Antibodies against PD-1 and methods of use thereof

Abstract

To provide PD-1 antibody compositions usable for treating cancer and chronic viral infections, and methods of using the same.SOLUTION: The present invention provides an isolated multispecific antibody or an antigen-binding fragment thereof that binds to PD-1 protein and interleukin-12 (IL-12) receptor, comprising CDR1, CDR2, and CDR3 of VH and VL including specific amino acid sequences, and further comprising a constant region, a linker, and an IL-12 amino acid sequence having specific amino acid sequences.SELECTED DRAWING: Figure 1

Description

[Technical Field]

[0001] This application is an international application claiming the benefit of priority to U.S. Provisional Patent Application No. 62 / 861,638, filed June 14, 2019, and U.S. Provisional Patent Application No. 62 / 884,473, filed August 8, 2019, each of which is incorporated herein by reference in its entirety.

[0002] All patents, patent applications, and publications cited herein are incorporated by reference in their entirety. The disclosures of these publications are incorporated by reference into this application in order to more fully describe the state of the art known to those skilled in the art at the date of the invention described and claimed herein.

[0003] This patent disclosure contains material that is subject to copyright protection. The copyright owner has no objection to the facsimile reproduction of either the patent document or the patent disclosure, as it appears in the U.S. Patent and Trademark Office patent file or records, but otherwise reserves all copyright rights whatsoever.

[0004] FIELD OF THE INVENTION The present invention relates to antibodies against PD-1 and methods of using the same. [Background technology]

[0005] Background of the Invention Programmed cell death-1 (PD-1) is a cell surface membrane protein of the immunoglobulin superfamily. This protein is expressed on pro-B cells and is thought to play a role in their differentiation. PD-1, a member of the CD28 family, is upregulated on activated T cells, B cells, and monocytes. PD-1 has two identified ligands in the B7 family: PD-L1 (programmed cell death-1 ligand 1, also known as cluster of differentiation 274 (CD274) or B7 homolog 1 (B7-H1)) and PD-L2. PD-L1 is a 40 kDa type I transmembrane protein. Binding of PD-L1 to PD-1 or B7.1 transmits an inhibitory signal that reduces CD8+ T cell proliferation in lymph nodes. Additionally, PD-1 can also control the accumulation of foreign antigen-specific T cells in lymph nodes through apoptosis, which is further mediated by downregulation of the Bcl-2 gene. PD-L2 expression tends to be more restricted and is found primarily on activated antigen-presenting cells (APCs), whereas PD-L1 expression is widespread, including on hematopoietic cells (including activated T cells, B cells, monocytes, dendritic cells, and macrophages) and peripheral non-lymphoid tissues (including cardiac, skeletal, muscle, placental, lung, kidney, and liver tissues). The widespread expression of PD-L1 indicates its important role in regulating PD-1 / PD-L1-mediated peripheral immune tolerance. Summary of the Invention

[0006] The present invention provides PD-1 antibody compositions and methods of use thereof.

[0007] One aspect of the present invention relates to an isolated multispecific antibody or antigen-binding fragment thereof that binds to the human programmed cell death 1 (PD-1) protein and the interleukin-12 (IL-12) receptor. In one embodiment, the isolated multispecific PD-1 antibody or antigen-binding fragment thereof comprises a heavy chain, a light chain, or a combination thereof. In some embodiments, the heavy chain comprises a CDR1 comprising G-(X1)-TF-(X2X3)-Y-(X4) (SEQ ID NO: 81), G-(X5)-TF-(X6X7X8)-A (SEQ ID NO: 82), GDSVSSDNYF (SEQ ID NO: 43), or GYTFNRFG (SEQ ID NO: 55), ISWNSGSI (SEQ ID NO: 19), IYPDDSDT (SEQ ID NO: 33), VYYNGNT (SEQ ID NO: 45), TNPYNGNT (SEQ ID NO: 57), or In another embodiment, the light chain comprises a CDR1 comprising SSNIGSNT (SEQ ID NO: 24), SSNIGAGYV (SEQ ID NO: 37), SNNVGAHG (SEQ ID NO: 49), SGSIAAYY (SEQ ID NO: 61), or NIGSKS (SEQ ID NO: 73), a CDR2 comprising ISYDGSNK (SEQ ID NO: 69), a CDR3 comprising ASDYGDKYYYYGMDV (SEQ ID NO: 21), AFWGASGAPVNGFDI (SEQ ID NO: 35), ATETPPTSYFNSGPFDS (SEQ ID NO: 47), ARVVAVNGMDV (SEQ ID NO: 59), ASQTVAGSDY (SEQ ID NO: 71), or ASDYGDKYYYGMDV (SEQ ID NO: 79), or a combination of CDRs thereof. ... 10)-NN (SEQ ID NO: 84), or DDS (SEQ ID NO: 75), and a CDR3 comprising AAWDGGLNGRGV (SEQ ID NO: 28), AAWDDSLNAPV (SEQ ID NO: 41), SSWDSSLSGYV (SEQ ID NO: 53), QSYDSSNLWV (SEQ ID NO: 65), or QVWHSVSDQGV (SEQ ID NO: 77), or a combination of CDRs thereof. In other embodiments, the isolated multispecific PD-1 antibody or antigen-binding fragment thereof further comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129. In some embodiments, the isolated multispecific PD-1 antibody or antigen-binding fragment thereof comprises heavy and light chains comprising the CDRs described herein. In further embodiments, the isolated multispecific PD-1 antibody or antigen-binding fragment thereof is fully human or humanized. In further embodiments, the isolated multispecific PD-1 antibody or antigen-binding fragment thereof is monospecific, bispecific, or multispecific. In a further embodiment, the isolated multispecific PD-1 antibody or antigen-binding fragment thereof is a single chain antibody. In other embodiments, the isolated multispecific PD-1 antibody or antigen-binding fragment thereof is at least 1.0 x 10 -6M. In other embodiments, the isolated multispecific PD-1 antibody or antigen-binding fragment thereof further comprises a heavy chain constant region, a light chain constant region, an Fc region, or a combination thereof. In some embodiments, the X1, X4, X5, or X8 amino acid residue of the CDR from the isolated multispecific PD-1 antibody or antigen-binding fragment thereof is a nonpolar amino acid residue. In some embodiments, the X1, X4, X5, or X8 amino acid residue of the CDR from the isolated multispecific PD-1 antibody or antigen-binding fragment thereof is tyrosine (Y), phenylalanine (F), or alanine (A). In some embodiments, the X2, X3, X4, X6, X7, or X8 amino acid residue of the CDR from the isolated multispecific PD-1 antibody or antigen-binding fragment thereof is a polar amino acid residue. In some embodiments, the X2, X3, X4, X6, X7, or X8 amino acid residue of a CDR from an isolated multispecific PD-1 antibody or antigen-binding fragment thereof is aspartic acid (D), threonine (T), serine (S), or tryptophan (W). In other embodiments, the X1 amino acid residue of a CDR from an isolated multispecific PD-1 antibody or antigen-binding fragment thereof is tyrosine (Y) or phenylalanine (F). In other embodiments, the X2 amino acid residue of a CDR from an isolated multispecific PD-1 antibody or antigen-binding fragment thereof is aspartic acid (D), threonine (T), or serine (S). In other embodiments, the X3 amino acid residue of a CDR from an isolated multispecific PD-1 antibody or antigen-binding fragment thereof is aspartic acid (D), threonine (T), or serine (S). In other embodiments, the X4 amino acid residue of a CDR from an isolated multispecific PD-1 antibody or antigen-binding fragment thereof is alanine (A) or tryptophan (W). In other embodiments, the X5 amino acid residue of the CDRs from the isolated multispecific PD-1 antibody or antigen-binding fragment thereof is phenylalanine (F) or tyrosine (Y). In other embodiments, the X6 amino acid residue of the CDRs from the isolated multispecific PD-1 antibody or antigen-binding fragment thereof is aspartic acid (D) or serine (S).In another embodiment, the X7 amino acid residue of a CDR from an isolated multispecific PD-1 antibody or antigen-binding fragment thereof is aspartic acid (D) or serine (S). In another embodiment, the X8 amino acid residue of a CDR from an isolated multispecific PD-1 antibody or antigen-binding fragment thereof is phenylalanine (F) or tyrosine (Y). In another embodiment, the X9 amino acid residue of a CDR from an isolated multispecific PD-1 antibody or antigen-binding fragment thereof is a polar hydrophilic amino acid residue. In another embodiment, the X9 amino acid residue of a CDR from an isolated multispecific PD-1 antibody or antigen-binding fragment thereof is glutamic acid (E), asparagine (N), or aspartic acid (D). In another embodiment, the X in a CDR from an isolated multispecific PD-1 antibody or antigen-binding fragment thereof. 10 In another embodiment, the X amino acid residues of the CDRs from an isolated multispecific PD-1 antibody or antigen-binding fragment thereof are polar hydrophilic amino acid residues. 10 The amino acid residue is serine (S) or arginine (R).

[0008] One aspect of the invention relates to antibody compositions comprising at least one antibody, wherein the at least one antibody comprises two heavy chains and two light chains. In some embodiments, the heavy chain CDRs are between residues 27 and 38, 56 and 65, and 105 and 119 according to the IMGT numbering of SEQ ID NO: 1, or between residues 27 and 38, 56 and 65, and 105 and 119 according to the IMGT numbering of SEQ ID NO: 3, or between residues 27 and 38, 56 and 65, and 105 and 121 according to the IMGT numbering of SEQ ID NO: 5, or between residues 27 and 38, 56 and 65, and 105 and 115 according to the IMGT numbering of SEQ ID NO: 7, or between residues 27 and 38, 56 and 65, and 105 and 114 according to the IMGT numbering of SEQ ID NO: 9, or between residues 27 and 38, 56 and 65, and 105 and 114 according to the IMGT numbering of SEQ ID NO: 1. or between residues 27 and 38, 56 and 65, and 105 and 119 according to the IMGT numbering of SEQ ID NO: 12 (e.g., an HL-14 mutant described herein), or between residues 27 and 38, 56 and 65, and 105 and 119 according to the IMGT numbering of SEQ ID NO: 13 (e.g., an HLkin-1 mutant described herein), or between residues 27 and 38, 56 and 65, and 105 and 119 according to the IMGT numbering of SEQ ID NO: 15 (e.g., a mut-3 mutant described herein), except that at least one of the heavy chain CDRs differs by a single amino acid substitution compared to the reference CDR.In some embodiments, the light chain CDRs are between residues 27 and 38, residues 56 and 65, and residues 105 and 116 according to the IMGT numbering of SEQ ID NO:2; or between residues 27 and 38, residues 56 and 65, and residues 105 and 115 according to the IMGT numbering of SEQ ID NO:4; or between residues 27 and 38, residues 56 and 65, and residues 105 and 115 according to the IMGT numbering of SEQ ID NO:6; or between residues 27 and 38, residues 56 and 65 according to the IMGT numbering of SEQ ID NO:8. and residues 105 and 114, or between residues 27 and 38, residues 56 and 65, and residues 105 and 115 according to the IMGT numbering of SEQ ID NO: 10, or between residues 27 and 38, residues 56 and 65, and residues 105 and 116 according to the IMGT numbering of SEQ ID NO: 11 (e.g., the HL-7 variants described herein), except that at least one of the light chain CDRs differs by a single amino acid substitution compared to the reference CDR. In some embodiments, the antibody composition binds to an epitope comprising amino acid residues within the face of PD-1 generated by the FCC' chain but does not contact the C'D loop of PD-1 comprising non-adjacent amino acids in SEQ ID NO: XX. In some embodiments, the antibody composition further comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129.

[0009] One aspect of the present invention relates to an isolated antibody or fragment thereof that binds to human programmed cell death 1 (PD-1) protein and interleukin-12 (IL-12) receptor. In one embodiment, the isolated antibody or fragment thereof that binds to PD-1 and interleukin-12 (IL-12) receptor comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28. In one embodiment, an isolated antibody or fragment thereof that binds to PD-1 and an interleukin-12 (IL-12) receptor comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 31, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 33, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 35, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 37, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 39, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 41. In one embodiment, an isolated antibody or fragment thereof that binds to PD-1 and an interleukin-12 (IL-12) receptor comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 43, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 45, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 47, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 49, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 51, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 53. In one embodiment, the isolated antibody or fragment thereof that binds to PD-1 and interleukin-12 (IL-12) receptor comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 55, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 57, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 59, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 61, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 63, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 65.In one embodiment, an isolated antibody or fragment thereof that binds to PD-1 and an interleukin-12 (IL-12) receptor comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 67, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 69, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 71, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 73, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 75, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 77. In one embodiment, an isolated antibody or fragment thereof that binds to PD-1 and an interleukin-12 (IL-12) receptor comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28 (e.g., an HL-7 variant described herein). In one embodiment, an isolated antibody or fragment thereof that binds to PD-1 and an interleukin-12 (IL-12) receptor comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 79, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28 (e.g., an HL-14 variant described herein). In one embodiment, an isolated antibody or fragment thereof that binds to PD-1 and an interleukin-12 (IL-12) receptor comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28 (e.g., an HLkin-1 variant described herein).In one embodiment, an isolated antibody or fragment thereof that binds to PD-1 and interleukin-12 (IL-12) receptor comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28 (e.g., the HLkin-1HL-7 mut2 mutant described herein). In one embodiment, an isolated antibody or fragment thereof that binds to PD-1 and an interleukin-12 (IL-12) receptor comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 79, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28 (e.g., an HLkin-1 HL-7 HL-14 mut3 mutant described herein). In one embodiment, an isolated antibody or fragment thereof that binds to PD-1 and an interleukin-12 (IL-12) receptor described herein further comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129.

[0010] One aspect of the present invention relates to an isolated multispecific antibody or antigen-binding fragment thereof, wherein the antibody binds to human programmed cell death 1 (PD-1) protein. In one embodiment, the isolated multispecific antibody or antigen-binding fragment thereof that binds to human PD-1 protein comprises a heavy chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 1, 3, 5, 7, 9, 12, 13, and 15, and a light chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, and 11. In one embodiment, in the isolated multispecific antibody or antigen-binding fragment thereof, the antibody binds to human PD-1 protein and also binds to interleukin-12 (IL-12) receptor, and comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129.

[0011] In another embodiment, the isolated multispecific antibody or antigen-binding fragment thereof that binds to human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 1 and the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 2, and the antibody binds to an IL-12 receptor comprising a constant region, a linker, and an interleukin-12 (IL-12) amino acid sequence having at least 90% identity to SEQ ID NO: 129. In another embodiment, the isolated multispecific antibody or antigen-binding fragment thereof that binds to human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 3 and the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 4, and the antibody binds to an IL-12 receptor comprising a constant region, a linker, and an interleukin-12 (IL-12) amino acid sequence having at least 90% identity to SEQ ID NO: 129. In another embodiment, the isolated multispecific antibody or antigen-binding fragment thereof that binds to human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO:5 and the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO:6, and the antibody binds to an IL-12 receptor comprising a constant region, a linker, and an interleukin-12 (IL-12) amino acid sequence having at least 90% identity to SEQ ID NO: 129. In another embodiment, the isolated multispecific antibody or antigen-binding fragment thereof that binds to human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO:7 and the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO:8, and the antibody binds to an IL-12 receptor comprising a constant region, a linker, and an interleukin-12 (IL-12) amino acid sequence having at least 90% identity to SEQ ID NO:129.In another embodiment, the isolated multispecific antibody or antigen-binding fragment thereof that binds to human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO:9 and the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO:10, and the antibody binds to an IL-12 receptor comprising a constant region, a linker, and an interleukin-12 (IL-12) amino acid sequence having at least 90% identity to SEQ ID NO: 129. In another embodiment, the isolated multispecific antibody or antigen-binding fragment thereof that binds to human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO:1 and the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO:11, and the antibody binds to an IL-12 receptor comprising a constant region, a linker, and an interleukin-12 (IL-12) amino acid sequence having at least 90% identity to SEQ ID NO:129. In another embodiment, the isolated multispecific antibody or antigen-binding fragment thereof that binds to human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 12 and the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 2, and the antibody binds to an IL-12 receptor comprising a constant region, a linker, and an interleukin-12 (IL-12) amino acid sequence having at least 90% identity to SEQ ID NO: 129. In another embodiment, the isolated multispecific antibody or antigen-binding fragment thereof that binds to human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 13 and the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 2, and the antibody binds to an IL-12 receptor comprising a constant region, a linker, and an interleukin-12 (IL-12) amino acid sequence having at least 90% identity to SEQ ID NO: 129.In another embodiment, the isolated multispecific antibody or antigen-binding fragment thereof that binds to human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 13 and the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 11, and the antibody binds to an IL-12 receptor comprising a constant region, a linker, and an interleukin-12 (IL-12) amino acid sequence having at least 90% identity to SEQ ID NO: 129. In another embodiment, the isolated multispecific antibody or antigen-binding fragment thereof that binds to human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 15 and the light chain comprises an amino acid sequence about 95% identical to SEQ ID NO: 11, and the antibody binds to an IL-12 receptor comprising a constant region, a linker, and an interleukin-12 (IL-12) amino acid sequence having at least 90% identity to SEQ ID NO: 129.

[0012] One aspect of the present invention relates to an isolated bispecific antibody comprising a first antibody fragment that binds to human PD-1 protein and a second antigen-binding fragment having specificity for a molecule on an immune cell. In one embodiment, the isolated bispecific antibody comprises a fragment of a human antibody against the PD-1 protein described herein. In some embodiments, the molecule on an immune cell comprises B7H3, B7H4, CD27, CD28, CD40, CD40L, CD47, CD122, CTLA-4, GITR, GITRL, ICOS, ICOSL, LAG-3, LIGHT, OX-40, OX40L, PD-1, TIM3, 4-1BB, TIGIT, VISTA, HEVM, BTLA, or KIR. In some embodiments, the antibody fragment that binds to human PD-1 protein comprises a Fab fragment, a single-chain variable fragment (scFv), or a single-domain antibody. In other embodiments, the second antigen-binding fragment having specificity for a molecule on an immune cell comprises a Fab fragment, a single-chain variable fragment (scFv), or a single-domain antibody. In some embodiments, the bispecific antibody comprises an Fc fragment.

[0013] One aspect of the present invention relates to an isolated multispecific antibody comprising a first antibody fragment that binds to human PD-1 protein and second and third antigen-binding fragments having specificity for a molecule on an immune cell. In one embodiment, the isolated multispecific antibody comprises fragments of a human antibody against the PD-1 protein described herein. In some embodiments, the molecule on an immune cell comprises B7H3, B7H4, CD27, CD28, CD40, CD40L, CD47, CD122, CTLA-4, GITR, GITRL, ICOS, ICOSL, LAG-3, LIGHT, OX-40, OX40L, PD-1, TIM3, 4-1BB, TIGIT, VISTA, HEVM, BTLA, or KIR. In some embodiments, the antibody fragment that binds to human PD-1 protein comprises a Fab fragment, a single-chain variable fragment (scFv), or a single-domain antibody. In other embodiments, the second and third antigen-binding fragments with specificity for a molecule on an immune cell comprise a Fab fragment, a single-chain variable fragment (scFv), or a single-domain antibody. In some embodiments, the multispecific antibody comprises an Fc fragment. In some embodiments, the multispecific antibody further comprises a fourth and / or fifth antigen-binding fragment with specificity for a molecule on an immune cell.

[0014] One aspect of the present invention relates to a nucleic acid encoding an isolated multispecific antibody or antigen-binding fragment thereof that binds to the human programmed cell death 1 (PD-1) protein as described herein. One aspect of the present invention relates to a nucleic acid encoding an isolated antibody or fragment thereof that binds to the human PD-1 protein as described herein. One aspect of the present invention relates to a nucleic acid encoding a bispecific antibody as described herein. One aspect of the present invention relates to a nucleic acid encoding a multispecific antibody as described herein. In some embodiments, the present invention relates to a vector comprising the nucleic acid as described herein. In some embodiments, the present invention relates to a cell comprising the vector as described herein.

[0015] One aspect of the present invention relates to pharmaceutical compositions comprising an antibody or fragment that binds to human PD-1 protein as described herein and a pharmaceutically acceptable carrier or excipient. In some embodiments, the pharmaceutical composition further comprises at least one additional therapeutic agent. For example, the therapeutic agent can be a toxin, a radiolabel, an siRNA, a small molecule, or a cytokine.

[0016] One aspect of the present invention relates to a pharmaceutical composition comprising a bispecific antibody or fragment that binds to human PD-1 protein, a second antigen-binding fragment having specificity for a molecule on an immune cell as described herein, and a pharmaceutically acceptable carrier or excipient. In some embodiments, the pharmaceutical composition further comprises at least one additional therapeutic agent. For example, the therapeutic agent can be a toxin, a radiolabel, an siRNA, a small molecule, or a cytokine.

[0017] One aspect of the present invention relates to a pharmaceutical composition comprising a bispecific antibody or fragment that binds to human PD-1 protein, as described herein, and a second, third, fourth, or fifth antigen-binding fragment having specificity for a molecule on an immune cell, and a pharmaceutically acceptable carrier or excipient. In some embodiments, the pharmaceutical composition further comprises at least one additional therapeutic agent. For example, the therapeutic agent can be a toxin, a radiolabel, an siRNA, a small molecule, or a cytokine.

[0018] One aspect of the present invention relates to an isolated cell comprising one or more polynucleotides encoding a PD-1 antibody or fragment thereof described herein. One aspect of the present invention relates to an isolated cell comprising one or more polynucleotides encoding a bispecific antibody or fragment thereof described herein. One aspect of the present invention relates to an isolated cell comprising one or more polynucleotides encoding a multispecific antibody or fragment thereof described herein.

[0019] One aspect of the present invention relates to a kit comprising a syringe, needle, or applicator and instructions for use for administering a pharmaceutical composition to a subject.

[0020] One aspect of the present invention relates to an engineered cell comprising a chimeric antigen receptor, the chimeric antigen receptor comprising an extracellular ligand-binding domain specific for an antigen on the surface of a cancer cell, the antigen comprising PD-1. Another aspect of the present invention relates to an engineered cell comprising a chimeric antigen receptor, the chimeric antigen receptor comprising an extracellular ligand-binding domain specific for a first antigen and a second antigen on the surface of a cancer cell, the first antigen comprising CXCR4 and the second antigen comprising CLDN4, or the first antigen comprising CAIX and the second antigen comprising CD70, or the first antigen comprising MUC1 and the second antigen comprising Msln. In one embodiment, the extracellular ligand-binding domain comprises an antibody or a fragment thereof. In one embodiment, the antibody comprises a VH and / or VL according to Tables 1-11, or any combination thereof, and further comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129. In one embodiment, the antibody comprises CDR1, CDR2, and / or CDR3 of Table 12, or any combination thereof, and the antibody further comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129. In one embodiment, the engineered cell is a T cell, an NK cell, or an NKT cell. In one embodiment, the T cell is a CD4+, CD8+, CD3+ panT cell, or any combination thereof.

[0021] One aspect of the present invention relates to a method of treating cancer in a subject. In one embodiment, the method comprises administering to a subject in need of cancer treatment a therapeutically effective amount of a composition comprising an antibody described herein. In one embodiment, the method comprises administering to a subject in need of cancer treatment a therapeutically effective amount of a pharmaceutical composition described herein. In one embodiment, the method comprises administering to a subject in need of cancer treatment a therapeutically effective amount of a CAR composition described herein. In some embodiments, the cancer expresses PD-1. In other embodiments, the cancer comprises non-small cell lung cancer, melanoma, ovarian cancer, lymphoma, B-cell chronic lymphocytic leukemia (CLL), or renal cell carcinoma. In a further embodiment, the method further comprises administering to the subject a chemotherapeutic agent.

[0022] [The present invention 1001] 1. An isolated multispecific antibody or antigen-binding fragment thereof that binds to human programmed cell death 1 (PD-1) protein and interleukin-12 (IL-12) receptor, CDR1 comprising G-(X1)-TF-(X2X3)-Y-(X4) (SEQ ID NO: 81), G-(X5)-TF-(X6X7X8)-A (SEQ ID NO: 82), GDSVSSDNYF (SEQ ID NO: 43), or GYTFNRFG (SEQ ID NO: 55), CDR2 comprising ISWNSGSI (SEQ ID NO: 19), IYPDDSDT (SEQ ID NO: 33), VYYNGNT (SEQ ID NO: 45), TNPYNGNT (SEQ ID NO: 57), or ISYDGSNK (SEQ ID NO: 69), CDR3 comprising ASDYGDKYYYYGMDV (SEQ ID NO: 21), AFWGASGAPVNGFDI (SEQ ID NO: 35), ATETPPTSYFNSGPFDS (SEQ ID NO: 47), ARVVAVNGMDV (SEQ ID NO: 59), ASQTVAGSDY (SEQ ID NO: 71), or ASDYGDKYYYGMDV (SEQ ID NO: 79), or a combination of these CDRs a heavy chain comprising CDR1 comprising SSNIGSNT (SEQ ID NO: 24), SSNIGAGYV (SEQ ID NO: 37), SNNVGAHG (SEQ ID NO: 49), SGSIAAYY (SEQ ID NO: 61), or NIGSKS (SEQ ID NO: 73); (X9)-DN (SEQ ID NO: 83), (X 10 )-NN (SEQ ID NO: 84), or DDS (SEQ ID NO: 75), a CDR3 comprising AAWDGGLNGRGV (SEQ ID NO: 28), AAWDDSLNAPV (SEQ ID NO: 41), SSWDSSLSGYV (SEQ ID NO: 53), QSYDSSNLWV (SEQ ID NO: 65), or QVWHSVSDQGV (SEQ ID NO: 77); or a combination of these CDRs a light chain comprising, or combinations of these and further comprising a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129. [The present invention 1002] The antibody of the present invention is bispecific. [The present invention 1003] The antibody of the present invention, which is a single-chain antibody. [The present invention 1004] At least 1.0 x 10 -6 1001. An antibody of the present invention having a binding affinity of M. [The present invention 1005] The antibody or fragment of the present invention, wherein said constant region comprises a heavy chain constant region, a light chain constant region, an Fc region, or a combination thereof. [The present invention 1006] 1001. The antibody of the present invention, wherein X1, X4, X5 or X8 is a non-polar amino acid residue. [The present invention 1007] 1006. The antibody of the present invention, wherein X1, X4, X5 or X8 is tyrosine (Y), phenylalanine (F), or alanine (A). [The present invention 1008] 1001. The antibody of the present invention, wherein X2, X3, X4, X6, X7 or X8 is a polar amino acid residue. [The present invention 1009] 1008. The antibody of the present invention, wherein X2, X3, X4, X6, X7 or X8 is aspartic acid (D), threonine (T), serine (S), or tryptophan (W). [The present invention 1010] 1001. The antibody of the present invention, wherein X1 is phenylalanine (F) or tyrosine (Y). [The present invention 1011] 1001. The antibody of the present invention, wherein X2 is aspartic acid (D), threonine (T), or serine (S). [The present invention 1012] 1001. The antibody of the present invention, wherein X3 is aspartic acid (D), threonine (T), or serine (S). [The present invention 1013] 1001. The antibody of the present invention, wherein X4 is alanine (A) or tryptophan (W). [The present invention 1014] 1001. The antibody of the present invention, wherein X5 is phenylalanine (F) or tyrosine (Y). [The present invention 1015] 1001. The antibody of the present invention, wherein X6 is aspartic acid (D) or serine (S). [The present invention 1016] 1001. The antibody of the present invention, wherein X7 is aspartic acid (D) or serine (S). [The present invention 1017] 1001. The antibody of the present invention, wherein X8 is phenylalanine (F) or tyrosine (Y). [The present invention 1018] 1001. The antibody of the present invention, wherein X9 is a polar hydrophilic amino acid residue. [The present invention 1019] The antibody of the present invention, wherein X9 is glutamic acid (E), asparagine (N), or aspartic acid (D). [The present invention 1020] X 10 is a polar hydrophilic amino acid residue. [The present invention 1021] X 10 is serine (S) or arginine (R). [The present invention 1022] An antibody composition comprising at least one antibody, wherein said at least one antibody comprises two heavy chains and two light chains; the heavy chain CDRs are between residues 27 and 38, residues 56 and 65, and residues 105 and 119 according to the IMGT numbering of SEQ ID NO: 1, or between residues 27 and 38, residues 56 and 65, and residues 105 and 119 according to the IMGT numbering of SEQ ID NO: 3, or between residues 27 and 38, residues 56 and 65, and residues 105 and 121 according to the IMGT numbering of SEQ ID NO: 5, or between residues 27 and 38, residues 56 and 65, and residues 105 and 115 according to the IMGT numbering of SEQ ID NO: 7, or between residues 27 and 38, residues 56 and 65, and residues 105 and 115 according to the IMGT numbering of SEQ ID NO: 9 or between residues 27 and 38, 56 and 65, and 105 and 119 according to the IMGT numbering of SEQ ID NO: 12, or between residues 27 and 38, 56 and 65, and 105 and 119 according to the IMGT numbering of SEQ ID NO: 13, or between residues 27 and 38, 56 and 65, and 105 and 119 according to the IMGT numbering of SEQ ID NO: 15, with the proviso that at least one of the heavy chain CDRs differs by a single amino acid substitution compared to the reference CDR; and the light chain CDRs are between residues 27 and 38, residues 56 and 65, and residues 105 and 116 according to the IMGT numbering of SEQ ID NO:2, or between residues 27 and 38, residues 56 and 65, and residues 105 and 115 according to the IMGT numbering of SEQ ID NO:4, or between residues 27 and 38, residues 56 and 65, and residues 105 and 115 according to the IMGT numbering of SEQ ID NO:6, or between residues 27 and 38, residues 56 and 65, and residues 105 and 115 according to the IMGT numbering of SEQ ID NO:8, 6 and 65, and residues 105 and 114, or between residues 27 and 38, residues 56 and 65, and residues 105 and 115 according to the IMGT numbering of SEQ ID NO: 10, or between residues 27 and 38, residues 56 and 65, and residues 105 and 116 according to the IMGT numbering of SEQ ID NO: 11, with the proviso that at least one of said light chain CDRs differs by a single amino acid substitution compared to its reference CDR; the antibody composition binds to an epitope comprising amino acid residues within the face of PD-1 generated by the FCC' chain but does not contact the C'D loop of PD-1 comprising non-adjacent amino acids in SEQ ID NO:XX; and the antibody further comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129. Antibody composition. [The present invention 1023] 1. An isolated multispecific antibody or fragment thereof that binds to human programmed cell death 1 (PD-1) protein and interleukin-12 (IL-12) receptor, (a) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28, or (b) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 31, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 33, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 35, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 37, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 39, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 41; or (c) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 43, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 45, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 47, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 49, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 51, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 53, or (d) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 55, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 57, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 59, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 61, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 63, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 65, or (e) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 67, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 69, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 71, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 73, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 75, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 77; or (f) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28, or (g) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 79, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28, or (h) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28, or (i) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28, or (j) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 79, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28 and further comprising a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129. [The present invention 1024] 1. An isolated multispecific antibody or antigen-binding fragment thereof, wherein the antibody binds to human PD-1 protein and comprises a heavy chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 1, 3, 5, 7, 9, 12, 13, and 15, and a light chain variable region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, and 11; and the antibody binds to interleukin-12 (IL-12) receptor and comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129. [The present invention 1025] 1. An isolated multispecific antibody or antigen-binding fragment thereof, wherein the antibody binds to PD-1 and comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO: 1 and the light chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO: 2, and the antibody binds to the interleukin-12 (IL-12) receptor and comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129. [The present invention 1026] 1. An isolated multispecific antibody or antigen-binding fragment thereof, wherein the antibody binds to PD-1 and comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:3 and the light chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:4, and the antibody binds to the interleukin-12 (IL-12) receptor and comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO:129. [The present invention 1027] 1. An isolated multispecific antibody or antigen-binding fragment thereof, wherein the antibody binds to PD-1 and comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:5 and the light chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:6, and the antibody binds to the interleukin-12 (IL-12) receptor and comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO:129. [The present invention 1028] 1. An isolated multispecific antibody or antigen-binding fragment thereof, wherein the antibody binds to PD-1 and comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:7 and the light chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:8, and the antibody binds to the interleukin-12 (IL-12) receptor and comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO:129. [The present invention 1029] 1. An isolated multispecific antibody or antigen-binding fragment thereof, wherein the antibody binds to PD-1 and comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:9 and the light chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO:10, and the antibody binds to the interleukin-12 (IL-12) receptor and comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO:129. [The present invention 1030] 1. An isolated multispecific antibody or antigen-binding fragment thereof, wherein the antibody binds to PD-1 and comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO: 1 and the light chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO: 11, and the antibody binds to the interleukin-12 (IL-12) receptor and comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129. [The present invention 1031] 1. An isolated multispecific antibody or antigen-binding fragment thereof, wherein the antibody binds to PD-1 and comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO: 12 and the light chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO: 2, and the antibody binds to the interleukin-12 (IL-12) receptor and comprises a constant region, a linker, and an IL-12 amino acid sequence that has at least 90% identity to SEQ ID NO: 129. [The present invention 1032] 1. An isolated multispecific antibody or antigen-binding fragment thereof, wherein the antibody binds to PD-1 and comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO: 13 and the light chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO: 2, and the antibody binds to the interleukin-12 (IL-12) receptor and comprises a constant region, a linker, and an IL-12 amino acid sequence that has at least 90% identity to SEQ ID NO: 129. [The present invention 1033] 1. An isolated multispecific antibody or antigen-binding fragment thereof, wherein the antibody binds to PD-1 and comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO: 13 and the light chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO: 11, and the antibody binds to the interleukin-12 (IL-12) receptor and comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129. [The present invention 1034] 1. An isolated multispecific antibody or antigen-binding fragment thereof, wherein the antibody binds to PD-1 and comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO: 15 and the light chain comprises an amino acid sequence that is about 95% identical to SEQ ID NO: 11, and the antibody binds to the interleukin-12 (IL-12) receptor and comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129. [This invention 1035] A nucleic acid encoding any one of the antibodies 1001 to 1034 of the present invention. [The present invention 1036] A pharmaceutical composition comprising any one of the antibodies or fragments thereof of the present invention 1001 to 1034 and a pharmaceutically acceptable carrier or excipient. [This invention 1037] The pharmaceutical composition of invention 1036, further comprising at least one additional therapeutic agent. [The present invention 1038] 1037. The pharmaceutical composition of claim 1037, wherein said therapeutic agent is a toxin, a radiolabel, an siRNA, a small molecule, or a cytokine. [This invention 1039] An isolated cell comprising one or more polynucleotides encoding any one of the antibodies or fragments thereof of the present invention 1001 to 1034. [The present invention 1040] A vector comprising the nucleic acid of the present invention. [This invention 1041] A cell comprising the vector of the present invention. [The present invention 1042] A kit comprising at least one antibody composition of the invention 1036, a syringe, needle or applicator for administering said at least one antibody to a subject, and instructions for use. [This invention 1043] 1. An engineered cell comprising a chimeric antigen receptor, wherein the chimeric antigen receptor comprises an extracellular ligand-binding domain specific for an antigen on the surface of a cancer cell, wherein the antigen comprises PD-1. [This invention 1044] 1. An engineered cell comprising a chimeric antigen receptor, the chimeric antigen receptor comprising an extracellular ligand-binding domain specific for a first antigen and a second antigen on the surface of a cancer cell, wherein the first antigen comprises CXCR4 and the second antigen comprises CLDN4, or the first antigen comprises CAIX and the second antigen comprises CD70, or the first antigen comprises MUC1 and the second antigen comprises Msln. [This invention 1045] 1043. The engineered cell of claim 1044, wherein said extracellular ligand-binding domain comprises an antibody or a fragment thereof. [The present invention 1046] The engineered cell of the present invention 1045, wherein the antibody comprises a VH and / or VL according to Tables 1-11, or any combination thereof, and the antibody further comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129. [This invention 1047] The engineered cell of the present invention 1045, wherein the antibody comprises CDR1, CDR2, and / or CDR3 of Table 12, or any combination thereof, and the antibody further comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129. [This invention 1048] The engineered cell of claim 1043 or 1044, wherein the engineered cell comprises a T cell, an NK cell, or an NKT cell. [This invention 1049] 1048. The engineered cell of claim 1048, wherein said T cells are CD4+, CD8+, CD3+ pan T cells, or any combination thereof. [The present invention 1050] A method for treating cancer in a subject, comprising administering to a subject in need thereof a therapeutically effective amount of an antibody of any of claims 1001 to 1034, a pharmaceutical composition of claim 1036, or a composition comprising a CAR composition of any of claims 1043 to 1048. [This invention 1051] The method of claim 1050, wherein said cancer expresses PD-1. [This invention 1052] The method of claim 1050, wherein said cancer comprises non-small cell lung cancer, melanoma, ovarian cancer, lymphoma, B-cell chronic lymphocytic leukemia (CLL), or renal cell carcinoma. [This invention 1053] The method of claim 1050, further comprising administering to said subject a chemotherapeutic agent. Other objects and advantages of the present invention will become readily apparent from the following description. [Brief explanation of the drawings]

[0023] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0024] [Figure 1] 1 shows an overview of the PMPL panning strategy for antibody discovery (e.g., PD-1 antibodies of the present invention). [Figure 2-1] Figure 2 shows a schematic of the VH and VL sequences of the anti-PD-1 antibody P4-B3. [Figure 2-2] See description of Figure 2-1. [Figure 3-1] Figure 3 illustrates the three-dimensional protein structure of human PD-1, highlighting differences between human and cynomolgus monkey PD-1 in red. The corresponding amino acid sequences are shown below. A high degree of similarity is observed between human and cynomolgus monkey PD-1. The three-dimensional protein structure of PD-1 bound to nivolumab is also shown. [Figure 3-2] See description of Figure 3-1. [Figure 4] 1 is a graph showing binding curves of the P4-B3 minibody to human and cynomolgus monkey PD-1. [Figure 5] 1 shows a graph of the octet binding curves of various formats of P4-B3. [Figure 6]Binding curves for PD-L1 competition assays using PD-1 antibodies are shown. [Figure 7] Binding curves of IgG ELISA are shown. [Figure 8-1] FIG. 8 shows FACS analysis plots of PD1 FACS performed with anti-PD1 IgG. [Figure 8-2] See description of Figure 8-1. [Figure 9] FIG. 1 is a schematic diagram of the PD1-PDL1 bioassay. [Figure 10A] Figure 10 shows graphs of induction curves from a commercially available PD1-PDL1 bioassay. (A) The IgG1 wt monomer version of P4-B3 is compared with pembro (pembrolizumab) and nivo (nivolumab). As shown, the P4-B3 anti-PD1 antibody exhibits approximately half the signal of pembro and nivo. [Figure 10B] Figure 10 shows a graph of induction curves from a commercially available PD1-PDL1 bioassay. (B) Comparison of hexamer IgG1 LALA configurations. The hexamer configuration shows an approximately 2- to 3-fold shift in the dose-response curve. [Figure 10C] Figure 10 shows a graph of induction curves from a commercially available PD1-PDL1 bioassay. (C) Direct comparison of IgG4 constructs (monomer and hexamer) with nivo. Here, a similar trend to 10A and 10B is observed. The commercially available antibody is 2-fold more potent than P4-B3, with the hexamer exhibiting an approximately 2-3 fold shift compared to the monomer. [Figure 11] Schematic ribbon diagram of human PD-1 (see Cheng, X et al., (2013). JBC doi.org / 10.1074 / jbc.M112.448126). PD-1 is an antiparallel B sandwich. Depicting an antiparallel B sandwich. The front sheet of the PD-1 ribbon diagram includes G, F, C, and C', and the back sheet of the PD-1 ribbon diagram includes A, B, E, and D. PD-1 lacks cysteines in the stalk region, preventing PD-1 homodimerization. [Figure 12-1]Figure 12 is a schematic diagram of the protein structure showing the interaction of PD-1 with its ligands, PDL-1 and PDL-2. See Cheng et al., Structure and Interactions of the Human Programmed Cell Death 1 Receptor, JBC 2013; Tan et al. (2016) Protein Cell DOI:10.1007 / s13238-016-0337-7, and Yan et al. (2008) PNAS, DPO:10.1073 / pnas.0804453105. [Figure 12-2] See description of Figure 12-1. [Figure 13-1] Figure 13 shows ribbon diagrams of PD-1 binding to commercially available antibodies. (A) Nivo blocks PD-L1 by binding to the FG loop. (B) Pembro blocks by binding to the C and C' strands. See Fessas et al, Seminars in Oncology, 2017. [Figure 13-2] See description of Figure 13-1. [Figure 14] Protein model overlay and amino acid sequence comparison of human and mouse PD-1. Similarity between human and mouse PD-1: approximately 64%. See Cheng, X et al., (2013). JBC doi.org / 10.1074 / jbc.M112.448126. [Figure 15] Protein model overlay and amino acid sequence comparison of human and mouse PD-1. Amino acid residue P110 (purple) introduces a kink into the FG loop. In mouse PD-1, this residue directs the BC loop toward the DE loop through a hydrophobic interaction between Arg83 and Trp39. Amino acid residue P63 (blue) in human PD-1 moves the loop away from the C' strand, forming a highly flexible loop. Without being bound by theory, these two structural differences may influence the lack of cross-reactivity of Pembro and Nivo with mouse PD-1. See Cheng, X et al., (2013). JBC doi.org / 10.1074 / jbc.M112.448126. [Figure 16] 1 is a graph showing P4-B3 binding to mouse PD-1. P4-B3 has a high affinity for mouse PD-1, setting it apart from Pembro and Nivo. [Figure 17]

[0033] Figure 1 is a schematic diagram of a staining strategy that can be used to differentially label displayed yeast libraries prior to screening by FACS. See Cherf and Cochran, 2015, Methods Mol Biol. [Figure 18] Figure 1 shows plots of FACS analysis. Standard staining sorting is shown, with blue gates representing positive hits and green gates representing negatives. The blue gate shifts upward along the x=y axis. Without being bound by theory, PD-1 antibody clones bind to PD-1 with higher affinity. [Figure 19] A plot of the FACS analysis of dynamic staining is shown. Cells collected in the blue gate, examples of targets are shown in red circles. The collection gate was kept wide to obtain a large sample. [Figure 20] 1 is a graph of the binding curve of P4-B3 mutants. [Figure 21] 1 is a graph of the binding curve of P4-B3 mutants. [Figure 22-1] FIG. 22 is a schematic diagram of the P4-B3 (anti-PD1) germline alignment and a diagram of the amino acid residues that were altered in the P4-B3 mutants that were generated. [Figure 22-2] See description of Figure 22-1. [Figure 22-3] See description of Figure 22-1. [Figure 23] Graph of octet binding curves of various P4-B3 mutants. SA sensors were coated with 2.5ug / ml biotinylated PD-1. [Figure 24] Binding curves of PD-L1 competition assays using PD-1 antibodies (various P4-B3 mutants) are shown. [Figure 25] FIG. 1 is a schematic diagram of the amino acid residues that were altered in the P4-B3 mutants generated. [Figure 26-1] Figure 26 is a schematic diagram of the germline alignment of anti-PD1 antibody clones. These candidates were screened via soluble protein panning (PD1-hFc). [Figure 26-2] See description of Figure 26-1. [Figure 26-3] See description of Figure 26-1. [Figure 26-4] See description of Figure 26-1. [Figure 27] Octet binding curves are shown. Both PD1 and PDL1 have His tags. Sensor H4 clearly shows that the sensor was not saturated before PDL1 was added. Further sequencing confirmed that PD1#5 was not an antibody. A4: R&D anti-PD1 (AF1086), B4: PD1 mini3, C4: PD1 mini4, D4: PD1 mini5, E4: PD1 mini7, F4: PD1 mini13, G4: TIG1 (control Ab) + PDL1, H4: No Ab + PD1 to confirm whether the sensor was saturated. [Figure 28] Octet binding curves are shown. Both PD1 and PDL1 have His tags, as evident from sensor H4. The sensor was not saturated before adding PDL1. PD1 and PDL1 were used at 2.5 μg / ml. Antibodies were used at 2 μg / ml. All samples were diluted in 1x PBST. A new PD-1 antibody was used in scFv-Fc format; Nivo and Pembro are commercially available formulations. A6: Nivo, B6: Pembro, C6: PD1#3, D6: PD1#4, E6: PD1#5, F6: PD1#7, G6: PD1#13, H6: TIG1(-). [Figure 29] Octet binding curve graphs are shown. SA sensors were loaded with 2.5µg of expi293 expressing soluble PD1-avi and biotinylated using Avidity's biotinylation kit. PD1#3 showed a high off-rate. [Figure 30-1] FIG. 30 is a schematic diagram of the germline sequence of anti-PD1 antibody clone P4-B7. [Figure 30-2] See description of Figure 30-1. [Figure 31] Figure 1 shows a graph of the minibody binding curves of P4-B7 to human and cynomolgus monkey PD-1. Curves were generated in expi293 cells 48 hours after transfection. Expression levels were normalized to a commercially available antibody for the human variant, but not for the cynomolgus monkey variant. Normalization was not performed for the cynomolgus monkey variant because the commercially available antibody used has not been reported to bind to cynomolgus monkey PD#1. [Figure 32] The graph shows the binding curve for an IgG ELISA using P4-B7. Because P4-B7 exhibited a significant right-shift, the reaction kinetics were not suitable for progression. In the upper panel, an ELISA plate was coated with 1 μg / ml soluble PD1 for 2 hours at 37°C. The plate was then washed and blocked with 2% BSA / PBS for 1 hour at 37°C. The blocking solution was removed, and 3-fold serial dilutions of the antibody, starting at 6 μg / ml, were added to each well (100 μl) in 2% milk-PBST. The plate was then incubated at room temperature with gentle shaking, washed six times with PBS-T, and a secondary anti-human Fc-HRP (1:150kJ, Bethyl) was added. The plate was again incubated at room temperature with gentle shaking for 1 hour, then washed six times with PBS-T. TMB substrate was added, and the plate was incubated at 30°C for 10 minutes to promote the HRP reaction. The signal was then quenched with TMB stop solution and read at 450 nm. Bottom: The data acquisition protocol was the same as the data acquisition protocol for the graph above, except plates were coated with 3-fold serial dilutions of antigen starting at 6ug / ml. Antibody was then added to all wells at a constant concentration of 1ug / ml. [Figure 33] Graph of induction curve from a commercially available PD1-PDL1 bioassay is shown. [Figure 34]A schematic diagram of the Promega PD1-PDL1 bioassay (J1250) is shown. The Promega PD1-PDL1 bioassay (J1250) was performed using wild-type aPD-1scFv-Fc (P4-B3) and single and combo mutants generated from a random mutagenesis yeast library. Nivolumab was used as a benchmark control. [Figure 35] The P4-B3 mutants in the Promega bioassay (scFv-Fc format bioassay) are shown. Nivo (filled circle) achieved approximately 6-fold induction, similar to previous experiments. The single mutants HLkin-1 and HL-7, and the combo mutants Mut+2 and Mut+3, demonstrated higher or equal levels of PD-1 / PD-L1 blockade compared to Nivo. This is reflected in the EC50 values, with Mut+2's EC50 value approximately half that of Nivo. P4-B3 wild-type showed lower levels of blockade, with an EC50 value 1.75-fold greater than Nivo. Point mutations identified by our random mutagenesis yeast display library likely significantly impact binding and checkpoint blocking capacity. All P4-B3 samples used in this assay were in scFv-Fc format. Only Nivo and F10 were used as full IgG. [Figure 36] Octet binding curves of P4-B3 WT / mutant IgG are shown. SA sensors were coated with biotinylated PD-1 and immersed in various concentrations of anti-PD-1 antibody. The first step after baseline indicates antibody binding, and the second step indicates dissociation. As can be seen, the off-rate of P4-B3 WT is fast, while the off-rates of the mutant and Pembro are much slower. [Figure 37] Binding curves of P4-B3 single versus combo mutants with mouse PD-1 (mPD-1) in scFv-Fc format are shown. [Figure 38] Unless otherwise stated, binding curves of P4-B3 single versus combo mutants with hPD1 in scFv-Fc format are shown. [Figure 39]Shown is the MFI of P4-B3 single versus combo variants with hPD1 in scFv-Fc format, excluding pembro / nivo / WT IgG1. [Figure 40-1] FIG. 40 is a schematic diagram of the design of aPD1-scIL12 fusions such as HC F2A scIL12. [Figure 40-2] See description of Figure 40-1. [Figure 41-1] FIG. 41 is a schematic diagram of the design of aPD1-scIL12 fusions such as HC G4S scIL12. [Figure 41-2] See description of Figure 41-1. [Figure 42-1] FIG. 42 is a schematic diagram of the design of aPD1-scIL12 fusions such as LC F2A scIL12. [Figure 42-2] See description of Figure 42-1. [Figure 43-1] Figure 43 is a schematic diagram of the design of aPD1-scIL12 fusions such as LC G4S scIL12. [Figure 43-2] See description of Figure 43-1. [Figure 44-1] Figure 44 is a schematic diagram of the cloning strategy of the aPD1-scIL12 fusion using stuffer. [Figure 44-2] See description of Figure 44-1. [Figure 44-3] See description of Figure 44-1. [Figure 44-4] See description of Figure 44-1. [Figure 44-5] See description of Figure 44-1. [Figure 44-6] See description of Figure 44-1. [Figure 44-7] See description of Figure 44-1. [Figure 44-8] See description of Figure 44-1. [Figure 44-9] See description of Figure 44-1. [Figure 44-10] See description of Figure 44-1. [Figure 44-11]See description of Figure 44-1. [Figure 44-12] See description of Figure 44-1. [Figure 45A] Figure 45 shows (A) a photographic image of a protein gel showing protein expression, and (B) a photographic image of a protein gel showing the expression and purification of a protein sample. For Figure 45B, samples were run on a NuPAGE Tris-acetate 3-8% gel in Tris-acetate SDS running buffer at 120 V for 1 hour. The reduced sample was mixed with 10% BME. [Figure 45B] See legend to Figure 45A. [Figure 46-1] Figure 46 is a graph of the kinetic binding data of aPD1-scIL12 fusion proteins. Octet assays were performed to measure the binding affinity of P4-B3 WT versus Mut+2 and Mut+3 to PD-1. [Figure 46-2] See description of Figure 46-1. [Figure 47] Figure 10 is a graph of kinetic binding data for aPD1-scIL12 fusion proteins. Octet assays were performed to measure the binding affinity of P4-B3 mut+3 HC and LC scIL12 constructs to PD-1. [Figure 48] FIG. 1 is a schematic diagram of the IL-12 signaling cascade. [Figure 49] 1 is a graph of an IL-12 reporter assay. [Figure 50] FIG. 1 is a schematic diagram showing the plate layout for a killing assay using CAR T cells. [Figure 51] Graph showing a comparison of aPD1-IL12-HC fusion with aPD1 in a killing assay. Percentage of killed target cells = (T0-x) / T0 [Figure 52] 1 is a graph showing a comparison of aPD1-IL12-HC fusion, aPD1, and IL-12 in a killing assay. Percentage of killed target cells = (T0-x) / T0 [Figure 53-1]Figure 53 shows the results of cytokine ELISA in a bar graph, where * indicates p<0.05, ** indicates p<0.005, *** indicates p<0.0005, and **** indicates p<0.0001. [Figure 53-2] See description of Figure 53-1. [Figure 54-1] Figure 54 shows the results of cytokine ELISA in a bar graph, where * indicates p<0.05, ** indicates p<0.005, *** indicates p<0.0005, and **** indicates p<0.0001. [Figure 54-2] See description of Figure 54-1. [Figure 55-1] Figure 55 shows the results of cytokine ELISA in a bar graph, where * indicates p<0.05, ** indicates p<0.005, *** indicates p<0.0005, and **** indicates p<0.0001. [Figure 55-2] See description of Figure 55-1. [Figure 56-1] FIG. 56 is a schematic diagram of scIL-12 fusion antibodies and mechanism of action. [Figure 56-2] See description of Figure 56-1. [Figure 57] FIG. 1 is a schematic diagram of the amino acid residues that were altered in the P4-B3 mutants generated. [Figure 58] Schematic diagram of a mixed lymphocyte reaction (MLR) assay. CD4+ T cells express high levels of PD-1 upon activation. DCs express high levels of PD-L1, improving self-tolerance in the body. T cell activation via MHC mismatch is limited due to PD-1 / PD-L1 blockade. Addition of anti-PD-1 antibodies removes this inhibitory signal, increasing T cell activation (measured by cytokine release). [Figure 59-1] Figure 59 shows a graph of the MLR assay showing cytokine production, as indicated in the graph title. [Figure 59-2] See description of Figure 59-1. [Figure 60-1] Figure 60 shows a graph of the MLR assay showing cytokine production, as indicated in the graph title. [Figure 60-2]See description of Figure 60-1. [Figure 61-1] Figure 61 shows a statistical data table for the MLR assay of Pembro versus P4B3mut+3 IgG4. [Figure 61-2] See description of Figure 61-1. [Figure 62-1] Figure 62 shows a statistical data table for the MLR assay of Pembro versus P4B3mut+3 IgG4. [Figure 62-2] See description of Figure 62-1. [Figure 63-1] Figure 63 shows a statistical data table for the MLR assay of Pembro versus P4B3mut+3 IgG4. [Figure 63-2] See description of Figure 63-1. [Figure 64-1] Figure 64 shows a statistical data table for the MLR assay of Pembro versus P4B3mut+3 IgG4. [Figure 64-2] See description of Figure 64-1. [Figure 65-1] Figure 65 shows a graph of the MLR assay showing cytokine production, as indicated in the graph title. [Figure 65-2] See description of Figure 65-1. [Figure 66-1] Figure 66 shows a graph of the MLR assay showing cytokine production, as indicated in the graph title. [Figure 66-2] See description of Figure 66-1. [Figure 67] FIG. 1 is a schematic diagram of a construct comprising constant region-linker-IL12, further comprising the p40 and p35 subunits of IL-12 separated by an MMP9 cleavage site (GPLGVRG). [Figure 68] FIG. 1 is a schematic diagram of a construct comprising constant region-linker-IL12 (further comprising the p40 and p35 subunits of IL-12 separated by a mutated MMP9 cleavage site). [Figure 69] Schematic diagram of armored CAR-T cells. [Figure 70] FIG. 1 is a schematic diagram of cytokines that stimulate CART therapy. [Figure 71-1] Figure 71 is a schematic diagram of the fusion of P4B3mut+3-scIL12 LC with an extended (G4S)5 linker. [Figure 71-2] See description of Figure 71-1. DETAILED DESCRIPTION OF THE INVENTION

[0025] Detailed Description of the Invention Abbreviations and Definitions A detailed description of one or more embodiments is provided herein. However, it is understood that the present invention can be embodied in various forms. Therefore, the specific details disclosed herein should not be construed as limiting, but as a basis for the claims and as a representative basis for teaching one skilled in the art how to use the present invention in any suitable manner.

[0026] The singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. The use of the words "a" or "an" when used in conjunction with the word "comprising" in the claims and / or specification can mean "one," but is also consistent with the meaning of "one or more," "at least one," and "one or more."

[0027] Whenever any of the phrases "for example," "such as," "including," etc. are used herein, unless expressly stated otherwise, it is understood that the phrase "without limitation" is also involved. Similarly, "one example," "exemplary," etc. are understood to be non-limiting.

[0028] The term "substantially" permits deviations from the descriptor that do not adversely affect the intended purpose. It is understood that a descriptor is modified by the term "substantially" even if the word "substantially" is not explicitly recited.

[0029] Terms such as "comprising," "including," "having," and "involving" (and similarly, "comprises," "includes," "has," and "involves") are used interchangeably and have the same meaning. Specifically, each term is defined consistent with the general U.S. patent law definition of "comprising" and, therefore, is construed as an open term meaning "at least the following," and not excluding additional features, limitations, aspects, etc. Thus, for example, "a process comprising steps a, b, and c" means that the process includes at least steps a, b, and c. Whenever the terms "a" or "an" are used, they are understood to mean "one or more," unless such interpretation is meaningless in the context.

[0030] As used herein, the term "about" is used herein to mean approximately, roughly, around, or within a range. When the term "about" is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the stated numerical values. In general, the term "about" is used herein to modify numerical values above and below the stated value by a variance of 20 percent above or below (high or low).

[0031] PD-1 Programmed T-cell death 1 (PD-1) is a transmembrane protein present on the surface of T cells that, when bound to programmed T-cell death ligand 1 (PD-L1) on tumor cells, suppresses T-cell activity and reduces T-cell-mediated cytotoxicity. Thus, PD-1 and PD-L1 are immune downregulators or "off switches" of immune checkpoints. Examples of PD-1 inhibitors include, but are not limited to, nivolumab, (Opdivo) (BMS-936558), pembrolizumab (Keytruda), pidilizumab, AMP-224, MEDI0680 (AMP-514), PDR001, MPDL3280A, MEDI4736, BMS-936559, and MSB0010718C.

[0032] The immune system must maintain a balance between effective responses to eliminate pathogens and maintaining tolerance to prevent autoimmune disease. T cells are central to maintaining this balance, and their proper regulation is primarily mediated by molecules of the B7-CD28 family. The interaction between B7 family members, which function as ligands, and CD28 family members, which function as receptors, not only provides important positive signals that initiate, enhance, and sustain T cell responses, but also contributes important negative signals that limit, terminate, and / or dampen T cell responses as needed. PD-1 is a member of the CD28 family.

[0033] Binding between PD-L1 and PD-1 has a profound effect on regulating T cell responses. Specifically, PD-L1 / PD-1 interaction inhibits T cell proliferation and the production of effector cytokines, such as IL-2 and IFN-γ, that mediate T cell activity and immune responses. This negative regulatory function is important for preventing T cell-mediated autoimmunity and immunopathology. However, the PD-1 / PD-L1 axis has also been shown to be involved in T cell exhaustion, thereby inhibiting T cell responses and adversely affecting the host. Long-term or chronic antigen stimulation of T cells can induce a negative immunological feedback mechanism, inhibiting antigen-specific responses and potentially leading to immune evasion by pathogens. T cell exhaustion can also lead to the physical loss of antigen-specific T cells themselves. PD-1 expression on T cells is upregulated upon chronic antigen stimulation, and its binding to PD-L1 blocks effector function in both CD4+ (T helper cells) and CD8+ (cytotoxic T lymphocytes or CTL) T cells, thus demonstrating PD-1 / PD-L1 interaction in inducing T cell exhaustion.

[0034] Recent studies have demonstrated that some chronic viral infections and cancers have developed immune evasion tactics that specifically exploit the PD-1 / PD-L1 axis by inducing PD-1 / PD-L1-mediated T cell depletion. Many human tumor cells and tumor-associated antigen-presenting cells express high levels of PD-L1, suggesting that tumors induce T cell depletion to evade antitumor immune responses. For example, during chronic HIV infection, HIV-specific CD8+ T cells are functionally impaired, including a reduced ability to produce cytokines and effector molecules and a reduced proliferation capacity. Studies have shown that PD-1 is highly expressed on HIV-specific CD8+ T cells in HIV-infected individuals, suggesting that blocking the PD-1 / PD-L1 pathway may have therapeutic potential in the treatment of HIV infection and AIDS patients. Collectively, agents that block the PD-1 / PD-L1 pathway offer novel therapeutic approaches for various cancers, HIV infection, and / or other diseases and conditions associated with T cell depletion. Therefore, there is an urgent need for agents that can block or prevent PD-1 / PD-L1 interaction.

[0035] Overexpression of PD-L1 has been detected in various cancers. For example, overexpression of PD-L1 in breast cancer is associated with a high-risk prognosis. PD-L1 is upregulated in renal cell carcinoma, and increased expression of PD-1 is also observed on tumor-infiltrating leukocytes. Anti-PD-L1 and anti-PD-1 antibodies have shown some clinical efficacy in phase I trials for renal cell carcinoma. Therapeutic agents capable of binding to PD-1 or PD-L1 may be useful for specifically targeting tumor cells. Agents capable of blocking the PD-1 / PD-L1 interaction may further aid in the treatment of cancers that have evaded antitumor T cell activity by inducing T cell exhaustion. The use of such agents alone or in combination with other anticancer therapeutics can effectively target tumor cells that overexpress PD-L1, enhancing antitumor T cell activity and thereby enhancing the immune response against targeted tumor cells.

[0036] PD-1 and PD-L1 can also be upregulated by T cells after chronic antigen stimulation, for example, by chronic infection. During chronic HIV infection, HIV-specific CD8+ T cells are functionally impaired, with reduced ability to produce cytokines and effector molecules and reduced proliferation. PD-1 is highly expressed on HIV-specific CD8+ T cells in HIV-infected individuals. Therefore, blocking this pathway may enhance the ability of HIV-specific T cells to proliferate and produce cytokines in response to stimulation with HIV peptides, thereby enhancing the immune response against HIV. Other chronic infections, such as chronic viral, bacterial, and parasitic infections, may also benefit from the use of PD-1 / PD-L1 blockade.

[0037] Embodiments of the present invention provide isolated multispecific antibodies with specificity for PD-1. As used herein, the term "isolated" with respect to nucleic acids, such as cells, DNA, or RNA, refers to molecules separated from other DNA or RNA, respectively, present in the natural source of the macromolecule. The term "isolated" can also refer to nucleic acids or peptides that are substantially free of cellular material, viral material, or culture medium, if produced by recombinant DNA technology, or from chemical precursors or other chemicals, if chemically synthesized. For example, an "isolated nucleic acid" can include nucleic acid fragments that are not naturally occurring as fragments and would not be found in their natural state. "Isolated" can also refer to cells or polypeptides that are isolated from other cellular proteins or tissues. Isolated polypeptides can encompass both purified and recombinant polypeptides. The isolated antibodies were identified through the use of a 27 billion human single-chain antibody (scFv) phage display library using PD-1 as the library selection target. These antibodies represent a new class of monoclonal antibodies against PD-1 that can compete with the binding of PD-L1, pembrolizumab, and nivolumab. Furthermore, the monoclonal PD-1 antibodies discussed herein cross-react with the PD-1 protein of cynomolgus monkeys (Macaca fascicularis). The monoclonal PD-1 antibodies discussed herein can also be used in the construction of multispecific antibodies or as payloads for CAR-T cells.

[0038] Ten unique recombinant monoclonal PD-1 antibodies are described herein. These include P4-B3, P4-B7, PD1#2, PD1#3, PD1#13, P4-B3-HLkin1, P4-B3-HL-7, P4-B3-HL-14, P4-B3 HLkin-1, HL-7 mut2, and P4-B3 HLkin-1 HL-7 HL-14 mut3. "Recombinant," as it relates to a polypeptide (such as an antibody) or polynucleotide, refers to a form of the polypeptide or polynucleotide that is not naturally occurring, a non-limiting example of which can be made by combining polynucleotides or polypeptides that are not normally together.

[0039] Nucleic acid and amino acid sequences of monoclonal PD-1 antibodies are provided below, along with exemplary wild-type IgG constant regions (see Table 2) useful in combination with the VH and VL sequences provided herein. TIFF2025121997000002.tif18154

[0040] Table 1A. Nucleic acid sequences of the variable regions of Ab (antibody) P4-B3 TIFF2025121997000003.tif77152

[0041] Table 1B. Amino acid sequences of the variable regions of Ab P4-B3 TIFF2025121997000004.tif44152

[0042] Table 2A. Nucleic acid sequence of the constant region of Ab P4-B3—wild-type IgG monomer TIFF2025121997000005.tif153152

[0043] Table 2B. Amino acid sequence of the constant region of Ab P4-B3—wild-type IgG monomer TIFF2025121997000006.tif86152

[0044] Table 3A. Nucleic acid sequences of the variable regions of Ab P4-B7 TIFF2025121997000007.tif77152

[0045] Table 3B. Amino acid sequences of the variable regions of Ab P4-B7 TIFF2025121997000008.tif44152

[0046] Table 4A: Nucleic acid sequences of the variable regions of PD1#2 TIFF2025121997000009.tif77152

[0047] Table 4B: Amino acid sequences of the variable regions of Ab PD1#2 TIFF2025121997000010.tif44152

[0048] Table 5A: Nucleic acid sequences of the variable regions of PD1#3 TIFF2025121997000011.tif77152

[0049] Table 5B: Amino acid sequences of the variable regions of Ab PD1#3 TIFF2025121997000012.tif43152

[0050] Table 6A. Nucleic acid sequences of the variable regions of Ab PD1#13 TIFF2025121997000013.tif73152

[0051] Table 6B: Amino acid sequence of the variable region of Ab PD1#13 TIFF2025121997000014.tif39152

[0052] TIFF2025121997000015.tif11156

[0053] Table 7A. Nucleic acid sequences of the variable regions of Ab P4-B3-HLkin1 TIFF2025121997000016.tif77152

[0054] Table 7B: Amino acid sequences of the variable regions of Ab HLKin1 TIFF2025121997000017.tif43152

[0055] Table 8A. Nucleic acid sequences of the variable regions of Ab P4-B3-HL-7 TIFF2025121997000018.tif81152

[0056] Table 8B: Amino acid sequence of the variable region of Ab HL-7 TIFF2025121997000019.tif43152

[0057] Table 9A. Nucleic acid sequences of the variable regions of Ab P4-B3-HL-14 TIFF2025121997000020.tif77152

[0058] Table 9B: Amino acid sequence of the variable region of Ab HL-14 TIFF2025121997000021.tif48152

[0059] Table 10A: Nucleic acid sequences of the variable regions of Ab HLkin-1 HL-7 mut2 TIFF2025121997000022.tif77152

[0060] Table 10B: Amino acid sequences of the variable regions of Ab HLkin-1 HL-7 mut2 TIFF2025121997000023.tif44152

[0061] Table 11A. Nucleic acid sequences of the variable regions of Ab HLkin-1 HL-7 HL-14 mut3 TIFF2025121997000024.tif77152

[0062] Table 11B: Amino acid sequences of the variable regions of Ab HLkin-1 HL-7 HL-14 mut3 TIFF2025121997000025.tif43152

[0063] The amino acid sequences of the heavy and light chain complementarity determining regions of the PD-1 antibody are shown in Tables 12A-B below.

[0064] Table 12A. PD-1 antibody heavy chain (V H ) complementarity-determining regions (CDRs) TIFF2025121997000026.tif114134

[0065] Table 12B. Light chain (V) of PD-1 antibody L ) complementarity-determining regions (CDRs) TIFF2025121997000027.tif114134

[0066] The amino acid sequences of the framework regions of the heavy and light chains of the PD-1 antibody are shown in Tables 13A-B below.

[0067] Table 13A. Heavy chain (V) of PD-1 antibodies H ) Framework region (FR) TIFF2025121997000028.tif202155

[0068] Table 13B. Light chain (V) of PD-1 antibody L ) Framework region (FR) TIFF2025121997000029.tif202155

[0069] The PD-1 antibodies described herein bind to PD-1. In one embodiment, the PD-1 antibodies have high affinity and high specificity for PD-1. Some embodiments also feature antibodies that share a certain percentage of identity or similarity with the amino acid or nucleotide sequence of the anti-PD-1 antibodies described herein. For example, "homology" or "identity" or "similarity" refers to the sequence similarity between two peptides or two nucleic acid molecules. Homology can be determined by comparing the position of each sequence, which may be aligned for comparison purposes. If a position in the compared sequences is occupied by the same base or amino acid, the molecules are homologous at that position. The degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. For example, an antibody can have 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more amino acid sequence identity when compared to a specific region or the full length of any one of the anti-PD-1 antibodies described herein. For example, an antibody can have 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more nucleic acid sequence identity when compared to a specific region or the full length of any one of the anti-PD-1 antibodies described herein. Sequence identity or similarity for the nucleic acids and proteins of the invention can be determined by sequence comparison and / or alignment by methods known in the art, such as those described in Ausubel et al. eds. (2007) Current Protocols in Molecular Biology. For example, sequence comparison algorithms (i.e., BLAST or BLAST 2.0), manual alignment, or visual inspection can be used to determine the percent sequence identity or similarity for the nucleic acids and proteins of the invention.

[0070] As used herein, "polypeptide" can encompass a single "polypeptide" as well as multiple "polypeptides" and refers to a molecule composed of monomers (amino acids) linked in a linear chain by amide bonds (also known as peptide bonds). The term "polypeptide" refers to any chain of two or more amino acids and does not refer to a specific length of the product. Thus, peptide, dipeptide, tripeptide, oligopeptide, "protein," "amino acid chain," or any other term used to refer to a chain of two or more amino acids can refer to a "polypeptide" herein, and the term "polypeptide" can be used in place of or interchangeably with any of these terms. "Polypeptide" can also refer to post-expression modified products of a polypeptide, such as, but not limited to, glycosylation, acetylation, phosphorylation, amidation, derivatization with known protecting / blocking groups, proteolytic cleavage, or modification with non-naturally occurring amino acids. A polypeptide can be derived from a natural biological source or produced by recombinant technology and need not necessarily be translated from a specific nucleic acid sequence. It can be generated by any method, including chemical synthesis. With respect to amino acid sequences, those skilled in the art will readily recognize that individual substitutions, deletions, or additions to nucleic acid, peptide, polypeptide, or protein sequences that alter, add, delete, or substitute a single amino acid or a small percentage of amino acids in the encoded sequence are collectively referred to herein as "conservatively modified variants." In some embodiments, the alteration results in the replacement of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. Such conservatively modified variants of the anti-PD-1 antibodies disclosed herein can exhibit increased cross-reactivity to PD-1 compared to unmodified PD-1 antibodies.

[0071] For example, a "conservative amino acid substitution" is one in which an amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues with similar side chains have been defined in the art as follows: basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), β-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, a non-essential amino acid residue in an immunoglobulin polypeptide is replaced with another amino acid residue from the same side chain family. In another embodiment, an amino acid chain can be replaced with a structurally similar chain that differs in the order and / or composition of the side chain family members.

[0072] antibody As used herein, "antibody" or "antigen-binding polypeptide" can refer to a polypeptide or polypeptide complex that specifically recognizes and binds to an antigen. An antibody can be a whole antibody, any antigen-binding fragment, or a single chain thereof. For example, an "antibody" can include any protein- or peptide-containing molecule containing at least a portion of an immunoglobulin molecule that has the biological activity of binding to an antigen. Non-limiting examples include the complementarity-determining regions (CDRs) of a heavy or light chain or a ligand-binding portion thereof, the variable region of a heavy or light chain, the constant region of a heavy or light chain, the framework (FR) region, or any portion thereof, or at least a portion of a binding protein. As used herein, the term "antibody" can refer to immunoglobulin molecules and immunologically active portions of immunoglobulin (Ig) molecules, i.e., molecules that contain an antigen-binding site that specifically binds (immunoreacts with) an antigen. "Specifically binds" or "immunoreacts" means that the antibody reacts with one or more antigenic determinants of a desired antigen and not with other polypeptides.

[0073] As used herein, the term "antibody fragment" or "antigen-binding fragment" refers to an antibody fragment of F (ab’)2 , F (ab)2 , F ab ', F ab "Antibody fragment" refers to a portion of an antibody, such as a Fv, scFv, or the like. Regardless of structure, an antibody fragment binds to the same antigen recognized by the intact antibody. The term "antibody fragment" can encompass aptamers (such as spiegelmers), minibodies, and diabodies. The term "antibody fragment" can also encompass any synthetic or genetically engineered protein that acts like an antibody by binding to a specific antigen to form a complex. Antibodies, antigen-binding polypeptides, variants, or derivatives described herein include, but are not limited to, polyclonal, monoclonal, multispecific, human, humanized, or chimeric antibodies, single chain antibodies, epitope-binding fragments such as Fab, Fab', F(ab')2, Fd, Fvs, single-chain Fv (scFv), single-chain antibodies, dAbs (domain antibodies), minibodies, disulfide-linked Fv (sdFv), fragments comprising either a VL or VH domain, fragments produced by a Fab expression library, and anti-idiotypic (anti-Id) antibodies.

[0074] A "single-chain variable fragment" or "scFv" is a fragment of an immunoglobulin heavy chain (V H ) and light chain (V L (ScFv) refers to a fusion protein of the variable regions of a single-chain Fv ("scFv") polypeptide molecule, a covalently linked VH:VL heterodimer, which can be expressed from a gene fusion comprising VH- and VL-encoding genes linked by a peptide-encoding linker. (See Huston et al. (1988) Proc Nat Acad Sci USA 85(16):5879-5883.) In some embodiments, the regions are linked by a short linker peptide of 10 to about 25 amino acids. The linker can be rich in glycines for flexibility and serine or threonine for solubility, whereby the VH N-terminus and V L The C-terminus of the scFv molecule can be linked to the C-terminus of the antibody V region of the scFv, or vice versa. This protein retains the specificity of the original immunoglobulin despite the removal of the constant region and the introduction of a linker. Many methods have been described for identifying chemical structures for converting naturally aggregated but chemically separated light and heavy polypeptide chains from antibody V regions into scFv molecules that fold into a three-dimensional structure substantially similar to that of an antigen-binding site. See, for example, U.S. Patent Nos. 5,091,513, 5,892,019, 5,132,405, and 4,946,778, each of which is incorporated by reference in its entirety.

[0075] Very large naive human scFv libraries have been and can be generated to provide a large source of rearranged antibody genes against a large number of target molecules. Smaller libraries can be constructed from individuals with infectious diseases to isolate disease-specific antibodies. (See Barbas et al., Proc. Natl. Acad. Sci. USA 89:9339-43 (1992); Zebedee et al., Proc. Natl. Acad. Sci. USA 89:3 175-79 (1992)).

[0076] Antibody molecules obtained from humans are classified into five classes of immunoglobulins: IgG, IgM, IgA, IgE, and IgD, which differ in the nature of the heavy chains present in the molecule. Those skilled in the art will understand that heavy chains are classified as gamma, mu, alpha, delta, or epsilon (γ, μ, α, δ, ε), with several subclasses within each (e.g., γ1-γ4). Certain classes also have subclasses, such as IgG1, IgG2, IgG3, and IgG4, as well as others. Immunoglobulin subclasses (isotypes), such as IgG1, IgG2, IgG3, IgG4, and IgG5, are well characterized and are known to confer functional specificity. For IgG, a typical immunoglobulin molecule contains two identical light chain polypeptides with a molecular weight of approximately 23,000 daltons and two identical heavy chain polypeptides with a molecular weight of 53,000-70,000. The four chains are typically joined by disulfide bonds in a "Y" configuration, with the light chains surrounding the heavy chains, which begin at the mouth of the "Y" and continue through the variable region. The immunoglobulin or antibody molecules described herein can be of any type (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2) or subclass of immunoglobulin molecule.

[0077] Light chains are classified as either kappa or lambda (κ, λ). Each heavy chain class can combine with either kappa or lambda light chains. Generally, light and heavy chains are covalently linked to each other, and when immunoglobulins are produced by either hybridomas, B cells, or genetically engineered host cells, the "tails" of the two heavy chains are linked to each other by covalent disulfide bonds or non-covalent bonds. In the heavy chains, the amino acid sequence extends from the N-terminus at the forked end of the Y-shape to the C-terminus at the bottom of each chain.

[0078] Both light and heavy chains are divided into regions of structural and functional homology. The terms "constant" and "variable" are used in a functional sense. The variable domains (VL and VH) of both the light and heavy chains determine antigen recognition and specificity. Conversely, the constant domains (CL, and CH1, CH2, or CH3) of the light and heavy chains confer important biological properties, such as secretion, transplacental mobility, Fc receptor binding, and complement fixation. The term "antigen-binding site" or "binding portion" can refer to the portion of an immunoglobulin molecule involved in antigen binding. The antigen-binding site is formed by amino acid residues in the N-terminal variable ("V") regions of the heavy ("H") and light ("L") chains. Three highly divergent sections within the V regions of the heavy and light chains, called "hypervariable regions," are interspersed between more conserved adjacent sections known as "framework regions" or "FRs." Thus, the term "FR" refers to the amino acid sequences naturally found between and adjacent to the hypervariable regions of immunoglobulins. In an antibody molecule, the three hypervariable regions of the light chain and the three hypervariable regions of the heavy chain are arranged relative to each other in three-dimensional space to form an antigen-binding surface. The antigen-binding surface is complementary to the three-dimensional surface of the antigen to be bound, and the three hypervariable regions of each of the heavy and light chains are referred to as "complementarity-determining regions," or "CDRs." The VH and VL regions, including the CDRs and framework regions (FRs), of the PD-1 antibody are shown in Tables 1A-15B.

[0079] The six CDRs present in each antigen-binding domain are short, noncontiguous sequences of amino acids that are specifically arranged to form the antigen-binding domain when the antibody assumes its three-dimensional configuration in an aqueous environment. The remaining amino acids of the antigen-binding domain, the FR regions, show little inter-molecular variability. The framework regions primarily adopt a beta-sheet conformation, and the CDRs form loops that connect them and, in some cases, form part of the beta-sheet structure. The framework regions function to form a scaffold that orients the CDRs through inter-chain non-covalent interactions. The antigen-binding domain formed by the arranged CDRs provides a surface complementary to the epitope on the antigen in an immune response, promoting non-covalent binding of the antibody to its cognate epitope. The amino acids comprising the CDRs and framework regions, respectively, can be readily identified for heavy or light chain variable regions by one skilled in the art, as they have been previously identified (see "Sequences of Proteins of Immunological Interest," Kabat, E., et al., USDapartment of Health and Human Services, (1983), and Chothia and Lesk, J. Mol. Biol., 196:901-917 (1987)).

[0080] When there are more than one definition for a term used and / or accepted in the art, the definition of the term used herein is intended to encompass all such meanings unless specifically and explicitly stated to the contrary. A specific example is the use of the term "complementarity-determining region" ("CDR") to describe the non-contiguous antigen-binding sites found within the variable regions of both heavy and light chain polypeptides. This particular region is described by Kabat et al., US Department of Health and Human Services, "Sequences of Proteins of Immunological Interest" (1983) and Chothia et al., J. Mol. Biol. 196:901-917 (1987), which are incorporated herein by reference in their entireties. The Kabat and Chothia definitions of CDRs include overlapping or subsets of amino acid residues when compared with each other. Nevertheless, the application of either definition to refer to a CDR of an antibody or variant thereof is intended to be within the scope of the term as defined and used herein. The appropriate amino acid residues encompassing the CDRs defined by each of the above cited references are set forth in the following table for comparison: The exact residue numbers which comprise a particular CDR will vary depending on the sequence and size of the CDR, and one of skill in the art can routinely determine which residues make up a particular CDR given the amino acid sequence of the variable region of an antibody. TIFF2025121997000030.tif48128

[0081] Kabat et al. defined a numbering system for variable domain sequences that is applicable to any antibody. One of skill in the art can unambiguously assign this "Kabat numbering" system to any variable domain sequence, without relying on other experimental data from the sequence itself. As used herein, "Kabat numbering" refers to the numbering system described in Kabat et al., U.S. Department of Health and Human Services, "Sequence of Proteins of Immunological Interest" (1983).

[0082] In addition to the above table, the Kabat numbering system describes the CDR regions as follows: CDR-H1 begins approximately amino acid 31 (i.e., approximately 9 residues after the first cysteine residue), includes approximately 5-7 amino acids, and ends at the next tryptophan residue. CDR-H2 begins approximately 15 residues after the end of CDR-H1, includes approximately 16-19 amino acids, and ends at the next arginine or lysine residue. CDR-H3 begins approximately 33 amino acid residues after the end of CDR-H2, includes 3-25 amino acids, and ends with the sequence WGXG (where X is any amino acid). CDR-L1 begins approximately 24 (i.e., following the cysteine residue), includes approximately 10-17 residues, and ends at the next tryptophan residue. CDR-L2 begins approximately 16 residues after the end of CDR-L1 and includes approximately 7 residues. CDR-L3 begins approximately 33 residues after the end of CDR-L2 (i.e., following the cysteine residue), includes approximately 7-11 residues, and ends with the sequence F or WGXG (where X is any amino acid).

[0083] As used herein, the term "epitope" can include any protein determinant capable of specifically binding to an immunoglobulin, scFv, or T-cell receptor. The variable region enables an antibody to selectively recognize and specifically bind to an epitope on an antigen. For example, the VL and VH domains of an antibody, or a subset of complementarity-determining regions (CDRs), combine to form the variable region that defines the three-dimensional antigen-binding site. The quaternary structure of this antibody forms the antigen-binding site present at the end of each arm of the Y. Epitope determinants typically consist of chemically active surface groups of molecules, such as amino acids or sugar side chains, and typically have specific three-dimensional structural and charge characteristics. For example, antibodies can be raised against N- or C-terminal peptides of a polypeptide. More specifically, the antigen-binding site is defined by three CDRs (i.e., CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3) on each of the VH and VL chains. In one embodiment, the antibody may be directed against PD-1 comprising the amino acid sequence of SEQ ID NO:XX (Genbank Accession No. NP_005009; 288 amino acid residues in length). TIFF2025121997000031.tif18137

[0084] As used herein, the terms "immunological binding" and "immunological binding properties" can refer to the type of non-covalent interaction that occurs between an immunoglobulin molecule and an antigen for which the immunoglobulin is specific. The strength, or affinity, of an immunological binding interaction is determined by the dissociation constant (K D ) and can be expressed as a smaller (K D ) represents a greater affinity. The immunological binding properties of a selected polypeptide can be quantified using methods well known in the art. One such method involves measuring the rates of antigen-binding site / antigen complex formation and dissociation, which depend on the concentrations of the complex partners, the affinity of the interaction, and geometric parameters that affect the rates in both directions equally. Thus, both "on rate constants" (K on) and "off rate constant" (K off ) can be determined by calculation of the concentration and the actual rates of association and dissociation. (See Nature 361:186-87 (1993)). K off / K on The ratio of α to β cancels all parameters unrelated to affinity, and the dissociation constant K D (See generally Davies et al. (1990) Annual Rev Biochem 59:439-473.) The antibodies of the present invention have an equilibrium binding constant (K) as measured by kinetic assays such as radioligand binding assays or similar assays known to those skilled in the art, such as BIAcore or Octet (BLI). D ) is ≦1 μM, ≦10 μM, ≦10 nM, ≦10 pM, or ≦100 pM to about 1 pM. For example, in some embodiments, D is between approximately 1E-12M and 1E-11M. D In some embodiments, K D is approximately between 1E-11M and 1E-10M. D In some embodiments, K D is between approximately 1E-10M and 1E-9M. D In some embodiments, K D is approximately between 1E-9M and 1E-8M. D In some embodiments, K D is between approximately 1E-8M and 1E-7M. D In some embodiments, K D is between approximately 1E-7M and 1E-6M. D For example, in some embodiments, K D is about 1E-12M, and in other embodiments, K D is about 1E-11M. In some embodiments, K D is about 1E-10 M, and in other embodiments, K D is about 1E-9M. In some embodiments, K D is about 1E-8M, and in other embodiments, KD is about 1E-7M. In some embodiments, K D is about 1E-6M, and in other embodiments, K D is about 1E-5M. In some embodiments, for example, K D is about 3E-11M, and in other embodiments, K D is about 3E-12M. In some embodiments, K D is approximately 6E-11M. "Specifically binds" or "having specificity for" can refer to an antibody that binds to an epitope via its antigen-binding domain, and that the binding involves some complementarity between the antigen-binding domain and the epitope. For example, an antibody is said to "specifically bind" to an epitope if it binds to that epitope via its antigen-binding domain more readily than it binds to a random, unrelated epitope.

[0085] For example, PD-1 antibodies can be monovalent or bivalent and include single or double chains. Functionally, the binding affinity of PD-1 antibodies can be greater than or equal to 10 -5 M~10 -12 For example, the binding affinity of PD-1 antibodies is in the range of 10 -6 M~10 -12 M, 10 -7 M~10 -12 M, 10 -8 M~10 -12 M, 10 -9 M~10 -12 M, 10 -5 M~10 -11 M, 10 -6 M~10 -11 M, 10 -7 M~10 -11 M, 10 -8 M~10 -11 M, 10 -9 M~10 -11 M, 10 -10 M~10 -11 M, 10 -5 M~10 -10 M, 10 -6 M~10 -10 M, 10 -7 M~10 -10 M, 10-8 M~10 -10 M, 10 -9 M~10 -10 M, 10 -5 M~10 -9 M, 10 -6 M~10 -9 M, 10 -7 M~10 -9 M, 10 -8 M~10 -9 M, 10 -5 M~10 -8 M, 10 -6 M~10 -8 M, 10 -7 M~10 -8 M, 10 -5 M~10 -7 M, 10 -6 M~10 -7 M, or 10 -5 M~10 -6 I am M.

[0086] The PD-1 proteins of the present invention, or derivatives, fragments, analogs, homologs, or orthologs thereof, can be used as immunogens in the generation of antibodies that immunologically specifically bind to these protein components, e.g., amino acid residues comprising SEQ ID NO: X. The PD-1 proteins, or derivatives, fragments, analogs, homologs, or orthologs thereof, coupled to proteoliposomes can be used as immunogens in the generation of antibodies immunologically specifically bind to these protein components.

[0087] Those skilled in the art will recognize that, without undue experimentation, one can determine whether a human monoclonal antibody has the same specificity as a human monoclonal antibody of the invention by determining whether the former prevents the latter from binding to PD-1. If the human monoclonal antibody being tested exhibits reduced binding by and competes with a human monoclonal antibody of the invention, then these two monoclonal antibodies likely bind to the same or closely related epitopes.

[0088] Another method for determining whether a human monoclonal antibody has the specificity of a human monoclonal antibody of the invention is to preincubate the human monoclonal antibody of the invention with the PD-1 protein with which it normally reacts, then add the human monoclonal antibody to be tested and determine whether the human monoclonal antibody to be tested is inhibited in its ability to bind to PD-1. If the human monoclonal antibody to be tested is inhibited, it likely has the same, or a functionally equivalent, epitope specificity as the monoclonal antibody of the invention. Screening of the human monoclonal antibodies of the invention can also be performed using PD-1 to determine whether the monoclonal antibody to be tested can neutralize PD-1.

[0089] Various procedures known in the art can be used for the production of polyclonal or monoclonal antibodies directed against the proteins of the invention, or against their derivatives, fragments, analogs, homologs, or orthologs (see, e.g., Antibodies: A Laboratory Manual, Harlow E, and Lane D, 1988, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, incorporated herein by reference).

[0090] Antibodies can be purified by well-known techniques, such as affinity chromatography using protein A or protein G, which primarily provide the IgG fraction of immune serum. Subsequently, or alternatively, the specific antigen that is the target of the desired immunoglobulin, or an epitope thereof, can be immobilized on a column, and immune-specific antibodies can be purified by immunoaffinity chromatography. Immunoglobulin purification is discussed, for example, by D. Wilkinson (The Scientist, published by The Scientist, Inc., Philadelphia, PA, Vol. 14, No. 8 (April 17, 2000), pp. 25-28).

[0091] As used herein, the term "monoclonal antibody" or "mAb" or "Mab" or "monoclonal antibody composition" can refer to a population of antibody molecules containing only one molecular species of antibody molecule, consisting of a unique light chain gene product and a unique heavy chain gene product. In particular, the complementarity-determining regions (CDRs) of a monoclonal antibody are identical in all molecules of the population. MAbs contain an antigen-binding site capable of immunoreacting with a particular epitope of an antigen characterized by a unique binding affinity for it.

[0092] Monoclonal antibodies can be prepared using hybridoma methods, such as those described by Kohler and Milstein, Nature, 256:495 (1975). In the hybridoma method, a mouse, hamster, or other suitable host animal is typically immunized with an immunizing agent to induce lymphocytes that produce, or are capable of producing, antibodies that will specifically bind to the immunizing agent. Alternatively, lymphocytes can be immunized in vitro.

[0093] The immunizing agent can contain a protein antigen, a fragment thereof, or a fusion protein thereof. For example, peripheral blood lymphocytes can be used if cells of human origin are desired, or spleen cells or lymph node cells can be used if a non-human mammalian source is desired. The lymphocytes are then fused with an immortalized cell line using a suitable fusing agent, such as polyethylene glycol, to form a hybridoma cell (see Goding, Monoclonal Antibodies: Principles and Practice, Academic Press, (1986) pp. 59-103). The immortalized cell line can be a transformed mammalian cell, particularly a myeloma cell of rodent, bovine, or human origin. For example, a rat or mouse myeloma cell line can be used. The hybridoma cells can be cultured in a suitable medium containing one or more substances that inhibit the growth or survival of the unfused, immortalized cells. For example, if the parent cells lack the enzyme hypoxanthine guanine phosphoribosyltransferase (HGPRT or HPRT), the culture medium for the hybridoma typically contains hypoxanthine, aminopterin, and thymidine ("HAT medium"), which substances prevent growth of HGPRT-deficient cells.

[0094] Useful immortalized cell lines are those that fuse efficiently, maintain stable high-level expression of antibody by the selected antibody-producing cells, and are sensitive to a medium such as HAT medium. Immortalized cell lines are, for example, mouse myeloma lines available from the Salk Institute Cell Distribution Center (San Diego, California) and the American Type Culture Collection (Manassas, Virginia). Human myeloma and mouse-human heteromyeloma cell lines have also been described for the production of human monoclonal antibodies. (See Kozbor, J. Immunol., 133:3001 (1984); Brodeur et al., Monoclonal Antibody Production Techniques and Applications, Marcel Dekker, Inc., New York, (1987) pp. 51-63).

[0095] The culture medium in which hybridoma cells are cultured can then be assayed for the presence of monoclonal antibodies against the antigen.For example, the binding specificity of the monoclonal antibodies produced by hybridoma cells can be determined by immunoprecipitation or by in vitro binding assays such as radioimmunoassay (RIA) or enzyme-linked immunosorbent assay (ELISA).Such techniques and assays are known in the art.The binding affinity of monoclonal antibodies can be determined, for example, by the Scatchard analysis of Munson and Pollard, Anal.Biochem.,107:220(1980).In addition, in the therapeutic use of monoclonal antibodies, it is important to identify antibodies that have high specificity and high binding affinity for target antigens.

[0096] After the desired hybridoma cells are identified, the clones can be subcloned by limiting dilution procedures and grown by standard methods. (See Goding, Monoclonal Antibodies: Principles and Practice, Academic Press, (1986) pp. 59-103.) Suitable culture media for this purpose include, for example, Dulbecco's modified Eagle's medium and RPMI-1640 medium. Alternatively, the hybridoma cells can be grown in vivo as ascites in a mammal.

[0097] The monoclonal antibodies secreted by the subclones can be isolated or purified from the culture medium or ascites fluid by conventional immunoglobulin purification procedures such as, for example, protein A-Sepharose, hydroxylapatite chromatography, gel electrophoresis, dialysis, or affinity chromatography.

[0098] Monoclonal antibodies can also be produced by recombinant DNA methods, such as those described in U.S. Patent No. 4,816,567 (incorporated herein by reference in its entirety). DNA encoding the monoclonal antibodies of the present invention can be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes capable of specifically binding to genes encoding the heavy and light chains of mouse antibodies). The hybridoma cells of the present invention serve as a source of such DNA. Once isolated, the DNA can be placed into an expression vector, which is then transfected into host cells such as monkey COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin protein, to obtain the synthesis of the monoclonal antibody in the recombinant host cells. The DNA can also be modified, for example, by substituting the coding sequence for human heavy and light chain constant domains for the homologous murine sequences (see U.S. Pat. No. 4,816,567; Morrison, Nature 368, 812-13 (1994)), or by covalently joining all or part of the coding sequence for a non-immunoglobulin polypeptide to the immunoglobulin coding sequence. Such a non-immunoglobulin polypeptide can be substituted for the constant domains of an antibody of the invention, or for the variable domains of one antigen-binding site of an antibody of the invention to create a chimeric bivalent antibody.

[0099] A fully human antibody is an antibody molecule in which the entire sequences of both the light and heavy chains, including, for example, the CDRs, originate from human genes. Such antibodies are referred to herein as "humanized antibodies" or "fully human antibodies." A "humanized antibody" can be an antibody derived from a non-human species, but its light and heavy chain protein sequences have been modified to enhance similarity to antibody variants produced in humans. A humanized antibody is an antibody molecule derived from a non-human species antibody that binds to a desired antigen, having one or more complementarity-determining regions (CDRs) from the non-human species and framework regions from a human immunoglobulin molecule. Often, framework residues in the human framework regions are substituted with corresponding residues from the CDR donor antibody, thereby altering, e.g., improving, antigen binding. These framework substitutions are identified by methods well known in the art, for example, by modeling the interactions between CDRs and framework residues to identify framework residues important for antigen binding and by comparing sequences to identify unusual framework residues at specific positions (see, for example, Queen et al., US Pat. No. 5,585,089; Riechmann et al., Nature 332:323 (1988), which are incorporated herein by reference in their entireties). For example, the non-human portions of the antibody (such as the CDRs of the light and / or heavy chains) can bind to the target antigen. Humanized monoclonal antibodies may also be referred to herein as "human monoclonal antibodies."

[0100] Antibodies can be humanized using various techniques known in the art, such as, for example, CDR grafting (EP 239,400, PCT Publication WO 91 / 09967, U.S. Pat. Nos. 5,225,539, 5,530,101, and 5,585,089), veneering or resurfacing (EP 592,106, EP 519,596, Padlan, Molecular Immunology 28(4 / 5):489-498 (1991); Studnicka et al., Protein Engineering 7(6):805-814 (1994); Roguska et al., Proc. Natl. Sci. USA 91:969-973 (1994)), and chain shuffling (U.S. Pat. No. 5,565,332, incorporated by reference in its entirety). "Humanization" (also called reshaping or CDR grafting) is an established technique well known to those skilled in the art for reducing the immunogenicity of monoclonal antibodies (mAbs) derived from xenogeneic sources (usually rodents) and improving activation of the human immune system (see, e.g., Hou S, Li B, Wang L, Qian W, Zhang D, Hong X, Wang H, Guo Y (July 2008) "Humanization of an anti-CD34 monoclonal antibody by complementarity-determining region grafting based on computer-assisted molecular modeling" J. Biochem. 144(1):115-20).

[0101] Human monoclonal antibodies, including fully human and humanized antibodies, can be prepared using trioma technology, human B-cell hybridoma technology (see Kozbor, et al, 1983 Immunol Today 4:72), and EBV hybridoma technology producing human monoclonal antibodies (see Cole, et al, 1985 In:MONOCLONAL ANTIBODIES AND CANCER THERAPY, Alan R. Liss, Inc., pp. 77-96). Human monoclonal antibodies are available and can be produced by using human hybridomas (see Cote, et al, 1983. Proc Natl Acad Sci USA 80:2026-2030) or by transforming human B cells in vitro with Epstein-Barr virus (Cole, et al., 1985 In: MONOCLONAL ANTIBODIES AND CANCER THERAPY, Alan R. Liss, Inc., pp. 77-96).

[0102] In addition, human antibodies can also be produced using other technologies, such as phage display libraries. (See Hoogenboom and Winter, J. Mol. Biol, 227:381 (1991); Marks et al., J. Mol. Biol, 222:581 (1991)). Similarly, human antibodies can be made by introducing human immunoglobulin loci into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. After challenge, human antibody production is observed, which closely resembles that seen in humans in all respects, including gene rearrangement, assembly, and antibody repertoire. This approach is described, for example, in U.S. Patent Nos. 5,545,807, 5,545,806, 5,569,825, 5,625,126, 5,633,425, and 5,661,016, as well as Marks et al., Bio / Technology 10, 779-783 (1992), Lonberg et al., Nature 368, 856-859 (1994), Morrison, Nature 368, 812-13 (1994), Fishwild et al., Nature Biotechnology 14, 845-51 (1996), Neuberger, Nature Biotechnology 14, 826 (1996), and Lonberg and Huszar, Intern. Rev. Immunol. 13 65-93 (1995).

[0103] Human antibodies can also be produced using transgenic non-human animals that are modified to produce fully human antibodies in response to antigen challenge rather than the animal's endogenous antibodies. (See PCT Publication No. WO 94 / 02602 and U.S. Patent No. 6,673,986.) The endogenous genes encoding heavy and light immunoglobulin chains in the non-human host are disabled, and active loci encoding human heavy and light immunoglobulin chains are inserted into the host's genome. Human genes are incorporated, for example, using yeast artificial chromosomes containing the necessary human DNA segments. Animals providing all the desired modifications are then obtained as offspring by breeding intermediate transgenic animals containing fewer than the total number of modifications required. A preferred embodiment of such a non-human animal is a mouse, referred to as a Xenomouse™, as disclosed in PCT Publication Nos. WO 96 / 33735 and WO 96 / 34096. The animal produces B cells that secrete fully human immunoglobulins. Antibodies can be obtained directly from animals after immunization with an immunogen of interest, e.g., as polyclonal antibody preparations, or alternatively, from immortalized B cells derived from animals, such as hybridomas, that produce monoclonal antibodies. Additionally, genes encoding immunoglobulins with human variable regions can be recovered and expressed to obtain antibodies directly or further modified to obtain antibody analogs, such as single-chain Fv (scFv) molecules. Thus, such techniques can be used to produce therapeutically useful IgG, IgA, IgM, and IgE antibodies. For an overview of this technology for producing human antibodies, see Lonberg and Huszar Int. Rev. Immunol. 73:65-93 (1995).For a detailed discussion of this technology for producing human antibodies and human monoclonal antibodies and protocols for producing such antibodies, see, e.g., PCT Publication Nos. WO 98 / 24893, WO 96 / 34096, WO 96 / 33735, U.S. Patent Nos. 5,413,923, 5,625,126, 5,633,425, 5,569,825, 5,661,016, 5,545,806, 5,814,318, and 5,939,598, which are incorporated by reference in their entireties. Additionally, companies such as Creative BioLabs (Shirley, NY) offer to provide human antibodies against a selected antigen using technology similar to that described above.

[0104] An example of a method for producing a non-human host, exemplified as a mouse, lacking expression of endogenous immunoglobulin heavy chains is disclosed in U.S. Patent No. 5,939,598. This can be obtained by a method comprising deleting a J segment gene from at least one endogenous heavy chain locus in embryonic stem cells to prevent rearrangement of the locus and the formation of transcripts of the rearranged immunoglobulin heavy chain locus, the deletion being carried out by a targeting vector containing a gene encoding a selectable marker, and producing a transgenic mouse from the embryonic stem cells, the somatic and germ cells of which contain the gene encoding the selectable marker.

[0105] One method for producing an antibody of interest, such as a human antibody, is disclosed in U.S. Patent No. 5,916,771. This method involves introducing an expression vector containing a nucleotide sequence encoding the heavy chain into one mammalian host cell in culture, introducing an expression vector containing a nucleotide sequence encoding the light chain into another mammalian host cell, and fusing the two cells to form a hybrid cell. The hybrid cell expresses the antibody containing the heavy and light chains.

[0106] In a further improvement of this procedure, methods for identifying clinically relevant epitopes on immunogens and corresponding methods for selecting antibodies that immunospecifically bind with high affinity to the relevant epitopes are disclosed in PCT Publication WO 99 / 53049.

[0107] The antibody of interest can also be expressed by a vector containing a DNA segment encoding the single-chain antibody. For example, the vector can include, but is not limited to, chemical conjugates containing a targeting moiety (e.g., a ligand for a cell surface receptor) and a nucleic acid binding moiety (e.g., polylysine), as described in International Publication No. 93 / 64701, viral vectors (e.g., DNA or RNA viral vectors), fusion proteins, such as those described in PCT / US95 / 02140 (WO95 / 22618), i.e., fusion proteins containing a targeting moiety (e.g., an antibody specific to a target cell) and a nucleic acid binding moiety (e.g., protamine), plasmids, phages, viral vectors, etc. The vector can be chromosomal, non-chromosomal, or synthetic. Retroviral vectors can also be used, including Moloney murine leukemia virus. DNA viral vectors can also be used, including pox vectors such as orthopox or avipox vectors, herpes virus vectors such as herpes simplex virus (HSV) vectors (see Geller, AI et al, J. Neurochem, 64:487 (1995); Lim, F., et al, in DNA Cloning: Mammalian Systems, D. Glover, Ed. (Oxford Univ. Press, Oxford England) (1995); Geller, AI et al, Proc Natl. Acad. Sci.: USA 90:7603 (1993); Geller, AI, et al, Proc Natl. Acad. Sci USA 87:1149 (1990)), and adenovirus vectors (LeGal LaSalle et al, Science, 259:988 (1993); Davidson, et al, Nat. Genet. 3:219 (1993); Yang, et al., J. Virol. 69:2004 (1995)), and adeno-associated virus vectors (Kaplitt, MG. et al., Nat. Genet. 8:148 (1994)).

[0108] Poxvirus vectors deliver genes into the cytoplasm of cells. Avipoxvirus vectors result in short-term expression of nucleic acids. Adenovirus vectors, adeno-associated virus vectors, and herpes simplex virus (HSV) vectors can be used to deliver nucleic acids to neural cells. Adenovirus vectors deliver shorter-term expression (approximately 2 months) than adeno-associated virus (approximately 4 months), which in turn results in shorter expression than HSV vectors. The specific vector selected will depend on the target cell and the condition being treated. Introduction can be by standard techniques, such as infection, transfection, transduction, or transformation. Examples of modes of gene delivery include, for example, naked DNA, CaP04 precipitation, DEAE-dextran, electroporation, protoplast fusion, lipofection, cell microinjection, and viral vectors.

[0109] Vectors can be used to target essentially any desired target cell. For example, stereotactic injection can be used to guide vectors (e.g., adenovirus, HSV) to the desired location. In addition, particles can be delivered by intracerebroventricular (icv) injection using a minipump infusion system such as the SynchroMed Infusion System. A method based on bulk flow, called convection, has also proven effective in delivering large molecules to extended areas of the brain and may be useful for delivering vectors to target cells. (See Bobo et al., Proc. Natl. Acad. Sci. USA 91:2076-2080 (1994); Morrison et al., Am. J. Physiol. 266:292-305 (1994)). Other methods that can be used include catheter, intravenous, parenteral, intraperitoneal, and subcutaneous injection, as well as oral or other known administration routes.

[0110] These vectors can be used to express large amounts of antibodies that can be used in a variety of ways, such as to detect the presence of PD-1 in a sample. The antibodies can also be used to attempt to bind to and destroy PD-1 activity.

[0111] Techniques can be adapted to produce single chain antibodies specific to antigenic proteins of the invention (see, e.g., U.S. Pat. No. 4,946,778). In addition, methods can be used to ab Monoclonal Fs with desired specificity for the protein, or derivatives, fragments, analogs, or homologs thereof, are suitable for constructing expression libraries (see, e.g., Huse, et al., 1989 Science 246:1275-1281). ab Antibody fragments containing the idiotype to a protein antigen can be produced by techniques known in the art, including, but not limited to, (i) F produced by pepsin digestion of antibody molecules. (ab’)2 Fragment, (ii)F (ab’)2 F generated by reducing the disulfide bridges of the fragment ab (iii) F fragments produced by treating antibody molecules with papain and a reducing agent. ab fragments, and (iv) F v Contains fragments.

[0112] Heteroconjugate antibodies are also within the scope of the present invention. Heteroconjugate antibodies are composed of two covalently linked antibodies. Such antibodies can, for example, target immune system cells to unwanted cells (see U.S. Pat. No. 4,676,980) and treat HIV infection (see PCT International Publication Nos. 91 / 00360 and 92 / 20373). It is contemplated that antibodies can be prepared in vitro using known methods in the field of protein synthetic chemistry, such as using cross-linking agents. For example, immunotoxins can be constructed using disulfide exchange reactions or by forming thioether bonds. Examples of suitable reagents for this purpose include iminothiolate and methyl-4-mercaptobutyrimidate, as well as those disclosed, for example, in U.S. Pat. No. 4,676,980.

[0113] The antibodies of the present invention can be modified with respect to effector function, for example, to enhance the effectiveness of the antibody in treating cancer. For example, cysteine residues can be introduced into the Fc region, thereby allowing interchain disulfide bond formation in this region. The homodimeric antibody thus generated can have improved internalization capability and / or increased complement-mediated cell killing and antibody-dependent cellular cytotoxicity (ADCC). (See Caron et al., J. Exp Med., 176:1191-1195 (1992) and Shopes, J. Immunol., 148:2918-2922 (1992)). Alternatively, antibodies can be engineered with dual Fc regions, thereby enhancing complement lysis and ADCC capabilities. (See Stevenson et al., Anti-Cancer Drug Design, 3:219-230 (1989)).

[0114] In certain embodiments, antibodies of the present invention can include Fc variants containing amino acid substitutions that alter the antigen-independent effector function of the antibody, particularly its circulating half-life. Such antibodies exhibit either increased or decreased binding to FcRn and therefore have increased or decreased serum half-lives, respectively, when compared with antibodies lacking these substitutions. Fc variants with improved affinity for FcRn are expected to have longer serum half-lives, and such molecules have useful applications in methods of treating mammals where a long half-life of the administered antibody is desired, for example, to treat chronic diseases or disorders. In contrast, Fc variants with reduced FcRn binding affinity are expected to have shorter half-lives, and such molecules are also useful, for example, for administration to mammals where a shortened circulation time would be advantageous, for example, for in vivo diagnostic imaging, or in situations where the starting antibody has toxic side effects if present in the circulation for an extended period of time. Fc variants with reduced FcRn-binding affinity are also less likely to cross the placenta and are therefore useful in treating diseases or disorders in pregnant women. Additionally, other applications in which reduced FcRn-binding affinity may be desirable include applications in which localization to the brain, kidney, and / or liver is desirable. In one embodiment, an Fc variant-containing antibody may exhibit reduced transport from the vasculature across the epithelium of renal glomeruli. In another embodiment, an Fc variant-containing antibody may exhibit reduced transport from the brain across the blood-brain barrier (BBB) into the vascular space. In one embodiment, an antibody with altered FcRn binding comprises an Fc domain with one or more amino acid substitutions within the "FcRn-binding loop" of the Fc domain. The FcRn-binding loop is composed of amino acid residues 280-299 (EU numbering). Exemplary amino acid substitutions that alter FcRn-binding activity are disclosed in PCT Publication WO 05 / 047327, incorporated herein by reference. In certain exemplary embodiments, an antibody of the invention, or a fragment thereof, comprises an Fc domain with one or more of the following substitutions: V284E, H285E, N286D, K290E, and S304D (EU numbering).

[0115] In some embodiments, mutations are introduced into the constant region of the mAb to alter the antibody-dependent cell-mediated cytotoxicity (ADCC) activity of the mAb. For example, the mutation is a LALA mutation in the CH2 domain. In one embodiment, an antibody (e.g., a human mAb or a bispecific Ab) contains a mutation on one scFv unit of the heterodimeric mAb that reduces ADCC activity. In another embodiment, the mAb contains mutations on both chains of the heterodimeric mAb that completely eliminate ADCC activity. For example, the mutation introduced into one or both scFv units of the mAb is a LALA mutation in the CH2 domain. These mAbs with variable ADCC activity can be optimized so that the mAb exhibits maximum selective killing toward cells expressing one antigen recognized by the mAb, but minimal killing toward a second antigen recognized by the mAb.

[0116] In other embodiments, antibodies for use in the diagnostic and therapeutic methods described herein have a constant region, such as an IgG1 or IgG4 heavy chain constant region, that is altered to reduce or eliminate glycosylation. For example, antibodies of the present invention can also include Fc variants containing amino acid substitutions that alter the glycosylation of the antibody. For example, Fc variants can have reduced glycosylation (e.g., N-linked or O-linked glycosylation). In some embodiments, the Fc variants have reduced glycosylation of the N-linked glycan normally found at amino acid position 297 (EU numbering). In another embodiment, the antibody has an amino acid substitution near or within a glycosylation motif, such as an N-linked glycosylation motif comprising the amino acid sequence NXT or NXS. In a specific embodiment, the antibody comprises an Fc variant with an amino acid substitution at amino acid position 228 or 299 (EU numbering). In a more specific embodiment, the antibody comprises an IgG1 or IgG4 constant region comprising S228P and T299A mutations (EU numbering).

[0117] Exemplary amino acid substitutions that reduce or alter glycosylation are disclosed in PCT Publication WO 05 / 018572, which is incorporated herein by reference. In some embodiments, antibodies of the present invention, or fragments thereof, are modified to eliminate glycosylation. Such antibodies, or fragments thereof, may be referred to as "agly" antibodies, or fragments thereof (e.g., "agly" antibodies). Without being bound by theory, "agly" antibodies, or fragments thereof, may have an improved safety and stability profile in vivo. An exemplary agly antibody, or fragment thereof, comprises a deglycosylated Fc region of an IgG4 antibody that lacks Fc effector function, thereby eliminating the potential for Fc-mediated toxicity to normal living tissues and cells that express PD-1. In yet other embodiments, antibodies of the present invention, or fragments thereof, comprise altered glycans. For example, the antibody may have a reduced number of fucose residues on the N-glycan at Asn297 of the Fc region, i.e., be defucosylated. In another embodiment, the antibody can have an altered number of sialic acid residues on the N-glycan at Asn297 of the Fc region.

[0118] The present invention also relates to immunoconjugates comprising antibodies conjugated to cytotoxic agents such as toxins (e.g., enzymatically active toxins of bacterial, fungal, plant, or animal origin, or fragments thereof), or to radioisotopes (the latter being radioconjugates).

[0119] Enzymatically active toxins and fragments thereof that can be used include diphtheria A chain, nonbinding active fragments of diphtheria toxin, exotoxin A chain (from Pseudomonas aeruginosa), ricin A chain, abrin A chain, modeccin A chain, alpha-sarcin, Aleurites fordii protein, dianthin protein, Phytolaca americana proteins (PAPI, PAPII, and PAP-S), momordica charantia inhibitor, curcin, crotin, sapaonaria officinalis inhibitor, gelonin, mitogenin, restrictocin, phenomycin, enomycin, and the trichothecenes. A variety of radionuclides are available for the production of radioconjugated antibodies. Non-limiting examples include: 212 Bi, 131 I, 131 In, 90 Y, and 186 Re is an example.

[0120] Conjugates of antibodies and cytotoxic agents are prepared using various bifunctional protein-binding agents, such as N-succinimidyl-3-(2-pyridyldithiol)propionate (SPDP), iminothiolane (IT), bifunctional derivatives of imidoesters (such as dimethyl adipimidate HCl), active esters (such as disuccinimidyl suberate), aldehydes (such as glutaraldehyde), bis-azido compounds (such as bis(p-azidobenzoyl)hexanediamine), bis-diazonium derivatives (such as bis-(p-diazoniumbenzoyl)-ethylenediamine), diisocyanates (such as triene 2,6-diisocyanate), and bis-active fluorine compounds (such as 1,5-difluoro-2,4-dinitrobenzene). For example, ricin immunotoxins can be prepared as described in Vitetta et al., Science 238:1098 (1987). Carbon-14 labeled 1-isothiocyanatobenzyl-3-methyldiethylenetriaminepentaacetic acid (MX-DTPA) is an exemplary chelating agent for conjugating radionucleotides to antibodies (see PCT Publication WO 94 / 11026 and U.S. Patent No. 5,736,137).

[0121] Those skilled in the art will recognize that a wide variety of possible moieties can be attached to a given antibody or other molecule of the invention (see, e.g., "Conjugate Vaccines," Contributions to Microbiology and Immunology, JM Cruse and RE Lewis, Jr (eds), Carger Press, New York, (1989), the entire contents of which are incorporated herein by reference).

[0122] Conjugation can be achieved by any chemical reaction that will link two molecules, so long as the antibody and other moiety retain their respective activities. This conjugation can involve many chemical mechanisms, such as covalent bonding, affinity bonding, intercalation, coordinate bonding, and complex formation. In one embodiment, the conjugation is a covalent bond. Covalent bonding can be achieved by direct condensation of existing side chains or by incorporating an external crosslinking molecule. Many bivalent or polyvalent linking agents are useful for linking protein molecules, such as the antibodies of the present invention, to other molecules. For example, representative linking agents can include organic compounds such as thioesters, carbodiimides, succinimide esters, diisocyanates, glutaraldehyde, diazobenzene, and hexamethylenediamine. This list is not intended to be exhaustive of the various classes of linking agents known in the art, but rather is illustrative of more common linking agents. (See Killen and Lindstrom, Jour. Immun. 133:1335-2549 (1984); Jansen et al., Immunological Reviews 62:185-216 (1982); and Vitetta et al., Science 238:1098 (1987)). Non-limiting examples of linkers are described in the literature. (See, for example, Ramakrishnan, S. et al., Cancer Res. 44:201-208 (1984), which describes the use of MBS (M-maleimidobenzoyl-N-hydroxysuccinimide ester). See also U.S. Pat. No. 5,030,719, which describes the use of halogenated acetylhydrazide derivatives linked to antibodies by oligopeptide linkers.Non-limiting examples of useful linkers that can be used with the antibodies of the invention include: (i) EDC (1-ethyl-3-(3-dimethylamino-propyl)carbodiimide hydrochloride), (ii) SMPT (4-succinimidyloxycarbonyl-α-methyl-α-(2-pyridyl-dithio)-toluene (Pierce Chem. Co., Cat. (21558G), (iii) SPDP (succinimidyl-6[3-(2-pyridyldithio)propionamido]hexanoate (Pierce Chem. Co., Cat. 21651G), (iv) sulfo-LC-SPDP (sulfosuccinimidyl-6[3-(2-pyridyldithio)-propionamido]hexanoate (Pierce Chem. Co., Cat. #2165-G), and (v) sulfo-NHS (-hydroxysulfo-succinimide: Pierce Chem. Co., Cat. #24510) conjugated to EDC.

[0123] The linkers described herein contain components with different attributes, thereby resulting in conjugates with different physicochemical properties. For example, sulfo-NHS esters of alkyl carboxylates are more stable than sulfo-NHS esters of aromatic carboxylates. NHS-ester-containing linkers are less soluble than sulfo-NHS esters. Furthermore, the linker SMPT contains a sterically hindered disulfide bond, allowing for the formation of conjugates with improved stability. Disulfide bonds are generally less stable than other bonds because they are cleaved in vitro, resulting in fewer available conjugates. In particular, sulfo-NHS can enhance the stability of carbodiimide bonds. Carbodiimide bonds (such as EDC) when used in combination with sulfo-NHS form esters that are more resistant to hydrolysis than the carbodiimide bond reaction alone.

[0124] The antibody disclosed herein can also be formulated as immunoliposome.The liposome containing antibody is prepared by the method known in the art, such as described in Epstein et al., Proc.Natl.Acad.Sci.USA, 82:3688(1985), Hwang et al., Proc.Natl Acad.Sci.USA, 77:4030(1980), and U.S. Patent No. 4,485,045 and U.S. Patent No. 4,544,545.Liposomes with extended circulation time are disclosed in U.S. Patent No. 5,013,556.

[0125] Non-limiting examples of useful liposomes can be generated by reverse-phase evaporation using a lipid composition comprising phosphatidylcholine, cholesterol, and PEG-derivatized phosphatidylethanolamine (PEG-PE). Liposomes are extruded through filters of defined pore size to generate liposomes with the desired diameter. Fab' fragments of the antibody of the present invention can be conjugated to liposomes as described in Martin et al., J. Biol. Chem., 257:286-288 (1982) via a disulfide exchange reaction.

[0126] bispecific antibody Bispecific antibodies (bsAbs) are antibodies that contain two variable domains or scFv units, such that the resulting antibody recognizes two different antigens. The present invention provides bispecific antibodies that recognize PD-1 and a second antigen (e.g., a non-immunodepleting anti-PD1-scFv IL12 fusion protein). Exemplary second antigens include tumor-associated antigens (e.g., LINGO1), cytokines (e.g., IL-12 (IL-12A (p35 subunit) protein sequence having NCBI Reference No. NP_000873.2, IL-12B (p40 subunit) protein sequence having NCBI Reference No. NP_002178.2, IL-18 (protein sequence with NCBI Reference No. NP_001553.1), IL-15 (protein sequence with NCBI Reference No. NP_000576.1), IL-7 (protein sequence with NCBI Reference No. NP_000871.1), IL-2 (protein sequence with NCBI Reference No. NP_000577.2), and IL-21 (protein sequence with NCBI Reference No. NP_068575.1)), and cytokine cognate receptors (e.g., IL-12R), and cell surface receptors. Non-limiting examples of second antigens include CTLA-4, LAG-3, CD28, CD122, 4-1BB, TIM3, OX-40, OX40L, CD40, CD40L, LIGHT, ICOS, ICOSL, GITR, GITRL, TIGIT, CD27, VISTA, B7H3, B7H4, HEVM (or BTLA), CD47, and CD73. In one embodiment, the bispecific antibody comprises a PD-1 fusion protein. For example, the fusion protein comprises an antibody comprising a variable domain or scFv unit and a ligand, such that the resulting antibody recognizes the antigen and binds to the ligand-specific receptor. In one embodiment, the fusion protein further comprises a constant region and / or a linker as described herein. For example, the fusion protein comprises an antibody that recognizes PD-1 and a ligand.Ligands include tumor-associated antigens (e.g., LINGO1, ErbB2 (HER2 / neu), carcinoembryonic antigen (CEA), epithelial cell adhesion molecule (EpCAM), epidermal growth factor receptor (EGFR), MUC1, MSLN, CD19, CD20, CD30, CD40, CD22, RAGE-1, MN-CA, and IL-1). IX, RET1, RET2 (AS), prostate-specific antigen (PSA), TAG-72, PAP, p53, Ras, prostein, PSMA, survivin, 9D7, prostate cancer tumor antigen-1 (PCTA-1), GAGE, MAGE, mesothelin, β-catenin, TGF-βRII, BRCA1 / 2, SAP-1, HPV-E6, HPV-E7 (for additional tumor-associated surface antigens, see also PCT / US2015 / 067225 and PCT / US2019 / 022272, which are incorporated by reference in their entireties)), cytokines (e.g., IL-12 (IL-12A (p35 subunit) protein sequence having NCBI reference number NP_000873.2, IL-12B (p40 subunit) protein sequence having NCBI reference number NP_002178.2), IL-1 IL-8 (sequence with protein NCBI reference number NP_001553.1), IL-15 (protein sequence with NCBI reference number NP_000576.1), IL-7 (protein sequence with NCBI reference number NP_000871.1), IL-2 (protein sequence with NCBI reference number NP_000577.2), and IL-21 (protein sequence with NCBI reference number NP_068575.1), CTLA-4, LAG-3, CD28, CD122, 4-1BB, TIM3, OX-40, OX40L, CD40, CD40L, LIGHT, ICOS, ICOSL, GITR, GITRL, TIGIT, CD27, VISTA, B7H3, B7H4, HEVM (or BTLA), CD47, and CD73. Bispecific antibodies in various formats are also provided herein. In some embodiments, each of the anti-PD1 fragment and the second antigen-specific fragment is independently selected from a Fab fragment, a single-chain variable fragment (scFv), or a single-domain antibody. In some embodiments, the bispecific antibody further comprises an Fc fragment.The bispecific antibodies of the invention comprise the heavy and light chain combinations, or scFvs, of the PD-1 antibodies disclosed herein.

[0127] For example, the nucleic acid and amino acid sequences of bispecific PD-1 antibodies (e.g., PD-1 IL-12 fusions) are shown below, along with exemplary constant regions useful in combination with the VH and VL sequences provided herein: P4-B3 scIL12 fusion (the variable and constant regions are the same as the underlying P4-B3 (as in Table 1 unless otherwise specified below); in some embodiments, the variable regions of other PD-1 antibodies disclosed herein can also be used to generate the IL12 fusions exemplified herein), CH3 / C L is shown in normal font, TIFF2025121997000032.tif18153

[0128] Table 14A. Nucleic acid sequence of Ab P4-B3 scIL12 HC F2A fusion TIFF2025121997000033.tif152152

[0129] Table 14B. Nucleic acid sequence of Ab P4-B3 scIL12 HC F2A fusion TIFF2025121997000034.tif56152

[0130] Table 15A. Nucleic acid sequence of Ab P4-B3 scIL12 HC G4S fusion TIFF2025121997000035.tif144152

[0131] Table 15B. Amino acid sequence of Ab P4-B3 scIL12 HC G4S fusion TIFF2025121997000036.tif56152

[0132] Table 16A. Nucleic acid sequence of Ab P4-B3 scIL12 LC F2A(-2) fusion TIFF2025121997000037.tif156152

[0133] Table 16B. Amino acid sequence of Ab P4-B3 scIL12 LC F2A(-2) fusion TIFF2025121997000038.tif56152

[0134] Table 17A. Nucleic acid sequence of Ab P4-B3 scIL12 LC G4S fusion TIFF2025121997000039.tif144152

[0135] Table 17B. Amino acid sequence of Ab P4-B3 scIL12 LC (G4S)2 TIFF2025121997000040.tif56152

[0136] Bispecific antibodies of the invention (e.g., non-immunodepleting anti-PD1-scFv IL12 fusion proteins) can be constructed using methods known in the art. In some embodiments, bispecific antibodies are single polypeptides in which two scFv fragments are joined by a long linker polypeptide of sufficient length to allow intramolecular association between the two scFv units to form the antibody. In other embodiments, bispecific antibodies are two or more polypeptides linked by covalent or non-covalent bonds. In some embodiments, the amino acid linker shown in bold blue (GGGGSGGGGS, "(G4S)2") used with anti-PD1-scFv IL12 fusion constructs can be generated with a longer G4S linker to improve flexibility. For example, the linker can be "(G4S)3" (e.g., GGGGSGGGGSGGGGGS), "(G4S)4" (e.g., GGGGSGGGGSGGGGSGGGGS), "(G4S)5" (e.g., GGGGSGGGGSGGGGSGGGGSGGGGGS), "(G4S)6" (e.g., GGGGSGGGGSGGGGSGGGGSGGGGSGGGGS), "(G4S)7" (e.g., GGGGSGGGGSGGGGSGGGGGSGGGGSGGGGGS), etc. For example, the use of a (G4S)5 linker can provide greater flexibility to the IL-12 molecule and improve expression. In some embodiments, the linker can also be (GS) n , (GGS) n , (GGGS) n , (GGSG) n , (GGSGG) n , or (GGGGS) n where n is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. Non-limiting examples of linkers known to those of skill in the art that can be used to construct the anti-PD-1-IL-12 fusions described herein can be found in U.S. Patent No. 9,708,412, U.S. Patent Application Publication Nos. 2018 / 0134789 and 2020 / 0148771, and PCT Publication No. WO 2019 / 051122 (the entire contents of each of which are incorporated by reference).

[0137] In another embodiment, bispecific antibodies are constructed using the "knob-into-hole" method (Ridgway et al., Protein Eng 7:617-621 (1996)). In this method, Ig heavy chains of two different variable domains are reduced to selectively cleave heavy chain pairing while preserving the heavy-light chain pairing. Two heavy-light chain heterodimers that recognize two different antigens are mixed to promote heteroligation pairing mediated through the engineered "knob-into-hole" in the CH3 domain.

[0138] In another embodiment, bispecific antibodies (e.g., non-immunodepleting anti-PD1-scFv IL12 fusion proteins) can be constructed through the exchange of heavy-light chain dimers from two or more different antibodies to generate hybrid antibodies in which a first heavy-light chain dimer recognizes PD-1 and a second heavy-light chain dimer recognizes a second antigen. The mechanism of heavy-light chain dimerization is similar to the formation of human IgG4, which also functions as a bispecific molecule. Dimerization of IgG heavy chains is promoted by intramolecular forces, such as the pairing of the CH3 domains of each heavy chain with disulfide bridges. The presence of a specific amino acid (R409) in the CH3 domain has been shown to promote dimer exchange and the assembly of IgG4 molecules. Heavy chain pairing is also further stabilized by inter-heavy chain disulfide bridges in the hinge region of the antibody. Specifically, in IgG4, the hinge region contains the amino acid sequence Cys-Pro-Ser-Cys (compared to the stable IgG1 hinge region, which contains the sequence Cys-Pro-Pro-Cys) at amino acids 226 to 230. This difference in the sequence of serine at position 229 has been linked to the propensity of IgG4 to form intrachain disulfides in the hinge region (Van der Neut Kolfschoten, M. et al., 2007, Science 317:1554-1557 and Labrijn, A. F. et al., 2011, Journal of Immunol 187:3238-3246).

[0139] Thus, bispecific antibodies of the present invention can be generated by introducing the R409 residue in the CH3 domain and a Cys-Pro-Ser-Cys sequence in the hinge region of an antibody that recognizes PD-1 or a second antigen, resulting in an exchange of heavy-light chain dimers to produce an antibody molecule having one heavy-light chain dimer that recognizes PD-1 and a second heavy-light chain dimer that recognizes a second antigen, where the second antigen is any antigen disclosed herein. Known IgG4 molecules can also be engineered such that the heavy and light chains recognize PD-1 or a second antigen, as disclosed herein. The use of this method to construct bispecific antibodies of the present invention can be advantageous due to the unique characteristic of IgG4 molecules, in that the Fc region differs from other IgG subtypes in that it interacts poorly with effector systems of the immune response, such as complement and Fc receptors expressed by certain leukocytes. This particular property makes these IgG4-based bispecific antibodies attractive for therapeutic applications where the antibody needs to bind to the target and functionally modify the signaling pathway associated with the target, but not induce effector activity.

[0140] The bispecific antibodies described herein (e.g., non-immunodepleting anti-PD1-scFvIL12 fusion proteins) can be engineered with a non-depleting heavy chain isotype, such as IgG1-LALA or stabilized IgG4 or one of other non-depleting variants. Without being bound by theory, anti-PD1-scFv IL12 fusion proteins containing the Fc region variants described herein (such as the IgG1 LALA mutation or stabilized IgG4) can block PD1+ T cells without depleting them, while simultaneously providing scIL12 to stimulate them.

[0141] In some embodiments, mutations are introduced into the constant region of the bsAb to alter the antibody-dependent cell-mediated cytotoxicity (ADCC) activity of the bsAb. For example, the mutation is a LALA mutation in the CH2 domain. In one aspect, the bsAb contains a mutation on one scFv unit of the heterodimeric bsAb that reduces ADCC activity. In another aspect, the bsAb contains mutations on both chains of the heterodimeric bsAb that completely eliminate ADCC activity. For example, the mutation introduced into one or both scFv units of the bsAb is a LALA mutation in the CH2 domain. These bsAbs with variable ADCC activity can be optimized so that the bsAb shows maximum selective killing toward cells expressing one antigen recognized by the bsAb, but minimal killing toward a second antigen recognized by the bsAb.

[0142] The bispecific antibodies disclosed herein can be used effectively to treat chronic infections, diseases, or medical conditions, such as cancer.

[0143] Use of antibodies against PD-1 Antibodies of the present invention that specifically bind to the PD-1 protein or a fragment thereof can be administered to treat PD-1-associated diseases or disorders. "PD-1-associated diseases or disorders" include disease states and / or symptoms associated with disease states in which elevated levels of PD-1 and / or activated cell signaling pathways involving PD-1 are observed. Exemplary PD-1-associated diseases or disorders include diseases in which T cells are suppressed, such as, but not limited to, cancer and infectious diseases. In some embodiments, the infectious disease is caused by a microorganism, such as a DNA virus, an RNA virus, or a reverse-transcription virus. Non-limiting examples of viruses include adenovirus, coxsackievirus, Epstein-Barr virus, hepatitis A virus, hepatitis B virus, hepatitis C virus, herpes simplex virus type 1, herpes simplex virus type 2, cytomegalovirus, human herpesvirus type 8, HIV, influenza virus, measles virus, mumps virus, human papillomavirus, parainfluenza virus, poliovirus, rabies virus, respiratory syncytial virus, rubella virus, and varicella zoster virus. In some embodiments, the infection is caused by a microorganism, such as a gram-positive bacterium, a gram-negative bacterium, a protozoan, or a fungus.

[0144] Non-limiting examples of disease-causing bacteria include Bacillus anthracis, Bacillus cereus, Bartonella henselae, Bartonella quintana, Bordetella pertussis, Borrelia burgdorferi, Borrelia garinii, Borrelia afzelii, Borrelia recurrentis, Brucella abortus, Brucella canis, Brucella melitensis, Brucella suis, Campylobacter jejuni, and the like. jejuni, Chlamydia pneumoniae, Chlamydia trachomatis, Chlamydophila psittaci, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Clostridium tetani, Corynebacterium diphtheria, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Francisella tularensis, Haemophilus influenzae influenza, Helicobacter pylori, Legionella pneumophila, Leptospira interrogansinterrogans, Leptospira santarosai, Leptospira weilii, Leptospira noguchii, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Mycobacterium ulcerans, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitides, Pseudomonas aeruginosa, Rickettsia rickettsia, Salmonella typhi, Salmonella typhi typhimurium, Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus saprophyticus, Streptococcus agalactiae, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholera, Yersinia pestis, Yersinia enterocolitica enterocolitica, and Yersinia pseudotuberculosis.

[0145] Non-limiting examples of disease-causing protozoa include Plasmodium falciparum (malaria), Toxoplasma gondii (toxoplasmosis), Leishmania species (leishmaniasis), Trypanosoma brucei (African sleeping sickness), Trypanosoma cruzi (Chagas disease), and Giardia intestinalis (giardiasis).

[0146] Non-limiting examples of disease-causing fungi include Candida albicans, Aspergillus fumigatus, Aspergillus flavus, Cryptococcus neoformans, Cryptococcus gattii, Histoplasma capsulatum, Pneumocystis carinii, and Stachybotrys chartarum.

[0147] The antibodies of the present invention, such as bispecific, polyclonal, monoclonal, humanized, and fully human antibodies, can be used as therapeutic agents. Such agents are generally considered to be used to treat or prevent cancer in a subject, to improve vaccine efficiency, or to enhance natural immune responses. Antibody preparations, for example, those with high specificity and high affinity for their target antigens, are administered to a subject and generally are considered to produce effects resulting from binding to the target. Administration of antibodies can neutralize, inhibit, or interfere with the activity of PD-1 protein.

[0148] The antibodies of the present invention that specifically bind to the PD-1 protein or a fragment thereof can be administered in the form of a pharmaceutical composition for the treatment of cancer. Principles and considerations related to the preparation of therapeutic pharmaceutical compositions containing antibodies, as well as guidance regarding the selection of ingredients, are provided, for example, in Remington: The Science and Practice of Pharmacy, 20th ed. (Alfonso R. Gennaro, et al., editors) Mack Pub. Co., Easton, Pa., 2000; Drug Absorption Enhancement: Concepts, Possibilities, Limitations, and Trends, Harwood Academic Publishers, Langhorne, Pa., 1994; and Peptide And Protein Drug Delivery (Advances In Parenteral Sciences, Vol. 4), 1991, M. Dekker, New York.

[0149] The specific dosage and treatment regimen for a particular patient depends on various factors, such as the specific antibody, its variant or derivative used, the patient's age, weight, general health, sex, and diet, as well as the administration time, excretion frequency, concomitant use of drugs, and the severity of the specific disease being treated.The judgment of such factors by medical professionals is within the skill of those skilled in the art.The amount will also depend on the individual patient being treated, the administration route, the type of formulation, the characteristics of the compound used, the severity of the disease, and the desired effect.The amount used can be determined by pharmaceutical and pharmacokinetic principles well known in the art.

[0150] A therapeutically effective amount of an antibody of the present invention can be the amount necessary to achieve a therapeutic goal. As noted above, this can be a binding interaction between the antibody and its target antigen, which in certain cases interferes with the function of the target. The amount that needs to be administered further depends on the binding affinity of the antibody for its specific antigen and also on the rate at which the administered antibody is depleted from the free volume of the other subject to which it is administered. The dosage of an antigen-binding polypeptide described herein administered to a subject (e.g., a patient) is typically 0.1 mg / kg to 100 mg / kg of patient body weight, 0.1 mg / kg to 20 mg / kg of patient body weight, or 1 mg / kg to 10 mg / kg of patient body weight. Human antibodies have a longer half-life in the human body than antibodies from other species due to the immune response to the foreign polypeptide. Therefore, lower dosages and less frequent administration of human antibodies are often possible. Furthermore, the dosage and frequency of administration of the antibodies of the present disclosure can be reduced by enhancing antibody uptake and tissue (e.g., brain) penetration through modifications such as lipidation. A typical range for therapeutically effective administration of an antibody or antibody fragment of the invention can be, by way of non-limiting example, about 0.1 mg / kg body weight to about 50 mg / kg body weight, and a typical administration frequency can range, for example, from twice daily to once weekly.

[0151] When an antibody fragment is used, the smallest inhibitory fragment that specifically binds to the binding domain of the target protein is preferred. For example, peptide molecules that retain the ability to bind to the target protein sequence can be designed based on the variable region sequence of the antibody. Such peptides can be chemically synthesized and / or produced by recombinant DNA technology. (See, for example, Marasco et al., Proc. Natl. Acad. Sci. USA, 90:7889-7893 (1993)). The formulation can also contain two or more active compounds as needed for the specific indication to be treated, for example, those with complementary activities that do not adversely affect each other. Alternatively, or in addition, the composition can contain an agent that enhances its function, such as, for example, a cytotoxic agent, a cytokine (e.g., IL-15), a chemotherapeutic agent, or a growth inhibitor. Such molecules are suitably present in combination in amounts effective for the intended purpose.

[0152] The active ingredient can also be encapsulated in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization, e.g., hydroxymethylcellulose or gelatin-microcapsules and poly-(methyl methacrylate) microcapsules, in colloidal drug delivery systems (e.g., liposomes, albumin microspheres, microemulsions, nanoparticles, and nanocapsules), or in macroemulsions, respectively.

[0153] Formulations to be used for in vivo administration must be sterile, which is readily accomplished by filtration through sterile filtration membranes.

[0154] Sustained-release preparations can be prepared.Suitable examples of sustained-release preparations include semipermeable matrices of solid hydrophobic polymers containing antibodies, which matrices are in the form of shaped articles, such as films or microcapsules.Examples of sustained-release matrices include polyesters, hydrogels (e.g., poly(2-hydroxyethyl-methacrylate) or poly(vinyl alcohol)), polylactide (U.S. Pat. No. 3,773,919), copolymers of L-glutamic acid and gamma-ethyl-L-glutamate, non-degradable ethylene-vinyl acetate, degradable lactic acid-glycolic acid copolymers such as LUPRON DEPOT™ (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate), and poly-D-(-)-3-hydroxybutyric acid.Polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid allow the release of molecules for more than 100 days, while certain hydrogels release proteins for shorter periods of time.

[0155] The antibodies of the present invention can be used as agents for detecting the presence of PD-1 (or a protein fragment thereof) in a sample. For example, the antibody can include a detectable label. The antibody can be polyclonal or monoclonal. The intact antibody, or a fragment thereof (e.g., F ab , scFv, or F (ab)2) can be used. With respect to probes or antibodies, the term "labeled" can encompass direct labeling of the probe or antibody by conjugating (i.e., physically linking) a detectable substance to the probe or antibody, and indirect labeling of the probe or antibody by reactivity with another reagent that is directly labeled. Examples of indirect labeling include detection of a primary antibody using a fluorescently labeled secondary antibody and end-labeling a DNA probe with biotin so that it can be detected with fluorescently labeled streptavidin. The term "biological sample" can include tissues, cells, and biological fluids isolated from a subject, as well as tissues, cells, and biological fluids present within a subject. Thus, the use of the term "biological sample" includes blood and fractions or components of blood, including serum, plasma, or lymph. That is, the detection methods of the present invention can be used to detect analyte mRNA, protein, or genomic DNA in biological samples in vitro and in vivo. For example, in vitro techniques for detecting analyte mRNA include Northern hybridization and in situ hybridization. In vitro techniques for detection of an analyte protein include enzyme linked immunosorbent assays (ELISAs), Western blots, immunoprecipitations, and immunofluorescence. In vitro techniques for detection of an analyte genomic DNA include Southern hybridizations.

[0156] Procedures for performing immunoassays are described, for example, in "ELISA: Theory and Practice: Methods in Molecular Biology", Vol. 42, J.R.Crowther (Ed.) Human Press, Totowa, NJ, 1995, "Immunoassay", E. Diamandis and T. Christopoulus, Academic Press, Inc., San Diego, CA, 1996, and "Practice and Theory of Enzyme Immunoassays", P. Tijssen, Elsevier Science Publishers, Amsterdam, 1985. Additionally, in vivo techniques for detecting an analyte protein include introducing into a subject a labeled anti-analyte protein antibody. For example, the antibody can be labeled with a radioactive marker whose presence and location in a subject can be detected by standard imaging techniques.

[0157] Antibodies to the PD-1 protein (or fragments thereof) can be used in methods known in the art related to localizing and / or quantitating PD-1 protein (e.g., for use in measuring levels of PD-1 protein in an appropriate physiological sample, for use in diagnostic methods, for use in protein imaging). In certain embodiments, antibodies specific for the PD-1 protein, or derivatives, fragments, analogs, or homologs thereof, that contain an antigen-binding domain derived from the antibody, are utilized as pharmaceutically active compounds (hereinafter referred to as "therapeutic agents").

[0158] Antibodies specific for the PD-1 protein of the invention can be used to isolate PD-1 polypeptides by standard techniques, such as immunoaffinity, chromatography, or immunoprecipitation. Antibodies to the PD-1 protein (or fragments thereof) can be used diagnostically to monitor protein levels in tissues as part of a clinical testing procedure, e.g., to determine the effectiveness of a given therapeutic regimen.

[0159] Detection can be facilitated by conjugating (i.e., physically linking) the antibody to a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase, or acetylcholinesterase. Examples of suitable prosthetic group complexes include streptavidin / biotin and avidin / biotin. Examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride, or phycoerythrin. Examples of luminescent materials include luminol. Examples of bioluminescent materials include luciferase, luciferin, and aequorin. Examples of suitable radioactive materials include 125 I, 131 I, 35 S, 32 P or 3 H is one example.

[0160] The antibodies or agents of the present invention (also referred to herein as "active compounds"), as well as their derivatives, fragments, analogs, and homologs, can be incorporated into pharmaceutical compositions suitable for administration. Such compositions typically comprise the antibody or agent and a pharmaceutically acceptable carrier. As used herein, "pharmaceutically acceptable carrier" can include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Suitable carriers are described in the most recent edition of Remington's Pharmaceutical Sciences, a standard reference text in the field, incorporated herein by reference. Preferred examples of such carriers or diluents include, but are not limited to, water, saline, Ringer's solution, dextrose solution, and 5% human serum albumin. Non-aqueous vehicles, such as liposomes and fixed oils, can also be used. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, its use in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions.

[0161] The pharmaceutical composition of the present invention is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (i.e., topical), transmucosal, and rectal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application may contain the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycol, glycerin, propylene glycol, or other synthetic solvents; an antibacterial agent such as benzyl alcohol or methylparaben; an antioxidant such as ascorbic acid or sodium bisulfite; a chelating agent such as ethylenediaminetetraacetic acid (EDTA); a buffer such as acetate, citrate, or phosphate, and an agent for adjusting tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases such as hydrochloric acid or sodium hydroxide. Parenteral preparations can be enclosed in ampoules, disposable syringes, or multiple-dose vials made of glass or plastic.

[0162] Pharmaceutical compositions suitable for injectable use can include sterile aqueous solutions (where water soluble) or dispersions, and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, NJ), or phosphate-buffered saline (PBS). In embodiments, the composition is sterile and fluid to the extent that easy syringability exists. It can be stable under the conditions of manufacture and storage and can be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, etc.), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. Prevention of microbial action can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, etc. In many cases, isotonic agents, for example, sugars, polyalcohols such as mannitol and sorbitol, sodium chloride can be included in the composition. Prolonged absorption of injectable compositions can be achieved by including in the composition an agent that delays absorption, for example, aluminum monostearate and gelatin.

[0163] Sterile injectable solution can be prepared by incorporating the required amount of active compound into the appropriate solvent with one or combination of the ingredients listed above as needed, and then sterilize by filtration.For example, dispersion is prepared by incorporating active compound into the sterile vehicle that contains the basic dispersion solvent and the other ingredients listed above.For the preparation of sterile injectable solution, the method of preparation is vacuum drying and freeze-drying, which produces powder of active compound and any additional desired ingredients from the solution that has been previously sterile filtered.

[0164] Oral compositions include inert diluents or edible carriers. They can be enclosed in gelatin capsules or compressed into tablets. For oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, lozenges, or capsules. Oral compositions can also be prepared using fluid carriers for use as mouthwashes, in which the compound in the fluid carrier is orally applied, swirled in the mouth, and expectorated or swallowed. Pharmaceutically compatible binders and / or adjuvants can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, tragacanth gum, or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, primogel, or corn starch; a lubricant such as magnesium stearate or sterol; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavor.

[0165] For administration by inhalation, the compounds are delivered in the form of an aerosol spray from pressured container or dispenser which contains a suitable propellant, eg, a gas such as carbon dioxide, or a nebulizer.

[0166] Systemic administration can also be by transmucosal or transdermal means.For transmucosal or transdermal administration, a penetrant suitable for the barrier to be permeated is used in the formulation.Such penetrants are generally known in the art, and for example, for transmucosal administration, include detergents, bile salts, and fusidic acid derivatives.Transmucosal administration can be achieved through the use of nasal sprays or suppositories.For transdermal administration, active compounds are formulated into ointments, salves, gels, or creams generally known in the art.

[0167] The compounds can also be prepared in the form of suppositories (eg, with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.

[0168] In one embodiment, the active compound is prepared with a carrier that will protect the compound against rapid elimination from the body, such as a controlled-release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. Methods for preparing such formulations are apparent to those skilled in the art. Materials are also commercially available from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeting infected cells with monoclonal antibodies against viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.

[0169] For the sake of ease of administration and uniformity of dosage, oral or parenteral compositions can be formulated in dosage unit form.Dosage unit form as used herein refers to a physically separate unit that is suitable as a single dose for the subject to be treated, and each unit contains a predetermined amount of active compound that is calculated to produce desired therapeutic effect in association with required pharmaceutical carrier.The specification of dosage unit form of the present invention is determined by and directly depends on the specific characteristics of active compound and the specific therapeutic effect that should be achieved, and the inherent limitation of the technology that formulates this active compound for individual treatment.

[0170] The pharmaceutical compositions can be included in a container, pack, or dispenser together with instructions for administration.

[0171] Treatment method As used herein, the term "treat" or "treatment" refers to both therapeutic treatment and prophylactic or preventative measures, the purpose of which is to prevent or slow (alleviate) an undesirable physiological change or disorder, such as the progression of cancer. Beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, reduction in extent of disease, stable (i.e., not worsening) state of disease, slowing or delaying of disease progression, improvement or palliation of disease state, remission (partial or total), whether detectable or not. "Treatment" refers to prolonging survival as compared to expected survival in the absence of treatment. Those in need of treatment include those already suffering from the condition or disorder, as well as those susceptible to the condition or disorder, or those in whom the condition or disorder is to be prevented.

[0172] The present invention provides both prophylactic and therapeutic methods for treating subjects at risk (or susceptible) for cancer or other cell proliferation-related diseases or disorders. Such diseases or disorders include, but are not limited to, diseases or disorders associated with aberrant expression of PD-1. For example, the methods are used to treat, prevent, or alleviate the symptoms of cancer. In one embodiment, the methods are used to treat, prevent, or alleviate the symptoms of solid tumors. Non-limiting examples of cancers that can be treated with the compositions described herein include lung cancer, ovarian cancer, prostate cancer, colon cancer, cervical cancer, brain cancer, skin cancer, liver cancer, pancreatic cancer, or gastric cancer. In addition, the methods of the present invention can be used to treat blood cancers such as leukemia and lymphoma. Alternatively, the methods can be used to treat, prevent, or alleviate the symptoms of metastatic cancer. For example, cancers that can be treated or prevented, or whose symptoms can be alleviated, include B-cell chronic lymphocytic leukemia (CLL), non-small cell lung cancer, melanoma, ovarian cancer, lymphoma, or renal cell carcinoma. Cancers that can be treated, prevented, or alleviated include solid tumors with high mutational burden and WBCs in filtrates.Cancers that can be treated, prevented, or alleviated further include cancers in which the signaling of the PD-1 / PD-L1 axis is modulated, such as (but not limited to) breast cancer, lung cancer (e.g., non-small cell lung cancer or lung adenocarcinoma), gastric cancer, colorectal cancer, bladder cancer, pancreatic cancer, prostate cancer, esophageal squamous cell carcinoma, nasopharyngeal carcinoma, and liquid tumors in which the PD1 / PD-L1 axis is active (diffuse large B-cell lymphoma (DLBCL) and B-cell chronic lymphocytic leukemia (B-CLL)) (see, e.g., Han et al., PD-1 / PD-L1 pathway: current researches in cancer, Am J Cancer Res 2020;10(3):727-742).

[0173] Thus, in one aspect, the invention provides a method for preventing, treating, or alleviating symptomatic cancer or cell proliferative disease or disorder in a patient by administering to the patient a monoclonal antibody, scFv antibody, or bispecific antibody of the invention. For example, an anti-PD-1 antibody can be administered in a therapeutically effective amount.

[0174] Subjects at risk for cancer or cell proliferation-related diseases or disorders may include patients with a family history of cancer or subjects who have been exposed to agents known or suspected to cause cancer. Administration of a prophylactic agent can occur prior to the onset of cancer, such that the disease is prevented or, alternatively, its progression is delayed.

[0175] In another embodiment, tumor cell growth is inhibited by contacting the cell with an anti-PD-1 antibody of the invention. The cell can be any cell that expresses PD-1.

[0176] The present invention further provides both prophylactic and therapeutic methods for treating subjects at risk (or susceptible) to chronic or acute viral, bacterial, or parasitic infections. The present invention also provides therapeutic methods for both prophylactic and therapeutic treatment of subjects at risk of a disease, disorder, or condition associated with T cell depletion, or at risk of developing T cell depletion. The present invention also provides therapeutic methods for both prophylactic and therapeutic treatment of subjects at risk of a disease, disorder, or condition associated with T cell depletion, or at risk of developing T cell depletion. Such diseases or disorders include, but are not limited to, HIV, AIDS, and chronic or acute bacterial, viral, or parasitic infections. Other such chronic infections include, for example, those caused by hepatitis B virus (HBV), hepatitis C virus (HCV), herpes simplex virus 1 (HSV-1), H. pylori, or Toxoplasma gondii. Other acute infections include, for example, those caused by microorganisms such as gram-positive bacteria, gram-negative bacteria, protozoa, or fungi, as described herein.

[0177] The present invention also encompasses methods for increasing or enhancing an immune response to an antigen. The immune response is increased or enhanced by administering a monoclonal antibody, scFv antibody, or bispecific antibody of the present invention to a subject. The immune response is enhanced, for example, by enhancing antigen-specific T effector function. The antigen is a viral (e.g., HIV), bacterial, parasitic, or tumor antigen. The immune response is a natural immune response. A natural immune response refers to an immune response resulting from an infectious disease. The infectious disease is a chronic infectious disease. An increase or enhancement of the immune response to an antigen can be measured by many methods known in the art. For example, the immune response can be measured by measuring any one of the following: T cell activity, T cell proliferation, T cell activation, effector cytokine production, and T cell transcriptional profile. Alternatively, the immune response is a response induced by vaccination.

[0178] Thus, in another aspect, the present invention provides a method for increasing vaccine efficacy by administering to a subject a monoclonal antibody or scFv antibody of the present invention and a vaccine, wherein the antibody and vaccine are administered sequentially or simultaneously. The vaccine may be a tumor vaccine, a bacterial vaccine, or a viral vaccine.

[0179] Combination Method The compositions of the present invention described herein can be administered in combination with chemotherapeutic agents.The chemotherapeutic agents that can be administered with the compositions of the present disclosure include but are not limited to antibiotic derivatives (for example, doxorubicin, bleomycin, daunorubicin and dactinomycin), antiestrogens (for example, tamoxifen), antimetabolites (for example, fluorouracil, 5-FU, methotrexate, floxuridine, interferon alpha-2b, glutamic acid, plicamycin, mercaptopurine and 6-thioguanine), cytotoxic agents (for example, carmustine, BCNU, lomustine, CCNU, cytosine arabinoside, cyclophosphamide, estramustine, hydroxyurea, procarbazine, mitomycin, busulfan, cisplatin, and vincristine sulfate), hormones (e.g., medroxyprogesterone, estramustine sodium phosphate, ethinyl estradiol, estradiol, megestrol acetate, methyltestosterone, diethylstilbestrol diphosphate, chlorotrianisene, and testolactone), nitrogen mustard derivatives (e.g., mephalen, colambucil, mechlorethamine (nitrogen mustard) and thiotepa), steroids and combinations (e.g., betamethasone sodium phosphate), and others (e.g., dicarbazine, asparaginase, mitotane, vincristine sulfate, vinblastine sulfate, and etoposide).

[0180] In additional embodiments, the compositions of the invention described herein can be administered in combination with cytokines, including but not limited to IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-10, IL-12, IL-13, IL-15, anti-CD40, CD40L, and TNF-α.

[0181] In additional embodiments, the compositions described herein can be administered in combination with other therapeutic or prophylactic regimens, such as, for example, radiation therapy.

[0182] In some embodiments, the compositions described herein can be administered in combination with other immunotherapeutic agents, including, but not limited to, simtuzumab, abagovomab, adecatumumab, afutuzumab, alemtuzumab, altumomab, amatuximab, anatumomab, arcitumomab, bavituximab, bectumomab, and the like. b), bevacizumab, bivatuzumab, blinatumomab, brentuximab, cantuzumab, catumaxomab, cetuximab, sitatuzumab, cixutumumab, clivatuzumab, conatumumab, daratumumab daratumumab, drozitumab, duligotumab, dusigitumab, detumomab, dacetuzumab, dalotuzumab, ecromeximab, elotuzumab, ensituximab, ertumaxomab, etaracizumab zumab, farletuzumab, ficlatuzumab, figitumumab, flanvotumab, futuximab, ganitumab, gemtuzumab, girentuximab, glembatumumab, ibritumomab, igovomab,Imgatuzumab, indatuximab, inotuzumab, intetumumab, ipilimumab, iratumumab, labetuzumab, lexatumumab, lintuzumab, lorvotuzumab, lucatumumab, mapatumumab, matuzumab (matuzumab), milatuzumab, minretumomab, mitumomab, moxetumomab, narnatumab, naptumomab, necitumumab, nimotuzumab, nofetumomab, ocaratuzumab, ofatumumab, olaratumab b), onartuzumab, oportuzumab, oregovomab, panitumumab, parsatuzumab, patritumumab, pemtumomab, pertuzumab, pintumomab, pritumumab, racotumomab, radretumab, rilotumumab lotumumab, rituximab, lobatumumab, satumomab, sibrotuzumab, siltuximab, solitomab, tacatuzumab, taplitumomab, tenatumomab, teprotumumab, tigatuzumab, tositumomab,These include trastuzumab, tucotuzumab, ublituximab, veltuzumab, vorsetuzumab, votumumab, zalutumumab, CC49, and 3F8.

[0183] The present invention provides methods for treating cancer in a patient by administering two antibodies that bind to the same epitope on the PD-1 protein, or alternatively, two different epitopes on the PD-1 protein. Alternatively, cancer can be treated by administering a first antibody that binds to PD-1 and a second antibody that binds to a protein other than PD-1. In other embodiments, cancer can be treated by administering a bispecific antibody that binds to PD-1 and a protein other than PD-1. For example, the protein other than PD-1 can include, but is not limited to, IL-12, IL-12R, IL-2, IL-2R, IL-15, IL-15R, IL-7, IL-7R, IL-21, or IL-21R. For example, the protein other than PD-1 can be a tumor-associated antigen, or the protein other than PD-1 can be a cytokine.

[0184] In some embodiments, the invention provides for the administration of anti-PD-1 antibodies, alone or with an additional antibody that recognizes another protein other than PD-1, together with cells capable of achieving or enhancing an immune response. For example, these cells can be peripheral blood mononuclear cells (PBMCs), or any cell type found in PBMCs, such as cytotoxic T cells, macrophages, and natural killer (NK) cells.

[0185] Additionally, the present invention provides for the administration of antibodies that bind to PD-1 protein with other therapeutic agents, including anti-neoplastic agents such as small molecules, growth factors, cytokines, or biomolecules such as peptides, peptidomimetics, peptoids, polynucleotides, lipid-derived mediators, small biogenic amines, hormones, neuropeptides, and proteases. Small molecules include, but are not limited to, inorganic molecules and small organic molecules. Suitable growth factors or cytokines include IL-2, GM-CSF, IL-12, and TNF-α. Small molecule libraries are known in the art. (See Lam, Anticancer Drug Des., 12:145, 1997.)

[0186] Chimeric antigen receptor (CAR) T-cell therapy Also provided herein are cell therapies such as chimeric antigen receptor (CAR) T cell therapy. CAR T cell therapy redirects a patient's T cells to kill tumor cells, for example, by exogenous expression of a CAR on the T cells. A CAR can be a transmembrane fusion protein linking the antigen recognition domain of an antibody to the intracellular signaling domain of a T cell receptor and co-receptor. For example, suitable cells capable of secreting (or alternatively engineered to express) the anti-PD-1 antibodies described herein that will cause secretion of the anti-PD-1 antibodies of the present invention can be used. The secreted anti-PD-1 "payload" can be, for example, a minibody, ScFv, IgG molecule, bispecific fusion molecule, and other antibody fragments described herein.

[0187] Solid tumors present unique challenges for CAR-T therapy. Some barriers to the effectiveness of CAR-T in solid tumors include heterogeneous antigen expression, poor tissue homing, activation, persistence, and an immunosuppressive tumor microenvironment. Unlike hematological cancers, tumor-associated target proteins are overexpressed between tumors and healthy tissues, resulting in on-target / off-tumor T cell killing in healthy tissues. Furthermore, immunosuppression in the tumor microenvironment (TME) limits the activation of tumor-killing CAR-T cells. After such contact or manipulation, the cells can be introduced into a cancer patient in need of treatment. The cancer patient may have any of the types of cancer disclosed herein. The cells (e.g., T cells) may be, but are not limited to, tumor-infiltrating T lymphocytes, CD4+ T cells, CD8+ T cells, or a combination thereof.

[0188] Exemplary CARs and CAR factories useful in embodiments of the present invention include, for example, those disclosed in PCT / US2015 / 067225 and PCT / US2019 / 022272, each of which is incorporated herein by reference in its entirety. For example, CAR-T cells can be generated according to methods known in the art using lentiviral systems (via transduction), retroviral systems (via transfection (electroporation)), and transposon systems (via PiggyBac). Useful promoters for payloads that can be used to generate CAR-Ts include, for example, constitutive promoters (the promoter is the same as that for CAR-T, such as EF1a followed by IRES or 2A), inducible promoters (the promoter is different from that of CAR-T, such as NFAT, IL-2 prom), and genetically engineered promoters (such as cytokine PD-1 locus "knock-in" and / or promoters under the control of the endogenous promoter). In one embodiment, the PD-1 antibodies or PD-1 fusion proteins discussed herein can be used in the construction of multispecific antibodies or as a payload for CAR-T cells. For example, in one embodiment, the anti-PD-1 antibodies or PD-1 fusion proteins discussed herein can be used for targeting CARS (i.e., as a targeting moiety). In one embodiment, the anti-PD-1 antibodies or PD-1 fusion proteins discussed herein can be used as a payload secreted by CAR-T cells. In another embodiment, the anti-PD-1 antibodies or PD-1 fusion proteins discussed herein can be used as a targeting moiety, and a different PD-1 antibody targeting a different epitope can be used as the payload. In another embodiment, the payload can be an immunomodulatory antibody payload. In some embodiments, the PD-1 antibodies or PD-1 fusion proteins described herein for use in CAR-T compositions are not high-affinity PD-1 antibodies (e.g., so that the antibody does not bind strongly to its PD-1 target).For example, the PD-1 antibodies or PD-1 fusion proteins described herein can be used as payloads secreted by CAR-T cells with two targeting moieties (e.g., tumor-associated surface antigens) selected for a particular cancer (i.e., MSLN and MUC1 in the case of ovarian cancer). Non-limiting examples of tumor-associated surface antigens include ErbB2 (HER2 / neu), carcinoembryonic antigen (CEA), epithelial cell adhesion molecule (EpCAM), epidermal growth factor receptor (EGFR), MUC1, MSLN, CD19, CD20, CD30, CD40, CD22, RAGE-1, MN-CA, and IL-1. IX, RET1, RET2 (AS), prostate-specific antigen (PSA), TAG-72, PAP, p53, Ras, prostein, PSMA, survivin, 9D7, prostate cancer tumor antigen-1 (PCTA-1), GAGE, MAGE, mesothelin, β-catenin, TGF-βRII, BRCA1 / 2, SAP-1, HPV-E6, HPV-E7 (also see PCT / US2015 / 067225 and PCT / US2019 / 022272, which are incorporated by reference in their entireties, for additional tumor-associated surface antigens). Exemplary armored CAR-T cells are listed in the table below. TIFF2025121997000041.tif132154

[0189] In one embodiment, a bispecific (or dual-targeted) CAR-T is provided. In another embodiment, the CAR-T is an engineered cell comprising a chimeric antigen receptor, the chimeric antigen receptor comprising extracellular ligand-binding domains specific for a first antigen and a second antigen on the surface of a cancer cell, wherein the first antigen comprises CXCR4 and the second antigen comprises CLDN4, or the first antigen comprises CAIX and the second antigen comprises CD70, or the first antigen comprises MUC1 and the second antigen comprises Msln. For example, an anti-PD-1 antibody or PD-1 fusion protein described herein (such as an anti-PD1-scIL12 fusion described herein) can be used as a payload for the CAR-T described herein. In one embodiment, a CXCR4 / CLDN4 dual-targeted CAR-T with an anti-PD1-scIL12 fusion payload can be used for breast cancer. In one embodiment, a CAIX / CD70 dual-targeting CAR-T with an anti-PD1-scIL12 fusion payload can be used for clear cell renal cell carcinoma (ccRCC). In one embodiment, a MUC1 / Msln dual-targeting CAR-T with an anti-PD1-scIL12 fusion payload can be used for ovarian cancer.

[0190] Diagnostic Assays Anti-PD-1 antibodies can be used diagnostically, e.g., to monitor the development or progression of cancer, e.g., as part of a clinical trial procedure to determine the effectiveness of a given therapeutic and / or prophylactic regimen.

[0191] In some embodiments, for diagnostic purposes, the anti-PD-1 antibodies of the invention are linked to a detectable moiety to provide a method for detecting cancer cells, e.g., in a subject at risk for or afflicted with cancer.

[0192] The detectable moiety can be conjugated directly to the antibody or fragment, or indirectly, for example, by using a fluorescent secondary antibody.Direct conjugation can be achieved, for example, by standard chemical binding of a fluorophore to the antibody or antibody fragment, or through genetic engineering.A chimera, or a fusion protein containing an antibody or antibody fragment bound to a fluorescent or bioluminescent protein, can be constructed.For example, Casadei et al. (Proc Natl Acad Sci US A. 1990 Mar;87(6):2047-51) describes a method for creating a vector construct that can express a fusion protein gene of aequorin and an antibody in mammalian cells.

[0193] As used herein, the term "labeled" with respect to a probe or antibody can encompass both direct labeling of the probe or antibody by conjugating (i.e., physically linking) a detectable substance to the probe or antibody, and indirect labeling of the probe or antibody by reactivity with another reagent that is directly labeled. Examples of indirect labeling include detection of a primary antibody using a fluorescently labeled secondary antibody and end-labeling a DNA probe with biotin for detection with fluorescently labeled streptavidin. The term "biological sample" is intended to include tissues, cells, and biological fluids isolated from a subject, as well as tissues, cells, and biological fluids present within a subject. That is, the detection methods of the present invention can be used to detect cells expressing PD-1 in biological samples in vitro and in vivo. For example, in vitro techniques for detecting PD-1 include enzyme-linked immunosorbent assay (ELISA), Western blotting, immunoprecipitation, and immunofluorescence. Additionally, in vivo techniques for detecting PD-1 include introducing a labeled anti-PD-1 antibody into a subject. For example, the antibody can be labeled with a radioactive marker whose presence and location in a subject can be detected by standard imaging techniques.

[0194] For "targeted" conjugates, i.e., conjugates containing a targeting moiety, which is a molecule or feature designed to localize the conjugate within a subject or animal at a specific site(s), localization can refer to a state when equilibrium between the bound "localized" entity and the unbound "free" entity within the subject is essentially achieved. The rate at which such equilibrium is achieved depends on the route of administration. For example, a conjugate administered by intravenous injection can achieve localization within minutes of injection, whereas an orally administered conjugate may take several hours to achieve localization. Alternatively, localization can simply refer to the location of an entity within a subject or animal at a selected period of time after the entity is administered. As another example, localization is achieved when the moiety becomes distributed after administration.

[0195] It is understood that a reasonable estimate of the time required to achieve localization can be made by one skilled in the art. Furthermore, the state of localization as a function of time can be tracked by imaging a detectable moiety (e.g., a luminescent conjugate) according to the method of the present invention, such as with a photodetector device. The "photodetector device" used should be sensitive enough to allow imaging of weak light from within a mammal in a reasonable time and to use the signal from such a device to construct an image.

[0196] If it is possible to use extremely bright light-generating moieties and / or detect light-generating fusion proteins localized near the surface of the object or animal being imaged, "night vision" goggles or standard highly sensitive video cameras such as Silicon Intensified Tube (SIT) cameras (e.g., from Hammamatsu Photonic Systems, Bridgewater, NJ) can be used. More typically, however, more sensitive light detection methods are required.

[0197] At extremely low light levels, the photon flux per unit area becomes so low that the scene being imaged no longer appears continuous. Instead, it is represented by individual photons that differ from each other both temporally and spatially. When viewed on a monitor, such an image appears as sparkling points of light, each representing a single detected photon. By accumulating these detected photons over time in a digital image processor, an image can be acquired and constructed. In contrast to conventional cameras, where the signal at each image point is assigned an intensity value, in photon-counting imaging, the amplitude of the signal is immaterial. The objective is simply to detect the presence of a signal (photon) and count its occurrence relative to its location over time.

[0198] At least two types of photodetector devices, described below, can detect individual photons and generate a signal that can be analyzed by an image processor. Noise-reducing photodetector devices achieve sensitivity by reducing the background noise of the photon detector rather than amplifying the photon signal. Noise is primarily reduced by cooling the detector array. Devices include charge-coupled device (CCD) cameras called "back-thinned" cooled CCD cameras. In more sensitive instruments, cooling is achieved using, for example, liquid nitrogen, which brings the temperature of the CCD array to approximately -120°C. "Back-thinned" refers to an ultra-thin backplate that reduces the path length photons must travel before detection, thereby increasing quantum efficiency. A particularly sensitive back-thinned cryogenic CCD camera is the "TECH 512" Series 200 camera, available from Photometries, Ltd. (Tucson, Arizona).

[0199] "Photon amplification devices" amplify photons before they hit the detection screen. This class includes CCD cameras equipped with intensifier tubes, such as microchannel intensifier tubes. Microchannel intensifier tubes typically contain a metal array of channels perpendicular to and coextensive with the camera's detection screen. The microchannel array is positioned between the sample, subject, or animal being imaged and the camera. Most of the photons that enter the channels of the array contact the sides of the channels before exiting. A voltage applied across the array results in the emission of many electrons from each photon collision. Electrons from such collisions exit their channels of origin in a "shotgun" pattern and are detected by the camera.

[0200] Even greater sensitivity can be achieved by arranging intensifying microchannel arrays in series, so that electrons generated in the first stage in turn result in an amplified signal of electrons in the second stage. However, the increased sensitivity is achieved at the expense of spatial resolution, which decreases with each additional stage of amplification. An exemplary microchannel intensifier-tube-based single-photon detection device is the C2400 series available from Hamamatsu.

[0201] Image processors process signals generated by photon-counting photodetector devices to construct images that can be displayed on a monitor or printed on a video printer, for example. Such image processors are typically sold as part of systems that include the highly sensitive photon-counting cameras described above, and are therefore available from the same sources. Image processors are usually connected to personal computers, such as IBM-compatible PCs or Apple Macintosh computers (Apple Computer, Cupertino, Calif.), which may or may not be included as part of a purchased imaging system. Once images are in the form of digital files, they can be manipulated and printed using a variety of image processing programs (e.g., Adobe Photoshop, Adobe Systems, Adobe Systems, Mt. View, Calif.).

[0202] In one embodiment, the biological sample contains protein molecules from the test subject. One exemplary biological sample is a peripheral blood leukocyte sample isolated by conventional means from a subject.

[0203] The present invention also encompasses kits for detecting the presence of PD-1 or PD-1-expressing cells in a biological sample. For example, the kit can include a labeled compound or agent (e.g., an anti-PD-1 scFv or monoclonal antibody) capable of detecting cancer or tumor cells in a biological sample, a means for determining the amount of PD-1 in the sample, and a means for comparing the amount of PD-1 in the sample with a standard. The standard, in some embodiments, is a non-cancerous cell or a cellular extract thereof. The compound or agent can be packaged in a suitable container. The kit can further include instructions for using the kit to detect cancer in a sample.

[0204] Other embodiments While the present invention has been described in conjunction with its detailed description, the foregoing description is intended to be illustrative, but not limiting, of the scope of the invention, which is defined by the appended claims. Other aspects, advantages, and modifications are within the scope of the appended claims.

[0205] The invention is further described in the following examples, which do not limit the scope of the invention described in the claims. [Example]

[0206] Examples are provided below to facilitate a more complete understanding of the present invention. The following examples illustrate exemplary modes of making and practicing the present invention. However, the scope of the present invention is not limited to the specific embodiments disclosed in these examples, which are for illustrative purposes only, as alternative methods may be used to obtain similar results.

[0207] Example 1 - PMPL Panning The PD-1 antibodies of the present invention (e.g., P4-B3 and P4-B7) were discovered via PMPL panning. Briefly, PD-1 was expressed genetically fused to a C-terminal C9 tag (TETSQVAPA). Expi293 cells were transiently transfected and then lysed. The lysate was clarified, and PD-1 protein was captured using 1D4 (anti-C9 tag)-conjugated magnetic beads. The beads were then dialyzed in a lipid solution to form a lipid bilayer around the beads, simulating the cell membrane and increasing protein stability. These beads were then used for panning.

[0208] Example 2 - Minibody Binding Curves Minibody binding curves were performed on transfected cells (see Figure 4). Binding curves for the P4-B3 minibody were generated using cells transfected with human or cynomolgus PD1. The human variant was performed twice, while the negative control and cynomolgus were performed once. Curves were generated on Expi293 cells 48 hours after transfection. The human variant curves were normalized based on expression levels using commercial antibody staining, but the cynomolgus variant curves were not. Normalization was not performed on the cynomolgus variant because the commercial antibody used has not been reported to bind to cynomolgus PD-1.

[0209] Example 3 - Octet binding curves of different antibody formats of P4-B3 The streptavidin sensor was loaded with 3 μg / ml of biotinylated PD-1. A 3 / 4 serial dilution was performed with a maximum concentration of 50 nM for all P4-B3 formats. Kinetic calculations were performed using Octet Red software and are shown in Figure 5. According to the EMEA evaluation report (EMEA / H / C / 003820 / 0000), the reported KD for Pembro is 2.9E-11 M, which is comparable to the results obtained from experiments with Pembro.

[0210] Example 4 - PD-L1 competition assay SA sensors were loaded with 3 μg / ml PD-1 and incubated with various concentrations (50–0 nM) of Pembro (IgG) or P4-B3 (IgG or minibody), followed by 5 μg / ml PD-L1. In Figure 6, the red curve represents the maximum amount of PD-L1 binding to an unloaded, PD-1-functionalized sensor. As shown in Figure 6, the P4-B3 antibody shifts slightly upon addition of PD-L1, but appears to block a significant portion of PD-L1 binding. The curve does not include the antibody loading step, but instead shows the PD-L1 binding step. The original antibody binding step is shown in detail in Figure 5.

[0211] Example 5 - IgG ELISA ELISA plates were coated with soluble PD1 at 1 μg / ml for 2 hours at 37°C. Plates were then washed and blocked with 2% BSA / PBS for 1 hour at 37°C. The blocking solution was removed, and 3-fold serial dilutions of antibody, starting at 6 μg / ml, were added to each well (100 μl) in 2% milk-PBST. Plates were then incubated at room temperature with gentle shaking, washed six times with PBS-T, and secondary anti-human Fc-HRP (1:150kJ, Bethyl) was added. Plates were again incubated at room temperature with gentle shaking for 1 hour, then washed six times with PBS-T. TMB substrate was added, and the plate was incubated at 30°C for 10 minutes to promote the HRP reaction. The signal was then quenched with TMB stop solution and read at 450 nm. See the top graph in Figure 7.

[0212] The same protocol described herein was applied to the bottom graph of Figure 7, except that plates were coated with 3-fold serial dilutions of antigen starting at 6 ug / ml. Antibody was then added to all wells at a constant concentration of 1 ug / ml.

[0213] Example 6 - PD1 FACS using anti-PD1 IgG T cells were cultured for 48 hours in complete DMEM (293FT medium) with or without 5 μg / ml PHA. Pembrolizumab and P4-B3 antibodies were detected with Biolegend's anti-human IgG Fc APC (Cat. No. 409306). As shown in Figure 8, the P4-B3 PD-1 antibody exhibits a similar binding pattern to pembrolizumab and the control anti-PD1 antibody.

[0214] Example 7 - PD1-PDL1 Bioassay A Promega PD1-PDL1 bioassay (J1250) was performed using a PD-1 antibody of the invention (P4-B3) and the commercially available antibodies pembrolizumab and nivolumab (Figure 9).

[0215] The constructs tested were: (a) IgG1: WT monomer, (b) LALA: monomer, hexamer, and mutant 3, (c) sIgG4: monomer and hexamer, control: mAb11 LALA monomer.

[0216] All samples were performed in triplicate except for mAb11.

[0217] Fold induction: RLU stimulated / RLU unstimulated (no Ab) (Figure 10).

[0218] Example 8 - Anti-PD-1 cross-reactivity Many anti-PD-1 antibodies are not cross-reactive with mouse and human PD-1 (Pembro and Nivo are not cross-reactive). See Fessas, Petros et al. "A molecular and preclinical comparison of the PD-1-targeted T-cell checkpoint inhibitors nivolumab and pembrolizumab" Seminars in Oncology vol. 44, 2 (2017): 136-140. See also Tan JBL, Chen C, Chen K, "Preclinical Characterization of GLS-010 (AB122): A Fully Human Clinical-Stage anti-PD-1 Antibody." Poster, Arcus Biosciences; Burova, Elena et al. "Characterization of the Anti-PD-1 Antibody REGN2810 and Its Antitumor Activity in Human PD-1 Knock-In Mice" Large Molecule Therapeutics, 2017; and Li, Dong et al. "Epitope mapping reveals the binding mechanism of a functional antibody cross-reactive to both human and murine programmed death 1" mAbs vol.9,4(2017):628-637.

[0219] The antibodies of the present invention (eg, P4-B3) are cross-reactive.

[0220] Expi293 cells transiently transfected with 3E5 were suspended in 100 μl of MACS buffer and added to each well. Next, 50 μl of each antibody dilution was mixed with the cells, and the plate was incubated at 4°C for 30 minutes. After incubation, the plate was washed twice with MACS buffer and incubated with 1 μl / well of anti-human Fc-APC (Biolegend #409306). The plate was incubated at 4°C for 25 minutes and washed three times before sample analysis.

[0221] As shown in Figure 16, P4-B3 has moderate affinity for mouse PD-1, which sets it apart from Pembro and Nivo.

[0222] Example 9 - Affinity Maturation Yeast library generation First, P4-B3 scFv is cut and pasted from the pFarber vector (phage display) into the pCTCON2 vector (yeast display). Then, the library is generated according to two methods implemented in the art: (1) bacterial digestion / ligation and transformation of the intact plasmid into yeast; and (2) homologous recombination in yeast with the linearized vector and PCR fragment. The digestion / ligation method (method (1) described herein) results in a very small library size, low ligation / bacterial transformation efficiency, and very low yeast transformation efficiency. However, homologous recombination (method (2) described herein) results in a very small library size, low ligation / bacterial transformation efficiency, and very low yeast transformation efficiency. 6 ~10 7 A library of mutants was obtained.

[0223] Error-prone mutagenesis The Agilent GeneMorph II Random Mutagenesis Kit was used, which is designed to vary the mutation rate based on the original template DNA. TIFF2025121997000042.tif41128

[0224] External primers (approximately 50-60 bp overlap with the pCTCON2 vector): (a) pCTCON2-HR-Fwd: GAGGAGGCTCTGGTGGAGGCGGTAGCGGAGGCGGAGGGTCGGCTAGCTGGGCCCAGCCGG (b) pCTCON2-HR-Rev: ACACTGTTGTTATCAGATCTCGAGCTATTACAAGTCCTCTTCAGAAATAAGCTTTTGTTC

[0225] Internal primers (45 bp overlap with heavy or light chain fragment): (a) G4S-Fwd: GGTGGCGGCGGTTCCGGAGGTGGTGGTTCTGGCGGTGGTGGCAGC (b) G4S-Rev: GCTGCCACCACCGCCAGAACCACCACCTCCGGAACCGCCGCCACC

[0226] Error-prone mutagenesis strategies (a) PCR the entire scFv fragment using external primers. This strategy allows for mutations in the linker region, which is undesirable. (b) PCR the heavy and light chains separately using external and G4S primers, using the G4S linker as the third overlap point for three-piece homologous recombination. This strategy protects the linker from mutations, but requires three-piece homologous recombination, which may be less efficient than two-piece.

[0227] Both methods were used with various amounts of template DNA. The template for the whole scFv PCR was the pCTCON4 vector into which P4-B3 had been cloned (approximately 1 / 10 of the template was the target sequence). The template for the separate heavy / light chain PCRs was the P4-B3 PCR fragment (approximately 1 / 2 of the template was the target sequence).

[0228] Templates used: for whole scFv PCR: 4ug, 2ug, 1ug, 0.5ug, for separate PCR of heavy / light chain: 450ng, 50ng (two reactions each).

[0229] *To increase DNA yield, PCR was performed for 33 cycles.

[0230] Library generation The protocol described in Benatuil et al., “An improved yeast transformation method for the generation of very large human antibody libraries,” Protein Eng Des Sel. 2010 Apr;23(4):155-9 was followed.

[0231] General protocol: EBY100 yeast cells were inoculated into 100 ml of YPD medium at an OD600 of 0.3 and grown at 30°C for approximately 5-6 hours until an OD600 of 1.6 was reached. Cells were harvested by centrifugation, washed twice with 50 ml of chilled ddH2O, and once with 50 ml of chilled electroporation buffer (1 M sorbitol / 1 mM CaCl2). Cells were then conditioned in 20 ml of 0.1 M LiAc / 10 mM DTT by shaking at 30°C for 30 minutes. Cells were harvested and washed with 50 ml of chilled electroporation buffer. After pelleting, cells were resuspended in a final volume of 1 ml, sufficient for two transformations.

[0232] Whole scFv PCR: 4.8 ug of insert was obtained and mixed with 4 ug of linearized vector (NcoI / BamHI).

[0233] H / L chain PCR: 4.1 ug of HC and 3.5 ug of LC were obtained and reduced to 3 ug of linearized vector (NcoI / BamHI).

[0234] The vector and fragment of interest were mixed, precipitated with EtOH, and the volume reduced (to less than 50 ul). 400 ul of electrocompetent yeast cells were transformed using a Biorad at 2.5 kV and 25 uF. Cells were harvested in 1:1 YPD:1M sorbitol. Cells were spun down for 1 hour, washed with SDCAA, and resuspended in 250 ml SDCAA for each transformation.

[0235] Titers: (a) entire scFv library: approximately 5.2E6 members, (b) individual H / L chains: approximately 5.8E6 members.

[0236] After two passages, colonies were plated out and subjected to sequencing (96 colonies per library). Overall scFv library: 56 / 96 (58.33%) had at least one mutation. Separate libraries for H / L chains: 42 / 96 (43.75%) had at least one mutation.

[0237] Effective library size: (a) total scFv library: approximately 2.9E6 members, (b) separate H / L chains: approximately 2.1E6 members.

[0238] Library sorting strategies Two staining methods were used: (1) standard staining to look for improved binding (shifted to the upper right quadrant during FACS analysis), and (2) a kinetic strategy to look for improved off-rates.

[0239] In dynamic staining, the library is stained with labeled antigen at a concentration 10 times the Kd, washed, and then incubated with an increasing volume of unlabeled antigen at a concentration 100 times the Kd. Incubating the sample in a large volume prevents dissociating antigens from rebinding to yeast. Furthermore, adding a high concentration of unlabeled antigen displaces the labeled antigen that has been turned off.

[0240] In the case of dynamic staining, the staining time depends on the time constant (τ). τ=(k on [Ag]0+k off )-1

[0241] where k = on rate (M^-1s^-1), k = off rate (s^-1), and [Ag] = initial antigen concentration (M).

[0242] From the octet measurements, the P4-B3 scfv has kon=6.85E4, koff=6.45E-5, and Kd=9.4E10.

[0243] Equilibrium binding with 3τ is 95% and with 5τ 99% binding.

[0244] The staining protocol was performed according to Cherf and Cochran, “Applications of Yeast Surface Display for Protein Engineering,” Methods Mol Biol. 2015;1319:155-75.

[0245] Briefly, high-affinity protein variants were isolated from yeast display libraries by FACS. Following transformation of yeast cells with the gene library and induction of surface expression, two main strategies are used to differentially label the displayed library prior to screening: 1) In the equilibrium binding strategy, the library is labeled with the predicted K for the highest affinity variants. D 2) In the kinetic binding strategy, the library is incubated with ligand concentrations 5-10 times higher than the initial value, resulting in near saturation for tight binding mutants and partial labeling for weak equilibrium affinity mutants; and 2) in the kinetic binding strategy, the library is incubated with ligand as described for the equilibrium binding strategy, but unbound ligand is removed by washing, and the library is then incubated with a 100-fold excess of unlabeled ligand or with a sufficient excess volume of buffer to prevent rebinding of dissociated ligand.

[0246] In this second incubation step, excess unlabeled ligand or a large excess of incubation volume prevents rebinding of dissociated labeled ligand. Proteins are therefore differentiated based on their dissociation rate constant (koff), with variants with the slowest koff retaining the greatest proportion of pre-bound labeled ligand. Addition of a fluorescently labeled anti-epitope tag antibody allows normalization of yeast surface expression levels by binding, allowing isolation of the highest affinity variants by FACS. The pool of selected yeast clones can be grown in culture for either analysis or subsequent sorting rounds, or DNA from these clones can be isolated, subjected to mutagenesis, and used to transform new batches of yeast for directed protein evolution. Components of the yeast display platform, such as the Aga1p, Aga2p, HA, and c-myc epitope tags, as well as the detection antibodies shown in Figure 17, are omitted for clarity.

[0247] Library sorting The libraries were sorted on a Sony 800, recovering approximately 1000 clones per sample. Samples were sorted for clones with increased and decreased binding (mapping key residues). Selected cells were plated, and only a few dozen were grown, all of which were sequenced. Standard and dynamic staining was used to focus the libraries on separate heavy and light chains. TIFF2025121997000043.tif72128

[0248] Selected cells were plated onto SDCAA plates and incubated at 30°C for 3 days. Colonies were then picked, grown in fresh SDCAA medium, and sequenced to identify significant mutations. Unique clones from the sequencing were then inoculated onto fresh SGCAA (galactose-induced) plates. After 36 hours, samples were stained and a binding curve was generated.

[0249] EBY100 yeast cultures were induced for 1.5 days at 30°C. 1E6 cells were spun down and various dilutions of antigen in PBS were added to the wells. The plates were incubated for 2 hours at room temperature with shaking. The plates were washed with PBS and 0.1 μg / ml streptavidin-APC (Biolegend) was added to each well. The plates were incubated for 25 minutes at room temperature with shaking, then washed and read on a FACSCalibur.

[0250] Clones 2, 7, 10, and 14 were derived from a random mutagenesis library of P4-B3 (anti-PD1) and sorted for high binding (upward shift on the y = x axis). HL clones were generated separately by error-prone sequencing of the heavy and light chains, then recombined by homologous recombination via linker sequences. HL Dynamic 1 was derived from a dynamic staining approach in which the library was incubated with labeled antigen at 10× Kd, followed by a prolonged incubation with 100-fold excess unlabeled antigen at a volume 10x the original stain. P4-B3wt was not positive at this stage, but several clones were present in the populated library (see Figure 20). The experiment was repeated at appropriate concentrations, and only clones with a left-shifted curve were used (see Figure 21).

[0251] Other clones identified but not characterized TIFF2025121997000044.tif71136

[0252] scFv positives are clones that showed increased binding (no upward shift on the x=y axis), primarily due to poor binding to cMyc but high binding to PD-1.

[0253] scFv negatives are clones that showed reduced binding compared to WT.

[0254] In addition to cloning HLkin1, HL-7, and HL-14 into the minibody vector, double (Mut+2:HLkin1+HL-7) and triple (Mut+3:HLkin1+HL-7+HL-14) combination mutants were generated to determine whether additive effects were observed (see Figures 23 and 24).

[0255] For example, K D The measurement results were as follows: PD1#3 approx. 1E-10M P4-B3 WT approx. 1E-9M Mut+2(HLkin1+HL-7) approx. 3E-11M Mut+3(HLkin1+HL-7+HL-14) Approx. 3E-12M HLkin-1 approx. 6E-11M

[0256] We also cloned anti-PD-1 single-chain IL12 fusion constructs (bispecific antibodies). Four constructs were generated: (1) light chain fusion, (2) light chain F2A fusion, (3) heavy chain fusion, and (4) heavy chain F2A fusion. The fusions were linked by a flexible linker, and F2A contained a self-cleaving peptide variant, allowing anti-PD-1 and scIL12 to be directed in different directions as needed.

[0257] Example 10 - PD1 bioassay using IgG A Promega PD1-PDL1 bioassay (J1250) was performed using PD-1 antibodies of the invention (e.g., P4-B3 and variants described herein) and the commercially available antibodies pembrolizumab and nivolumab (Figure 33).

[0258] Nivo (green triangle) achieved approximately 5-6-fold induction, similar to previous experiments. In the scFv-Fc experiments, Mut+2, Mut+3, HLkin-1, and HL-7 all showed higher induction compared to Nivo. When converted to IgG, the combo mutant (Mut+2 / Mut+3) maintained superior performance to Nivo and performed at a level comparable to Pembro, but showed slightly lower activity as a single mutant (HLkin-1 / HL-7). The original P4-B3 IgG significantly underperformed all the other IgGs. Clone scFv-6 is a double mutant derived from a yeast library, with mutations in both light chains. As can be seen, it is an improvement over P4-B3 WT, but significantly inferior to commercially available and other mutant antibodies.

[0259] Example 11 - Construct design and killing assays Design of aPD1-scIL12 fusion P4-B3 Mut±3 scIL12 fused to IgG1: Single-chain IL12 fusions with either the IgG1 heavy or light chain are generated. Either a (G4S)2 linker, which maintains the linkage of scIL12 to the IgG, or a self-cleaving F2A peptide, which allows for separation of the two molecules, is used. All experiments are performed with IL12 fused to the G4S linker. F2A work is performed. Due to the length of IL12 and the efficiency and cost of gene synthesis, constructs are initially cloned using a stuffer sequence to add the correct restriction enzyme sites. The following protocol is based on that described in Jiang et al. (1999) Infect Immun. Jun;67(6):2996-3001, Lode et al. (1999) Proc Natl Acad Sci U S A. Jul 20;96(15):8591-6, Peng et al (1999) J Immunol. Jul 1;163(1):250-8, and Yu et al. (2012) PLoS One.7(11):e50438.doi:10.1371 / journal.pone.0050438.Epub 2012 Nov 28.

[0260] Stuffer-based cloning strategy Figure 44 shows the cloning steps used to generate an aPD1-scIL12 fusion starting with P4-B3 Mut+3 and ending with a G4S-scIL12 HC fusion (heavy chain fusions can be generated this way for any antibody construct; for kappa LC antibodies, the restriction enzyme cloning sites will need to be modified, but the overall strategy is the same). When creating the HC F2A version, the same procedure is followed except an F2A stuffer synthetic fragment is used (the F2A stuffer fragment can be cut with NheI / BamHI, and then scIL12 can be inserted with XbaI / BamHI). In some embodiments, heavy chain fusions can be made using the exact same restriction sites for any IgG vector, but the light chain restriction enzyme site and light chain constant region used with the stuffer are specific to the lambda light chain. To add a fusion to a kappa light chain, the restriction enzyme sites must be changed and the light chain constant region changed to kappa to match the kappa vector rather than the lambda vector.

[0261] When making the light chain, similar steps can be followed as outlined in Figure 44, but the AvrII and EcoRI sites can be used instead of NheI / BamHI to insert the stuffer. scIL12 can then be inserted with XbaI / EcoRI.

[0262] Protein expression See, for example, Figure 45.

[0263] Kinetic binding study of aPD1-scIL12 fusion protein An Octet assay was performed to measure the binding affinity of P4-B3 WT versus Mut+2 and Mut+3 to PD-1 (Figure 46). PD-1 was loaded at 2 μl / ml onto the streptavidin sensor in row AG, and the negative control H5 biotin was loaded at 2 μl / ml onto row H. Antibodies were diluted in two-fold serial dilutions. Improved off-rates (flatter slopes) were observed for Mut+2 and +3 compared to WT. The lower curve for Pembro is an artifact of the Octet sensor.

[0264] Octet assays were performed to measure the binding affinity of the P4-B3 mut+3 HC and LC scIL12 constructs to PD-1. PD-1 was loaded onto the streptavidin sensor in row AG at 2 μl / ml, and the negative control H5 biotin was loaded onto row H at 2 μl / ml. Fusion proteins were diluted in two-fold serial dilutions. The HC fusion is shown in the left graph in Figure 47, and the LC fusion is shown in the right graph in Figure 47. The anti-PD1 IL12 fusions show similar binding curves when compared to P4-B3 Mut+3 in Figure 46, and the addition of the IL12 fusion does not compromise the improved off-rate.

[0265] Assessment of the biological activity of aPD1-scIL12 fusion protein by IL12 cytokine reporter assay IL12 binding to the native heterodimeric IL12R leads to signaling through TyK2, JAK2, and STAT4, increasing IFNγ production. Invivogen engineered the IL12 pathway to link STAT4 production to an inducible SEAP reporter gene and stably transduced it into 293T cells (Figure 48). When supernatant from IL12-induced 293T-IL12 cells was mixed with Quanti-Blue reagent, the solution turned blue in the presence of SEAP, which could be quantified by measuring absorbance at 620-655 nm. Invivogen Cat #: hkb-il12.

[0266] The functionality of the IL12 fusions was tested using Invivogen's HEK-Blue IL12 reporter assay. Biolegend's carrier-free IL12 was used as a positive control. This experiment shows that our scIL12 and aPD1-LC-IL12 fusions have higher levels of activity compared to Biolegend IL12. The aPD1-HC-IL12 fusion shows a two-fold shift to the left compared to the LC fusion and scIL12.

[0267] Negative controls used: P4-B3 Mut+3 IgG1, pembroluzimab, CD70-mFc, and medium-only wells were all negative.

[0268] Assessment of the biological activity of aPD1-scIL12 fusion protein by CART killing assay A Celigo-based killing assay was set up to test the effect of IL12 fusions on T cell killing activity. In this experiment, anti-CAIX CARs were used in both 4-1BB format and CD28-mat against CAIX+BFP cells. The A716-41BB CAR was used as a negative control because it does not target CAIX. BioIL12 is recombinant IL12 purchased from Biolegend.

[0269] Constructs tested: aPD1P4-B3 Mut+3 with HC or LC scIL12 fusion, aPD1P4-B3 Mut+3 alone, and scIL12 alone. Pembrolizumab + bioIL12 was also tested to mimic the separate administration of aPD1 and IL12. This experiment was designed to test the effect of IL12 on CARs using media alone. The plate layout for the killing assay is shown in Figure 50.

[0270] Killing activity was measured by counting the change in BFP cell number on days 0, 1, and 2 via a Celigo image cytometer. At the end of day 2, supernatants were collected for cytokine ELISAs (IL2, TNFα, IFNγ). For cytokine ELISAs, supernatants were diluted 1:5 (TNFα), 1:40 (IL2), or 1:50 (IFNγ). TNFα and IL2 ELISAs were obtained from BioLegend, and IFNγ was obtained from Invitrogen.

[0271] Viral transduction efficiency: Three types of CAR T cells were generated using different lentiviral vectors. The CARs were generated to provide T cells already designed for killing to be used in killing assays. G36-41BB and G36-CD28 both target CAIX+ tumor cells, while A716-41BB targets BCMA. This provides both target-specific killing and a control, as CAIX+ tumor cells are used in the killing assays and A716-41BB is unable to kill CAIX+ cells. Without being bound by theory, the G36-CD28 CAR exhibits a stronger and more rapid response than G36-41BB, and it is believed that this is also observed in the killing assays. G36-41BB → Donor O: 58.4% G36-CD28 → Donor O: 45.5% A716-41BB → Donor O: 32.6%

[0272] Bulk T cells were added to each well to normalize transduction efficiency. T cells were not sorted prior to use. Transduction efficiency was measured 3 days after transduction by GFP expression.

[0273] T cells were isolated from one donor (designated Donor O) and incubated with TransAct overnight. The next day, they were used to transduce T cells by spinoculation and DEAE at an MOI of 20. One day after transduction, T cells were washed, resuspended in fresh medium containing IL-21, and treated.

[0274] A killing assay using CAR T cells was performed (Figure 50 shows the plate setup). CAIX+ cells were added to each well. All three CARs and untransduced cells were added to the plate alone or in combination with various antibodies to observe their differences in effect. LC and HC fusions were added to corresponding wells, as well as anti-PD1, Pembro, IL-12, and a combination of Pembro and bioIL12. When the plate was read, extensive clustering and killing of tumor cells was observed.

[0275] Even at an E:T ratio of 1.25:1, the G36 CAR exhibits significant killing activity (Figure 41). Addition of the aPD1-HS scIL12 fusion increases killing activity compared to aPD1 in both G36-41BB or CD28 CAR T cells. There is also a shift in A716 killing (non-specific killing) with the addition of the scIL12 fusion compared to aPD1 alone (Figure 51).

[0276] When the killing curves of G36-41BB alone and G36-41BB+scIL12 alone are added, all the lines "clump" at the top of the killing curve (Figure 52).

[0277] Cytokine ELISA Cytokine values are shown as OD450 measurements. aPD1 refers to the P4-B3 Mut+3 antibody in IgG1 WT mono format (can be fused to scIL12). Pembro refers to pembrolizumab.

[0278] A716-41BB was treated like all G36-41BB CARS and served as a control. For G36-CD28, untransduced T cells served as a control and were not treated with cytokines or antibodies. Cytokine ELISAs compared untreated CARs (media only) versus treatment options.

[0279] The IL12 constructs have a significant effect on G36-41BB T cells at each E:T ratio. At E:T ratios of 2.5:1 and 1.25:1, they have a moderate effect on G36-CD28 T cells (except for CD28 at a 1:1.25 ratio) (Figure 43). G36-41BB alone or in combination with anti-PD1 produces only small amounts of IL2, but the addition of IL12 significantly increases IL-2 secretion, which is further enhanced by treatment with aPD1-HCscIL12 or aPD1-LCscIL12 (Figure 53).

[0280] The scIL12 fusion pairs produce similar effects for both 41BB and CD28 constructs. In this IFNγ assay, scIL12 induces increased IFNγ secretion compared to CART cells alone. aPD1 itself also has a variable effect on IFNγ secretion, with a slight inhibitory effect seen in some samples. Addition of either aPD1-IL12 fusion increases IFNγ production for both 41BB and CD28-based CARs compared to CAR alone, aPD1 alone, or scIL12 alone (Figure 54). The aPD1 HC IL12 fusion is generally superior to aPD1 LC IL12, but in most conditions, both aPD1 scIL12 fusions are superior to CART alone (Figure 54).

[0281] The scIL12 fusions did not significantly affect TNFα production by the G36-41BB construct, but a significant increase in TNFα production was observed with the G36-CD28 construct. In this experiment, the HC fusions had a greater effect on TNFα production than either IL12 alone or the LC fusions. However, all IL-12 samples appear to exceed basal TNFα production by the G36-CD28 cells.

[0282] Example 12 - Mixed Lymphocyte Reaction (MLR) Protocol CD14+ monocytes were isolated using Miltenyi CD14+ microbeads. The cells were cultured in Miltenyi Mo-DC medium (pre-prepared medium containing GM-CSF and IL4). After 5 days of culture, TNF-α (1000 U / ml), IL-1β (5 ng / ml), IL-6 (10 ng / ml), and prostaglandin E2 (PGE2) (1 μM) were added, and the cells were cultured for 2 days to mature DCs. T cells were isolated on the day of the MLR experiment (CD4+ negative selection kit, StemCell). 100,000 T cells and 10,000 MoDC cells were used per well for the MLR. Antibodies were added at various concentrations, and the cultures were incubated for 5 days.

[0283] Supernatants were saved for ELISA screening (e.g., IL2 and IFNγ). For FACS analysis, cells were stained with CD4-FITC, PD1-PE, LAG3-BV421, TIM3-APC Cy7.

[0284] MLR Pembro vs. P4-B3mut+3 IgG4. Two T cell donors and two DC donors were used. Graph titles in Figures 59 and 60 indicate the cytokine measured, T cell donor, and DC donor. IL2 T2 DCV raw corresponds to the IL2 assay, T cell donor 2, DC donor V.

[0285] The P4-B3mut+3 antibody in sIgG4 format was tested against the commercially available formulations of pembrolizumab and F10-sIgG4 (negative control). As shown in Figures 59 and 60, the addition of either P4-B3mut+3 or pembrolizumab significantly increases cytokine production compared to F10.

[0286] MLR PD-1 / IL12 fusion. One T cell donor and two DC donors were used. Graph titles in Figures 65 and 66 indicate the cytokine measured, T cell donor, scIL12 construct, and DC donor. T2 DCV HC IL2 data corresponds to the IL2 assay, T cell donor 2, DC donor V, and scIL12 HC fusion pair.

[0287] The P4-B3mut+3 antibody in the LALA format, with or without scIL12 fusion to either the heavy or light chain, was tested against F10 in the same format. As shown in Figures 59 and 60, the addition of either P4-B3mut+3 resulted in increased cytokine production compared to F10. The addition of the scIL12 fusion significantly increased IFN-γ but not IL2. The effects of the heavy and light chain fusions were similar. The PD-1 / IL12 fusions described herein activated T cells and increased expression of IFNγ but not IL2.

[0288] Example 13 - Masked IL-12 constructs Two "masked" PD-1 / IL12 constructs are shown in Figures 67 and 68. Figure 67 shows an intact MMP9 cleavage site for the protease MMP9 between the P35 and P40 subunits of IL-12. The other construct in Figure 68 shows a mutated protease cleavage site between the P35 and P40 subunits of IL-12.

[0289] Proteases are proteins that cleave proteins, in some cases in a sequence-specific manner. Examples of proteases include, but are not limited to, serine proteases, cysteine proteases, aspartic acid proteases, threonine proteases, glutamic acid proteases, metalloproteases, aspartic peptide lyases, serum proteases, cathepsin, cathepsin B, cathepsin C, cathepsin D, cathepsin E, cathepsin K, cathepsin L, kallikrein, hK1, hK10, hK15, plasmin, collagenase, type IV collagenase, stromelysin, factor Xa, chymotrypsin-like proteases, trypsin-like proteases, elastase-like proteases, subtilisin-like proteases, actinidain, bromelain, calpain, caspase, caspase-3, Mi These include rl-CP, papain, HIV-1 protease, HSV protease, CMV protease, chymosin, renin, pepsin, matriptase, legumain, plasmepsin, nepenthesin, metalloexopeptidases, metalloendopeptidases, matrix metalloproteinases (MMPs), MMP1, MMP2, MMP3, MMP8, MMP9, MMP13, MMP11, MMP14, urokinase plasminogen activator (uPA), enterokinase, prostate-specific antigen (PSA, hK3), interleukin-1β converting enzyme, thrombin, FAP (FAP-α), dipeptidyl peptidase, and dipeptidyl peptidase IV (DPPIV / CD26). A "protease cleavage site" can refer to an amino acid sequence that can be cleaved by a protease, such as, for example, a matrix metalloproteinase (MMP) or furin. Non-limiting examples of linkers and protease cleavage sites known to those of skill in the art that can be used to construct the anti-PD-1-IL-12 fusions described herein are described in U.S. Patent No. 9,708,412, U.S. Patent Application Publication Nos. 2018 / 0134789 and 2020 / 0148771, and PCT Publication No. WO 2019 / 051122 (each of which is incorporated by reference in its entirety). In some embodiments, the protease cleavage site is recognized by a protease disclosed in Table X herein.

[0290] Table X: Proteases and protease cleavage sites TIFF2025121997000045.tif220150TIFF2025121997000046.tif229150

[0291] For example, the anti-PD-1-IL-12 fusions described herein comprise at least one protease cleavage site comprising an amino acid sequence that is cleaved by at least one protease. In some embodiments, the anti-PD-1-IL-12 fusions described herein comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more protease cleavage sites that are cleaved by at least one protease. Non-limiting examples of such cleavage sites include (GPLGIAGQ) or (AVRWLLTA), which may be cleaved by metalloproteinases, and (RRRRRR), which may be cleaved by furin. In therapeutic applications, the protease cleavage site can be cleaved by a protease produced by a target cell, such as a cancer cell or an infected cell, or a pathogen. In some embodiments described herein, the linker may comprise a protease cleavage site. Such linkers containing a protease cleavage site are, in certain embodiments, susceptible to proteases (such as MMPs, furin, cathepsin B, etc.) present in particular tissues or intracellular compartments. Exemplary sequences of such protease-cleavable linkers include, but are not limited to, (PLGLWA)n, (RVLAEA)n(EDVVCCSMSY)n, (GGIEGRGS)n, where n is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, which are recognized by MMP-1, and (GFLG)n, where n is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, which are recognized by furin. In some embodiments, the linker containing a protease cleavage site plays a role in masking / unmasking (e.g., activating) the IL-12 targeting domain binding protein. In some embodiments, the binding protein can be other cytokines, such as those described herein.In some embodiments, the inducible target binding protein is 100 kD or less, 75 kD or less, 50 kD or less, 25 kD or less, 20 kD or less, 15 kD or less, 10 kD or less, or 5 kD or less upon activation by protease cleavage. Prior to cleavage and activation, the target binding protein is in certain embodiments 100 kD or less, 75 kD or less, 50 kD or less, 25 kD or less, 20 kD or less, 15 kD or less, 10 kD or less, or 5 kD or less.

[0292] The protease cleavage sites described herein are polypeptides having a sequence that is recognized and cleaved in a sequence-specific manner. The anti-PD-1-IL-12 fusions described herein can comprise a protease cleavage site that is sequence-specifically recognized by a matrix metalloprotease (MMP), such as MMP9. In some embodiments, the protease cleavage site recognized by MMP9 comprises a polypeptide having the amino acid sequence PR(S / T)(L / I)(S / T). In some embodiments, the protease cleavage site recognized by MMP9 comprises a polypeptide having the amino acid sequence LEATA. In some embodiments, the protease cleavage site is sequence-specifically recognized by MMP11. In some embodiments, the protease cleavage site recognized by MMP11 comprises a polypeptide having the amino acid sequence GGAANLVRGG.

[0293] For example, the MMP9 / mutation site forms a 7-amino acid pseudo-linker, compared to the 15 amino acids originally present in the G4S repeat linker. Without being bound by theory, shortening the linker prevents IL-12 from folding into a dimeric form, thus significantly reducing activity. In one embodiment, the MMP9 / mutation site forms a 6-amino acid pseudo-linker. In one embodiment, the MMP9 / mutation site forms a 5-amino acid pseudo-linker. In one embodiment, the MMP9 / mutation site forms a 4-amino acid pseudo-linker. In one embodiment, the MMP9 / mutation site forms a 3-amino acid pseudo-linker. In one embodiment, the MMP9 / mutation site forms a 2-amino acid pseudo-linker. In some embodiments, the pseudo-linker site can be formed according to techniques routinely used by those skilled in the art, resulting in pseudo-linkers of 14, 13, 12, 11, 10, 9, or 8 amino acids in length (see Eckhard et al. (2016) Matrix Biology, 49:37-60, incorporated by reference in its entirety). For example, upon reaching the tumor site, a localized protease can cleave the linker, releasing the P35 subunit to form a heterodimer. Without being bound by theory, a 7aa linker is short enough to inhibit folding, and once the second monomer is released, the subunits can assemble properly.

[0294] In some embodiments, MMP9 is selected because the cleavage sequence and recombinant protease are readily available to those skilled in the art. In other embodiments, cleavage sites can be optimized / selected for various cancer indications (see, e.g., Al-Alem L, Curry TE Jr. Ovarian cancer: involvement of the matrix metalloproteinases. Reproduction. 2015; 150(2):R55-R64; Wang, S., Jia, J., Liu, D. et al. Matrix Metalloproteinase Expressions Play Important role in Prediction of Ovarian Cancer Outcome. Sci Rep 9, 11677(2019); Ren F, Tang R, Zhang X, et al. Overexpression of MMP Family Members Functions as Prognostic Biomarker for Breast Cancer Patients: A Systematic Review and Meta-Analysis. PLoS One. 2015; 10(8):e0135544, each of which is incorporated by reference in its entirety). For example, if an ovarian cancer overexpresses MMP2 but not MMP9, the linker / cleavage sequence would be altered accordingly.

[0295] equivalent Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, numerous equivalents to the specific substances and procedures specifically described herein which equivalents are considered to be within the scope of this invention and covered by the appended claims.

[0296] Sequence information SEQUENCE LISTING <110> DANA-FARBER CANCER INSTITUTE, INC. <120> ANTIBODIES AGAINST PD-1 AND METHODS OF USE THEREOF <150> US 62 / 884,473 <151> 2019-08-08 <150> US 62 / 861,638 <151> 2019-06-14 <160> 225 <170> PatentIn version 3.5 <210> 1 <211> 122 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 1 Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr 20 25 30 Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Gly Ile Ser Trp Asn Ser Gly Ser Ile Gly Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Val Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ser Asp Tyr Gly Asp Lys Tyr Tyr Tyr Tyr Gly Met Asp Val Trp 100 105 110 Gly Lys Gly Thr Thr Val Thr Val Ser Ser 115 120 <210> 2 <211> 111 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 2 Gln Pro Gly Leu Thr Gln Pro Pro Ser Ala Ser Gly Thr Pro Gly Gln 1 5 10 15 Arg Val Thr Ile Ser Cys Ser Gly Ser Ser Ser Asn Ile Gly Ser Asn 20 25 30 Thr Val Asn Trp Tyr Gln Gln Phe Pro Gly Lys Ala Pro Lys Leu Leu 35 40 45 Ile Phe Asn Asp Asn Gln Arg Pro Ser Gly Val Pro Asp Arg Phe Ser 50 55 60 Ala Ser Lys Ser Gly Thr Ser Ala Ser Leu Ala Ile Ser Gly Leu Gln 65 70 75 80 Ser Glu Asp Glu Ala Asp Tyr Tyr Cys Ala Ala Trp Asp Gly Gly Leu 85 90 95 Asn Gly Arg Gly Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 110 <210> 3 <211> 122 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 3 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Glu 1 5 10 15 Ser Leu Lys Ile Ser Cys Lys Asp Ser Gly Tyr Thr Phe Thr Thr Tyr 20 25 30 Trp Ile Gly Trp Val Arg Gln Leu Pro Gly Lys Gly Leu Glu Leu Met 35 40 45 Gly Ile Ile Tyr Pro Asp Asp Ser Asp Thr Thr Tyr Ser Pro Ser Phe 50 55 60 Gln Gly His Val Thr Ile Ser Ala Asp Lys Ser Ile Asn Thr Ala Tyr 65 70 75 80 Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp Thr Ala Met Tyr Tyr Cys 85 90 95 Ala Phe Trp Gly Ala Ser Gly Ala Pro Val Asn Gly Phe Asp Ile Trp 100 105 110 Gly Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 4 <211> 112 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 4 Leu Pro Val Leu Thr Gln Pro Pro Ser Ala Ser Gly Thr Pro Gly Gln 1 5 10 15 Arg Val Thr Ile Ser Cys Thr Gly Ser Ser Ser Asn Ile Gly Ala Gly 20 25 30 Tyr Val Val His Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu 35 40 45 Leu Ile Tyr Ser Asn Asn Gln Arg Pro Ser Gly Val Pro Asp Arg Phe 50 55 60 Ser Gly Ser Lys Ser Gly Thr Ser Ala Ser Leu Ala Ile Ser Gly Leu 65 70 75 80 Gln Ser Glu Asp Glu Ala Asp Tyr Tyr Cys Ala Ala Trp Asp Asp Ser 85 90 95 Leu Asn Ala Pro Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Leu 100 105 110 <210> 5 <211> 125 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 5 Gln Val Gln Leu Gln Gln Ser Gly Pro Gly Leu Val Arg Pro Ser Ala 1 5 10 15 Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Asp Ser Val Ser Ser Asp 20 25 30 Asn Tyr Phe Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Pro Leu Glu 35 40 45 Trp Ile Gly Tyr Val Tyr Tyr Asn Gly Asn Thr Asn Tyr Asn Pro Ser 50 55 60 Phe Asn Ser Arg Val Thr Met Ser Leu Asp Thr Ser Lys Asn Gln Phe 65 70 75 80 Ser Leu Lys Leu Arg Ser Val Thr Ala Ala Asp Thr Ala Phe Tyr Tyr 85 90 95 Cys Ala Thr Glu Thr Pro Pro Thr Ser Tyr Phe Asn Ser Gly Pro Phe 100 105 110 Asp Ser Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 125 <210> 6 <211> 110 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 6 Gln Pro Gly Leu Thr Gln Pro Pro Ser Val Ser Lys Gly Leu Arg Gln 1 5 10 15 Thr Ala Thr Leu Thr Cys Thr Gly Ser Ser Asn Asn Val Gly Ala His 20 25 30 Gly Ala Ala Trp Leu Gln Gln His Gln Gly His Pro Pro Lys Leu Leu 35 40 45 Ala Tyr Arg Asn Asn Asn Arg Pro Ser Gly Ile Ser Glu Arg Phe Ser 50 55 60 Ala Ser Arg Ser Gly Asn Thr Ala Ser Leu Thr Ile Ile Gly Leu Gln 65 70 75 80 Pro Glu Asp Glu Gly Asp Tyr Tyr Cys Ser Ser Trp Asp Ser Ser Leu 85 90 95 Ser Gly Tyr Val Phe Gly Pro Gly Thr Lys Val Thr Val Leu 100 105 110 <210> 7 <211> 118 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 7 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser 1 5 10 15 Ser Val Lys Val Ser Cys Lys Thr Ser Gly Tyr Thr Phe Asn Arg Phe 20 25 30 Gly Leu Thr Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45 Gly Trp Thr Asn Pro Tyr Asn Gly Asn Thr Arg Tyr Ala Gln Lys Phe 50 55 60 Gln Gly Arg Val Thr Met Thr Thr Asp Thr Ser Thr Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Arg Ser Leu Arg Ser Asp Asp Thr Ala Met Tyr Phe Cys 85 90 95 Ala Arg Val Val Ala Val Asn Gly Met Asp Val Trp Gly Gln Gly Thr 100 105 110 Thr Val Thr Val Ser Ser 115 <210> 8 <211> 111 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 8 Asn Phe Met Leu Thr Gln Pro His Ser Val Ser Glu Ser Pro Gly Lys 1 5 10 15 Thr Val Thr Ile Ser Cys Thr Arg Asn Ser Gly Ser Ile Ala Ala Tyr 20 25 30 Tyr Val Gln Trp Tyr Gln Gln Arg Pro Gly Ser Ser Pro Thr Thr Val 35 40 45 Ile Tyr Glu Asp Asn Gln Arg Pro Ser Gly Val Pro Asp Arg Phe Ser 50 55 60 Gly Ser Ile Asp Ser Ser Ser Asn Ser Ala Ser Leu Thr Ile Ser Gly 65 70 75 80 Leu Lys Thr Glu Asp Glu Ala Asp Tyr Tyr Cys Gln Ser Tyr Asp Ser 85 90 95 Ser Asn Leu Trp Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 110 <210> 9 <211> 117 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 9 Glu Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ser Gln Thr Val Ala Gly Ser Asp Tyr Trp Gly Gln Gly Thr Leu 100 105 110 Val Thr Val Ser Ser 115 <210> 10 <211> 108 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 10 Gln Pro Gly Leu Thr Gln Pro Pro Ser Val Pro Val Ala Pro Gly Gln 1 5 10 15 Thr Ala Arg Ile Thr Cys Gly Gly Asn Asn Ile Gly Ser Lys Ser Val 20 25 30 His Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val Leu Val Val Tyr 35 40 45 Asp Asp Ser Asp Arg Pro Ser Gly Ile Pro Glu Arg Phe Ser Gly Ser 50 55 60 Asn Ser Gly Asn Thr Ala Thr Leu Thr Ile Ser Arg Val Glu Ala Gly 65 70 75 80 Asp Glu Ala Asp Tyr Tyr Cys Gln Val Trp His Ser Val Ser Asp Gln 85 90 95 Gly Val Phe Gly Thr Gly Thr Lys Val Thr Val Leu 100 105 <210> 11 <211> 111 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 11 Gln Pro Gly Leu Thr Gln Pro Pro Ser Ala Ser Gly Thr Pro Gly Gln 1 5 10 15 Arg Val Thr Ile Ser Cys Ser Gly Ser Ser Ser Asn Ile Gly Ser Asn 20 25 30 Thr Val Asn Trp Tyr Gln Gln Phe Pro Gly Lys Ala Pro Lys Leu Leu 35 40 45 Ile Phe Asp Asp Asn Gln Arg Pro Ser Gly Val Pro Asp Arg Phe Ser 50 55 60 Ala Ser Lys Ser Gly Thr Ser Ala Ser Leu Ala Ile Ser Gly Leu Gln 65 70 75 80 Ser Glu Asp Glu Ala Asp Tyr Tyr Cys Ala Ala Trp Asp Gly Gly Leu 85 90 95 Asn Gly Arg Gly Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 110 <210> 12 <211> 122 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 12 Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr 20 25 30 Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Gly Ile Ser Trp Asn Ser Gly Ser Ile Gly Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Val Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ser Asp Tyr Gly Asp Lys Tyr Ser Tyr Tyr Gly Met Asp Val Trp 100 105 110 Gly Lys Gly Thr Thr Val Thr Val Ser Ser 115 120 <210> 13 <211> 122 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 13 Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Phe 20 25 30 Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Gly Ile Ser Trp Asn Ser Gly Ser Ile Gly Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Val Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ser Asp Tyr Gly Asp Lys Tyr Tyr Tyr Tyr Gly Met Asp Val Trp 100 105 110 Gly Lys Gly Thr Thr Val Thr Val Ser Ser 115 120 <210> 14 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 14 Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 1 5 10 <210> 15 <211> 122 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 15 Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Phe 20 25 30 Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Gly Ile Ser Trp Asn Ser Gly Ser Ile Gly Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Val Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ser Asp Tyr Gly Asp Lys Tyr Ser Tyr Tyr Gly Met Asp Val Trp 100 105 110 Gly Lys Gly Thr Thr Val Thr Val Ser Ser 115 120 <210> 16 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 16 Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser 20 25 <210> 17 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 17 Gly Phe Thr Phe Asp Asp Tyr Ala 1 5 <210> 18 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 18 Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser 1 5 10 15 Gly <210> 19 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 19 Ile Ser Trp Asn Ser Gly Ser Ile 1 5 <210> 20 <211> 38 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 20 Gly Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Val Ser Arg Asp Asn 1 5 10 15 Ala Lys Asn Ser Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp 20 25 30 Thr Ala Val Tyr Tyr Cys 35 <210> 21 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 21 Ala Ser Asp Tyr Gly Asp Lys Tyr Tyr Tyr Tyr Gly Met Asp Val 1 5 10 15 <210> 22 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 22 Trp Gly Lys Gly Thr Thr Val Thr Val Ser Ser 1 5 10 <210> 23 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 23 Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser 1 5 10 <210> 24 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 24 Ser Ser Asn Ile Gly Ser Asn Thr 1 5 <210> 25 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 25 Gln Pro Gly Leu Thr Gln Pro Pro Ser Ala Ser Gly Thr Pro Gly Gln 1 5 10 15 Arg Val Thr Ile Ser Cys Ser Gly Ser 20 25 <210> 26 <211> 3 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 26 Asn Asp Asn 1 <210> 27 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 27 Val Asn Trp Tyr Gln Gln Phe Pro Gly Lys Ala Pro Lys Leu Leu Ile 1 5 10 15 Phe <210> 28 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 28 Ala Ala Trp Asp Gly Gly Leu Asn Gly Arg Gly Val 1 5 10 <210> 29 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 29 Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 1 5 10 <210> 30 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 30 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Glu 1 5 10 15 Ser Leu Lys Ile Ser Cys Lys Asp Ser 20 25 <210> 31 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 31 Gly Tyr Thr Phe Thr Thr Tyr Trp 1 5 <210> 32 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 32 Ile Gly Trp Val Arg Gln Leu Pro Gly Lys Gly Leu Glu Leu Met Gly 1 5 10 15 Ile <210> 33 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 33 Ile Tyr Pro Asp Asp Ser Asp Thr 1 5 <210> 34 <211> 38 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 34 Thr Tyr Ser Pro Ser Phe Gln Gly His Val Thr Ile Ser Ala Asp Lys 1 5 10 15 Ser Ile Asn Thr Ala Tyr Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp 20 25 30 Thr Ala Met Tyr Tyr Cys 35 <210> 35 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 35 Ala Phe Trp Gly Ala Ser Gly Ala Pro Val Asn Gly Phe Asp Ile 1 5 10 15 <210> 36 <211> 35 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 36 Leu Pro Val Leu Thr Gln Pro Pro Ser Ala Ser Gly Thr Pro Gly Gln 1 5 10 15 Arg Val Thr Ile Ser Cys Thr Gly Ser Phe Gly Gly Gly Thr Lys Leu 20 25 30 Thr Val Leu 35 <210> 37 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 37 Ser Ser Asn Ile Gly Ala Gly Tyr Val 1 5 <210> 38 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 38 Val His Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu Leu Ile 1 5 10 15 Tyr <210> 39 <211> 3 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 39 Ser Asn Asn 1 <210> 40 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 40 Gln Arg Pro Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Lys Ser Gly 1 5 10 15 Thr Ser Ala Ser Leu Ala Ile Ser Gly Leu Gln Ser Glu Asp Glu Ala 20 25 30 Asp Tyr Tyr Cys 35 <210> 41 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 41 Ala Ala Trp Asp Asp Ser Leu Asn Ala Pro Val 1 5 10 <210> 42 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 42 Gln Val Gln Leu Gln Gln Ser Gly Pro Gly Leu Val Arg Pro Ser Ala 1 5 10 15 Thr Leu Ser Leu Thr Cys Thr Val Ser 20 25 <210> 43 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 43 Gly Asp Ser Val Ser Ser Asp Asn Tyr Phe 1 5 10 <210> 44 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 44 Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Pro Leu Glu Trp Ile Gly 1 5 10 15 Tyr <210> 45 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 45 Val Tyr Tyr Asn Gly Asn Thr 1 5 <210> 46 <211> 38 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 46 Asn Tyr Asn Pro Ser Phe Asn Ser Arg Val Thr Met Ser Leu Asp Thr 1 5 10 15 Ser Lys Asn Gln Phe Ser Leu Lys Leu Arg Ser Val Thr Ala Ala Asp 20 25 30 Thr Ala Phe Tyr Tyr Cys 35 <210> 47 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 47 Ala Thr Glu Thr Pro Pro Thr Ser Tyr Phe Asn Ser Gly Pro Phe Asp 1 5 10 15 Ser <210> 48 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 48 Gln Pro Gly Leu Thr Gln Pro Pro Ser Val Ser Lys Gly Leu Arg Gln 1 5 10 15 Thr Ala Thr Leu Thr Cys Thr Gly Ser 20 25 <210> 49 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 49 Ser Asn Asn Val Gly Ala His Gly 1 5 <210> 50 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 50 Ala Ala Trp Leu Gln Gln His Gln Gly His Pro Pro Lys Leu Leu Ala 1 5 10 15 Tyr <210> 51 <211> 3 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 51 Arg Asn Asn 1 <210> 52 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 52 Asn Arg Pro Ser Gly Ile Ser Glu Arg Phe Ser Ala Ser Arg Ser Gly 1 5 10 15 Asn Thr Ala Ser Leu Thr Ile Ile Gly Leu Gln Pro Glu Asp Glu Gly 20 25 30 Asp Tyr Tyr Cys 35 <210> 53 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 53 Ser Ser Trp Asp Ser Ser Leu Ser Gly Tyr Val 1 5 10 <210> 54 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 54 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser 1 5 10 15 Ser Val Lys Val Ser Cys Lys Thr Ser 20 25 <210> 55 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 55 Gly Tyr Thr Phe Asn Arg Phe Gly 1 5 <210> 56 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 56 Leu Thr Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met Gly 1 5 10 15 Trp <210> 57 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 57 Thr Asn Pro Tyr Asn Gly Asn Thr 1 5 <210> 58 <211> 38 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 58 Arg Tyr Ala Gln Lys Phe Gln Gly Arg Val Thr Met Thr Thr Asp Thr 1 5 10 15 Ser Thr Ser Thr Ala Tyr Met Glu Leu Arg Ser Leu Arg Ser Asp Asp 20 25 30 Thr Ala Met Tyr Phe Cys 35 <210> 59 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 59 Ala Arg Val Val Ala Val Asn Gly Met Asp Val 1 5 10 <210> 60 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 60 Asn Phe Met Leu Thr Gln Pro His Ser Val Ser Glu Ser Pro Gly Lys 1 5 10 15 Thr Val Thr Ile Ser Cys Thr Arg Asn 20 25 <210> 61 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 61 Ser Gly Ser Ile Ala Ala Tyr Tyr 1 5 <210> 62 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 62 Val Gln Trp Tyr Gln Gln Arg Pro Gly Ser Ser Pro Thr Thr Val Ile 1 5 10 15 Tyr <210> 63 <211> 3 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 63 Glu Asp Asn 1 <210> 64 <211> 38 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 64 Gln Arg Pro Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Ile Asp Ser 1 5 10 15 Ser Ser Asn Ser Ala Ser Leu Thr Ile Ser Gly Leu Lys Thr Glu Asp 20 25 30 Glu Ala Asp Tyr Tyr Cys 35 <210> 65 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 65 Gln Ser Tyr Asp Ser Ser Asn Leu Trp Val 1 5 10 <210> 66 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 66 Glu Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser 20 25 <210> 67 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 67 Gly Phe Thr Phe Ser Ser Tyr Ala 1 5 <210> 68 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 68 Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ala 1 5 10 15 Val <210> 69 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 69 Ile Ser Tyr Asp Gly Ser Asn Lys 1 5 <210> 70 <211> 38 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 70 Tyr Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn 1 5 10 15 Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp 20 25 30 Thr Ala Val Tyr Tyr Cys 35 <210> 71 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 71 Ala Ser Gln Thr Val Ala Gly Ser Asp Tyr 1 5 10 <210> 72 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 72 Gln Pro Gly Leu Thr Gln Pro Pro Ser Val Pro Val Ala Pro Gly Gln 1 5 10 15 Thr Ala Arg Ile Thr Cys Gly Gly Asn 20 25 <210> 73 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 73 Asn Ile Gly Ser Lys Ser 1 5 <210> 74 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 74 Val His Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val Leu Val Val 1 5 10 15 Tyr <210> 75 <211> 3 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 75 Asp Asp Ser 1 <210> 76 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 76 Asp Arg Pro Ser Gly Ile Pro Glu Arg Phe Ser Gly Ser Asn Ser Gly 1 5 10 15 Asn Thr Ala Thr Leu Thr Ile Ser Arg Val Glu Ala Gly Asp Glu Ala 20 25 30 Asp Tyr Tyr Cys 35 <210> 77 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 77 Gln Val Trp His Ser Val Ser Asp Gln Gly Val 1 5 10 <210> 78 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 78 Gly Phe Thr Phe Asp Asp Phe Ala 1 5 <210> 79 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 79 Ala Ser Asp Tyr Gly Asp Lys Tyr Ser Tyr Tyr Gly Met Asp Val 1 5 10 15 <210> 80 <211> 3 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 80 Asp Asp Asn 1 <210> 81 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <220> <221> MOD_RES <222> (2)..(2) <223> Any amino acid <220> <221> MOD_RES <222> (5)..(6) <223> Any amino acid <220> <221> MOD_RES <222> (8)..(8) <223> Any amino acid <400> 81 Gly Xaa Thr Phe Xaa Xaa Tyr Xaa 1 5 <210> 82 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <220> <221> MOD_RES <222> (2)..(2) <223> Any amino acid <220> <221> MOD_RES <222> (5)..(7) <223> Any amino acid <400> 82 Gly Xaa Thr Phe Xaa Xaa Xaa Ala 1 5 <210> 83 <211> 3 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <220> <221> MOD_RES <222> (1)..(1) <223> Any amino acid <400> 83 Xaa Asp Asn 1 <210> 84 <211> 3 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <220> <221> MOD_RES <222> (1)..(1) <223> Any amino acid <400> 84 Xaa Asn Asn 1 <210> 85 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 85 Gln Arg Pro Ser Gly Val Pro Asp Arg Phe Ser Ala Ser Lys Ser Gly 1 5 10 15 Thr Ser Ala Ser Leu Ala Ile Ser Gly Leu Gln Ser Glu Asp Glu Ala 20 25 30 Asp Tyr Tyr Cys 35 <210> 86 <211> 333 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 86 cagcctgggc tgactcagcc accctcagcg tctgggaccc ccgggcagag ggtcaccatc 60 tcttgttctg gaagcagctc caacatcgga agtaatactg tcaactggta tcagcaattc 120 cccggaaagg cccccaaact cctcatcttt gatgataatc agcggccctc aggggtccct 180 gaccgcttct ctgcttccaa gtctggcacc tcagcctccc tggccattag tggcctccag 240 tctgaggatg aggctgacta ttactgtgcg gcatgggatg gcggtctgaa tggtcgaggg 300 gtgttcggcg gagggaccaa actgaccgtc cta 333 <210> 87 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 87 Gly Gly Gly Gly Ser 1 5 <210> 88 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 88 Gly Pro Leu Gly Val Arg Gly 1 5 <210> 89 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 89 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly 1 5 10 15 Gly Gly Gly Ser Gly Gly Gly Gly Ser 20 25 <210> 90 <211> 288 <212> PRT <213> Homo sapiens <400> 90 Met Gln Ile Pro Gln Ala Pro Trp Pro Val Val Trp Ala Val Leu Gln 1 5 10 15 Leu Gly Trp Arg Pro Gly Trp Phe Leu Asp Ser Pro Asp Arg Pro Trp 20 25 30 Asn Pro Pro Thr Phe Ser Pro Ala Leu Leu Val Val Thr Glu Gly Asp 35 40 45 Asn Ala Thr Phe Thr Cys Ser Phe Ser Asn Thr Ser Glu Ser Phe Val 50 55 60 Leu Asn Trp Tyr Arg Met Ser Pro Ser Asn Gln Thr Asp Lys Leu Ala 65 70 75 80 Ala Phe Pro Glu Asp Arg Ser Gln Pro Gly Gln Asp Cys Arg Phe Arg 85 90 95 Val Thr Gln Leu Pro Asn Gly Arg Asp Phe His Met Ser Val Val Arg 100 105 110 Ala Arg Arg Asn Asp Ser Gly Thr Tyr Leu Cys Gly Ala Ile Ser Leu 115 120 125 Ala Pro Lys Ala Gln Ile Lys Glu Ser Leu Arg Ala Glu Leu Arg Val 130 135 140 Thr Glu Arg Arg Ala Glu Val Pro Thr Ala His Pro Ser Pro Ser Pro 145 150 155 160 Arg Pro Ala Gly Gln Phe Gln Thr Leu Val Val Gly Val Val Gly Gly 165 170 175 Leu Leu Gly Ser Leu Val Leu Leu Val Trp Val Leu Ala Val Ile Cys 180 185 190 Ser Arg Ala Ala Arg Gly Thr Ile Gly Ala Arg Arg Thr Gly Gln Pro 195 200 205 Leu Lys Glu Asp Pro Ser Ala Val Pro Val Phe Ser Val Asp Tyr Gly 210 215 220 Glu Leu Asp Phe Gln Trp Arg Glu Lys Thr Pro Glu Pro Pro Val Pro 225 230 235 240 Cys Val Pro Glu Gln Thr Glu Tyr Ala Thr Ile Val Phe Pro Ser Gly 245 250 255 Met Gly Thr Ser Ser Pro Ala Arg Arg Gly Ser Ala Asp Gly Pro Arg 260 265 270 Ser Ala Gln Pro Leu Arg Pro Glu Asp Gly His Cys Ser Trp Pro Leu 275 280 285 <210> 91 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 91 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 1 5 10 <210> 92 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 92 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 1 5 10 15 <210> 93 <211> 20 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 93 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly 1 5 10 15 Gly Gly Gly Ser 20 <210> 94 <211> 366 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 94 caggtgcagc tggtgcagtc tgggggaggc ttggtacagc ctggcaggtc cctgagactc 60 tcctgtgcag cctctggatt cacctttgat gattatgcca tgcactgggt ccggcaagct 120 ccagggaagg gcctggagtg ggtctcaggt attagttgga atagtggtag cataggctat 180 gcggactctg tgaagggccg attcaccgtc tccagagaca acgccaagaa ctcactgtat 240 ctgcaaatga acagcctgag agccgaggac acggctgtgt attactgtgc gagtgactac 300 ggtgacaaat actactacta cggtatggac gtctggggca aagggaccac ggtcaccgtc 360 tcctca 366 <210> 95 <211> 333 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 95 cagcctgggc tgactcagcc accctcagcg tctgggaccc ccgggcagag ggtcaccatc 60 tcttgttctg gaagcagctc caacatcgga agtaatactg tcaactggta tcagcaattc 120 cccggaaagg cccccaaact cctcatcttt aatgataatc agcggccctc aggggtccct 180 gaccgcttct ctgcttccaa gtctggcacc tcagcctccc tggccattag tggcctccag 240 tctgaggatg aggctgacta ttactgtgcg gcatgggatg gcggtctgaa tggtcgaggg 300 gtgttcggcg gagggaccaa actgaccgtc cta 333 <210> 96 <211> 366 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 96 caggtgcagc tggtgcagtc tggagcagag gtgaagaagc ccggggagtc tctgaagatc 60 tcctgtaagg attctggata cacctttacc acctactgga tcggctgggt gcgccagctg 120 cccgggaaag gcctggagtt gatggggatc atctatcctg atgactctga taccacatac 180 agcccgtcct tccaaggcca tgtcaccatc tcagccgaca agtccatcaa caccgcctac 240 ctgcagtgga gcagcctgaa ggcctcggac accgccatgt attactgtgc gttttggggt 300 gcgagtggag cgccagtgaa tggttttgat atctggggcc aaggcaccct ggtcaccgtc 360 tcctca 366 <210> 97 <211> 333 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 97 ctgcctgtgc tgactcagcc accctcagcg tctgggaccc ccgggcagag ggtcaccatc 60 tcctgcactg ggagcagctc caacatcggg gcaggttatg ttgtacactg gtaccagcag 120 ctcccaggaa cggcccccaa actcctcatc tatagtaata atcagcggcc ctcaggggtc 180 cctgaccgat tctctggctc caagtctggc acctcagcct ccctggccat cagtgggctc 240 cagtctgagg atgaggctga ttattactgt gcagcatggg atgacagcct gaatgctccg 300 gtgttcggcg gagggaccaa gctgaccgtc cta 333 <210> 98 <211> 375 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 98 caggtacagc tgcagcagtc aggcccagga ctggtgaggc cttcggcgac cctgtccctc 60 acctgcactg tctctggtga ctccgtcagc agtgataatt acttctggag ttggattcgg 120 cagcccccag ggaagccact ggagtggatt ggctatgtct attacaatgg gaacaccaac 180 tacaacccct ccttcaacag tcgagtcacc atgtcacttg acacgtccaa gaaccagttc 240 tccttgaagc tgaggtctgt gaccgccgcg gacacggcct tttattactg tgcgacagag 300 acgcccccaa ccagctattt taatagtgga ccctttgact cctggggcca gggcaccctg 360 gtcaccgtct cctcg 375 <210> 99 <211> 330 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 99 cagcctgggc tgactcagcc accctcggtg tccaagggct tgagacagac cgccacactc 60 acctgcactg ggagcagcaa caatgtaggc gcccacggag cagcttggct gcagcagcac 120 cagggccacc ctcccaaact ccttgcctac aggaataaca accggccctc agggatctca 180 gagagattct ctgcatccag gtcaggaaac acagcctccc tgaccattat tggactccag 240 cctgaggacg agggtgacta ttactgctca tcatgggaca gcagcctcag tggttatgtc 300 ttcggacctg ggaccaaagt caccgtccta 330 <210> 100 <211> 354 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 100 caggtgcagc tggtgcagtc tggggctgag gtgaagaagc ctgggtcctc agtgaaggtc 60 tcctgcaaga cttctggcta cacctttaac aggtttggtc tcacctgggt gcgacaggcc 120 cctggacaag ggcttgagtg gatgggatgg accaaccctt acaatggtaa cacaaggtat 180 gcacagaagt tccagggcag agtcaccatg accacagaca catccacgag cacagcctac 240 atggagctga ggagcctgag atctgacgac acggccatgt atttctgtgc gagagtcgta 300 gccgtaaacg gtatggacgt ctggggccaa gggaccacgg tcaccgtctc ctca 354 <210> 101 <211> 333 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 101 aattttatgc tgactcagcc ccactctgtg tcggagtctc cggggaagac ggttaccatc 60 tcctgcaccc gcaacagtgg cagcattgcc gcctactatg tgcagtggta ccagcagcgc 120 ccgggcagtt cccccaccac tgtgatctat gaagataacc aaagaccctc tggggtccct 180 gatcggttct ctggctccat cgacagctcc tccaactctg cctccctcac catctctgga 240 ctgaagactg aggacgaggc tgactactac tgtcagtctt atgatagcag caatctttgg 300 gtgttcggcg gagggaccaa gctgaccgtc cta 333 <210> 102 <211> 351 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 102 gaggtgcagc tggtgcagtc tgggggaggc gtggtccagc ctgggaggtc cctgagactc 60 tcctgtgcag cctctggatt caccttcagt agctatgcta tgcactgggt ccgccaggct 120 ccaggcaagg ggctggagtg ggtggcagtt atatcatatg atggaagcaa taaatactac 180 gcagactccg tgaagggccg attcaccatc tccagagaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgag agctgaggac acggctgtgt attactgtgc gagccaaaca 300 gtggctggaa gtgactactg gggccagggc accctggtca ccgtctcctc a 351 <210> 103 <211> 324 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 103 cagcctgggc tgactcagcc accctcggtg ccagtggccc caggacagac ggccaggatt 60 acctgtgggg gaaacaacat tggaagtaaa agtgtgcact ggtaccagca gaagccaggc 120 caggcccctg tgctggtcgt ctatgatgat agcgaccggc cctcagggat ccctgagcga 180 ttctctggct ccaactctgg gaacacggcc accctgacca tcagcagggt cgaagccggg 240 gatgaggccg actattactg tcaggtgtgg catagtgtta gtgatcaagg ggtcttcgga 300 actgggacca aagtcaccgt ccta 324 <210> 104 <211> 366 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 104 caggtgcagc tggtgcagtc tgggggaggc ttggtacagc ctggcaggtc cctgagactc 60 tcctgtgcag cctctggatt cacctttgat gattttgcca tgcactgggt ccggcaagct 120 ccagggaagg gcctggagtg ggtctcaggt attagttgga atagtggtag cataggctat 180 gcggactctg tgaagggccg attcaccgtc tccagagaca acgccaagaa ctcactgtat 240 ctgcaaatga acagcctgag agccgaggac acggctgtgt attactgtgc gagtgactac 300 ggtgacaaat actactacta cggtatggac gtctggggca aagggaccac ggtcaccgtc 360 tcctca 366 <210> 105 <211> 333 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 105 cagcctgggc tgactcagcc accctcagcg tctgggaccc ccgggcagag ggtcaccatc 60 tcttgttctg gaagcagctc caacatcgga agtaatactg tcaactggta tcagcaattc 120 cccggaaagg cccccaaact cctcatcttt aatgataatc agcggccctc aggggtccct 180 gaccgcttct ctgcttccaa gtctggcacc tcagcctccc tggccattag tggcctccag 240 tctgaggatg aggctgacta ttactgtgcg gcatgggatg gcggtctgaa tggtcgaggg 300 gtgttcggcg gagggaccaa actgaccgtc cta 333 <210> 106 <211> 366 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 106 caggtgcagc tggtgcagtc tgggggaggc ttggtacagc ctggcaggtc cctgagactc 60 tcctgtgcag cctctggatt cacctttgat gattatgcca tgcactgggt ccggcaagct 120 ccagggaagg gcctggagtg ggtctcaggt attagttgga atagtggtag cataggctat 180 gcggactctg tgaagggccg attcaccgtc tccagagaca acgccaagaa ctcactgtat 240 ctgcaaatga acagcctgag agccgaggac acggctgtgt attactgtgc gagtgactac 300 ggtgacaaat actactacta cggtatggac gtctggggca aagggaccac ggtcaccgtc 360 tcctca 366 <210> 107 <211> 333 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 107 cagcctgggc tgactcagcc accctcagcg tctgggaccc cagggcagag ggtcaccatc 60 tcttgttctg gaagcagctc caacatcgga agtaatactg tcaactggta tcagcaattc 120 cccggaaagg cccccaaact cctcatcttt gatgataatc agcggccctc aggggtccct 180 gaccgcttct ctgcttccaa gtctggcacc tcagcctccc tggccattag tggcctccag 240 tctgaggatg aggctgacta ttactgtgcg gcatgggatg gcggtctgaa tggtcgaggg 300 gtgttcggcg gagggaccaa actgaccgtc cta 333 <210> 108 <211> 366 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 108 caggtgcagc tggtgcagtc tgggggaggc ttggtacagc ctggcaggtc cctgagactc 60 tcctgtgcag cctctggatt cacctttgat gattatgcca tgcactgggt ccggcaagct 120 ccagggaagg gcctggagtg ggtctcaggt attagttgga atagtggtag cataggctat 180 gcggactctg tgaagggccg attcaccgtc tccagagaca acgccaagaa ctcactgtat 240 ctgcaaatga acagcctgag agccgaggac acggctgtgt attactgtgc gagtgactac 300 ggtgacaaat actcctacta cggtatggac gtctggggca aagggaccac ggtcaccgtc 360 tcctca 366 <210> 109 <211> 333 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 109 cagcctgggc tgactcagcc accctcagcg tctgggaccc ccgggcagag ggtcaccatc 60 tcttgttctg gaagcagctc caacatcgga agtaatactg tcaactggta tcagcaattc 120 cccggaaagg cccccaaact cctcatcttt aatgataatc agcggccctc aggggtccct 180 gaccgcttct ctgcttccaa gtctggcacc tcagcctccc tggccattag tggcctccag 240 tctgaggatg aggctgacta ttactgtgcg gcatgggatg gcggtctgaa tggtcgaggg 300 gtgttcggcg gagggaccaa actgaccgtc cta 333 <210> 110 <211> 366 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 110 caggtgcagc tggtgcagtc tgggggaggc ttggtacagc ctggcaggtc cctgagactc 60 tcctgtgcag cctctggatt cacctttgat gattttgcca tgcactgggt ccggcaagct 120 ccagggaagg gcctggagtg ggtctcaggt attagttgga atagtggtag cataggctat 180 gcggactctg tgaagggccg attcaccgtc tccagagaca acgccaagaa ctcactgtat 240 ctgcaaatga acagcctgag agccgaggac acggctgtgt attactgtgc gagtgactac 300 ggtgacaaat actcctacta cggtatggac gtctggggca aagggaccac ggtcaccgtc 360 tcctca 366 <210> 111 <211> 97 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 111 Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys 1 5 10 15 Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr 20 25 30 Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser 35 40 45 Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser 50 55 60 Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr 65 70 75 80 Tyr Ile Cys Asn Val Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys 85 90 95 Lys <210> 112 <211> 16 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 112 Ala Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro 1 5 10 15 <210> 113 <211> 110 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 113 Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys 1 5 10 15 Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val 20 25 30 Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr 35 40 45 Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu 50 55 60 Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His 65 70 75 80 Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys 85 90 95 Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys 100 105 110 <210> 114 <211> 107 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 114 Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp 1 5 10 15 Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe 20 25 30 Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu 35 40 45 Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe 50 55 60 Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly 65 70 75 80 Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr 85 90 95 Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys 100 105 <210> 115 <211> 106 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 115 Gly Gln Pro Lys Ala Ala Pro Ser Val Thr Leu Phe Pro Pro Ser Ser 1 5 10 15 Glu Glu Leu Gln Ala Asn Lys Ala Thr Leu Val Cys Leu Ile Ser Asp 20 25 30 Phe Tyr Pro Gly Ala Val Thr Val Ala Trp Lys Ala Asp Gly Ser Pro 35 40 45 Val Lys Ala Gly Val Glu Thr Thr Thr Pro Ser Lys Gln Ser Asn Asn 50 55 60 Lys Tyr Ala Ala Ser Ser Tyr Leu Ser Leu Thr Pro Glu Gln Trp Lys 65 70 75 80 Ser His Arg Ser Tyr Ser Cys Gln Val Thr His Glu Gly Ser Thr Val 85 90 95 Glu Lys Thr Val Ala Pro Thr Glu Cys Ser 100 105 <210> 116 <211> 285 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 116 accaagggcc catcggtctt ccccctggca ccctcctcca agagcacctc tgggggcaca 60 gcggccctgg gctgcctggt caaggactac ttccccgaac cggtgacggt gtcgtggaac 120 tcaggcgccc tgaccagcgg cgtgcacacc ttcccggctg tcctacagtc ctcaggactc 180 tactccctca gcagcgtggt gaccgtgccc tccagcagct tgggcaccca gacctacatc 240 tgcaacgtga atcacaagcc cagcaacacc aaggtggaca agaaa 285 <210> 117 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 117 gcagagccca aatcttgtga caaaactcac acatgcccac cgtgccca 48 <210> 118 <211> 330 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 118 gcacctgaac tcctgggggg accgtcagtc ttcctcttcc ccccaaaacc caaggacacc 60 ctcatgatct cccggacccc tgaggtcaca tgcgtggtgg tggacgtgag ccacgaagac 120 cctgaggtca agttcaactg gtacgtggac ggcgtggagg tgcataatgc caagacaaag 180 ccgcgggagg agcagtacaa cagcacgtac cgtgtggtca gcgtcctcac cgtcctgcac 240 caggactggc tgaatggcaa ggagtacaag tgcaaggtct ccaacaaagc cctcccagcc 300 cccatcgaga aaaccatctc caaagccaaa 330 <210> 119 <211> 324 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 119 gggcagcccc gagaaccaca ggtgtacacc ctgcccccat cccgggatga gctgaccaag 60 aaccaggtca gcctgacctg cctggtcaaa ggcttctatc ccagcgacat cgccgtggag 120 tgggagagca atgggcagcc ggagaacaac tacaagacca cgcctcccgt gctggactcc 180 gacggctcct tcttcctcta cagcaagctc accgtggaca agagcaggtg gcagcagggg 240 aacgtcttct catgctccgt gatgcatgag gctctgcaca accactacac gcagaagagc 300 ctctccctgt ctccgggtaa atga 324 <210> 120 <211> 321 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 120 ggtcagccca aggctgcccc ctcggtcact ctgttcccgc cctcctctga ggagcttcaa 60 gccaacaagg ccacactggt gtgtctcata agtgacttct acccgggagc cgtgacagtg 120 gcctggaagg cagatggcag cccctcaag gcgggagtgg agaccaccac accctccaaa 180 caaagcaca acagtacgc ggccagcagc tatctgagcc tgacgcctga gcagtggaag 240 tcccacagaa gctacagctg ccaggtcacg catgaaggga gcaccgtgga gaagacagtg 300 gccctacag aatgttcatg a 321 <210> 121 <211> 682 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 121 Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp 1 5 10 15 Glu Thr Lys Asn Gln Will Be Thr Cys Thr Lys Gly Phe 20 25 30 Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu 35 40 45 Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe 50 55 60 Phe Leu Tyr Ser Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly 65 70 75 80 Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr 85 90 95 Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Ala Lys Arg Ser 100 105 110 Gly Ser Gly Leu Asn Phe Asp Leu Leu Lys Leu Ala Gly Asp Val Glu 115 120 125 Ser Asn Pro Gly Pro Ser Arg Met Cys His Gln Gln Leu Val Ile Ser 130 135 140 Trp Phe Ser Leu Val Phe Leu Ala Ser Pro Leu Val Ala Ile Trp Glu 145 150 155 160 Leu Lys Lys Asp Val Tyr Val Val Glu Leu Asp Trp Tyr Pro Asp Ala 165 170 175 Pro Gly Glu Met Val Val Leu Thr Cys Asp Thr Pro Glu Glu Asp Gly 180 185 190 Ile Thr Trp Thr Leu Asp Gln Ser Ser Glu Val Leu Gly Ser Gly Lys 195 200 205 Thr Leu Thr Ile Gln Val Lys Glu Phe Gly Asp Ala Gly Gln Tyr Thr 210 215 220 Cys His Lys Gly Gly Glu Val Leu Ser His Ser Leu Leu Leu Leu His 225 230 235 240 Lys Lys Glu Asp Gly Ile Trp Ser Thr Asp Ile Leu Lys Asp Gln Lys 245 250 255 Glu Pro Lys Asn Lys Thr Phe Leu Arg Cys Glu Ala Lys Asn Tyr Ser 260 265 270 Gly Arg Phe Thr Cys Trp Trp Leu Thr Thr Ile Ser Thr Asp Leu Thr 275 280 285 Phe Ser Val Lys Ser Ser Arg Gly Ser Ser Asp Pro Gln Gly Val Thr 290 295 300 Cys Gly Ala Ala Thr Leu Ser Ala Glu Arg Val Arg Gly Asp Asn Lys 305 310 315 320 Glu Tyr Glu Tyr Ser Val Glu Cys Gln Glu Asp Ser Ala Cys Pro Ala 325 330 335 Ala Glu Glu Ser Leu Pro Ile Glu Val Met Val Asp Ala Val His Lys 340 345 350 Leu Lys Tyr Glu Asn Tyr Thr Ser Ser Phe Phe Ile Arg Asp Ile Ile 355 360 365 Lys Pro Asp Pro Pro Lys Asn Leu Gln Leu Lys Pro Leu Lys Asn Ser 370 375 380 Arg Gln Val Glu Val Ser Trp Glu Tyr Pro Asp Thr Trp Ser Thr Pro 385 390 395 400 His Ser Tyr Phe Ser Leu Thr Phe Cys Val Gln Val Gln Gly Lys Ser 405 410 415 Lys Arg Glu Lys Lys Asp Arg Val Phe Thr Asp Lys Thr Ser Ala Thr 420 425 430 Val Ile Cys Arg Lys Asn Ala Ser Ile Ser Val Arg Ala Gln Asp Arg 435 440 445 Tyr Tyr Ser Ser Ser Trp Ser Glu Trp Ala Ser Val Pro Cys Ser Gly 450 455 460 Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Arg Asn 465 470 475 480 Leu Pro Val Ala Thr Pro Asp Pro Gly Met Phe Pro Cys Leu His His 485 490 495 Ser Gln Asn Leu Leu Arg Ala Val Ser Asn Met Leu Gln Lys Ala Arg 500 505 510 Gln Thr Leu Glu Phe Tyr Pro Cys Thr Ser Glu Glu Ile Asp His Glu 515 520 525 Asp Ile Thr Lys Asp Lys Thr Ser Thr Val Glu Ala Cys Leu Pro Leu 530 535 540 Glu Leu Thr Lys Asn Glu Ser Cys Leu Asn Ser Arg Glu Thr Ser Phe 545 550 555 560 Ile Thr Asn Gly Ser Cys Leu Ala Ser Arg Lys Thr Ser Phe Met Met 565 570 575 Ala Leu Cys Leu Ser Ser Ile Tyr Glu Asp Leu Lys Met Tyr Gln Val 580 585 590 Glu Phe Lys Thr Met Asn Ala Lys Leu Leu Met Asp Pro Lys Arg Gln 595 600 605 Ile Phe Leu Asp Gln Asn Met Leu Ala Val Ile Asp Glu Leu Met Gln 610 615 620 Ala Leu Asn Phe Asn Ser Glu Thr Val Pro Gln Lys Ser Ser Leu Glu 625 630 635 640 Glu Pro Asp Phe Tyr Lys Thr Lys Ile Lys Leu Cys Ile Leu Leu His 645 650 655 Ala Phe Arg Ile Arg Ala Val Thr Ile Asp Arg Val Met Ser Tyr Leu 660 665 670 Asn Ala Ser His His His His His His His 675 680 <210> 122 <211> 2046 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 122 gggcagcccc gagaaccaca ggtgtacacc ctgcccccat cccgggatga gctgaccaag 60 aaccaggtca gcctgacctg cctggtcaaa ggcttctatc ccagcgacat cgccgtggag 120 tgggagagca atgggcagcc ggagaacaac tacaagacca cgcctcccgt gctggactcc 180 gacggctcct tcttcctcta cagcaagctc accgtggaca agagcaggtg gcagcagggg 240 aacgtcttct catgctccgt gatgcatgag gctctgcaca accactacac gcagaagagc 300 ctctccctgt ctccgggtaa acgcgctaag cggtcaggtt caggcttgaa tttcgacctc 360 ctcaaactgg ccggggatgt cgagagcaat ccgggaccat ctagaatgtg ccatcagcag 420 ctggtgatta gctggtttag cctggtgttt ctggcgagcc cgctggtggc gatttgggaa 480 ctgaaaaaag atgtgtatgt ggtggaactg gattggtatc ctgatgcgcc gggcgaaatg 540 gtggtgctga cctgcgatac cccggaagaa gatggcatta cctggaccct ggatcagagc 600 agcgaagtgc tgggcagcgg caaaaccctg accattcagg tgaaagaatt tggcgatgcg 660 ggccagtata cctgtcataa aggaggcgaa gtcctgagtc atagcctgct gctgctgcat 720 aaaaaagaag atggcatttg gagcaccgat attctgaaag atcagaaaga accgaaaaac aaaacctttc tgcgctgcga agcgaaaaac tatagtgga gatttacctg ctggtggctg accaccatta gcaccgatct gacctttagc gtgaaa...

Claims

1. 1. An isolated multispecific antibody or antigen-binding fragment thereof that binds to human programmed cell death 1 (PD-1) protein and interleukin-12 (IL-12) receptor, comprising: (a) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28; or (b) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28; or (c) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 79, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28; or (d) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28; or (e) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28; or (f) a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 79, a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28 and further comprising a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO:

129.

2. an isolated multispecific antibody or antigen-binding fragment thereof, wherein the antibody binds to PD-1 and comprises a heavy chain and a light chain, wherein the heavy chain comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, and a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO: 1, and the light chain comprises a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO: 2, and wherein the antibody binds to the interleukin-12 (IL-12) receptor and comprises a constant region, a linker, and an IL-12 amino acid sequence that has at least 90% identity to SEQ ID NO: 129; or an isolated multispecific antibody or antigen-binding fragment thereof, wherein the antibody binds to PD-1 and comprises a heavy chain and a light chain, wherein the heavy chain comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, and a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 21, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO: 1; and the light chain comprises a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO: 11; and wherein the antibody binds to the interleukin-12 (IL-12) receptor and comprises a constant region, a linker, and an IL-12 amino acid sequence that has at least 90% identity to SEQ ID NO: 129; or an isolated multispecific antibody or antigen-binding fragment thereof, wherein the antibody binds to PD-1 and comprises a heavy chain and a light chain, wherein the heavy chain comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a VH CDR2 comprising the amino acid sequence of SEQ ID NO: 19, and a VH CDR3 comprising the amino acid sequence of SEQ ID NO: 79, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO: 12, and the light chain comprises a VL CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO: 26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO: 28, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO: 2, and wherein the antibody binds to the interleukin-12 (IL-12) receptor and comprises a constant region, a linker, and an IL-12 amino acid sequence that has at least 90% identity to SEQ ID NO: 129; or an isolated multispecific antibody or antigen-binding fragment thereof, wherein the antibody binds to PD-1 and comprises a heavy chain and a light chain, wherein the heavy chain comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO:78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO:19, and a VH CDR3 comprising the amino acid sequence of SEQ ID NO:21, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO:13, and the light chain comprises a VL CDR1 comprising the amino acid sequence of SEQ ID NO:24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO:26, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO:28, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO:2, and wherein the antibody binds to the interleukin-12 (IL-12) receptor and comprises a constant region, a linker, and an IL-12 amino acid sequence that has at least 90% identity to SEQ ID NO:129; or an isolated multispecific antibody or antigen-binding fragment thereof, wherein the antibody binds to PD-1 and comprises a heavy chain and a light chain, wherein the heavy chain comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO:78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO:19, and a VH CDR3 comprising the amino acid sequence of SEQ ID NO:21, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO:13, and the light chain comprises a VL CDR1 comprising the amino acid sequence of SEQ ID NO:24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO:80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO:28, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO:11, and wherein the antibody binds to the interleukin-12 (IL-12) receptor and comprises a constant region, a linker, and an IL-12 amino acid sequence that has at least 90% identity to SEQ ID NO:129; or 1. An isolated multispecific antibody or antigen-binding fragment thereof, wherein the antibody binds to PD-1 and comprises a heavy chain and a light chain, wherein the heavy chain comprises a VH CDR1 comprising the amino acid sequence of SEQ ID NO:78, a VH CDR2 comprising the amino acid sequence of SEQ ID NO:19, and a VH CDR3 comprising the amino acid sequence of SEQ ID NO:79, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO:15, and the light chain comprises a VL CDR1 comprising the amino acid sequence of SEQ ID NO:24, a VL CDR2 comprising the amino acid sequence of SEQ ID NO:80, and a VL CDR3 comprising the amino acid sequence of SEQ ID NO:28, and comprises an amino acid sequence that is 95% or more identical to SEQ ID NO:11, and wherein the antibody binds to an interleukin-12 (IL-12) receptor and comprises a constant region, a linker, and an IL-12 amino acid sequence that has at least 90% identity to SEQ ID NO:

129.

3. A nucleic acid encoding the antibody of claim 1 or 2.

4. A pharmaceutical composition comprising the antibody or antigen-binding fragment thereof described in claim 1 or 2 and a pharmaceutically acceptable carrier or excipient.

5. An isolated cell comprising one or more polynucleotides encoding the antibody or antigen-binding fragment thereof of claim 1 or 2.

6. A vector comprising the nucleic acid of claim 3.

7. A cell comprising the vector of claim 6.

8. 10. A kit comprising the pharmaceutical composition of claim 4, a syringe, needle or applicator for administering the at least one antibody to a subject, and instructions for use.

9. 3. An engineered cell comprising a chimeric antigen receptor, wherein the chimeric antigen receptor comprises an extracellular ligand-binding domain specific for an antigen on the surface of a cancer cell, the antigen comprising PD-1, and the extracellular ligand-binding domain comprises the antibody or antigen-binding fragment thereof of claim 1 or 2.

10. 10. The engineered cell of claim 9, wherein the engineered cell comprises a T cell, an NK cell, or an NKT cell.

11. 5. The pharmaceutical composition of claim 4, further comprising at least one additional therapeutic agent.

12. 12. The pharmaceutical composition of claim 11, wherein the therapeutic agent is a toxin, a radiolabel, an siRNA, a small molecule, or a cytokine.

13. 11. The engineered cell of claim 10, wherein the T cells are CD4+, CD8+, CD3+ pan T cells, or any combination thereof.

Images