Lactic acid bacterium having tear fluid secretion promoting activity
Fructophilic lactic acid bacteria compositions address the growing issue of dry eye by promoting tear secretion through increased interleukin-10 and BDNF expression, providing relief and prevention for dry eye symptoms.
Patent Information
- Application Number
- JP2024024152
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-02-21
- Publication Date
- 2025-09-02
AI Technical Summary
The increasing prevalence of dry eye conditions due to decreased tear production, exacerbated by prolonged screen usage and dry environments, necessitates the development of effective treatments or preventive measures, particularly through health-promoting foods.
Utilizing fructophilic lactic acid bacteria, which are formulated as a composition for oral or parenteral administration, to promote tear secretion by increasing plasma interleukin-10 levels and brain-derived neurotrophic factor expression, thereby alleviating eye discomfort and preventing dry eye symptoms.
The fructophilic lactic acid bacteria composition effectively promotes tear secretion, alleviates eye fatigue, and maintains eye moisture, offering a potential treatment or prevention for dry eye and related conditions.
Smart Images

Figure 2025127486000001_ABST
Abstract
Description
[Technical Field]
[0001] The present invention relates to lactic acid bacteria having a lacrimal secretion promoting effect, more specifically to fructophilic lactic acid bacteria, and further to a lacrimal secretion promoting agent containing the same. [Background technology]
[0002] Lactic acid bacteria are widely used as ingredients in health foods due to their intestinal regulating effects, etc. Lactic acid bacteria are also known to have a variety of functions other than intestinal regulating effects, such as lactose digestion assistance, resistance to enteric pathogens, suppression of colon cancer carcinogenesis, suppression of small intestinal bacterial overgrowth, immune function regulation, anti-allergy, blood lipid reduction, antihypertensive, suppression of urinary tract infection, suppression of Helicobacter pylori infection, and suppression of hepatic and encephalopathy (Non-Patent Document 1).
[0003] Lactic acid bacteria include the genera Enterococcus, Streptococcus, Lactobacillus, Alkalibacterium, Atopobacter, Carnobacterium, Fructobacillus, Halolactibacillus, Isobaculum, Marinilactibacillus, Olsenella, Paralactobacillus, Pilibacter, Weissella, Abiotrophia, and Bavariicoccus. Examples of the genera include the genus Granulicatella, the genus Melissococcus, the genus Lacticigenium, the genus Lactococcus, the genus Leuconostoc, the genus Oenococcus, the genus Pediococcus, the genus Tetragenococcus, the genus Trichococcus, the genus Vagococcus, and the genus Apilactobacillus (Patent Document 1, etc.).
[0004] Furthermore, fructophilic lactic acid bacteria are known as a group of lactic acid bacteria that prefer fructose (Non-Patent Document 2). Lactic acid bacteria are generally known to prefer glucose as a carbon source, but fructophilic lactic acid bacteria hardly grow in media that use glucose as a carbon source, but grow well in media that use fructose as a carbon source. All species in the genus Fructobacillus and several species classified in the genus Apilactobacillus are known as fructophilic lactic acid bacteria.
[0005] Meanwhile, in modern society, a decrease in tear secretion has become a problem due to factors such as increased screen usage, dry air caused by air conditioning, and the use of contact lenses. Typically, this leads to a decrease in eye moisture, resulting in discomfort such as eye fatigue. Furthermore, a condition known as "dry eye" is known, a chronic condition that is accompanied by decreased tear function and corneal and conjunctival epithelial damage due to various factors. In response to this, oral compositions containing lactic acid bacteria have been proposed for the treatment or prevention of dry eye (Patent Document 1, and Non-Patent Documents 3 and 4). In particular, it has been reported that oral administration of live Enterococcus faecium WB2000 strain lactic acid bacteria increases tear production (recovering tear production that has decreased due to stress).
[0006] Research into the mechanisms of dry eye pathogenesis has also been reported. For example, using mice with excessive reactive oxygen species, the relationship between intracellular reactive oxygen species and dry eye was examined (Non-Patent Document 5). In this study, it was shown that mice with excessive reactive oxygen species, in which reactive oxygen species were acutely generated by doxycycline, had significantly reduced tear secretion and elevated levels of cytokines such as IL-10 in the lacrimal glands. Furthermore, using a mouse model with low brain-derived neurotrophic factor (BDNF) expression, the relationship between BDNF expression levels in the brain and dry eye was examined (Non-Patent Document 6). In this study, it was shown that tear production was reduced in models with reduced BDNF expression levels in the brain. [Prior art documents] [Patent documents]
[0007] [Patent Document 1] WO2016 / 032000 [Non-patent literature]
[0008] [Non-Patent Document 1] Antonie vanLeeuwenhoek, Vol. 76, 293-315 (1999) Bringing a probiotic-containing functional food to the market: microbiological, product, regulatory and labeling issues [Non-patent document 2] Applied and Environmental Microbiology, Vol. 84, Issue 19, e01290-18, (2018) Fructophilic Lactic Acid Bacteria, a Unique Group of Fructose-Fermenting Microbes [Non-patent document 3] Journal of Intestinal Microbiology, Vol. 30, No. 2, 99 (2016) The tear secretion and maintenance effects of lactic acid bacteria (Enterococcusfaecium WB2000 strain) in a mouse dry eye model [Non-patent document 4] Frontiers in Dry Eyes, Vol. 13, No. 1, 24 (2018) Effect of combined supplement intake on dry eye symptoms: A multicenter collaborative study [Non-Patent Document 5] Grant-in-Aid for Scientific Research (2011) Examination of the mechanism of dry eye disease using a mouse model of excessive reactive oxygen species [Non-patent document 6] Scientific Reports, vol. 9, Article number: 3422 (2019) Enrichedenvironment alleviates stress-induced dry-eye through the BDNF axis Summary of the Invention [Problem to be solved by the invention]
[0009] The number of patients with dry eye caused by decreased tear production is increasing not only in Japan but also around the world, necessitating the development of new treatments, alleviation, or prevention methods. Furthermore, prolonged VDT (visual display terminal) work is leading to decreased eye moisture, leading to an increase in the number of people experiencing dry eyes, eye fatigue, and eye inflammation. Since many people are at potential risk, there is a demand for daily care using health-promoting foods such as foods for specified health uses and foods with functional claims. The present inventors focused on the lacrimal secretion-promoting activity of lactic acid bacteria and discovered that fructophilic lactic acid bacteria have a strong lacrimal secretion-promoting activity. Furthermore, they confirmed that fructophilic lactic acid bacteria increase the plasma concentration of certain anti-inflammatory cytokines and enhance the expression level of brain-derived neurotrophic factor. As a result, the inventors have discovered that fructophilic lactic acid bacteria are useful as lacrimal secretion promoters, and can be used as components of compositions for treating or preventing dry eye, which can maintain or support eye moisture, thereby reducing eye fatigue and discomfort associated with decreased eye moisture, and treating or preventing dry eye. [Means for solving the problem]
[0010] That is, the present invention relates to the following lacrimation promoters: <1> A tear secretion promoter containing fructophilic lactobacillus. <2> The fructophilic lactic acid bacteria are sterilized fructophilic lactic acid bacteria. <1> The lacrimation promoter according to any one of claims 1 to 4. <3> The above-mentioned is for oral administration or ingestion. <1> or <2> The lacrimation promoter according to any one of claims 1 to 4.
[0011] Next, the present invention relates to the following composition. <4> The aforementioned <1> ~ <3> 1. A composition for treating and / or preventing dry eye, comprising the lacrimal secretion promoter according to any one of the preceding claims. <5> The aforementioned <1> ~ <3> 1. A composition for maintaining eye moisture, supporting eye moisture, or relieving eye fatigue or discomfort, comprising the lacrimal secretion promoter according to any one of the above. <6> The above-mentioned food grade <4> or <5> The composition described in <7> The aforementioned <1> ~ <3> 10. A composition for treating and / or preventing Sjogren's syndrome, Riley-Day syndrome, trachoma, or drug-induced hypolacrimation, comprising the lacrimation promoter according to any one of the preceding items.
[0012] Furthermore, the present invention relates to the following lacrimation promoters: <8> Increases the expression of brain-derived neurotrophic factor (BDNF), <1> ~ <3> The lacrimation promoter according to any one of the above. <9> Increases plasma interleukin-10 (IL-10) levels, <1> ~ <3> The lacrimation promoter according to any one of the above. <10> A lacrimal secretion promoter containing lactic acid bacteria that increases plasma interleukin-10 (IL-10) levels. <11> A tear secretion promoter containing lactic acid bacteria that increases the expression of brain-derived neurotrophic factor (BDNF). [Effects of the Invention]
[0013] The lacrimation promoter of the present invention has a lacrimation promoting effect; in particular, when the lactic acid bacteria (particularly, fructophilic lactic acid bacteria) contained therein are sterilized, a lacrimation promoter with stable formulation quality can be obtained. Furthermore, when the lacrimation promoter of the present invention is administered (particularly orally), it exhibits a lacrimation promoting effect in a subject to which it is administered.
[0014] Furthermore, the lacrimation promoter of the present invention is effective in alleviating eye fatigue and discomfort caused by decreased eye moisture, and is also effective as a component of a composition for treating or preventing dry eye, and by forming it into a food composition such as a food for specified health uses or a food with functional claims, it is possible to maintain eye moisture in "healthy individuals" or "borderline individuals" and prevent dry eye. Furthermore, the lacrimation promoter of the present invention may be effective as a component of a composition for treating or preventing various diseases and symptoms associated with lacrimal secretion insufficiency. [Brief explanation of the drawings]
[0015] [Figure 1] 1 is a graph showing the tear volume of each group of mice measured in the test of Example 1. [Figure 2] 1 is a graph showing the expression level of brain-derived neurotrophic factor (BDNF) in the hippocampus of mice in each group, measured in the test of Example 2. [Figure 3] 1 is a graph showing the plasma interleukin-10 (IL-10) concentration in each group of mice measured in the test of Example 3. DETAILED DESCRIPTION OF THE INVENTION
[0016] 1. Lacrimal secretion promoters The lacrimal secretion promoter of the present invention contains at least lactic acid bacteria, preferably fructophilic lactic acid bacteria, or contains lactic acid bacteria that increase the concentration of plasma cytokine interleukin-10 (IL-10) or lactic acid bacteria that increase the expression level of brain-derived neurotrophic factor (BDNF). The lacrimal secretion promoter of the present invention may also contain other ingredients.
[0017] [1-1. About fructophilic lactic acid bacteria] Fructophilic lactic acid bacteria are lactic acid bacteria that grow in fructose-rich environments such as those found in flowers, fruits, and fermented fruit products. Fructophilic lactic acid bacteria prefer fructose, rather than glucose, as a growth substrate. The fructophilic lactic acid bacteria contained in the lacrimal secretion promoter of the present invention can be any known fructophilic lactic acid bacteria without limitation; known fructophilic lactic acid bacteria include species belonging to the genus Fructobacillus and species belonging to the genus Apiractobacillus. Bacterial species belonging to the genus Fructobacillus include Fructobacillus fructosus, Fructobacillus pseudoficulneus, Fructobacillus tropaeoli, Fructobacillus ficulneus, and Fructobacillus durionis, and any of these may be used as the fructophilic lactic acid bacteria of the present invention. An example of Fructobacillus fructosus is the FMO-85 strain (deposited at the Patent Microorganisms Depositary Center of the National Institute of Technology and Evaluation under accession number NITE P-04016), and this fructophilic lactic acid bacterium strain was used in the examples of this patent specification.
[0018] The fructophilic lactic acid bacteria may be cocci or bacilli. The fructophilic lactic acid bacteria may be homolactic or heterolactic, but are generally heterolactic, and may produce acetic acid along with lactic acid. The origin of the fructophilic lactic acid bacteria is not particularly limited, and may be plant-derived lactic acid bacteria, animal-derived lactic acid bacteria, intestinal lactic acid bacteria, etc.
[0019] The fructophilic lactic acid bacteria may be used in the form of either live bacteria or dead bacteria (sterilized bacteria).Furthermore, the fructophilic lactic acid bacteria may be used as a fermented product containing the lactic acid bacteria.The fructophilic lactic acid bacteria contained in the fermented product may be in the form of either live bacteria or dead bacteria (sterilized bacteria).
[0020] It may be preferable that the fructophilic lactic acid bacteria contained in the lacrimal secretion promoter of the present invention are killed. For example, enzymes produced by live bacteria may interact with other components of the lacrimal secretion promoter, causing adverse effects; and compositions containing live bacteria may have stability problems (for example, in the case of a composition containing live bacteria, the number of live bacteria may decrease during formulation).
[0021] Fructophilic lactic acid bacteria may be used after being grown by culturing or other treatment. The culturing method for lactic acid bacteria is not particularly limited, and for example, a method according to or similar to a known method can be employed. The culture medium used for culturing can be a conventional culture medium, but fructose may be used as a carbon source. Furthermore, the culture medium may contain yeast extract, peptone, meat extract, or corn steep liquor as a nitrogen source, glucose, sucrose, maltose, or alcohol as a carbon source (in addition to fructose), and inorganic salts such as calcium salts, phosphate salts, magnesium salts, or sodium chloride. The culture conditions are not particularly limited, but aerobic culture is preferred, with the pH adjusted to a range of 6.0 to 7.2, the temperature adjusted to a range of 20 to 45°C, and the culture time approximately 8 to 100 hours. The culture method is not limited to aerobic culture, and static culture, shaking culture, anaerobic culture, aeration and agitation culture, etc., may also be used.
[0022] The fructophilic lactic acid bacteria contained in the medium after cultivation may be used as they are in the medium, or may be collected from the medium. Collection of bacteria is carried out by centrifugation or filtration using a filter press, and the collected lactic acid bacteria may be washed with water, physiological saline, Ringer's solution, or the like. Furthermore, the lactic acid bacteria may be subjected to drying treatment (e.g., freeze-drying treatment), high-temperature treatment under low pH, or the like.
[0023] The fructophilic lactic acid bacteria may be in the form of wet cells or freeze-dried to form a dry powder. Alternatively, the lactic acid bacteria (live cells) may be heat-sterilized and then formed into a dry powder, or may be formed into a disrupted cell product. The disrupted cell product is obtained by heating and then physically disrupting the cells obtained by culture, and disruption can be performed by ultrasonication, ball milling, French press, or the like.
[0024] The amount of fructophilic lactic acid bacteria contained in the lacrimal secretion promoter of the present invention is preferably 1×10 6 ~2×10 11 billion, more preferably 1 x 10 7 ~2×10 11 billion, and more preferably 1×10 8 ~2×10 11 The number of lactic acid bacteria in the lacrimal secretion promoter of the present invention may be set to be 100 million. The content of fructophilic lactic acid bacteria in the lacrimal secretion promoter of the present invention may also be any percentage, but is usually 0.0001 to 90% by mass, preferably 0.001 to 20% by mass, and more preferably 0.01 to 10% by mass. The number of lactic acid bacteria in the lacrimal secretion promoter or composition can be measured by any method, for example, using DAPI staining.
[0025] [1-2. Other ingredients contained in lacrimal secretion promoters] The lacrimal secretion promoter of the present invention may be a preparation containing only fructophilic lactic acid bacteria, or may be a preparation containing other optional ingredients together with fructophilic lactic acid bacteria. The lacrimal secretion promoter of the present invention may also contain other bacteria such as lactic acid bacteria other than fructophilic lactic acid bacteria, bifidobacteria, etc. These bacteria may also have the effect of promoting lacrimal secretion.
[0026] The lacrimal secretion promoter of the present invention can contain a component for enhancing the function of fructophilic lactic acid bacteria. For example, the lacrimal secretion promoter can contain one or more components selected from the group consisting of lutein, fish oil, lactoferrin, vitamins, gamma-aminobutyric acid (GABA), zinc, zeaxanthin, bilberry extract, maqui berry, crocetin, beta-carotene, and DHA / EPA (contained in fish oil). Lutein can be free lutein, lutein ester, lutein salt, etc. Vitamins can be vitamin C, vitamin E, vitamin A, vitamin B2, etc.
[0027] [1-3. Administration route of lacrimal secretion promoters] The lacrimation promoter of the present invention can be administered or ingested orally, or may be administered parenterally (for example, by eye drops).
[0028] [1-4. Pharmacological effects of lacrimal secretion promoters] The lacrimation promoter of the present invention can increase the concentration of interleukin-10 (IL-10) in plasma. The concentration of interleukin-10 in plasma can be measured by a conventional method (e.g., ELISA) (see Example 3 below).
[0029] As shown in Example 3 below, the group administered with the tear secretion promoter of the present invention had a higher plasma interleukin-10 concentration compared to the untreated group (see Figure 3). Interleukin-10 is an anti-inflammatory cytokine and is believed to suppress inflammatory responses. Therefore, it is thought that increased interleukin-10 in plasma contributes to the alleviation of eye fatigue and discomfort caused by decreased tear secretion, but the reason for the alleviation of eye fatigue and discomfort is not limited to this.
[0030] The lacrimation promoter of the present invention can increase the expression level of brain-derived neurotrophic factor (BDNF). The expression level of BDNF can be measured by a conventional method; for example, the gene expression level in the hippocampus can be quantified by RT-PCR (see Example 2 below).
[0031] As shown in Example 2 below, in dry eye model mice (ventilation stress + lactic acid bacteria group) administered with the lacrimation promoter of the present invention, the expression level of BDNF in the hippocampus was found to be increased (see Figure 2). As described in Non-Patent Document 6 above, it is known that tear volume is low in animal models in which BDNF expression is suppressed. Therefore, it is thought that the lacrimation promoter of the present invention promotes tear secretion through the enhancement of BDNF expression, but the mechanism of promoting tear secretion is not limited to this.
[0032] 2. Compositions containing lacrimal secretion promoters A composition containing the lacrimation promoter of the present invention (the composition of the present invention) can be used to alleviate, treat, or prevent symptoms or diseases caused by decreased tear secretion. For example, the composition of the present invention may be a composition for 1) maintaining eye moisture, supporting eye moisture, or alleviating eye fatigue or discomfort, 2) treating and / or preventing dry eye, or 3) treating and / or preventing decreased tear secretion caused by Sjögren's syndrome, Riley-Day syndrome, trachoma, or drugs.
[0033] The composition of the present invention may be in either solid or liquid form. Solid compositions may be in any form such as powder, granules, capsules, tablets, etc., and liquid compositions may be in any form such as aqueous solutions, suspensions, pastes, jelly, etc.
[0034] The composition of the present invention may be a food. The food may be a general food, or may be a food with health claims, such as a food for specified health uses (a food approved under Article 43, Paragraph 1 of the Health Promotion Act) or a food with functional claims (a food notified under the Food Labeling Act). These health claims can be labeled with their functions, and the function of the composition of the present invention (for example, maintaining eye moisture, supporting eye moisture, or reducing eye fatigue or discomfort) may be labeled.
[0035] Examples of food forms include beverages such as soft drinks, fruit juice drinks, milk drinks, alcoholic drinks, sports drinks, and energy drinks; bread, noodles, rice, tofu, dairy products, soy sauce, miso paste, confectionery, cream, yogurt, sauces, mayonnaise, dressings, and supplements. Furthermore, supplements such as capsules (soft capsules and hard capsules) and tablets (including chewable tablets) may be preferred as foods and beverages because they are easy to take.
[0036] When the composition of the present invention is a food product, it may contain any other ingredients in addition to fructophilic lactic acid bacteria, such as other bacteria (lactic acid bacteria other than fructophilic lactic acid bacteria, bifidobacteria, acetic acid bacteria, koji mold, butyric acid bacteria, natto bacteria, etc.) or yeast. Further optional ingredients include, for example, dietary fiber; sweeteners such as trehalose, sucralose, aspartame, and oligosaccharides; acidulants such as citric acid, acetic acid, lactic acid, phosphoric acid, and lemon juice; amino acids such as glutamic acid, glycine, gamma-aminobutyric acid (GABA), taurine, and alanine; other seasonings such as sucrose, lactose, salt, and soy sauce; herbal medicines such as turmeric, liver extract, cinnamon bark, fennel, peony, and licorice; cosmetic ingredients such as collagen, hyaluronic acid, placenta, coenzyme Q10, chondroitin, and royal jelly; thickening polysaccharides such as soybean polysaccharides, guar gum, and xanthan gum; and flavorings such as grapefruit and lemon.
[0037] The composition of the present invention may be a pharmaceutical. If it is a pharmaceutical, it may be an oral medication (internal medication) or eye drops. Examples of eye drops include artificial tears, general eye drops, antibacterial eye drops, and allergy eye drops. Artificial tears are medicinal solutions containing salt components at the same concentration as tears. General eye drops are medicinal solutions containing components that suppress symptoms such as eye fatigue, itching, and conjunctival congestion. Allergy eye drops are medicinal solutions containing components that alleviate allergic symptoms, such as antihistamine components and antiallergic components, and antibacterial eye drops are medicinal solutions containing antibacterial components.
[0038] The composition of the present invention may be administered to humans (by ingestion, etc.) or other animals. The human to whom the composition of the present invention is administered may be a patient (patient in the affected area) suffering from a disease caused by decreased tear secretion, such as dry eye, or may be a healthy individual or a borderline individual who is not considered a patient. The other animals may include mammals, such as pets and livestock. [Example]
[0039] Example 1: Tear secretion-promoting effect of fructophilic lactic acid bacteria in dry eye model mice Five-week-old male C57BL / 6J mice were used. From 3 weeks before ventilation stress was administered until the final day of the study (day 38 after the start of feeding), the mice were fed ad libitum with either the National Institute of Nutrition AIN-93M standard purified diet or AIN-93M diet containing 3% fructophilic lactic acid bacteria. The fructophilic lactic acid bacteria used was sterilized Fructobacillus fructosus FMO-85 (dried powder).
[0040] Eight-week-old mice were restrained in polypropylene centrifuge tubes with measures in place to allow breathing and excretion for four hours a day, and air was blown onto the faces of the mice while they were restrained. This procedure was repeated for four days to induce dry eye symptoms.
[0041] Tear volume measurements were performed on mice before ventilation stress (3 weeks, 2 weeks, 1 week, and the day before ventilation stress; i.e., days 0, 7, 14, and 20 after the start of feeding), on each ventilation stress day (i.e., every day from days 21 to 24 after the start of feeding), and 1, 3, 5, 7, 10, and 14 days after the end of ventilation treatment (i.e., days 25, 27, 29, 31, 34, and 38 after the start of feeding). Tear volume was calculated by inserting a phenolphthalein red cotton thread into the outer canthus for 15 seconds, and dividing the length of discoloration (mm) by the mouse's body weight (g). The results are shown in Figure 1.
[0042] In the graph in Figure 1, the "untreated group" represents mice fed AIN-93M diet without ventilation stress; the "ventilation-stressed group" represents mice fed AIN-93M diet with ventilation stress; the "ventilation-stressed + lactobacillus group" represents mice fed AIN-93M diet with ventilation stress; and the "untreated + lactobacillus group" represents mice fed fructophilic lactobacillus diet without ventilation stress. As shown in the graphs for the "ventilation-stressed group" and "ventilation-stressed + lactobacillus group" in Figure 1, tear production decreased due to ventilation stress (see days 21 to 25 after the start of feeding). Subsequently, tear production significantly increased in the "ventilation-stressed + lactobacillus group" compared with the "ventilation-stressed group," with tear production increasing significantly from days 29 to 34 after the start of feeding.
[0043] Thus, it is clear that fructophilic lactic acid bacteria (the lacrimation promoter of the present invention) have the effect of restoring (promoting) decreased tear secretion. The dry eye model mouse used in this Example 1 is a common model also used in the aforementioned Patent Document 1, Non-Patent Document 3, Non-Patent Document 6, etc.
[0044] Example 2: Effect of fructophilic lactic acid bacteria on hippocampal BDNF expression In the test of Example 1, mice were euthanized on the final day of the test (day 38 after the start of feeding), and hippocampi were sampled. RT-PCR was performed on the sampled hippocampal gene samples. BDNF expression levels were calculated as a ratio to the expression level of GAPDH (glyceraldehyde-3-phosphate dehydrogenase), which was used as an internal standard gene. The results are shown in Figure 2. On the X axis of the graph in Figure 2, the "untreated group" represents mice fed an AIN-93M diet without ventilation stress; the "ventilation stress group" represents mice fed an AIN-93M diet with ventilation stress; the "ventilation stress + lactic acid bacteria group" represents mice fed a ventilation stress and a fructophilic lactic acid bacteria-containing diet; and the "untreated + lactic acid bacteria group" represents mice fed a fructophilic lactic acid bacteria-containing diet without ventilation stress.
[0045] As shown in Figure 2, the expression level of BDNF in the hippocampus was higher in the "ventilation stress + lactic acid bacteria group" compared to the "ventilation stress group" (Figure 2). Thus, it is clear that fructophilic lactic acid bacteria (the tear secretion promoter of the present invention) has the effect of increasing the expression level of BDNF in the hippocampus of dry eye model mice.
[0046] BDNF expression levels were quantified by RT-PCR using NucleoSpin RNA, PrimeScript RT reagent Kit, and TB Green Premix Ex Taq II (all from Takara Bio Inc.) according to the kit supplier's recommended procedure. The primer sequences are as follows: TotalBDNF- Forward: ACTATGGTTATTTCATACTTCGGTT Total BDNF- Reverse: CCATTCACGCTCTCCAGA GAPDH- Forward: AGGAGCGAGACCCCACTAAC GAPDH- Reverse: GATGACCCTTTTGGCTCCAC
[0047] Example 3: Effect of fructophilic lactic acid bacteria on anti-inflammatory cytokine secretion In the test of Example 1, blood was drawn from the mice on the final day of the test (day 38 after the start of feeding), and plasma samples were collected. The amount of interleukin-10 (IL-10), an anti-inflammatory cytokine, was measured using ELISA. The results are shown in Figure 3. On the X axis of the graph in Figure 3, the "untreated group" represents mice fed an AIN-93M diet without being subjected to ventilation stress; the "ventilation stress group" represents mice fed an AIN-93M diet with ventilation stress; the "ventilation stress + lactic acid bacteria group" represents mice fed a ventilation stress and a diet containing fructophilic lactic acid bacteria; and the "untreated + lactic acid bacteria group" represents mice fed a fructophilic lactic acid bacteria diet without being subjected to ventilation stress.
[0048] As shown in Figure 3, the plasma concentration of interleukin-10 was found to be higher in the "untreated + lactic acid bacteria group" compared to the "untreated group." This suggests that fructophilic lactic acid bacteria (the tear secretion promoter of the present invention) may promote the secretion of interleukin-10.
[0049] Quantification of interleukin-10 by ELISA was performed using the Mouse IL-10 Quantikine ELISA Kit (R&D Systems, M1000B-1) according to the procedure recommended by the kit supplier. [Industrial Applicability]
[0050] According to the present invention, a new lacrimation promoter is provided, which can be preferably used as a food or pharmaceutical. By administering it to humans or animals, it can be used to alleviate eye fatigue and discomfort caused by decreased eye moisture, and to treat / prevent diseases caused by decreased tear secretion (e.g., dry eye).
Claims
1. A tear secretion promoter containing fructophilic lactobacillus.
2. The lacrimal secretion promoter according to claim 1 , wherein the fructophilic lactic acid bacteria is a sterilized form of fructophilic lactic acid bacteria.
3. The lacrimation promoter according to claim 1 or 2, which is for oral administration or ingestion.
4. A composition for treating and / or preventing dry eye, comprising the lacrimation promoter according to claim 1 or 2.
5. A composition for maintaining eye moisture, supporting eye moisture, or relieving eye fatigue or discomfort, comprising the lacrimal secretion promoter according to claim 1 or 2.
6. The composition of claim 5, which is for food use.
7. A composition for treating and / or preventing Sjogren's syndrome, Riley-Day syndrome, trachoma, or drug-induced hypolacrimation, comprising the lacrimation promoter according to claim 1 or 2.
8. The lacrimation promoter according to claim 1 or 2, which increases the expression level of brain-derived neurotrophic factor (BDNF).
9. The lacrimation promoter according to claim 1 or 2, which increases the concentration of interleukin 10 (IL-10) in plasma.
10. A lacrimal secretion promoter containing lactic acid bacteria that increases the concentration of interleukin-10 (IL-10) in plasma.
11. A tear secretion promoter containing lactic acid bacteria that increases the expression of brain-derived neurotrophic factor (BDNF).
Citation Information
Patent Citations
Lactic acid bacteria-containing composition
WO2016032000A1