Bar-coded extracellular vesicle library

Abstract

To provide bar-coded extracellular vesicle libraries, to provide methods for making the same, and to provide methods for using the same.SOLUTION: A method for generating a library of extracellular vesicles containing bar-code RNA includes the steps of: (1) introducing (a) an expression vector expressing multiple types of bar-code RNA or (b) multiple types of bar-code RNA into extracellular vesicle-secreting cells expressing a fusion protein containing a protein present in extracellular vesicles and an RNA-binding protein; (2) culturing the extracellular vesicle-secreting cells in a culture medium; and (3) recovering extracellular vesicles containing bar-code RNA bound to the fusion protein from a culture supernatant of the extracellular vesicle-secreting cells.SELECTED DRAWING: None

Description

[Technical Field]

[0001] <Cross Reference> This application benefits from priority from a Japanese patent application (Patent Application No. 2019-207329) filed on November 15, 2019, the entire contents of which are incorporated herein by reference.

[0002] The present invention relates to a library of barcoded extracellular vesicles. [Background technology]

[0003] Vesicles secreted from cells (extracellular vesicles; EVs) are classified into several types depending on their origin and characteristics. While numerous classification methods exist based on their heterogeneity, EVs can be broadly divided into small EVs (EVs) with diameters of 200 nm or less and larger EVs. The former are membrane vesicles with diameters of approximately 30–200 nm, and contain many exosomes, whose membranes are thought to be derived primarily from endosomes. While exosomes are heterogeneous, many are thought to be enriched in endosome-associated proteins such as Rab GTPases, SNAREs, annexins, and phloritins, as well as the transmembrane protein family tetraspanins (e.g., CD63, CD81, and CD9). Large EVs include microvesicles (MVs; also known as ectosomes), whose membranes are thought to be primarily composed of components of the plasma membrane, and apoptotic bodies formed by cell fragmentation during apoptosis (Non-Patent Documents 1, 2, and 3). MVs are formed by being directly constricted from the cell membrane and are small vesicles approximately 200 to 1000 nm in size. MVs contain integrins, selectins, CD40, etc. Apoptotic bodies are also formed by being directly constricted from the cell membrane, but they are small vesicles measuring 500 nm to 2000 nm in size and contain fragmented genomic DNA, histone proteins, etc.

[0004] Exosomes have been reported to be involved in close or long-distance intercellular communication. For example, in the immune system, exosomes released from cells function as antigen-presenting vesicles, inducing antitumor immune responses and immune tolerance that suppresses inflammation (Non-Patent Document 4). In neurodegenerative diseases, it is known that pathogenic proteins such as prions and beta-amyloid peptides use exosomes to spread to other cells.

[0005] Exosomes have low immunogenicity and are capable of penetrating the blood-brain barrier. In addition to proteins, they contain various nucleic acids (mRNA, miRNA, shRNA, ncRNA, etc.), and it is known that these nucleic acids function within exosome-receiving cells and affect their function. Therefore, in recent years, there has been active research into using exosomes as drug delivery systems (DDS) in the hope of achieving therapeutic effects by modifying the function of exosome-receiving cells (Non-Patent Document 5). For example, attempts have been made to improve the efficiency of DDS by expressing peptides or proteins recognized by exosome-receiving cells on the membrane surface of exosomes to increase the efficiency of targeting to exosome-receiving cells, or by expressing RNA-binding proteins on the inner membrane side of exosomes to efficiently recruit cytoplasmic RNA (Non-Patent Documents 6 to 9, Patent Document 1).

[0006] The present inventors have also developed exosomes suitable for DDS (Non-Patent Document 10).

[0007] It has also been proposed that cancer cells program their metastatic destinations using exosomes they secrete, creating an environment favorable for their own metastasis. Therefore, some papers suggest that if exosome secretion could be selectively inhibited in cancer cells, anticancer drugs could be developed (Non-Patent Documents 11 and 12). These studies suggest that the type of integrin present on the surface of exosomes is related to the type of organ to which cancer metastasizes.

[0008] Extracellular vesicles are not only unique to animals, but also exist in plants, and it has been suggested that they play an important role in the host's defense against pathogens (plant immunity), but the function of extracellular vesicles is not well understood (Non-patent document 13). [Prior art documents] [Patent documents]

[0009] [Patent Document 1] US Publication No. 2015 / 0093433 [Non-patent literature]

[0010] [Non-Patent Document 1] eLife(2018);7:e41460 [Non-patent document 2] Journal of Extracellular Vesicles(2015);4:26316 [Non-patent document 3] Journal of Extracellular Vesicles(2018);7:1535750 [Non-patent document 4] Immunological Reviews(2013);Vol.251:p125-142 [Non-patent document 5] NATURE (2017);VOL546:p498-521 [Non-patent document 6] Nano letters (2019);19:19-28 [Non-Patent Document 7] Journal of Extracellular Vesicles(2016);5:31027 [Non-patent document 8] Journal of Extracellular Vesicles(2016);5:31053 [Non-Patent Document 9] Nature Biotechnology(2011);29:341-345 [Non-Patent Document 10] NATURE COMMUNICATIONS(2018);9:1305 [Non-Patent Document 11] NATURE(2015);VOL527(7578):p329-35 [Non-Patent Document 12] Sci.Rep.(2018);8:8161 [Non-Patent Document 13] Plant Physiology (2017);Vol. 173:p728-741 [Non-Patent Document 14] NATURE COMMUNICATIONS(2017);8:15178 Summary of the Invention [Problem to be solved by the invention]

[0011] The present invention aims to provide a library of barcoded extracellular vesicles, a method for producing the same, and a method for using the same. [Means for solving the problem]

[0012] As a result of extensive research, the present inventors have succeeded in creating a library of extracellular vesicles encapsulating nucleic acids for comprehensive screening of factors that affect the properties of extracellular vesicles (i.e., the in vivo dynamics of extracellular vesicles, the amount of extracellular vesicles secreted, the substances encapsulated (proteins, nucleic acids, etc.), and the composition of the extracellular vesicle membrane (phospholipids that make up the membrane, proteins localized in the extracellular vesicle membrane, etc.)).

[0013] The present invention includes the following embodiments: [1A] (Tools for creating extracellular vesicle libraries) A nucleic acid encoding a fusion protein comprising a protein present in extracellular vesicles and an RNA-binding protein. [2A] The nucleic acid described in 1A, wherein the protein present in the extracellular vesicles is a tetraspanin or an active fragment thereof. [3A] 2B. The nucleic acid of 2A, wherein the tetraspanin is selected from the group consisting of CD63, CD9 and CD81. [4A] The nucleic acid according to any one of 1A to 3A, wherein the RNA-binding protein is selected from the group consisting of MS2 or an active fragment thereof, CAS or an active fragment thereof, L7Ae or an active fragment thereof, λ bacteriophage antiterminator protein N or an active fragment thereof, and HuR or an active fragment thereof. [5A] An expression vector comprising the nucleic acid according to any one of 1A to 4A. [6A] An extracellular vesicle-secreting cell containing the expression vector described in 5A. [7A] Further, the extracellular vesicle-secreting cell described in 6A contains a nucleic acid that affects the properties of the extracellular vesicle. [8A] The extracellular vesicle-secreting cell described in 6A, further comprising an expression vector that expresses a nucleic acid that affects the properties of the extracellular vesicles. [9A] The nucleic acid that affects the properties of the extracellular vesicles (1) Nucleic acids present within or on the surface of extracellular vesicles that alter the amount of endogenous proteins; (2) nucleic acids that promote or inhibit the secretion of extracellular vesicles; (3) nucleic acids that affect the lipid membranes that make up the membranes of extracellular vesicles; and (4) A nucleic acid for causing an exogenous protein to be present within or on the surface of the extracellular vesicle; [10A] The extracellular vesicle-secreting cell according to any one of 7A to 9A, wherein the nucleic acid that affects the properties of the extracellular vesicles comprises mRNA or ncRNA (including miRNA, siRNA, shRNA, gRNA, snRNA, and snoRNA).

[0014] [1B] A fusion protein containing a protein present in extracellular vesicles and an RNA-binding protein. [2B] The fusion protein described in 1B, wherein the protein present in the extracellular vesicles is a tetraspanin or an active fragment thereof. [3B] 2B. The fusion protein of 2B, wherein the tetraspanin is selected from the group consisting of CD63, CD9 and CD81. [4B] The fusion protein according to any one of 1B to 3B, wherein the RNA-binding protein is selected from the group consisting of MS2 or an active fragment thereof, CAS or an active fragment thereof, L7Ae or an active fragment thereof, λ bacteriophage antiterminator protein N or an active fragment thereof, and HuR or an active fragment thereof. [5B] A fusion protein described in any one of 1B to 4B, which is bound to a nucleic acid that affects the properties of extracellular vesicles. [6B] The nucleic acid that affects the properties of the extracellular vesicles (1) Nucleic acids present within or on the surface of extracellular vesicles that alter the amount of endogenous proteins; (2) nucleic acids that promote or inhibit the secretion of extracellular vesicles; (3) nucleic acids that affect the lipid membranes that make up the extracellular vesicle membrane; and (4) A nucleic acid for making an exogenous protein present within or on the surface of an extracellular vesicle; [7B] The fusion protein according to 5B or 6B, wherein the nucleic acid that affects the dynamics of extracellular vesicles comprises mRNA or ncRNA (including miRNA, siRNA, shRNA, gRNA, snRNA, and snoRNA). [8B] An extracellular vesicle comprising a fusion protein described in any one of 1B to 7B. [9B] Extracellular vesicles according to 8B, having an average diameter of 30 nm or more and 150 nm or less.

[0015] [1C] (Library construction method) 1. A method for producing a library of extracellular vesicles containing barcode RNA, comprising: (1) We expressed a fusion protein containing a protein present in extracellular vesicles and an RNA-binding protein in extracellular vesicle-secreting cells. (a) an expression vector that expresses multiple types of barcode RNA; or (b) Multiple barcode RNAs introducing (2) culturing the extracellular vesicle-secreting cells in a culture medium; and (3) recovering extracellular vesicles containing the barcode RNA bound to the fusion protein from the culture supernatant of the extracellular vesicle-secreting cells; method. [2C] The method described in 1C, wherein the protein present in the extracellular vesicles is a tetraspanin or an active fragment thereof. [3C] The method of 2C, wherein the tetraspanin is selected from the group consisting of CD63, CD9 and CD81. [4C] The method of any one of 1C to 3C, wherein the RNA-binding protein is selected from the group consisting of MS2 or an active fragment thereof, dCas9 or an active fragment thereof, L7Ae or an active fragment thereof, λ bacteriophage antiterminator protein N or an active fragment thereof, and HuR or an active fragment thereof. [5C] The method of any one of 1C to 4C, wherein the barcode RNA comprises mRNA or ncRNA (including miRNA, siRNA, shRNA, gRNA, snRNA, and snoRNA). [6C] The method of 5C, wherein the barcode RNA further comprises a recognition sequence for an RNA-binding protein. [7C] The method according to any one of 1C to 6C, wherein the extracellular vesicle-secreting cells are selected from the group consisting of HEK293 cells, stem cells, epithelial cells, endothelial cells, fibroblasts, cancer cells, immune cells, nerve cells, and plant cells.

[0016] [1D] (Library screening method (1): Identification of factors involved in changes in secretion levels) A method for screening an agent that promotes or inhibits the secretion of extracellular vesicles containing proteins present in extracellular vesicles in an extracellular vesicle-secreting cell, comprising: (1) The extracellular vesicle-secreting cells are subjected to expression of a fusion protein comprising a protein present in the extracellular vesicles and an RNA-binding protein. (a) an expression vector that expresses multiple types of barcode RNA; or (b) Multiple barcode RNAs introducing (2) culturing the extracellular vesicle-secreting cells in a culture medium; (3) recovering extracellular vesicles containing the barcode RNA bound to the fusion protein from the culture supernatant of the extracellular vesicle-secreting cells; (4) recovering barcode RNA from the recovered extracellular vesicles; (5) recovering barcode RNA from the cultured extracellular vesicle-secreting cells; (6) determining the sequences of the multiple barcode RNAs recovered in step (4) and calculating the quantitative ratio of each barcode RNA; and (7) a method comprising a step of determining the sequences of the multiple types of barcode RNA recovered in step (5) and calculating the quantitative ratio of each barcode RNA; Preferably, the quantitative ratio calculated in step (6) is compared with the quantitative ratio calculated in step (7), barcode RNAs with altered quantitative ratios are identified, and factors that promote or inhibit the secretion of extracellular vesicles containing proteins present in the extracellular vesicles are identified from the sequence information contained in the identified barcode RNAs. [1D2] (Library screening method (2): Identification of factors that affect the secretion of EVs displaying specific proteins, or factors that affect the protein sorting process that displays specific proteins on the EV membrane) A method for screening factors that promote or inhibit the secretion of extracellular vesicles in which a specific protein is localized on the surface of extracellular vesicles, or factors that affect the localization of a specific protein on the membrane surface of extracellular vesicles, in extracellular vesicle-secreting cells, comprising: (1) A fusion protein containing a protein present in extracellular vesicles and an RNA-binding protein is expressed in the extracellular vesicle-secreting cells, (a) an expression vector that expresses multiple types of barcode RNA; or (b) Multiple barcode RNAs introducing (2) culturing the extracellular vesicle-secreting cells in a culture medium; (3) selectively recovering extracellular vesicles on the surface of which the specific protein is present from the culture supernatant of the extracellular vesicle-secreting cells; (4) recovering barcode RNA from the recovered extracellular vesicles; (5) recovering barcode RNA from the cultured extracellular vesicle-secreting cells; (6) determining the sequences of the multiple barcode RNAs recovered in step (4) and calculating the quantitative ratio of each barcode RNA; and (7) a method comprising a step of determining the sequences of the multiple types of barcode RNA recovered in step (5) and calculating the quantitative ratio of each barcode RNA; Preferably, the quantitative ratio calculated in step (6) is compared with the quantitative ratio calculated in step (7) to identify barcode RNAs with altered quantitative ratios, and from the sequence information contained in the identified barcode RNAs, factors that promote or inhibit the secretion of extracellular vesicles on the surface of which the specific protein is present, or factors that affect the localization of the specific protein on the membrane surface of extracellular vesicles, are identified. [1D3] The method according to 1D2, wherein the specific protein is selected from the group consisting of tetraspanin, integrin, and IFITM3 (interferon-induced transmembrane protein). [2D] The method of any one of 1D, 1D2, and 1D3, wherein the protein present in the extracellular vesicles is a tetraspanin or an active fragment thereof. [3D] 2D. The method of 2D, wherein the tetraspanin is selected from the group consisting of CD63, CD9, and CD81. [4D] The method of any one of 1D, 1D2, 1D3, 2D, and 3D, wherein the RNA-binding protein is selected from the group consisting of MS2 or an active fragment thereof, CAS or an active fragment thereof, L7Ae or an active fragment thereof, λ bacteriophage antiterminator protein N or an active fragment thereof, and HuR or an active fragment thereof. [5D] The method according to any one of 1D, 1D2, 1D3, and 2D to 4D, wherein the barcode RNA comprises mRNA or ncRNA (including miRNA, siRNA, shRNA, gRNA, snRNA, and snoRNA). [6D] The method of 5D, wherein the barcode RNA further comprises a recognition sequence for an RNA-binding protein. [7D] The method according to any one of 1D, 1D2, 1D3, and 2D to 6D, wherein the extracellular vesicle-secreting cells are selected from the group consisting of HEK293 cells, stem cells, epithelial cells, endothelial cells, fibroblasts, cancer cells, immune cells, nerve cells, and plant cells.

[0017] [1E] (Library Screening Method (3-1): Identification of Factors Affecting the Half-Life or Dynamics of Extracellular Vesicles in Body Fluids) A method for screening a factor that contributes to the stability of extracellular vesicles in body fluids or a factor that promotes or inhibits the secretion of extracellular vesicles into body fluids, comprising: (1) preparing a library containing multiple types of fusion proteins each containing a protein present in extracellular vesicles and an RNA-binding protein, and extracellular vesicles each containing a barcode RNA bound to the fusion protein; (2) administering the library containing the plurality of types of extracellular vesicles to a subject (including humans, non-human animals (including mice and rats), plants, and microorganisms) (preferably, in the case of humans or non-human animals, administering the library orally, intravenously, intramuscularly, subcutaneously, transdermally, nasally, pulmonary, or by enema); (3) isolating a subject's body fluid (e.g., in the case of a human or non-human animal, blood (including whole blood, serum, and plasma), saliva, urine, amniotic fluid, cerebrospinal fluid, pericardial spleen, pleural effusion, ascites, stool, sweat, or semen) and extracting RNA (here, extracellular vesicles may be isolated from the isolated body fluid, and RNA may be extracted from the isolated extracellular vesicles); and (4) detecting barcode RNA from the extracted RNA; Preferably, the quantitative ratio of each barcode RNA detected in step (4) is compared with the quantitative ratio of each barcode RNA in the multiple types of extracellular vesicles prepared in step (1), and barcode RNAs with altered quantitative ratios are identified. From the sequence information contained in the identified barcode RNAs, factors that promote or inhibit the secretion of extracellular vesicles are identified. [2E] The method described in 1E, wherein the protein present in the extracellular vesicles is a tetraspanin or an active fragment thereof. [3E] The method of 2E, wherein the tetraspanin is selected from the group consisting of CD63, CD9, and CD81. [4E] The method of any one of 1E to 3E, wherein the RNA-binding protein is selected from the group consisting of MS2 or an active fragment thereof, CAS or an active fragment thereof, L7Ae or an active fragment thereof, λ bacteriophage antiterminator protein N or an active fragment thereof, and HuR or an active fragment thereof. [5E] The method of any one of 1E to 4E, wherein the barcode RNA comprises mRNA or ncRNA (including miRNA, siRNA, shRNA, gRNA, snRNA, and snoRNA). [6E] The method of 5E, wherein the barcode RNA further comprises a recognition sequence for the RNA-binding protein.

[0018] [1F] (Library Screening Method (3-2): Identification of Factors Affecting Targeting of Extracellular Vesicles to Each Tissue or Body Fluid) A method for screening factors that affect the efficiency of targeting extracellular vesicles to tissues, comprising: (1) preparing a library containing multiple types of fusion proteins containing a protein present in extracellular vesicles and an RNA-binding protein, and extracellular vesicles containing barcode RNA bound to the fusion protein; (2) administering the library containing the multiple types of extracellular vesicles to a subject (human or non-human animal (including mouse or rat)), preferably by oral, intravenous, intramuscular, subcutaneous, transdermal, nasal, or pulmonary administration; (3) isolating tissue or fluid from a subject and extracting RNA; and (4) detecting barcode RNA from the extracted RNA; Preferably, the quantitative ratio of each barcode RNA detected in step (4) is compared with the quantitative ratio of each barcode RNA in the multiple types of extracellular vesicles prepared in step (1) to identify barcode RNAs with altered quantitative ratios, and factors that affect the efficiency of targeting of extracellular vesicles to the tissue or body fluid are identified from information on the sequences contained in the identified barcode RNAs. [2F] The method described in 1F, wherein the protein present in the extracellular vesicles is a tetraspanin or an active fragment thereof. [3F] The method of 2F, wherein the tetraspanin is selected from the group consisting of CD63, CD9 and CD81. [4F] The method of any one of 1F to 3F, wherein the RNA-binding protein is selected from the group consisting of MS2 or an active fragment thereof, CAS or an active fragment thereof, L7Ae or an active fragment thereof, λ bacteriophage antiterminator protein N or an active fragment thereof, and HuR or an active fragment thereof. [5F] The method of any one of 1F to 4F, wherein the barcode RNA comprises mRNA or ncRNA (including miRNA, siRNA, shRNA, gRNA, snRNA, and snoRNA). [6F] The method of 5F, wherein the barcode RNA further comprises a recognition sequence for the RNA-binding protein. [7F] The method of any one of 1F to 6F, wherein the tissue is selected from the group consisting of tumor tissue, nervous tissue, and immune tissue.

[0019] [1G] (Library screening method (3-3): Identification of factors affecting extracellular vesicle targeting in cultured cells (including primary cultured cells)) A method for screening factors that affect the efficiency of targeting extracellular vesicles to cells, comprising: (1) preparing a plurality of types of extracellular vesicles each containing a fusion protein including a protein present in extracellular vesicles and an RNA-binding protein, and a barcode RNA bound to the fusion protein; (2) administering the multiple types of extracellular vesicles to cells; (3) extracting RNA from the cells; (4) detecting barcode RNA from the extracted RNA; Preferably, the quantitative ratio of each barcode RNA detected in step (4) and The quantitative ratios of each barcode RNA in the multiple types of extracellular vesicles prepared in step (1) are compared to identify barcode RNAs with altered quantitative ratios, and factors that affect the efficiency of targeting extracellular vesicles to the cells are identified from information on the sequences contained in the identified barcode RNAs. [2G] The method described in 1G, wherein the protein present in the extracellular vesicles is a tetraspanin or an active fragment thereof. [3G] 2G. The method of 2G, wherein the tetraspanin is selected from the group consisting of CD63, CD9 and CD81. [4G] The method according to any one of 1G to 3G, wherein the RNA-binding protein is selected from the group consisting of MS2 or an active fragment thereof, CAS or an active fragment thereof, L7Ae or an active fragment thereof, λ bacteriophage antiterminator protein N or an active fragment thereof, and HuR or an active fragment thereof. [5G] The method according to any one of 1G to 4G, wherein the barcode RNA comprises mRNA or ncRNA (including miRNA, siRNA, shRNA, gRNA, snRNA, and snoRNA). [6G] The method according to 5G, wherein the barcode RNA further comprises a recognition sequence for the RNA-binding protein. [7G] The method according to any one of 1G to 6G, wherein the cells are selected from stem cells, epithelial cells, endothelial cells, fibroblasts, cancer cells, immune cells and neural cells, and cell lines established therefrom.

[0020] [1H] An agent for promoting the secretion of extracellular vesicles, comprising an active ingredient selected from the group consisting of inhibitors of PI4KA (Phosphatidylinositol 4-kinase alpha), inhibitors of CYB5B (Cytochrome B5 Type B), inhibitors of PIK3C3 (Phosphatidylinositol 3-Kinase Catalytic Subunit Type 3), inhibitors of PTPN23 (Protein Tyrosine Phosphatase Non-Receptor Type 23), inhibitors of PIK3R4 (Phosphoinositide-3-Kinase Regulatory Subunit 4), and inhibitors of METAP1 (Methionyl Aminopeptidase 1). [2H] The secretion promoter of extracellular vesicles described in 1H, wherein the extracellular vesicles express CD63. [3H] An extracellular vesicle secretion promoter according to 1H or 2H, wherein the PI4KA inhibitor is GSK-A1 (5-(2-amino-1-(4-morpholinophenyl)-1H-benzo[d]imidazol-6-yl)-N-(2-fluorophenyl)-2-methoxypyridine-3-sulfonamide). [4H] A secretion promoter for extracellular vesicles described in any one of 1H to 3H for liquid biopsy.

[0021] [1H1] A method for promoting the secretion of extracellular vesicles by administering an active ingredient selected from the group consisting of inhibitors of PI4KA (Phosphatidylinositol 4-kinase alpha), inhibitors of CYB5B (Cytochrome B5 Type B), inhibitors of PIK3C3 (Phosphatidylinositol 3-Kinase Catalytic Subunit Type 3), inhibitors of PTPN23 (Protein Tyrosine Phosphatase Non-Receptor Type 23), inhibitors of PIK3R4 (Phosphoinositide-3-Kinase Regulatory Subunit 4), and inhibitors of METAP1 (Methionyl Aminopeptidase 1) to a subject (human, non-human animal, higher plant, or cells or tissues thereof) in vivo or in vitro. [2H1] The method for promoting secretion of extracellular vesicles described in 1H1, wherein the extracellular vesicles express CD63. [3H1] A method for promoting the secretion of extracellular vesicles according to 2H1, wherein the PI4KA inhibitor is GSK-A1 (5-(2-amino-1-(4-morpholinophenyl)-1H-benzo[d]imidazol-6-yl)-N-(2-fluorophenyl)-2-methoxypyridine-3-sulfonamide). [4H1] A method for promoting secretion of extracellular vesicles described in any one of 1H1 to 3H1, which are administered for liquid biopsy.

[0022] [1H2] An active ingredient selected from the group consisting of inhibitors of PI4KA (Phosphatidylinositol 4-kinase alpha), inhibitors of CYB5B (Cytochrome B5 Type B), inhibitors of PIK3C3 (Phosphatidylinositol 3-Kinase Catalytic Subunit Type 3), inhibitors of PTPN23 (Protein Tyrosine Phosphatase Non-Receptor Type 23), inhibitors of PIK3R4 (Phosphoinositide-3-Kinase Regulatory Subunit 4), and inhibitors of METAP1 (Methionyl Aminopeptidase 1), for use as a sensitizer for cancer diagnosis by liquid biopsy. [2H2] The active ingredient for the use described in 1H2, wherein the extracellular vesicles express CD63. [3H2] An active ingredient for use according to 2H2, wherein the PI4KA inhibitor is GSK-A1 (5-(2-amino-1-(4-morpholinophenyl)-1H-benzo[d]imidazol-6-yl)-N-(2-fluorophenyl)-2-methoxypyridine-3-sulfonamide).

[0023] [1H3] Use of an active ingredient selected from the group consisting of PI4KA (Phosphatidylinositol 4-kinase alpha) inhibitors, CYB5B (Cytochrome B5 Type B) inhibitors, PIK3C3 (Phosphatidylinositol 3-Kinase Catalytic Subunit Type 3) inhibitors, PTPN23 (Protein Tyrosine Phosphatase Non-Receptor Type 23) inhibitors, PIK3R4 (Phosphoinositide-3-Kinase Regulatory Subunit 4) inhibitors, and METAP1 (Methionyl Aminopeptidase 1) inhibitors in the manufacture of an agent for promoting the secretion of extracellular vesicles in vivo or in vitro. [2H3] Use of extracellular vesicles according to 1H3 in the manufacture of a secretagogue, wherein the extracellular vesicles express CD63. [3H3] Use in the manufacture of an agent for promoting the secretion of extracellular vesicles according to 2H3, wherein the PI4KA inhibitor is GSK-A1 (5-(2-amino-1-(4-morpholinophenyl)-1H-benzo[d]imidazol-6-yl)-N-(2-fluorophenyl)-2-methoxypyridine-3-sulfonamide). [4H3] Use of extracellular vesicles described in any one of 1H3 to 3H3 in the manufacture of a secretagogue to be administered for liquid biopsy.

[0024] [1I] An inhibitor of the secretion of extracellular vesicles containing an inhibitor of MMAA (Metabolism of Cobalamin Associated A). [1I1] A method for inhibiting the secretion of extracellular vesicles by administering an inhibitor of MMAA (Metabolism of Cobalamin Associated A) to a subject (human, non-human animal, higher plant, or their cells or tissues) in vivo or in vitro. [1I2] Inhibitors of MMAA (Metabolism Of Cobalamin Associated A) for use in cancer treatment. [1I3] Use of an inhibitor of Metabolism of Cobalamin Associated A (MMAA) in the manufacture of an inhibitor of extracellular vesicle secretion. [Effects of the Invention]

[0025] The present invention can be useful for the development of an efficient drug delivery system using extracellular vesicles, biology research on extracellular vesicles, and drug discovery research targeting the extracellular vesicle secretion pathway. [Brief explanation of the drawings]

[0026] [Figure 1] Evaluation of barcoded CD63-MS2-expressing EVs [Figure 2] CD63-MS2 expressing EV library (for gRNA and random peptide-Lamp2b) and CD63-dCas9 expressing EV library [Figure 3] gRNAs whose composition ratios in the blood increased significantly [Figure 4] Screening of factors that promote / inhibit EV secretion using barcoded EVs (1) [Figure 5] Screening of factors that promote / inhibit EV secretion using barcoded EVs (2) [Figure 6] Enhancement of secretion of CD63-positive EVs by PI4KA inhibitors DETAILED DESCRIPTION OF THE INVENTION

[0027] The following embodiments and specific examples of the present invention are intended to illustrate preferred embodiments of the present invention and are presented for illustrative or explanatory purposes only, and are not intended to limit the present invention. It will be apparent to those skilled in the art that various changes and modifications can be made based on the description in this specification within the spirit and scope of the present invention disclosed herein. In the present disclosure, "comprising" aspects include "essentially comprising" and "consisting of" aspects.

[0028] One embodiment of the present invention is a nucleic acid encoding a fusion protein comprising a protein present in extracellular vesicles and an RNA-binding protein; or a fusion protein comprising a protein present in extracellular vesicles and an RNA-binding protein.

[0029] Extracellular (secretory) vesicles (EVs) are vesicles used to release intracellular substances extracellularly and are formed by a phospholipid bilayer. Examples of lipid compositions include sphingomyelin and phosphatidylserine. Their size ranges from 10 nm to 10 μm, 30 nm to 5,000 nm, or 50 nm to 3,000 nm in diameter. Small EVs (mainly including exosomes and microvesicles) with diameters of 10 nm or more, 20 nm or more, 30 nm or more, 40 nm or more, or 50 nm or more, and 500 nm or less, 400 nm or less, 300 nm, or 200 nm or less are preferred in the present invention, but are not limited thereto. Their origin is preferably derived from eukaryotes, but is not particularly limited thereto. Extracellular vesicles derived from humans, non-human mammals (including mice and rats), higher plants, and microorganisms (including enterobacteria) are preferred.

[0030] In the present invention, proteins present in extracellular vesicles are preferably extracellular vesicle markers, i.e., proteins whose detection proves the presence of (specific) extracellular vesicles (i.e., proteins that are abundantly present in extracellular vesicles or that are specifically present in extracellular vesicles). Their origin is not particularly limited, but they are preferably derived from humans, non-human mammals (including mice and rats), higher plants, or microorganisms (including enterobacteria).

[0031] According to Non-Patent Document 3, markers for mammalian extracellular vesicles are classified as follows: Membrane proteins or GPI-anchored proteins that can be used as marker proteins for extracellular vesicles include: 1) Non-tissue specific Tetraspanins (CD63, CD9, CD81, CD82), other multi-transmembrane proteins (CD47, heterotrimeric G proteins (GNAs): guanine nucleotide-binding proteins), etc. MHC class I (HLA-A / B / C, H2-K / D / Q), Integrins (ITGA / ITGB), transferrin receptor (TFR2); LAMP1 / 2; heparan sulfate proteoglycans (including syndecans (SDCs)); Extracellular matrix metalloproteinase inducer (EMMPRIN) (also known as BSG or CD147); ADAM10; CD73 (NT5E), a GPI-anchored 5' nucleotidase the GPI-anchored complement-binding proteins CD55 and CD59; Sonic hedgehog protein (SHH) 2) Cell / tissue specific Several tetraspanins: TSPAN8 (epithelial cell specific), CD37 and CD53 (leukocyte specific); PECAM1 (endothelial cell specific); ERBB2 (breast cancer specific); EPCAM (epithelial specific); CD90(THY1) (mesenchymal stem cell specific); CD45 (PTPRC) (immune cell specific), CD41 (ITGA2B) or CD42a (GP9) (platelet specific); glycophorin A (GYPA) (erythrocyte-specific); CD14 (monocyte specific), MHC class II (HLA-DR / DP / DQ, H2-A); CD3 (T cell specific); Acetylcholinesterase / AChE-S (neuron-specific), AChE-E (erythrocyte-specific); Amyloid βA4 / APP (neuron-specific); Examples include:

[0032] Cytoplasmic proteins that can be used as marker proteins for extracellular vesicles are ESCRT-I / II / III (TSG101, CHMP) and accessory proteins: ALIX (PDCD6IP), VPS4A / B; ARRDC1; flotillin-1 and 2 (FLOT1 / 2); caveolin (CAV); EHD; RHOA; Annexin A (ANXA); the heat shock proteins HSC70 (HSPA8) and HSP84 (HSP90AB1); ARF6; syntenin (SDCBP); Microtubule-associated protein tau (MAPT; neuron-specific) Examples include: In the present invention, proteins present in extracellular vesicles may be naturally occurring proteins (including polymorphisms, orthologs, and paralogs), or may be artificial mutants in which some amino acids have been added, substituted, or deleted, or may be fragments thereof (e.g., "exoTOPE"), although artificial mutants or fragments that do not change the localization of the protein are preferred.

[0033] An RNA-binding protein refers to a protein that can bind to RNA, either depending on or independent of the RNA sequence. The RNA-binding ability of the protein is preferably such that the dissociation constant (Kd) with RNA is 1 μM or less, 500 nM or less, 300 nM or less, 100 nM or less, 50 nM or less, 30 nM or less, 10 nM or less, 5 nM or less, 3 nM or less, 1 nM or less, 500 pM or less, 300 pM or less, 100 pM or less, 50 pM or less, 30 pM or less, 10 pM or less, 5 pM or less, or 3 pM or less. Bacteriophage MS2 coat protein (maturation gene product) (Kd = 3-300 nM with RNA containing the MS2 recognition sequence), CAS (CRISPR-associated gene) products (including Cas9 (SpCas9, SaCas9, and mutants lacking endonuclease activity (dCas9)); Kd = 10 pM with gRNA), Cpf1 (Cas12a, Cas13, etc.), L7Ae, λ bacteriophage antiterminator protein N, HuR (Human antigen Examples of RNA-binding proteins include RNA-binding proteins such as RNA-binding proteins R and R. They may be naturally occurring proteins (including polymorphisms, orthologs, and paralogs). Alternatively, they may be artificial mutants in which some amino acids have been added, substituted, or deleted, or fragments thereof. However, (active) artificial mutants or (active) fragments that maintain their RNA-binding ability are preferred (preferably having at least 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 100% or more of the binding ability of the corresponding naturally occurring protein).

[0034] In the present invention, the fusion protein of a protein present in extracellular vesicles and an RNA-binding protein may further contain a transcription factor, a transcription activator (e.g., VP64, p65, Rta, VPH), a transcription repressor (e.g., KRAB), or an active fragment thereof. It may also be fused with a labeling peptide (e.g., GFP, HisTag, etc.). The fusion protein of a protein present in extracellular vesicles and an RNA-binding protein may contain post-translational modifications (e.g., glycosylation, phosphorylation, etc.).

[0035] One embodiment of the present invention includes nucleic acids that affect the properties of extracellular vesicles.

[0036] Nucleic acids that affect the properties of extracellular vesicles can be determined by analyzing extracellular vesicles secreted from cells that contain the nucleic acid. (1) The amount of endogenous protein present within or on the surface of the secreted extracellular vesicles is changed compared to when the cells secreting the extracellular vesicles do not contain the nucleic acid; (2) The amount of extracellular vesicles secreted by cells that secrete extracellular vesicles changes compared to when the cells do not contain the nucleic acids; (3) affecting the lipid membrane that constitutes the extracellular vesicle membrane compared to when the cells secreting the extracellular vesicles do not contain the nucleic acid; (4) the exogenous protein encoded by the nucleic acid is present within or on the surface of the extracellular vesicle; Examples of such nucleic acids include nucleic acids that affect the following: The nucleic acid may be naturally occurring DNA or RNA, or a mixture thereof. It may also be a non-naturally occurring nucleic acid (for example, a nucleic acid in which some or all of the nucleotides are sulfur-modified (phosphorothioate) rather than phosphate ester (P) bonds, or a peptide nucleic acid (PNA)).

[0037] (1) includes nucleic acids encoding proteins such as nucleic acids encoding endogenous proteins themselves, nucleic acids encoding transcription factors that control the transcription of endogenous proteins, nucleic acids encoding factors involved in the post-translational modification of endogenous proteins, and nucleic acids encoding factors involved in the chaperoning of endogenous proteins (including folding and intracellular transport); antisense RNA (siRNA), miRNA (microRNA), shRNA (small hairpin RNA), and snRNA (small nuclear RNA) that positively or negatively regulate the expression of endogenous proteins; and nucleic acids for modifying genes encoding endogenous proteins using genome editing technologies (e.g., Zinc-Finger Nuclease (ZFN), Transcription Activator-Like Effector Nuclease (TALEN), Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) / Crispr Associated protein 9 (Cas9)), such as gRNAs used in CRISPR / Cas9 systems. (2) Examples include nucleic acids encoding factors that affect the amount of extracellular vesicles secreted, nucleic acids encoding factors that control the transcription, translation, and expression of factors that affect the amount of extracellular vesicles secreted themselves; antisense RNA, miRNA, shRNA, and snRNA that positively or negatively regulate the expression of factors that control the transcription, translation, and expression of factors that affect the amount of extracellular vesicles secreted or factors that affect the amount of extracellular vesicles secreted themselves, and nucleic acids for modifying genes encoding factors that control the transcription, translation, and expression of factors that affect the amount of extracellular vesicles secreted or factors that affect the amount of extracellular vesicles secreted themselves using genome editing technologies (e.g., ZFN, TALEN, CRISPR / Cas9) (e.g., gRNA used in the CRISPR / Cas9 system). Examples of (3) include nucleic acids encoding enzymes for synthesizing the lipid membranes that make up the extracellular vesicle membrane, nucleic acids encoding factors for controlling the transcription, translation, and expression of enzymes for synthesizing the lipid membranes that make up the extracellular vesicle membrane, and antisense RNA, miRNA, shRNA, and snRNA that negatively or positively regulate the expression of enzymes for synthesizing the lipid membranes that make up the extracellular vesicle membrane or factors for controlling the transcription, translation, and expression of enzymes for synthesizing the lipid membranes that make up the extracellular vesicle membrane, as well as nucleic acids for modifying genes encoding factors for controlling the transcription, translation, and expression of enzymes for synthesizing the lipid membranes that make up the extracellular vesicle membrane in genome editing technologies (e.g., ZFN, TALEN, CRISPR / Cas9, etc.) (e.g., gRNA used in the CLISPR / Cas9 system). (4) includes nucleic acids encoding foreign proteins.

[0038] In the present disclosure, nucleic acids that affect the properties of extracellular vesicles may include mRNA or ncRNA, and may further include a recognition sequence for an RNA-binding protein.

[0039] In the present disclosure, mRNA refers to RNA including RNA (cRNA; coding RNA) that has base sequence information and a structure that can be translated into a protein (or peptide), and includes not only naturally occurring mRNA but also RNA that does not contain an m7G cap at the 5' end or RNA that does not contain polyadenylation (polyA) at the 3' end. It also includes premature mRNA that, if properly spliced ​​in cells, will have the base sequence information and structure that can be translated into a protein.

[0040] Non-coding RNA (ncRNA) refers to RNA (functional nucleic acid) that does not have the base sequence information and structure that can be translated into protein but has some function in the body. It includes, but is not limited to, small nuclear RNA (snRNA) and small nucleolar RNA (snoRNA) that form complexes with proteins in the nucleus, as well as miRNA (including pre-miRNA) and siRNA (including pre-siRNA (e.g., shRNA (small hairpin RNA))) that bind to other RNAs. Furthermore, ncRNA may also contain guide RNA (gRNA; including single-stranded guide RNA) (RNA that guides the RNA:protein complex to the target nucleic acid molecule through complementary binding). In the CRISPR / Cas9 system in bacteria and archaea, gRNA functions as a complex of two types: crRNA (CRISPR RNA) that recognizes the target DNA sequence of approximately 20 bases, and tracrRNA (trans-activating crRNA) that serves as a scaffold for binding to Cas9. However, for genome editing, gRNA also includes a single guide RNA (sgRNA) that combines these two. When Cpf1 is used instead of Cas9, only the 41-44 base crRNA (with a recognition region of 21-24 bases) functions as gRNA.

[0041] The recognition sequence of an RNA-binding protein is a sequence to which the RNA protein can bind. The RNA protein may bind as a monomer, a multimer, or a heteromultimer with other factors. Examples of recognition sequences for RNA-binding proteins include, but are not limited to, ACAUGAGGAUCACCCAUGU (SEQ ID NO: 1) for MS2; CAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 2) for Cas9 as tracrRNA; GGGUACCGUGAUCCGAAAGGUGAGUACCC (SEQ ID NO: 3) for L7Ae; GCCCUGAAGAAGGGC (SEQ ID NO: 4) for LBAPN (λ bacteriophage antiterminator protein N); and AUUUACCCAUUUACCCAUUUACCCAUUUACCCAUUUACCCAUUUA (SEQ ID NO: 5) for HuR.

[0042] The cells secreting extracellular vesicles according to the present invention are not particularly limited as long as they are derived from eukaryotes, but are preferably derived from humans, non-human mammals (including mice and rats), or higher plants. Mammalian cells may include stem cells (including induced pluripotent stem cells (iPS cells), embryonic stem cells (ES cells), and somatic stem cells (including mesenchymal stem cells, adipose stem cells, hematopoietic stem cells, neural stem cells, vascular endothelial stem cells, hepatic stem cells, and epithelial stem cells)), cells obtained by inducing differentiation of stem cells, epithelial cells, endothelial cells, fibroblasts, cancer cells, immune cells (dendritic cells and blood cells), and nerve cells, as well as established cell lines of these cells. Cultured cells (e.g., HEK293T cells) may also be used.

[0043] One embodiment of the present invention is a method for producing a library of extracellular vesicles containing barcode RNAs and a screening method using the library. The screening method includes identifying specific barcode RNAs contained in the extracellular vesicles.

[0044] Barcode RNA is RNA containing mRNA and / or ncRNA, and its inclusion in intracellular vesicles enables the identification of intracellular vesicles.

[0045] In one embodiment of the present invention, a library of extracellular vesicles containing barcode RNA contains at least two types of extracellular vesicles, and the extracellular vesicles are identified by determining the sequences of the barcode RNAs encapsulated in them. Preferably, the library contains 5,000 or more types, 6,000 or more types, 7,000 or more types, 8,000 or more types, 9,000 or more types, or 10,000 or more types of extracellular vesicles. The method for introducing barcode RNA into cells is not particularly limited, and barcode RNA itself may be introduced into cells (for example, by microinjection, electroporation, or gene transfer using cationic liposomes), or an expression vector that expresses barcode RNA (such as a DNA vector or an RNA vector (including a viral vector)) may be introduced into cells and the barcode RNA may be transcribed within the cells. A library of extracellular vesicles can be obtained by collecting extracellular vesicles secreted from cells containing barcode RNA. For example, secreted extracellular vesicles can be collected from the cell culture supernatant. Furthermore, when recovering extracellular vesicles, a specific extracellular vesicle marker may be used as an indicator to recover only specific types of extracellular vesicles. For example, by using an antibody that recognizes a membrane protein such as a tetraspanin present in the membrane of the extracellular vesicles, only extracellular vesicles having the tetraspanin on their membrane surface can be recovered without destruction.

[0046] Barcode RNA is extracted from cells, tissues, body fluids, or extracellular vesicles and its sequence is determined. In the case of tissues or body fluids, extracellular vesicles may be isolated from these samples, and barcode RNA may then be extracted from the isolated extracellular vesicles. While not particularly limited, the extraction method is preferably carried out using an RNA isolation reagent such as TRIzol reagent, which is based on phenol and guanidine isothiocyanate, or a general-purpose RNA purification kit. The recovered barcode RNA is preferably amplified and then sequenced. Although not particularly limited, it is preferable to perform reverse transcription and amplification using multiple types of primers to improve the accuracy of the amplification.

[0047] The library screening method is (1) Identification of factors involved in changes in the secretion rate of extracellular vesicles (including factors involved in changes in the secretion rate of vesicles containing specific proteins); (2) Identification of factors involved in the localization of specific proteins in / on the membrane of extracellular vesicles; (3) Identification of factors affecting the half-life and dynamics of extracellular vesicles in body fluids; (4) Identification of factors that influence the targeting of extracellular vesicles to each tissue or each body fluid; (5) Identification of factors that influence the targeting of extracellular vesicles to specific cells (including primary cells); It can be used for the following purposes:

[0048] In (1) or (2), an expression vector that expresses barcode RNA or barcode RNA is introduced into extracellular vesicle-secreting cells, and the target factor can be identified by comparative analysis of the barcode RNA recovered from extracellular vesicles secreted by the extracellular vesicle-secreting cells after the introduction and the barcode RNA remaining in the extracellular vesicle-secreting cells. A specific drug may be administered to the extracellular vesicle-secreting cells, and the extracellular vesicles may be collected after a certain period of time to observe the effect of the drug on changes in the amount of extracellular vesicle secretion.

[0049] In (2), the recovered barcoded extracellular vesicle library is precipitated with an antibody (or antibody-bound beads) that recognizes a specific protein, and the barcode RNA in the extracellular vesicles, on whose surface the specific protein is present, is analyzed to identify factors involved in the localization of the specific protein in / on the membrane of the extracellular vesicles. Factors involved in the localization of the specific protein in / on the membrane of the extracellular vesicles include factors that affect the transcription / translation of the specific protein (e.g., transcription factors), factors involved in the post-translational modification of the specific protein (e.g., enzymes that perform glycosylation, including GPI anchor attachment), and factors involved in the chaperoning of the specific protein (including folding and intracellular transport). The specific protein is preferably a protein present on or in the membrane of extracellular vesicles, and may be the same as or different from the protein used for fusion with the RNA-binding protein. Examples include, but are not limited to, adhesion factors such as tetraspanins, various integrins, and interferon-induced transmembrane protein (IFITM3), which is one of the factors thought to link the relationship between cellular senescence and EVs.

[0050] In (3) and (4), the target factor can be identified by administering the library of extracellular vesicles prepared by the present invention to a subject, isolating the subject's tissue or body fluid after a certain period of time, and detecting barcode RNA in the isolated tissue or body fluid. In (5), the target factor can be identified by administering the library of extracellular vesicles prepared by the present invention to target cells, and detecting barcode RNA in the cells after a certain period of time. A specific drug may be administered to the subject (cells) before, after, or simultaneously with administering the library of extracellular vesicles to the subject (cells), and the effect of the drug may be observed by collecting extracellular vesicles after a certain period of time.

[0051] The body fluids in (3) and (4) include fluids present within the animal's body that fill the spaces between tissues, within body cavities, or within the ducts and circulatory system that are distributed throughout the body, as well as fluids secreted or excreted from the body, such as saliva, sweat, semen, and urine. These fluids include, but are not limited to, blood (including whole blood, serum, and plasma), saliva, urine, amniotic fluid, cerebrospinal fluid, pericardial effusion, pleural effusion, ascites, feces, sweat, and semen. (4) The tissue in question may be normal tissue (such as nervous tissue, immune tissue, muscle tissue, or tissues forming various organs, such as the digestive tract) of eukaryotes (including humans, non-human animals, and plants), or abnormal tissue such as benign or malignant tumor tissue (including blood cancer) or tissue infected with a pathogen. The cells in (5) are cells that can receive extracellular vesicles, and may be normal cells (differentiated or undifferentiated cells (including stem cells)) or abnormal cells such as cancer cells of eukaryotes (including humans, non-human animals, and plants), or cell lines established from these, plant cells (including callus cells), or unicellular microorganisms (including enterobacteria).

[0052] Such factors are identified by comparing the quantitative ratios of barcode RNA. Although not particularly limited, quantitative ratios of 1.5 times or more, 2 times or more, or 3 times or more, or 0.3 times or less, 0.5 times or less, or 0.67 times or less may be used as a guideline for identification. For example, the quantitative ratio of barcode RNA in a DNA library or RNA library (e.g., expression vector) used to prepare a library of extracellular vesicles may be compared with the quantitative ratio of barcode RNA recovered from cells, tissues, body fluids, or extracellular vesicles.

[0053] One embodiment of the present invention is an agent for promoting or inhibiting the secretion of extracellular vesicles in vitro or in vivo. The extracellular vesicles are preferably those that express tetraspanins (CD63, CD9, CD81, CD82) on their surface. Examples of agents that promote the secretion of extracellular vesicles include inhibitors of PI4KA (Phosphatidylinositol 4-kinase alpha), inhibitors of CYB5B (Cytochrome B5 Type B), inhibitors of PIK3C3 (Phosphatidylinositol 3-Kinase Catalytic Subunit Type 3), inhibitors of PTPN23 (Protein Tyrosine Phosphatase Non-Receptor Type 23), inhibitors of PIK3R4 (Phosphoinositide-3-Kinase Regulatory Subunit 4), and inhibitors of METAP1 (Methionyl Aminopeptidase 1). Examples of inhibitors of extracellular vesicle secretion include inhibitors of MMAA (Metabolism of Cobalamin Associated A). The inhibitor may be an miRNA (including pre-miRNA) or siRNA (pre-siRNA (e.g., shRNA (small hairpin RNA)) that suppresses the expression of these genes; or a low-molecular-weight compound (molecular weight of 2000 or less, preferably 1000 or less, more preferably 600 or less), aptamer, or antibody (including binding fragment) that binds to these gene products and suppresses their function. A preferred low molecular weight compound inhibitor of PI4KA (Phosphatidylinositol 4-kinase alpha) is GSK-A1 (5-(2-amino-1-(4-morpholinophenyl)-1H-benzo[d]imidazol-6-yl)-N-(2-fluorophenyl)-2-methoxypyridine-3-sulfonamide).

[0054] Liquid biopsy, primarily used in the field of cancer, is a technology for diagnosing and predicting therapeutic efficacy using bodily fluid samples such as blood (including whole blood, serum, and plasma), saliva, urine, amniotic fluid, cerebrospinal fluid, pericardial pancreas, pleural effusion, ascites, and stool, instead of conventional biopsies that use endoscopes and needles to collect tumor tissue. Research is being conducted into diagnosing and predicting therapeutic efficacy by detecting circulating free DNA, circulating tumor DNA, circulating free RNA, extracellular vesicles, and other substances present in bodily fluids. The extracellular vesicle secretion promoter of the present invention can improve the accuracy of liquid biopsy diagnoses and predicting therapeutic efficacy by promoting the secretion of extracellular vesicles secreted by cancer cells and other cells.

[0055] Inhibitors of extracellular vesicle secretion can be applied to cancer therapy. Inhibiting extracellular vesicle secretion not only suppresses cancer metastasis, but also prevents the primary tumor from secreting small EVs to program its surroundings and affect the primary tumor itself. [Example]

[0056] A. Materials and Methods <Fusion protein expression vector> 1.CD63-L7Ae A vector plasmid (pRK320) expressing the CD63-L7Ae fusion protein (SEQ ID NO: 6) was constructed by introducing a sequence encoding the CD63-L7Ae fusion protein under the EF-1α promoter of the pSBbi-GH vector (addgene, plasmid #60514; hygromycin resistance gene + EGFP co-expression type). 2.CD63-MS2 A vector plasmid (pKK47:pSBbi-GH CD63-MS2) expressing the CD63-MS2 fusion protein (SEQ ID NO: 7) was constructed by introducing a sequence encoding the CD63-MS2 fusion protein into the SfiI restriction enzyme recognition site under the EF-1α promoter of the pSBbi-GH vector (addgene, plasmid #60514; hygromycin resistance gene + EGFP co-expression type). 3.CD63-dCas9 A vector plasmid (pKK60:pSBbi-GH CD63-dCas9) expressing the CD63-dCas9 fusion protein (SEQ ID NO: 8) was constructed by introducing a sequence encoding the CD63-dCas9 fusion protein into the SfiI restriction enzyme recognition site under the EF-1α promoter of the pSBbi-GH vector (addgene, plasmid #60514; hygromycin resistance gene + EGFP co-expression type). 4.CD9-dCas9 A vector plasmid (pKK106:pSBbi-GH CD9-dCas9) expressing the CD9-dCas9 fusion protein (SEQ ID NO: 9) was constructed by introducing a sequence encoding the CD9-dCas9 fusion protein into the SfiI restriction enzyme recognition site under the EF-1α promoter of the pSBbi-GH vector (addgene, plasmid #60514; hygromycin resistance gene + EGFP co-expression type).

[0057] <CRISPR Vector> 1. Cas9 (for knockout) The vector plasmid (pRK300:pSBbi-RB Cas9) that expresses SpCas9-NLS-FLAG (SEQ ID NO: 10) was prepared by introducing the sequence encoding the Cas9 fusion protein into the SfiI restriction enzyme recognition site under the EF-1α promoter of the pSBbi-RB vector (addgene, plasmid#60522; blasticidin resistance gene + RFP co-expression type). 2. dCas9-VPR (for enhancing expression) The vector plasmid (pKK56:pSBbi-RB dCas9-VPR) that expresses the dCas9-VPR fusion protein (SEQ ID NO: 11) was prepared by introducing the sequence encoding the dCas9-VPR fusion protein under the EF-1α promoter of the pSBbi-RB vector (addgene, plasmid#60522; blasticidin resistance gene + RFP co-expression type).

[0058] <Preparation of EV-producing cells> HEK293T cells were transfected with the vector for expressing the fusion protein (pRK320:CD63-L7Ae; pKK47:CD63-MS2; or pKK60:CD63-dCas9) and, if necessary, the CRISPR vector (pRK300 or pKK56), selected with drug resistance, and a stable expression strain was established.

[0059] <Library for each fusion protein> 1. Library for CD63-L7Ae (for CRISPRa (expression amplification)) The gRNA backbone sequence (SEQ ID NO: 12) containing the L7Ae recognition sequence site (C / D box) was created by oligo annealing and cloned into the BlpI-XhoI site of pCRISPRia-v2 (addgene, plasmid #84832). From the resulting plasmid, the BlpI-NheI sequence containing the L7Ae recognition sequence site (C / D box) and the gRNA backbone region was excised and cloned into the addgene Membrane Proteins - gRNA pooled library (1.2x10) of the Human Subpooled CRISPRi-v2 Libraries series. 4 species) (addgene, plasmid #83976) or the addgene Membrane Proteins - gRNA pooled library (1.2x10 4 By cloning the gene into the same restriction enzyme site of the L7Ae gene (species) (addgene, plasmid #83985), a library vector is created that transcribes RNA bound to the gRNA and the sequence recognized by the L7Ae protein.

[0060] 2(1). CD63-MS2 Library (CRISPRa (Expression Amplification)) Using the sgRNA (MS2) cloning backbone (addgene, plasmid #61424) as a template, the gRNA backbone sequence containing the MS2 recognition sequence (two MS2 boxes) was amplified by PCR to include BlpI and XhoI recognition sequences at both ends. This was then cloned into the BlpI-XhoI site of pCRISPRia-v2 (addgene, plasmid #84832). From the resulting plasmid (pKK66), a BlpI-NheI fragment containing the MS2 recognition sequence (two MS2 boxes) and the gRNA backbone region was excised and used as a library insert for the addgene Membrane Proteins - gRNA pooled library (1.3x10 4A vector library for transcribing gRNA containing a sequence recognized by the MS2 protein was prepared by cloning the vector into the same restriction enzyme recognition site of the MS2 protein (addgene, plasmid #83976). Separately, vectors expressing gRNAs for CD274, CD47, CD55, CD59, CD81, ICAM1, ITGAL, LRP1, and IL1B (one or two types for each gene) were also constructed. The gRNA-encoding sequences contained in each vector are shown in Table 1 below. [Table 1]

[0061] 2(2). CD63-MS2 library (a library displaying random peptides on the extracellular domain of Lamp2b) Using pCRISPRia-v2 (addgene plasmid #84832) as a backbone, we introduced a bidirectional promoter (amplified from pSBbi-RB addgene #60522) sequence, three MS2 recognition sequences, a sequence encoding RVGLamp2b (pcDNA GNSTM-3-RVG-10-Lamp2b-HA; addgene, plasmid #71294, modified to include the desired restriction enzyme recognition sequences), and a sequence encoding bGHpolyA into the NheI / SbfI digestion site (where the region between the cPPT and PuroR coding sequences is removed). The RPBSA promoter in the bidirectional promoter was inserted in the forward direction relative to PuroR, while the EF1a promoter, three MS2 recognition sequences, RVGLamp2b, and bGHpolyA were inserted in the reverse direction. The portion encoding the RVG peptide was then excised by restriction enzyme treatment, and a synthetic oligonucleotide library (NDT codon set; 12x4 = 20,736 types) encoding random peptides (4mers) was introduced instead to create a library (pSF63) for expressing a random peptide-Lamp2b fusion protein (sequence number 34).

[0062] 3. CD63-dCas9 Library Existing gRNA libraries can be used as libraries for CD63-dCas9. In this example, the addgene Membrane Proteins - gRNA pooled library (1.3x10 4 In addition to the Human CRISPR Knockout Pooled Library (GeCKOv2) (addgene, Pooled Library #1000000048) and the Bassik Human CRISPR Knockout library (Non-Patent Document 14), Drug Targets, Kinases, Phosphatases (DTKP library) (10 gRNAs / gene, total 24,569 gRNA species (2,323 target genes), addgene, Pooled library # 101927) (both for CRISPR knockout) were used.

[0063] Lenti-X® 293T cells (Takara Bio, Japan) were transfected with each plasmid library or gRNA plasmid for each individual gene, as well as the lentiviral packaging plasmids psPAX2 (addgene, plasmid #122260) and pMD2.G (addgene, plasmid #12259). After 6–16 hours of culture, the medium was replaced. After 48 hours of culture, the culture supernatant was filtered to collect the lentivirus-containing solution. The collected lentivirus was then used to infect EV-producing cells. The lentivirus titer (MOI) was determined by monitoring a fluorescent marker encoded separately in the library expression cassette or by performing a cell viability assay using an antibiotic resistance gene encoded separately in the library expression cassette.

[0064] <Lentiviral infection and EV production> EV-producing cells were infected with the lentivirus according to the measured titer. After infection, the cells were cultured in the presence of puromycin for at least 4 days. The culture medium was then replaced with OptiMEM® medium (Thermo Fisher Scientific, Japan), and after 48 hours of culture, the culture supernatant containing extracellular vesicles was collected. The supernatant was then centrifuged at 300 G for 5 minutes, followed by 1500 G for 10 minutes, and the cells and cell debris were removed by passing the supernatant through a 0.22 μm filter. Extracellular vesicles were then purified and concentrated from the supernatant by ultracentrifugation.

[0065] <Barcode RNA sequence analysis method> 1. RNA from the CD63-L7Ae gRNA library RNA was extracted from the recovered extracellular vesicles or EV-producing cells using TRIzol and reverse-transcribed in the presence of LNA (2'-4' bridged nucleic acid, AAGCAGTGGTATCAACGCAGAGTACrGrG+G) (SEQ ID NO: 13; bases marked with "r" are RNA bases, and bases marked with "+" are LNA bases) using the reverse transcription primer AAAGCACCGACTCGGTGCCAC (SEQ ID NO: 14) and a reverse transcriptase with template switching activity. The reverse transcription product was amplified by PCR using oligonucleotides with Fw and Rev primers, each containing an adapter sequence for next-generation sequencing and a barcode for sample multiplexing. The amplified DNA was analyzed using an Ion Proton or Illumina Hiseq X Ten to determine the sequence of each gRNA and calculate its quantitative ratio. 2(1).RNA derived from the CD63-MS2 gRNA library RNA was extracted from the recovered extracellular vesicles or EV-producing cells using TRIzol and reverse transcribed using the reverse transcription primer AAAGCACCGACTCGGTGCCAC (SEQ ID NO: 14) and a reverse transcriptase with template switching activity in the presence of LNA (SEQ ID NO: 13). The reverse transcription product was amplified by PCR using oligonucleotides Fw and Rev primers containing an adapter sequence for next-generation sequencing and a barcode for sample multiplexing. The amplified DNA was analyzed using Ion Proton or Illumina Hiseq X Ten to determine the sequence of each gRNA and calculate its quantitative ratio. 2(2). RNA from the random peptide-Lamp2b library for CD63-MS2 RNA was extracted from the recovered extracellular vesicles or EV-producing cells using TRIzol, reverse transcribed using the reverse transcription primer atttgcataaaggcaagtgg (SEQ ID NO: 15) and reverse transcriptase, and PCR amplified using oligo DNA with next-generation sequencing adapters attached to the Fw primer and Rev primer. Analysis was performed using Ion Proton, and the quantitative ratio was calculated. 3. RNA from the CD63-dCas9 library (when using addgene Pooled Library #83976, #1000000048, or #101927) RNA was extracted from the recovered extracellular vesicles using TRIzol and reverse transcribed using the reverse transcription primer TTTTTCAAGTTGATAACGGACTAGCC (SEQ ID NO: 16) and a reverse transcriptase with template switching activity in the presence of LNA (2'-4' bridged nucleic acid, AAGCAGTGGTATCAACGCAGAGTACrGrG+G) (SEQ ID NO: 13). The reverse transcription product was amplified by PCR using oligonucleotides fused to the Fw and Rev primers, each containing an adapter sequence for next-generation sequencing and a barcode for sample multiplexing. The amplified DNA was analyzed using an Ion Proton or Illumina Hiseq X Ten to determine the sequence of each gRNA and calculate its quantitative ratio.

[0066] B. Evaluation of barcoded CD63-MS2-expressing extracellular vesicles To examine the blood retention of CD63-MS2-expressing extracellular vesicles, the following experiment was performed. CD63-MS2 EV-producing cells (HEK293T CD63-MS2, dCas9-VPR expressing cell line) were transfected separately with vectors expressing gRNAs for CD274, CD47, CD55, CD59, CD81, ICAM1, ITGAL, LRP1, and IL1B (one or two types of each gene), and the culture supernatants containing extracellular vesicles were collected and mixed. Extracellular vesicles were purified from the collected culture supernatant by ultracentrifugation, and a total of approximately 1 x 10 11 ~10 12 The cells were suspended in PBS to a concentration of vesicles / mL. 100 μL of the prepared EV solution was injected into Jcl:ICR mice via the tail vein. Two minutes after intravenous injection, the mice were euthanized with CO2, and whole blood was collected from the mice. Serum was obtained using microtainer blood collection tubes (BD). Extracellular vesicles were isolated from the serum using Total Exosome Isolation Reagent (Thermo Fisher Scientific, Japan). RNA was extracted from the isolated extracellular vesicles using TRIzol reagent, reverse transcribed, and amplified. The sequence of each gRNA was determined, and the quantitative ratio was calculated (t = 2 min). As a control (t=0), the EV solution prepared before injection into mice was treated in the same manner except for the isolation of EVs from serum using total exosome isolation reagent. The sequences of each gRNA were determined and their quantitative ratios were calculated. The amount of each gRNA recovered from the blood was then calculated, assuming the control as 1. As a result, all 17 types of gRNAs used were detected, and their quantitative ratios were stably detected (Figure 1).

[0067] C. CD63-MS2-expressing EV library and CD63-dCas9-expressing EV library For the CD63-MS2 expressing EV library (for gRNA), addgene #83985, Human Subpooled CRISPRa-v2 Libraries Membrane Proteins - gRNA pooled library (1.3x10 4 Cloning was performed as described above using the dCas9-VPR stable expression strain (HEK293T CD63-MS2) to generate a gRNA library containing the MS2box in the backbone. The resulting library was packaged into lentivirus and used to infect EV-producing cells (HEK293T CD63-MS2, dCas9-VPR stable expression strain). For the CD63-dCas9 expression EV library, the addgene #83985 library was directly packaged into lentivirus and used to infect EV-producing cells (HEK293T CD63-dCas9, dCas9-VPR stable expressing strain). After infection, the cells were cultured under the same conditions, and extracellular vesicles were collected from the culture supernatant. RNA was extracted from the recovered extracellular vesicles, reverse transcribed and amplified, and the sequence was determined, and the quantitative ratio was calculated. As a control, the sequence of the original gRNA library itself was also determined, and the quantitative ratio was calculated. As a result, we detected more than 9,000 gRNA-barcoded EVs out of 13,147 species (detection rate: 68.4%) from the CD63-MS2-expressing EV library. Furthermore, we detected 13,120 gRNA-barcoded EVs out of 13,147 species (detection rate: 99.8%) from the CD63-dCas9-expressing EV library (Figure 2A-C). Furthermore, we detected 60,711 gRNA-barcoded EVs out of 63,950 (detection rate: 94.9%) from a CD63-dCas9-expressing EV library using the Gecko V2A (addgene #1000000048) library (Figure 2D). We also detected 24,285 gRNA-barcoded EVs out of 24,569 (detection rate: 98.8%) from a CD63-dCas9-expressing EV library using the DTKP (addgene #101927) library (Figure 2E). For the CD63-MS2 expression EV library (for random peptide-Lamp2b), the plasmid library prepared in 2(2) above was packaged into lentivirus and used to infect EV-producing cells (HEK293T CD63-MS2, dCas9-VPR stable expressing strain). After infection, the cells were cultured under the same conditions, and extracellular vesicles were collected from the culture supernatant. RNA was extracted from the recovered extracellular vesicles, reverse transcribed, amplified, sequenced, and the quantitative ratio was calculated (Figure 2G). As a control, RNA was extracted from the EV-producing cells themselves after recovery of the culture supernatant, reverse transcribed, amplified, sequenced, and the quantitative ratio was calculated (Figure 2F). As a result, we succeeded in creating an EV library that expressed random peptides on its surface.

[0068] D. Screening for factors that extend the blood half-life of exosomes using barcoded exosomes 3.0x10 of the CD63-dCas9-expressing EV library generated in C above10 The vesicles were injected into the tail vein of mice. Thirty minutes after injection, blood was collected from the mice and extracellular vesicles were isolated from the collected blood. RNA was extracted from the isolated extracellular vesicles, reverse transcribed, amplified, and sequenced. As a control, RNA was extracted from the CD63-dCas9-expressing EV library before injection, reverse transcribed and amplified, and sequenced. The quantitative ratio was calculated. The amount of each gRNA recovered from the blood was then calculated, assuming the control as 1. As a result, gRNAs whose composition ratio in the blood was significantly increased were identified (Figure 3). The sequences encoding the detected gRNAs are shown in Table 2. [Table 2]

[0069] E1. Screening of factors that promote / inhibit extracellular vesicle secretion using barcoded extracellular vesicles HEK293T cells were transfected with only the CD63-dCas9 expression vector, selected for drug resistance, and a stable expression line was established (hereafter referred to as Cas9(-) EV-producing cells). HEK293T cells were transfected with the CD63-dCas9 expression vector and pRK300 plasmid, and selected for drug resistance to establish stable expression lines (hereafter referred to as Cas9(+)EV-producing cells). Cas9(-)EV-producing cells and Cas9(+)EV-producing cells were infected with lentivirus containing the DTKP library. After infection, the cells were cultured for at least 7 days in the presence of puromycin. The culture medium was then replaced with OptiMEM® medium (Thermo Fisher Scientific, Japan). After 48 hours of culture, the culture supernatant containing extracellular vesicles was collected. The cells were centrifuged at 300 x g for 5 minutes and at 1500 x g for 10 minutes, and then passed through a 0.22 μm filter to remove cells and cell debris. Extracellular vesicles (Cas9(-)EVs and Cas9(+)EVs) were then purified and concentrated from the cell supernatant by ultracentrifugation. RNA was extracted from the recovered extracellular vesicles, reverse transcribed and amplified, and the sequence was determined and quantified using a next-generation sequencer. RNA was also extracted from the cultured EV-producing cells, reverse transcribed and amplified, and the sequence was determined and quantified using a next-generation sequencer. The quantitative ratio of gRNA corresponding to each gene was calculated for Cas9(-)EV / Cas9(+)EV or Cas9(+)EV / Cas9(+)EV producing cells using CRISPR AnalyzeR (bioRxiv 2017, http: / / crispr-analyzer.dkfz.de / ) (Figures 4 and 5). As a result, knockout of PI4KA, CYB5B, PIK3C3, PTPN23, PIK3R4, and METAP1 increased the amount of extracellular vesicles secreted (Figure 4A). This effect was independent of the number of EV-producing cells expressing each gRNA (Figure 4B).

[0070] E2. Enhancement of secretion of CD63-positive EVs by PI4KA inhibitors The PI4KA inhibitor GSK-A1 was administered to HEK293T cells expressing CD63-nanoLuc (pDB30), and the amount of secreted extracellular vesicles was measured using a luminescence assay (Promega, Nanoglo luciferase assay system) to measure nluc activity in the culture supernatant or nanoparticle tracking analysis (NTA) using Nanosight (Malvern). As a control, a similar experiment was performed without GSK-A1 administration, and the amount of EV secretion at each GSK-A1 concentration was calculated, assuming the amount of EV secretion in the control as 1. As a result, it was found that the addition of GSK-A1 increased the amount of CD63-positive extracellular vesicles secreted (Figure 6), indicating that the screening method of the present invention can identify factors that promote the amount of extracellular vesicles secreted.

[0071] The same assay was also performed using HEK293T cells expressing CD9-dCas9 (SEQ ID NO: 9) as EV-producing cells. The results showed that the secretion of exosomes containing a gRNA barcode knocking out MMAA (Metabolism of Cobalamin Associated A) was suppressed (0.62-fold compared to intracellular secretion). On the other hand, when HEK293T cells expressing CD63-dCas9 were used as EV-producing cells, the secretion amount remained unchanged (1.06-fold compared to intracellular secretion). This suggests that by changing the EV marker used, it may be possible to elucidate differences in the EV secretion mechanisms of specific populations. [Industrial Applicability]

[0072] The barcoded exosomes of the present invention can be used to develop efficient drug delivery systems using exosomes, to conduct biology research on exosomes (e.g., to elucidate EV secretion in various cells), and to conduct drug discovery research targeting the exosome secretion pathway (e.g., to identify factors that change the amount of EV secretion in a cell-specific manner).

[0073] This method can also be used to analyze exosome-mediated networks across biological kingdoms. For example, in the mammalian digestive tract, in addition to plants (food), intestinal bacteria, pathogenic microorganisms, and dietary yeasts constantly interact with each other, and this method can be useful for studying the exosomes produced by these heterogeneous biological communities.

[0074] The extracellular vesicle secretion promoters or inhibitors of the present invention can also be used to analyze the physiological role played by a specific subpopulation of extracellular vesicles in vivo or in vitro by administering them to a subject and promoting or inhibiting the secretion of that specific subpopulation.

Claims

1. 1. A method for generating a library of extracellular vesicles containing barcode RNA, comprising: (1) introducing (a) an expression vector that expresses multiple types of barcode RNAs, or (b) multiple types of barcode RNAs, into extracellular vesicle-secreting cells that have been made to express a fusion protein containing a protein present in extracellular vesicles and an RNA-binding protein; (2) culturing the extracellular vesicle-secreting cells in a culture medium; and (3) A method comprising a step of recovering extracellular vesicles containing barcode RNA bound to the fusion protein from the culture supernatant of extracellular vesicle-secreting cells.

2. The barcode RNA is (1) A nucleic acid that changes the amount of an endogenous protein present in or on the surface of an extracellular vesicle; (2) a nucleic acid that promotes or inhibits the secretion of extracellular vesicles; (3) a nucleic acid encoding an enzyme for synthesizing a lipid membrane constituting an extracellular vesicle membrane; and (4) Nucleic acids for causing an exogenous protein to exist within or on the surface of extracellular vesicles; The method of claim 1.

3. The method of claim 1 or 2, wherein the barcode RNA is a nucleic acid that negatively or positively regulates the expression of a factor that promotes or inhibits the secretion of extracellular vesicles.

4. A method for screening a factor, comprising steps (1) to (3) of the method of claim 1, the barcode RNA is a nucleic acid that negatively or positively regulates the expression of the factor, moreover, (4) determining the sequences of multiple types of barcode RNA and calculating the quantitative ratio of each barcode RNA; and (5) A method comprising a step of identifying the factor from information on the sequence contained in barcode RNA whose quantitative ratio is changed.

5. The method of claim 4, wherein the factor is a factor that promotes or inhibits the secretion of extracellular vesicles.

6. The method of claim 4, wherein the factor promotes or inhibits the secretion of extracellular vesicles on whose surface a specific protein is localized, or a factor involved in the localization of a specific protein to the membrane surface of extracellular vesicles.

7. The method of claim 4, wherein the factor contributes to the stability of extracellular vesicles in body fluids, or promotes or inhibits the secretion of extracellular vesicles into body fluids.

8. (1) preparing a library containing multiple types of fusion proteins containing a protein present in extracellular vesicles and an RNA-binding protein, and extracellular vesicles containing barcode RNA bound to the fusion protein; (2) Extracting RNA from tissue or body fluid isolated from a subject administered the library containing the multiple types of extracellular vesicles; and (3) detecting barcode RNA from the extracted RNA; A screening method comprising:

9. The method further comprises a step of comparing the quantitative ratio of each barcode RNA detected in step (3) with the quantitative ratio of each barcode RNA in the multiple types of extracellular vesicles prepared in step (1) to identify barcode RNAs with altered quantitative ratios, and identifying factors based on sequence information contained in the identified barcode RNAs. The screening method according to claim 8.

10. The screening method according to claim 8 or 9, wherein the tissue or body fluid is saliva, urine, feces, or semen.

11. The screening method according to any one of claims 8 to 10, wherein the subject is a non-human animal.

Images