 85 90 95 Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys 100 105 110 <210> 114 <211> 107 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 114 Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp 1 5 10 15 Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe 20 25 30 Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu 35 40 45 Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe 50 55 60 Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly 65 70 75 80 Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr 85 90 95 Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys 100 105 <210> 115 <211> 106 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 115 Gly Gln Pro Lys Ala Ala Pro Ser Val Thr Leu Phe Pro Pro Ser Ser 1 5 10 15 Glu Glu Leu Gln Ala Asn Lys Ala Thr Leu Val Cys Leu Ile Ser Asp 20 25 30 Phe Tyr Pro Gly Ala Val Thr Val Ala Trp Lys Ala Asp Gly Ser Pro 35 40 45 Val Lys Ala Gly Val Glu Thr Thr Thr Pro Ser Lys Gln Ser Asn Asn 50 55 60 Lys Tyr Ala Ala Ser Ser Tyr Leu Ser Leu Thr Pro Glu Gln Trp Lys 65 70 75 80 Ser His Arg Ser Tyr Ser Cys Gln Val Thr His Glu Gly Ser Thr Val 85 90 95 Glu Lys Thr Val Ala Pro Thr Glu Cys Ser 100 105 <210> 116 <211> 285 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 116 accaagggcc catcggtctt ccccctggca ccctcctcca agagcacctc tgggggcaca 60 gcggccctgg gctgcctggt caaggactac ttccccgaac cggtgacggt gtcgtggaac 120 tcaggcgccc tgaccagcgg cgtgcacacc ttcccggctg tcctacagtc ctcaggactc 180 tactccctca gcagcgtggt gaccgtgccc tccagcagct tgggcaccca gacctacatc 240 tgcaacgtga atcacaagcc cagcaacacc aaggtggaca agaaa 285 <210> 117 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 117 gcagagccca aatcttgtga caaaactcac acatgcccac cgtgccca 48 <210> 118 <211> 330 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 118 gcacctgaac tcctgggggg accgtcagtc ttcctcttcc ccccaaaacc caaggacacc 60 ctcatgatct cccggacccc tgaggtcaca tgcgtggtgg tggacgtgag ccacgaagac 120 cctgaggtca agttcaactg gtacgtggac ggcgtggagg tgcataatgc caagacaaag 180 ccgcgggagg agcagtacaa cagcacgtac cgtgtggtca gcgtcctcac cgtcctgcac 240 caggactggc tgaatggcaa ggagtacaag tgcaaggtct ccaacaaagc cctcccagcc 300 cccatcgaga aaaccatctc caaagccaaa 330 <210> 119 <211> 324 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 119 gggcagcccc gagaaccaca ggtgtacacc ctgcccccat cccgggatga gctgaccaag 60 aaccaggtca gcctgacctg cctggtcaaa ggcttctatc ccagcgacat cgccgtggag 120 tgggagagca atgggcagcc ggagaacaac tacaagacca cgcctcccgt gctggactcc 180 gacggctcct tcttcctcta cagcaagctc accgtggaca agagcaggtg gcagcagggg 240 aacgtcttct catgctccgt gatgcatgag gctctgcaca accactacac gcagaagagc 300 ctctccctgt ctccgggtaa atga 324 <210> 120 <211> 321 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 120 ggtcagccca aggctgcccc ctcggtcact ctgttcccgc cctcctctga ggagcttcaa 60 gccaacaagg ccacactggt gtgtctcata agtgacttct acccgggagc cgtgacagtg 120 gcctggaagg cagatggcag ccccgtcaag gcgggagtgg agaccaccac accctccaaa 180 caaagcaaca acaagtacgc ggccagcagc tatctgagcc tgacgcctga gcagtggaag 240 tcccacagaa gctacagctg ccaggtcacg catgaaggga gcaccgtgga gaagacagtg 300 gcccctacag aatgttcatg a 321 <210> 121 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 121 gctgccacca ccgccagaac caccacctcc ggaaccgccg ccacc 45 <210> 122 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 122 Gly Gly Gly Gly Ser 1 5 <210> 123 <211> 99 <212> PRT <213> Homo sapiens <400> 123 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr 20 25 30 Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Gly Ile Ser Trp Asn Ser Gly Ser Ile Gly Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Leu Tyr Tyr Cys 85 90 95 Lys Asp Wing <210> 124 <211> 98 <212> PRT <213> Homo sapiens <400> 124 Gln Ser Val Leu Thr Gln Pro Pro Ser Ala Ser Gly Thr Pro Gly Gln 1 5 10 15 Arg Val Thr Ile Ser Cys Ser Gly Ser Ser Ser Asn Ile Gly Ser Asn 20 25 30 Thr Val Asn Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu Leu 35 40 45 Ile Tyr Ser Asn Asn Gln Arg Pro Ser Gly Val Pro Asp Arg Phe Ser 50 55 60 Gly Ser Lys Ser Gly Thr Ser Ala Ser Leu Ala Ile Ser Gly Leu Gln 65 70 75 80 Ser Glu Asp Glu Ala Asp Tyr Tyr Cys Ala Ala Trp Asp Asp Ser Leu 85 90 95 Asn Gly <210> 125 <211> 142 <212> PRT <213> Homo sapiens <400> 125 Met Gln Ile Pro Gln Ala Pro Trp Pro Val Val Trp Ala Val Leu Gln 1 5 10 15 Leu Gly Trp Arg Pro Gly Trp Phe Leu Asp Ser Pro Asp Arg Pro Trp 20 25 30 Asn Pro Pro Thr Phe Ser Pro Ala Leu Leu Val Val Thr Glu Gly Asp 35 40 45 Asn Ala Thr Phe Thr Cys Ser Phe Ser Asn Thr Ser Glu Ser Phe Val 50 55 60 Leu Asn Trp Tyr Arg Met Ser Pro Ser Asn Gln Thr Asp Lys Leu Ala 65 70 75 80 Ala Phe Pro Glu Asp Arg Ser Gln Pro Gly Gln Asp Cys Arg Phe Arg 85 90 95 Val Thr Gln Leu Pro Asn Gly Arg Asp Phe His Met Ser Val Val Arg 100 105 110 Ala Arg Arg Asn Asp Ser Gly Thr Tyr Leu Cys Gly Ala Ile Ser Leu 115 120 125 Ala Pro Lys Ala Gln Ile Lys Glu Ser Leu Arg Ala Glu Leu 130 135 140 <210> 126 <211> 142 <212> domestic worker <213> Macaca fascicularis <400> 126 Met Gln Ile Pro Gln Ala Pro Trp Pro Val Val Trp Ala Val Leu Gln 1 5 10 15 Leu Gly Trp Arg Pro Gly Trp Phe Leu Glu Ser Pro Asp Arg Pro Trp 20 25 30 Asn Ala Pro Thr Phe Ser Pro Ala Leu Leu Leu Val Thr Glu Gly Asp 35 40 45 Asn Ala Thr Phe Thr Cys Ser Phe Ser Asn Ala Ser Glu Ser Phe Val 50 55 60 Leu Asn Trp Tyr Arg Met Ser Pro Ser Asn Gln Thr Asp Lys Leu Ala 65 70 75 80 Ala Phe Pro Glu Asp Arg Ser Gln Pro Gly Gln Asp Cys Arg Phe Arg 85 90 95 Val Thr Arg Leu Pro Asn Gly Arg Asp Phe His Met Ser Val Val Arg 100 105 110 Ala Arg Arg Asn Asp Ser Gly Thr Tyr Leu Cys Gly Ala Ile Ser Leu 115 120 125 Ala Pro Lys Ala Gln Ile Lys Glu Ser Leu Arg Ala Glu Leu 130 135 140 <210> 127 <211> 117 <212> PRT <213> Homo sapiens <400> 127 Pro Pro Thr Phe Ser Pro Ala Leu Leu Val Val Thr Glu Gly Asp Asn 1 5 10 15 Ala Thr Phe Thr Cys Ser Phe Ser Asn Thr Ser Glu Ser Phe Val Leu 20 25 30 Asn Trp Tyr Arg Met Ser Pro Ser Asn Gln Thr Asp Lys Leu Ala Ala 35 40 45 Phe Pro Glu Asp Arg Ser Gln Pro Gly Gln Asp Ser Arg Phe Arg Val 50 55 60 Thr Gln Leu Pro Asn Gly Arg Asp Phe His Met Ser Val Val Arg Ala 65 70 75 80 Arg Arg Asn Asp Ser Gly Thr Tyr Leu Cys Gly Ala Ile Ser Leu Ala 85 90 95 Pro Lys Ala Gln Ile Lys Glu Ser Leu Arg Ala Glu Leu Arg Val Thr 100 105 110 Glu Arg Arg Ala Glu 115 <210> 128 <211> 116 <212> PRT <213> Mus sp. <400> 128 Ser Leu Thr Phe Tyr Pro Ala Trp Leu Thr Val Ser Glu Gly Ala Asn 1 5 10 15 Ala Thr Phe Thr Cys Ser Leu Ser Asn Trp Ser Glu Asp Leu Met Leu 20 25 30 Asn Trp Asn Arg Leu Ser Pro Ser Asn Gln Thr Glu Lys Gln Ala Ala 35 40 45 Phe Cys Asn Gly Leu Ser Gln Pro Val Gln Asp Ala Arg Phe Gln Ile 50 55 60 Ile Gln Leu Pro Asn Arg His Asp Phe His Met Asn Ile Leu Asp Thr 65 70 75 80 Arg Arg Asn Asp Ser Gly Ile Tyr Leu Cys Gly Ala Ile Ser Leu His 85 90 95 Pro Lys Ala Lys Ile Glu Glu Ser Pro Gly Ala Glu Leu Val Val Thr 100 105 110 Glu Arg Ile Leu 115 <210> 129 <211> 9 <212> PRT <213> Unknown <220> <223> Description of Unknown: P4-B3 sequence <400> 129 Ser Gly Phe Thr Phe Asp Asp Tyr Ala 1 5 <210> 130 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 130 Ser Gly Phe Thr Phe Asp Asp Phe Ala 1 5 <210> 131 <211> 99 <212> PRT <213> Homo sapiens <400> 131 Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu 1 5 10 15 Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Val Ser Ser Gly 20 25 30 Ser Tyr Tyr Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Gly Leu Glu 35 40 45 Trp Ile Gly Tyr Ile Tyr Tyr Ser Gly Ser Thr Asn Tyr Asn Pro Ser 50 55 60 Leu Lys Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn Gln Phe 65 70 75 80 Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr 85 90 95 Cys Ala Arg <210> 132 <211> 98 <212> PRT <213> Homo sapiens <400> 132 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala 1 5 10 15 Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr 20 25 30 Gly Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45 Gly Trp Ile Ser Ala Tyr Asn Gly Asn Thr Asn Tyr Ala Gln Lys Leu 50 55 60 Gln Gly Arg Val Thr Met Thr Thr Asp Thr Ser Thr Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Arg Ser Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg <210> 133 <211> 98 <212> PRT <213> Homo sapiens <400> 133 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg <210> 134 <211> 98 <212> PRT <213> Homo sapiens <400> 134 Gln Ala Gly Leu Thr Gln Pro Pro Ser Val Ser Lys Gly Leu Arg Gln 1 5 10 15 Thr Ala Thr Leu Thr Cys Thr Gly Asn Ser Asn Asn Val Gly Asn Gln 20 25 30 Gly Ala Ala Trp Leu Gln Gln His Gln Gly His Pro Pro Lys Leu Leu 35 40 45 Ser Tyr Arg Asn Asn Asn Arg Pro Ser Gly Ile Ser Glu Arg Leu Ser 50 55 60 Ala Ser Arg Ser Gly Asn Thr Ala Ser Leu Thr Ile Thr Gly Leu Gln 65 70 75 80 Pro Glu Asp Glu Ala Asp Tyr Tyr Cys Ser Ala Trp Asp Ser Ser Leu 85 90 95 Ser Ala <210> 135 <211> 98 <212> PRT <213> Homo sapiens <400> 135 Asn Phe Met Leu Thr Gln Pro His Ser Val Ser Glu Ser Pro Gly Lys 1 5 10 15 Thr Val Thr Ile Ser Cys Thr Arg Ser Ser Gly Ser Ile Ala Ser Asn 20 25 30 Tyr Val Gln Trp Tyr Gln Gln Arg Pro Gly Ser Ser Pro Thr Thr Val 35 40 45 Ile Tyr Glu Asp Asn Gln Arg Pro Ser Gly Val Pro Asp Arg Phe Ser 50 55 60 Gly Ser Ile Asp Ser Ser Ser Asn Ser Ala Ser Leu Thr Ile Ser Gly 65 70 75 80 Leu Lys Thr Glu Asp Glu Ala Asp Tyr Tyr Cys Gln Ser Tyr Asp Ser 85 90 95 Ser Asn <210> 136 <211> 111 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <220> <221> MOD_RES <222> (84)..(84) <223> Any amino acid <400> 136 Asn Phe Met Leu Thr Gln Pro His Ser Val Ser Glu Ser Pro Gly Lys 1 5 10 15 Thr Val Thr Ile Ser Cys Thr Arg Asn Ser Gly Ser Ile Ala Ala Tyr 20 25 30 Tyr Val Gln Trp Tyr Gln Gln Arg Pro Gly Ser Ser Pro Thr Thr Val 35 40 45 Ile Tyr Glu Asp Asn Gln Arg Pro Ser Gly Val Pro Asp Arg Phe Ser 50 55 60 Gly Ser Ile Asp Ser Ser Ser Asn Ser Ala Ser Leu Thr Ile Ser Gly 65 70 75 80 Leu Lys Thr Xaa Asp Glu Ala Asp Tyr Tyr Cys Gln Ser Tyr Asp Ser 85 90 95 Ser Asn Leu Trp Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 110 <210> 137 <211> 96 <212> PRT <213> Homo sapiens <400> 137 Ser Tyr Val Leu Thr Gln Pro Pro Ser Val Ser Val Ala Pro Gly Gln 1 5 10 15 Thr Ala Arg Ile Thr Cys Gly Gly Asn Asn Ile Gly Ser Lys Ser Val 20 25 30 His Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val Leu Val Val Tyr 35 40 45 Asp Asp Ser Asp Arg Pro Ser Gly Ile Pro Glu Arg Phe Ser Gly Ser 50 55 60 Asn Ser Gly Asn Thr Ala Thr Leu Thr Ile Ser Arg Val Glu Ala Gly 65 70 75 80 Asp Glu Ala Asp Tyr Tyr Cys Gln Val Trp Asp Ser Ser Ser Asp His 85 90 95 <210> 138 <211> 98 <212> PRT <213> Homo sapiens <400> 138 Glu Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Glu 1 5 10 15 Ser Leu Lys Ile Ser Cys Lys Gly Ser Gly Tyr Ser Phe Thr Ser Tyr 20 25 30 Trp Ile Gly Trp Val Arg Gln Met Pro Gly Lys Gly Leu Glu Trp Met 35 40 45 Gly Ile Ile Tyr Pro Gly Asp Ser Asp Thr Arg Tyr Ser Pro Ser Phe 50 55 60 Gln Gly Gln Val Thr Ile Ser Ala Asp Lys Ser Ile Ser Thr Ala Tyr 65 70 75 80 Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp Thr Ala Met Tyr Tyr Cys 85 90 95 Ala Arg <210> 139 <211> 111 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 139 Leu Pro Val Leu Thr Gln Pro Pro Ser Ala Ser Gly Thr Pro Gly Gln 1 5 10 15 Arg Val Thr Ile Ser Cys Thr Gly Ser Ser Ser Asn Ile Gly Ala Gly 20 25 30 Tyr Val Val His Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu 35 40 45 Leu Ile Tyr Ser Asn Asn Gln Arg Pro Ser Gly Val Pro Asp Arg Phe 50 55 60 Ser Gly Ser Lys Ser Gly Thr Ser Ala Ser Leu Ala Ile Ser Gly Leu 65 70 75 80 Gln Ser Glu Asp Glu Ala Asp Tyr Tyr Cys Ala Ala Trp Asp Asp Ser 85 90 95 Leu Asn Ala Pro Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 110 <210> 140 <211> 15 <212> PRT <213> Unknown <220> <223> Description of Unknown: P4-B3 sequence <400> 140 Ala Ser Asp Tyr Gly Asp Lys Tyr Tyr Tyr Tyr Gly Met Asp Val 1 5 10 15
Claims
1. An isolated antibody or antigen-binding fragment thereof that binds to human programmed cell death 1 (PD-1) protein, (a) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28; or (b) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28; or (c) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 79, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28; or (d) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28; or (e) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28; or (f) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 79, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28 1. An isolated antibody or antigen-binding fragment thereof comprising:
2. an isolated monoclonal antibody or antigen-binding fragment thereof that binds to PD-1, comprising a heavy chain and a light chain, wherein the heavy chain comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO:17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO:19, and a VH CDR3 comprising the amino acid sequence of SEQ ID NO:21, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO:1; and the light chain comprises a VL CDR1 comprising the amino acid sequence of SEQ ID NO:24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO:26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO:28, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO:2; or an isolated monoclonal antibody or antigen-binding fragment thereof that binds to PD-1, comprising a heavy chain and a light chain, wherein the heavy chain comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO:17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO:19, and a VH CDR3 comprising the amino acid sequence of SEQ ID NO:21, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO:1; and the light chain comprises a VL CDR1 comprising the amino acid sequence of SEQ ID NO:24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO:80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO:28, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO:11; or an isolated monoclonal antibody or antigen-binding fragment thereof that binds to PD-1, comprising a heavy chain and a light chain, wherein the heavy chain comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, and a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 79, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO: 12; and the light chain comprises a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO: 2; or an isolated monoclonal antibody or antigen-binding fragment thereof that binds to PD-1, comprising a heavy chain and a light chain, wherein the heavy chain comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO:78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO:19, and a VH CDR3 comprising the amino acid sequence of SEQ ID NO:21, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO:13; and the light chain comprises a VL CDR1 comprising the amino acid sequence of SEQ ID NO:24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO:26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO:28, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO:2; or an isolated monoclonal antibody or antigen-binding fragment thereof that binds to PD-1, comprising a heavy chain and a light chain, wherein the heavy chain comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO:78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO:19, and a VH CDR3 comprising the amino acid sequence of SEQ ID NO:21, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO:13; and the light chain comprises a VL CDR1 comprising the amino acid sequence of SEQ ID NO:24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO:80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO:28, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO:11; or 1. An isolated monoclonal antibody or antigen-binding fragment thereof that binds to PD-1, comprising a heavy chain and a light chain, wherein the heavy chain comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO:78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO:19, and a VH CDR3 comprising the amino acid sequence of SEQ ID NO:79, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO:15; and the light chain comprises a VL CDR1 comprising the amino acid sequence of SEQ ID NO:24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO:80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO:28, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO:
11.
3. 10. An isolated bispecific antibody comprising the antigen-binding fragment of claim 1 or 2 and a second antigen-binding fragment having specificity for a molecule on an immune cell.
4. the molecule is selected from the group consisting of B7H3, B7H4, CD27, CD28, CD40, CD40L, CD47, CD122, CTLA-4, GITR, GITRL, ICOS, ICOSL, LAG-3, LIGHT, OX-40, OX40L, PD-1, TIM3, 4-1BB, TIGIT, VISTA, HEVM, BTLA, and KIR; or each of the antigen-binding fragment and the second antigen-binding fragment is independently selected from a Fab fragment, a single-chain variable fragment (scFv), or a single-domain antibody; or Further comprising an Fc fragment, The bispecific antibody of claim 3.
5. A nucleic acid encoding an antibody according to claim 1 or 2, or encoding a bispecific antibody according to claim 3 or 4.
6. 10. A pharmaceutical composition comprising i) an antibody or antigen-binding fragment thereof according to claim 1 or 2, and a pharmaceutically acceptable carrier or excipient, or ii) a bispecific antibody according to claim 3 or 4, and a pharmaceutically acceptable carrier or excipient.
7. 7. The pharmaceutical composition of claim 6, further comprising at least one additional therapeutic agent.
8. i) one or more polynucleotides encoding the antibody or antigen-binding fragment thereof of claim 1 or 2; or ii) one or more polynucleotides encoding the bispecific antibody of claim 3 or 4 1. An isolated cell comprising:
9. A vector comprising the nucleic acid of claim 5.
10. A cell comprising the vector of claim 9.
11. 10. A kit comprising the pharmaceutical composition of claim 6, a syringe, needle, or applicator for administering at least one antibody to a subject, and instructions for use.
12. 3. An engineered cell comprising a chimeric antigen receptor, wherein the chimeric antigen receptor comprises an extracellular ligand-binding domain specific for an antigen on the surface of a cancer cell, the antigen comprising PD-1, and the extracellular ligand-binding domain comprises the antibody or antigen-binding fragment thereof of claim 1 or 2.
13. 13. The engineered cell of claim 12, wherein the engineered cell comprises a T cell, an NK cell, or an NKT cell.
14. 8. The pharmaceutical composition of claim 7, wherein the therapeutic agent is a toxin, a radiolabel, an siRNA, a small molecule, or a cytokine.
15. 14. The engineered cell of claim 13, wherein the T cells are CD4+, CD8+, CD3+ pan T cells, or any combination thereof.
Citation Information
Patent Citations
Anti-PD-1 Antibody and Method of Using the Same
JP2018527952A