Kidney stone treatment or prevention agent

The AIM peptide, targeting the SRCR1 domain and hinge region, addresses the ineffectiveness of current treatments by inhibiting kidney stone growth and reducing inflammation, providing a novel therapeutic approach.

JP2025128418AInactive Publication Date: 2025-09-03宫崎彻
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2022112069
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2022-07-12
Publication Date
2025-09-03
Estimated Expiration
Not applicable · inactive patent

AI Technical Summary

Technical Problem

Current treatments for kidney stones are ineffective in preventing or removing kidney stones, leading to high recurrence rates and significant health and economic burdens, with no clinical use beyond behavioral and nutritional interventions or surgical/endoscopic urologic treatments.

Method used

A therapeutic agent comprising an apoptosis inhibitor of macrophage (AIM) peptide or nucleic acid, specifically targeting the SRCR1 domain and hinge region, with a negative charge imbalance, to inhibit kidney stone growth and promote debris clearance.

Benefits of technology

The AIM peptide effectively inhibits kidney stone growth, reduces inflammation, and promotes weight loss, offering a novel treatment and prevention strategy for kidney stones.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025128418000001
    Figure 2025128418000001
  • Figure 2025128418000002
    Figure 2025128418000002
  • Figure 2025128418000003
    Figure 2025128418000003
Patent Text Reader

Abstract

To provide novel agents for preventing and / or treating kidney stones.SOLUTION: Provided is an agent for inhibiting the growth of kidney stones, comprising a peptide containing an amino acid sequence that satisfies the following conditions, or a nucleic acid encoding the peptide: (1) an amino acid sequence of 20 or more consecutive amino acids in a region consisting of an SRCR1 domain and a hinge region of apoptosis inhibitor of macrophage (AIM); and (2) (the number of aspartic acid and glutamic acid in the amino acid sequence) - (the number of arginine and lysine in the amino acid sequence)≥5.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a therapeutic or preventive agent for kidney stones, and more particularly to a therapeutic or preventive agent for kidney stones, which comprises an apoptosis inhibitor of macrophage (AIM). [Background technology]

[0002] Kidney stone formation is highly prevalent and has been increasing for the past 50 years in both men and women due to rapid changes in lifestyle and dietary habits as well as global warming. After initial stone formation, the recurrence rate reaches 50% within 5 years. Metabolic syndrome, which includes obesity, diabetes, and hypertension, is considered a significant risk factor for stone formation. Conversely, stone-forming patients are at risk for hypertension, acute kidney injury (AKI), and chronic kidney disease. Globally, approximately 80% of kidney stones are diagnosed as drug-related stones, consisting of calcium oxalate (CaOx) mixed with calcium phosphate, 10% struvite, 9% uric acid, and the remainder composed of cystine or ammonium urate.

[0003] Excessive supersaturation in urine leads to crystal nucleation, the initial step in the transition from liquid to solid phase in the urinary tract. CaOx crystals attach to the surface of renal tubular epithelial cells by interacting with negatively charged membrane components, such as phosphatidylserine, which redistributes to the cell surface upon mechanical (by the crystal itself) and / or chemical (by oxalic acid) cell injury. If the attached crystals remain on the luminal side of the epithelial cells, they aggregate and grow in the tubules, developing into stones (nephrolithiasis or urolithiasis). Some crystals are internalized by epithelial cells, subsequently dissolved in lysosomes, or reappear on the basolateral surface, once again providing centers for stone growth in the renal interstitial region. Additionally, crystal internalization frequently injures cells, leading to epithelial cell death and the release of cellular debris that forms foci for further crystal growth, thereby promoting stone formation. Therefore, in addition to urinary supersaturation, crystal-cell adhesion, crystal aggregation / growth, and tubular epithelial cell damage are crucial processes in stone formation. Although many efforts have been directed toward developing effective treatments for kidney stone disease that target any or all of these processes, no treatments have yet reached clinical use that effectively prevent kidney stone development / recurrence or induce stone removal, other than behavioral and nutritional interventions or surgical / endoscopic urologic treatments. As a result, the annual cost of kidney stones and related complaints in the United States alone is currently over $2 billion and continues to rise.

[0004] Apoptosis inhibitor of macrophage (AIM; also known as CD5 antigen-like: CD5L) is a blood protein produced by tissue macrophages. It was first identified by the present inventors as a protein that supports macrophage survival and is now known to promote the treatment of many diseases (Non-Patent Documents 1-6). Among the mechanisms by which AIM promotes disease treatment, its promotion of phagocytic clearance of dead cell debris and damage-associated molecular patterns (DAMPs) derived from dead cells has attracted the most attention. The present inventors have demonstrated that AIM binds to cell debris or DAMPs through charge interactions with a unique positively charged amino acid cluster in the third scavenger receptor cysteine-rich (SRCR) domain at its carboxyl terminus and disulfide bond formation with an isolated cysteine ​​residue located in the second SRCR domain (Non-Patent Documents 7-9). Because AIM is efficiently internalized by phagocytes via multiple scavenger receptors, this binding potently enhances the phagocytosis of debris and DAMPs by phagocytes. Indeed, through such actions, intravenous injection of recombinant AIM (rAIM) protein promotes the treatment of ischemia / reperfusion-induced AKI by improving the renal tubular obstruction and associated sterile inflammation, which are the core pathology of AKI. Similar therapeutic effects of AIM based on equivalent mechanisms have recently been confirmed in mice for peritonitis and stroke, and the prognosis of affected animals has been significantly improved by rAIM administration. [Prior art documents] [Non-patent literature]

[0005] [Non-Patent Document 1] Kurokawa, J. et al. Macrophage-derived AIM is endocytosed into adipocytes and decreases lipid droplets via inhibition of fatty acid synthase activity. Cell Metab. 11, 479-492 (2010). [Non-patent document 2] Maehara, N. et al. Circulating AIM prevents hepatocellular carcinoma through complement activation. Cell Rep. 9, 61-74 (2014). [Non-patent document 3] Wang, C. et al. CD5L / AIM Regulates Lipid Biosynthesis and Restrains Th17 Cell Pathogenicity. Cell. 163, 1413-1427 (2015). [Non-patent document 4] Arai, S. et al. Apoptosis inhibitor of macrophage protein enhances intraluminal debris clearance and ameliorates acute kidney injury in mice. Nat. Med. 22, 643 183-193 (2016). [Non-Patent Document 5] Tomita, T. et al. Apoptosis inhibitor of macrophage ameliorates fungus-induced peritoneal injury model in mice. Sci. Rep. 7, 6450 (2017). [Non-patent document 6] Arai, S. & Miyazaki, T. A scavenging system against internal pathogens promoted by the circulating protein apoptosis inhibitor of macrophage (AIM). Semin Immunopathol. 40, 567-575 (2018). [Non-Patent Document 7] Miyazaki, T., Hirokami, Y., Matsuhashi, N., Takatsuka, H. & Naito, M. Increased susceptibility of thymocytes to apoptosis in mice lacking AIM, a novel murine macrophage-derived soluble factor belonging to the scavenger receptor cysteine-rich domain superfamily. J. Exp. Med. 189, 413-422 (1999). [Non-patent document 8] Hiramoto, E. et al. The IgM pentamer is an asymmetric pentagon with an open groove that binds the AIM protein. Sci. Adv. 4, eaau1199 (2018). [Non-Patent Document 9] Maehara, N. et al. AIM / CD5L attenuates DAMPs in the injured brain and thereby ameliorates ischemic stroke. Cell Rep. 36, 109693 (2021). Summary of the Invention [Problem to be solved by the invention]

[0006] The present invention aims to provide a novel medicament for treating or preventing kidney stones. [Means for solving the problem]

[0007] As a result of extensive research into the above-mentioned problems, the present inventors have found that (1) Administration of AIM to mice loaded with glyoxylic acid significantly inhibited the growth of kidney stones. (2) AIM binds strongly to small stones and inhibits their growth, mainly via the SRCR1 domain and the amino acids in the downstream hinge region. (3) Compared with various negatively charged substances, AIM has a stronger inhibitory effect on stone growth. (4) The administration of AIM not only inhibits stone growth but also has other beneficial effects, such as suppressing inflammation in the kidney and weight loss; and (5) Unlike in AKI, AIM does not cooperate with KIM-1 in the process of inhibiting kidney stone growth. The present invention was completed by further research based on these findings. That is, the present invention is as follows.

[0008] [1] A drug for inhibiting the growth of kidney stones, comprising a peptide having an amino acid sequence that satisfies the following conditions, or a nucleic acid encoding the same: (1) an amino acid sequence of 20 or more consecutive amino acids in a region consisting of the SRCR1 domain and hinge region of apoptosis inhibitor of macrophage (AIM); and (2) (the number of aspartic acids and glutamic acids in the amino acid sequence) - (the number of arginines and lysines in the amino acid sequence) ≥ 5. [2] The agent according to [1], wherein the peptide is an SRCR1 domain or a full-length AIM. [3] 1. A method for inhibiting kidney stone growth in a subject, comprising administering to the subject a peptide comprising an amino acid sequence, or a nucleic acid encoding the peptide, that satisfies the following criteria: (1) an amino acid sequence of 20 or more consecutive amino acids in a region consisting of the SRCR1 domain and hinge region of apoptosis inhibitor of macrophage (AIM); and (2) (the number of aspartic acids and glutamic acids in the amino acid sequence) - (the number of arginines and lysines in the amino acid sequence) ≥ 5. [4] The method described in [3], wherein the peptide is the SRCR1 domain or full-length AIM. [Effects of the Invention]

[0009] According to the present invention, it is possible to inhibit the growth of kidney stones in a subject, and therefore, it is possible to treat and / or prevent kidney stones in a subject. [Brief explanation of the drawings]

[0010] [Figure 1] Figure 1 shows that rAIM inhibits stone growth. (a) Kidney stone volume in rAIM-treated (400 μg; n = 5) and PBS-treated (n = 5) mice on day 6 of glyoxylate challenge. Numbers indicate the percentage of stone area in the entire kidney section. Scale bar: 1 mm. Average stone area in non-consecutive sections for each mouse is plotted. (b, c) Quantitative PCR analysis of mRNA levels of kidney injury markers Haver1 (KIM-1) and Ngal (b), as well as various pro-inflammatory and macrophage marker genes (c) in the kidneys of the mice. (d) Serum Cre and BUN levels. (e) Body weight change. Values ​​are compared with body weight before glyoxylate challenge. (f) Daily food intake. (g) Kidney stone volume in rAIM-treated (n = 7) and PBS-treated (n = 8) KIM-1- / - mice on day 6 of glyoxylate challenge. [Figure 2]In the presence of rAIM (100 μg / mL), mProx24 cells were challenged with FITC-labeled CaOx crystals in culture medium for 1 hour at 37°C. The crystals were washed, and then their attachment / uptake into cells was analyzed using a flow cytometer. [Figure 3]Figure 3 illustrates the mechanism by which AIM inhibits kidney stone formation. (a) Crystal formation in the presence or absence of rAIM. Equal amounts of CaCl2 (2 mM) and Na2C2O4 (10 mM) were mixed and incubated for 1 h at 37 °C in the presence or absence of AIM (100 μg / mL). Representative photographs of the resulting crystals are shown, along with the mean (±s.d.) number (per photograph) and size (longest diagonal line) of each crystal. Ten randomly taken photographs were analyzed for each group. Similar results were obtained in three independent experiments. Scale bar: 20 μm. (b) CaOx crystals were incubated with FITC-labeled rAIM (100 μg / mL) at 37 °C for 1 h, washed with PBS, and their binding was analyzed using flow cytometry. Similar results were obtained in three independent experiments. Representative results are shown. (c) Pull-down assay. CaOx crystals were incubated with either rAIM, SRCR1, SRCR2, or SRCR3 domains (FLAG-tagged or unlabeled; rAIM at 1 μg / mL and each SRCR domain at 0.3 μg / mL) at 37°C for 1 hour, washed with PBS, and precipitated by centrifugation. After boiling the precipitated crystals in SDS-PAGE loading buffer, binding of rAIM and SRCR domains to CaOx crystals was assessed by immunoblotting using an anti-FLAG tag antibody. The extra bands for SRCR1 and SRCR2 likely result from differences in glycosylation. The ratio of pull-down / input signal is shown. A diagram showing the charge distribution of AIM is shown. Blue: positively charged amino acids; red: negatively charged amino acids; white: neutral amino acids. (d) In vitro crystallization was performed as in (a) in the presence of each SRCR domain. Similar results were obtained in three independent experiments. Scale bar: 20 μm. (e) Kidney stone development in mice on day 6 of glyoxylate loading, with administration of rAIM (400 μg) or the SRCR domain (120 μg each) on days 1, 3, and 5. Data are shown as in Figure 1a. Seven to eight mice were analyzed in each group. Scale bar: 1 mm.(f) Quantitative PCR analysis of mRNA levels of kidney injury markers and various pro-inflammatory genes in the kidneys of the above mice. (g) Serum Cre and BUN levels. (h) Body weight change. Values ​​are relative to body weight before glyoxylate challenge. (i) Daily food intake. Mean ± SD (a, dg) or sem (h, i) are shown. Statistical analysis was performed using Welch's t-test (a) or one-way (dg) or multi-way (h, i) ANOVA with Dunnett's post hoc test. Significance was given when significant differences occurred compared to the control. [Figure 4] Figure 4 shows the full length immunoblot for AIM shown in Figure 2c, with the AIM signal boxed. [Figure 5](a) Kidney stone volume on day 6 of glyoxylate challenge in wild-type (n = 7) and AIM- / - mice (n = 8). (b) Serum from glyoxylate-challenged mice (n = 3) on days 0 (before challenge), 3, and 6 was immunoblotted for AIM under non-reducing conditions. For reference, serum from mice 1 day after challenge with ischemia / reperfusion to induce AKI (denoted as IR) was also analyzed for AIM. Three mice were challenged with IR, and a representative blot is shown (right). IgM-free AIM is enclosed in a red box. The graph shows the fold increase (mean ± SD) of IgM-free AIM in three glyoxylate-challenged mice (days 3 and 6) and three IR-challenged mice (day 1). (c) Sera from human individuals with and without kidney stones were analyzed for IgM-free AIM by ELISA as described in Koyama, N. et al. J. Gastroenterol. 53, 770-779 (2018). n=18 for each. No statistically significant differences were obtained after analysis by Welch's t-test. (d) Immunohistochemistry for AIM in kidney specimens from mice on day 6 after glyoxylate challenge. No AIM staining (brown) was observed in the stone area. Black arrow: stone. Some AIM-expressing interstitial macrophages stained for AIM. Scale bar: 20 μm. [Figure 6]Figure 6 shows the therapeutic effects of rAIM and various negatively charged substances on kidney stones and the associated deterioration of overall physical condition. (a) In vitro crystal growth was performed as in Figure 2a, but in the presence of equimolar levels of either rAIM, rOPN, pAA5.1, D9E3 peptide, or R8K4 peptide (rAIM; 100 μg, rOPN; 125 μg, pAA5.1; 15 μg, D9E3 and R8K4 peptides; 2.5 μg each). Representative photographs of the resulting crystals are shown, along with the mean (±s.d.) number (per photograph) and size (longest diagonal line) of each crystal. Similar results were obtained in three independent experiments. Scale bar: 20 μm. (b) Kidney stone growth in mice on day 6 after glyoxylate loading with isomolar administration of the substances (rAIM; 400 μg, rOPN; 500 μg, pAA5.1; 60 μg, D9E3 and R8K4; 10 μg each) on days 1, 3, and 5. Data are shown as in Figure 1a. n = 4 (control and R8K4 peptide), n = 6 (rAIM, OPN, pAA, and D9E3 peptide). Three control mice and three R8K4-treated mice (out of the initial seven mice) died of renal failure before day 6. Scale bar: 1 mm. (c) Serum Cre and BUN levels. (d) Quantitative PCR analysis of the mRNA levels of kidney injury markers and various pro-inflammatory genes in the kidneys of these mice. (e) Body weight change. Values ​​are relative to body weight before glyoxylate loading. (f) Daily food intake (without rAIM). The mean ± SD (a-d) or sem (e, f) are shown. Statistical analysis was performed using one-way (a-d) or multi-way (e, f) ANOVA with Dunnett's post hoc test. Significance was given when a significant difference occurred compared to the control. [Figure 7]Figure 7 shows the high binding affinity of AIM to crystals. (a) Crystals were incubated with FLAG-tagged rAIM (0.5 μg / mL) and various molar ratios of rOPN, pAA5.1, and D9E3 peptides (designated competitors) or PBS (designated 0) at 37°C for 1 hour. The crystals were then washed with PBS and boiled in SDS-PAGE loading buffer, and rAIM binding to the crystals was assessed by immunoblotting. The AIM signal is relative to the signal of crystals incubated with rAIM alone (left lane). (b) Crystals were preincubated with rAIM (0.5 μg / mL) for 1 hour at 37°C and then washed with PBS. The crystals were then incubated with various molar ratios of the aforementioned substances relative to the rAIM molar ratio. After an additional 1 hour of incubation, rAIM retention on the crystals was assessed as in (a). Representative results from both experiments are shown. Similar results were obtained in three independent experiments. [Figure 8] Figure 8 shows the results of immunoblotting analysis of urine samples from five glyoxylate-loaded mice (day 5) intravenously administered with rOPN tagged with the C-terminus FLAG sequence. The urine samples were pooled for 4 hours and analyzed for OPN by immunoblotting using anti-FLAG antibody (n=5). Only a small signal corresponding to the truncated rOPN C-terminal fragment (see Kubota, T., et al. Biochem. Biophys. Res. Commun. 162, 1453-1459 (1989)) was detected (indicated by an arrow). The molecular weight of full-sized OPN is 45-66 kDa, depending on the level of glycosylation. [Figure 9]Figure 9 shows the clearance of DAMPs in the kidney by rAIM. Immunohistochemistry for S100A9 was performed in kidney specimens from mice on day 6 after glyoxylate loading. Prior to analysis, mice were treated with equimolar doses of rAIM, rOPN, pAA5.1, D9E3 peptide, or R8K4 peptide (amounts similar to those in Figure 3b) or PBS. Extracellular S100A9-positive areas were analyzed. n = 6 per panel. Scale bars: 1 mm (upper panel), 100 μm (lower panel). Mean ± SD values ​​are shown. Statistical analysis was performed using one-way ANOVA with Dunnett's post hoc test. Significance was assigned when significant differences occurred compared to the control. [Figure 10] Figure 10 shows the removal of mature stones by KIM-1. (a) Mice were administered glyoxylic acid (150 mg / kg body weight) daily for 9 days, and the kidney stone burden in the mice was analyzed on days 3, 6, and 9. n = 7–9. (b) Haver1 (KIM-1) mRNA levels in the kidneys of the mice. (c) Immunohistochemistry for KIM-1 in kidney specimens from mice on day 6 of glyoxylic acid challenge. Representative photographs are shown. KIM-1 (brown) around the stones is shown. Scale bar: 20 μm. (d) Kidney stone burden in KIM-1- / - mice on days 3, 6, and 9 of glyoxylic acid challenge. (e) Wild-type and KIM-1- / - mice were challenged with glyoxylic acid for 6 days to develop kidney stones, and then administered rAIM (400 μg) or PBS daily from day 6. The mice were sacrificed on day 9, and the kidney stone burden was analyzed. n = 6-8. Scale bar: 20 μm. Mean ± SD is shown. Statistical analysis was performed using one-way ANOVA with Bonferroni's post hoc test (a, b, d) or Welch's t-test (e) within each genotype group. [Figure 11-A]Figure 11-A shows a photograph of the crystals formed when each peptide prepared by dividing AIM into 12 parts was added. Observation and photography were performed using a polarizing microscope (magnification: 60x, scale bar: 20 μm). Crystals were precipitated by mixing equal volumes of 500 μL each of 2 mM CaCl2 solution and 10 mM Na2C2O4 solution and leaving the mixture to stand for 1 hour at 4°C (final concentrations were 1 mM and 5 mM, respectively). Each peptide was added to the mixed solution at a concentration of 10 μg / mL. [Figure 11-B] Figure 11-B shows the amino acid sequence of the mouse AIM fragment peptide used in Example 7. Portions overlapping with the preceding and following peptides are shown in bold. [Figure 11-C] FIG. 11-C is a diagram showing the number of representative basic amino acids (arginine, lysine) and acidic amino acids (aspartic acid, glutamic acid) contained in each peptide shown in FIG. 11-B. [Figure 12-A] Figure 12-A shows the inhibition of CaOx crystal growth by human AIM peptides (10 μg / mL) corresponding to mouse AIM peptides (#3-#7), human rAIM (full-length, 100 μg / mL), human SRCR1 domain, and human SRCR2 domain (30 μg / mL each), as determined using a polarizing microscope (scale bar: 20 μm). Crystals were precipitated by mixing equal volumes of 500 μL each of 2 mM CaCl2 and 10 mM Na2C2O4 solutions and allowing to stand at 4°C for 1 hour (final concentrations of 1 mM and 5 mM, respectively). [Figure 12-B] FIG. 12-B shows the amino acid sequence of the human AIM fragment used in Example 8. [Figure 12-C] FIG. 12-C is a diagram showing the number of representative basic amino acids (arginine, lysine) and acidic amino acids (aspartic acid, glutamic acid) contained in each peptide shown in FIG. 12-B. DETAILED DESCRIPTION OF THE INVENTION

[0011] The present invention will be described in detail below.

[0012] 1. Medications to inhibit kidney stone growth The present invention provides a drug for inhibiting the growth of kidney stones (hereinafter, sometimes referred to as the "drug of the present invention"), which comprises a peptide comprising an amino acid sequence that satisfies the following conditions, or a nucleic acid encoding the peptide: (1) an amino acid sequence of 20 or more consecutive amino acids in a region consisting of the SRCR1 domain and hinge region of apoptosis inhibitor of macrophage (AIM); and (2) (the number of aspartic acids and glutamic acids in the amino acid sequence) - (the number of arginines and lysines in the amino acid sequence) ≥ 5.

[0013] AIM protein is known to contain three cysteine-rich scavenger-receptor cysteine-rich (SRCR) domains. The three SRCR domains are designated SRCR1, SRCR2, and SRCR3 from the N-terminus. The SRCR1 and SRCR2 domains are linked via a "hinge region." Specifically, using human AIM (SEQ ID NO: 1), the SRCR1 domain is the portion of amino acids 24-125 (SEQ ID NO: 2), and the hinge portion is the portion of amino acids 126-137 (SEQ ID NO: 3). In the case of mouse AIM (SEQ ID NO: 4), the SRCR1 domain is the portion of amino acids 27-128 (SEQ ID NO: 5), and the hinge portion is the portion of amino acids 129-140 (SEQ ID NO: 6). Those skilled in the art can easily identify the SRCR1 domain and hinge region in AIMs other than those of humans and mice.

[0014] The drug of the present invention contains as an active ingredient a peptide containing an amino acid sequence of 20 or more consecutive amino acids contained in the region consisting of SRCR1 and the hinge region of the AIM, wherein the number of aspartic acids and glutamic acids in the amino acid sequence minus the number of arginines and lysines in the amino acid sequence is 5 or more.

[0015] In the present invention, the length of the amino acid sequence of "20 or more consecutive amino acids contained in the region consisting of SRCR1 and hinge region of AIM" can be a minimum of 20 amino acids and a maximum of the entire SRCR1 domain and hinge region. The specific number of amino acids in the region consisting of the SRCR1 domain and hinge region varies depending on the species, but in mammals it is approximately 110 to 120 amino acids. For example, in the case of human AIM, the SRCR1 domain is 102 amino acids and the hinge region is 12 amino acids, so the entire SRCR1 domain and hinge region consists of 114 amino acids. In the case of mouse AIM, the entire SRCR1 domain and hinge region also consists of 114 amino acids. In the case of cat AIM, the SRCR1 domain is 102 amino acids and the hinge region is 13 amino acids, so the entire SRCR1 domain and hinge region consists of 115 amino acids. Those skilled in the art can easily determine the entire length of the SRCR1 domain and hinge region for AIMs other than human, mouse, and cat.

[0016] In one aspect, the length of the amino acid sequence of "20 or more consecutive amino acids contained in the region consisting of SRCR1 and the hinge region of AIM" may be, but is not limited to, 20 or more amino acids (e.g., 20 or more amino acids, 21 or more amino acids, 22 or more amino acids, 23 or more amino acids, 24 or more amino acids, 25 or more amino acids, 26 or more amino acids, 27 or more amino acids, 28 or more amino acids, 29 or more amino acids, or 30 or more amino acids).In another embodiment, the amino acid sequence length of the "amino acid sequence of 20 or more consecutive amino acids contained in the region consisting of SRCR1 and the hinge region of AIM" is 115 amino acids or less (115 amino acids or less, 114 amino acids or less, 113 amino acids or less, 112 amino acids or less, 111 amino acids or less, 110 amino acids or less, 109 amino acids or less, 108 amino acids or less, 107 amino acids or less, 106 amino acids or less, 105 amino acids or less, 104 amino acids or less, 103 amino acids or less, 102 amino acids or less, 101 amino acids or less, 100 amino acids or less, 99 amino acids or less, 98 amino acids or less, 97 amino acids or less, 96 amino acids or less, 95 amino acids or less, 94 amino acids or less, 93 amino acids or less, 92 amino acids or less, 91 amino acids or less, 90 amino acids or less, 89 amino acids or less, 88 amino acids or less, 87 amino acids or less, 86 amino acids or less, 85 amino acids or less, 84 amino acids or less, 83 amino acids or less, 82 amino acids or less, 81 amino acids or less, 80 amino acids or less, 79 amino acids or less, 78 amino acids or less, 77 amino acids or less, 76 amino acids or less, 75 amino acids or less, 74 amino acids or less, 73 amino acids or less, 72 amino acids or less, 71 amino acids or less, 70 amino acids or less, 69 amino acids or less, 68 amino acids or less, 67 amino acids or less, 66 amino acids or less, 65 amino acids or less, 64 amino acids or less, 63 amino acids or less, 62 amino acids or less, 61 amino acids or less, 60 amino acids or less, 59 amino acids or less, 58 amino acids or less, 57 amino acids or less, 56 amino acids or less, 55 amino acids or less, 54 amino acids or less, 53 amino acids or less, 52 amino acids or less, 51 amino acids or less, 50 amino acids or less, 49 amino acids or less, 48 ​​amino acids or less, 47 amino acids or less, 46 amino acids or less, 45 amino acids or less, 44 amino acids or less, 43 amino acids or less, 42 amino acids or less, 41 amino acids or less, 40 amino acids or less, 39 amino acids or less, 38 amino acids or less, 37 amino acids or less, 36 amino acids or less, or 35 amino acids or less.

[0017] In one aspect, the length of the amino acid sequence of "20 or more consecutive amino acids contained in the region consisting of SRCR1 and the hinge region of AIM" may be, but is not limited to, 20 to 115 amino acids, 20 to 100 amino acids, 20 to 90 amino acids, 20 to 80 amino acids, 20 to 70 amino acids, 20 to 60 amino acids, 20 to 50 amino acids, 25 to 50 amino acids, 25 to 40 amino acids, or 28 to 35 amino acids.

[0018] In the present invention, the "amino acid sequence of 20 or more consecutive amino acids contained in the region consisting of SRCR1 and the hinge region of AIM" is characterized in that the number of negatively charged amino acids exceeds the number of positively charged amino acids, resulting in an overall negative charge. More specifically, the "amino acid sequence of 20 or more consecutive amino acids contained in the region consisting of SRCR1 and the hinge region of AIM" is characterized in that the number of negatively charged amino acids in the amino acid sequence (i.e., aspartic acid (Asp or D) and glutamic acid (Glu or E)) minus the number of positively charged amino acids in the amino acid sequence (i.e., arginine (Arg or R) and lysine (Lys or K)) is 5 or more (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15).

[0019] That is, the agent of the present invention contains, as an active ingredient, a peptide consisting of an amino acid sequence that satisfies the above-mentioned two conditions ((1) a sequence present in the SRCR1 domain and hinge region of AIM, and (2) the number of negatively charged amino acids (i.e., D and E) in the amino acid sequence is at least five more than the number of positively charged amino acids (i.e., R and K)), or a peptide containing a peptide that satisfies the above-mentioned two conditions. Hereinafter, a peptide consisting of an amino acid sequence that satisfies these two conditions and a peptide containing an amino acid sequence that satisfies these two conditions may be referred to as a "peptide of the present invention." In addition, the term "peptide" in this specification refers to a general polypeptide in which multiple amino acid sequences are linked via peptide bonds. For example, the term "peptide" in this specification is a concept that can include partial fragments of proteins, full-length proteins, and polypeptides in which full-length proteins are linked to other polypeptides, etc.

[0020] In one embodiment, the peptide of the present invention may be the SRCR1 domain of AIM itself or a peptide containing the SRCR1 domain. In a preferred embodiment, the peptide of the present invention may be full-length AIM itself or a peptide containing full-length AIM.

[0021] The peptides of the present invention may be derived from any warm-blooded animal that may suffer from kidney stones. The origin of the peptides of the present invention may be, for example, human, mouse, rat, rabbit, sheep, pig, cow, horse, cat, dog, monkey, chimpanzee, or bird. Furthermore, the peptides may be chemically synthesized or biochemically synthesized using a cell-free translation system, or may be recombinant proteins produced from a transformant into which a nucleic acid containing a base sequence encoding the amino acid sequence has been introduced. The origin of the peptides of the present invention may be the same as or different from the species to which the pharmaceutical agent of the present invention is administered. In one embodiment, when the pharmaceutical agent of the present invention is intended for humans, it is preferable that the pharmaceutical agent of the present invention contain a peptide of the present invention containing the amino acid sequence of human AIM as an active ingredient. In another embodiment, when the pharmaceutical agent of the present invention is intended for cats, it is preferable to use a peptide containing feline AIM (SEQ ID NO:7) or the SRCR1 domain of feline AIM (SEQ ID NO:8).

[0022] In one embodiment, the peptide of the present invention may be appropriately modified or altered in amino acids, as long as it can inhibit the growth of kidney stones.

[0023] Examples of amino acid modifications include amino acid sequences that typically have 60% or more identity or similarity, preferably 70% or more, 80% or more, or 90% or more, more preferably 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more identity or similarity with the amino acid sequence derived from wild-type AIM. Here, "identity" refers to the percentage (%) of identical and similar amino acid residues relative to the total number of overlapping amino acid residues in optimal alignment (preferably, the algorithm can consider the introduction of gaps into one or both of the sequences for optimal alignment) when two amino acid sequences are aligned using a mathematical algorithm known in the art. Furthermore, "similarity" refers to the percentage (%) of the number of positions where identical or similar amino acid residues exist in both aligned amino acid sequences relative to the total number of amino acid residues in the two sequences. "Similar amino acids" refer to amino acids similar in physicochemical properties, and include, for example, amino acids classified in the same group, such as aromatic amino acids (Phe, Trp, Tyr), aliphatic amino acids (Ala, Leu, Ile, Val), polar amino acids (Gln, Asn), basic amino acids (Lys, Arg, His), acidic amino acids (Glu, Asp), amino acids with hydroxyl groups (Ser, Thr), and amino acids with small side chains (Gly, Ala, Ser, Thr, Met). Substitution with such similar amino acids is expected to not change the phenotype of the protein (i.e., conservative amino acid substitution). Specific examples of conservative amino acid substitutions are well known in the art and have been described in various publications (see, for example, Bowie et al., Science, 247: 1306-1310 (1990)).

[0024] The identity or similarity of amino acid sequences herein can be calculated using the identity or similarity calculation algorithm NCBI BLAST (National Center for Biotechnology Information Basic Local Alignment Search Tool) under the following conditions (expectation value = 10; gaps allowed; matrix = BLOSUM62; filtering = OFF). Other algorithms for determining identity or similarity of amino acid sequences include, for example, the algorithm described in Karlin et al., Proc. Natl. Acad. Sci. USA, 90:5873-5877 (1993) [this algorithm is incorporated into the NBLAST and XBLAST programs (version 2.0) (Altschul et al., Nucleic Acids Res., 25:3389-3402 (1997))], the algorithm described in Needleman et al., J. Mol. Biol., 48:444-453 (1970) [this algorithm is incorporated into the GAP program in the GCG software package], the algorithm described in Myers and Miller, CABIOS, 4:11-17 (1988) [this algorithm is incorporated into the ALIGN program (version 2.0) which is part of the CGC sequence alignment software package], and the algorithm described in Pearson et al., Proc. Natl. Acad. Sci. USA, 85:2444-2448 (1988) [this algorithm is incorporated into the FASTA program in the GCG software package], and the like, which can also be preferably used.

[0025] Furthermore, the peptides of the present invention may be peptides in which some amino acids have been deleted, added, inserted, and / or substituted, as long as they achieve the desired effects of the present invention. For example, peptides contained as active ingredients in the pharmaceutical agents of the present invention include, but are not limited to, the following peptides (1) to (5): (1) A peptide comprising an amino acid sequence in which one or more amino acids (preferably about 1 to 100, preferably about 1 to 50, more preferably about 1 to 10, particularly preferably one to several (2, 3, 4, or 5)) are deleted from the amino acid sequence of the wild-type AIM or SRCR1 domain; (2) A peptide comprising an amino acid sequence in which one or more (preferably about 1 to 100, preferably about 1 to 50, more preferably about 1 to 10, particularly preferably one to several (2, 3, 4, or 5)) amino acids are added to the amino acid sequence of a wild-type AIM or SRCR1 domain. (3) A peptide comprising an amino acid sequence in which one or more (preferably about 1 to 50, preferably about 1 to 10, more preferably one to several (2, 3, 4, or 5)) amino acids are inserted into the amino acid sequence of a wild-type AIM or SRCR1 domain. (4) A peptide comprising an amino acid sequence in which one or more (preferably about 1 to 50, preferably about 1 to 10, more preferably one to several (2, 3, 4, or 5)) amino acids in the amino acid sequence of the wild-type AIM or SRCR1 domain are substituted with other amino acids, or (5) Amino acid sequences that combine these. When the amino acid sequence is deleted, added, inserted and / or substituted as described above, the position of the deletion, addition, insertion or substitution is not particularly limited, as long as the effect of inhibiting the growth of kidney stones is maintained.

[0026] In a preferred embodiment, the peptide of the present invention is the full-length human AIM protein (GenBank accession number: AAD01446) or its homologue in another mammal (e.g., the mouse homologue registered in GenBank under accession number: AAD01445), more preferably the human AIM protein consisting of the amino acid sequence represented by SEQ ID NO:1.

[0027] In this specification, peptides (and proteins) are written according to the convention of peptide notation, with the N-terminus (amino terminus) at the left and the C-terminus (carboxyl terminus) at the right. The peptides used in the drugs of the present invention may have a partially modified amino acid sequence. For example, the C-terminus may be a carboxyl group (-COOH), carboxylate (-COO-), amide (-CONH2), or ester (-COOR). Here, R in the ester is, for example, C such as methyl, ethyl, n-propyl, isopropyl, n-butyl, etc. 1-6 Alkyl groups; for example, C groups such as cyclopentyl and cyclohexyl 3-8 Cycloalkyl groups such as phenyl and α-naphthyl 6-12 Aryl groups; for example, phenyl-C such as benzyl and phenethyl 1-2 Alkyl groups; α-naphthyl-C such as α-naphthylmethyl 1-2 C such as alkyl group 7-14 Aralkyl groups, pivaloyloxymethyl groups, etc. are used.

[0028] When the peptide of the present invention has a carboxyl group (or carboxylate) other than that at the C-terminus, the carboxyl group may be amidated or esterified. In this case, the ester may be, for example, the C-terminal ester described above.

[0029] Furthermore, in the peptide of the present invention, the amino group of the N-terminal amino acid residue is protected by a protecting group (e.g., a C group such as a formyl group or an acetyl group). 1-6 C such as alkanoyl 1-6 those in which the N-terminal glutamine residue that can be generated by cleavage in vivo is pyroglutamated; those in which the substituents on the side chains of amino acids in the molecule (e.g., -OH, -SH, amino group, imidazole group, indole group, guanidino group, etc.) are protected by an appropriate protecting group (e.g., C group such as formyl group, acetyl group, etc.); 1-6 C such as alkanoyl group 1-6These also include those protected by an acyl group or a glycoprotein, such as a glycopeptide (glycoprotein) bound to a sugar chain.

[0030] As used herein, the term "full-length AIM" refers not only to wild-type AIM but also to variants thereof having substantially the same or improved biological activity as that of wild-type AIM (the same applies to the "SRCR1 domain"). Here, "substantially the same activity" refers to the "activity of suppressing kidney stone growth" possessed by wild-type AIM. "Substantially the same activity" can be measured in the same manner as in the case of AIM, for example, by the method used in the Examples of the present specification.

[0031] In one embodiment, examples of variants of full-length AIM include, but are not limited to, the following: (1b) An amino acid sequence in which the cysteine ​​at amino acid number 191 of the amino acid sequence represented by SEQ ID NO:1 is substituted with serine. (2b) An amino acid sequence in which the cysteine ​​at amino acid number 300 of the amino acid sequence represented by SEQ ID NO:1 is substituted with serine. (3b) An amino acid sequence in which the cysteine ​​at amino acid number 191 of the amino acid sequence represented by SEQ ID NO:1 is replaced with serine, and the cysteine ​​at amino acid number 300 of the amino acid sequence represented by SEQ ID NO:1 is replaced with serine. (4b) An amino acid sequence that is substantially identical to any one of the amino acid sequences of (1b) to (3b), and in which the cysteine ​​and the substituted serine present in any one of the amino acid sequences of (1b) to (3b) are retained. (5b) An amino acid sequence comprising one or more amino acids deleted, added, inserted or substituted, or a combination thereof, at a position other than the cysteine ​​and the substituted serine present in any one of the amino acid sequences (1b) to (3b). In addition, AIM variants having functions equivalent to or improved over wild-type recombinant AIM can be those disclosed in Japanese Patent Application No. 2017-220733, etc.

[0032] The peptides of the present invention may be in the form of salts. For example, salts with physiologically acceptable acids (e.g., inorganic acids, organic acids) or bases (e.g., alkali metal salts) are used, with physiologically acceptable acid addition salts being particularly preferred. Examples of such salts include salts with inorganic acids (e.g., hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) and salts with organic acids (e.g., acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid, tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid).

[0033] AIM can be produced from mammalian macrophages by the above-mentioned publicly known protein purification method. Specifically, mammalian macrophages are homogenized, and cell debris is removed by low-speed centrifugation. The supernatant is then centrifuged at high speed to precipitate a cell membrane-containing fraction, which is then subjected to chromatography such as reverse-phase chromatography, ion-exchange chromatography, or affinity chromatography to prepare AIM or a salt thereof.

[0034] The peptides of the present invention can also be produced by known peptide synthesis methods. The peptide synthesis method may be, for example, either solid-phase synthesis or liquid-phase synthesis. The target peptide can be produced by condensing a partial peptide or amino acid that can constitute AIM with the remaining portion, and if the product has a protecting group, removing the protecting group. Here, the condensation and removal of the protecting group are carried out by a method known per se, for example, the method described in (1) and (2) below. (1) M. Bodanszky and M.A. Ondetti, Peptide Synthesis, Interscience Publishers, New York (1966) (2) Schroeder and Luebke, The Peptide, Academic Press, New York (1965)

[0035] The peptide thus obtained can be purified and isolated by known purification methods, such as solvent extraction, distillation, column chromatography, liquid chromatography, recrystallization, and combinations thereof.

[0036] When the peptide obtained by the above method is in a free form, the free form can be converted into an appropriate salt by a known method or a method similar thereto. Conversely, when the peptide is obtained as a salt, the salt can be converted into the free form or another salt by a known method or a method similar thereto.

[0037] Furthermore, the peptide of the present invention can also be produced by culturing a transformant containing a nucleic acid encoding it and isolating and purifying AIM from the resulting culture. The nucleic acid encoding the peptide contained as an active ingredient in the agent of the present invention may be DNA or RNA, or may be a DNA / RNA chimera. DNA is preferred. Furthermore, the nucleic acid may be double-stranded or single-stranded. If double-stranded, it may be double-stranded DNA, double-stranded RNA, or a DNA:RNA hybrid. If single-stranded, it may be the sense strand (i.e., coding strand) or the antisense strand (i.e., non-coding strand).

[0038] Nucleic acids encoding the peptides of the present invention can be prepared using methods known per se. The nucleic acids encoding the peptides of the present invention may be genomic DNA, cDNA, or synthetic DNA. When the nucleic acids encoding the peptides of the present invention are genomic DNA, they can be prepared by using any cells of warm-blooded animals [e.g., hepatocytes, splenocytes, nerve cells, glial cells, pancreatic β cells, bone marrow cells, mesangial cells, Langerhans cells, epidermal cells, epithelial cells, goblet cells, endothelial cells, smooth muscle cells, fibroblasts, fibrocytes, muscle cells, adipocytes, immune cells (e.g., macrophages, T cells, B cells, natural killer cells, mast cells, neutrophils, basophils, eosinophils, monocytes), megakaryocytes, synoviocytes, chondrocytes, osteocytes, osteoblasts, osteoclasts, mammary gland cells, hepatocytes, or stromal cells, or any of these cells. The DNA fragments can be directly amplified by polymerase chain reaction (hereinafter referred to as "PCR") using as a template a genomic DNA fraction prepared from tissues containing these cells (e.g., brain, brain regions (e.g., olfactory bulb, amygdala, basal ganglia, hippocampus, thalamus, hypothalamus, cerebral cortex, medulla oblongata, cerebellum), spinal cord, pituitary gland, stomach, pancreas, kidney, liver, gonads, thyroid gland, gallbladder, bone marrow, adrenal gland, skin, lung, gastrointestinal tract (e.g., large intestine, small intestine), blood vessels, heart, thymus, spleen, submandibular gland, peripheral blood, prostate, testis, ovary, placenta, uterus, bone, joint, adipose tissue (e.g., brown adipose tissue, white adipose tissue), skeletal muscle, etc.) or any tissue in which these cells are present (e.g., brain, brain regions (e.g., olfactory bulb, amygdala, basal ganglia, hippocampus, thalamus, hypothalamus, cerebral cortex, medulla oblongata, cerebellum), spinal cord, pituitary gland, stomach, pancreas, kidney, liver, gonads, thyroid gland, gallbladder, bone marrow, adrenal gland, skin, lung, gastrointestinal tract (e.g., large intestine, small intestine), blood vessels, heart, thymus, spleen, submandibular gland, peripheral blood, prostate, testis, ovary, placenta, uterus, bone, joint, adipose tissue (e.g., brown adipose tissue, white adipose tissue), skeletal muscle, etc.). Furthermore, when the nucleic acid encoding the peptide of the present invention is cDNA or synthetic DNA, it can be directly amplified by PCR or reverse transcriptase-PCR (hereinafter abbreviated as "RT-PCR") using total RNA or an mRNA fraction prepared from macrophages of a warm-blooded animal as a template.

[0039] Nucleic acids encoding the peptides of the present invention include, for example, not only nucleic acids derived from a nucleotide sequence encoding wild-type AIM, but also nucleic acids having a nucleotide sequence substantially identical thereto. Examples of nucleic acids having substantially the same nucleotide sequence include nucleic acids comprising a nucleotide sequence typically having 60% or more, preferably 70% or more, 80% or more, or 90% or more, more preferably 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more identity or similarity to a nucleic acid derived from a nucleotide sequence encoding wild-type AIM, and encoding a peptide exhibiting the desired effects of the present invention. In one aspect, nucleic acids comprising a nucleotide sequence substantially identical to a nucleic acid encoding full-length human AIM (SEQ ID NO:9) include nucleic acids comprising a nucleotide sequence typically having 60% or more, preferably 70% or more, 80% or more, or 90% or more, more preferably 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more identity to the nucleotide sequence represented by SEQ ID NO:9, and encoding a peptide exhibiting the desired effects of the present invention. The nucleic acid encoding the peptide of the present invention also includes a nucleic acid sequence that has been codon-optimized for the purpose of increasing expression efficiency in the target organism.

[0040] The identity or similarity of base sequences herein can be calculated using the identity or similarity calculation algorithm NCBI BLAST (National Center for Biotechnology Information Basic Local Alignment Search Tool) under the following conditions (expectation value = 10; gaps allowed; filtering = ON; match score = 1; mismatch score = -3). Other preferred examples of algorithms for determining the identity or similarity of base sequences include the amino acid sequence homology calculation algorithms described above.

[0041] In a preferred embodiment, the nucleic acid encoding the peptide of the present invention is a nucleic acid comprising a base sequence encoding the full-length AIM protein of human AIM (GenBank accession number: AF011429) or its homolog in other mammals [e.g., the mouse homolog registered in GenBank under accession number: AF011428], more preferably a nucleic acid encoding the human AIM protein consisting of the amino acid sequence represented by SEQ ID NO:9.

[0042] Examples of the peptide of the present invention that can be used as an active ingredient in the drug of the present invention include, but are not limited to, the following.

[0043] (1)Full length AIM SEQ ID NO: 1 (human) SEQ ID NO:4 (mouse) SEQ ID NO:7(cat)

[0044] (2) SRCR1 domain SEQ ID NO:2 (human) SEQ ID NO:5 (mouse) SEQ ID NO:8(cat)

[0045] (3) Peptide fragment of the SRCR1 domain SEQ ID NO: 42 (human) SEQ ID NO:32 (mouse)

[0046] (4) Peptide fragment contained in the region consisting of the SRCR1 domain and hinge region SEQ ID NO: 43 (human) SEQ ID NO:33 (mouse) SEQ ID NO: 48 (cat)

[0047] In another embodiment of the present invention, the agent of the present invention comprises a nucleic acid encoding the peptide of the present invention (hereinafter, may be referred to as "nucleic acid of the present invention") as an active ingredient.

[0048] The nucleic acid of the present invention may be not only a sequence derived from wild-type AIM, but also a nucleic acid encoding a modified peptide having kidney stone growth inhibitory activity equal to or greater than that of the peptide of the present invention.

[0049] The nucleic acid of the present invention can be cloned by a method known per se, such as PCR.

[0050] The nucleic acid of the present invention may be functionally linked to an expression vector or the like having a promoter that induces kidney-specific expression. By delivering an expression vector containing the nucleic acid of the present invention into the kidney, the peptide of the present invention can be expressed in a kidney-specific manner. Any known kidney-specific promoter may be used.

[0051] The agents of the present invention can be used in any warm-blooded animal that may suffer from kidney stones, including, but not limited to, humans, mice, rats, rabbits, sheep, pigs, cows, horses, cats, dogs, monkeys, chimpanzees, and birds.

[0052] When the agent of the present invention is used to inhibit the growth of kidney stones in a subject, the route of administration is not particularly limited as long as the active ingredient is delivered to the affected area. Preferred routes of administration include, but are not limited to, intravenous administration, intraarterial administration, subcutaneous administration, and intraperitoneal administration.

[0053] When the agents of the present invention are formulated for parenteral administration, they can be formulated, for example, as injections, suppositories, etc. Injections may include dosage forms such as intravenous injections, subcutaneous injections, intradermal injections, intramuscular injections, and drip infusion injections. Such injections can be prepared according to known methods. For example, injections can be prepared by dissolving, suspending, or emulsifying components such as the peptide of the present invention, the nucleic acid of the present invention, and / or the virus carrying the nucleic acid of the present invention in a sterile aqueous or oily liquid typically used for injections. Examples of aqueous solutions for injection include physiological saline, isotonic solutions containing glucose and other adjuvants, and the like, which may be used in combination with appropriate solubilizing agents such as alcohol (e.g., ethanol), polyalcohols (e.g., propylene glycol, polyethylene glycol), and nonionic surfactants (e.g., polysorbate 80, HCO-50 (polyoxyethylene (50 mol) adduct of hydrogenated castor oil)). As the oily liquid, for example, sesame oil, soybean oil, etc. can be used, and a solubilizing agent such as benzyl benzoate, benzyl alcohol, etc. can be used in combination. The prepared injection solution is preferably filled into a suitable ampule.

[0054] The amount of the drug of the present invention to be administered to a subject is not particularly limited as long as it is an amount that can suppress the growth of kidney stones, and may be optimized as appropriate depending on the type and form of the active ingredient, the age and weight of the subject, the administration schedule, the administration method, etc.

[0055] The timing of administering the drug of the present invention to a subject is not particularly limited as long as it can suppress the growth of kidney stones. Without wishing to be bound by theory, as shown in the examples, the peptide of the present invention efficiently suppresses the growth of small stones to large sizes, but does not promote the removal of stones that have already grown to a certain size. Therefore, it is considered that the timing of administration of the drug of the present invention is preferably, for example, preventive administration before stone formation or stone recurrence.

[0056] The pharmaceutical agent of the present invention can also be used in combination with other drugs for treating or preventing kidney stones, including, but not limited to, stone-expelling drugs, stone-preventing drugs, analgesics, etc.

[0057] By administering the agent of the present invention to a subject, the peptide of the present invention is delivered to or expressed in the kidney of the subject. The peptide of the present invention strongly binds to relatively small stones present in the kidney and significantly inhibits their growth. As a result, kidney stones in the subject are prevented from occurring by preventing stones of a size that can physically damage kidney tissue.

[0058] As used herein, "inhibiting the growth of kidney stones" can be rephrased as "treating kidney stone disease" or "preventing kidney stone disease."

[0059] In this specification, "treating kidney stones" includes not only the cure of kidney stones but also the remission and improvement of the severity of kidney stones. In addition, in this specification, "preventing kidney stones" includes not only the elimination of kidney stones but also the delay of their onset.

[0060] 2. How to prevent kidney stones from growing The present invention also provides a method for inhibiting kidney stone growth in a subject (hereinafter sometimes referred to as the "method of the present invention"), comprising the step of administering to the subject a peptide comprising an amino acid sequence satisfying the following conditions, or a nucleic acid encoding the peptide: (1) an amino acid sequence of 20 or more consecutive amino acids in a region consisting of the SRCR1 domain and hinge region of apoptosis inhibitor of macrophage (AIM); and (2) (the number of aspartic acids and glutamic acids in the amino acid sequence) - (the number of arginines and lysines in the amino acid sequence) ≥ 5.

[0061] The method of the present invention is achieved by administering the agent of the present invention to a subject. The peptide of the present invention, the nucleic acid of the present invention, the subject to which the method of the present invention is applied, the administration method, the administration timing, etc., in the method of the present invention are the same as those for the agent of the present invention described above.

[0062] The present invention will be explained in more detail in the following examples, but the present invention is not limited to these examples in any way. [Example]

[0063] [Experimental Procedure] mouse All animal experiments were performed in strict accordance with the recommendations in the NIH Guide for the Care and Use of Laboratory Animals. All surgical procedures were performed under pentobarbital sodium anesthesia, and every effort was made to minimize suffering. Humane endpoints were strictly adhered to in animal experiments. Post-IR mice were carefully observed, and mice were euthanized and used for analysis upon the appearance of significant decline in renal function (serum creatinine level 3.0 or higher), difficulty in eating or drinking, signs of severe distress, prolonged external abnormalities with no prospect of recovery, or rapid weight loss. This protocol was approved by the University of Tokyo Animal Experiment Ethics Committee (Permit Numbers: P15-126 and P21-001).

[0064] Human Subjects and Ethics Serum samples from individuals with and without stones were obtained from Tokyo Women's Medical University Hospital. For human subject analyses, written informed consent was obtained from serum donors, and the study protocol followed the ethical guidelines of the 1975 Declaration of Helsinki, with a priori approval from the Ethics Committee for Medical Experiments at the University of Tokyo and the Ethics Committee at Tokyo Women's Medical University (Permission Number: 2019358NI and Permission Number: 2020-0016).

[0065] Induction and evaluation of kidney stones in mice To induce kidney stones in mouse kidneys, glyoxylic acid was administered intraperitoneally daily. Administration was performed according to the body weight of each mouse (150 mg / kg) using a 27-gauge needle. To evaluate kidney stones, kidney specimens were fixed in 4% paraformaldehyde and embedded in paraffin. 4-μm-thick sections were dewaxed and then sealed in the usual manner. A microscope (IX83, Olympus) equipped with polarized optics was used to observe the sections, and photographs were analyzed using the software HALO (Indica Lab).

[0066] Antibodies and reagents The antibodies and reagents used in the histological experiments are as follows: Primary antibodies: KIM-1 (MAB1817, R&D systems), AIM (rab2 rabbit polyclonal antibody for IHC of mouse and human kidney specimens); #11 and #12 (human-free AIM ELISA antibodies developed in our laboratory, partially purchased from Transgenic Inc.), S100A9 (AF2065, R&D systems, NE, USA). Secondary antibodies and related reagents: G-Block (Genostaff, Tokyo, Japan) and HISTOFINE simple stain mouse MAX-PO (R, Rat, or G) (for nuclei; NICHIREI, Japan). Specimens were analyzed using an inverted microscope: IX83 (Olympus) and a research slide scanner: SLIDEVIEW VS200 (Olympus).

[0067] Purification of rAIM CHO-S cells were transfected with the pcDNA3.1-mAIM plasmid and cultured in CD Forti CHO medium (Invitrogen, CA) for 3 days. rAIM was purified from the culture supernatant using a rat anti-mouse AIM monoclonal antibody conjugated to Protein G Sepharose (GE Healthcare Life Sciences, PA). Bound protein was eluted with 0.1 M Glycin-HCl, pH 3.0, and neutralized with 1 M Tris-HCl, pH 8.5. Protein was concentrated using Amicon Ultra filter concentrators (Millipore, MA) as needed and stored in PBS at -80°C. Endotoxin levels were measured using a chromogenic LAL endotoxin detection system (Genscript, NJ) according to the manufacturer's protocol. Protein concentration was determined by the BCA (bicinchoninic acid) assay (Pierce, Rockford, IL) according to the manufacturer's protocol.

[0068] Preparation of SRCR fragments ExpiCHO-S cells were transfected with the pFLAG5.1-SRCR plasmid using the ExpiFectamine CHO Transfection Kit (Gibco) and cultured in ExpiCHO Expression Medium (Gibco) for 4 days with agitation. Each SRCR fragment was purified from the culture supernatant using anti-FLAG M2 affinity gel (Sigma-Aldrich). Bound proteins were eluted with 0.1 M Glycin-HCl, pH 3.5, and neutralized with 1 M Tris-HCl, pH 8.5. Proteins were concentrated using Amicon Ultra filter concentrators (Millipore, MA) as needed and stored in PBS at -80°C. Endotoxin levels were measured using a Limulus Color KY Test Wako (FUJIFILM Wako) according to the manufacturer's protocol. Protein concentrations were determined by the BCA (bicinchoninic acid) assay (Pierce, Rockford, IL) according to the manufacturer's protocol.

[0069] negatively charged substances FLAG-tagged recombinant osteopontin (OPN) protein was produced similarly to the SRCR fragment. Polyacrylic acid was purchased from FUJIFILM Wako. D9E3 and R8K4 peptides were synthesized by Pepmic Co., Ltd. (Jiangsu, China).

[0070] Serum biomarkers Serum Cre concentrations were measured using a Lab-Assay Creatinine Kit (Wako Pure Chemical Co., Ltd., Osaka, Japan), and serum BUN levels were determined using a FUJI DRI-CHEM 4000 V analyzer system (FUJIFILM Co., Ltd., Tokyo, Japan).

[0071] histology IHC for AIM: Kidneys were fixed in 4% formaldehyde in PBS for 24 hours and embedded in paraffin. Eight-micron sections were immunostained by incubation with rabbit anti-AIM polyclonal antibody (Rab2; available for human and mouse AIM) followed by HISTOFINE simple stain mouse MAX-PO® (NICHIREI, Japan) for 30 minutes. After staining with diaminobenzidine tetrahydrochloride (DAB), sections were counterstained with hematoxylin. To block nonspecific binding, slides were incubated in G-Block (GB-01, Genostaff) for 20 minutes at room temperature before immunostaining.

[0072] IHC for KIM-1 Kidneys were fixed in 4% formaldehyde in PBS for 24 hours and embedded in paraffin. Eight-micrometer sections were immunostained with rat anti-KIM-1 monoclonal antibody (MAB1817, R&D Systems) followed by a 30-minute incubation with HISTOFINE simple stain mouse MAX-PO (Rat) (NICHIREI, Japan). After staining with diaminobenzidine tetrahydrochloride (DAB), sections were counterstained with hematoxylin. To block nonspecific binding, slides were incubated with G-Block (GB-01, Genostaff) for 20 minutes at room temperature before immunostaining. DAMP staining: Sections were immunostained with goat anti-S100A9 polyclonal antibody (AF2065) by incubation with HISTOFINE simple stain mouse MAX-PO (G) for 30 minutes.

[0073] Quantification of DAMPs in the kidney DAMP-DAB staining images were acquired using a VS200 slide scanner (OLYMPUS, Germany) equipped with a 20x objective and digitally recorded. Digital image analysis was performed using the commercially available software HALO (IndicaLabs, Corrales, NM, USA). DAB and hematoxylin signals were detected using object colocalization-based algorithms, and the amount of extracellular DAMPs was estimated by subtracting the DAB signal colocalized with hematoxylin from the total DAB signal.

[0074] Flow cytometry analysis Renal proximal tubule epithelial cells (mProx24 cells) were cultured in 24-well plates in the presence of FITC-labeled crystals, with or without AIM (100 μg / mL), in DMEM / F12 supplemented with 10% FBS for 1 hour at 37°C. Cells were then collected in 4 mL round-bottom tubes. FITC fluorescence intensity was analyzed by flow cytometry (BD FACSCelesta, BD Biosciences). BD FACSDiva and FlowJo (BD Biosciences) were used for analysis.

[0075] In vitro CaOx crystal growth Crystals were precipitated by slowly mixing each protein solution with calcium chloride and sodium oxalate (final concentrations of 1 mM and 5 mM, respectively) for 1 hour. The crystals were collected by centrifugation and observed under a polarized light microscope (IX83, Olympus).

[0076] Pull-down assay The amount of protein bound to the crystals was measured by Western blotting. Specifically, crystals grown in a mixture of calcium chloride and sodium oxalate were collected by centrifugation and then incubated with recombinant full-length AIM protein (100 μg / mL) or each SRCR domain (30 μg / mL, the same molar concentration as full-length AIM) at 37°C for 1 hour. The crystals were then collected by centrifugation, washed twice with PBS, and the crystal pellet was boiled in SDS loading buffer. The liquid phase was immunoblotted against AIM.

[0077] Analysis of binding and dissociation of negatively charged substances to crystals The crystals were grown in a 1000 mL glass flask containing rAIM (13.2 pmol) and different molar ratios of OPN, pAA 5.1 The crystals were incubated with either rAIM or D9E3 peptide at 37°C for 1 hour. The crystals were then centrifuged, washed twice with PBS, and the amount of attached rAIM was analyzed by immunoblotting. To assess the dissociation of rAIM from the crystals due to the presence of other negatively charged substances, the crystals were first incubated with rAIM (13.2 pmol) at 37°C for 1 hour. After washing twice with PBS, the crystals were incubated with different molar ratios of OPN, pAA, and rAIM. 5.1 or D9E3 peptide for an additional 1 hour. The amount of rAIM remaining in the crystals was assessed as described above.

[0078] Quantitative PCR assay Quantitative evaluation of mRNA was performed using the QuantStudio 3 Real-Time PCR system (Thermo Fisher Scientific) using ΔΔC T The oligonucleotide sequences used are listed below.

[0079] Name Sequence (5'→3') SEQ ID NO: f-GAPDH AGAACATCATCCCTGCATTC 10 r-GAPDH CACATTGGGGGTAGGAACAC 11 f-KIM-1 TCCACACATGTACCAACATCAA 12 r-KIM-1 GTCACAGTGCCATTCCAGTC 13 f-NGAL CCATCTATGAGCTACAAGAGAACAAT 14 r-NGAL TCTGATCCAGTAGCGACAGC 15 f-IL1B TGTAATGAAAGACGGCACACC 16 r-IL1B TCTTCTTTGGGTATTGCTTGG 17 f-IL6 ATGGATGCTACCAAACTGGAT 18 r-IL6 TGAAGGACTCTGGCTTTGTCT 19 f-TNFA ACGGCATGGATCTCAAAGAC 20 r-TNFA AGATAGCAAATCGGCTGACG 21 f-MCP-1 TGATCCCAATGAGTAGGCTGGAG 22 r-MCP-1 ATGTCTGGACCCATTCCTTCTTG 23 f-CD11B ATGGACGCTGATGGCAATACC 24 r-CD11B TCCCCATTCACGTCTCCCA 25 f-F4 / 80 CCTGGACGAATCCTGTGAAG 26 r-F4 / 80 GGTGGGACCACAGAGAGTTG 27

[0080] statistical analysis Data were analyzed using BellCurve for Excel (Social Survey Research Information Co., Ltd.) and are presented as mean ± SD unless otherwise specified. Paired results were evaluated using parametric tests such as Welch's t-test. Comparisons between multiple groups were performed using one-way or multi-way ANOVA with Dunnett's post hoc test to compare each group to the control group. Comparisons between values ​​were performed using one-way ANOVA with Bonferroni's post hoc test. *P < 0.05, **P < 0.01, and ***P < 0.001 unless otherwise specified.

[0081] The present invention will be explained in more detail in the following examples, but the present invention is not limited to these examples in any way.

[0082] [Example 1] AIM inhibits kidney stone growth and associated tissue damage Continuous glyoxylic acid administration is commonly used to induce CaOx-based stones in animals. In mice, over a one-week period, stone burden increases, primarily at the corticomedullary junction where the proximal tubule is located.

[0083] Intravenous administration of rAIM (400 μg) to mice on days 1, 3, and 5 during glyoxylic acid treatment significantly reduced stone burden on day 6 (Figure 1). Quantitative PCR analysis showed that mRNA levels of NGAL and KIM-1, typical markers of renal tubular injury, were lower in rAIM-treated mice compared with untreated mice, suggesting that stone-associated epithelial cell damage was reduced by AIM (Figure 1b). In addition, mRNA levels of inflammatory cytokines such as IL-1β, IL-6, TNFα, and MCP-1, as well as myeloid cell markers CD11b and F4 / 80, were also significantly reduced by rAIM treatment, demonstrating the suppression of sterile inflammation at the injury site (Figure 1c). Serum levels of creatinine (Cre) and serum urea nitrogen (BUN) were also reduced by rAIM treatment, indicating that AIM ameliorated renal injury caused by stone-associated tissue damage (Figure 1d). Glyoxylate challenge reduced body weight and worsened the overall physical condition of mice, likely related to renal injury. rAIM administration also ameliorated these pathological phenotypes, including weight loss (Fig. 1e) and food intake (Fig. 1f).

[0084] KIM-1 is highly expressed in the lumen of proximal tubules following tubular epithelial cell injury. KIM-1 also acts as a counterpart of AIM in the phagocytic clearance of tubule-occluding debris during the repair process of AKI. Here, KIM-1 acts as a scavenger receptor that promotes phagocytosis of AIM-associated dead cell debris by tubular epithelial cells. Since KIM-1 mRNA levels increased up to 600-fold upon glyoxylate loading (Figure 1b), the hypothesis emerged that, as in AKI, AIM cooperates with KIM-1 to promote the phagocytic clearance of CaOx crystals, thereby promoting intraluminal stone formation. However, unexpectedly, KIM-1 deficiency (KIM-1) was observed from day 1 of glyoxylate loading. - / -Intravenous administration of rAIM to mice reduced the amount of kidney stones formed on day 6 to a level comparable to that observed in wild-type mice (Fig. 1g). Thus, unlike in AKI, the reduction in kidney stones by rAIM treatment appears to be achieved independently of the AIM / KIM-1 axis.

[0085] [Example 2] AIM binds to CaOx crystals and prevents their growth To investigate the mechanism by which AIM prevents kidney stone growth in mice, we first investigated whether AIM induces phagocytic clearance of CaOx crystals by renal tubular epithelial cells via specific scavenger receptors expressed on these cells, resulting in the dissolution of the crystals in intracellular lysosomes. Indeed, we previously demonstrated that AIM is recognized by CD36, a well-known scavenger receptor expressed on proximal tubular epithelial cells. Therefore, we tested in vitro whether mProx24 cells, a mouse proximal tubular epithelial cell line, internalize CaOx crystals in the presence or absence of rAIM. Flow cytometry analysis showed that the presence of rAIM did not affect (or even inhibited) the capture and / or internalization of CaOx crystals by mProx (Figure 2), thus excluding the possibility that AIM enhances phagocytic clearance of CaOx crystals.

[0086] Therefore, we hypothesized that AIM might prevent the aggregation and growth of CaOx crystals. Therefore, we incubated equal volumes of 1 mM CaCl2 and 5 mM Na2CO4 in the presence or absence of AIM and observed under a microscope whether CaOx crystals grew. As expected, the number and size of crystals were significantly smaller in the presence of rAIM. Furthermore, in the presence of rAIM, the typical sharp shape of CaOx crystals disappeared and changed to a rounded, boulder-like shape (Fig. 3a). In vivo, such a change in the shape of CaOx crystals by rAIM may reduce mechanical damage to renal tubule tissue and contribute to a decrease in the levels of injury and inflammatory markers in the kidney (Fig. 1b and 1c).

[0087] Thus, AIM can bind to small CaOx crystals and prevent their aggregation and growth. Indeed, flow cytometry analysis clearly demonstrated the binding of AIM to CaOx crystals (Figure 3b). The binding of AIM to CaOx crystals was also biochemically confirmed by pull-down assays (Figure 3c; the entire blot is shown in Figure 4). Further analysis of the binding mode of AIM to CaOx crystals using the three SRCR domains of AIM revealed that, in biochemical studies, the N-terminal domain (SRCR1) efficiently bound to CaOx crystals, whereas the SRCR2 and SRCR3 domains did not (Figure 3c). The surface of SRCR1 is strongly negatively charged, whereas SRCR2 is neutral and SRCR3 is positively charged, which are similar to the predicted isoelectric points of each SRCR domain (4.32, 8.44, and 6.55, respectively) (Figure 3c). Because CaOx crystals are positively charged due to the presence of calcium as a bridging cation, SRCR1 binds to CaOx crystals through charge-based interactions, preventing the aggregation and growth of small crystals. Consistent with this hypothesis, the SRCR1 domain, but not the SRCR2 or SRCR3 domain, efficiently inhibited CaOx crystal growth in vitro (Figure 3d). Furthermore, intravenous administration of the SRCR1 domain at molar levels equivalent to rAIM reduced glyoxylate-induced stone growth (Figure 3e). SRCR1 administration reduced the mRNA levels of injury markers and inflammatory cytokines in the kidney (Figure 3f), while also improving serum Cre / BUN levels (Figure 3g), body weight (Figure 3h), and food intake (Figure 3i). These effects were not observed with treatment with either the SRCR2 or SRCR3 domain (Figures 3e-i). Therefore, we concluded that AIM prevents kidney stone growth by binding to small CaOx crystals via SRCR1 and preventing their aggregation and growth. While stone reduction and improvement of serum Cre / BUN levels were achieved to a similar extent by the complete AIM protein and SRCR1, it is noteworthy that the improvements in nephritis and body weight / food intake were more pronounced when mice were administered the complete AIM protein than when mice were administered only the SRCR1 domain.

[0088] Interestingly, despite the apparent preventive effect of AIM on kidney stone development, AIM deficiency (AIM - / - When stones were induced in AIM mice, the amount of stones on day 6 was comparable to that in wild-type mice (Fig. 5a). - / - This contrasts with AKI cases, in which the disease progresses significantly in mice. In mice and humans, serum AIM is normally present bound to IgM pentamers, but is released during AKI to promote disease repair. We observed that the induction of IgM-free AIM was less in the serum of mice with kidney stones than in mice with AKI (Fig. 5b). Human patients with kidney stones did not show a significant increase in serum IgM-free AIM levels compared with healthy controls. In addition, immunohistochemistry in mice did not reveal any clear AIM staining on intraluminal kidney stones (Fig. 5d), which contrasts with the massive accumulation of AIM in intraluminal dead cell debris during AKI. Thus, although AIM protein is effective in inhibiting kidney stone growth, the presence of crystals does not appear to induce sufficient release of endogenous AIM from IgM pentamers in the blood of mice and humans.

[0089] Example 3: Negatively charged substances inhibit kidney stone growth at different levels Having identified the unique mechanism by which AIM prevents kidney stone growth, we next investigated whether various negatively charged substances could also inhibit CaOx crystal growth and kidney stone growth. To this end, we investigated the effects of various negatively charged substances, including recombinant osteopontin (rOPN) protein, the acidic polyanion polyacrylic acid (5.1 kDa; pAA 5.1), and a highly acidic artificial peptide (DEDDDEDDDEDD; D9E3 (SEQ ID NO:28)) were tested and compared with the therapeutic effects of AIM. OPN is a highly negatively charged extracellular matrix protein that exhibits potent inhibitory activity against calcium crystal aggregation and adhesion to renal epithelial cells in vitro. However, a potential role of OPN as a promoter of stone formation by tethering CaOx crystals to the tubular cell membrane has also been proposed, and the mode of involvement of OPN in the kidney stone growth process remains controversial. Acidic polyanion pAA 5.1 Continuous administration of pAA per body weight given per day has been shown to suppress CaOx crystal accumulation in rat kidneys. 5.1 The molar amount of is 10 to 100 times greater than that of the AIM used in the present invention.

[0090] We first confirmed the inhibitory effects of these substances on CaOx crystal aggregation and growth in vitro. We also used a highly positively charged artificial peptide (RRRRKRKRKRKR; R8K4 (SEQ ID NO: 29)) as a control for the D9E3 peptide. All tested negatively charged substances, including rAIM, reduced the size and sharpness of CaOx crystals when added at equimolar levels (Fig. 6a). Interestingly, the effects of these substances on the total number of crystals formed varied, with the presence of OPN increasing the number of crystals (Fig. 6a). As expected, the R8K4 peptide had no effect (Fig. 6a). We then examined their therapeutic effects on kidney stone formation and associated pathological symptoms in vivo. Mice were administered glyoxylic acid for 6 days, and each substance was administered intravenously (rOPN and D9E3 peptide) or intraperitoneally (pAA) on days 1, 3, and 5. 5.1), and 400 μg rAIM were administered at equimolar doses. All three substances reduced kidney stone burden on day 6 of glyoxylic acid treatment, but not as efficiently as rAIM (Figure 6b). Similarly, the reduction in serum Cre / BUN levels was not as pronounced as that achieved by rAIM (Figure 6c). This was also true for the reduction in mRNA levels of injury markers and inflammatory molecules (Figure 6d). More strikingly, these three substances did not induce the weight recovery observed with rAIM (Figure 6e). Similarly, none of the negatively charged substances improved food intake (Figure 6f). Overall, these results suggest the exceptional efficacy of rAIM as a therapeutic tool against kidney stone development and the associated deterioration of overall physical condition. It is noteworthy that several mice (2–3 of 7) in the control (PBS-treated) and R8K4 peptide-treated groups died of acute renal failure due to the development of large stones, whereas no mice died in the other groups. Interestingly, although stone growth was not inhibited in mice treated with the R8K4 peptide, mRNA levels of IL-1β and IL-6 were significantly reduced. The exact reason for this effect is unclear, but it is thought that the R8K4 peptide is a positively charged, L-type Ca2+ receptor. + Like tryptophan-histidine peptides, which have been reported to have anti-inflammatory properties through channel blockade, the R8K4 peptide may have a direct anti-inflammatory effect.

[0091] [Example 4] AIM binds to crystals more strongly than other negatively charged substances The reason why rAIM is particularly effective among various negatively charged substances in preventing kidney stone growth is that AIM may bind covalently to CaOx crystals more effectively than other compounds, thereby preventing stone growth more efficiently. We tested this idea using a competitive binding assay. CaOx crystals were mixed with rAIM and different molar ratios of rOPN and pAA. 5.1The binding of rAIM to CaOx crystals was biochemically evaluated by incubating the cells with either pAA or D9E3 peptide. The presence of other substances at equimolar levels did not inhibit the binding of rAIM to CaOx crystals (Fig. 7a). This tendency was consistent with the presence of other substances at equimolar levels (Fig. 7b). 5.1 The binding of rAIM to CaOx crystals was maintained until the addition of the D9E3 peptide at 100- to 1000-fold higher molar levels (Fig. 7a). Furthermore, rAIM pre-bound to CaOx crystals was not released, even when the crystals were incubated with other substances at equivalent or higher molar levels (Fig. 7b). These results suggest that rAIM has a superior binding affinity to CaOx crystals compared with other negatively charged substances. Furthermore, intravenously administered rOPN is larger than rAIM (40 kDa AIM vs. 45–66 kDa OPN, depending on glycosylation level), and therefore appears to be less efficiently excreted in urine. Indeed, urinary rOPN was not detected (only a small amount of a degraded C-terminal fragment was detected; Fig. 8), which is in stark contrast to the rapid and efficient excretion of full-length AIM after administration.

[0092] [Example 5] AIM reduces DAMPs in kidneys with stones Among the negatively charged substances tested in this study, only rAIM improved the body weight and food intake of glyoxylate-loaded mice (Fig. 3e and 3f). Recently, we have reported that AIM binds to DAMPs and promotes their phagocytic clearance, thereby improving the physical condition and overall prognosis of animals with cerebral infarction. Since a significant amount of DAMPs is released from damaged / dead cells in the luminal and interstitial regions of the kidney associated with CaOx crystal accumulation, the clearance of DAMPs by rAIM may improve the physical complaints associated with kidney stone growth. Furthermore, rOPN, pAA 5.1 Alternatively, the D9E3 peptides are not expected to have AIM-like potency because they do not have a solitary cysteine ​​residue or a positively charged amino acid cluster, both of which are required for efficient binding to DAMPs.

[0093] To this end, we performed immunohistochemical staining for S100A9 (one of the most representative DAMPs in the kidney) using mouse kidney specimens on day 6 after glyoxylic acid loading and quantified the area of ​​extracellular S100A9 staining (area that did not overlap with DAPI-stained nuclei). As expected, treatment with rAIM significantly reduced the volume of S100A9 staining in the luminal and interstitial regions of the kidney (Figure 9). Of note, rOPN, pAA 5.1 Alternatively, in mice administered with the D9E3 peptide, extracellular S100A9 staining was reduced at a different level, although not to the same level as that achieved by rAIM administration (FIG. 9).

[0094] [Example 6] KIM-1 mediates the clearance of developed stones in an AIM-independent manner Continuous administration of glyoxylic acid to mice resulted in an increase in the number of stones for a certain period (up to 6 days); however, interestingly, the number of stones tended to decrease thereafter, even with continued glyoxylic acid administration (Fig. 10a). This suggests that a specific mechanism for removing developed stones is induced by stone accumulation in the kidney. Although KIM-1 was not involved in the prevention of stone growth by AIM, its expression was highly induced in the lumen during stone growth, suggesting that its function as a scavenger receptor may play a role in the physiological removal of developed stones. Supporting this idea, we analyzed KIM-1 mRNA levels over time during stone formation induction with glyoxylic acid. They significantly increased from days 3 to 6, when stone accumulation reached its peak, and then decreased on day 9, when stone volume significantly decreased compared to day 6 (Fig. 10b). Histological analysis revealed that the renal tubular epithelial cells surrounding the deposited stones were positive for KIM-1 staining, suggesting that the renal tubular epithelial cells may actively remove stones through KIM-1 (Fig. 10c).

[0095] KIM-1 plays an important role in stone removal - / -This was demonstrated by inducing kidney stones in mice with glyoxylic acid. Stone volume on days 3 and 6 was significantly greater in KIM-1 mice than in wild-type mice. - / - significantly higher in mice, and more importantly, KIM-1 - / - On day 9, stone burden further increased in the RA-treated mice, whereas it was significantly reduced in the wild-type mice (Fig. 10d). All these data indicate that induction of KIM-1 in renal tubular epithelial cells is an important protective response against stone accumulation.

[0096] Interestingly, KIM-1 patients with stones after the 6th day of glyoxylate loading - / - Daily administration of rAIM to mice did not result in a significant increase in stone burden on day 9 (Fig. 10e). In addition, administration of rAIM to wild-type mice did not enhance the spontaneous reduction of kidney stones (Fig. 10e). Thus, rAIM is highly effective in preventing kidney stone formation, but not in removing them once they have developed.

[0097] [Example 7] Examination of AIM fragments with preventive effects against kidney stone formation 1 We designed 12 peptides (SEQ ID NOs: 30-41, Figure 11-B) by dividing mouse AIM into 12 segments, and performed crystallization experiments using these peptides to identify the peptide regions that inhibit kidney stone formation. As a result, we found that the SRCR1 domain of AIM and the downstream hinge region, which contain a relatively large number of negatively charged amino acids, efficiently inhibited crystal growth (Figure 11-A, C).

[0098] [Example 8] Examination of AIM fragments with preventive effects against kidney stone formation 2 We investigated whether similar effects could be obtained using human AIM peptides corresponding to mouse AIM peptides. Specifically, we performed experiments similar to those in Example 7 using human AIM peptides (SEQ ID NOs: 42-46, FIG. 12-B) corresponding to mouse AIM peptides (#3-#7 (SEQ ID NOs: 32-36)), human rAIM (full length), the human SRCR1 domain, and the human SRCR2 domain. As a result, similar to the results of the experiment using mouse AIM, when human AIM peptide was used, the region containing a relatively large number of negatively charged amino acids in the AIM SRCR1 domain and the downstream hinge region efficiently inhibited crystal growth (FIGS. 12-A and 12-C).

[0099] These results indicate that the region with a large number of negatively charged amino acids in the SRCR1 domain of AIM and in the downstream hinge region is important for AIM's inhibition of kidney stone growth. [Industrial Applicability]

[0100] According to the present invention, kidney stones can be prevented or treated, and therefore the present invention is extremely useful in the medical field.

Claims

1. A drug for inhibiting the growth of kidney stones, comprising a peptide having an amino acid sequence that satisfies the following conditions, or a nucleic acid encoding the same: (1) an amino acid sequence of 20 or more consecutive amino acids in a region consisting of the SRCR1 domain and hinge region of apoptosis inhibitor of macrophage (AIM); and (2) (the number of aspartic acids and glutamic acids in the amino acid sequence) - (the number of arginines and lysines in the amino acid sequence) ≥ 5.

2. The agent according to claim 1, wherein the peptide is the SRCR1 domain or full-length AIM.

3. A method for inhibiting kidney stone growth in a subject, comprising administering to the subject a peptide comprising an amino acid sequence satisfying the following conditions, or a nucleic acid encoding the peptide: (1) an amino acid sequence of 20 or more consecutive amino acids in a region consisting of the SRCR1 domain and hinge region of apoptosis inhibitor of macrophage (AIM); and (2) (the number of aspartic acids and glutamic acids in the amino acid sequence) - (the number of arginines and lysines in the amino acid sequence) ≥ 5.

4. The method of claim 3, wherein the peptide is the SRCR1 domain or full-length AIM.