Method for determining presence state of target substance, kit, and apparatus for determining presence state of target substance
The method uses a first complex with target-binding and signal nucleic acids, along with template nucleic acids and enzymes, to perform nucleic acid amplification at low temperatures, addressing sensitivity issues in existing detection methods and enabling sensitive detection of various substances.
Patent Information
- Application Number
- JP2024037655
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-03-11
- Publication Date
- 2025-09-25
AI Technical Summary
Existing methods for detecting target substances often lack sensitivity and require precise temperature control or high-temperature reactions, limiting their versatility.
A method involving a first complex with a target-binding molecule and signal nucleic acid, combined with template nucleic acids and enzymes, allows for nucleic acid amplification at 50°C or less, using a polymerase and lambda exonuclease to detect target substances with high sensitivity.
Enables simple and sensitive detection of a wide range of molecules, including proteins, nucleic acids, sugars, microorganisms, viruses, and cells, with a low detection limit and versatile components.
Smart Images

Figure 2025138517000001_ABST
Abstract
Description
[Technical Field]
[0001] Various techniques are known for detecting target substances in samples. For example, methods using nucleic acid amplification, such as polymerase chain reaction (PCR), are commonly known as highly sensitive methods for detecting nucleic acids. Instead of PCR, which requires temperature cycling, other methods using isothermal amplification reactions, such as strand displacement amplification (SDA), nicking enzyme amplification reaction (NEAR), loop-mediated isothermal amplification (LAMP), and isothermal and chimeric primer-initiated amplification of nucleic acids (ICAN), are also known. A highly versatile method that is not limited to nucleic acids is enzyme-linked immunosorbent assay (ELISA), which binds an antibody or antigen to a target substance and detects its presence using an enzymatic reaction.
[0002] Various applied technologies aimed at improving the sensitivity of ELISA are also being developed. For example, Non-Patent Document 1 describes a method called immuno-PCR, in which a target substance is captured with a DNA-linked antibody and the DNA is amplified by real-time PCR to detect the target substance with high sensitivity. Non-Patent Document 2 describes the highly sensitive detection of MUC1 (tumor protein Mucin 1) by the IMEXPAR method, which combines an immunoassay with a technique called EXPAR (Exponential Amplification Reaction). While conventional ELISA requires a washing step to remove excess antibody, Non-Patent Document 3 reports a method (called a proximity assay or proximity extension assay) for detecting antibodies without washing the antibodies, using an antibody linked to a certain DNA and an antibody linked to DNA complementary to the same DNA, designed so that amplification occurs when they bind to and hybridize with the same target substance. [Prior art documents] [Non-patent literature]
[0003] [Non-Patent Document 1] Science, Volume 258, No.5079,2 October, 1992, Pages 120-122 [Non-patent document 2] Talanta, Volume 204, 1 November 2019, Pages 248-254 [Non-patent document 3] Nucleic Acids Res., Volume 39, No.15, 6 June 2011, e102 Summary of the Invention [Problem to be solved by the invention]
[0004] On the other hand, commonly used methods for detecting target substances often lack sensitivity or require precise temperature control or high-temperature reactions like PCR, and are therefore often insufficient in terms of versatility. In view of this situation, the present disclosure provides a simple method for determining the presence state of a target substance, which has a low detection limit, as well as a kit and a determination device used in the method. [Means for solving the problem]
[0005] Means for solving the above problems include the following aspects. <1> A method for determining the state of a target substance in a sample, comprising: (A) preparing a sample; (B) adding to the sample a first complex containing a first target-binding molecule capable of binding to the target substance and a signal nucleic acid that is bound to or capable of binding to the first target-binding molecule, thereby obtaining a second complex in which the target substance and the first complex are bound via the first target-binding molecule; (C) adding to the second complex: a first template nucleic acid including a first template recognition region having sequence complementarity to a continuous region of 7 or more bases in the signal nucleic acid; a second template nucleic acid containing a second template corresponding region having sequence identity to a continuous region of 7 or more bases in the signal nucleic acid; A polymerase and a nicking enzyme; adding lambda exonuclease; (D) after (A) to (C), performing a nucleic acid amplification reaction at a temperature range of 50°C or less; and (E) after (D), detecting the amplification product. Including, the signal nucleic acid comprises, in order from upstream, a region having sequence identity to a second template nucleic acid and a region having sequence complementarity to a first template nucleic acid; A determination method that satisfies either (X) or (Y) below. (X) The second template nucleic acid comprises, in order from upstream, a stabilizing region, a nick-forming site, and the second template corresponding region, and the nicking enzyme is capable of forming a nick only in the second template nucleic acid among the first template nucleic acid, the second template nucleic acid, and the signal nucleic acid. (Y) The first template nucleic acid comprises, in order from upstream, a stabilizing region, a nick-forming site, and the first template recognition region, and the nicking enzyme is capable of forming a nick only in the first template nucleic acid among the first template nucleic acid, the second template nucleic acid, and the signal nucleic acid. <2> the target substance is at least one selected from the group consisting of proteins, nucleic acids, sugars, low molecular weight compounds, microorganisms, viruses, and cells; <1> The determination method described in <3> The first target-binding molecule is at least one selected from the group consisting of an antibody, an aptamer, biotin, streptavidin, a thiol, N-hydroxysuccinimide, an alkyne, and an azide compound; <1> or <2> The determination method described in <4> In the first complex, the first target-binding molecule and the signal nucleic acid are indirectly bound or indirectly bindable via biotin and streptavidin. <1> ~ <3> 10. The method for determining whether or not a subject is a subject of the present invention. <5> determining the presence states of multiple types of target substances by using multiple types of first target-binding molecules, multiple types of signal nucleic acids, and multiple types of first template nucleic acids corresponding to the multiple types of signal nucleic acids; <1> ~ <4> 10. The method for determining whether or not a subject is a subject of the present invention. <6> In (A), the target substance may or may not be immobilized on a substrate; <1> ~ <5> 10. The method for determining whether or not a subject is a subject of the present invention. <7> In the step (A), the sample is prepared on a substrate, and the step (C) is performed after the steps (A) and (B), and the method further comprises washing the substrate after the steps (A) and (B) and before the step (C). <1> ~ <6> 10. The method for determining whether or not a subject is a subject of the present invention. <8> In the step (A), the sample is prepared on a substrate, and the material of the substrate is selected from the group consisting of polystyrene, polypropylene, gold colloid, and magnetic particles. <1> ~ <7> 10. The method for determining whether or not a subject is a subject of the present invention. <9> the polymerase has strand displacement activity; <1> ~ <8> 10. The method for determining whether or not a subject is a subject of the present invention. <10> The nucleic acid amplification reaction is an isothermal amplification reaction. <1> ~ <9> 10. The method for determining whether or not a subject is a subject of the present invention. <11> The isothermal amplification reaction is carried out at 10°C to 50°C. <10> The determination method described in <12> When (X) and (Y) are satisfied, a continuous region of 3 or more bases in the stabilizing region and a continuous region downstream of the continuous region of 3 or more bases have sequence complementarity and can form a hairpin structure. <1> ~ <11> 10. The method for determining whether or not a subject is a subject of the present invention. <13> When (X) and (Y) are satisfied, the Tm value of the stabilization region is 30°C or higher. <1> ~ <12> 10. The method for determining whether or not a subject is a subject of the present invention. <14> In the second template nucleic acid when the condition (X) is satisfied and in the first template nucleic acid when the condition (Y) is satisfied, (1) two consecutive bases at the 5' end, (2) two consecutive bases at the 3' end; (3) two consecutive bases at the 5' end that can be generated by nicking with a nicking enzyme, and (4) Two consecutive bases at the 3' end that can be generated by nicking with a nicking enzyme are have neither sequence identity nor sequence complementarity with each other; <1> ~ <13> 10. The method for determining whether or not a subject is a subject of the present invention. <15> When the 3' end of the first template nucleic acid and the 3' end of the second template nucleic acid are aligned with the signal nucleic acid, the first template recognition region and the second template corresponding region are arranged with an interval of one or more bases between them, are adjacent to each other without an interval, or are arranged with an overlap of one or more bases between them. <1> ~ <14> 10. The method for determining whether or not a subject is a subject of the present invention. <16> The 3'-end of the second template nucleic acid when the condition (X) is satisfied and the 3'-end of the first template nucleic acid when the condition (Y) is satisfied are modified. <1> ~ <15> 10. The method for determining whether or not a subject is a subject of the present invention. <17> A kit for determining the state of a target substance in a sample, comprising: a first complex stored in a container, the first complex including a first target-binding molecule capable of binding to a target substance and a signal nucleic acid that is bound to or capable of binding to the first target-binding molecule; a polymerase contained in a container; a nicking enzyme contained in a container; a lambda exonuclease contained in a container; a first template nucleic acid stored in a container; a second template nucleic acid stored in a container; Equipped with the first template nucleic acid includes a first template recognition region having sequence complementarity to a continuous region of 7 or more bases in the signal nucleic acid; the second template nucleic acid comprises a second template corresponding region having sequence identity to a continuous region of 7 or more bases in the signal nucleic acid; the signal nucleic acid comprises, in order from upstream, a region having sequence identity to a second template nucleic acid and a region having sequence complementarity to a first template nucleic acid; A kit that satisfies the following (X) or (Y): (X) The second template nucleic acid comprises, in order from upstream, a stabilizing region, a nick-forming site, and the second template corresponding region, and the nicking enzyme is capable of forming a nick only in the second template nucleic acid among the first template nucleic acid, the second template nucleic acid, and the signal nucleic acid. (Y) The first template nucleic acid comprises, in order from upstream, a stabilizing region, a nick-forming site, and the first template recognition region, and the nicking enzyme is capable of forming a nick only in the first template nucleic acid among the first template nucleic acid, the second template nucleic acid, and the signal nucleic acid. <18> the target substance is at least one selected from the group consisting of proteins, nucleic acids, sugars, low molecular weight compounds, microorganisms, viruses, and cells; <17> The kit according to claim 1. <19> <1> ~ <16> a receiving unit that acquires a detection result of an amplification product in the determination method according to any one of the above items; a processing unit that converts the detection result acquired by the reception unit into output data; an output unit that outputs the output data; An apparatus for determining the state of presence of a target substance, comprising: [Effects of the Invention]
[0006] According to the present disclosure, there are provided a simple method for determining the presence state of a target substance, which has a low detection limit, as well as a kit and a determination device used in the method. [Brief explanation of the drawings]
[0007] [Figure 1] FIG. 1 is a schematic diagram showing the relationship between a signal nucleic acid, a first template nucleic acid, and a second template nucleic acid in a method that satisfies (X). [Figure 2] FIG. 2 is a schematic diagram showing the presumed mechanism of nucleic acid amplification in a method that satisfies (X). [Figure 3] FIG. 3 is a schematic diagram showing the relationship between a signal nucleic acid, a first template nucleic acid, and a second template nucleic acid in a method that satisfies (Y). [Figure 4] FIG. 4 is a schematic diagram showing the presumed mechanism of nucleic acid amplification in a method that satisfies (Y). [Figure 5] FIG. 5 shows a schematic diagram of the estimated mechanism of nucleic acid amplification in one embodiment of the determination method of the present disclosure. [Figure 6] FIG. 6 shows a schematic diagram of the estimated mechanism of nucleic acid amplification in one embodiment of the determination method of the present disclosure. [Figure 7] FIG. 7 shows a schematic diagram of the estimated mechanism of nucleic acid amplification in one embodiment of the determination method of the present disclosure. [Figure 8] FIG. 8 is a schematic diagram showing the functional configuration of a determination device according to an embodiment. [Figure 9] FIG. 9 is a schematic block diagram of a computer that functions as a determination device in one embodiment. [Figure 10] FIG. 10 is a graph plotting the change in antigen (logarithm) and amplification initiation time in Test Groups 1 to 7 of the Example. [Figure 11] FIG. 11 is a graph plotting antigen (pg) and absorbance in Test Plots 9 to 11 of the Example. DETAILED DESCRIPTION OF THE INVENTION
[0008] Hereinafter, modes for carrying out embodiments of the present disclosure will be described in detail. However, the embodiments of the present disclosure are not limited to the following embodiments. In the following embodiments, components (including element steps, etc.) are not essential unless otherwise specified. The same applies to numerical values and their ranges, and they do not limit the embodiments of the present disclosure.
[0009] In the present disclosure, the term "process" includes not only a process that is independent of other processes, but also a process that cannot be clearly distinguished from other processes as long as the purpose of the process is achieved. In the present disclosure, numerical ranges indicated using "to" include the numerical values before and after "to" as the minimum and maximum values, respectively. In the numerical ranges described in stages in this disclosure, the upper or lower limit value described in one numerical range may be replaced with the upper or lower limit value of another numerical range described in stages. Furthermore, in the numerical ranges described in this disclosure, the upper or lower limit value of that numerical range may be replaced with a value shown in the examples. In the present disclosure, when multiple elements are listed using "or" or "or," unless otherwise expressly stated, it does not exclude the selection of a combination of the multiple elements unless a technical contradiction arises. In the present disclosure, even if an element is referred to in the singular, unless expressly stated otherwise, it does not exclude the presence of a plurality insofar as it does not create a technical contradiction. In the present disclosure, multiple exemplary aspects described separately may be combined with each other to form a new aspect, unless they contradict each other. When embodiments of the present disclosure are described with reference to the drawings, the configuration of the embodiment is not limited to the configuration shown in the drawings. Furthermore, the sizes of the components in each drawing are conceptual, and the relative size relationships between the components are not limited to these. In the present disclosure, the term "nucleic acid" includes all nucleic acids (e.g., DNA, RNA, analogs thereof, natural products, artificial products), and all nucleic acids linked to small molecules, groups, molecules other than nucleic acids, structures, etc.
[0010] <Method for determining the state of a target substance in a sample> The determination method of the present disclosure is a method for determining the state of a target substance in a sample, comprising: (A) preparing a sample; (B) adding to the sample a first complex containing a first target-binding molecule capable of binding to the target substance and a signal nucleic acid that is bound to or capable of binding to the first target-binding molecule, thereby obtaining a second complex in which the target substance and the first complex are bound via the first target-binding molecule; (C) adding to the second complex: a first template nucleic acid including a first template recognition region having sequence complementarity to a continuous region of 7 or more bases in the signal nucleic acid; a second template nucleic acid containing a second template corresponding region having sequence identity to a continuous region of 7 or more bases in the signal nucleic acid; A polymerase and a nicking enzyme; adding lambda exonuclease; (D) after (A) to (C), performing a nucleic acid amplification reaction at a temperature range of 50°C or less; and (E) after (D), detecting the amplification product. Including, the signal nucleic acid comprises, in order from upstream, a region having sequence identity to a second template nucleic acid and a region having sequence complementarity to a first template nucleic acid; Satisfies either (X) or (Y) below. (X) The second template nucleic acid comprises, in order from upstream, a stabilizing region, a nick-forming site, and the second template corresponding region, and the nicking enzyme is capable of forming a nick only in the second template nucleic acid among the first template nucleic acid, the second template nucleic acid, and the signal nucleic acid. (Y) The first template nucleic acid comprises, in order from upstream, a stabilizing region, a nick-forming site, and the first template recognition region, and the nicking enzyme is capable of forming a nick only in the first template nucleic acid among the first template nucleic acid, the second template nucleic acid, and the signal nucleic acid. Hereinafter, the steps (A) to (E) will also be referred to as "step (A)" to "step (E)", respectively.
[0011] The determination method of the present disclosure enables simple determination of the state of a target substance with a low detection limit. By using a first target-binding molecule capable of binding to a target substance, the determination method of the present disclosure can be applied to the detection of a wide variety of molecules, including proteins, nucleic acids, sugars, low-molecular-weight compounds, microorganisms, viruses, and cells. Furthermore, since the nucleic acid amplification reaction is performed at a temperature range of 50°C or less, the components used are highly versatile and simple. Furthermore, since the nucleic acid amplification reaction is performed using the signal nucleic acid, first template nucleic acid, and second template nucleic acid designed as described above, as well as a polymerase, a nicking enzyme, and a lambda exonuclease, detection sensitivity is high.
[0012] Note that, since the determination method of the present disclosure determines the presence state of a target substance by detecting an amplification product, the expression "performing a nucleic acid amplification reaction" above means adjusting conditions so that nucleic acids can be amplified when a target substance is present, but does not necessarily mean that nucleic acids are amplified. Furthermore, the expression "detecting an amplification product" means performing an operation that makes an amplification product detectable when an amplification product is present, but does not necessarily mean that an amplification product is detected. In other words, if an amplification product is not present, an amplification product will not be detected even if an operation that makes it detectable is performed, but such an operation is also included in the scope of the operation referred to by the above expression.
[0013] In the present disclosure, the "state of existence" may simply refer to the presence or absence of a substance, or may refer to the amount of existence (including an amount of existence of 0, i.e., no substance). Therefore, "determining the state of existence" may refer to a binary determination of whether a substance is present or absent, or may also refer to the amount of existence when a substance is present, in addition to the amount of existence. Here, the "amount of existence" is not limited to the absolute amount of existence, but may also refer to the amount of existence relative to a comparison target such as a negative control or a positive control.
[0014] [Example embodiment] In step (A), the sample may be prepared on a substrate. If a target substance is present in the sample, the target substance may or may not be immobilized on the substrate. If the target substance is immobilized on the substrate, unimmobilized substances can be removed by washing the substrate, which tends to improve sensitivity and / or specificity. If the target substance is not immobilized on the substrate, omitting washing the substrate tends to simplify the process.
[0015] The nucleic acid amplification reaction may be carried out by a method that satisfies (X) or (Y).
[0016] In a method that satisfies (X), the second template nucleic acid includes, in order from upstream, a stabilizing region, a nick-forming site, and a second template corresponding region, and the nicking enzyme is capable of forming a nick only in the second template nucleic acid among the first template nucleic acid, the second template nucleic acid, and the signal nucleic acid. In a method that satisfies (X), an example of the relationship between a signal nucleic acid, a first template nucleic acid, and a second template nucleic acid is shown in Figure 1. Note that Figure 1 is a schematic diagram for illustrative purposes only and does not limit the embodiments of the present disclosure. The base sequence shown in Figure 1 is also a base sequence for illustrative purposes only and does not limit the embodiments of the present disclosure. In Figure 1, the arrows along the base sequence indicate that the start point of the arrow indicates the 5' end of the base sequence, and the end point of the arrow indicates the 3' end of the base sequence. Figure 1 shows an example in which the nicking enzyme is Nb.BbvCI. In Figure 1, for example, the second template nucleic acid includes, in order from upstream (i.e., from the 5' end of the second template nucleic acid), a stabilizing region, a nick-forming site "5'-GCTGAGG-3'," an additional region, and a second template corresponding region. The second template corresponding region has sequence identity to a continuous region of 7 or more bases in the signal nucleic acid. The first template nucleic acid includes a first template recognition region, which has sequence complementarity to a continuous region of 7 or more bases in the signal nucleic acid. As described above, the second template nucleic acid contains a nicking site, and a nick is formed by the nicking enzyme. On the other hand, the first template nucleic acid does not contain a nicking site, and a nick is not formed by the nicking enzyme. That is, the nicking enzyme can form a nick only in the second template nucleic acid among the first template nucleic acid, the second template nucleic acid, and the signal nucleic acid. The signal nucleic acid contains, from upstream (i.e., from the 5' end of the signal nucleic acid), a region having sequence identity to the second template nucleic acid and a region having sequence complementarity to the first template nucleic acid. That is, the signal nucleic acid and the first template nucleic acid can form a double-stranded nucleic acid (i.e., hybridize) in the region having sequence complementarity. A method that satisfies (X) is carried out using the above-mentioned signal nucleic acid, first template nucleic acid, and second template nucleic acid.
[0017] The principle of the nucleic acid amplification reaction when (X) is satisfied will be explained using Figure 2. Note that Figure 2 is a schematic diagram for illustrative purposes only and does not limit the embodiments of the present disclosure. In Figure 2, the arrow indicating the nucleic acid has its starting point indicating the 5' end of the base sequence and its end point indicating the 3' end of the base sequence. First, the first template nucleic acid hybridizes with the signal nucleic acid in the first template recognition region due to sequence complementarity between the nucleic acids. Then, the polymerase extends the 3' end of the complementary strand at the single-stranded portion (i.e., the 5' overhanging end of the first template nucleic acid) to form a double-stranded nucleic acid. Here, lambda exonuclease has a high affinity for double-stranded DNA containing a nucleic acid strand phosphorylated at the 5' end, and removes the 5' mononucleotide from the 5' end to the 3' end of the 5'-phosphorylated nucleic acid strand. Therefore, only the strand phosphorylated at the 5' end (i.e., the strand of the double-stranded nucleic acid originating from the signal nucleic acid phosphorylated at the 5' end) is degraded (P in Figure 2). At this time, an amplification intermediate is produced. Next, the second template nucleic acid hybridizes with the amplification intermediate in the second template-corresponding region due to sequence complementarity of the nucleic acids. The polymerase then extends the 3' end of the complementary strand at the single-stranded portion (i.e., the 5'-overhanging end of the second template nucleic acid) to form a double-stranded nucleic acid. The nicking enzyme then recognizes the nicking enzyme recognition region of the second template nucleic acid and cleaves one side strand (i.e., the strand of the double-stranded nucleic acid originating from the second template nucleic acid) at the nick site. As a result, a new 3' end is generated in the single strand, and the polymerase extends a new strand from this 3' end. At this time, the previously formed nucleic acid strand (the nucleic acid strand whose 5' end is the site cut by the nicking enzyme; also known as a signal nucleic acid equivalent) dissociates (strand displacement). After extension, the nicking enzyme again cleaves one strand at the nick site, and the polymerase extends the strand from the resulting 3' end, repeating this process to generate multiple signal nucleic acid equivalents, whose 5' ends are phosphorylated (P in Figure 2). The first template nucleic acid then hybridizes with the signal nucleic acid equivalent in the first template recognition region due to sequence complementarity of the nucleic acids, and the signal nucleic acid equivalent is subsequently amplified from the signal nucleic acid equivalent in a manner similar to that described above.
[0018] In a method that satisfies (Y), the first template nucleic acid includes, in order from upstream, a stabilizing region, a nick-forming site, and a first template recognition region, and the nicking enzyme is capable of forming a nick only in the first template nucleic acid among the first template nucleic acid, the second template nucleic acid, and the signal nucleic acid. In a method that satisfies (Y), an example of the relationship between a signal nucleic acid, a first template nucleic acid, and a second template nucleic acid is shown in Figure 3. Note that Figure 3 is a schematic diagram for illustrative purposes only and does not limit the embodiments of the present disclosure. The base sequence shown in Figure 3 is also a base sequence for illustrative purposes only and does not limit the embodiments of the present disclosure. In Figure 3, the arrows along the base sequence indicate that the start point of the arrow indicates the 5' end of the base sequence, and the end point of the arrow indicates the 3' end of the base sequence. Figure 3 shows an example in which the nicking enzyme is Nb.BbvCI. In Figure 3, for example, the first template nucleic acid includes, in order from upstream (i.e., from the 5' end of the first template nucleic acid), a stabilizing region, a nick-forming site "5'-GCTGAGG-3'," an additional region, and a first template recognition region. The first template recognition region has sequence complementarity to a continuous region of 7 or more bases in the signal nucleic acid. The second template nucleic acid comprises, in order from upstream, an additional region and a second template corresponding region, which has sequence identity to a continuous region of 7 or more bases in the signal nucleic acid. As described above, the first template nucleic acid contains a nicking site, and a nick is formed by the nicking enzyme. On the other hand, the second template nucleic acid does not contain a nicking site, and a nick is not formed by the nicking enzyme. That is, the nicking enzyme can form a nick only in the first template nucleic acid among the first template nucleic acid, the second template nucleic acid, and the signal nucleic acid. The signal nucleic acid contains, from upstream (i.e., from the 5' end of the signal nucleic acid), a region having sequence identity to the second template nucleic acid and a region having sequence complementarity to the first template nucleic acid. That is, the signal nucleic acid and the first template nucleic acid can form a double-stranded nucleic acid (i.e., hybridize) in the region having sequence complementarity. A method that satisfies (Y) is carried out using the above-mentioned signal nucleic acid, first template nucleic acid, and second template nucleic acid.
[0019] The principle of the nucleic acid amplification reaction when (Y) is satisfied will be explained using Figure 4. Note that Figure 4 is a schematic diagram for illustrative purposes only and does not limit the embodiments of the present disclosure. In Figure 4, the arrow indicating the nucleic acid has its starting point indicating the 5' end of the base sequence and its end point indicating the 3' end of the base sequence. First, the first template nucleic acid hybridizes with the signal nucleic acid in the first template recognition region due to sequence complementarity between the nucleic acids. Then, a polymerase extends the complementary strand at the single-stranded portion (i.e., the protruding end) to form a double-stranded nucleic acid. Furthermore, a nicking enzyme recognizes the nicking enzyme recognition region of the first template nucleic acid and cleaves one side strand (i.e., the strand of the double-stranded nucleic acid originating from the first template nucleic acid) at the nick site. As a result, a new 3' end is generated in the single strand, and the polymerase extends a new strand starting from this 3' end. At this time, the previously formed nucleic acid strand (the nucleic acid strand whose 5' end is the site cut by the nicking enzyme; also known as an amplification intermediate) dissociates and is generated. After extension, the nicking enzyme again cleaves the other side strand at the nick site, and the polymerase extends a new strand starting from the resulting 3' end. This reaction is repeated, resulting in the generation of numerous amplification intermediates. The 5' end of the amplification intermediate is phosphorylated (P in Figure 4). Next, the second template nucleic acid hybridizes with the amplification intermediate in the second template-corresponding region due to sequence complementarity of the nucleic acids. The polymerase then extends the complementary strand at the single-stranded (i.e., protruding) portion to form a double-stranded nucleic acid. Here, lambda exonuclease has a high affinity for double-stranded DNA having a nucleic acid strand phosphorylated at the 5' end, and removes the 5' mononucleotide from the 5' end to the 3' end of the nucleic acid strand phosphorylated at the 5' end. Therefore, only the strand phosphorylated at the 5' end (i.e., the strand of the double-stranded nucleic acid originating from the amplification intermediate phosphorylated at the 5' end) is degraded. This mechanism results in the generation of a signal nucleic acid equivalent. The first template nucleic acid then hybridizes with the signal nucleic acid equivalent in the first template recognition region due to sequence complementarity of the nucleic acids, and the signal nucleic acid equivalent is subsequently amplified from the signal nucleic acid equivalent in a manner similar to that described above.
[0020] Preferred embodiments of the determination method of the present disclosure are listed below. In the table below, when a target substance is immobilized on a substrate, it is referred to as "immobilized," and when it is not immobilized, it is referred to as "non-immobilized." The meanings of "(X)" and "(Y)" are as described above. A "single assay" is an embodiment in which only a first target-binding molecule (i.e., only one type of target-binding molecule) is bound to a target substance.
[0021] [Table 1]
[0022] Each embodiment will be described below with reference to the drawings. However, the embodiments of the present disclosure are not limited to the following examples. Furthermore, the drawings are schematic diagrams, and the actual size and shape are not limited to the aspects shown in the drawings. Hereinafter, the embodiments in the above table will also be referred to as "Embodiment 1" to "Embodiment 2," respectively. In the following explanations and schematic diagrams of Embodiments 1 and 2, each substance is explained, and each substance may be dissolved or suspended in a solvent, and the following embodiments may be carried out in a solution or suspension.
[0023] A schematic diagram of the first embodiment is shown in FIG. When a sample contains a target substance 1, adding the sample to a substrate 10 in step (A) immobilizes the target substance 1 on the substrate 10. After immobilization, it is desirable to wash the substrate 10 to remove any unimmobilized substances (especially unimmobilized target substances). In step (B), a first complex containing a first target-binding molecule 2a bound to a signal nucleic acid 3a binds to the target substance 1, thereby obtaining a second complex. It is desirable to then wash the substrate 10 to remove any unimmobilized substances. In step (C), when a polymerase, a nicking enzyme, a lambda exonuclease, and a first template nucleic acid 4a are added to the substrate 10, the signal nucleic acid 3a hybridizes to the first template nucleic acid 4a, and nucleic acid amplification begins. In addition to the first template nucleic acid 4a, a second template nucleic acid 4b is also added. Then, due to the mechanism of the nucleic acid amplification reaction when the above-mentioned (X) is satisfied, the signal nucleic acid equivalent 3c is amplified, and therefore the target substance can be detected by detecting the signal nucleic acid equivalent 3c.
[0024] In the first embodiment, the target substance 1 may be indirectly immobilized via a substance bound to the substrate. For example, as shown in Fig. 6, the target substance 1 may be immobilized to a substrate 10 via a substance 9 bound to the substrate. This also applies to the other embodiments in which a target substance is immobilized.
[0025] In the second embodiment, (X) in the first embodiment is changed to (Y). A schematic diagram of the second embodiment is shown in FIG. When a sample contains a target substance 1, adding the sample to a substrate 10 in step (A) immobilizes the target substance 1 on the substrate 10. After immobilization, it is desirable to wash the substrate 10 to remove any unimmobilized substances (especially unimmobilized target substances). In step (B), a first complex containing a first target-binding molecule 2a bound to a signal nucleic acid 3a binds to the target substance 1, yielding a second complex. It is desirable to then wash the substrate 10 to remove any unimmobilized substances. In step (C), a polymerase, a nicking enzyme, a lambda exonuclease, and a first template nucleic acid 4a' are added to the substrate 10, whereupon the signal nucleic acid 3a hybridizes to the first template nucleic acid 4a', initiating nucleic acid amplification. In addition to the first template nucleic acid 4a', a second template nucleic acid 4b' is also added. Then, due to the mechanism of the nucleic acid amplification reaction when the above-mentioned (Y) is satisfied, the signal nucleic acid equivalent 3c' is amplified, and the target substance can be detected by detecting the signal nucleic acid equivalent 3c'.
[0026] 〔material〕 Substances related to the determination method of the present disclosure will be described in detail below.
[0027] (sample) The sample is not particularly limited as long as it can contain a target substance, and examples include biological samples, virus samples, environmental samples, foods, pharmaceuticals (biological preparations, etc.), etc. The sample may be a natural sample or an artificial sample. Examples of biological samples include samples derived from living organisms such as animals (mammals (e.g., humans and non-human mammals), birds, amphibians, reptiles, fish, chordates, arthropods, etc.), plants (rice, wheat, tobacco, etc.), fungi (mold, yeast, etc.), and bacteria. Specific examples of biological samples include blood, urine, feces, cerebrospinal fluid, semen, saliva, tissue, and other biological samples; organisms (bacterial bodies, etc.); cell cultures, etc. Examples of environmental samples include samples derived from soil, water (domestic wastewater, river water, seawater, groundwater, tap water, etc.), air, etc.
[0028] (Target substance) The target substance is not particularly limited, and examples thereof include proteins, nucleic acids, sugars, low molecular weight compounds, microorganisms, viruses, and cells. Proteins include peptides, antigens, antibodies (eg, primary antibodies), enzymes, cytokines, lipoproteins, glycoproteins, hormones, and the like. Nucleic acids include DNA, RNA, analogs thereof, natural products, artificial products, and nucleic acids to which low molecular weight compounds, groups, molecules other than nucleic acids, structures, etc. Nucleic acids also include small RNA (sRNA), microRNA (miRNA), messenger RNA (mRNA), ribosomal RNA (rRNA), transfer RNA (tRNA), circular RNA (circRNA), etc. of living organisms, as detailed in WO 2020 / 179823. The sugars include monosaccharides, polysaccharides, and derivatives thereof. Examples of low molecular weight compounds include natural or synthetic compounds with a molecular weight of 2000 or less. The molecular weight of a low molecular weight compound may be 1500 or less, or may be 1000 or less. Microorganisms include prokaryotes (bacteria and archaea) and eukaryotes (protists, fungi, algae, etc.), mycoplasmas, rickettsiae, phytoplasmas, and pathogenic microorganisms. Viruses include RNA viruses, DNA viruses, phages, pathogenic viruses, and the like. Examples of cells include animal cells and plant cells.
[0029] (base material) When a substrate is used in the determination method of the present disclosure, the substrate is not particularly limited, and a commonly used substrate can be used. Examples of the substrate that can be used include plates, particles (gold colloid, magnetic particles, gel particles, etc.), nonwoven fabrics, and membranes. Examples of substrate materials include resins, glass, metals (gold, silver, iron, zirconia, etc.), diatomaceous earth, silica, activated carbon, peptides, polysaccharides, etc. Resins include polystyrene, polypropylene, polyethylene, polycarbonate, polydimethylsiloxane, polymethyl methacrylate, polyvinylidene fluoride, nylon, polyacrylamide, polyethylene glycol, polyacrylonitrile, polyurethane, etc. Polysaccharides include cellulose, nitrocellulose, Sepharose, Sephadex, Sephacryl, dextran, agarose, alginic acid, carrageenan, pectin, konjac flour, chitosan, etc. According to the determination method of the present disclosure, since high-temperature treatment is not required in the nucleic acid amplification reaction, commonly used substrates can be used without limitation. For example, polystyrene, polypropylene, gold colloid, and magnetic particles are preferred.
[0030] When a target substance is immobilized on a substrate, the target substance may be immobilized directly on the substrate or indirectly via a substance bound to the substrate. When a target substance is immobilized directly on a substrate, the substrate may be made of a material capable of immobilizing the target substance, or may be treated to enable immobilization. When a target substance is indirectly immobilized via a substance bound to the substrate, examples of the substance bound to the substrate include antibodies, proteins, and aptamers (peptide aptamers, nucleic acid aptamers, etc.) capable of binding to the target substance. The binding mode of the target substance to the substrate is not particularly limited, and examples include covalent bonds (ester bonds, amide bonds, S-S bonds, click chemistry, etc.) and non-covalent bonds (ionic bonds, hydrogen bonds, hydrophobic interactions, electrostatic interactions, etc.). Examples include binding to a polystyrene substrate via hydrophobic interactions and non-covalent bonds via biotin-streptavidin.
[0031] (First target-binding molecule) The first target-binding molecule (hereinafter also referred to as "target-binding molecule") is not particularly limited as long as it can bind to a target substance. Examples of target-binding molecules include antibodies, aptamers, biotin, streptavidin, thiols, N-hydroxysuccinimide, alkynes, and azide compounds.
[0032] (First complex and second complex) In the present disclosure, in a first complex comprising a first target-binding molecule capable of binding to a target substance and a signal nucleic acid that is bound to or capable of binding to the first target-binding molecule, the first target-binding molecule and the signal nucleic acid may be bound directly or indirectly via another substance (such as a secondary antibody, a biotin-streptavidin complex, a linker nucleic acid or peptide, branched polyethylene glycol, gold colloid, or a combination thereof). The first complex is preferably a complex in which a biotinylated first target-binding molecule and a biotinylated signal nucleic acid are bound via streptavidin, and more preferably a first target-binding molecule-biotin-streptavidin-biotin-signal nucleic acid complex.
[0033] In the present disclosure, in a second complex formed by binding a target substance and a first complex via a first target-binding molecule, the first target-binding molecule and the signal nucleic acid may be directly bound, or indirectly bound via another substance (such as a secondary antibody, a biotin-streptavidin complex, a linker nucleic acid or peptide, branched polyethylene glycol, gold colloid, or a combination thereof). The second complex is preferably a complex formed by binding a biotinylated first target-binding molecule and a biotinylated signal nucleic acid via streptavidin to the target substance, and more preferably a target substance-first target-binding molecule-biotin-streptavidin-biotin-signal nucleic acid complex.
[0034] (signal nucleic acid) In this disclosure, a signal nucleic acid refers to a nucleic acid having any nucleic acid sequence. The signal nucleic acid comprises, from upstream (i.e., the 5' end of the signal nucleic acid), a region having sequence identity to the second template nucleic acid and a region having sequence complementarity to the first template nucleic acid. That is, the first template nucleic acid is designed to include a region having sequence complementarity to the signal nucleic acid. The second template nucleic acid is designed to include a region having sequence identity to the signal nucleic acid. The signal nucleic acid may have other sequences in addition to the region having sequence identity to the second template nucleic acid and the region having sequence complementarity to the first template nucleic acid.
[0035] In the present disclosure, the signal nucleic acid is a single-stranded nucleic acid or a double-stranded nucleic acid, and a single-stranded nucleic acid is preferred from the viewpoint of ease of nucleic acid amplification.
[0036] The signal nucleic acid can be designed arbitrarily, and is preferably designed taking into consideration the melting temperature (Tm value) according to the reaction conditions, the melting temperature of the higher-order structure, and the like. The number of bases in the signal nucleic acid is preferably 5 to 500, more preferably 8 to 500, even more preferably 10 to 200, particularly preferably 12 to 100, and extremely preferably 15 to 30.
[0037] The signal nucleic acid may be DNA, RNA, or an analog thereof, a natural product, or an artificial product. The type of signal nucleic acid is not particularly limited, and may be any of mRNA, rRNA, siRNA, hnRNA, piRNA, aRNA, miRNA, synthetic RNA, genomic DNA, synthetic DNA, or a DNA-RNA hybrid.
[0038] The signal nucleic acid may be linked to a low molecular weight compound, a group, a molecule other than a nucleic acid, or a structure. The 3'-end of the signal nucleic acid may be an unmodified or modified hydroxyl group, but is preferably an unmodified hydroxyl group to facilitate nucleic acid amplification by polymerase. The 5'-end of the signal nucleic acid may be an unmodified or modified hydroxyl group. The 5'-end of the signal nucleic acid may be phosphorylated to facilitate the action of lambda exonuclease.
[0039] The signal nucleic acid may be added to the sample while bound to the first target binding molecule, or may be added separately from the first target binding molecule if it can be bound to the first target binding molecule by mixing or other processing.
[0040] As described above, the signal nucleic acid may be directly bound or capable of binding to the first target-binding molecule, or may be indirectly bound or capable of binding via other substances, such as a secondary antibody, a biotin-streptavidin complex, a linker nucleic acid or peptide, a modified nucleic acid (amino group-modified, biotin-modified, or azide group-modified; which may include a linker hydrocarbon chain or polyethylene glycol chain), a hydrocarbon chain, branched or unbranched polyethylene glycol, gold colloid, or a combination thereof. The method for binding the signal nucleic acid to the first target-binding molecule is not particularly limited, and examples include covalent bonds (reaction of an activated ester with an amino group using N-hydroxysuccinimide, SS bonds, click chemistry, etc.) and high-affinity non-covalent bonds (biotin-streptavidin bonds, antibody-mediated binding, His tags, Myc tags, GST tags, etc.).
[0041] [Method to satisfy (X)] (First template nucleic acid in the method satisfying (X)) In a method that satisfies (X), the first template nucleic acid includes a first template recognition region that has sequence complementarity to a continuous region of 7 or more bases in the signal nucleic acid. In the present disclosure, a region having "sequence complementarity" means a region having a complementary base sequence to a region of a base sequence of a certain nucleic acid (for example, T for A, U for A, or G for C). Note that a region having sequence complementarity not only includes cases where the base sequences are completely complementary (i.e., no mismatches), but also includes cases where the base sequences contain mismatches (for example, mismatches of 1 base, 2 bases or less, or 3 bases or less) within the scope of the present disclosure, but preferably does not contain mismatches.
[0042] The first template nucleic acid is a single-stranded nucleic acid. The first template nucleic acid may be DNA or RNA, or may be an analog thereof, a DNA-RNA hybrid, a natural product, or an artificial product. DNA is preferred as the first template nucleic acid from the viewpoint of ease of synthesis and handling.
[0043] The signal nucleic acid contains, from upstream to downstream, a region having sequence identity to a second template nucleic acid (described below) and a region having sequence complementarity to the first template nucleic acid. That is, the first template nucleic acid has sequence complementarity to the 3'-end of the signal nucleic acid, and the second template nucleic acid has sequence identity to the 5'-end of the signal nucleic acid.
[0044] The number of bases in the first template nucleic acid is not particularly limited, and is preferably 6 to 50, more preferably 7 to 30, and even more preferably 8 to 15, from the viewpoint of ease of handling.
[0045] The first template nucleic acid can be prepared by any method known to those skilled in the art, for example, by the phosphoramidite method, the phosphate triester method, the H-phosphonate method, or the thiophosphonate method.
[0046] [First template recognition region] In the method that satisfies (X), the first template nucleic acid includes a first template recognition region. From the viewpoint of forming a complementary strand with the signal nucleic acid or a signal nucleic acid equivalent and ensuring a sufficient amplification rate, the first template recognition region is 7 or more bases, preferably 8 or more bases, and more preferably 9 or more bases.
[0047] From the viewpoint of reducing non-specific binding, the first template recognition region is preferably 50 bases or less in length, more preferably 40 bases or less in length, even more preferably 30 bases or less in length, even more preferably 20 bases or less in length, even more preferably 15 bases or less in length, and even more preferably 13 bases or less in length. The 3' end of the first template nucleic acid is preferably unmodified, since modification may inhibit amplification from the 3' end in the amplification mechanism, and therefore the 3' end of the first template nucleic acid preferably has a free hydroxyl group.
[0048] Additional Area In the method that satisfies (X), the first template nucleic acid may contain an additional region. The first template nucleic acid may contain one or more additional regions. The additional region of the first template nucleic acid may be located upstream of the first template recognition region in the first template nucleic acid.
[0049] The additional region may be 1 to 20 bases, 2 to 10 bases, or 3 to 5 bases.
[0050] The base sequence of the additional region is not particularly limited, but is preferably 2 to 8 consecutive bases, more preferably 2 to 5 consecutive bases. The consecutive bases may be any of A, T, G, and C, but are preferably A, G, or T, more preferably A or G, and even more preferably G.
[0051] The additional region may comprise a palindromic sequence. In the present disclosure, a palindromic sequence is a sequence in a single-stranded nucleic acid in which the base sequence read from the 5' end to the 3' end is complementary to the base sequence read from the 3' end to the 5' end.
[0052] The length of the palindromic sequence may be 1 to 40 bases, 3 to 30 bases, or 5 to 20 bases. The base sequence of the palindromic sequence is not particularly limited, but may be a base sequence in which two types of bases alternate. The Tm value of the palindromic sequence may be 10°C to 50°C, 20°C to 40°C, or 30°C to 35°C.
[0053] [Other Areas] In the method that satisfies (X), the first template nucleic acid may have other regions in addition to the regions and sites described above. The number of bases and the base sequence of the other region are not particularly limited, as long as it does not have either a first template recognition region or a nick-forming site.
[0054] [First template nucleic acid in the system] In a method that satisfies (X), the concentration of the first template nucleic acid in the nucleic acid amplification reaction system can be adjusted as appropriate. In one embodiment, from the viewpoint of ensuring a sufficient amount of the first template nucleic acid, the concentration is preferably 0.01 nM or more, more preferably 0.1 nM or more, even more preferably 1 nM or more, and particularly preferably 10 nM or more. In another embodiment, the concentration may be 1 μM or less, 100 nM or less, or 50 nM or less.
[0055] In the nucleic acid amplification reaction, one type of first template nucleic acid may be used alone, or two or more types may be used in combination. For example, when determining the presence state of two or more types of signal nucleic acids, efficient determination is possible by using two or more types of first template nucleic acids in combination. Examples of using two or more types of first template nucleic acids in combination include using two or more types of first template nucleic acids that differ only in the first template recognition region, and using two or more types of first template nucleic acids that differ in both the first template recognition region and other regions. Note that by preparing multiple types of second template nucleic acids corresponding to each first template nucleic acid, it is possible to amplify each of the multiple types of signal nucleic acids.
[0056] (Second template nucleic acid in the method satisfying (X)) In a method that satisfies (X), the second template nucleic acid includes a second template corresponding region that has sequence identity to a continuous region of 7 or more bases in the signal nucleic acid. In the present disclosure, a region having "sequence identity" means a region having the same base sequence as a region of a base sequence of a certain nucleic acid (for example, A for A, U for U, or C for C). Note that a region having sequence identity includes not only a case where the base sequence is completely identical (i.e., no mismatches), but also a case where the region contains mismatches (for example, mismatches of 1 base, 2 bases or less, or 3 bases or less) within the scope of the present disclosure, although it is preferable that the region does not contain mismatches.
[0057] The second template nucleic acid is a single-stranded nucleic acid. The second template nucleic acid may be DNA or RNA, or may be an analog thereof, a DNA-RNA hybrid, a natural product, or an artificial product. DNA is preferred as the second template nucleic acid from the viewpoint of ease of synthesis and handling.
[0058] The number of bases in the second template nucleic acid is not particularly limited, and is preferably 10 to 50, more preferably 15 to 40, and even more preferably 20 to 35, from the viewpoint of ease of handling.
[0059] The 3'-end of the second template nucleic acid may be modified (i.e., capped). Modification of the 3'-end of the second template nucleic acid may reduce non-specific amplification. The 3'-end of the second template nucleic acid is preferably modified by amination, a spacer, biotinylation, or a fluorescent dye.
[0060] The second template nucleic acid can be prepared by any method known to those skilled in the art, for example, by the phosphoramidite method, the phosphate triester method, the H-phosphonate method, or the thiophosphonate method.
[0061] The second template nucleic acid includes, in order from upstream (that is, from the 5' end of the second template nucleic acid), a stabilizing region, a nick formation site, and a region corresponding to the second template. The second template nucleic acid preferably comprises, in order from upstream (ie, from the 5' end of the second template nucleic acid), a stabilizing region, a nick-forming site, an additional region, and a region corresponding to the second template.
[0062] The stabilizing region, the nick formation site, the additional region, and the second template corresponding region may overlap partially, may not overlap, may be directly adjacent to each other, or may be spaced apart from each other.
[0063] [Second mold compatible area] In the method that satisfies (X), the second template nucleic acid includes a second template corresponding region. From the viewpoint of forming a complementary strand with the signal nucleic acid and ensuring a sufficient amplification rate, the second template corresponding region is 7 or more bases long, and preferably 8 or more bases long.
[0064] From the viewpoint of reducing non-specific binding, the second template corresponding region is preferably 50 bases or less in length, more preferably 40 bases or less in length, even more preferably 30 bases or less in length, even more preferably 20 bases or less in length, even more preferably 15 bases or less in length, and even more preferably 13 bases or less in length.
[0065] [Stabilization region] In the method satisfying (X), the second template nucleic acid contains a stabilizing region, which allows a polymerase to stably extend a new strand from the newly generated 3' end after the nucleic acid strand derived from the second template nucleic acid is cleaved at the nick site. The stabilization region of the second template nucleic acid is located upstream of the second template corresponding region and upstream of the nick formation site described below in the second template nucleic acid. The stabilizing region is preferably 3 to 20 bases, more preferably 4 to 15 bases, and even more preferably 5 to 13 bases. The base sequence of the stabilizing region is not particularly limited.
[0066] In the second template nucleic acid, it is preferable that a continuous region of 3 or more bases in the stabilizing region and a continuous region downstream of the continuous region of 3 or more bases have sequence complementarity to form a hairpin structure, and the continuous region of 3 or more bases is more preferably a continuous region of 5 or more bases, and even more preferably a continuous region of 7 or more bases. In the second template nucleic acid, it is preferable that a continuous region of 20 bases or less in the stabilizing region and a continuous region downstream of the continuous region of 20 bases or less have sequence complementarity to form a hairpin structure, more preferably a continuous region of 15 bases or less, and even more preferably a continuous region of 13 bases or less.
[0067] The continuous region downstream of the continuous region of 3 or more bases may be within the stabilizing region, may overlap with the stabilizing region, may include a nick-forming site, may overlap with the second template corresponding region, or may overlap with another region.
[0068] The stabilization region of the second template nucleic acid preferably contains a T base. This is because T bases have less structural constraints and are more likely to form a turn structure in a hairpin structure. By including a T base downstream in the stabilization region of the second template nucleic acid, the distance between the stabilization region and the complementary region in the second template nucleic acid increases, making it easier for the second template nucleic acid to form the aforementioned hairpin structure between the stabilization region and its complementary region. The T base is preferably 1 to 10 bases, but may be 2 to 7 bases, or may be 3 to 5 bases.
[0069] In the second template nucleic acid, it is preferable that a continuous region of 3 or more bases in the stabilizing region and a continuous region located downstream of the nick formation site have sequence complementarity to form a hairpin structure.
[0070] By forming a hairpin structure within the template of the second template nucleic acid and protecting the 5' end of the second template nucleic acid, it becomes difficult for nonspecific nucleic acids to form a complementary strand with the second template nucleic acid, thereby reducing background amplification.
[0071] It is preferable that the sequence used to form the hairpin structure does not contain a second template corresponding region of 3 or more bases. It is even more preferable that the sequence used to form the hairpin structure does not contain a second template corresponding region. This is because if the second template corresponding region is protected by the hairpin structure, the nucleic acid amplification reaction will be difficult to proceed.
[0072] For example, in the second template nucleic acid shown in Figure 1, "5'-CGGGCCT-3'" in the stabilizing region and "5'-AGGCCCG-3'" downstream have sequence complementarity to form a hairpin structure. Furthermore, "5'-TTTTT-3'" in the hairpin structure forms a turn structure, which is a preferred embodiment.
[0073] The preferred Tm (melting temperature of double-stranded nucleic acid) value of the stabilizing region in the second template nucleic acid depends on the reaction temperature in the amplification method. If the Tm value of the stabilizing region is too low relative to the reaction temperature, the double-stranded nucleic acid consisting of the nucleic acid strand derived from the second template nucleic acid and the nucleic acid strand derived from the signal nucleic acid equivalent will be more likely to dissociate, making it difficult for the amplification reaction to proceed. From the viewpoint of facilitating the amplification reaction, the Tm value of the stabilizing region in the second template nucleic acid is preferably 10° C. or higher, more preferably 20° C. or higher, even more preferably 30° C. or higher, and particularly preferably 35° C. or higher. There is no particular upper limit to the Tm value of the stabilizing region in the second template nucleic acid, but it may be 60° C. or lower, 50° C. or lower, or 40° C. or lower.
[0074] In particular, the stabilizing region of the second template nucleic acid preferably has a Tm value that hardly deviates during the amplification reaction. The Tm value of the stabilizing region is preferably at least −15°C above the reaction temperature (e.g., 22°C or higher when the reaction temperature is 37°C), more preferably at least −10°C above the reaction temperature (e.g., 27°C or higher when the reaction temperature is 37°C), even more preferably at least −5°C above the reaction temperature (e.g., 32°C or higher when the reaction temperature is 37°C), and particularly preferably at least the reaction temperature (e.g., 37°C or higher when the reaction temperature is 37°C). The Tm value of a single-stranded nucleic acid can be simply determined by the Wallace method as follows. Tm (°C) = 2 × (total number of As and Ts) + 4 × (total number of Gs and Cs)
[0075] [Nick formation site] In the method satisfying (X), the second template nucleic acid contains a nicking site. The nicking site is a position where a nicking enzyme forms a nick and cuts the nucleic acid. The nicking site is determined depending on the type of nicking enzyme described below. The nick formation site of the second template nucleic acid is located upstream of the second template corresponding region and downstream of the stabilizing region in the second template nucleic acid.
[0076] The nicking enzyme recognition region is a sequence recognized by the nicking enzyme to form a nick at the nick formation site. When a nicking enzyme that cleaves inside the nicking enzyme recognition region is used, the nicking enzyme recognition region becomes the nick formation site. When a nicking enzyme that cleaves outside the nicking enzyme recognition region is used, the nicking site includes the base sequence up to the cleavage point outside the nicking enzyme recognition region.
[0077] The base sequence and length of the nicking enzyme recognition region are determined depending on the type of nicking enzyme described below. From the viewpoint of excellent specificity, the nicking enzyme recognition region preferably has 3 or more bases, more preferably 4 or more bases, even more preferably 5 or more bases, particularly preferably 6 or more bases, and extremely preferably 7 or more bases. From the viewpoint of ease of availability, the nicking enzyme recognition region may have 10 or fewer bases, 9 or fewer bases, 8 or fewer bases, 7 or fewer bases, or 6 or fewer bases.
[0078] The nicking enzyme recognition region may consist of two, three, or four types of bases. "The nicking enzyme recognition region consists of two types of bases" refers, for example, to a case where the nicking enzyme recognition region has only two types of bases, G and C. "The nicking enzyme recognition region consists of three types of bases" refers, for example, to a case where the nicking enzyme recognition region has only three types of bases, G, C, and A. "The nicking enzyme recognition region consists of four types of bases" refers, for example, to a case where the recognition sequence has four types of bases, G, C, A, and T.
[0079] In the second template nucleic acid, (1) two consecutive bases at the 5' end, (2) two consecutive bases at the 3' end; (3) two consecutive bases at the 5' end that can be generated by nicking with a nicking enzyme, and (4) Two consecutive bases at the 3' end that can be generated by nicking with a nicking enzyme are Preferably, they have neither sequence identity nor sequence complementarity with each other. This makes it difficult for complementary strands to form between the second template nucleic acids or within the second template nucleic acid, and further makes it difficult for a nucleic acid strand from the 5'-end of the nucleic acid strand derived from the second template nucleic acid to the nick, which is generated by the formation of a nick in the nucleic acid strand derived from the second template nucleic acid, to form a complementary strand with a nucleic acid strand from the nick to the 3'-end of the nucleic acid strand derived from the second template nucleic acid, which makes it easier for the desired amplification reaction to proceed and also suppresses background amplification.
[0080] The base length at which the 3'-end of the first template nucleic acid is complementary to the internal sequence of the second template nucleic acid, or the base length at which the 3'-end of the second template nucleic acid is complementary to the internal sequence of the first template nucleic acid or the second template nucleic acid, is preferably short, and the number of complementary bases is preferably small. This is because when the 3'-end of the first template nucleic acid is complementary to the internal sequence of the second template nucleic acid, or when the 3'-end of the second template is complementary to the internal sequence of the first template nucleic acid or the second template nucleic acid, dimers are formed, which can cause increased nonspecific amplification (complementarity between first template nucleic acids is unlikely to cause nonspecific amplification and is not a major problem). Therefore, even when a complementary region exists, the base length at which complementarity is present is preferably four bases or less, more preferably three bases or less, and even more preferably two bases or less. The number of complementary sites is preferably four or less, more preferably three or less, more preferably two or less, more preferably one or less, and even more preferably zero.
[0081] Additional Area In the method satisfying (X), the second template nucleic acid may contain an additional region. The second template nucleic acid may contain one or more additional regions. The additional region functions as a spacer in the second template nucleic acid, separating each region and site in the second template nucleic acid from each other. When the second template nucleic acid contains an additional region, the distance between the stabilizing region and the complementary region in the second template nucleic acid increases, making it easier for the second template nucleic acid to form the aforementioned hairpin structure between the stabilizing region and its complementary region. The additional region may be present in the second template nucleic acid upstream of the second template corresponding region and downstream of the stabilizing region and the nick formation site.
[0082] The second template nucleic acid preferably contains an additional region of two or more bases, which increases the speed of the nucleic acid amplification reaction. The additional region is preferably 1 to 20 bases, more preferably 2 to 10 bases, and even more preferably 3 to 5 bases.
[0083] The base sequence of the additional region is not particularly limited, but is preferably 2 to 8 consecutive bases, and more preferably 2 to 5 consecutive bases.
[0084] [Other Areas] In the method that satisfies (X), the second template nucleic acid may have other regions in addition to the regions and sites described above. The number of bases and the base sequence of the other region are not particularly limited, as long as it does not have either a region corresponding to the second template or a nick formation site.
[0085] [Second template nucleic acid in the system] In a method that satisfies (X), the concentration of the second template nucleic acid in the nucleic acid amplification reaction system can be adjusted as appropriate. In one embodiment, from the viewpoint of ensuring a sufficient amount of second template nucleic acid, the concentration is preferably 0.01 nM or more, more preferably 0.1 nM or more, even more preferably 1 nM or more, and particularly preferably 10 nM or more. In another embodiment, the concentration may be 1 μM or less, 100 nM or less, 50 nM or less, or 20 nM or less.
[0086] In the nucleic acid amplification reaction, one type of second template nucleic acid may be used alone, or two or more types may be used in combination. For example, when determining the presence state of two or more types of signal nucleic acids, efficient determination is possible by using two or more types of second template nucleic acids in combination. Examples of using two or more types of second template nucleic acids in combination include using two or more types of second template nucleic acids that differ only in the second template region among the stabilizing region, nick formation site, and second template region, and using two or more types of second template nucleic acids that differ in both the stabilizing region and the second template region. Note that by preparing multiple types of first template nucleic acids corresponding to each second template nucleic acid, it is possible to amplify each of multiple types of signal nucleic acids.
[0087] (Relationship between the first template nucleic acid and the second template nucleic acid) When the 3'-end of the first template nucleic acid and the 3'-end of the second template nucleic acid are aligned with a signal nucleic acid, the first template recognition region and the second template corresponding region are preferably arranged with a gap of one or more bases between them, adjacent to each other without a gap, or overlapping by one or more bases. Note that in the alignment, the 3'-end of the first template nucleic acid and the signal nucleic acid are aligned so as to have sequence complementarity, and the 3'-end of the second template nucleic acid and the signal nucleic acid are aligned so as to have sequence identity.
[0088] In the present disclosure, alignment can be performed using well-known alignment tools such as BLAST, FASTA, and CLUSTAL W. For example, alignment can be evaluated using the default parameters of BLAST.
[0089] It is more preferable that the first template recognition region and the second template corresponding region are arranged with an interval of one or more bases between them, are adjacent to each other without any interval, or are arranged with one or two bases overlapping each other. It is more preferable that the first template recognition region and the second template corresponding region are arranged with an interval of one or more bases between them, are adjacent to each other without any interval, or are arranged with one base overlap. It is particularly preferred that the first template recognition region and the second template recognition region are arranged with an interval of one or more bases between them, or are adjacent to each other without any interval between them. This is because when the first template recognition region and the second template corresponding region are arranged to overlap, the first template nucleic acid and the second template nucleic acid form complementary strands to form a dimer, and nonspecific nucleic acid amplification proceeds.
[0090] <First template nucleic acid and second template nucleic acid in the method satisfying (Y)> The description of the first template nucleic acid in the method that satisfies (Y) is the same as the description of the second template nucleic acid in the method that satisfies (X), including definitions, examples, preferred embodiments, etc. The "second template nucleic acid" in the method that satisfies (X) should be read as the "first template nucleic acid" in the method that satisfies (Y). 1 and 3, the description of the first template recognition region in the first template nucleic acid in the method that satisfies (Y) corresponds to the description of the second template corresponding region in the second template nucleic acid in the method that satisfies (X). The first template recognition region in the first template nucleic acid in the method that satisfies (Y) has sequence complementarity to a continuous region of 7 or more bases in the signal nucleic acid.
[0091] The second template nucleic acid in the method that satisfies (Y) is similar to the first template nucleic acid in the method that satisfies (X), including definitions, examples, preferred embodiments, etc. The "first template nucleic acid" in the method that satisfies (X) should be read as the "second template nucleic acid" in the method that satisfies (Y). 1 and 3, the description of the region corresponding to the second template in the second template nucleic acid in the method that satisfies (Y) corresponds to the description of the region corresponding to the first template in the first template nucleic acid in the method that satisfies (X). The region corresponding to the second template in the second template nucleic acid in the method that satisfies (Y) has sequence identity to a continuous region of 7 or more bases in the signal nucleic acid.
[0092] Furthermore, in a method that satisfies (Y), the signal nucleic acid comprises, from upstream to downstream, a region having sequence identity to the second template nucleic acid and a region having sequence complementarity to the first template nucleic acid. That is, the first template nucleic acid has sequence complementarity to the 3'-end of the signal nucleic acid, and the second template nucleic acid has sequence identity to the 5'-end of the signal nucleic acid.
[0093] <Polymerase> The polymerase used in the determination method of the present disclosure is not particularly limited as long as it can extend a nucleic acid strand. In particular, it is preferable that the polymerase has strand displacement activity. When the polymerase has strand displacement activity, the nucleic acid amplification reaction can be carried out, for example, isothermally, without the need for temperature adjustment to dissociate the signal nucleic acid equivalent from the nucleic acid strand after the nicking enzyme forms a nick. The polymerase may be mesophilic, mesophilic, or thermostable. The polymerase is preferably a nucleic acid polymerase, more preferably a DNA polymerase. The polymerase preferably has substantially no 5' to 3' exonuclease activity.
[0094] Examples of polymerases include the Klenow fragment of DNA polymerase I derived from Escherichia coli (including mutants lacking at least one of the 3'→5' exonuclease activity and the 5'→3' exonuclease activity), the 5'→3' exonuclease-deficient Bst DNA polymerase derived from Bacillus stearothermophilus, the 5'→3' exonuclease-deficient Bst DNA polymerase, Large Fragment derived from Bacillus stearothermophilus, and the 5'→3' exonuclease-deficient Bca DNA polymerase derived from Bacillus caldotenax. Only one type of polymerase may be used, or two or more types may be used. When the target is RNA, it is desirable that the polymerase (any polymerase) has reverse transcription activity.
[0095] The concentration of polymerase in the nucleic acid amplification reaction system can be adjusted as appropriate. In one embodiment, from the viewpoint of a good nucleic acid amplification reaction, the concentration is preferably 1 U / mL or more, more preferably 10 U / mL or more, and even more preferably 20 U / mL or more. In another embodiment, the concentration may be 150 U / mL or less, 100 U / mL or less, or 50 U / mL or less.
[0096] <Nick-forming enzyme> A nicking enzyme refers to an endonuclease capable of forming a nick. Forming a nick means cleaving only one strand of one of the double-stranded nucleic acids. The nicking enzyme is not particularly limited as long as it is an endonuclease capable of forming a nick. Many endonucleases that can be used to form a nick are known, along with their recognition sequences, and an appropriate endonucleases can be selected and used from these endonucleases. Examples of nicking enzymes include nicking endonucleases and restriction enzymes.
[0097] The nicking enzyme can form a nick in only the second template nucleic acid when (X) is satisfied, and only the first template nucleic acid when (Y) is satisfied, among the first template nucleic acid, the second template nucleic acid, and the signal nucleic acid. The nicking enzyme forms a nick in the nucleic acid strand by recognizing the nicking enzyme recognition region. The nicking enzyme can preferably form a nick at only one site in the second template nucleic acid when (X) is satisfied, and at only one site in the first template nucleic acid when (Y) is satisfied. The nicking enzyme preferably does not form a nick in any of the first template nucleic acid when (X) is satisfied, or the second template nucleic acid, signal nucleic acid, amplification intermediate, and signal nucleic acid equivalent when (Y) is satisfied.
[0098] Preferred embodiments of the recognition sequence for the nicking enzyme are as explained in [Nick formation site] in (Second template nucleic acid in the method satisfying (X)) above.
[0099] From the viewpoint of ease of amplification reaction, the optimal reaction temperature for the nicking enzyme is preferably 10° C. to 60° C., more preferably 20° C. to 50° C., and even more preferably 30° C. to 45° C. The optimal reaction temperature can be confirmed by a correlation curve between reaction temperature and reaction rate.
[0100] From the viewpoint of allowing the reactions of polymerase, lambda exonuclease, and other enzymes used as needed to proceed smoothly, the wider the pH range in which the nicking enzyme is active, the more preferable. The pH range preferably includes a range of pH 6.0 to 9.0, more preferably a range of pH 6.5 to 8.5, and even more preferably a range of pH 7.0 to 8.0.
[0101] Nick-forming enzymes include Nb.BbvCI, Nb.BsmI, Nb.BsrDI, Nb.BssSI, Nb.BtsI, Nt.AlwI, Nt.BbvCI, Nt.BspQI, Nt.BstNBI, Nt.BsmAI, and Nt.CviPII. Only one type of nicking enzyme may be used, or two or more types may be used.
[0102] Restriction enzymes typically cleave both strands of a double-stranded nucleic acid. However, for example, by chemically modifying one strand of a double-stranded nucleic acid so that it cannot be cleaved by the restriction enzyme, it is possible to cleave only the other strand. In other words, a restriction enzyme can be used as a nicking enzyme. For example, by substituting a sulfur atom for the oxygen atom in the phosphodiester bond of one strand, it is possible to form a nick in the other strand. In this case, the sites of the first template nucleic acid and / or the second template nucleic acid where nicking is not to be performed may be modified as described above.
[0103] The concentration of the nicking enzyme in the nucleic acid amplification reaction system can be adjusted as appropriate. In one embodiment, from the viewpoint of a good nucleic acid amplification reaction, the concentration is preferably 10 U / mL or more, more preferably 100 U / mL or more, and even more preferably 200 U / mL or more. In another embodiment, the concentration may be 1000 U / mL or less, 600 U / mL or less, or 400 U / mL or less.
[0104] <Lambda exonuclease> Lambda exonuclease is a 5' to 3' exonuclease specific for double-stranded DNA, which removes 5' mononucleotides from 5'-phosphorylated nucleic acid strands in the 5' to 3' direction. The type of lambda exonuclease is not particularly limited, and one type or two or more types of lambda exonuclease may be used.
[0105] The concentration of lambda exonuclease in the nucleic acid amplification reaction system is preferably 1 U / mL to 200 U / mL. In one embodiment, from the viewpoint of detection sensitivity, the concentration is preferably 150 U / mL or less, more preferably 100 U / mL or less, even more preferably 50 U / mL or less, particularly preferably 40 U / mL or less, and may be 30 U / mL or less. From the viewpoint of effectively exerting exonuclease activity and more suitably suppressing background amplification, the concentration is preferably 2 U / mL or more, more preferably 5 U / mL or more, even more preferably 10 U / mL or more, and may be 20 U / mL or more.
[0106] <Other reagents> Other reagents that can be used in the nucleic acid amplification reaction include, for example, metal salts such as sodium chloride, magnesium chloride, magnesium acetate, and magnesium sulfate; substrates such as dNTP mix; and buffers such as Tris-HCl buffer, Trisine buffer, sodium phosphate buffer, and potassium phosphate buffer. Additionally, additives such as dimethyl sulfoxide or betaine (N,N,N-trimethylglycine), acidic substances described in WO 99 / 54455, or cationic complexes may also be used.
[0107] [Explanation of each process] Steps (A) to (E) and other optional steps will be described below.
[0108] (Process (A) ~ Process (C)) In step (A), a sample is prepared. The sample may be a specimen that may contain a target substance as is, may be prepared by purifying the specimen that may contain the target substance, or may be prepared by adding a solvent to the specimen that may contain the target substance. The sample may be solid or liquid. When the sample is liquid, the type of solvent for the sample is not particularly limited and may be water, a hydrophilic organic solvent (e.g., alcohol), a buffer solution (e.g., tris-ethylenediaminetetraacetic acid buffer (TE), phosphate buffer (PBS), PBS with Tween (PBST)), or physiological saline. The concentration of the target substance in the sample is not particularly limited.
[0109] For example, samples may be obtained by dissolving the surface of an object such as the surface of a workbench, the object itself such as food, a liquid such as tap water, a gas such as air, bacteria of unknown species, or a culture solution of bacteria in water.
[0110] In one embodiment, when a target substance is immobilized on a substrate, a substrate capable of immobilizing the target substance is used, or another substance capable of binding to the target substance is immobilized on the substrate before the sample is added. The method for immobilizing the target substance on the substrate is not particularly limited, and for example, the target substance may be immobilized by placing a sample containing the target substance on the substrate and leaving the substrate to stand for 3 hours or more.
[0111] In one embodiment, a blocking treatment may be performed after immobilizing the target substance on the substrate. Blocking treatment can suppress nonspecific binding of the first target-binding molecule to substances other than the target substance. Blocking treatment can be performed by a known method, for example, by immersing the substrate in a blocking agent (e.g., a casein-based blocking solution or a bovine serum albumin-based blocking solution) for one hour or more.
[0112] In step (B), a first target-binding molecule capable of binding to a target substance and a signal nucleic acid that is bound to or capable of binding to the first target-binding molecule are added to a sample to obtain a second complex in which the target substance and the first complex are bound via the first target-binding molecule. The first target-binding molecule capable of binding to a target substance and the signal nucleic acid that is bound to or capable of binding to the first target-binding molecule may be added to the sample as a solution or suspension in which they are dissolved or suspended in a solvent, or as a solid. For the type of solvent, please refer to the description of the type of solvent for the sample above. In this step, the first target-binding molecule and the signal nucleic acid may be added already bound to each other. Alternatively, when the signal nucleic acid capable of binding to the first target-binding molecule is added separately from the first target-binding molecule, the two are configured to bind to each other by mixing or other processing.
[0113] In step (C), the second complex is a first template nucleic acid including a first template recognition region having sequence complementarity to a continuous region of 7 or more bases in the signal nucleic acid; a second template nucleic acid containing a second template corresponding region having sequence identity to a continuous region of 7 or more bases in the signal nucleic acid; A polymerase and a nicking enzyme; Lambda exonuclease and .
[0114] Details of the substrate, sample, target material, and other essential or optional materials involved in the above steps are given above.
[0115] From the viewpoint of ease of operation, it is preferable that the second complex, the first template nucleic acid, the second template nucleic acid, the polymerase, the nicking enzyme, and the lambda exonuclease are each mixed as a solution or suspension in which they are dissolved or suspended in a solvent, respectively. For the type of solvent, please refer to the description of the type of solvent for the sample above.
[0116] The timing and order of steps (A) to (C) are not particularly limited and may be performed at any timing and in any order. For example, the sample, first target-binding molecule, signal nucleic acid, polymerase, nicking enzyme, lambda exonuclease, first template nucleic acid, second template nucleic acid, and other substances may be added sequentially or two or more of them may be added simultaneously, and the timing and order of addition may be appropriately determined within the scope compatible with the technique employed.
[0117] In one embodiment, to determine the presence states of multiple types of target substances, multiple types of first target-binding molecules, multiple types of signal nucleic acids, and multiple types of first template nucleic acids corresponding to the multiple types of signal nucleic acids may be used. By using a first target-binding molecule, a signal nucleic acid corresponding to the first target-binding molecule, and a first template nucleic acid and a second template nucleic acid for each of the multiple types of target substances, and detecting an amplification product corresponding to the target substance, the presence states of the multiple types of target substances can be determined.
[0118] In one embodiment, when a technique is used in which the target substance is immobilized on a substrate, the determination method of the present disclosure may further include performing steps (B) and (C) after step (A), and removing the target substance that is not bound to the substrate by washing the substrate after step (A) and before step (B) and step (C). In one embodiment, when a technique is used in which the target substance is immobilized on a substrate, the determination method of the present disclosure may further include performing step (C) after step (A) and step (B), and removing the target substance that is not bound to the substrate (and the signal nucleic acid that has not formed a second complex) by washing the substrate after step (A) and step (B) and before step (C). Either one of the above washing steps may be performed, or both may be performed. A substrate washing step can remove unfixed material and tend to improve sensitivity and / or specificity.
[0119] (Process (D)) In step (D), a nucleic acid amplification reaction is carried out after steps (A) to (C). The temperature of the nucleic acid amplification reaction may be 50°C or less, and is preferably carried out isothermally. That is, the nucleic acid amplification reaction is preferably an isothermal amplification reaction. An isothermal amplification reaction is preferred because it does not require the preparation of an amplification device (a device that changes the temperature in accordance with the temperature cycle). In the present disclosure, "isothermal amplification reaction" refers to a nucleic acid amplification reaction carried out under approximately constant temperature conditions in which enzymes and primers can substantially function, in contrast to nucleic acid amplification reactions that require temperature cycles for nucleic acid annealing, extension, and dissociation. Here, "approximately constant temperature conditions" refers not only to temperature conditions in which a set temperature is precisely maintained, but also to temperature conditions that allow fluctuations (e.g., fluctuations of ±10°C, preferably ±5°C) within a range that does not impair the substantial functions of the signal nucleic acid, first template nucleic acid, second template nucleic acid, polymerase, nicking enzyme, lambda exonuclease, etc. Such an isothermal amplification reaction can be carried out by maintaining the temperature at which the activity of the enzyme used can be maintained. Even if the enzyme activity decreases as the reaction proceeds, the temperature is sufficient as long as the intended nucleic acid amplification reaction can be carried out.
[0120] The temperature of the isothermal amplification reaction is preferably 10° C. to 50° C., and from the viewpoint of simplicity, more preferably 10° C. to 40° C. For simplicity, the isothermal amplification reaction may be carried out at room temperature (for example, 20° C. to 40° C.).
[0121] The pH of the nucleic acid amplification reaction may be adjusted depending on the type of enzyme used. In one embodiment, the pH of the nucleic acid amplification reaction is preferably pH 6.0 to 9.0, more preferably pH 6.5 to 8.5, and even more preferably pH 7.0 to 8.0.
[0122] The nucleic acid amplification reaction of the present disclosure produces a signal nucleic acid equivalent. When the signal nucleic acid is DNA, the signal nucleic acid equivalent produced will be DNA. When the signal nucleic acid is RNA, the signal nucleic acid equivalent produced will be DNA. Furthermore, the signal nucleic acid equivalent does not necessarily have to contain the exact same sequence as the signal nucleic acid, as long as it can be used as an indicator to estimate the amount of signal nucleic acid present in a sample. For example, if a mismatch occurs in the formation of a complementary strand between the signal nucleic acid and a first template nucleic acid or between an amplification intermediate and a second template nucleic acid, the signal nucleic acid equivalent produced thereby may contain a base mutation resulting from the mismatch compared to the signal nucleic acid. Furthermore, the signal nucleic acid equivalent may be a nucleic acid to which base sequences have been added at the 5' and 3' ends of the signal nucleic acid. For example, as can be seen from Figure 2, the signal nucleic acid equivalent may have a base sequence derived from the first template nucleic acid and / or the amplification intermediate (a base sequence amplified using the first template nucleic acid and / or the amplification intermediate as a template).
[0123] (Process (E)) In step (E), after step (D), the amplification product is detected. Detection of amplification products can be carried out using any method for detecting oligonucleotides. For example, gel electrophoresis and ethidium bromide staining, fluorescence polarization, immunoassay, fluorescence resonance energy transfer, enzyme labeling (e.g., peroxidase, alkaline phosphatase, etc.), fluorescent labeling (e.g., fluorescein, rhodamine, etc.), fluorescent dyes (e.g., EvaGreen®, etc.), chemiluminescence, bioluminescence, etc. may be used. Detection may also be carried out using Taqman probes, molecular beacons, etc. Amplification products may also be detected using labeled nucleotides labeled with biotin, etc. In this case, biotin in the amplification products can be detected using fluorescently labeled avidin or enzyme-labeled avidin, etc. Alternatively, amplification products may be detected using an electrode by using a redox intercalator. Alternatively, amplification products may be detected using surface plasmon resonance (SPR). Alternatively, the amplification product may be detected by adding an excess of a fluorescent dye such as SYBR Green to the amplification product, irradiating it with black light, and visually checking the light.
[0124] In one embodiment, the amplification product may be quantified. The amount of the target substance present can be determined by quantifying the amplification product. For example, when the amplification product is detected by measuring fluorescence, the quantification of the amplification product can be performed using fluorescence intensity as an index. The amplification product can be detected, for example, by performing a nucleic acid amplification reaction under similar conditions using a target substance of known concentration, creating a calibration curve showing the correlation between the target substance concentration and the amplification start time, and then performing the determination method of the present disclosure using a target substance of unknown concentration and comparing it with the calibration curve.
[0125] An example of the operation procedure is shown below. However, the operation procedure is not limited to the following example and may be determined appropriately within the scope that is compatible with the method employed.
[0126] In one embodiment, in the case of a single assay involving immobilization of a target substance, the following steps are performed in this order: (a) addition of a sample to a substrate and immobilization of the target substance, (b) washing, (c) addition of a first target-binding molecule and a signal nucleic acid, (d) washing, (e) addition of a polymerase, a nicking enzyme, a lambda exonuclease, a first template nucleic acid, and a second template nucleic acid, (f) amplification reaction, and (g) detection of the amplified product. The polymerase, the nicking enzyme, the lambda exonuclease, the first template nucleic acid, and the second template nucleic acid may be added simultaneously or sequentially.
[0127] <Kit> The kit of the present disclosure is a kit for determining the state of a target substance in a sample, comprising: a first complex stored in a container, the first complex including a first target-binding molecule capable of binding to a target substance and a signal nucleic acid that is bound to or capable of binding to the first target-binding molecule; a polymerase contained in a container; a nicking enzyme contained in a container; a lambda exonuclease contained in a container; a first template nucleic acid stored in a container; a second template nucleic acid stored in a container; Equipped with the first template nucleic acid includes a first template recognition region having sequence complementarity to a continuous region of 7 or more bases in the signal nucleic acid; the second template nucleic acid comprises a second template corresponding region having sequence identity to a continuous region of 7 or more bases in the signal nucleic acid; the signal nucleic acid comprises, in order from upstream, a region having sequence identity to a second template nucleic acid and a region having sequence complementarity to a first template nucleic acid; Satisfies either (X) or (Y) below. (X) The second template nucleic acid comprises, in order from upstream, a stabilizing region, a nick-forming site, and the second template corresponding region, and the nicking enzyme is capable of forming a nick only in the second template nucleic acid among the first template nucleic acid, the second template nucleic acid, and the signal nucleic acid. (Y) The first template nucleic acid comprises, in order from upstream, a stabilizing region, a nick-forming site, and the first template recognition region, and the nicking enzyme is capable of forming a nick only in the first template nucleic acid among the first template nucleic acid, the second template nucleic acid, and the signal nucleic acid. The kit of the present disclosure can be used in the above-described determination method of the present disclosure.
[0128] The kit may further include any of the substances described in the determination method section of the present disclosure. For example, the kit may further include other components stored in a container. The kit may also further include dNTPs stored in a container, a washing solution stored in a container, etc. Any buffer solution can be used as the washing solution. Details of the target substance, first target binding molecule, signal nucleic acid, polymerase, nicking enzyme, lambda exonuclease, first template nucleic acid, second template nucleic acid, and each optional substance are as described above.
[0129] In one embodiment, the signal nucleic acid may be bound to the first target-binding molecule. When adding a first target-binding molecule bound to a signal nucleic acid, it is convenient to use the kit of this embodiment. In a further embodiment, the container containing the signal nucleic acid does not need to contain the first target-binding molecule. When the first target-binding molecule and the signal nucleic acid capable of binding thereto are prepared separately, it is convenient to use the kit of this embodiment.
[0130] a first complex stored in a container, the first complex including a first target-binding molecule capable of binding to a target substance and a signal nucleic acid that is bound to or capable of binding to the first target-binding molecule; a polymerase contained in a container; a nicking enzyme contained in a container; a lambda exonuclease contained in a container; a first template nucleic acid stored in a container; a second template nucleic acid stored in a container; may be stored in a container as a solution or suspension dissolved or suspended in a solvent, or may be stored in a container as a solid. When stored in a container as a solid, the user of the kit may prepare each solution or suspension by adding a solvent to each container as needed. For the type of solvent, please refer to the description of the type of solvent for the sample above.
[0131] <Device for determining the state of existence of a target substance> The apparatus for determining the presence state of a target substance according to the present disclosure includes: a receiving unit for acquiring the detection result of the amplification product in the determination method according to the present disclosure; a processing unit that converts the detection result acquired by the reception unit into output data; an output unit that outputs the output data; Equipped with.
[0132] Fig. 8 is a block diagram showing an example of the functional configuration of a determination device 20. As shown in Fig. 8, the determination device 20 has, as its functional configuration, a reception unit 11, a processing unit 12, and an output unit 13. Each functional configuration is executed by a computer. The receiving unit 11 is configured to be able to acquire the detection results of the amplification products obtained by the determination method of the present disclosure. The detection results include, for example, the presence or absence of fluorescence, the detection time, and the intensity. The processing unit 12 converts the detection result acquired by the receiving unit into output data, which includes the presence or absence of detection of the target substance, its concentration, and the like. The output unit 13 outputs the converted output data as a determination result to a display unit such as a liquid crystal display, an organic EL display, etc. The output unit may be configured to include a communication interface, and may be configured to output the detection result to an external device via the communication interface.
[0133] The decision device consists of a Central Processing Unit (CPU) and Random Access Memory (RAM ) and Read Only Memory (ROM) that stores programs for executing each process and various data.
[0134] For example, the determination device can be realized by a computer 50 shown in Fig. 9. The computer 50 includes a CPU 51, a memory 52 as a temporary storage area, and a non-volatile storage unit 53. The computer 50 also includes an input / output interface (I / F) 54 and a read / write (R / W) unit 55 that controls reading and writing of data from and to the recording medium. The computer 50 also includes a network I / F 56 that is connected to a network such as the Internet. The CPU 51, memory 52, storage unit 53, input / output I / F 54, R / W unit 55, and network I / F 56 are connected to one another via a bus 57.
[0135] The storage unit 53 can be realized by a hard disk drive (HDD), a solid state drive (SSD), a flash memory, etc. The storage unit 53 as a storage medium stores a program for causing the computer 50 to function. The CPU 51 reads the program from the storage unit 53, loads it into the memory 52, and sequentially executes the processes contained in the program.
[0136] As shown in FIG. 8, this determination device functionally includes a receiving unit 11, a processing unit 12, and an output unit 13. [Example]
[0137] Next, embodiments of the present disclosure will be described in detail using examples, but the embodiments of the present disclosure are not limited to these examples.
[0138] Example 1: Single Assay In this example, a single assay was attempted in which nucleic acid amplification was performed by a method that satisfied (X) by immobilizing a target substance on a microplate (direct method). A rabbit antibody (i.e., primary antibody) was used as the target substance, and an anti-rabbit antibody (i.e., secondary antibody) was used as the first target-binding molecule.
[0139] [Preparation of secondary antibody-signal nucleic acid complex (first complex)] A secondary antibody-signal nucleic acid complex (first complex of the present disclosure) was prepared by mixing 10 μL of 2 μM biotinylated signal nucleic acid ([BioON]GTTGTGAGGTTAAGCGACT (SEQ ID NO: 1); Eurofins Genomics), 10 μL of 35 μg / mL streptavidin (New England Biolabs), 10 μL of 0.1 mg / mL biotinylated antibody (Biotin-SP (long spacer) AffiniPure Donkey Anti-Rabbit IgG (H+L) (min X Bov, Ck, Gt, GP, Sy Hms, Hrs, Hu, Ms, Rat, Shp Sr Prot), Jackson ImmunoResearch, 711-065-152), and 20 μL of 1×TE buffer. Next, two Amicon Ultra 100K (0.5 mL) tubes (Merck) were prepared and the entire volume of the secondary antibody-signal nucleic acid complex and NC (negative control) were added along with 450 μL of 1× TE. The tubes were centrifuged at 14,000 × g for 5 minutes, the flow-through was discarded, and 450 μL of 1× TE buffer was added again. The tubes were centrifuged at 14,000 × g for 5 minutes. This centrifugation wash procedure was repeated six times, and the remaining solution of the secondary antibody-signal nucleic acid complex and NC was collected.
[0140] [Preparation of target substance-binding microplate] (Assessment method of the present disclosure: Test Areas 1 to 8) Anti-GST antibody (manufactured by Abcam, EPR4236), a rabbit antibody (primary antibody), was used as the target substance, and binding of the target substance to the substrate was attempted. For the wells to which the secondary antibody-signal nucleic acid complex solution was subsequently added, a primary antibody solution was prepared by diluting it with 1x PBS(-) so that the amount of anti-GST antibody applied to each well would be the value shown in Table 2.
[0141] [Table 2]
[0142] (Conventional evaluation method: Test area 9 to Test area 12) For wells to which HRP (Horseradish peroxidase)-conjugated secondary antibody Donkey Anti-Rabbit IgG (Jackson, 711-035-152) was subsequently added, a primary antibody solution was prepared by diluting the anti-GST antibody with 1x PBS(-) to the values shown in Table 3.
[0143] [Table 3]
[0144] (Binding of target substance to substrate) 100 μL of the primary antibody solution was dispensed into each well of a Nunc immunoplate (Thermo Fisher Scientific). Control wells (Test Groups 8 and 12) were also prepared without the primary antibody solution, and 100 μL of 1x PBS was added. The plate was left overnight at 4°C. After incubation, the solution in each well was removed, and 200 μL of Tween-supplemented PBS (PBST) was added, followed by further removal of 200 μL. After washing, 200 μL of a mixture of Blocking One (Nacalai Tesque, Inc.) diluted 5-fold with purified water was added to each well and the plate was left at room temperature for 4 hours. After incubation, the solution in each well was removed, and 200 μL of PBST was added, followed by further removal of 200 μL. For Test Groups 1 to 8, 100 μL of a secondary antibody-signal nucleic acid complex solution diluted 100-fold with PBS was added to each washed well. For Test Areas 9 to 12, 100 μL of HRP-conjugated secondary antibody Donkey Anti-Rabbit IgG solution diluted 1:1000 with PBS was added to each washed well. The plate was left to stand at room temperature for 2 hours. After standing, the solution was removed from the wells, 200 μL of PBST was added, and 200 μL of PBST was removed again. This washing process was repeated six times.
[0145] [Nucleic acid amplification reaction (Test areas 1 to 8 and Test areas 13 to 15)] In tube 1, 8.2 μL of RNase-free water, 9 μL of 10× NEB#2 buffer (manufactured by New England Biolabs), 10 μL of 10% Triton X-100 (manufactured by Nacalai Tesque), 0.2 μL each of 100 mM dATP, dCTP, dTTP, and dGTP (manufactured by New England Biolabs), and 1 μL of 20× EvaGleen (manufactured by Biotium) were mixed to prepare a nucleic acid solution. In tube 2, 4.9 μL of 50% glycerol (Nacalai Tesque), 1 μL of 10×NEB#2 buffer, 0.6 μL of 5 U / μL Lambda exonuclease (New England Biolabs), 0.5 μL of 8 U / μL BST DNA polymerase (New England Biolabs), and 3 μL of 10 U / μL Nb.BbvCI (New England Biolabs) were mixed to prepare an enzyme solution. In tube 3, 48 μL of RNase-free water, 1 μL of 50 μM first template nucleic acid (AGTCGCTTA (SEQ ID NO: 2)), and 1 μL of 50 μM second template nucleic acid (CGGGCCTTTTTGCTGAGGCCCGTTGTGAG[AmC7] (SEQ ID NO: 3)) were mixed to prepare a 1 μM template solution. In tube 4, 49.75 μL of RNase-free water, 29 μL of the prepared nucleic acid solution, 10 μL of the enzyme solution, and 1.25 μL of the 1 μM template solution were mixed to prepare a premix reaction solution.
[0146] The signal nucleic acid, the first template nucleic acid, and the second template nucleic acid in Example 1 are shown in detail in FIG. The nicking enzyme Nb.BbvCI forms a nick at the " / " portion of "5'-GC / TGAGG-3'". In the first template nucleic acid, 5'-AGTCGCTTA-3', "5'-AGTCGCTTA-3'" is the first template recognition region. The second template nucleic acid, 5'-CGGGCCTTTTTGCTGAGGCCCGTTGTGAG[AmC7]-3', consists of, from upstream to downstream, a stabilizing region, a nick formation site, an additional region, and the second template recognition region.
[0147] The prepared reaction solution was added to wells in test areas 1 to 8. At the same time, the prepared reaction solution and biotinylated signal nucleic acid (SEQ ID NO: 1) (test area 13: final concentration of signal nucleic acid: 1 pM, test area 14: final concentration of signal nucleic acid: 10 fM) were added as positive controls, and the prepared reaction solution and water (test area 15) were added as negative controls. The plate was set in a plate reader (SpectraMax i3x; Molecular Devices), and fluorescence was measured continuously at 37°C (excitation light 485 nm, measurement 535 nm; 1-minute intervals, 10-hour measurement).
[0148] The amplification start time for each test group is shown in Table 4. The point at which the fluorescence intensity in each well was at its minimum from the start to the end of amplification was set as the zero point of the fluorescence intensity. The standard deviation was calculated from the fluorescence intensity at five points (10 points in total, one minute apart) before and after the time at which the fluorescence intensity reached zero, and this value (38,191 RFU) was multiplied by 10 to set the threshold value. The intersection of the threshold value and the amplification curve was set as the amplification start time of 0 minutes. Figure 10 shows a calibration curve created from ΔCT (min), which is the value obtained by subtracting the amplification start time of each of test areas 1 to 7 from the amplification start time of test area 8, which is the control for the secondary antibody-signal nucleic acid complex, and the logarithm to the base 10 of the antigen amount in each test area.
[0149] That is, it was confirmed that the determination method of the present disclosure can detect target substances on the order of pg. Furthermore, it is also possible to quantify the target substances by creating a calibration curve.
[0150] [Table 4]
[0151] [ELISA (Test Areas 9 to 12)] For test plots 9 to 12, in which HRP-conjugated secondary antibody Donkey Anti-Rabbit IgG solution was added, ELISA TMB substrate (Merck) was added after six washes, and the resulting chemiluminescence was measured using a plate reader (excitation light 450 nm). Figure 11 shows a calibration curve constructed from the values (Abs) obtained by subtracting the absorbance of test plot 12, the HRP-conjugated secondary antibody Donkey Anti-Rabbit IgG control, from the respective absorbance values of test plots 9 to 11, and the antigen (pg) (amount of target substance).
[0152] The detection limit of the secondary antibody-signal nucleic acid complex was determined from the calibration curve in Figure 10 and was found to be 2.268 pg. On the other hand, the detection limit of the HRP-conjugated secondary antibody Donkey Anti-Rabbit IgG was determined from the calibration curve in Figure 11 and was found to be 22.863 pg. From the above, it can be seen that the method of the present disclosure was approximately 10 times more sensitive than the conventional method.
[0153] <Reference example X> In Reference Examples X2-2 to X2-5, Reference Examples X3-1 to X3-4, and Reference Examples X4-1 to X4-4, nucleic acid amplification was attempted by a method that satisfied (X).
[0154] The following reagents were prepared: First template nucleic acid: manufactured by Eurofins Genomics (SEQ ID NO: 5 to SEQ ID NO: 9) Second template nucleic acid: manufactured by Eurofins Genomics (SEQ ID NO: 10 to SEQ ID NO: 17) Polymerase: New England Biolabs, 5U / μL Klenow Fragment, 3'→5' exo - (Hereafter referred to as KW.) Nicking enzyme: 10 U / μL Nb.BbvCI (manufactured by New England Biolabs) (Nb.BbvCI forms a nick at the " / " portion of "5'-GC / TGAGG-3'") Lambda exonuclease: New England Biolabs, 5U / μL dNTPs (100 mM each of dATP, dTTP, dCTP, and dGTP): New England Biolabs
[0155] The base sequence of the signal nucleic acid is shown below. [SEQ ID NO: 4] 5'-GTTGTGAGGTTAAGCGACT-3'
[0156] (Design of the first template nucleic acid) The first template nucleic acids represented by SEQ ID NOs: 5 to 9 contain a first template recognition region (for example, "5'-AGTCGCTTA-3'"). The base sequences of the first template nucleic acids (SEQ ID NO: 5 to SEQ ID NO: 9) are shown in Table 5.
[0157] (Design of the second template nucleic acid) The second template nucleic acids represented by SEQ ID NOs: 10 to 17 contain, in order from the 5' end, a stabilizing region, a nick formation site "5'-GC / TGAGG-3'" where a nick is formed at the " / " position by the nicking enzyme Nb.BbvCI, an additional region "5'-CCC-3'", and a second template corresponding region "5'-GTTGTGAG-3'". The base sequences of the second template nucleic acids (SEQ ID NO: 10 to SEQ ID NO: 17) are shown in Table 5.
[0158] (Nucleic acid amplification reaction) -Preparation of nucleic acid solution- For each reaction, 0.82 μL of RNase-free water, 0.9 μL of 10×NEB#2 buffer, 1 μL of 10% TritonX-100, 0.1 μL of 20×EvaGreen®, 0.02 μL of 100 mM dATP, 0.02 μL of 100 mM dTTP, 0.02 μL of 100 mM dCTP, and 0.02 μL of 100 mM dGTP were mixed (total 2.9 μL / reaction). The required amount of nucleic acid solution was prepared prior to the amplification experiment and stored frozen at -20°C. It was then thawed and used during the amplification reaction.
[0159] - Preparation of enzyme solution - Each reaction contained 0.49 μL of 50% glycerol, 0.1 μL of 10× NEB#2 buffer, 0.3 μL of nicking enzyme, 0.05 μL of DNA polymerase (KW), and 0.06 μL of lambda exonuclease (total 1 μL per reaction). The required amount of enzyme solution was prepared before the amplification experiment and stored frozen at -20°C. It was then removed from the freezer and used during the amplification reaction.
[0160] -Sample preparation- Samples were prepared to a total volume of 10 μL per reaction. Specifically, 4.975 μL of RNase-free water, 2.9 μL of nucleic acid solution, and 1 μL of enzyme solution were mixed for each reaction, and 0.125 μL of a mixture of the first template nucleic acid and the second template nucleic acid (1 μM each) was added per reaction to prepare a master mix. A strong positive sample was prepared by adding 1 μL of 10 pM signal nucleic acid to this master mix. A weak positive sample was prepared by adding 1 μL of 100 fM signal nucleic acid to the master mix. Furthermore, a negative sample (i.e., background sample) was prepared by adding 1 μL of RNase-free water to the reaction mixture. Strongly positive samples (1 pM signal nucleic acid), weakly positive samples (10 fM signal nucleic acid), and negative samples (i.e., no signal nucleic acid) were each incubated at 37°C for 10 hours using a real-time PCR device (CFX Duet or CFX-1000; BIO-RAD), and the Ct value (minutes), which is the time when amplification began, was measured.
[0161] -Nucleic acid amplification reaction- In this example, the threshold value in the real-time PCR device was set to RFU (Relative Fluorescent Unit) = 20, and the time it took for the amplification curve to reach the threshold was evaluated as the threshold cycle value (Ct value).
[0162] As indicators for evaluating the detection efficiency, the "negative / strong positive Ct value ratio" and "sample concentration converted from the negative Ct value" were calculated. As described above, the "negative / strong positive Ct value ratio" is calculated by dividing the negative Ct value by the strongly positive Ct value, and the higher the calculated value, the more clearly the Ct values of the positive sample and the Ct values of the negative sample are separated. As described above, the "analyte concentration converted from the negative Ct value" was calculated from the logarithm of the strongly positive and weakly positive Ct values, the respective analyte concentrations, and the Excel TREND function to determine the corresponding analyte concentration. As described above, the concentration of a single molecule of signal nucleic acid in a 10 μL system is approximately 0.1 aM, calculated from Avogadro's number. In other words, if the "analyte concentration converted from the negative Ct value" is 0.1 aM or less, this suggests that, theoretically, a single copy of signal nucleic acid present in a 10 μL system can be detected. Therefore, the detection sensitivity can be derived from the "analyte concentration converted from the negative Ct value."
[0163] In the present disclosure, the ability to suppress nonspecific nucleic acid amplification can be confirmed by a high negative / strongly positive Ct value ratio. The ability to achieve rapid isothermal amplification can be confirmed by a low Ct value for a strongly positive or weakly positive sample. High detection sensitivity can be confirmed by a low sample concentration calculated from the negative Ct value.
[0164] Nucleic acid amplification of Reference Examples X2-2 to X2-5, Reference Examples X3-1 to X3-4, and Reference Examples X4-1 to X4-4 was evaluated. The results are shown in Table 6. In all of Reference Examples X2-2 to X2-5, Reference Examples X3-1 to X3-4, and Reference Examples X4-1 to X4-4, background amplification was suppressed, the negative / strong positive Ct value ratio was high, and the sample concentration calculated from the negative Ct value was below 0.1 aM, indicating that all of the detection systems had good detection sensitivity.
[0165] In Table 6, † indicates that the sample concentration calculated from the negative Ct value is lower than 0.1 aM (i.e., the concentration at which one copy exists in 10 μL of reaction solution), meaning that single copies can be detected in the sample. For example, in Table 6, "3.0E-04" means "3.0 × 10 -4 " indicates that
[0166] [Table 5]
[0167] [Table 6]
[0168] <Reference Example Y> In Reference Examples Y2-2 to Y2-8 and Reference Example Y3-1, nucleic acid amplification was attempted by a method that satisfied (Y).
[0169] The following reagents were prepared: First template nucleic acid: manufactured by Eurofins Genomics (SEQ ID NO: 18 to SEQ ID NO: 19) Second template nucleic acid: Eurofins Genomics (SEQ ID NO: 20 to SEQ ID NO: 27) Polymerase: 8 U / μL Bst DNA polymerase, Large Fragment (hereinafter also referred to as BST LF) manufactured by New England Biolabs New England Biolabs 5U / μL Klenow Fragment, 3'→5' exo - (Hereafter referred to as KW.) Nicking enzyme: 10 U / μL Nb.BbvCI (manufactured by New England Biolabs) (Nb.BbvCI forms a nick at the " / " portion of "5'-GC / TGAGG-3'") Lambda exonuclease: New England Biolabs, 5U / μL dNTPs (100 mM each of dATP, dTTP, dCTP, and dGTP): New England Biolabs
[0170] The base sequence of the signal nucleic acid is shown below. [SEQ ID NO: 4] 5'-GTTGTGAGGTTAAGCGACT-3'
[0171] (Design of the first template nucleic acid) The first template nucleic acids represented by SEQ ID NOs: 18 to 19 each contain, in order from the 5' end, a stabilizing region, a nick formation site "5'-GC / TGAGG-3'" where a nick is formed at the " / " position by the nicking enzyme Nb.BbvCI, an additional region "5'-CCC-3'", and a first template recognition region (a region adjacent to the downstream side of the additional region). The base sequences of the first template nucleic acids (SEQ ID NO: 18 to SEQ ID NO: 19) are shown in Table 7.
[0172] (Design of the second template nucleic acid) The second template nucleic acids represented by SEQ ID NOs: 20 to 27 contain a second template corresponding region (for example, "5'-GTTGTGAG-3'"). The base sequences of the second template nucleic acids (SEQ ID NO: 20 to SEQ ID NO: 27) are shown in Table 7.
[0173] (Nucleic acid amplification reaction) Except for changing the type of polymerase (KW or BST LF) as shown in Table 8, the nucleic acid solution, enzyme solution, and sample were prepared in the same manner as in <Reference Example X>, and the Ct value (minutes), which is the amplification start time, was measured.
[0174] Furthermore, in the same manner as in <Reference Example X>, the "negative / strong positive Ct value ratio" and the "specimen concentration converted from the negative Ct value" were calculated.
[0175] Nucleic acid amplification in Reference Examples Y2-2 to Y2-8 and Reference Example Y3-1 was evaluated. The results are shown in Table 8. In all of Reference Examples Y2-2 to Y2-8 and Reference Example Y3-1, background amplification was suppressed, the negative / strong positive Ct value ratio was high, and the sample concentration calculated from the negative Ct value was on the order of aM or less, indicating that all of these detection systems had good detection sensitivity.
[0176] In Table 8, † indicates that the sample concentration calculated from the negative Ct value is lower than 0.1 aM (i.e., the concentration at which one copy exists in 10 μL of reaction solution), meaning that single copies can be detected in the sample. For example, in Table 8, "7.3E-08" means "7.3 × 10 -8 " indicates that
[0177] [Table 7]
[0178] [Table 8]
[0179] The above-mentioned Reference Examples demonstrate that nucleic acid amplification for detecting a signal nucleic acid is possible using either a method that satisfies (X) or a method that satisfies (Y). This further supports the idea that the use of either a nucleic acid amplification reaction that satisfies (X) or a nucleic acid amplification reaction that satisfies (Y) in the determination method of the present disclosure provides an effect of providing a simple method for determining the presence state of a target substance that has a low detection limit. [Explanation of symbols]
[0180] 1 Target substance 2a. First target-binding molecule 3a Signal nucleic acid 3c, 3c' signal nucleic acid equivalents 4a, 4a' First template nucleic acid 4b, 4b' second template nucleic acid 9 Substances bound to substrates 10 Base material 11 Reception 12 Processing section 13 Output section 20 Judgment device 50 Computers 51 CPU 52 memory 53 Storage section 54 Input / Output Interface 55 R / W section 56 Network I / F 57 Bus
Claims
1. A method for determining the state of a target substance in a sample, comprising: (A) preparing a sample; (B) adding to the sample a first complex containing a first target-binding molecule capable of binding to the target substance and a signal nucleic acid that is bound to or capable of binding to the first target-binding molecule, thereby obtaining a second complex in which the target substance and the first complex are bound via the first target-binding molecule; (C) adding to the second complex, a first template nucleic acid including a first template recognition region having sequence complementarity to a continuous region of 7 or more bases in the signal nucleic acid; a second template nucleic acid containing a second template corresponding region having sequence identity to a continuous region of 7 or more bases in the signal nucleic acid; A polymerase and a nicking enzyme; adding lambda exonuclease; (D) after (A) to (C), performing a nucleic acid amplification reaction at a temperature range of 50°C or less; and (E) after (D), detecting the amplification product. Including, the signal nucleic acid comprises, in order from upstream, a region having sequence identity to a second template nucleic acid and a region having sequence complementarity to a first template nucleic acid; A determination method that satisfies the following (X) or (Y): (X) The second template nucleic acid includes, in order from upstream, a stabilizing region, a nick-forming site, and the second template corresponding region, and the nicking enzyme is capable of forming a nick only in the second template nucleic acid among the first template nucleic acid, the second template nucleic acid, and the signal nucleic acid. (Y) The first template nucleic acid comprises, in order from upstream, a stabilizing region, a nick-forming site, and the first template recognition region, and the nicking enzyme is capable of forming a nick only in the first template nucleic acid among the first template nucleic acid, the second template nucleic acid, and the signal nucleic acid.
2. The method according to claim 1 , wherein the target substance is at least one selected from the group consisting of proteins, nucleic acids, sugars, low-molecular-weight compounds, microorganisms, viruses, and cells.
3. 2. The method of claim 1, wherein the first target-binding molecule is at least one selected from the group consisting of an antibody, an aptamer, biotin, streptavidin, a thiol, N-hydroxysuccinimide, an alkyne, and an azide compound.
4. The method of claim 1 , wherein in the first complex, the first target-binding molecule and the signal nucleic acid are indirectly bound or indirectly bindable via biotin and streptavidin.
5. The method according to claim 1, wherein the presence states of multiple types of target substances are determined by using multiple types of first target-binding molecules, multiple types of signal nucleic acids, and multiple types of first template nucleic acids corresponding to the multiple types of signal nucleic acids.
6. The method according to claim 1 , wherein in (A), the target substance is immobilized on a substrate or is not immobilized on a substrate.
7. 2. The method of claim 1, wherein in (A), the sample is prepared on a substrate, and (C) is performed after (A) and (B), and further comprising washing the substrate after (A) and (B) and before (C).
8. 2. The method according to claim 1, wherein in (A), the sample is prepared on a substrate, and the material of the substrate is selected from the group consisting of polystyrene, polypropylene, gold colloid, and magnetic particles.
9. The method of claim 1 , wherein the polymerase has strand displacement activity.
10. The method according to claim 1 , wherein the nucleic acid amplification reaction is an isothermal amplification reaction.
11. The method according to claim 10, wherein the isothermal amplification reaction is carried out at 10°C to 50°C.
12. The method of claim 1, wherein, when (X) and (Y) are satisfied, a continuous region of 3 or more bases in the stabilizing region and a continuous region downstream of the continuous region of 3 or more bases have sequence complementarity and are capable of forming a hairpin structure.
13. The method according to claim 1, wherein the Tm value of the stabilizing region is 30°C or higher when (X) and (Y) are satisfied.
14. In the second template nucleic acid when the condition (X) is satisfied and in the first template nucleic acid when the condition (Y) is satisfied, (1) two consecutive bases at the 5' end, (2) two consecutive bases at the 3' end; (3) two consecutive bases at the 5' end that can be generated by nicking with a nicking enzyme, and (4) Two consecutive bases at the 3' end that can be generated by nicking with a nicking enzyme are The method of claim 1, wherein the sequences have neither sequence identity nor sequence complementarity with each other.
15. 2. The method according to claim 1, wherein, when the 3′-end of the first template nucleic acid and the 3′-end of the second template nucleic acid are aligned with the signal nucleic acid, the first template recognition region and the second template corresponding region are arranged with a gap of one or more bases between them, are adjacent to each other without a gap between them, or are arranged with an overlap of one or more bases between them.
16. The method according to claim 1 , wherein the 3′-end of the second template nucleic acid when (X) is satisfied and the 3′-end of the first template nucleic acid when (Y) is satisfied are modified.
17. A kit for determining the state of a target substance in a sample, comprising: a first complex stored in a container, the first complex including a first target-binding molecule capable of binding to a target substance and a signal nucleic acid that is bound to or capable of binding to the first target-binding molecule; a polymerase contained in a container; a nicking enzyme contained in a container; a lambda exonuclease contained in a container; a first template nucleic acid stored in a container; a second template nucleic acid stored in a container; Equipped with the first template nucleic acid includes a first template recognition region having sequence complementarity to a continuous region of 7 or more bases in the signal nucleic acid; the second template nucleic acid includes a second template corresponding region having sequence identity to a continuous region of 7 or more bases in the signal nucleic acid; the signal nucleic acid comprises, in order from upstream, a region having sequence identity to a second template nucleic acid and a region having sequence complementarity to a first template nucleic acid; A kit that satisfies the following (X) or (Y): (X) The second template nucleic acid includes, in order from upstream, a stabilizing region, a nick-forming site, and the second template corresponding region, and the nicking enzyme is capable of forming a nick only in the second template nucleic acid among the first template nucleic acid, the second template nucleic acid, and the signal nucleic acid. (Y) The first template nucleic acid comprises, in order from upstream, a stabilizing region, a nick-forming site, and the first template recognition region, and the nicking enzyme is capable of forming a nick only in the first template nucleic acid among the first template nucleic acid, the second template nucleic acid, and the signal nucleic acid.
18. The kit according to claim 17 , wherein the target substance is at least one selected from the group consisting of proteins, nucleic acids, sugars, low-molecular-weight compounds, microorganisms, viruses, and cells.
19. a receiving unit for acquiring a detection result of an amplification product in the determination method according to any one of claims 1 to 16; a processing unit that converts the detection result acquired by the reception unit into output data; an output unit that outputs the output data; An apparatus for determining the state of presence of a target substance, comprising: