Reagent for pretreatment and method for pretreatment of sample for nucleic acid detection

Abstract

To detect a target nucleic acid contained in a sample, particularly a water sample in the environment such as treated sewage water or rivers, in a more convenient manner with higher accuracy.SOLUTION: A sample for nucleic acid detection is mixed with a reagent for pretreatment containing EDTA, and the mixture is heated using heating means at 90°C or higher.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to a pretreatment reagent and a pretreatment method for detecting a target nucleic acid from a sample containing nucleic acid. [Background technology]

[0002] Virus quantification in water is used as one of the pollution indicators for aquatic environments such as rivers. In particular, in recent years, it has been reported that the amount of virus in sewage can be a leading indicator of the spread of infectious diseases in aquatic environments, and it has been used by governments to make decisions about infectious disease control measures. Quantitative measurement of environmental viruses to understand the pollution status of rivers and water supply / sewage systems has primarily been carried out using quantitative PCR. Sample pretreatment for this method requires the extraction and purification of viral nucleic acids, and in the case of RNA viruses, a reverse transcription step for RNA viruses.

[0003] The nucleic acid pretreatment process described above requires a combination of complex reaction operations. Commercially available nucleic acid extraction kits are often used to simplify the process of extracting viral nucleic acids from samples, but even so, the nucleic acid extraction process typically takes about an hour. Environmental samples must be collected from multiple measurement points and continuously measured, so it is desirable that the pretreatment of samples for measurement be as simple as possible, quick, and low-cost.

[0004] Patent Document 1 discloses a method for amplifying and detecting nucleic acids of microorganisms in a sample containing many impurities, such as contaminated foodstuffs, by adding metal ions to the sample, while avoiding the influence of foodstuff components, etc. Patent Document 2 discloses a method for easily and quickly extracting viral nucleic acids by heat-treating a sample from an aqueous environment. Non-Patent Document 1 discloses that adding polyvinylpyrrolidone (PVPP) to a sample containing many impurities improves the efficiency of nucleic acid amplification. [Prior art documents] [Patent documents]

[0005] [Patent Document 1] Japanese Patent Application Laid-Open No. 2008-72904 [Patent Document 2] Japanese Patent Application Laid-Open No. 2012-157265 [Non-patent literature]

[0006] [Non-Patent Document 1] M. Watanabe et al. Plant Biotechnology 33, 133-136 (2016) Summary of the Invention [Problem to be solved by the invention]

[0007] An object of the present invention is to more simply and accurately detect a target nucleic acid contained in a sample, particularly an environmental water sample such as sewage treatment water or a river, etc. In particular, an object of the present invention is to detect the nucleic acid under conditions that are less susceptible to the influence of nucleases contained in the sample. [Means for solving the problem]

[0008] The present invention provides the following: [1] A method for pretreating a sample to be subjected to nucleic acid detection, comprising: i) mixing the sample with a pretreatment reagent containing ethylenediaminetetraacetic acid (EDTA); and ii) heating the sample mixed in step i) by a heating means at 90°C or higher; A method comprising: [2] The method according to [1], wherein the sample is an environmental water sample. [3] The method according to either [1] or [2], wherein the nucleic acid is a viral nucleic acid. [4] The method according to any one of [1] to [3], which comprises a step of concentrating nucleic acids in the sample before step i). [5] The method according to any one of [1] to [4], wherein the concentration of EDTA in the sample mixed in step i) is 0.01 to 20 mM. [6] The method according to [5], wherein the concentration of EDTA in the sample mixed in step i) is 0.1 to 10 mM. [7] The method according to any one of [1] to [6], wherein the heat treatment time in step ii) is less than 120 seconds. [8] The method according to any one of [1] to [7], wherein the temperature of the heating means in step ii) is 105°C or higher and 160°C or lower. [9] A method for detecting nucleic acid in a sample, comprising: a) mixing a sample to be subjected to nucleic acid detection with a pretreatment reagent containing EDTA; b) heating the sample after step a) by a heating means at 90°C or higher; c) mixing the sample after step b) with a nucleic acid detection reagent; and d) detecting nucleic acids in the sample after step c); A method comprising:

[10] The method according to [9], wherein the nucleic acid detection reagent is a reagent for reverse transcription polymerase chain reaction (RT-PCR).

[11] The method according to [9] or

[10] , wherein the time from step b) to initiation of step d) is less than 4 hours.

[12] The method according to any one of [9] to

[11] , wherein in the step c), the EDTA concentration in the sample after mixing is 0.001 to 10 mM.

[13] A reagent for pre-treating a sample to be subjected to nucleic acid detection, the reagent comprising EDTA.

[14] The reagent according to

[13] , wherein the concentration of EDTA is 0.01 to 20 mM.

[15] The reagent according to

[14] , wherein the concentration of EDTA is 0.1 to 10 mM.

[16] The reagent according to any one of

[13] to

[15] , wherein the sample is an environmental water sample.

[17] The reagent according to any one of

[13] to

[16] , wherein the nucleic acid is a viral nucleic acid.

[18] The reagent according to any one of

[13] to

[17] , further comprising a buffering agent. [Effects of the Invention]

[0009] The reagent and method of the present invention make it possible to more simply and accurately detect target nucleic acids contained in samples, particularly environmental water samples such as treated sewage water and river water. [Brief explanation of the drawings]

[0010] [Figure 1] 1 is a graph showing the relationship between the heat treatment time of a sample and the quantitative value of PMMoV in Comparative Example 1. [Figure 2] 1 is a graph showing the relationship between the standing time after heat treatment until the reverse transcription reaction and the quantitative value of PMMoV in Comparative Example 1. [Figure 3] 10 is a graph showing the relationship between the heat treatment time of the sample and the quantitative value of PMMoV in Comparative Example 2. [Figure 4] 1 is a graph showing the relationship between the presence or absence of EDTA addition, the standing conditions after heat treatment until reverse transcription reaction, and the quantitative value of PMMoV in Example 1. [Figure 5] 1 is a graph showing the relationship between the heat treatment conditions (95° C. for 5 minutes or 140° C. for 15 seconds) of Samples A to C and the quantitative value of PMMoV in Example 2. DETAILED DESCRIPTION OF THE INVENTION

[0011] 1 Definition As used herein, "pretreatment" refers to a process for preparing a sample to be subjected to nucleic acid detection in a state suitable for nucleic acid amplification prior to the nucleic acid detection process (particularly the nucleic acid amplification process), more specifically, a process for extracting nucleic acid from virus particles or cells. As used herein, the "quantitative value" of a virus refers to a numerical value calculated based on the output value of a standard solution containing a known concentration of viral nucleic acid, corresponding to the number of viruses per predetermined volume (e.g., 1 μL, 5 μL, etc.) in a sample. As used herein, the term "reagent" encompasses both a compound consisting of a single component and a composition containing multiple components.

[0012] As used herein, the term "ethylenediaminetetraacetic acid (EDTA)" encompasses any of the following forms: free acid, metal salt, and solvate. While any of the above forms may be used, water-soluble metal salts, particularly disodium EDTA and dipotassium EDTA, are typically used. Furthermore, when preparing an aqueous solution of EDTA, solvates, particularly hydrates, of the above metal salts can be used.

[0013] In this specification, the "sample" to be subjected to nucleic acid detection is not particularly limited as long as it is a sample that can contain nucleic acids, and can be, for example, environmental samples such as rivers, treated sewage water, activated sludge, soil, samples related to the quality control of foods, beverages, pharmaceuticals, cosmetics, etc., biological samples collected from animals and plants, samples of microbial cultures, etc. Environmental samples that can contain unknown components that can inhibit nucleic acid amplification reactions are particularly suitable.

[0014] As used herein, the term "nucleic acid" encompasses any nucleic acid derived from viruses, bacteria, fungi, and other eukaryotic cells. When derived from viruses, nucleic acids include, for example, genomic DNA and genomic RNA, and may be in the form of single-stranded DNA, single-stranded RNA, double-stranded DNA, or double-stranded RNA. When derived from bacteria, fungi, and other eukaryotic cells, nucleic acids may be in the form of genomic DNA, ribosomal RNA, messenger RNA, plasmid DNA, or the like. Examples of viruses include pepper mild mottle virus (PMMoV), a plant-infecting virus detected in sewage and the like as an indicator of environmental pollution, and viruses that infect humans, such as rotavirus, adenovirus, norovirus, respiratory syncytial virus, human metapneumovirus, and SARS-CoV-2. Examples of bacteria include Acinetobacter, Actinomyces, Aerococcus, Aeromonas, Alcaligenes, Bacillus, Bacteroides, Bordetella, Branhamella, Brevibacterium, Campylobacter, Candida, Capnocytophaga, Chromobacterium, and the like. ), Clostridium genus, Corynebacterium genus, Cryptococcus genus, Deinococcus genus, Enterococcus genus, Erysielothrix genus, Escherichia genus, Flavobacterium genus, Gemella genus, Haemophilus genus, Klebsiella genus, Lactobacillus genus, Lactococcus genus, Legionella genus,Leuconostoc spp., Listeria spp., Micrococcus spp., Mycobacterium spp., Neisseria spp., Cryptosporidium spp., Nocardia spp., Oerskovia spp., Paracoccus spp., Pediococcus spp., Peptostreptococcus spp., Pseudomonas aeruginosa, Examples of the genera include the genera Propionibacterium, Proteus, Pseudomonas, Rahnella, Rhodococcus, Rhodospirillium, Staphylococcus, Streptomyces, Streptococcus, Vibrio, and Yelsinia.

[0015] In this specification, the "heating means" is not particularly limited as long as it is a means capable of applying a temperature of 90°C or higher to the container wall, etc., and examples thereof include a heat block equipped with a Peltier element, an oil bath, hot air, etc.

[0016] As used herein, the technique for "nucleic acid detection" is not particularly limited and may be any known technique, such as nucleic acid amplification, Northern hybridization, Southern hybridization, or DNA probe method. In particular, nucleic acid amplification, which enables highly sensitive detection, is preferably used. As used herein, "nucleic acid amplification" is not particularly limited as long as it is a technique that can amplify a predetermined base sequence in a template nucleic acid to be detected, and any technique, such as PCR (Polymerase Chain Reaction), LAMP (Loop-Mediated Isothermal Amplification), or SDA (Strand Displacement Amplification), may be used. When the nucleic acid to be detected is RNA, it is preferable that a reverse transcription reaction be included before nucleic acid amplification.

[0017] 2. Pretreatment reagents for samples to be subjected to nucleic acid detection A first embodiment of the present invention is a reagent for pretreatment of a sample to be subjected to nucleic acid detection. The reagent of this embodiment is characterized by containing ethylenediaminetetraacetic acid (EDTA). The reagent of this embodiment makes it possible to avoid the influence of nucleases and the like contained in a sample containing nucleic acid, thereby enabling high-sensitivity and high-precision detection in the subsequent nucleic acid detection stage.

[0018] The reagent of this embodiment is suitable for pretreatment of environmental water samples. Because the reagent of this embodiment can avoid the effects of nucleases and the like in the sample, it is particularly suitable for detecting nucleic acids in environmental samples containing unknown components, particularly water samples from rivers, treated sewage, and other environmental sources. Being able to detect nucleic acids in environmental water samples with high sensitivity and accuracy makes it possible to understand the infectivity and contamination status of the water environment. The reagent of this embodiment is preferably used to detect nucleic acids derived from infectious viruses, bacteria, and the like, particularly nucleic acids derived from viruses.

[0019] The concentration of EDTA contained in the reagent of this embodiment is preferably 0.01 to 20 mM, particularly preferably 0.1 to 10 mM. The concentration of EDTA can be, for example, 0.2 mM or more, 0.3 mM or more, 0.4 mM or more, 0.5 mM or more, 0.6 mM or more, 0.7 mM or more, 0.8 mM or more, 0.9 mM or more, 1.0 mM or more, 1.1 mM or more, 1.2 mM or more, 1.3 mM or more, 1.4 mM or more, 1.5 mM or more, 1.6 mM or more, 1.7 mM or more, 1.8 mM or more, 1.9 mM or more, 2.0 mM or more, 2.1 mM or more, 2.2 mM or more, 2.3 mM or more, 2.4 mM or more, 2.5 mM or more, 3.0 mM or more, 3.5 mM or more, 4.0 mM or more, 4.5 mM or more, 5.0 mM or more, 6.0 mM or more, 7.0 mM or more, 8.0 mM or more, or 9.0 mM or more. The concentration of EDTA is, for example, 9.5mM or less, 9.0mM or less, 8.5mM or less, 8.0mM or less, 7.5mM or less, 7.0mM or less, 6.9mM or less, 6.8mM or less, 6.7mM or less, 6.6mM or less, 6.5mM or less, 6. 4mM or less, 6.3mM or less, 6.2mM or less, 6.1mM or less, 6.0mM or less, 5.9mM or less, 5.8mM or less, 5.7mM or less, 5.6mM or less, 5.5mM or less, 5.4mM or less, 5.3mM or less, 5.2mM or less, 5.1mM Below, 5.0mM or less, 4.9mM or less, 4.8mM or less, 4.7mM or less, 4.6mM or less, 4.5mM or less, 4.4mM or less, 4.3mM or less, 4.2mM or less, 4.1mM or less, 4.0mM or less, 3.9mM or less, 3.8mM or less , 3.7mM or less, 3.6mM or less, 3.5mM or less, 3.4mM or less, 3.3mM or less, 3.2mM or less, 3.1mM or less, 3.0mM or less, 2.5mM or less, 2.0mM or less, 1.5mM or less, or 1.0mM or less.

[0020] In the pretreatment reagent, the concentration of EDTA in the reaction system for the subsequent nucleic acid detection, particularly nucleic acid amplification, is preferably diluted 1.5 to 20 times, particularly 2.0 to 10 times, the above concentration.

[0021] The reagent of this embodiment preferably contains a buffer, particularly a pH buffer. The buffer used here is preferably a buffer known to have no negative effect on the nucleic acid detection reaction system described below. Examples of such buffers include Tris-HCl (pH 7.0 to 8.5), as well as pH buffers such as HEPES, BES, TES, MOBS, DIPSO, TAPSO, HEPPSO, TAPSO, TEA, glycylglycine, and bicine. The pH of the reagent of this embodiment is preferably 6.0 to 9.0, particularly 6.5 to 8.5.

[0022] The reagent of this embodiment may further contain other components. Examples of other components include components used to expose nucleic acids from capsids or cells. Examples of such components include alkalis (NaOH, KOH, etc.), acids (HCl, H2SO4, etc.), enzymes (proteases such as proteinase K, polysaccharide-degrading enzymes such as chitinase, lysozyme, and zymolyase), surfactants (anionic surfactants such as SDS, cationic surfactants such as CTAB (cetyltrimethylammonium bromide), nonionic surfactants such as Triton-X, and zwitterionic surfactants such as betaine (a general term for compounds with a specific structure, e.g., trimethylglycine)), redox agents (hydrogen peroxide, β-mercaptoethanol, dithiothreitol, etc.), and protein denaturants (guanidine hydrochloride, urea, etc.). A mixture of these components may also be used. Furthermore, when the sample contains a large amount of impurities other than nucleic acids, for example, polyvinylpyrrolidone (PVPP) may be added so that the final concentration at the time of nucleic acid detection becomes approximately 50 mg / mL (see Non-Patent Document 1).

[0023] 3. Method for pretreating samples to be used for nucleic acid detection A second embodiment of the present invention is a method for pretreating a sample to be subjected to nucleic acid detection. The method of this embodiment is characterized by comprising the following steps: i) mixing the sample with a pretreatment reagent containing EDTA; and ii) A step of heating the sample mixed in step i) by a heating means at 90°C or higher.

[0024] In the method of this embodiment, the sample is preferably an environmental water sample, particularly a river sample, treated sewage water, etc. Furthermore, the nucleic acid to be detected is preferably derived from a virus.

[0025] 3-1 Preparation process The method of this embodiment will be described below step by step. The method of this embodiment includes the above steps i) and ii) as essential steps, but may also include one or more preparatory steps prior to step i). For example, if the sample contains a large amount of impurities other than nucleic acids, the method may also include a step of removing these impurities. Examples of such a step include filtration through a coarse mesh filter or filter paper. Furthermore, for example, if the sample contains a large amount of solids, such as some foods or biological samples, the method may also include a step of crushing the solids in a liquid and a step of removing insoluble components (residue).

[0026] When the nucleic acid concentration in the sample is low, particularly in the case of environmental water samples, it is preferable to include a step of concentrating the nucleic acids in the sample. The method for concentrating the sample is not particularly limited, but any of the following can be used: concentration by ultrafiltration, nucleic acid adsorption onto a filter made of glass fiber or a similar material, nucleic acid precipitation with ethanol or isopropanol, etc.

[0027] 3-2 Process i) EDTA mixing process In this embodiment, step i) is a step of mixing the sample with a pretreatment reagent containing EDTA. The EDTA-containing pretreatment reagent may be the reagent described in the section "2. Pretreatment reagent for sample to be subjected to nucleic acid detection."

[0028] In step i), the concentration of EDTA in the sample after mixing is preferably 0.01 to 20 mM, particularly 0.1 to 10 mM, and further preferably 1 to 5 mM, and most preferably 2.5 mM. The concentration of EDTA can be, for example, 0.2 mM or more, 0.3 mM or more, 0.4 mM or more, 0.5 mM or more, 0.6 mM or more, 0.7 mM or more, 0.8 mM or more, 0.9 mM or more, 1.0 mM or more, 1.1 mM or more, 1.2 mM or more, 1.3 mM or more, 1.4 mM or more, 1.5 mM or more, 1.6 mM or more, 1.7 mM or more, 1.8 mM or more, 1.9 mM or more, 2.0 mM or more, 2.1 mM or more, 2.2 mM or more, 2.3 mM or more, 2.4 mM or more, 2.5 mM or more, 3.0 mM or more, 3.5 mM or more, 4.0 mM or more, 4.5 mM or more, 5.0 mM or more, 6.0 mM or more, 7.0 mM or more, 8.0 mM or more, or 9.0 mM or more. The concentration of EDTA is, for example, 9.5mM or less, 9.0mM or less, 8.5mM or less, 8.0mM or less, 7.5mM or less, 7.0mM or less, 6.9mM or less, 6.8mM or less, 6.7mM or less, 6.6mM or less, 6.5mM or less, 6. 4mM or less, 6.3mM or less, 6.2mM or less, 6.1mM or less, 6.0mM or less, 5.9mM or less, 5.8mM or less, 5.7mM or less, 5.6mM or less, 5.5mM or less, 5.4mM or less, 5.3mM or less, 5.2mM or less, 5.1mM The concentration can be 5.0 mM or less, 4.9 mM or less, 4.8 mM or less, 4.7 mM or less, 4.6 mM or less, 4.5 mM or less, 4.4 mM or less, 4.3 mM or less, 4.2 mM or less, 4.1 mM or less, 4.0 mM or less, 3.9 mM or less, 3.8 mM or less, 3.7 mM or less, 3.6 mM or less, 3.5 mM or less, 3.4 mM or less, 3.3 mM or less, 3.2 mM or less, 3.1 mM or less, 3.0 mM or less, 2.5 mM or less, 2.0 mM or less, 1.5 mM or less, or 1.0 mM or less. By using the above concentrations, it is possible to sufficiently suppress the degradation of nucleic acids, particularly RNA, and by performing appropriate dilution, it is possible to detect the target nucleic acid in the subsequent detection step without causing reaction inhibition by EDTA or reduced sensitivity due to excessive dilution.

[0029] The EDTA-containing pretreatment reagent preferably contains a buffer, particularly a pH buffer, in addition to EDTA. The buffer used here is preferably a buffer known to have no negative effect on the nucleic acid detection reaction system described below. Examples of such buffers include pH buffers with a buffer pH range of 6 to 9, such as Tris-HCl (pH 7.0 to 8.5), HEPES, BES, TES, MOBS, DIPSO, TAPSO, HEPPSO, TAPSO, TEA, glycylglycine, and bicine. The pH of the sample after mixing is preferably 6.0 to 9.0, particularly 6.5 to 8.5.

[0030] The pretreatment reagent may further contain other components. Examples of other components include components used to expose nucleic acids from capsids or cells. Examples of such components include alkalis (NaOH, KOH, etc.), acids (HCl, H2SO4, etc.), enzymes (proteases such as proteinase K, polysaccharide-degrading enzymes such as chitinase, lysozyme, and zymolyase), surfactants (anionic surfactants such as SDS, cationic surfactants such as CTAB (cetyltrimethylammonium bromide), nonionic surfactants such as Triton-X, and zwitterionic surfactants such as betaine (a general term for compounds with a specific structure, such as trimethylglycine)), redox agents (hydrogen peroxide, β-mercaptoethanol, dithiothreitol, etc.), and protein denaturants (guanidine hydrochloride, urea, etc.). A mixture of these components may also be used.

[0031] In step i), the nucleic acid concentration of the sample after mixing is not particularly limited, but is preferably 1 fg / μL to 500 ng / μL, particularly 0.1 pg / μL to 100 ng / μL.

[0032] 3-3 Process ii) Heating process Step ii) of the method of this embodiment is a step of heating the sample mixed in step i) using a heating means at 90° C. or higher. By including this step, the method of this embodiment can bring the sample into a state suitable for nucleic acid detection in a short period of time.

[0033] In step ii), the temperature of the heating means is preferably 100°C or higher, particularly 105°C to 160°C, and even more preferably 125°C to 145°C. In this case, the sample is preferably heated in a sealed, heatable container. That is, the container used is preferably thermally conductive, heat-resistant, sealable, and pressure-resistant. In step ii), the sample to be heated is an aqueous solution. While it is difficult to heat the sample to temperatures above 100°C without sealing, heating in a sealed state creates a high-temperature, pressurized state, making it possible to heat the sample to temperatures above 100°C. Examples of such containers include boil-lock polypropylene tubes (capacity: 0.2 mL, 0.6 mL, 1.5 mL, etc.) with a mechanical structure for sealing, heat-sealable bags, glass test tubes with screw caps, and microchannel chips. When the heating temperature is 90 to 100°C, ordinary polypropylene tubes and the like can be used as the container.

[0034] To ensure that the sample is heated to a high temperature, a method can be used to ensure that no gas phase exists within the container. For example, the container can be filled with the sample liquid and sealed so that no air bubbles or air spaces remain. Alternatively, a high-boiling-point solvent such as mineral oil can be introduced into the gas phase within the container.

[0035] In step ii), when the heating temperature is 90 to 100°C, the heating time is approximately 5 minutes. On the other hand, by setting the heating temperature to 100°C or higher, the heating time can be set to less than 120 seconds, preferably less than 45 seconds, less than 35 seconds, or less than 25 seconds. Most preferably, the heating time can be set to 15 seconds or less. Heating can be achieved by preheating a heating means to a set temperature, setting the container therein, and leaving it there for a predetermined period of time. It is preferable that the sample be cooled immediately after heating for the predetermined period of time has been completed.

[0036] After heating, the sample is preferably cooled at room temperature (e.g., 20 to 30°C), refrigerated temperature (e.g., 2 to 8°C), or ice-cooled. In particular, if it is difficult to immediately perform nucleic acid amplification, it is preferable to immediately store the sample at or below refrigerated temperature.

[0037] When nucleic acids derived from cells with a rigid structure, such as gram-positive bacteria or fungi, are targeted, the heating step may be performed in two or more cycles. On the other hand, when nucleic acids derived from viruses or the like derived from an aqueous environment are targeted, it is preferable to avoid prolonging the heating step in order to avoid the influence of nucleases and the like in the sample, and therefore it is preferable to perform heating only once.

[0038] 4. Methods for detecting nucleic acids in samples A third embodiment of the present invention is a method for detecting nucleic acid in a sample. The method of this embodiment is characterized by comprising the following: a) mixing a sample to be subjected to nucleic acid detection with a pretreatment reagent containing EDTA; b) heating the sample after step a) by a heating means at 90°C or higher; c) mixing the sample after step b) with a nucleic acid detection reagent; and d) detecting nucleic acids in the sample after step c). Unless otherwise specified and unless there is any particular contradiction, the method of this embodiment can be a method of further performing nucleic acid detection on a sample pretreated in accordance with "3. Method for pretreating a sample to be subjected to nucleic acid detection."

[0039] 4-1 Preparation process The method of this embodiment will be described below step by step. The method of this embodiment includes the above steps a) to d) as essential steps, but may also include one or more preparatory steps prior to step a). For example, if the sample contains a large amount of impurities other than nucleic acids, the method may also include a step of removing these. Examples of such steps include filtration through a coarse mesh filter or filter paper.

[0040] When the concentration of nucleic acids in the sample is low, particularly in the case of environmental water samples, it is preferable to include a step of concentrating the nucleic acids in the sample.

[0041] 4-2 Process a) EDTA mixing process Step a) of this embodiment is a step of mixing a sample with a pretreatment reagent containing EDTA. As the pretreatment reagent containing EDTA, the reagent described in the section "2. Pretreatment reagent for sample to be subjected to nucleic acid detection" may be used. In step a), the concentration of EDTA in the sample after mixing is preferably 0.01 to 20 mM, particularly 0.1 to 10 mM.

[0042] The pretreatment reagent containing EDTA preferably contains a buffer, particularly a pH buffer, in addition to EDTA. The buffer used here is preferably a buffer known to have no negative effect on the nucleic acid detection reaction system described below. The buffer may also be a pH buffer. The pH of the sample after mixing is preferably 6 to 9, particularly 6.5 to 8.5. The pretreatment reagent may further contain other components. Examples of other components include components used to expose nucleic acids from capsids or cells.

[0043] 4-3 Process b) Heating process Step b) of this embodiment is a step of heating the sample after step a) using a heating means at 90°C or higher. In step b), the sample is preferably heated while sealed in a sealed, heatable container. In step b), the temperature of the heating means is preferably 100°C or higher, particularly 105°C to 160°C, and more preferably 125°C to 145°C. In this case, the sample is preferably heated while sealed in a sealed, heatable container. On the other hand, when the heating temperature is 90 to 100°C, a normal polypropylene tube or the like may be used as the container.

[0044] To ensure that the sample is heated to a high temperature, a method can be used to ensure that no gas phase exists within the container. For example, the container can be filled with the sample liquid and sealed so that no air bubbles or air spaces remain. Alternatively, a high-boiling-point solvent such as mineral oil can be introduced into the gas phase within the container.

[0045] In step b), when the heating temperature is 90 to 100°C, the heat treatment time is approximately 5 minutes. On the other hand, when the heating temperature is 100°C or higher, the heat treatment time can be less than 120 seconds, preferably less than 45 seconds, less than 35 seconds, or less than 25 seconds. Most preferably, the heat treatment time can be 15 seconds or less. Heating can be achieved by preheating a heating means to a set temperature and setting the container therein for a predetermined period of time. It is preferable that the sample be cooled immediately after heating for the predetermined period of time has been completed.

[0046] After heating, the sample is preferably cooled at room temperature (e.g., 20 to 30°C), refrigerated temperature (e.g., 2 to 8°C), or ice-cooled. In particular, if it is difficult to immediately perform nucleic acid amplification, it is preferable to immediately store the sample at or below refrigerated temperature.

[0047] The heating step may be carried out in two or more cycles, but when targeting nucleic acids derived from viruses or the like originating from the aqueous environment, it is preferable to carry out heating only once.

[0048] Through the above steps a) and b), a pretreated sample for nucleic acid detection can be obtained.

[0049] 4-4 Step c) Nucleic acid detection reagent mixing step Step c) in the method of this embodiment is a step of mixing the sample after step b) with a nucleic acid detection reagent. Here, the nucleic acid detection reagent is preferably a reagent for reverse transcription polymerase chain reaction (RT-PCR) when the nucleic acid to be detected is RNA, and is preferably a reagent for polymerase chain reaction (PCR) when the nucleic acid to be detected is DNA.

[0050] When the nucleic acid to be detected is RNA and an RT-PCR reagent is used as the nucleic acid detection reagent, the RT-PCR reagent can contain, for example, the following components. - DNA polymerases with reverse transcription function (e.g., Tth DNA polymerase); - at least one pair of primers for amplifying a desired region of a template nucleic acid; - Deoxyribonucleoside triphosphates; - divalent metal ions; and - pH buffer.

[0051] When the nucleic acid to be detected is DNA and a PCR reagent is used as the nucleic acid detection reagent, the PCR reagent can contain the following components. - DNA polymerase (e.g., Taq DNA polymerase); - at least one pair of primers for amplifying a desired region of a template nucleic acid; - Deoxyribonucleoside triphosphates; - divalent metal ions; and - pH buffer.

[0052] When RT-PCR or PCR is performed under real-time PCR conditions, a detection probe (e.g., TaqMan® probe) or a fluorescent intercalator (e.g., SYBR® GREEN) may be further included. Furthermore, for accurate detection / quantification, an internal standard DNA, uracil DNA glycosylase (UNG), etc. may also be included.

[0053] The structures of the primers and probes can be appropriately designed according to the structure of the nucleic acid to be detected. The RT-PCR reagents or PCR reagents may be prepared using commercially available kits. Known examples of such kits include PrimeScript™ RT Master Mix (Takara Bio Inc.), SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (Thermo Fisher), and ReverTra Ace qPCR RT Master Mix (Toyobo).

[0054] In order to avoid the influence of residual nuclease activity, etc., the sample after step b) is preferably mixed with a nucleic acid detection reagent as soon as possible and subjected to the detection step.

[0055] After step c), it is preferable to preset the EDTA concentrations of the pretreatment reagent and the detection reagent so that the final EDTA concentration in the sample to be subjected to the nucleic acid detection step is 0.001 to 10 mM, particularly 0.01 to 5 mM, and even more preferably 0.1 to 1 mM. The final EDTA concentration may be, for example, 0.02 mM or more, 0.03 mM or more, 0.04 mM or more, 0.05 mM or more, 0.06 mM or more, 0.07 mM or more, 0.08 mM or more, 0.09 mM or more, 0.10 mM or more, 0.11 mM or more, 0.12 mM or more, 0.13 mM or more, 0.14 mM or more, 0.15 mM or more, 0.16 mM or more, 0.17 mM or more, 0. It can be 18 mM or more, 0.19 mM or more, 0.20 mM or more, 0.21 mM or more, 0.22 mM or more, 0.23 mM or more, 0.24 mM or more, 0.25 mM or more, 0.30 mM or more, 0.35 mM or more, 0.40 mM or more, 0.45 mM or more, 0.50 mM or more, 0.60 mM or more, 0.70 mM or more, 0.80 mM or more, or 0.90 mM or more. In addition, the final concentration of EDTA is, for example, 4.9mM or less, 4.8mM or less, 4.7mM or less, 4.6mM or less, 4.5mM or less, 4.4mM or less, 4.3mM or less, 4.2mM or less, 4.1mM or less, 4.0mM or less. , 3.9mM or less, 3.8mM or less, 3.7mM or less, 3.6mM or less, 3.5mM or less, 3.4mM or less, 3.3mM or less, 3.2mM or less, 3.1mM or less, 3.0mM or less, 2.9mM or less, 2.8mM or less, The concentration can be 2.7 mM or less, 2.6 mM or less, 2.5 mM or less, 2.4 mM or less, 2.3 mM or less, 2.2 mM or less, 2.1 mM or less, 2.0 mM or less, 1.9 mM or less, 1.8 mM or less, 1.7 mM or less, 1.6 mM or less, 1.5 mM or less, 1.4 mM or less, 1.3 mM or less, 1.2 mM or less, 1.1 mM or less, 1.0 mM or less, 0.9 mM or less, 0.8 mM or less, 0.7 mM or less, 0.6 mM or less, or 0.5 mM or less. By using the above concentrations, the influence of reaction inhibition by EDTA can be avoided as it is, or, as described below, reaction inhibition can be avoided by allowing a divalent metal salt to coexist.

[0056] If the final concentration of EDTA is 1 mM or higher, a chelate complex will be formed with an equivalent amount of divalent metal ions in the RT-PCR reagent or PCR reagent, which may result in a risk of reduced DNA polymerase activity. In this case, it is preferable to add 0.5 to 2.0 equivalents, particularly 0.75 to 1.25 equivalents of a divalent metal salt to EDTA prior to step d).

[0057] 4-5 Step d) Nucleic acid detection step Step d) of this embodiment is a step of detecting nucleic acids in the sample after step c). The method of nucleic acid detection is not particularly limited, but it is preferable to use a nucleic acid amplification method. As the nucleic acid amplification method, RT-PCR can be suitably used when the nucleic acid to be detected is RNA, and PCR can be suitably used when the nucleic acid is DNA. More suitably, real-time RT-PCR and real-time PCR can be used. Reagents that can be used for real-time RT-PCR and real-time PCR are as described in the section "4-4 Step c) Mixing step of nucleic acid detection reagents."

[0058] When performing real-time RT-PCR, the detection process is divided into a reverse transcription process and an amplification / detection process. The reverse transcription process is a process of generating complementary strand DNA (cDNA) from template RNA, and the amplification / detection process is a process of detecting a signal emitted by amplifying the cDNA. The reactions and signal detection in the above processes can be carried out using, for example, the CronoSTAR® 96 Real-Time PCR System (Takara Bio Inc.).

[0059] Step d) is preferably started as soon as possible after step b), and the time between step b) and the start of step d) is preferably within 4 hours, particularly preferably within 30 minutes.

[0060] According to the method of this embodiment, it is possible to detect a target nucleic acid in a sample simply and accurately. [Example]

[0061] [Comparative Example 1] Detection of Pepper mild mottle virus (PMMoV) in treated wastewater Sewage (treated water) that had been filtered through a microfiltration membrane (MF) was placed in a polypropylene centrifuge tube, and 20 μL of the filtrate was mixed with 20 μL of lysis buffer containing 10 mM Tris-HCl (pH 8.0).

[0062] The centrifuge tubes were placed in a 140°C heat block and heated for 15, 25, 35, or 45 seconds. A control sample was also prepared without heat treatment. After heating, the tubes were cooled to room temperature and centrifuged at 10,000 × g for 1 minute. The supernatant was left at room temperature for 3, 30, 4, or 24 hours, then diluted 10-fold with DNase / RNase-free water. A 10 μL aliquot was added and mixed with 10 μL of cDNA Reverse Transcription Kit (ThermoFisher, product number 4368813), and reverse transcription was performed at 37°C for 60 minutes.

[0063] 5 μL of the reverse transcription product was used to perform quantitative PCR (TaqMan PCR) using TaqPath® qPCR (ThermoFisher, No. A15297) and the following primers and probes to form a 25 μL system using the Thermal Cycler Dice Real Time System (Takara Bio), and the output value Ct was calculated. The PCR temperature conditions were as shown in Table 1. Forward primer: GAGTGGTTTGACCTTAACGTTTGA (SEQ ID NO: 1) Reverse primer: TTGTCGGTTGCAATGCAAGT (SEQ ID NO: 2) Probe: FAM-CCTACCGAAGCAAATG-MGB-NFQ (SEQ ID NO: 3)

[0064] [Table 1]

[0065] Reverse transcription and quantitative PCR were performed under similar conditions using a standard solution containing a known amount of PMMoV virus, and the virus quantitative value per 1 μL and 5 μL was calculated by comparing the Ct with the Ct of the sample.

[0066] Figure 1 shows the virus quantification values ​​(per 1 μL) in samples at each heat treatment time. It was shown that the longer the heat treatment time (beyond 15 seconds), the lower the quantification value. Figure 2 shows the relationship between the time allowed to stand before the reverse transcription reaction after 15 seconds of heat treatment and the PMMoV quantification value (per 5 μL). It also shows the quantification value of a sample that was not heat treated as a control. PMMoV could not be detected in the sample that was not heat treated. While PMMoV detection was possible by heat treatment, it was found that the longer the standing time after heat treatment, the lower the PMMoV quantification value. This was presumed to be due to the effect of nucleases contained in the sewage.

[0067] [Comparative Example 2] Detection of purified PMMoV N. benthamiana was inoculated with a virus solution containing PMMoV, and leaves that had developed mosaics were collected. After freezing at -80°C, the infected leaves were thoroughly crushed in a phosphate buffer solution (pH 7.2) ten times the weight of the infected leaves. After crushing, the leaves were filtered through 5 μm and 0.45 μm filters, and the filtrate was placed in a 1.5 mL Eppendorf® tube. This was then diluted 10-fold with lysis buffer containing 10 mM Tris-HCl (pH 8.0).

[0068] The centrifuge tube was placed in a 140°C heat block and heated for 15, 25, 35, or 45 seconds. After heating, the tube was cooled to room temperature and centrifuged at 10,000 × g for 1 minute. The supernatant was immediately diluted 10-fold with DNase / RNase-free water. 10 μL of the solution was added to and mixed with 10 μL of cDNA Reverse Transcription Kit (ThermoFisher, model number 4368813), and reverse transcription was performed at 37°C for 60 minutes. Five μL of the reverse transcription product was subjected to PCR under the same conditions as in Comparative Example 1.

[0069] Figure 3 shows the virus quantitative values ​​( / 1 μL) quantified in samples for each heat treatment time. When purified virus was used as the sample, no significant changes in the quantitative values ​​were observed due to differences in heat treatment time. This is presumably because purified virus samples, unlike sewage, are less susceptible to the effects of nucleases and other enzymes.

[0070] [Example 1] Detection of PMMoV in treated wastewater in the presence of EDTA The sewage after MF filtration was transferred to a polypropylene centrifuge tube, and 20 μL of the tube was mixed with 20 μL of a lysis buffer containing 10 mM Tris-HCl (pH 8.0) and 5 mM EDTA.

[0071] The centrifuge tube was placed in a heat block at 140°C and heated for 15 seconds. For comparison, a sample not subjected to heat treatment was also prepared. After heating, the tube was cooled to room temperature and centrifuged at 10,000 × g for 1 minute. The supernatant was left to stand at room temperature or 4°C for 3 minutes, 30 minutes, 4 hours, or 24 hours, and then diluted 10-fold with DNase / RNase-free water. A 10 μL aliquot was added and mixed with 10 μL of cDNA Reverse Transcription Kit (ThermoFisher, model number 4368813), and reverse transcription was performed at 37°C for 60 minutes. Five μL of the reverse transcription product was subjected to PCR under the same conditions as in Comparative Example 1.

[0072] Figure 4 shows the relationship between the time to reverse transcription after heat treatment and the quantitative PMMoV value ( / 5 μL) for samples heated with EDTA and left at room temperature, and for samples heated without EDTA and left at room temperature and 4°C. Without EDTA, the quantitative PMMoV value for samples left at room temperature was significantly lower after 30 minutes and 4 hours compared to samples left at 4°C. With EDTA, however, quantitative values ​​were not significantly different from those left at 4°C up to 30 minutes after room temperature. Furthermore, even after 4 hours, quantitative values ​​were higher than those left without EDTA. This indicates that the addition of EDTA increases the stability of the samples.

[0073] [Example 2] Comparison of PMMoV detection results in treated wastewater depending on heat treatment conditions The three types of sewage water (samples A to C) after filtration were suspended in 20 μL of lysis buffer containing 10 mM Tris-HCl (pH 8.0) and 5 mM EDTA in a polypropylene centrifuge tube.

[0074] The centrifuge tube was placed in a 140°C heat block for 15 seconds or in a 95°C heat block for 5 minutes. After heating, the tube was cooled to room temperature and centrifuged at 10,000 x g for 1 minute. The supernatant was left to stand at room temperature for 30 minutes, after which 10 μL of cDNA Reverse Transcription Kit (ThermoFisher, model number 4368813) was added and mixed, and a reverse transcription reaction was carried out at 37°C for 60 minutes. 5 μL of the reverse transcription product was subjected to a PCR reaction under the same conditions as in Comparative Example 1.

[0075] Figure 5 shows the quantitative values ​​of PMMoV (per 5 μL) under each heating condition for samples A to C. In all cases, high quantitative values ​​were obtained after treatment at 140°C for 15 seconds. This indicates that sample treatment in a short time is possible by using a high temperature of 140°C.

[0076] [Example 3] PCR reaction under various EDTA and divalent metal ion concentrations Genomic DNA extracted from Bacillus subtilis (obtained from NBRC, No. 3134) using a QIAamp DNA Kit (QIAGEN, 56304) was dissolved in DNase / RNase-free water to a concentration of 100 pg / μL to prepare a DNA solution. The above genomic DNA was dispensed at 200 pg / tube using TB Green premix Ex Taq II (Takara Bio, No. RR820S), and EDTA and FeSO4 were added to the concentrations shown in Table 3. The following primers and probes were added to a 20 μL system, and quantitative PCR was performed using a Thermal Cycler Dice Real Time System (Takara Bio). The PCR temperature conditions were as shown in Table 2. Forward primer: TCAACTAGTTCAGTATGGACGAC (SEQ ID NO: 4) Reverse primer: CCTCATCAAGAAACCACTGA (SEQ ID NO: 5)

[0077] [Table 2]

[0078] Table 3 shows the Ct values ​​under each condition. When the final EDTA concentration was 0 to 0.33 mM, nucleic acid amplification was possible without adding FeSO4. On the other hand, when the FeSO4 concentration exceeded 1.0 mM, nucleic acid amplification was not observed. When the final EDTA concentration was 1 mM, nucleic acid amplification was observed at a lower Ct value by adding 0.33 to 1 mM FeSO4. When the final EDTA concentration was 3.3 mM, nucleic acid amplification was possible by adding 1.0 to 3.3 mM FeSO4. When the final EDTA concentration was 10 mM, nucleic acid amplification was not observed even with the addition of FeSO4.

[0079] [Table 3]

[0080] As mentioned above, low concentrations of EDTA do not affect nucleic acid amplification, but high concentrations of EDTA result in insufficient nucleic acid amplification. However, it was shown that the negative effects of EDTA can be reversed by adding an appropriate concentration of divalent metal ions after heat treatment and before nucleic acid amplification.

Claims

1. A method for pretreating a sample to be subjected to nucleic acid detection, comprising: i) mixing the sample with a pretreatment reagent containing ethylenediaminetetraacetic acid (EDTA); and ii) a step of heating the sample mixed in i) by a heating means at 90°C or higher; A method comprising:

2. The method of claim 1 , wherein the sample is an environmental water sample.

3. The method of claim 1 , wherein the nucleic acid is a viral nucleic acid.

4. The method of claim 1, further comprising a step of concentrating nucleic acids in the sample prior to step i).

5. 2. The method of claim 1, wherein the concentration of EDTA in the sample mixed in step i) is 0.01 to 20 mM.

6. The method according to claim 5, wherein the concentration of EDTA in the sample mixed in step i) is 0.1 to 10 mM.

7. 2. The method of claim 1, wherein the heat treatment time in step ii) is less than 120 seconds.

8. The method according to claim 1, wherein the temperature of the heating means in step ii) is 105°C or higher and 160°C or lower.

9. 1. A method for detecting a nucleic acid in a sample, comprising: a) mixing a sample to be subjected to nucleic acid detection with a pretreatment reagent containing EDTA; b) heating the sample after step a) by a heating means at 90°C or higher; c) mixing the sample after step b) with a nucleic acid detection reagent; and d) detecting nucleic acids in the sample after step c); A method comprising:

10. The method according to claim 9, wherein the nucleic acid detection reagent is a reagent for reverse transcription polymerase chain reaction (RT-PCR).

11. 10. The method of claim 9, wherein step d) is initiated after step b) for less than 4 hours.

12. 10. The method according to claim 9, wherein in step c), the EDTA concentration in the sample after mixing is 0.001 to 10 mM.

13. A reagent for pretreatment of environmental water samples to be subjected to viral nucleic acid detection, comprising EDTA at a concentration of 0.1 to 10 mM and a pH buffer.

Images