Methods and compositions for treating skeletal muscular dystrophy

JP2025157552A5Pending Publication Date: 2025-12-24CEDARS SINAI MEDICAL CENT +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025125726
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2018-01-08
Filing Date
2025-07-28
Publication Date
2025-12-24

AI Technical Summary

Technical Problem

Current treatments for Duchenne muscular dystrophy, such as corticosteroids and cardioprotective agents, do not address the underlying genetic abnormality in dystrophin deficiency, leading to progressive muscle and cardiac damage, with no effective options for late-stage heart failure beyond symptomatic management.

Method used

Administration of cardiosphere-derived cells (CDCs) and/or CDC-derived exosomes (CDC-XO) to patients, either alone or in combination, to treat dystrophinopathies by delaying muscle dysfunction and restoring muscle function and integrity.

Benefits of technology

The treatment effectively delays the onset of muscle dysfunction, improves muscle function, and reduces fibrosis and inflammation, increasing dystrophin expression and mitochondrial function in skeletal muscles.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

To provide a novel method for treating dystrophinopathy and / or a disease condition associated therewith.SOLUTION: A composition for use in treating dystrophinopathy and / or a disease condition associated therewith, the composition comprising cardiosphere-derived cells (CDCs) and / or CDC-derived exosomes.SELECTED DRAWING: Figure 4A
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to U.S. Provisional Application Nos. 62 / 487393, filed April 19, 2017, 62 / 487402, filed April 19, 2017, and 62 / 487408, filed April 19, 2017, and U.S. Provisional Application No. 62 / 535672, filed July 21, 2017. This application also claims priority to U.S. Provisional Application Nos. 62 / 569,440, filed October 6, 2017, and 62 / 614,753, filed January 8, 2018. All of the prior applications are incorporated herein by reference in their entireties. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0003] This invention was made with government support under Grant No. HL124074 awarded by the National Institutes of Health. The government has certain rights in this invention. Technical Field

[0004] Some embodiments relate to the use of cardiosphere-derived cells and extracellular vesicles (e.g., exosomes) derived therefrom, as well as isolated molecular cargos thereof (e.g., nucleic acids, short non-coding RNAs, microRNAs, and / or variants and synthetic analogs thereof), for the treatment of dystrophinopathies (muscular dystrophy, Duchenne muscular dystrophy, and Becker muscular dystrophy) and symptoms or disease states associated therewith, including skeletal myopathy associated with Duchenne muscular dystrophy. [Background technology]

[0005] Approximately 20,000 boys and young adults in the United States suffer from Duchenne muscular dystrophy (DMD). Its primary cause is a genetic abnormality in the dystrophin complex, resulting in secondary damage to skeletal muscle and cardiac tissue. Dystrophin is a large, rod-shaped sarcolemmal protein that provides a physical link between the cytoskeleton and the extracellular matrix. Dystrophin deficiency renders the sarcolemma unstable, leaving muscle fibers vulnerable to mechanical damage from repeated contractions. There is no specific treatment for this devastating X-linked sarcopenia. It affects one in every 3,500 male births, and DMD accounts for 80% of all cases of muscular dystrophy. Dystrophic muscle develops through myopathy (damage to the cell membranes in muscle fibers), leading to loss of walking at a very young age and later respiratory muscle weakness and heart failure. In pediatric subjects, skeletal muscle weakness begins 3–5 years after onset, leading to progressive weakness and wheelchair dependency at approximately 13 years after onset. Importantly, cardiomyopathy has been observed to occur in one-third of patients within 13 years of onset, increasing to one-half within 18 years of onset, and occurring in all patients after 18 years. Heart failure due to and / or secondary to DMD, particularly in the late stages (HF-DMD), represents a significant and exclusive disease, and cell, tissue, cardiac, or mechanical transplantation is not an option for late-stage heart failure beyond symptomatic or advanced heart failure (HF). Patients may also suffer from vascular insufficiency and smooth muscle myopathy, including involvement of the gastrointestinal and urinary systems. The common outcome is respiratory insufficiency or death due to cardiomyopathy.

[0006] These clinical features are due to dystrophin gene mutations (deletions), and loss of dystrophin leads to cell membrane damage and extracellular Ca 2+This condition results in the leakage of calcium into the cells. Elevated intracellular calcium levels ultimately lead to increased oxidative and / or nitrosative stress and inflammation, as well as activation of calpains. The combination of these effects leads to muscle proteolysis and apoptosis, leading to the degenerative characteristics described above. Current treatments are limited to the use of corticosteroids and cardioprotective agents that mitigate the effects of the disease but do not treat the disease itself or slow its progression. Therefore, there remains a great need in the art for treatments, including for pediatric patients, where early intervention could prevent the emergence of later comorbidities. Summary of the Invention

[0007] Described herein are methods for treating dystrophinopathy and / or one or more disease states associated therewith by administering a therapeutically effective amount of cardiosphere-derived cells (CDCs), CDC-derived exosomes (CDCs-XO), and / or a combination thereof to a patient suffering from a dystrophinopathy and / or a disease state associated therewith. In some embodiments, the dystrophinopathy is one or more of Duchenne muscular dystrophy (DMD) and / or Becker muscular dystrophy. In some embodiments, the disease state being treated is a skeletal myopathy (e.g., skeletal DMD or skeletal Becker muscular dystrophy). In some embodiments, administration of CDCs and / or CDC-XO delays the onset of muscle dysfunction (including in skeletal muscle dysfunction) and / or maintains, improves, and / or restores muscle function and integrity (including in skeletal muscle) in a subject with a dystrophinopathy. In some embodiments, the dystrophic skeletal muscles of the patient being treated include one or more of the diaphragm, limb muscles (eg, in the arms and / or legs), and / or trunk muscles.

[0008] For brevity, some embodiments are specifically disclosed with respect to CDC-XO and CDC. However, it should be understood that one or more of the treatments disclosed herein can be achieved with CDC-derived extracellular vesicles (referred to herein as CDC-EVs, which may include CDC-derived microvesicles (CDC-MVs)), isolated molecular cargo of CDC-XO or CDC-EV, and combinations thereof. Thus, in some embodiments, the treatment methods described herein can be performed using one or more of CDC-XO, CDC, CDC-EV, isolated and / or purified molecular cargo of CDC-XO, isolated and / or purified molecular cargo of CDC-EV, and / or combinations thereof.

[0009] In some embodiments, a method of treatment involves administering to a subject (e.g., a patient suffering from a dystrophinopathy or an associated condition) a therapeutically effective amount of CDC, CDC-XO, and / or CDC-EV. In some embodiments, the CDC, CDC-XO, and / or CDC-EV is autologous or allogeneic to the subject (e.g., derived from the subject's own tissue, tissue from another subject, and / or tissue from another animal species). In some embodiments, a method of treatment involves administering to a subject a therapeutically effective amount of molecular cargo derived from CDC-XO and / or CDC-EV (including CDC-derived microvesicles (CDC-MVs)). In some embodiments, the molecular cargo of CDC-XO or CDC-EV is isolated and / or synthesized, and the molecular cargo (e.g., specific molecules and / or combinations of various molecules, including RNA polynucleotides and / or short non-coding RNAs) is administered to a subject in need thereof (e.g., a subject with a dystrophinopathy and / or a disease state thereof). In some embodiments, the method of treatment comprises administering to a subject a therapeutically effective amount of an isolated RNA polynucleotide or a vector encoding (and / or comprising) an RNA polynucleotide found in CDC-XO and / or CDC-EV.

[0010] In some embodiments, CDC, CDC-EV, and / or CDC-XO are delivered systemically to a subject. In some embodiments, CDC, CDC-EV, and / or CDC-XO are delivered systemically or locally to a subject. In some embodiments, CDC, CDC-EV, and / or CDC-XO are delivered systemically but not locally to a subject. In some embodiments, CDC, CDC-EV, and / or CDC-XO are delivered systemically and systemically locally to a subject. In some embodiments, CDC, CDC-EV, and / or CDC-XO are delivered locally but not systemically to a subject. In some embodiments, non-limiting examples of methods for administering a therapeutically effective amount of CDC, CDC-EV, and / or CDC-XO include systemic administration (e.g., intravenous, intra-arterial, intraventricular, intra-aortic, and / or intraperitoneal injection and / or infusion). In some embodiments, CDC, CDC-EV, and / or CDC-XO are injected or infused intravenously. In some embodiments, a therapeutically effective amount of CDC, CDC-EV, and / or CDC-XO is administered to a patient by intramuscular injection and / or infusion. In some embodiments, a therapeutically effective amount of CDC, CDC-EV, and / or CDC-XO is administered to a patient by direct injection at a local site (e.g., into or near the dystrophic skeletal muscle and / or target site where treatment is desired). In some embodiments, an effective amount of CDC, CDC-EV, and / or CDC-XO is delivered systemically by injection and / or infusion in a region of the body other than within the heart. In some embodiments, intravenous administration of CDC, CDC-EV, and / or CDC-XO includes injection and / or infusion into the jugular and / or femoral veins.

[0011] In some embodiments, administration of CDC, CDC-EV, and / or CDC-XO to a subject in need thereof comprises a single dose and / or multiple doses (e.g., two, four, six, eight, ten or more doses). In some embodiments, when multiple doses are used, administration of CDC, CDC-EV, and / or CDC-XO is daily, weekly, every two weeks, every three weeks, monthly, every six months, or yearly. In some embodiments, the dosing schedule is, for example, two weeks, one month, two months, three months, five months, six months, one year, five years, or a range of periods including and / or spanning the above values. Illustratively, in some embodiments, the time intervals include administration of two to ten doses spaced one to five months apart. In some embodiments, the dosing schedule is three doses with approximately three months between each dose. In some embodiments, the dosing schedule is five doses with approximately one week between each dose. In some embodiments, the dosing schedule is three administrations at weeks 0, 6, and 9 (e.g., three single doses at different times). In some embodiments, an interval schedule is used, with periods of dosing and periods of rest between the dosing periods (e.g., one month of weekly dosing followed by a five-month rest period, followed by one month of weekly dosing, etc.). In some embodiments, a single dose comprises a therapeutically effective amount of CDC, CDC-XO, and / or CDC-EV. In some embodiments, the dosing periods and / or interval schedule are administered throughout the patient's lifetime. In some embodiments, multiple administrations of each single dose are provided to the subject. In various embodiments, as disclosed elsewhere herein, administration may be repeated, such as two, three, four, or more sequentially applied doses.

[0012] In some embodiments, the therapeutically effective amount of CDC is at least about 75×10 6 pieces~500×10 6 In some embodiments, the therapeutically effective amount of CDCs is about: 75 x 10 6 CDCs over 150 x 10 6 CDCs over 300 x 10 6 CDCs over 400 x 10 6 CDCs over 500 x 106 In some embodiments, a therapeutically effective amount of CDC is about: 75×10 or more CDCs, or a range including and / or spanning the values ​​recited above. 6 CDCs below 150 x 10 6 CDCs below 300 x 10 6 CDCs below 400 x 10 6 CDCs below 500 x 10 6 CDCs or less, or ranges including and / or spanning the values ​​set forth above.

[0013] In some embodiments, the number of CDC-EV or CDC-XO administered in each dose (if single or multiple doses are used) and / or over the course of a treatment regimen is at least about equal to: 1 x 10 6 pieces, 1×10 7 pieces, 1×10 8 pieces, 1×10 9 pieces, 1×10 10 pieces, 1×10 11 pieces, 1×10 12 In some embodiments, the amount of CDC-EV or CDC-XO administered in each dose (if single or multiple doses are used) and / or over the course of a treatment regimen is 1 x 10 or more. 6 ~1×10 7 , 1×10 7 ~1×10 8 , 1×10 8 ~1×10 9 , 1×10 9 ~1×10 10 , 1×10 10 ~1×10 11 , 1×10 11 ~1×10 12 , 1×10 12 The above range.

[0014] In some embodiments, the number of CDC-XOs (or CDC-EVs) delivered to a subject in a given dose (or dosing regimen) is determined based on the number of CDCs that can be used in a clinically effective amount in a cell therapy method. For example, in some embodiments, 75×10 6pieces~500×10 6 If a CDC is an effective amount for the therapeutic treatment of skeletal myopathy, then using an equivalent amount of CDC-XO or CDC-MV that can be released by those CDCs in vivo can be administered to patients in a "cell-free" therapy. In other words, a CDC equivalent amount of CDC-XO and / or CDC-MV can be used. Illustratively, in some embodiments, 3 mL / 3 x 10 8 CDCs can provide a therapeutic benefit. Therefore, multiple CDC-XOs are used that can be derived from that number of CDCs over time as those CDCs remain in the body. In some embodiments, the amount of CDC-XO or CDC-EV delivered to a patient is equal to or at least about 75 x 10 6 CDCs, approximately 150 x 10 6 CDCs, approximately 300 x 10 6 CDCs, approximately 400 x 10 6 CDCs, approximately 500 x 10 6 CDCs, or the amount of CDC-XO or CDC-EV that can be released via injection in a range including and / or spanning the values ​​set forth above. In some embodiments, the number of CDCs administered in any single dose is 1 x 10 5 pieces, 1×10 6 pieces, 1×10 7 pieces, 1×10 8 pieces, 1×10 9 pieces, 1×10 10 pieces, 1×10 11 pieces, 1×10 12 In some embodiments, the amount of CDC-XO or CDC-EV delivered to a patient is at least about equal to: 1 x 10 5 CDCs, approximately 1 x 10 6 CDCs, approximately 1 x 10 7 CDCs, approximately 1 x 10 8 CDCs, approximately 1 x 10 9 CDCs, approximately 1 x 10 10 CDCs, approximately 1 x 10 11 CDCs, approximately 1 x 10 12CDCs, or amounts of CDC-XO or CDC-EV that can be released via injection ranging from and / or including the values ​​recited above. In some embodiments, the dose of CDCs ranges from about 10 to about 90 million, about 10 to about 20 million, about 20 to about 30 million, about 30 to about 50 million, about 50 to about 60 million, about 60 to about 70 million, about 70 to about 75 million, about 75 to about 80 million, about 80 to about 90 million, and ranges including and / or including the values ​​recited above. Some such doses are particularly advantageous for delivery via the coronary arteries. In some embodiments, the dose of CDCs ranges from about 30 million to about 45 million, about 40 million to about 50 million, about 50 million to about 50 million, about 60 to about 75 million, about 75 to about 1 billion, about 90 million to about 1.1 billion, about 1 billion to 1.25 billion, about 1.25 billion to about 1.5 billion, and ranges including and / or ranging from the above values. Without being bound by theory, it is believed that when injected, CDCs remain transiently in the subject. Depending on the embodiment, the extent of CDC retention varies. For example, in some embodiments, retention rates are about 0.01% to about 0.05%, about 0.05% to about 0.1%, about 0.1% to about 0.5%, about 0.5% to about 1.0%, about 1.0% to about 2.5%, about 2.5% to about 5%, about 5% to about 10%, and ranges inclusive and / or spanning the aforementioned values. Thus, in some embodiments, the equivalent amount of CDC-XO or CDC-EV delivered to a patient is calculated as the amount of CDC-XO or CDC-EV that can be released by administration (e.g., injection or infusion) of the disclosed amount of CDC over a given time period in which the CDC resides in the body for about one week, about two weeks, about three weeks, or more. In certain examples, dosages can be assigned to body weight (total CDC doses ranging from 100,000 M to 1 M CDC / kg body weight). In some embodiments, for cardiac injection, the number of CDCs administered includes 25 million CDCs per coronary artery (i.e., 75 million CDCs total) as an alternative baseline for XO or EV dosing.

[0015] In some embodiments, the amount (e.g., dose) of CDC, CDC-XO, and / or CDC-EV delivered to a patient can be measured by the weight (in mg) of CDC, CDC-XO, and / or CDC-EV (e.g., when the solution and / or environment surrounding the CDC, CDC-XO, and / or CDC-EV has been removed or substantially removed). For example, in some embodiments, the dose of CDC, CDC-XO, and / or CDC-EV can be equal to or at least about the following: about 0.001 to about 0.005, about 0.005 to about 0.01, about 0.01 to about 0.05, about 0.05 to about 0.1, about 0.1 to about 0.5, about 0.5 to about 1, about 1 to about 10, about 10 to about 25, about 25 to about 50, about 50 to about 75, or about 75 to about 100 mg, or ranges including and / or spanning the values ​​recited above. As discussed in more detail herein, these masses represent the number of CDCs, CDC-XOs, and / or CDC-EVs administered to a subject depending on the embodiment. For example, in some embodiments, the number of CDCs in a dose is about 5×10 4 pieces~approx. 1×10 5 pieces, about 1×10 5 pieces ~ approx. 2.5×10 5 pieces, approximately 2.5×10 5 pieces~approx. 1×10 6 pieces, about 1×10 6 pieces~approx. 1×10 7 pieces, about 1×10 7 pieces~approx. 1×10 8 pieces, about 1×10 8 pieces~approx. 1×10 9 pieces, about 1×10 9 pieces ~ approx. 2×10 9 pieces, approximately 2×10 9 pieces~approx. 5×10 9 about 5 x 10, including ranges including and / or ranging from the above values. 4 pieces ~ approx. 2×10 9 Similarly, depending on the embodiment, the number of exosomes or particles (e.g., vesicles) administered to a subject may range from about 1 x 10 9 pieces ~ approx. 2×10 9 pieces, approximately 2×10 9 pieces~approx. 4×10 9 pieces, about 4×10 9 pieces~approx. 1×1010 pieces, about 1×10 10 pieces~approx. 1×10 11 pieces, about 1×10 11 pieces~approx. 1×10 12 pieces, about 1×10 12 pieces ~ approx. 2×10 12 pieces, approximately 2×10 12 pieces ~ approx. 2×10 13 pieces, approximately 2×10 13 pieces~approx. 1×10 14 pieces, about 1×10 14 pieces ~ approx. 2×10 14 about 1 x 10, including ranges including and / or ranging from the above values. 9 pieces ~ approx. 2×10 14 In some embodiments, the amount of CDC, CDC-XO, and / or CDC-EV delivered to a patient may be measured by protein weight (in mg) and / or by total cell or vesicle weight (e.g., when water is removed from the outer compartment of the cell or vesicle). In some embodiments, the amount of CDC, CDC-XO, and / or CDC-EV delivered to a patient is equal to 1 mg to 10 mg, 10 mg to 25 mg, 25 mg to 50 mg, 50 mg to 75 mg, 75 mg to 100 mg, or 100 mg or more of protein. In some embodiments, administration of a therapeutically effective amount of the composition comprises about 1 mg to about 100 mg of XO and / or EV protein in a single dose.

[0016] In some embodiments, a formulation or composition comprising CDC, CDC-EV, and / or CDC-XO is provided. In some embodiments, the formulation and / or composition comprises a pharmaceutically acceptable carrier. In some embodiments, the carrier is water at physiological pH and / or isotonic. In some embodiments, the formulation or composition is used to treat a dystrophinopathy (e.g., skeletal muscular dystrophy, dystrophic cardiomyopathy, etc.) according to the methods described above. In some embodiments, the formulation or composition is used to effectively and / or safely treat a dystrophinopathy in a subject in need thereof, wherein a therapeutically effective amount of the formulation and / or composition comprising CDC, CDC-EV, and / or CDC-XO is delivered to the targeted dystrophic skeletal muscle.

[0017] In some embodiments, the methods of treatment are for a subject (e.g., a patient) suffering from a myopathy, as disclosed elsewhere herein. In some embodiments, the muscle myopathy includes one or more of cell membrane degeneration, interstitial inflammation, fatty replacement, and fibrosis, one or more of which are treated and / or substantially alleviated during the treatment disclosed herein.

[0018] In some embodiments, the treatment is directed to a subject (e.g., a patient) suffering from cardiomyopathy, as disclosed elsewhere herein. In some embodiments, the subject suffers from cardiomyopathy rather than heart failure. In some embodiments, the subject is diagnosed with cardiomyopathy. In some embodiments, the subject is diagnosed with cardiomyopathy rather than heart failure. In some embodiments, the cardiomyopathy includes one or more of the following: left ventricular basal posterobasal fibrosis, intra-atrial conduction abnormalities including SVT with abnormal AV nodal conduction, one or more of which are treated and / or substantially alleviated by the treatments disclosed herein. In various embodiments, the cardiomyopathy includes advanced ventricular enlargement, dyspnea, peripheral edema, and hepatomegaly, one or more of which are treated and / or substantially alleviated by the treatments disclosed herein. In various embodiments, heart failure (HF) includes asymptomatic abnormalities (Stage B) in which cardiac structure and function are compromised, overt HF (Stage C), and advanced HF (Stage D), any one or more of which may be treated and / or substantially alleviated by the treatments disclosed herein.

[0019] In various embodiments, the subject is afflicted with a smooth muscle myopathy, including skeletal muscle myopathy, vascular dysfunction, further including GI and urinary tract complications. In some embodiments, one or more of these disease states are treated and / or substantially alleviated by the methods disclosed herein. In some embodiments, the myopathy includes one or more of cell membrane degeneration, interstitial inflammation, fatty replacement, and fibrosis, one or more of which are treated and / or substantially alleviated by the treatments disclosed herein.

[0020] In some embodiments, treating the subject further includes assessing functional improvement in the subject, including functional improvement in skeletal muscle tissue. In some embodiments, the methods disclosed herein result in functional improvement in muscle tissue. In some embodiments, the methods disclosed herein result in functional improvement, for example, in voluntary muscle contraction. In some embodiments, functional improvement includes one or more of increased contractile force, improved walking ability, improved ability to stand from a sitting position, improved ability to sit from a lying or supine position, and improved manual dexterity, such as mouse pointing and / or clicking. In some embodiments, treating the subject further includes assessing cognition in response to treatment of nerve injury, blood oxygenation in response to treatment of lung injury, and immune function in response to treatment of damaged immunologically related tissue.

[0021] In some embodiments, the subject in need of treatment for a dystrophinopathy is a human subject. In some embodiments, the human subject is about: 3 years of age or younger, 8 years of age or younger, 11 years of age or younger, 12 years of age or younger, 15 years of age or younger, 18 years of age or younger, or ranges including and / or spanning the above values. In some embodiments, the human subject is a pediatric subject, for example, between about 3 and 11 years of age, or between about 12 and 18 years of age. In some embodiments, the subject is classified by one or more characteristics described above, such as one of the listed age groups, and / or suffers from and / or has been diagnosed with one or more disease conditions described above (e.g., myopathy, cardiomyopathy, and / or heart failure). In some embodiments, the patient suffers from one or more disease conditions disclosed above, but does not suffer from other diseases. For example, a subject between 3 and 11 years of age who suffers from and / or has been diagnosed with cardiomyopathy rather than heart failure. As another example, the subject may be between 8 and 15 years old and may suffer from a skeletal myopathy rather than a cardiomyopathy or heart failure.

[0022] In some embodiments, the injection may be intraarterial or intravenous, as disclosed elsewhere herein. Arteries and veins may include those in the legs, trunk (e.g., in or around the lungs), neck, etc. In some embodiments, the injection delivers a therapeutically effective dose of CDC-XO, CDC-EV, and / or CDC to one or more locations in the body (e.g., at the injection site or at a location distant from the injection site). In some embodiments, the injection delivers a therapeutically effective dosage of exosomes to smooth and skeletal muscle tissue. In some embodiments, administering a therapeutically effective amount of the composition comprises an injection. In some embodiments, the injection comprises an intramyocardial injection, an injection into the heart, including the heart cavities and ventricles, and their associated blood vessels. In some embodiments, injection into the heart, heart cavities and ventricles, and their associated blood vessels can deliver a therapeutically effective dosage of exosomes to smooth and skeletal muscle tissue. In some embodiments, the injection results in and / or is performed to achieve systemic delivery. In some embodiments, the injection delivers a therapeutic dose of CDC-XO, CDC-EV, and / or CDC to one or more targeted locations within the body (e.g., the injection site or locations that may be distant from the injection site). In some embodiments, the injection comprises a skeletal muscle injection. In some embodiments, the injection comprises an intraperitoneal injection. In some embodiments, the injection comprises a subcutaneous injection.

[0023] According to some embodiments, provided herein are methods for treating muscular dystrophy (e.g., dystrophinopathy) in a subject in need thereof, the method comprising administering a therapeutically effective amount of cardiosphere-derived cells (CDCs) to the subject. In some embodiments, also provided are methods for treating cardiomyopathy in a subject in need thereof, the method comprising administering a therapeutically effective amount of CDCs to the subject. In some embodiments, the cardiomyopathy is dystrophic cardiomyopathy, and according to some embodiments, the dystrophic cardiomyopathy is heart failure secondary to chronic muscular dystrophy. In some embodiments, the method uses exosomes derived from CDCs instead of or in addition to CDCs themselves. In some embodiments, provided are methods for treating dystrophinopathy, the method comprising administering a therapeutically effective amount of exosomes to a pediatric subject suffering from a dystrophinopathy, thereby treating the subject. In some embodiments, a plurality of exosomes are isolated from cardiosphere-derived cells (CDCs) grown in serum-free medium. In some embodiments, a method of treating dystrophic skeletal muscle is provided, comprising administering cardiosphere-derived cells (CDCs) and / or CDC-derived exosomes (CDC-XO) to a subject suffering from a dystrophinopathy, thereby treating the dystrophic skeletal muscle, wherein the CDCs and / or CDC-XO are administered to the subject at a non-cardiac site, the dystrophic skeletal muscle is targeted dystrophic skeletal muscle, and the targeted dystrophic skeletal muscle is administered a therapeutically effective amount of CDCs and / or CDC-XO. In one embodiment, a method of treating skeletal muscular dystrophy in a subject in need thereof is provided, the method comprising administering to the subject a first dose of a composition comprising a therapeutically effective amount of cardiosphere-derived cells (CDCs), wherein the therapeutically effective amount of the first dose is about 1 x 10 7 pieces~approx. 1×10 9 CDCs), waiting a first period of time after administration of the first dose, wherein the first period of time is about 1 month to 6 months, administering to the subject a second dose of a composition comprising a therapeutically effective amount of CDCs, wherein the therapeutically effective amount of the second dose is about 1 x 10 7 pieces~approx. 1×10 9CDCs), waiting a second period of time after administration of the second dose, wherein the second period of time is about 1 month to 6 months; administering to the subject at least one additional dose of a composition comprising a therapeutically effective amount of CDCs, wherein the therapeutically effective amount of the at least one additional dose is about 1 x 10 7 pieces~approx. 1×10 9 In some embodiments, the administration of at least one dose of CDC alters expression of one or more markers of T cell activation or proliferation, the markers comprising CD69 and / or HLA-DR.

[0024] In some embodiments, a therapeutically effective amount of CDC is sufficient to treat dystrophic skeletal muscle in a subject suffering from Duchenne muscular dystrophy (DMD) or Becker muscular dystrophy, each of which is associated with skeletal muscle dystrophinopathy. While any skeletal muscle may be affected, in some embodiments, the dystrophic skeletal muscle is skeletal muscle of the diaphragm, arm, or leg.

[0025] The route of administration can vary depending on the embodiment. For example, in some embodiments, CDCs are administered to a subject by intramuscular injection (e.g., local administration) in dystrophic skeletal muscle. In some embodiments, CDCs are administered to a subject systemically, where several routes are freely selected. For example, in some embodiments, systemic administration is by intravenous injection or infusion. In some embodiments, systemic administration is by injection into the right ventricle, while in further embodiments, systemic administration is by injection into the left ventricle.

[0026] In some embodiments, administration of CDCs is by a single dose, although in some embodiments, two or more doses are administered. In some embodiments, by multiple dosing, dosing is given at intervals of about 3 weeks to 3 months, e.g., 3 to 4 weeks, 4 to 5 weeks, 5 to 6 weeks, 6 to 8 weeks, 8 to 12 weeks, or any time therebetween, including the endpoint. In some embodiments, subsequent doses are given 6 weeks and 12 weeks after the first CDC dose is administered. Depending on the embodiment, the number and / or location of administration of CDCs may vary between repeated doses. Alternatively, a dosing regimen can use a constant number and location of CDCs throughout the regimen.

[0027] By way of example, the methods disclosed herein can be used to detect at least about 75×10 6 A dose of CDC (e.g., a therapeutically effective amount of CDC) can be employed. More specifically, in some embodiments, the dose is at least about 150×10 6 CDCs, at least about 300 x 10 6 CDCs, at least about 350 x 10 6 CDCs, at least about 400 x 10 6 CDCs, at least about 450 x 10 6 CDCs, at least approximately 500 x 10 6 CDCs, at least about 550 x 10 6 CDCs, at least about 600 x 10 6 In those embodiments utilizing exosomes, some embodiments include a dose of between about 1 mg and about 100 mg of exosome protein in a single dose.

[0028] In some embodiments, the CDCs or exosomes are allogeneic with respect to the subject to which the CDCs are administered.

[0029] In some embodiments, administration of CDCs or exosomes results in an increase in dystrophin expression (e.g., an increase relative to "normal" dystrophin expression, e.g., relative to a control population or an earlier time point in the disease). In some embodiments, the increase in dystrophin is detectable, for example, in skeletal muscle and / or diaphragm.

[0030] In some embodiments, the method further comprises administering (eg, administering separately or simultaneously) a steroid along with the CDC.

[0031] In some embodiments, the methods, uses, and compositions disclosed herein result in an improvement in muscle function or a reduction in muscle fibrosis or tissue damage. In some embodiments, the improvement is in skeletal muscle. In some embodiments, the improvement is in cardiac muscle.

[0032] Also provided herein are uses of compositions comprising CDCs and / or CDC exosomes, wherein the compositions are suitable for systemic administration to a subject with muscular dystrophy, and wherein administration of the composition treats the muscular dystrophy (e.g., treats skeletal muscle).

[0033] In some embodiments, compositions are further provided comprising an isolated RNA polynucleotide derived from CDC, CDC-XO, or CDC-derived extracellular vesicles (CDC-EVs), or a vector encoding the RNA polynucleotide, wherein the RNA polynucleotide comprises a short non-coding RNA. In some embodiments, the RNA polynucleotide sequence comprises at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to a short non-coding RNA derived from DMD (srDMD). In some embodiments, the short non-coding RNA comprises srDMD. In some embodiments, the short non-coding RNA comprises a microRNA. Depending on the embodiment, the microRNA may comprise a GCG residue at the 5' or 3' end. In some embodiments, the RNA polynucleotide comprises at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to miR-148a. In one embodiment, the microRNA comprises miR-148a. In some embodiments, the vector is a virus (e.g., a parvovirus, retrovirus, lentivirus, etc.), and in one embodiment, an adenovirus or adeno-associated virus.

[0034] In some embodiments, the methods disclosed herein achieve one or more desired patient outcomes. In some embodiments, treating a subject results in increased dystrophin expression. In some embodiments, the increased dystrophin expression occurs in skeletal muscle. In some embodiments, the increased dystrophin expression in skeletal muscle includes skeletal muscle of the limbs (e.g., arm or leg), such as the soleus muscle. In some embodiments, the increased dystrophin expression occurs in the diaphragm. In some embodiments, treating a subject results in reduced fibrosis, reduced inflammation, and / or increased mitochondrial function. In some embodiments, the reduced fibrosis includes reduced collagen accumulation. In some embodiments, the collagen includes collagen I and / or collagen III. In some embodiments, the reduced inflammation includes increased cytoplasmic nuclear factor (erythroid-derived 2)-like 2 (Nrf2), reduced fatty acid peroxidation end products, reduced inflammatory cell numbers, and / or upregulated expression of antioxidants. In some embodiments, the antioxidants that are upregulated include one or more of heme oxygenase-1 (HO-1), catalase, superoxide dismutase-2 (SOD-2), and glutamate-cysteine ​​ligase catalytic (GCLC) subunit. In some embodiments, the inflammatory cells that are downregulated include one or more of CD68 + In some embodiments, increased mitochondrial function comprises increased mitochondrial ultrastructure and / or increased mitochondrial biogenesis. In some embodiments, increased mitochondrial function comprises increased nuclear PPAR-γ coactivator-1 (PGC-1) expression.

[0035] In some embodiments, therapeutic compositions comprising one or more isolated components of the molecular cargo of CDC-XO, as disclosed elsewhere herein, are used in the methods disclosed herein. In some embodiments, the therapeutic composition comprises CDC-XO RNA. In some embodiments, RNA is isolated from CDC, CDC-XO, and / or CDC-MV, as disclosed elsewhere herein, and recombined (e.g., mixed and matched) to provide a therapeutic mixture for use in a therapeutic method. In some embodiments, the therapeutic mixture of RNA may comprise a single RNA or multiple RNAs (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more RNAs), including non-coding RNA. In some embodiments, non-coding RNA includes tRNA, Y RNA, rTNA, mirRNA, IncRNA, piRNA, SnRNA, snoRNA, among others, and further includes fragments thereof. In some embodiments, the therapeutic mixture comprises a microRNA, miR-146a, miR-148a, miR-22, miR-24, miR-210, miR-150, miR-140-3p, miR-19a, miR-27b, miR-19b, miR-27a, miR-376c, miR-128, miR-320a, miR-143, miR-21, miR-130a, miR-9, miR-185, miR-23a, miR-215, miR-33a, miR-204, miR-376c, miR-4532, miR-4742, miR-582, miR-629, miR-223, miR-3125, miR-3126, miR-3127, miR-3128, miR-3129 ... 29, or any other microRNA shown to be abundant in FIG. 29, and / or a polynucleotide having at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% percent identity to any of the foregoing.In some embodiments, the therapeutic mixture comprises one or more of miR-148a, miR-148-5p, miR-148-39, srDMD, and / or a polynucleotide having at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% percent identity to any of the foregoing. In some embodiments, the microRNA of the therapeutic mixture comprises miR-148a-3p, and / or a polynucleotide having at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% percent identity to any of the foregoing. In some embodiments, the microRNA comprises a polynucleotide having at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% percent identity to miR-148a-3p, and / or a polynucleotide having at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% percent identity to any of the foregoing. In various embodiments, the exosomes comprise srDMD, a small non-coding RNA derived from DMD, and / or a polynucleotide having at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% percent identity to any of the foregoing.

[0036] In some embodiments, methods otherwise disclosed herein can be performed using non-coding RNA isolated from CDC-XO. Without being bound by theory, non-coding RNA is believed to be well suited for regulatory roles requiring highly specific nucleic acid recognition, including non-coding RNA genes identified and designated as microRNAs. In some embodiments, the isolated RNA polynucleotide is selected from one or more of miR-148a, miR-148-5p, miR-148-39, srDMD, and / or polynucleotides having at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% percent identity to miR-148a, miR-148-5p, miR-148-39, or srDMD. In some embodiments, the nucleotide sequence of miR-148a is as follows: 5'GAGGCAAAGUUCUGAGACACUCCGACUCUGAGUAUGAUAGAAGUCAGUGCACUACAGAACUUUGUCUC3' (SEQ ID NO: 1); The nucleotide sequence of miR-148-5p is as follows: 5'AAAGUUCUGAGACACUCCGACU3' (SEQ ID NO: 2); The nucleotide sequence of miR-148-3p is as follows: 5'UCAGUGCACUACAGAACUUUGU3' (SEQ ID NO: 3); and The nucleotide sequence of srDMD is as follows: 5'UGUACACAGAGGCUGAUCGAUUCUCCCUGAACAGCCUAUUACGGAGGCACUGCAGAUCAAGCCCGCCUGGAGAGGUGGAGUUUCAAGAGUCCCUUCCUGGUUCACCGUCUCCUUU3' (SEQ ID NO: 4).

[0037] In some embodiments, one or more isolated components of the molecular cargo of CDC, CDC-XO, and / or CDC-MV are delivered to cells using a viral or non-viral vector. In some embodiments, the vector is a virus. In some embodiments, the virus is an adenovirus or an adeno-associated virus.

[0038] In certain embodiments, a formulation or composition comprising miR-148a, miR-148-5p, miR-148-39, srDMD, and / or a polynucleotide having at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% percent identity to miR-148a, miR-148-5p, miR-148-39, or srDMD for use in treating skeletal muscular dystrophy and / or dystrophic cardiomyopathy in a subject in need thereof, according to the aforementioned methods for effectively and / or safely treating a dystrophinopathy. In some embodiments, there is provided a use of the above-described formulation and / or composition for treating skeletal muscular dystrophy and / or dystrophic cardiomyopathy in a subject in need thereof, according to the aforementioned methods for effectively and / or safely treating a dystrophinopathy.

[0039] In some embodiments, CDCs are generated from biopsy samples that are cultured into explants, further cultured into explant-derived cells, further cultured as cardiosphere-forming cells, then cultured as cardiosphere cells, and then cultured as CDCs from which XOs and EVs are isolated. In some embodiments, the CDCs are human. In various embodiments, the CDCs are generated from biopsies obtained from subjects with dystrophinopathy. In some embodiments, the CDCs are cultured under hypoxic conditions (e.g., 2% O2) for a period of about 24 hours. In some embodiments, the CDCs are cultured under serum-free conditions. [Brief explanation of the drawings]

[0040] [Figure 1]Figures 1-1J. Transplantation of CDCs into mdx hearts. Transplantation of CDCs into mdx mice improved function, survival, antioxidant pathways, inflammation, mitochondrial dysfunction, and dystrophin expression. Figure 1A: Ejection fraction (EF) in CDC-injected mdx mice (Mdx + CDC) and vehicle-injected mdx mice (Mdx + Vehicle) in response to injection at baseline (10 months of age) and 3 months later (CTL: n = 7; Mdx + Vehicle and Mdx + CDC: n = 12 each). Figure 1B: Exercise capacity in mice subjected to weekly high-intensity treadmill exercise starting 3 weeks after administration of a single dose of CDC or vehicle (CTL: n = 7; Mdx + Vehicle and Mdx + CDC: n = 11 each). Cardiac and treadmill experiments were performed separately for different groups of experimental mice. Figure 1C: Kaplan-Meier analysis of the same animals as in Figure 1C shows that vehicle-treated mdx mice had a lower survival rate than CDC-treated mdx mice or wild-type controls (p < 0.01, log-rank test); however, the latter two groups were statistically comparable. Figure 1D: Immunohistochemistry images of Nrf2 in mdx mouse hearts 3 weeks after vehicle or CDC administration. Age-matched wild-type mice (CTL) served as controls. Hearts were stained for inflammatory cell markers CD68, CD20, and CD3. Black arrows indicate CD68+ (top row), CD20+ (middle row), and CD3+ (bottom row) cells. Figure 1E: Malondialdehyde protein adducts in mdx mouse hearts 3 weeks after vehicle or CDC administration (WT, n = 4; Mdx + Vehicle, n = 6; and Mdx + CDC, n = 6). Figure 1F: Western blot and pooled data for the protein abundance of phosphorylated Akt (Akt-pT308, Akt-pS473), cytoplasmic phosphorylated Nrf2 (Nrf2-pS40), and nuclear Nrf2. Figure 1G: Western blot and pooled data for the protein abundance of nuclear p65 and P-IκB (NF-κB pathway) in mdx mouse hearts. Figure 1H: Western blot and pooled data for the protein abundance of heme oxygenase-1 (HO-1), a downstream gene product of Nrf2.Figure 1I: Western blot, pooled data, and bar graphs showing the protein abundance of MCP1 (monocyte chemotactic protein 1) and the average number of indicated inflammatory cells in mdx mouse hearts. Figure 1J: Nrf2 immunohistochemistry images in mdx mouse hearts 3 weeks after administration of vehicle or CDC. Pooled data are mean ± SEM; CM: cardiomyocytes; *p<0.05; #p<0.005; †p<0.05; ‡p<0.002; Scale bar: 10 μm. [Figure 2] Figures 2A-B. Restoration of mitochondrial integrity. Figure 2A: Transmission electron microscopy (TEM) images of mdx mouse hearts 3 weeks after vehicle or CDC administration. Age-matched WT mice served as controls. Scale bar: 5 μm. Mitochondrial structure showed clear restoration of organized structures. Figure 2B: Western blot and pooled data of mitochondrial respiratory chain subunits in WT and vehicle / CDC mdx heart tissue, as well as oxygen consumption rates (OCR) of mitochondria isolated from CDC- or vehicle-treated mdx mouse hearts 3 weeks after treatment (WT, n = 3; Mdx + Vehicle and Mdx + CDC, n = 8, respectively). Where indicated, substrates (pyruvate, malate, and ADP), selective uncouplers (FCCP), and blockers (oligomycin; antimycin, and rotenone) of oxidative phosphorylation were applied. [Figure 3] Figures 3A-B. Repopulation with stable, competent mitochondria. Figure 3A: Initial turnover of damaged mitochondria is followed by repopulation with healthy mitochondria. Figure 3B: Mitochondria counts by TEM images, showing the same number of mitochondria present between groups, and mitochondrial DNA copy number per nuclear genome in mdx heart tissue. [Figure 4]Figures 4A-B. Reduction of cardiac collagen content and fibrosis. Figure 4A: Reduction of cardiac fibrosis. Representative Masson's Trichrome images of wild-type, vehicle-injected, and CDC-injected mdx hearts, and pooled data from morphometric analysis. Figure 4B: Western blot and pooled data for cardiac collagens IA1 and IIIA1 in the myocardium 3 weeks after CDC injection in mdx hearts. Data are mean ± SEM; †p<0.05; #p<0.05. [Figure 5] Figures 5A-5B. Cardiomyogenesis. Enhanced cardiomyogenesis 3 weeks after CDC injection in mdx mice is evident from representative immunohistochemistry images and pooled data. Figure 5A: Immunohistochemistry images (wild-type, vehicle-treated, and CDC-treated mdx mouse hearts stained for Ki67 and Aurora B; n = 4-6 per group). Arrows point to Ki67+ (top row) and Aurora B+ (bottom row) cardiomyocytes. Figure 5B: Pooled data for morphometric analysis of Aurora B+ and Ki67+ staining. Data are mean ± SEM; †p < 0.05; scale bar: 10 μm. [Figure 6] Diagram of various mechanisms unpinning muscular dystrophy pathogenesis, including myocyte loss, fibrosis, oxidative stress, inflammation, mitochondrial ineffectiveness / loss, apoptosis, and fibrosis. [Figure 7] Figures 7A-7B. Restoration of dystrophin expression. Figure 7A: Immunohistochemistry images, Western blots, and pooled data for protein abundance of dystrophin isoforms: dp427, dp260, dp140, dp116, dp71, and dp40 in mdx mouse hearts 3 weeks after vehicle or CDC administration. CDC injection in mdx hearts resulted in restoration of dystrophin expression for all measured isoforms. Figure 7B: Additional representative figures. [Figure 8] Overview of the pathophysiological mechanisms operative in muscular dystrophies and the cellular mechanisms recruited by CDC and CDC-XO, including myocyte loss, fibrosis, oxidative stress, inflammation, mitochondrial ineffectiveness / loss, apoptosis, and fibrosis. [Figure 9]Figures 9A-9D. CDC-XO recapitulates the effects of CDC. Intramyocardial injection of CDC-XO reduces collagen to levels similar to those of wild-type. Figure 9A: Western blots and pooled data for cardiac collagens IA and IIIA. WGA (wheat germ agglutinin) was applied to stain and delineate cell membranes. Figure 9B: Immunohistochemistry images and pooled data from mdx mouse hearts stained for Ki67 and Aurora B (wild-type, n = 4; and CDC-XO-treated and vehicle-treated, n = 6 each). Arrows indicate Ki67+ (top) and Aurora B+ (bottom) cardiomyocytes. Figure 9C: Western blot and pooled data for the abundance of dystrophin isoforms: dp427, dp260, dp140, dp16, dp71, and dp40 in mdx mouse hearts (n=4-6) 3 weeks after administration of vehicle, CDC, or CDC-XO. Figure 9D: Injection of CDC-XO into mdx hearts delayed the progressive decline in ejection fraction (n=11). Data are mean ± SEM; *p<0.05; †p<0.02; ‡p<0.01. Scale bar: 10 μm. [Figure 10] Figures 10A-10B. Disproportionate increases in cardiac function and exercise capacity in CDC-treated mdx mice. This may be due to CDCs themselves, mediators secreted from engrafted CDCs (exosomes, EVs, proteins, etc.), modulation of the cardiac secretome, and / or improved systemic hemodynamics. Figure 10A: Disproportionate increases in cardiac function in CDC-treated mdx mice. Figure 10B: Disproportionate increases in exercise capacity in CDC-treated mdx mice. [Figure 11]Figures 11A-11N. Intraventricular injection of CDC-XO. CDC-XO administration demonstrated similar beneficial results. Figure 11A: Whole-body biodistribution of CDC-XO after intraventricular injection in mdx mice. CDC-XO was stained with a fluorescent lipid dye and tracked 6 hours later using bioluminescence imaging. Figure 11B: CDC-XO modulated gene expression to reflect CDC. Figure 11C: Dimensional hierarchical clustering using genes derived from the hearts of untreated mdx mice or mdx mice treated with intramyocardial CDC or intravenous CDC-XO. Genes with at least a two-fold difference from the corresponding transcript in untreated mdx mice were included. Figure 11D: Improved ejection fraction with intraventricular CDC-XO injection. Figure 11E: Improved exercise capacity with intraventricular CDC-XO injection. Figure 11F: Correlation of fold change in expression of the same genes in the diaphragm 3 weeks after intramyocardial CDC or intraventricular CDC-XO injection. Figure 11G: Two-dimensional hierarchical clustering using genes from the diaphragms of untreated mdx mice and mdx mice treated with intramyocardial CDC or intraventricular CDC-XO. Genes with at least a two-fold difference from the corresponding gene in untreated mdx mice were included. Figure 11H: Diaphragm contractile properties 3 weeks after intraventricular CDC-XO injection. Both twitch force and specific muscle force improved with intraventricular CDC-XO injection. Figure 11I: These results were further observed in the soleus muscle, as shown for the gene expression results. Figure 11J: Two-dimensional hierarchical clustering. Figure 11K: Contractile properties from the soleus muscle 3 weeks after intraventricular CDC-XO injection. Both twitch force and specific muscle force improved with intraventricular CDC-XO injection. Figure 11L: Heart; Figure 11M: Diaphragm; Figure 11N: Dystrophin levels shown for the soleus muscle. Data are mean ± SEM; *p<0.05; †P<0.05. [Figure 12] Biodistribution after intraventricular CDC-XO injection. Figure 12 shows the distribution of CDC-XO stained with a fluorescent lipid dye in mdx mice. [Figure 13]Figures 13A-13J. Intramuscular CDC-XO injection resulted in muscle growth and reversal of the pathophysiological abnormalities of muscular dystrophy. Figure 13A: H&E and immunohistochemistry images of soleus muscles (soleus muscles from wild-type, vehicle-treated, and CDC-XO-treated mdx mice) stained for MyoD. Arrows in the H&E images indicate linearly arranged nuclei (left column) and myofibers (right column). In immunohistochemistry, directly arranged nuclei were positive for MyoD (middle column). Figures 13B and 13C: Frequency distribution of myofiber size and number of myoblasts (MyoD+) in mdx soleus muscles (n=59) 3 weeks after vehicle and CDC-XO injection. Figures 13D-13F: Western blot and pooled data for protein abundance of Figure 13D: MyoD and myogenin, Figure 13E: IGF1 receptor, and Figure 13F: cytoplasmic p-p65 in mdx soleus muscles 3 weeks after intrasoleus injection of vehicle and CDC-XO (n = 4-6). Figure 13G: CDC-XO microRNA readings as a measure of myogenesis. Figure 13H: Representative Masson's Trichrome images and morphometric analysis of mdx soleus muscles 3 weeks after administration of vehicle and CDC-XO to mdx soleus muscles (n = 5-9). Figure 13I: Immunohistochemistry images of dystrophin in mdx mouse soleus muscles 3 weeks after intrasoleus injection of vehicle and CDC-XO (n = 4-6). Age-matched wild-type mice served as controls. Western blot and pooled data for protein abundance of dystrophin isoform dp427 in mdx mouse soleus muscle 3 weeks after vehicle and CDC-XO (n = 4-6) administration. Figure 13J: Ex vivo measurement of soleus muscle contractile properties: twitch force and absolute muscle strength 3 weeks after vehicle and CDC-XO injection into mdx soleus muscle. Pooled data are mean ± SEM; *p < 0.05; †p < 0.05; ‡p < 0.002; Scale bars: 5 μm (Figure 13A, right column), 10 μm (Figure 13A, center column), 50 μm (Figure 13A, left column), 200 μm (Figure 13H), 20 μm (Figure 13I). [Figure 14]Figures 14A-14C. Figure 14A: CDC-XO injection was able to modulate the diaphragm transcriptome. Figure 14B: Western blot and pooled data for the protein abundance of dystrophin isoforms in human Duchenne cardiomyocytes (DMD CM) 1 week after priming with CDC-XO. Calcium transients from normal and DMD CM measured during 1 Hz burst pacing. Duchenne cardiomyocytes were primed with vehicle (DMD CM) or CDC exosomes (DMD CM+XO) 1 week before evaluation. Bar graphs show calcium transient alternans (variation in calcium transient amplitude between beats) and time to peak. Western blot and pooled data for the protein abundance of dystrophin isoforms: dp427, dp260, dpl40, dpi16, dp71, and dp40 in mdx mouse hearts after 3 weeks. Figure 14C: Oxygen consumption rate (OCR) measurements in DMD CM primed with CDC-XO or normal human dermal fibroblast-derived EVs (NHDF-XO) one week prior. Normal and untreated DMD CM were studied in parallel. [Figure 15] Left ventricular end-diastolic volume (LV EDV) and end-systolic volume (LV ESV) after CDC administration. CDC implantation resulted in sustained improvements in LV EDV and LV ESV over 3 months after the first and second (3-month interval) injections in mdx mice compared with placebo. Data are mean ± SEM; n = 12 per group; p < 0.05. [Figure 16] Percentage engraftment of CDCs in the heart 1, 2, and 3 weeks after transplantation. Percentage engraftment of CDCs at 1 week was approximately 8% and at 2 weeks was less than 1%. At 3 weeks, no viable CDCs could be detected. n=3 for each time point. [Figure 17]Figures 17A-17D. Changes in the mdx cardiac transcriptome 3 weeks after CDC treatment. Figure 17A: Two-dimensional hierarchical clustering using 560 genes with at least a two-fold difference between vehicle-treated and CDC-treated mdx hearts. Each row represents an mdx heart, and each column represents a gene. Probe set signal values ​​were normalized to the mean of the mdx hearts. Relative levels of gene expression are represented from lowest (green) to highest (red) according to the scale shown at the top. Examples of transcript fold changes for genes involved in various pathways of interest are plotted here, including Figure 17B: mitochondrial integrity, Figure 17C: oxidative stress, and Figure 17D: inflammation. [Figure 18] Western blot and pooled data for protein abundance measurements, including catalase, superoxide dismutase-2 (SOD-2), and the catalytic subunit of glutamate cysteine ​​ligase (GCLC), in mdx mouse hearts 3 weeks after vehicle or CDC administration. [Figure 19] IPA analysis of differentially expressed genes involved in inflammation in mdx mouse hearts treated with CDC or vehicle, showing inhibition of the inflammatory response accompanied by reduced inflammatory cell migration in mdx hearts 3 weeks after CDC treatment. Blue represents inhibition of function / response, while red and green represent up- and down-regulation, respectively. [Figure 20] Figures 20A-20C. Immunohistochemistry images. mdx hearts stained for the inflammatory cell marker CD3 are shown, including Figure 20A: vehicle-treated mdx mouse, Figure 20B: CDC-treated mdx mouse, and Figure 20C: wild-type heart as a control, with enlargements of boxed areas. [Figure 21] Figures 21A-B. Mitochondria. Figure 21A: Number of mitochondria by TEM image. Figure 21B: Mitochondrial DNA copy number per nuclear genome in cardiac tissue 3 weeks after treatment. [Figure 22]XO analysis. Isolated XO obtained by ultracentrifugation were analyzed by nanoparticle tracking using a NanoSight NS300 system (NanoSight Ltd, UK). Videos were collected and analyzed using NTA software (version 2.3) with the minimum expected particle size, minimum track length, and blur settings all set to automatic. The camera shutter speed was fixed at 30.01 ms, and the camera gain was set to 500. The camera sensitivity and detection threshold were set to near maximum (15 or 16) and minimum (3 or 4), respectively, to display small particles. Ambient temperature was recorded manually and ranged from 24°C to 27°C. For each sample, five 60-second videos were recorded with a 10-second delay between recordings, and five replicate histograms were generated and averaged. A representative histogram of five replicates showing size / concentration is shown. The standard error of the mean concentration calculated across the five replicates is shown in red. [Figure 23] LV end-diastolic volume (LV EDV) and LV end-systolic volume (LV ESV) after CDC-XO administration. CDC-XO implantation resulted in sustained improvements in LV EDV and LV ESV for 3 months after both the first and second (3-month interval) injections in mdx mice compared with placebo. Data are mean ± SEM; n = 11 per group; #p < 0.05. [Figure 24] Immunoglobulin serum levels. IgG serum levels in mdx mice 6 months after the first injection and 3 months after repeated injections of mouse CDC, human CDC-XO, and vehicle. Circulating anti-donor IgG antibodies were screened by flow cytometry. [Figure 25]Clathrin-dependent myocardial uptake of XO. Distribution of intramyocardially injected CDC-XO in mdx mouse hearts with or without chlorpromazine (CPZ) pretreatment. CPZ is an inhibitor of clathrin-dependent uptake. Fluorescently labeled XO (XenoLight DiR, 5 μM, overnight incubation; Caliper Life Sciences, Hopkinton, MA) was intramyocardially injected into the apex of mdx mouse hearts; 6 h later, hearts were harvested, fixed, and sectioned for assessment of XO distribution. The average number of labeled XO within cardiomyocytes (verified by co-staining for sarcomeric actinin [green] and DAPI [blue]) was calculated by counting intracellular XO in 10 fields of cells from 10 randomly selected sections from the apical (3 sections; 50 μm intervals), central (4 sections; 50 μm intervals), and basal (3 sections; 50 μm intervals) regions of each heart. The presence of fluorescently labeled XO inside cardiomyocytes is a measure of endocytic uptake; pretreatment with CPZ (50 μg / g, single ip dose, 1 h before XO injection) resulted in a significant decrease in the intracellular presence of XO, indicating the involvement of clathrin-mediated uptake in the internalization of CDC-XO, particularly in mdx cardiomyocytes. The bar graph represents the number of labeled XO (purple) inside cardiomyocytes treated with and without CPZ, expressed as the number of labeled XO in the myocardium divided by the total number of cardiomyocytes per high-power field (HPF). Arrows indicate fluorescently labeled exosomes. Pooled data are mean ± SEM; †p<0.001. [Figure 26] Contractile properties. Extensor digitorum longus (EDL) contractile properties after intramyocardial CDC injection: In situ measurements of EDL contractile properties, absolute twitch force, and maximum tetanic force 3 weeks after CDC / vehicle treatment of mdx hearts. [Figure 27] IPA analysis of differentially expressed genes involved in liver inflammation in mdx mice treated intramyocardially with CDC or vehicle, showing inhibition of the NF-κB inflammatory pathway in mdx livers 3 weeks after intramyocardial CDC injection. Blue represents inhibition of function / response, while red and green represent up- and down-regulation, respectively. [Figure 28]Fold change of mitochondrial-associated microRNAs in XO derived from hypoxic cultured CDCs compared to XO derived from CDCs grown under normoxic conditions. Two-dimensional hierarchical clustering using microRNAs showing a log2 fold change of -6 to 6 (230 microRNAs) is shown. The relative log2 fold change of microRNAs is represented according to the scale shown at the top, from lowest (red (bottom), -6) to highest (green (top), +6). Each row represents an XO preparation, and each column represents a microRNA species. Of the 389 microRNAs detected in hypoxic XOs, 248 have previously been reported to be mitochondrial-associated microRNAs. [Figure 29] Fold changes in microRNAs under different culture conditions. Characteristics of CDC-XO isolated from hypoxia-conditioned medium (2% O2) compared to CDC-XO isolated from normoxic medium were shown, including fold changes greater than 10 and less than -20. For miRNA sequencing library preparation of small RNAs extracted from XO, the NEBNext Small RNA Library Prep kit (New England BioLabs, Ipswich, MA) was used. RNA was extracted from XO using the miRNeasy Serum / Plasma Kit (QIAGEN, Germantown, MD). [Figure 30] Figures 30A-B. Physiological characteristics after CDC-XO and miR-148 administration. Figure 30A: LV ejection fraction at baseline and 3 weeks after intramyocardial injection of CDC-XO and NHDF-XO in mdx mice. Figure 30B: LV ejection fraction at baseline and 3 weeks after intramyocardial injection of miR-148 and microRNA mimic control in mdx mice. Data are mean ± SEM; n=5 per group. [Figure 31]Figures 31A-B. Age-related changes in dystrophin expression in mdx hearts. Figure 31A: Dystrophin expression in young (8 weeks) and aged (10 months) mdx hearts. Figure 31B: Western blot of dystrophin protein in wild-type control and mdx mouse hearts 3 weeks and 3 months after the first intramyocardial CDC injection and 3 months after a second (repeat) CDC injection into the myocardium. All hearts were 10 months old at baseline. CS: citrate synthase. [Figure 32] Figures 32A-32D. Non-cardiac indications of CDC or CDC-XO injection. Figure 32A: Present pathway analysis of differentially expressed genes involved in inflammation in the livers of mdx mice injected intramyocardially with CDC or vehicle, showing inhibition of the NF-κB inflammatory pathway in mdx livers 3 weeks after intramyocardial CDC injection. Blue represents inhibition of function / response, while red and green represent up- and down-regulation, respectively. Figure 32B: Bioluminescence imaging of stained mdx mouse organs after systemic injection of human CDC-XO. 6 hours after systemic injection of XO into the left ventricular cavity of mdx mice, the indicated organs were dissected and imaged using an IVIS molecular imaging system (Caliper Life Sciences, Hopkinton, MA, USA). Figure 32C: Western blot of dystrophin protein in wild-type and mdx mouse hearts 1 week, 3 weeks, and 3 months after the first intraventricular CDC-XO injection and 3 months after the second (repeat) CDC-XO injection. Figure 32D: Western blot showing dystrophin protein content in the heart, hypothalamus, diaphragm, soleus, tibialis anterior, and extensor digitorum longus muscles of wild-type control and mdx mice 3 weeks after systemic delivery of CDC-XO by intraventricular injection. CS: citrate synthase loading control. Although dystrophin expression was not evident in the EDL, contractile force was increased in the EDL after intramyocardial CDC injection, suggesting that dystrophin re-expression may not be the only beneficial mechanism in skeletal muscle. [Figure 33] Dystrophin expression and consequences. Absence of dystrophin in XO. Wild-type heart lysates were used as a positive control for dystrophin detection. [Figure 34] Figures 34A-34D. Validation that the bioactivity of XO studied here can be attributed to characterized exosomes. Exosomes were floated on a linear iodixanol density gradient, which demonstrated the presence of vesicles and proteins by transmission electron microscopy (TEM), indicating that the biological activity is vesicle-associated. Figure 34A: TEM images of exosomes purified by linear iodixanol density gradient (Exol, left) and unpurified (Exo2, right) serial centrifugation show vesicles in both conditions. Vesicles were variable in size and morphology, consistent with previous studies. Figure 34B: Western blot analysis of lysed exosomes for the characterization of key exosomal proteins: CD63, CD81, and TSG. Figures 34C-34D: The bioactivity of Exol and Exo2 was compared by injection into mdx soleus muscle and evaluation of the mdx soleus muscle transcriptome 3 weeks after injection. Figure 34C: Changes in the mdx soleus muscle transcriptome 3 weeks after Exol and Exo2 injection. Two-dimensional hierarchical clustering using 332 genes with at least a two-fold difference between vehicle / Exol and vehicle / Exo2 in mdx soleus muscle. Figure 34D: Correlation of fold change in expression of the same genes 3 weeks after Exol and Exo2 injection in mdx soleus muscle. The similarity in the effects of Exol and Exo2 supports the notion that the bioactivity of vesicles isolated by the default protocol is truly attributable to exosomes and not to other types of vesicles that may be co-purified by ultracentrifugation. Scale bar: 50 μm (Exo1); 100 nm (Exo2). [Figure 35]Figures 35A-C. Transplantation of miR-148a-3p and srDMD into mdx hearts. Figure 35A: Differential expression of miR-148a-3p and srDMD in CDC-XO isolated from hypoxic conditioned medium (2% O2) compared to CDC-XO isolated from normoxic conditioned medium (n=2), along with depiction of the apparent secondary structure of srDMD. Figure 35B: Western blot and pooled data for protein abundance of dystrophin isoforms: dp427, dp260, dp140, dp16, dp71, and dp40 in mdx mouse hearts 3 weeks after intramyocardial injection of vehicle, CDC, CDC-XO (n=4-6), miR-148a-3p, or srDMD. Figure 35C: Western blot and pooled data for protein abundance of dystrophin isoforms: dp427, dp260, dpl40, dpi16, dp71, dp40 in mdx mouse hearts 3 weeks after intramyocardial injection of vehicle, CDC, CDC-XO (n=4-6), miR-148a-3p, and srDMD. [Figure 36] Figures 36A-B. Exon skipping / elimination of alternative splicing. Figure 36A: miR-148a results in a decrease in both NFκB p65 and phosphorylated-Akt levels. Figure 36B: RT-PCR using primers flanking exon 23 of dystrophin. Used to assess exon 23 inclusion of dystrophin expressed in mdx hearts from mice (n=4-6) treated with vehicle, miR-148a-3p, and srDMD. Sashimi plots of RNA-seq data for dystrophin from mdx hearts treated with vehicle, miR-148a-3p, or srDMD do not represent junction reads spanning exon 23. All data are mean ± SEM; †p<0.03. [Figure 37]Figures 37A-B. Western blot detection of dystrophin. Figure 37A: Western blot showing dystrophin protein content in wild-type mouse hearts and srDMD-treated mdx mice 3 weeks after intramyocardial injection of srDMD. Figure 37B: Percentage increase in dystrophin / eGFP expression after treatment with CDC-XO, miR-148a-3p, or srDMD compared to vehicle (PBS) in HEK293 NT cells transfected with dual reporter constructs harboring a point mutation in exon 23 of the dystrophin gene or a deletion of exon 50 of the dystrophin gene. [Figure 38] Figures 38A-B. Dystrophin expression and outcomes. Figure 38A: Ejection fraction at baseline and 3 weeks after intramyocardial injection of miR-148a-3p or microRNA mimic control in mdx mice. Wild-type EF values ​​are shown for reference; n=5 per group. Figure 38B: Western blot showing dystrophin protein content in wild-type mouse hearts and mdx mouse hearts injected with vehicle, mutant srDMD, or srDMD 3 weeks after intramyocardial injection. [Figure 39] Figures 39A-B. Figure 39A: Plasmid maps of synthetic DNA constructs cloned into mammalian expression vectors. Full-length human dystrophin was cloned into the ORF as wild-type or one of two mutants: a premature termination codon of UAA in exon 23 (PTC), or an exon 50 deletion (exon50Δ). The constructs generate fusion proteins of full-length dystrophin in frame with eGFP, so that green fluorescence can be considered a reporter of dystrophin expression. Constitutive luciferase expression (driven independently by the SV40 promoter) was used to normalize for transfection efficiency. Figure 39B: Dystrophin / eGFP expression in HEK-293NT cells transfected with full-length (WT), PTC, or exon50Δ constructs. Fluorescence and luminescence of total cell lysates were quantified on a well-by-well basis in a 96-well spectrophotometer; fluorescence in each well was also quantified using untransfected cells of similar seeding density and lysis volume. [Figure 40] Figures 40A-40D. 10- to 12-month-old mdx mice were treated with a single dose of vehicle (mdx), 2.5 x 10 syngeneic CDCs, or 2.0 x 10 human CDC-exosomes (CDC-XO) via intravenous injection into the femoral vein. Figure 40A shows maximal exercise capacity before treatment (baseline) and after 3 weeks of treatment (n = 8-10 per group), and Figure 40B shows in vivo cardiac ejection fraction (EF) before treatment (baseline) and after 3 weeks of treatment (n = 6-8 per group). Figure 40C shows Masson's Trichrome micrographs of mdx mice treated with vehicle (upper panel), CDC (middle panel), or XO (lower panel). Figure 40D shows pooled data analyzing the area of ​​blue staining (collagen) versus red staining (cytoplasm) as a marker of cardiac fibrosis (n = 5-6 per group). Data are expressed as mean ± SEM. * indicates statistically different from vehicle treatment. Statistical significance was set at P<0.05. [Figure 41] Figures 41A-41D. Animals were treated as described in Figure 40. Figure 41A shows whole-transcriptome analysis of hearts from RNA-sequencing data. Transcripts were considered differentially expressed with a fold change of 2 or more with P<0.05 and are represented as a heatmap in panel A. mdx columns were compared to age-matched wild-type mouse hearts, while CDC and XO columns were compared to mdx mouse hearts, respectively. Figure 41B shows representative Western blots and pooled data probing phosphorylated NFκB protein levels in wild-type (WT), vehicle (mdx), CDC, or XO-treated mice. Figure 41C shows pooled data from immunofluorescence images of CD68 (n=3 per group) from mdx, CDC, or XO-treated hearts in Figure 41D. Data are presented as mean ± SEM. * indicates statistically different from vehicle treatment. Statistical significance was set at P<0.05. [Figure 42]Figures 42A-42D. Animals were treated as described in Figure 40. Figure 42A. Pooled data from Western blot analysis of mitochondrial electron transport complexes from hearts treated with WT, mdx, CDC, or XO (n = 6 per group). Figure 42B. Protein-carbonyl adduct formation in hearts treated with WT, mdx, CDC, or XO (n = 8-10 per group). Figure 42C. Pooled data from immunofluorescence images of Ki-67 (n = 3 per group). Figure 42D. Pooled data from hearts treated with mdx, CDC, or XO. Data are presented as mean ± SEM. * indicates statistically different from vehicle treatment. Statistical significance was set at P < 0.05. [Figure 43] Figures 43A-43F. Animals were treated as described in Figure 40. Figure 43A. Force-contraction frequency relationships of soleus muscles from WT (circles), mdx (squares), CDC (upper triangles), or XO (lower triangles) (n = 5-8 per group). Figure 43B Twitch force and Figure 43C Tetanic force generated by soleus muscles from WT, mdx, CDC, or XO-treated mice. Figure 43D. Force-contraction frequency relationships of diaphragms from WT (circles), mdx (squares), CDC (upper triangles), or CDC-XO (lower triangles) (n = 5-6 per group). Figure 43E Twitch force and Figure 43F Tetanic force generated by diaphragms from WT, mdx, CDC, or CDC-XO-treated mice. Figure 43G. Masson's Trichrome micrographs of mice treated with mdx (left panel), CDC (center panel), or CDC-XO (right panel). Figure 43H. Pooled data analyzing the area of ​​blue staining (collagen) versus red staining (cytoplasm) as a marker of skeletal muscle fibrosis in soleus muscles (n=5-6 per group). Figure 43I. Quantification of the number of myofibers per whole muscle section in soleus muscles (n=5-6 per group). Data are expressed as mean ± SEM. * indicates statistically different from vehicle treatment. Statistical significance was set at P<0.05. [Figure 44]Figures 44A-44D. Animals were treated as described in Figure 40. Figure 44A. Heart whole transcriptome analysis from RNA sequencing data. Transcripts were considered differentially expressed with a 2-fold change or greater at P<0.05 and are represented as a heatmap in panel A. mdx rows were compared to age-matched wild-type mouse soleus, while CDC and XO rows were compared to mdx mouse soleus, respectively. Figure 44B. Kyoto Encyclopedia of Genes and Genomes analysis of CDC-XO-treated soleus. The listed pathways were considered upregulated compared to mdx soleus, and many are involved in inflammation. Fold changes of genes known to be involved in TNF (Figure 44C) and NFκB (Figure 44D) signaling were altered in soleus by CDC and CDC-XO treatment. [Figure 45] Figures 45A-45C. Animals were treated as described in Figure 40. Figure 45A. Representative Western blots and pooled data examining phosphorylated NFκB protein levels in soleus muscles from wild-type (WT), vehicle (mdx), CDC, or CDC-XO-treated mice (n=3 per group). Figure 45B. Pooled data from CD68 immunofluorescence images (n=3 per group). Figure 45C, from hearts treated with mdx, CDC, or CDC-XO. Data are presented as mean ± SEM. * indicates statistically different from vehicle treatment. Statistical significance was set at P<0.05. [Figure 46] Figures 46A-B. Animals were treated as described in Figure 40. Western blots probing full-length dystrophin in Figure 46A soleus muscle and Figure 46B diaphragm from vehicle (mdx), CDC, GW4869-treated CDC, and CDC-XO-treated mice. The left two columns represent relative levels of WT dystrophin (e.g., 5% and 1%). [Figure 47]Figure 47 depicts the outline protocol used to evaluate the efficacy of dose-escalating intravenous administration of CDC to improve exercise capacity using a DMD mouse model (mdx mice), where mdx mice received treatment or control vehicle at week 0, exercised once a week, and were sacrificed at week 6. [Figure 48] Figures 48A-B. Figures 48A and 48B graphically show the effect of intravenous (IV) administration of CDCs on the exercise performance of mdx mice injected with 75,000, 150,000, or 250,000 (referred to in the figures as "75K," "150K," and "250K") CDCs versus phosphate-buffered saline (PBS) control. [Figure 49] FIG. 49 graphically depicts the effect of intra-cervical IV administration of CDC on diaphragm muscle function in mice injected with 75K-250K CDC versus PBS control. [Figure 50] Figures 50A-B. Figures 50A and 50B graphically show the effect of intracervical IV administration of CDC on body weight of mdx mice injected with 37K-150K CDC versus PBS control. [Figure 51] FIG. 51 shows that CDCs administered according to several embodiments disclosed herein reduce cardiac fibrosis in mdx mice (collagen staining, an indicator of fibrosis, is shown). [Figure 52A] FIG. 52A depicts the outline protocol used to assess the effect of CDC treatment on cardiac ejection fraction using echocardiography. [Figure 52B] FIG. 52B graphically depicts the effect of intrajugular IV administration of CDC on cardiac ejection fraction in mdx mice injected with 150K CDC versus PBS control. [Figure 53] FIG. 53 shows Masson's trichrome staining of cardiac tissue sections from mdx mice injected with 150K CDC via jugular IV injection or 250K CDC via femoral IV injection versus PBS control. [Figure 54]Figure 54 graphically illustrates the effect of IV administration on cardiac (left ventricular) ejection fraction in a mouse model of myocardial infarction with 300K CDC via systemic injection (100K CDC via femoral IV injection or injection into the right ventricle), versus 100K CDC via intramyocardial injection, versus PBS control. [Figure 55A] Figure 55A graphically depicts validation of qPCR performed on purified human CDC DNA. [Figure 55B] FIG. 55B graphically depicts a standard curve of human CDC DNA spiked into mouse tissue DNA prepared for each tissue tested. [Figure 56A] Figure 56A depicts an outline protocol for determining the biodistribution of human CDC in wild-type (WT) mice after jugular intravenous administration by human Alu sequence qPCR. [Figure 56B] FIG. 56B graphically depicts the biodistribution of human CDC in WT mice 10 minutes and 24 hours after jugular vein injection in lung, liver, blood, heart, soleus, diaphragm, and spleen tissues. [Figure 57A] FIG. 57A depicts an outline protocol for determining the biodistribution and clearance of human CDC in severe combined immunodeficiency (SCID) mice after jugular vein administration by mHuman Alu sequence qPCR. [Figure 57B] FIG. 57B shows the biodistribution of human CDC in lung tissue in SCID mice 24 hours, 1 week, and 3 weeks after jugular vein injection. [Figure 57C] FIG. 57C graphically depicts the biodistribution of human CDC in SCID mice 24 hours, 1 week, and 3 weeks after jugular vein injection in liver, blood, heart, soleus muscle, diaphragm, spleen, and testis tissues. [Figure 58] Figure 58 outlines lung sample collection for histopathological analysis to assess the safety of high doses of CDC in a porcine acute myocardial infarction model. [Figure 59]Figure 59 graphically depicts the change in serum troponin I (TnI) levels in pigs treated with 50 million, 100 million, or 200 million CDCs ("50M," "100M," or "200M," respectively). [Figure 60] Figure 60 shows the average area at risk (AAR) in pigs treated with 50 million, 100 million, or 200 million CDCs. [Figure 61] FIG. 61 graphically depicts the mean ratio of no reflow (unstained) to area at risk, indicating myocardial vascular occlusion (MVO) in pigs treated with 50 million, 100 million, or 200 million CDCs. [Figure 62] FIG. 62 graphically depicts the mean ratio of triphenyltetrazolium chloride (TTC) staining to area at risk, indicating scar size, in pigs treated with 50 million, 100 million, or 200 million CDCs. [Figure 63] FIG. 63 graphically depicts the calculated ΔEF for treated and untreated animals in pigs treated with 50 million, 100 million, or 200 million CDCs. [Figure 64] Figure 64 graphically depicts the expression of immune molecules involved in T and natural killer (NK) immune responses by steady-state CDC. The percentage of positive cells and geometric mean fluorescence intensity are shown. [Figure 65] Figure 65 shows representative images of tailored MLR cultures. [Figure 66] Figure 66 graphically depicts T cell activation by CDC. Expression of CD69 (left panel) and HLA-DR (right panel) by CD4+ (black) and CD8+ (white) T cells from three different PBMCs (donors A, C, and D). Results are the mean ± SD of triplicates. *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001. [Figure 67]Figures 67A-67C. Graphical representations of T cell proliferation from unfractionated PBMC in response to CDC. Figure 67A shows a representative equal plot (from donor A). Figure 67B shows proliferation of T cells from three different PBMC donors. Figure 67C shows proliferation of T cells from three different donors. For Figure 67B, results are means ± SD from triplicates. For Figure 67C, results are means ± SD from three different donors, each with triplicates. [Figure 68] Figure 68 graphically depicts the activation and proliferation of purified T cells in response to CDC. Results are the mean ± SD from duplicate responses to each donor (top and middle panels) and from triplicates of each response from both donors (bottom panel). [Figure 69] Figure 69 shows immune modulation of phytohemagglutinin (PHA)-induced T cell proliferation by CDC. Representative cultures and histograms (top row) and results presented as mean percentages ± SD from three different donors, each performed in triplicate. [Figure 70] Figure 70 graphically depicts PHA-induced modulation of CD69 and HLA-DR expression, and PHA-induced T cell proliferation by CDC. Results for each donor are presented as the mean ± SD of triplicate replicates. The bottom panel presents the mean ± SD of activation marker expression reduction (CD69) or increase (HLA-DR) (left and middle panels), as well as the percentage of proliferation inhibition obtained from both donors, each performed in triplicate. [Figure 71] Figure 71 is a Western blot showing the content of CDC-EVs of recognized exosomal markers. [Figure 72] Figure 72 graphically depicts the expression of immune molecules involved in T and natural killer (NK) immune responses to CDC-EV. [Figure 73]Figures 73A-73B. Activation of T cells by CDC and CDC-EV. Figure 73A shows representative images of tailored MLR cultures. Figure 73B shows expression of CD69 and HLA-DR by CD4+ and CD8+ T cells. [Figure 74] Figures 74A-74B. Graphical representation of T cell proliferation in response to CDC and EV. Figure 74A shows a representative equal plot. Figure 74B shows proliferation of T cells from three different donors presented as mean ± SD from triplicates. [Figure 75] Figure 75 graphically depicts purified T cell activation and proliferation in response to CDC and CDC-EV. Results are presented as the mean ± SD from responses (two replicates) from two different donors. [Figure 76] Figure 76 shows IDC culture in the presence and absence of EVs and the expression of associated immune molecules (bottom panel). [Figure 77] Figure 77 graphically depicts the activation and proliferation of purified T cells by CDC-EVs presented by iDCs. Results are presented as the mean ± values ​​from triplicates. [Figure 78] Figure 78 shows mDC cultures in the presence and absence of EVs (top panel) and the expression of relevant immune molecules (bottom panel). [Figure 79] Figure 79 graphically depicts the activation and proliferation of purified T cells by mDC and mDC-EVs. Results are presented as the mean ± values ​​from triplicates. [Figure 80] Figure 80 shows immunomodulation of PHA-induced T cell proliferation by CDC and CDC-EV. Results are mean percentage values ​​± SEM from three donors, each performed in triplicate. [Figure 81] Figure 81 graphically depicts PHA-induced downregulation of CD69 and / or HLA-DR expression by CDC and CDC-EV. Results are mean percentage values ​​± SEM from triplicates. [Figure 82]Figure 82 graphically shows that CDC and CDC-EV downregulate PHA-induced T cell proliferation. Mean ± SD from triplicates. [Figure 83] Figure 83 graphically depicts immunomodulation of PHA-induced CD4+ and CD8+ T cell proliferation by CDC and CDC-EV. Results are mean percentage values ​​± SEM from two donors, each performed in triplicate. [Figure 84A] Figure 84A is a graphical representation of the change from baseline in exercise capacity following multiple administrations of syngeneic CDC (derived from C57BL / 10 mice) or PBS control. [Figure 84B] Figure 84B is a graphical representation of the change from baseline in exercise capacity after multiple administrations of allogeneic CDC (derived from C3H mice) or PBS control. [Figure 84C] FIG. 84C is a graph that combines FIG. 84A and FIG. 84B. [Figure 85A] Figure 85A is a graphical representation of the change from baseline in exercise capacity following two administrations of allogeneic CDC (from C3H mice), steroid and / or PBS vehicle. [Figure 85B] Figure 85B is a graph of the percentage of cells positive for various gene markers. [Figure 85C] Figure 85C is a graph showing the amount of IgG antibody. [Figure 86] Figure 86 shows data regarding the evaluation of antibody production in response to administration of CDC (compared to PBS). DETAILED DESCRIPTION OF THE INVENTION

[0041] Detailed Description of the Invention

[0042] Some embodiments disclosed herein relate to methods of treating diseases, disease states, and / or disease symptoms using CDC, CDC-XO, CDC-EV, isolated molecular cargos of CDC (e.g., individual molecules or combinations of molecules derived from CDC, CDC-XO, and / or CDC-EV); and / or combinations of the foregoing. In some embodiments, the disease is a dystrophinopathy. In some embodiments, the disease state is a dystrophic disorder. In some embodiments, the dystrophinopathy comprises one or more of Duchenne muscular dystrophy (DMD) and / or Becker muscular dystrophy. In some embodiments, the disease state is a myopathy. In some embodiments, the myopathy is a skeletal myopathy. In some embodiments, the method comprises administering a therapeutically effective amount of CDC, CDC-XO, CDC-EV, CDC-XO, or CDC-EV molecular cargo and / or combinations of the foregoing to a subject (e.g., patient) suffering from the disease, thereby treating the disease and / or symptoms thereof. Some embodiments of the methods and compositions provided herein are based, inter alia, on the surprising discovery that despite the finding that intravenous administration of CDCs to mdx mice results in at least a portion of the administered CDCs accumulating in the lungs, various data presented herein demonstrate that administration of a therapeutically effective amount of CDCs to human subjects suffering from skeletal muscular dystrophy achieves functional improvement of dystrophic skeletal muscle, thereby enabling the effective treatment of human subjects suffering from skeletal muscular dystrophy, e.g., Duchenne muscular dystrophy (DMD).

[0043] As used herein, "and / or" refers to any and all combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted as alternatives ("or").

[0044] "Treate" or "treating" or "treatment" refers to any type of action that provides a modulating effect, which may be, for example, a beneficial effect for a subject suffering from a disorder, disease, or condition, including preventing the onset of symptoms associated with the condition, improving the subject's condition (e.g., one or more symptoms or disease), slowing or reducing the progression of a condition, and / or altering clinical parameters, the disease or condition, curing the condition, etc.

[0045] As used herein, the term "therapeutically effective amount" refers to an amount of a therapeutic agent (e.g., CDC-XO, CDC-EV, molecular cargos of CDC, XO, and EV, or combinations thereof) that provides a modulating effect to a subject suffering from a disorder, disease, or condition, which may be, for example, a beneficial effect, including improvement of the subject's condition (e.g., modulation of one or more symptoms), slowing or reducing the progression of the condition, preventing or delaying the onset of the disorder, and / or altering clinical parameters, disease, or condition, etc. For example, in some embodiments, an effective amount can refer to the amount of a composition, compound, or agent that improves the condition in a subject by at least 5%, e.g., at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100%. Actual dosage levels of the active ingredients and agents in the active compositions of the disclosed subject matter may be varied to administer an effective amount of the active agent(s) to achieve the desired response for a particular subject and / or application. The selected dosage level will depend on various factors, including, but not limited to, the activity of the composition, formulation, route of administration, combination with other drugs or treatments, the severity of the condition being treated, and the physical condition and prior medical history of the subject being treated. Determining and adjusting the effective dose, as well as evaluating the timing and manner of making such adjustments, are contemplated herein. The term "therapeutically effective amount" refers to an amount of CDC-XO, CDC-EV, CDC, and / or molecular cargo XO and EV sufficient to permanently (e.g., substantially irreversibly) restore dystrophin re-expression and / or skeletal muscle function in targeted dystrophic skeletal muscle.

[0046] As used herein, the term "targeted dystrophic skeletal muscle" refers to the delivery of an amount of CDC-XO, CDC-EV, CDC, molecular cargo CDC-XO and CDC-EV, and / or combinations thereof at the site of dystrophic skeletal muscle. In some embodiments, targeted delivery does not include accidental, accidentally, or inadvertent delivery of CDC-XO, CDC-EV, CDC, and / or molecular cargo CDC-XO and CDC-EV to the target site. In some embodiments, targeted delivery does not include systemic delivery. In some embodiments, targeted delivery does not include accidental, accidentally, or inadvertent delivery of an amount of CDC-XO, CDC-EV, CDC, and / or molecular cargo CDC-XO and CDC-EV at the site of dystrophic skeletal muscle that may be insufficient to treat a dystrophinopathy.

[0047] As used herein, the term "dystrophic" is the absence or deficiency of dystrophin (e.g., in skeletal and / or cardiac muscle).

[0048] Cells release various types of extracellular vesicles (EVs), termed exosomes (XOs) and microvesicles (MVs), originating from endosomes and the plasma membrane into the extracellular environment. EVs are an important mode of intercellular communication, serving as vehicles for the transfer of molecular cargo (e.g., one or more cytoplasmic proteins, lipids, and RNA) between cells and across cell membranes. XOs, secreted lipid vesicles containing a rich milieu of biological factors, provide potent paracrine signals, thereby enhancing the biological effects of stem cells on neighboring cells, including diseased or damaged cells. By encapsulating and transferring proteins, bioactive lipids, and nucleic acid cargo, these natural delivery devices can induce significant phenotypic and functional changes in recipient cells, leading to the activation of regenerative programs. Administration of XOs was demonstrated to treat heart failure in mdx mice in International Publication No. 2016 / 05491, the entire contents of which are incorporated herein by reference.

[0049] Some embodiments disclosed herein relate to the use of CDCs and CDC-XOs in methods for therapeutic applications. In some embodiments, methods for treating dystrophinopathy described herein include administering a therapeutically effective amount of CDCs and / or CDC-XOs to a subject suffering from or having a dystrophinopathy, thereby treating the subject. In some embodiments, the subject is a pediatric subject with a dystrophinopathy. In some embodiments, XOs are isolated from CDCs. In some embodiments, CDCs are grown in serum-free medium. In some embodiments, the dystrophinopathy is Duchenne muscular dystrophy. In other embodiments, the dystrophinopathy is Becker muscular dystrophy. In some embodiments, CDC-XOs, CDC-EVs, molecular cargos of CDC-XOs or CDC-EVs, CDCs producing XOs and EVs, and / or combinations of the above are used in methods to achieve dystrophin re-expression. In some embodiments, the inventors have contemplated novel therapeutic methods described herein for the first time, e.g., methods for treating skeletal DMD by administering therapeutically effective amounts of CDCs and / or CDC-EVs in single or multiple systemic doses, by systemic intraventricular injection of CDC-EVs, and similarly by direct intramuscular injection of CDC-EVs into the skeletal muscle of mdx mice, including CDC-XO, CDC-EVs, CDC-XO or CDC-EV molecular cargo, CDC producing XO and EVs, and / or combinations. In some embodiments, the disease is muscular dystrophy.

[0050] The data and experiments disclosed herein demonstrate the unexpected benefits of CDCs, CDC-XOs, and / or CDC-EVs in inducing dystrophin expression. As shown elsewhere herein, injection of CDCs into the hearts of mdx mice boosts full-length dystrophin protein levels in both the heart and skeletal muscle, dramatically and durably improving cardiac function, ambulatory capacity, and survival. Similar results have been demonstrated in human Duchenne cardiomyocytes. A positive factor appears to reside in cellular XOs generated by CDCs, which are lipid bilayer nanovesicles secreted by cells when multivesicular endosomes fuse with the plasma membrane.

[0051] In some embodiments, XO (and EV) secreted by human CDC has been demonstrated to recapitulate the benefits of CDC in mdx mice and human Duchenne cardiomyocytes. In some embodiments, delivery of non-coding RNA species found in CDC-XO (e.g., miR-148a) mimics the ability of CDC, CDC-XO, and / or CDC-EV to increase dystrophin protein levels without affecting transcript length or exon / intron junctions. In some aspects, CDC-XO-mediated non-coding RNA translocation ameliorates DMD by restoring dystrophin in cardiac and skeletal muscle.

[0052] In some embodiments, the results described herein validate CDCs and their XOs (and / or EVs) as a treatment option for dystrophinopathy. CDCs and their secreted XOs (and / or EVs) robustly increase dystrophin levels in the heart and skeletal muscle. In some embodiments, increased dystrophin levels in the heart and skeletal muscle are associated with significant and sustained systemic benefits following injection of CDCs, CDC-XOs, and / or CDC-EVs into the body (e.g., systemically or locally, including locally into skeletal muscle). In some embodiments, as disclosed herein, CDCs, CDC-XOs, and / or CDC-EVs are not only regenerative but also anti-inflammatory and anti-fibrotic. CDCs secrete diffusible factors that promote angiogenesis, recruit endogenous progenitor cells, and successfully proliferate surviving cardiac cells; transplanted CDCs also suppress maladaptive remodeling and apoptosis. In some embodiments, CDC operates via an indirect pathway (via CDC-XO and / or CDC-EV), which acts indirectly via the secretion of CDC-XO and / or CDC-EV containing non-coding RNAs, including microRNAs (components of molecular cargo). In some embodiments, homologous CDCs are completely eliminated within weeks, while their functional and structural benefits persist for at least six months. These diverse mechanisms are mediated through the secretion of CDC-XO and / or CDC-EV by non-coding RNAs, including microRNAs.

[0053] Without being bound by any particular theory, the above mechanisms, with application to similar muscular dystrophies such as Becker muscular dystrophy, give CDC, CDC-EV, or CDC-XO the ability to treat DMD. In some embodiments, CDC, CDC-XO, and / or CDC-EV replace dystrophin and counteract the pathophysiological consequences of dystrophin loss by recruiting regenerative cells, reversing fibrosis, and targeting inflammation. In some embodiments, by reversing the core defect of DMD in pediatric patients, the methods herein can forestall or prevent disease progression, allowing these patients to avoid comorbidities that may significantly limit therapeutic intervention options.

[0054] While the methods disclosed herein include those involving the delivery of CDCs to patients, in some embodiments, the use of CDC-EVs (e.g., CDC-XO) secreted by CDCs rather than cells may offer advantages compared to transplantation and delivery of cells themselves. In some embodiments, CDC-EVs and CDC-XOs, including those produced by CDCs, may provide a powerful and abundant source for developing "cell-free" therapies. In contrast to cell therapies, CDC-XO-based "cell-free" therapies offer one or more of the following advantages in regenerative medicine: As nonviable entities with low or no immunogenic or tumorigenic potential, these characteristics significantly eliminate certain safety concerns. In some embodiments, stem cell-derived exosomes (and / or CDC-XOs) may be less immunogenic than parental cells due to their reduced content of membrane-bound proteins, including MHC complex molecules. In some embodiments, CDC-XO encapsulation of bioactive components within lipid vesicles can protect the contents from degradation in vivo, thereby potentially negating the obstacles often associated with the delivery of soluble molecules such as cytokines, growth factors, transcription factors, RNA, etc. In some embodiments, the ease of administration (and / or storage) of CDC-XO and / or CDC-EV ultimately allows for repeated and sustained delivery to patients, thereby maximizing the potential for regeneration and repair of diseased and / or dysfunctional tissues.

[0055] In some embodiments, CDCs and / or CDC-XO can be used to stimulate numerous cellular, tissue, and physiological processes, including immunomodulatory processes, angiogenesis, and endothelial cell migration. Based on the pathophysiology of DMD patients, including increased oxidative and / or nitrosative stress, increased inflammation, and a pro-apoptotic and remodeling environment, as disclosed herein, therapeutic approaches involving CDCs and / or CDC-XO secreted by cells offer significant advantages in reversing the course of the disease (and one or more of the aforementioned disease states and / or symptoms). In some embodiments, CDCs, CDC-XO, and / or CDC-EVs promote antioxidant, anti-inflammatory, anti-apoptotic, and anti-remodeling effects. In some embodiments, CDCs, CDC-XO, and / or CDC-EVs enhance the regenerative capacity of diseased cells and tissues. In some embodiments, administration of CDCs, CDC-XO, and / or CDC-EVs is beneficial in delaying and / or reversing DMD, and exosome populations derived from CDCs enable these benefits to be achieved. Early therapeutic intervention in pediatric subjects provides durable, systemic benefits that prevent or avoid late-stage disease comorbidities such as heart failure. In some embodiments, these sustained benefits are equal to, or at least about, 3 months, 6 months, 12 months, or ranges including and / or spanning the foregoing values.

[0056] Some embodiments of exosomes.XOs are lipid bilayer vesicles enriched in various biological factors, such as cytokines, growth factors, transcription factors, lipids, and coding and non-coding nucleic acids. XOs are found in blood, urine, amniotic fluid, interstitial spaces, and the extracellular space. These exocytic vesicles of endosomal origin range in size from 30 nm to 200 nm, including sizes from 40 nm to 100 nm, and have a cup-like morphology as revealed by electron microscopy. Their initial formation begins with inward budding of the plasma membrane to form endosomes, followed by invagination of the limiting membrane of late endosomes to form multivesicular bodies (MVBs). Fusion of MVBs with the plasma membrane then results in the release of the internal vesicles into the extracellular space, forming vesicles known as exosomes. In some embodiments, the XOs described herein are exocytosed and / or endosomal extracellular vesicles. In some embodiments, the XOs described herein can have diameters equal to or at least about: 30 nm, 50 nm, 100 nm, 150 nm, 200 nm, or ranges including and / or ranging from the foregoing values.

[0057] As described herein, the "cargo" content of XOs reflects their parental cell origin, containing distinct subsets of biological factors associated with the parental cell origin, including the cellular regulatory state of the parental cell at the time of formation. The rich biological milieu within exosomes, including cytokines and growth factors, lipids, and various proteins, including coding and non-coding RNA molecules, all necessarily originate from the parental cell. In addition to containing a rich array of cytoplasmic derivatives, exosomes also express the extracellular domains of membrane-bound receptors on their surface.

[0058] In some embodiments, the described encapsulation and formation process creates heterogeneity in XO compositions based on the parent cell origin and regulatory conditions at the time of formation. Nevertheless, in some embodiments, the common budding and release mechanism establishes a set of common properties as a result of their origin, such as endosome-associated proteins (e.g., Rab GTPases, SNAREs, annexins, flotillins), proteins known to cluster into microdomains at the plasma membrane or endosomes (four-transmembrane domain tetraspanins, e.g., CD63, CD81, CD82, CD53, and CD37), lipid raft-associated proteins (e.g., glycosylphosphatidylinositol-anchored proteins and flotillins), cholesterol, sphingomyelin, and hexosylceramide.

[0059] In some embodiments, in addition to components reflecting the vesicle's origin, XOs contain both mRNAs and microRNAs associated with signaling processes, with cargo mRNAs translatable in recipient cells or microRNAs functionally degrading target mRNAs in recipient cells. In some embodiments, other non-coding RNAs capable of influencing gene expression may also be present in XOs. The processes governing the selective incorporation of mRNA or microRNA populations into XOs are not fully understood, and without being bound by any particular theory, it is believed that RNA molecules are selectively, rather than randomly, incorporated into XOs, as demonstrated by the enrichment of XO cargo RNAs compared with the RNA profiles of other exosomes and their cells of origin. In some embodiments, without being bound by theory, given the potential role of RNA molecules in disease pathogenesis and regenerative processes, the presence of RNA molecules in XOs and their apparent efficacy in affecting target recipient cells renders XOs and their molecular cargoes therapeutically effective, as disclosed elsewhere herein.

[0060] In some embodiments, the natural double membrane encapsulation of exosomes also provides a protected and controlled internal microenvironment that allows the cargo contents to persist or travel without degradation in the bloodstream or tissues. In some embodiments, subsequent release of this cargo into the extracellular environment allows interaction with recipient cells through adhesion to the cell surface mediated by lipid-ligand-receptor interaction, internalization via endocytic uptake, or direct fusion of the vesicle with the cell membrane. These processes release the exosomal cargo contents into the target cell.

[0061] In some embodiments, XO cell interactions can modulate genetic pathways in target recipient cells, as induced by any of several different mechanisms, including antigen presentation, transcription factors, cytokines, growth factors, and transfer of nucleic acids such as mRNA and microRNA.

[0062] Exosome isolation and preparation.In some embodiments, XO isolation can be achieved using their common biochemical and biophysical characteristics for separation and analysis. In some embodiments, differential ultracentrifugation can be used as a technique to isolate secreted XO from the supernatant of cultured cells. In some embodiments, this approach allows for the separation of XO from non-membranous particles by leveraging their relatively low buoyant density. In some embodiments, size exclusion allows for their separation from biochemically similar but biophysically distinct MVs, which have larger diameters up to 1000 nm. In some embodiments, MVs are also included in the therapeutic mixture along with XO (if EVs contain both XO and MVs), and / or MVs are not removed from XO. In other embodiments, XO can be isolated from MVs such that XO is enriched and / or substantially free of MVs. In some embodiments, differences in flotation velocity further enable the separation of exosomes of different sizes. In some embodiments, XO sizes range from 30 nm to 200 nm in diameter, including sizes from 40 nm to 100 nm. In some embodiments, the disclosed MVs and EVs have a size (in nm) of about 1000 nm, 750 nm, 500 nm, 400 nm, 300 nm, 250 nm, 200 nm or greater, or a range including and / or spanning the aforementioned values.

[0063] In some embodiments, further purification of XOs can be performed based on the specific properties of the particular exosomes of interest, including, for example, the use of immunoadsorption with a protein of interest to select for exoplasmic or outward-bound specific vesicles.

[0064] In some embodiments, XO (and / or MV) can be isolated using any one of differential centrifugation, discontinuous density gradients, immunoaffinity, ultrafiltration, and high-performance liquid chromatography (HPLC), but differential ultracentrifugation is used. In some embodiments, this technique utilizes increasing centrifugal forces from 2,000 × g to 10,000 × g to separate medium- and large-sized particles and cellular debris from the exosome pellet at 100,000 × g. While centrifugation alone allows significant separation / collection of XO from conditioned medium, in some embodiments, ultracentrifugation can also remove various protein aggregates, genetic material, and particles derived from medium and cellular debris, which are common contaminants. In some embodiments, enhanced specificity of exosome purification can be achieved by employing continuous centrifugation in combination with ultrafiltration or equilibrium density gradient centrifugation in a sucrose density gradient to provide higher purity of exosome preparations (flotation density 1.1 g / ml to 1.2 g / ml) or the application of a separate sugar cushion during preparation.

[0065] In some embodiments, ultrafiltration can be used to purify exosomes without compromising biological activity. In some embodiments, membranes have various pore sizes, such as molecular weight cutoffs (MWCOs) of about 200 kDa, 100 kDa, 75 kDa, 50 kDa, or less, or ranges inclusive and / or spanning the aforementioned values. In some embodiments, gel filtration may be used alternatively or additionally to eliminate small particles. In some embodiments, membrane (e.g., dialysis, ultrafiltration, etc.) and / or gel filtration is performed using a substantially physiological pH and / or a substantially physiological salt concentration (e.g., avoiding the use of non-neutral pH or non-physiological salt concentrations). In some embodiments, a tangential flow filtration (TFF) system is used. In some embodiments, TFF systems are scalable (up to over 10,000 L) and can not only purify but also concentrate the XO fraction. In some embodiments, such an approach is advantageously less time-consuming than differential centrifugation. In some embodiments, HPLC is used to purify XO. In some embodiments, HPLC can be used to purify exosomes into uniformly sized particles and maintain their biological activity as the preparation is maintained at physiological pH and salt concentration.

[0066] In some embodiments, chemical methods are used to isolate XO. In some embodiments, these chemical methods include separation by differential solubility in a precipitation technique. In some embodiments, a precipitation reagent is added to a solution of XO to purify XO. In some embodiments, these chemical methods include separation by addition to a volume-excluding polymer (e.g., polyethylene glycol (PEG)). In some embodiments, these chemical methods can be combined with additional rounds of centrifugation or filtration. In some embodiments, for example, a precipitation reagent, ExoQuick®, is added to the conditioned cell medium to immediately and rapidly precipitate the exosome population. In some embodiments, flow field-flow fractionation (F1FFF), an elution-based technique used to separate and characterize macromolecules (e.g., proteins) and nano- to micro-sized particles (e.g., organelles and cells), is applied to fractionate exosomes from culture media.

[0067] In some embodiments, depending on the biochemical and biophysical characteristics of XO, focused techniques beyond those otherwise disclosed herein may be applied to isolated specific exosomes of interest. In some embodiments, antibody immunoaffinity is used to recognize XO-associated antigens. In some aspects, XO express the extracellular domain of a membrane-bound receptor on the surface of the parent cell membrane. In some embodiments, this expression allows for the isolation and separation of XO in relation to the parent cell's origin based on a shared antigen profile. In some embodiments, conjugation to magnetic beads, chromatography matrices, plates, or microfluidic devices, and / or combinations of such techniques with other techniques disclosed herein, allows for the isolation of specific XO or MV populations of interest (e.g., potentially related to the regulatory state of the parent cell or related cells of interest). Other affinity capture methods use lectins that bind to specific sugar residues on the surface of XO.

[0068] Exosome-based therapies.In some embodiments, as disclosed elsewhere herein, XO-based therapies advantageously enable potential "cell-free" therapies (e.g., CDCs, etc., are separated from CDC-XOs, etc.). The use of "cell-free" therapies retains the potential benefits of cell therapy with reduced risk and / or can be used in situations where cell therapy is unavailable (and / or impossible). In some embodiments, as described elsewhere herein, the therapeutic benefits of cell-based therapies, such as CDCs, may arise through indirect mechanisms involving regenerative tissue arising from endogenous sources. In some embodiments, cellular XOs produced by CDCs may enable the production and delivery of growth factors, transcription factors, cytokines, and nucleic acids for novel therapeutic approaches in ways that not only ameliorate disease progression but also repair and regenerate diseased and / or dysfunctional tissues. In this regard, CDC-derived exosomes may effectively address major unmet medical needs by mobilizing synergistic mechanisms to attract endogenous stem cells to sites of myocardial injury, promote cellular differentiation, and reverse the pathophysiology of chronic diseases such as Duchenne muscular dystrophy. In some embodiments, the CDC may be used as a manufacturer of XO (and / or EV), advantageously providing a continuous source of XO in the patient throughout their stay at the CDC.

[0069] In some embodiments, particularly for chronic conditions such as DMD, repeated and sustained delivery of CDC-XO or CDC producing XC to patients may enhance the likelihood of regenerating and repairing diseased and / or dysfunctional tissue in a manner that may be easier and potentially safer than using cell-based therapies. Dosage regimens and schedules are disclosed in further detail elsewhere herein.

[0070] In some embodiments, as disclosed elsewhere herein, the administration method and amount of XO and / or CDC provided to a patient can be provided by various methods to deliver a therapeutic dose. In some embodiments, for example, compositions and / or solutions for administration of XO contain about 1 mg to about 100 mg of CDC-XO protein in a single dose. In some embodiments, a dose of CDC-EV (e.g., CDC-XO) may contain EV or XO (in mg) equal to or at least about: 1 mg, 10 mg, 25 mg, 50 mg, 75 mg, 100 mg, 200 mg, or a range including and / or ranging from the foregoing values. In some embodiments, the administration method includes multiple administrations of each single dose to a subject. In some embodiments, administering a composition (e.g., a composition comprising CDC-XO, CDC-EV, CDC, or a combination thereof) includes injection. In some embodiments, the injection includes skeletal muscle injection. In some embodiments, the injection includes intraperitoneal injection. In some embodiments, administering a composition includes intra-arterial or intravenous infusion. In some embodiments, treatment of a subject (e.g., by delivery of single or multiple doses of CDC-XO and / or CDCs that release CDC-XO) results in increased dystrophin expression. In some embodiments, increased dystrophin expression occurs in skeletal muscle of the extremities (e.g., one or more of the arms or legs). In some embodiments, increased dystrophin expression occurs in the diaphragm. In some embodiments, the patient undergoing a treatment disclosed elsewhere herein is a pediatric patient suffering from cardiomyopathy. In some embodiments, the pediatric subject has been diagnosed with cardiomyopathy. In some embodiments, the pediatric subject suffers from cardiomyopathy but does not suffer from heart failure. In some embodiments, the pediatric subject is between 3 and 11 years of age. In other embodiments, the pediatric subject is between 12 and 18 years of age. In some embodiments, the human subject is a pediatric subject of an age of about 3, 6, 11, 12, 15, 18, or less, or a range of ages including and / or ranging from the foregoing values.

[0071] In some embodiments, administering a composition (e.g., comprising CDC, CDC-XO, or CDC-EV) as otherwise disclosed herein comprises injection. In some embodiments, the injection comprises skeletal muscle injection. In some embodiments, the injection comprises intraperitoneal injection. In some embodiments, administering the composition comprises intra-arterial or intravenous infusion. In some embodiments, treating the subject results in increased dystrophin expression. In some embodiments, the increased dystrophin expression occurs in skeletal muscle of the limbs. In other embodiments, the increased dystrophin expression occurs in the diaphragm. In other embodiments, the subject suffers from cardiomyopathy. In other embodiments, the subject has been diagnosed with cardiomyopathy. In other embodiments, the subject suffers from cardiomyopathy but does not suffer from heart failure. In other embodiments, the subject is between 3 and 11 years old. In other embodiments, the subject is between 12 and 18 years old.

[0072] Described herein are compositions and methods that provide significant benefits in the repair or regeneration of damaged or diseased tissue via CDC and CDC-XO. Certain assistive technologies are described, for example, in U.S. Patent Application Nos. 11 / 666,685, 12 / 622,143, 12 / 622,106, and 14 / 421,355, and International Application Nos. PCT / US2013 / 054732, PCT / US2015 / 053853, PCT / US2015 / 054301, and PCT / US2016 / 035561, which are incorporated herein by reference in their entireties.

[0073] In some embodiments, described herein are methods for treating a skeletal muscle disease, comprising administering a therapeutically effective amount of CDCs and / or CDC-XO to a subject, thereby treating the subject. Further described herein are methods for treating a skeletal muscle disease, comprising administering a therapeutically effective amount of a composition comprising CDCs and / or CDC-XO to a subject, thereby treating the subject. In other embodiments, the composition comprises a pharmaceutically acceptable carrier. Further described herein are methods for treating a chronic muscle disease, comprising administering a therapeutically effective amount of a composition comprising a plurality of CDCs and / or CDC-XO to a subject, thereby treating the subject. In various embodiments, the plurality of CDCs and / or CDC-XO are isolated from CDCs grown in serum-free medium. In various embodiments, the exosomes have a diameter of about 90 nm to about 200 nm and are CD81+, CD63+, or both. In other embodiments, the chronic muscle disease includes a dystrophinopathy. In various embodiments, the dystrophinopathy includes Duchenne muscular dystrophy. In various embodiments, the dystrophinopathy includes Becker muscular dystrophy. In various embodiments, the subject is a pediatric patient under the age of 18. In various embodiments, the subject is a prepubertal patient under the age of 13. In various embodiments, the subject is a prepubertal patient under the age of 12. In various embodiments, the subject is a prepubertal patient under the age of 11. In various embodiments, the subject is a prepubertal patient under the age of 10. In various embodiments, the subject is between the ages of 3 and 11. In various embodiments, the subject is between the ages of 12 and 18.

[0074] Some embodiments described herein are methods for treating skeletal muscle diseases, comprising administering a therapeutically effective amount of CDC-XO, CDC-EV, and / or XO-released CDC to a subject, thereby treating the subject. Some embodiments relate to methods for treating skeletal muscle diseases, comprising administering a therapeutically effective amount of a composition comprising CDC-XO, CDC-EV, and / or XO-released CDC to a subject, thereby treating the subject. In some embodiments, the composition comprises a pharmaceutically acceptable carrier. Further described herein are methods for treating chronic muscle diseases, comprising administering a therapeutically effective amount of a composition comprising CDC-XO, CDC-EV, and / or XO-released CDC to a subject, thereby treating the subject. In some embodiments, the chronic muscle disease comprises a dystrophinopathy. In other embodiments, the dystrophinopathy is Duchenne muscular dystrophy. In some embodiments, the dystrophinopathy comprises Becker muscular dystrophy. In various embodiments, the subject is a pediatric patient under the age of 18. In various embodiments, the subject is a prepubertal patient under the age of 13. In various embodiments, the subject is a prepubertal patient under the age of 12. In various embodiments, the subject is a prepubertal patient under the age of 11. In various embodiments, the subject is a prepubertal patient under the age of 10. In various embodiments, the subject is between the ages of 3 and 11. In various embodiments, the subject is between the ages of 12 and 18.

[0075] In various embodiments, the subject is suffering from cardiomyopathy. In various embodiments, the subject is suffering from cardiomyopathy but not from heart failure. In various embodiments, the subject has been diagnosed with cardiomyopathy. In various embodiments, the subject has been diagnosed with cardiomyopathy but not heart failure.

[0076] In various embodiments, the cardiomyopathy includes one or more of cell membrane degradation, interstitial inflammation, fatty replacement, and fibrosis. In various embodiments, the cardiomyopathy includes left ventricular posterior basilar fibrosis; and intra-atrial conduction abnormalities, including SVT with abnormal atrioventricular nodal conduction. In various embodiments, the cardiomyopathy includes advanced stages of ventricular enlargement, dyspnea, peripheral edema, and hepatomegaly. In various embodiments, heart failure (HF) includes asymptomatic abnormalities (Stage B), in which cardiac structure and function are compromised, overt HF (Stage C), and advanced HF (Stage D). In various embodiments, the subject is suffering from a smooth muscle myopathy involving vascular dysfunction, further including involvement of the GI and urinary systems.

[0077] In some embodiments, the subject is one or more of the above, such as one of the above age groups, and has and / or has been diagnosed with cardiomyopathy and / or heart failure, including, for example, a subject aged 3-11 years who has and / or has been diagnosed with cardiomyopathy but not heart failure.

[0078] In other embodiments, administering a therapeutically effective amount of the composition is about 1 x 10 in a single dose. 5 pieces~approx. 1×10 8 In another example, the number of CDCs administered includes 25 million CDCs per coronary artery (i.e., 75 million CDCs total) as another baseline for exosome dosage. In various embodiments, the number of CDCs is 1 x 10 or more in a single dose as another baseline for exosome dosage. 5 pieces, 1×10 6 pieces, 1×10 7 pieces, 1×10 8 pieces, 1×10 9 In certain instances, this may be divided proportionately by body weight (total CDC dose ranging from 100,000 CDC / kg body weight to 1M CDC / kg body weight). In various embodiments, administration may be repeated dosing of two, three, four, four or more consecutively applied doses.

[0079] In other embodiments, administering a therapeutically effective amount of the composition includes injection, including intra-arterial and intravenous injection. In other embodiments, the injection results in systemic delivery. In other embodiments, the injection can deliver a therapeutically effective amount of exosomes to one or more locations in the body. In other embodiments, the injection can deliver a therapeutically effective dose of exosomes to smooth muscle tissue or skeletal muscle tissue. In other embodiments, administering a therapeutically effective amount of the composition includes injection. In other embodiments, the injection includes intramyocardial injection, injection into the heart, including the heart cavities and endocardial cavities and their associated blood vessels. In other embodiments, injection into the heart, heart cavities and endocardial cavities and their associated blood vessels can deliver a therapeutically effective dose of exosomes to smooth muscle or skeletal muscle tissue. In other embodiments, the injection includes skeletal muscle injection. In other embodiments, the injection includes intraperitoneal injection. In other embodiments, the injection includes percutaneous injection.

[0080] In another embodiment, treating a subject results in increased dystrophin expression. In another embodiment, increased dystrophin expression occurs in skeletal muscle, including skeletal muscle of the limbs, such as the soleus. In another embodiment, increased dystrophin expression occurs in the diaphragm. In another embodiment, treating a subject results in decreased fibrosis, decreased inflammation, and / or increased mitochondrial function. In another embodiment, decreased fibrosis includes decreased collagen accumulation. In another embodiment, collagen includes collagen I and / or collagen III. In another embodiment, decreased inflammation includes increased cytoplasmic nuclear factor (erythroid-derived 2)-like 2 (Nrf2), decreased fatty acid peroxidation end products, decreased number of inflammatory cells, and / or increased expression of antioxidants. In another embodiment, antioxidants include heme oxygenase-1 (HO-1), catalase, superoxide dismutase-2 (SOD-2), and glutamate cysteine ​​ligase catalytic (GCLC) subunits. In another embodiment, inflammatory cells include CD68 + Macrophages and CD3 +In another embodiment, the increased mitochondrial function comprises an increase in mitochondrial ultrastructure and / or an increase in mitochondrial biogenesis. In another embodiment, the increased mitochondrial function comprises an increase in nuclear PPAR-γ coactivator-1 (PGC-1) expression.

[0081] In various embodiments, the CDCs are generated from a biopsy sample that is cultured into explants, further cultured into explant-derived cells, further cultured as cardiosphere-forming cells, then cultured as cardiospheres, and subsequently cultured. In other embodiments, the CDCs are human. In various embodiments, the CDCs are generated from a biopsy sample obtained from a subject suffering from a dystrophinopathy.

[0082] In other embodiments, treating a subject further comprises assessing the subject's functional improvement, including functional improvement of skeletal muscle tissue. In various embodiments, functional improvement includes one or more of increased contractile strength, improved walking ability, improved ability to stand from a sitting position, improved ability to sit from a lying or supine position, and improved manual dexterity, such as mouse pointing and / or clicking. In other embodiments, treating a subject further comprises assessing cognition in response to treatment of nerve injury, blood oxygen transfer in response to treatment of lung injury, and immune function in response to treatment of damaged immunologically relevant tissue.

[0083] In some embodiments, described herein are methods comprising isolating a biopsy specimen from a subject, culturing the biopsy specimen as an explant to generate explant-derived cells (EDCs), culturing the EDCs into cardiospheres, and inducing the formation of cardiosphere-derived cells (CDCs). In other embodiments, the method comprises administering the CDCs to the subject. In other embodiments, the method comprises isolating exosomes from the CDCs and administering the CDC-derived exosomes to the subject. In various embodiments, culturing the biopsy specimen as an explant comprises mincing the biopsy specimen and culturing it on a fibronectin-coated vessel. In various embodiments, generating EDCs comprises isolating cells from the explant. In various embodiments, the cells isolated from the explant include loosely attached cells and / or interstitial-like cells. In various embodiments, culturing the EDCs into cardiospheres comprises culturing the EDCs on poly-D-lysine plates. In various embodiments, forming CDCs comprises culturing detached cardiospheres on a fibronectin-coated vessel. Further examples and embodiments for producing CDCs are described in U.S. Patent Application Publication No. 6,217,415, which is incorporated herein by reference in its entirety. In various embodiments, isolating CDC-derived exosomes comprises the use of any of the techniques described herein. In various embodiments, administering CDCs to a subject comprises the use of any of the techniques described herein. In various embodiments, administering CDCs or CDC-derived exosomes to a subject comprises the use of any of the techniques described herein. In various embodiments, the biopsy specimen is isolated from the same subject administered the CDCs or CDC-derived exosomes. In various embodiments, the biopsy specimen is isolated from a different subject than the subject administered the CDC-derived exosomes. In various embodiments, the subject suffers from a chronic muscle disease. In other embodiments, the chronic muscle disease comprises a dystrophinopathy. In other embodiments, the dystrophinopathy is Duchenne muscular dystrophy. In other embodiments, the dystrophinopathy comprises Becker muscular dystrophy.In various embodiments, the subject suffering from a chronic muscle disease is a pediatric subject under the age of 18. In various embodiments, the subject is a pre-pubertal subject under the age of 12.

[0084] In some embodiments, delivery of non-coding RNA species found in CDC-derived exosomes (e.g., miR-148a-3p or srDMD, a small 115-nucleotide RNA of previously unknown function) mimics the ability of CDCs and CDC-derived exosomes to increase dystrophin protein levels without affecting transcript length or exon / intron junctions. In some embodiments, these non-coding RNAs ameliorate Duchenne muscular dystrophy by restoring dystrophin in cardiac and skeletal muscle. In some embodiments, disclosed herein are factors that can replace dystrophin and counteract the pathophysiological consequences of dystrophin loss. In some embodiments, the factors include one or more of miR-148a-3p and srDMD, which are transferred into recipient cells to affect dystrophin expression, thereby establishing the nucleic acids as a treatment option for DMD.

[0085] In some embodiments, RNA polynucleotides are used whose sequences are at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to microRNAs or short non-coding RNAs otherwise referred to herein. As used herein, the term "identical" (i.e., "sequence identity") means that two polynucleotide sequences are the same (i.e., nucleotide-by-nucleotide) over a comparison window. When referring to a percentage of sequence identity (i.e., sequences that are "X% identical," "percent identical"), the percentage of "identity" is calculated by comparing two aligned sequences, including optimally aligned sequences, over the comparison window, determining the number of positions where the same nucleic acid base (A, T, C, G, U, or I) occurs in both sequences to obtain the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window (i.e., window size), and multiplying the result by 100 to obtain the percentage of sequence identity. In some embodiments, the percentage of sequence identity is calculated by comparing a reference sequence to a polynucleotide sequence of interest over a comparison window spanning at least 15 nucleotide positions, frequently at least 15-50, 50-100, or 100 or more nucleotides. In some embodiments, one or more comparison windows between the reference and polynucleotide sequences of interest, including discontinuous segments of the polynucleotide sequences of interest, may be combined to calculate a percentage of sequence identity that accounts for translocations. In some embodiments, the polynucleotide sequence of interest may contain deletions or additions totaling no more than 20 percent of the reference sequence over the comparison window. In some embodiments, the microRNAs of the present invention may contain at least, up to, or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more additional nucleotides at the 5' end, 3' end, or both the 5' and 3' ends. This includes, for example, the addition of GCG-modified miR-148a, which contains a GCG addition at the 5' or 3' end.

[0086] In some embodiments, the one or more polynucleotides are encoded by one or more vectors disclosed elsewhere herein. In some embodiments, the one or more vectors are introduced into cells via a gene delivery vehicle. In some embodiments, the delivery vehicle comprises a viral vector, such as an adenoviral vector (e.g., an adeno-associated viral vector). In some embodiments, the delivery vehicle comprises an expression vector and a delivery vehicle. In some embodiments, the polynucleotides can act on a release factor or the ribosome itself. In some aspects, the one or more polynucleotides can enhance readthrough of dystrophin transcripts.

[0087] In some embodiments, a therapeutic composition can include CDC, CDC-XO, and / or CDC-EV, while in other embodiments, a therapeutic composition can lack CDC and / or vesicles and instead include a composition comprising an effective amount of an RNA polynucleotide or a vector encoding the RNA polynucleotide. In some embodiments, an effective amount of the RNA therapeutic ranges from 0.1 mg / kg to 20 mg / kg, 0.5 mg / kg to 10 mg / kg. In some embodiments, a therapeutically effective amount is a single unit dose. In some embodiments, an effective amount includes a concentration range of 0.1 nM to 10 M. In some embodiments, the concentration ranges from 0.3 nM to 400 nM, and / or 1 nM to 200 nM. In some embodiments, an effective amount includes an amount capable of increasing dystrophin expression in one or more tissues, including, for example, cardiac and skeletal muscle tissue. In some embodiments, short non-coding RNAs and microRNAs comprise RNA polynucleotides of at least, up to, or about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 50, 100, 150, or 200 nucleotides in length (including all integers or ranges that can be derived therebetween, and ranges inclusive and / or spanning the above values). In some embodiments, as with any administration disclosed herein, the administration of a therapeutically effective amount in a dosing regimen will depend on the subject being treated and may be extrapolated based on the size of the patient (extrapolating from a mouse model, increasing for larger patients and decreasing for smaller patients, such as multiplying the mouse dose by a factor of at least about 1500, 2000, 2500, 3000, or a range equal to and / or including and / or ranging from the above values).In some embodiments, the dosing regimen may be a single dose or multiple doses over a period of 10, 20, 30, 40, 50, 60 minutes, and / or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 hours or more, and / or 1, 2, 3, 4, 5, 6, 7 days or more. In some embodiments, dosing may be via a time-release or sustained-release mechanism, as implemented by the formulation and / or mode of administration.

[0088] In some embodiments, one or more RNA polynucleotides are biologically active. In some embodiments, biological activity may include enhanced translational readthrough of a peptide or protein of interest. This includes, for example, assessing biological activity using expression of the peptide or protein in a heterologous expression system. In some embodiments, a heterologous expression fusion protein system, such as dystrophin-eGFP, may be used to transfect cells with wild-type or mutant proteins as a measure of enhanced translational readthrough to assess biological activity. In some embodiments, biological activity may be assessed as a percentage of fluorescence normalized to vehicle alone when compared to the wild-type or mutant protein. In some embodiments, G418 serves as a positive control. In some embodiments, percentages of fluorescence for assessing biological activity include an increase in fluorescent signal of about 10%-25%, 25%-50%, 50%-75%, 75%-100%, or 100% compared to the mutant. In some embodiments, the percentage of fluorescence for assessing biological activity includes 0% to 25%, 25% to 50%, 50% to 75%, 75% to 100%, or 100% of the fluorescence of wild-type peptide or protein expression or a G418 positive control.

[0089] In some embodiments, administering the RNA polynucleotide composition comprises injection, including intra-arterial, intravenous, and intramyocardial injection. In some embodiments, administering the composition comprises injection. In some embodiments, injection comprises intramyocardial injection, injection into the heart, including the cardiac cavities and chambers and associated blood vessels. In some embodiments, injection comprises skeletal muscle injection. In some embodiments, injection comprises intraperitoneal injection. In some embodiments, injection comprises transdermal injection. In some embodiments, administering the composition comprises inhalation.

[0090] In some embodiments, treating a subject with an RNA polynucleotide composition results in increased dystrophin expression. In some embodiments, the increased dystrophin expression occurs in skeletal muscle. In some embodiments, this includes skeletal muscle of the limbs, such as the soleus. In some embodiments, the increased dystrophin expression occurs in the diaphragm. In some embodiments, treating a subject results in reduced fibrosis, reduced inflammation, and / or increased mitochondrial function. In some embodiments, reduced fibrosis includes reduced collagen accumulation. In some embodiments, collagen includes collagen I and / or collagen III. In some embodiments, reduced inflammation includes increased cytoplasmic nuclear factor (erythroid-derived 2)-like 2 (Nrf2), reduced fatty acid peroxidation end products, reduced number of inflammatory cells, and / or upregulated expression of antioxidants. In some embodiments, antioxidants include heme oxygenase-1 (HO-1), catalase, superoxide dismutase-2 (SOD-2), and glutamate cysteine ​​ligase catalytic (GCLC) subunits. In some embodiments, the inflammatory cells include CD68 + Macrophages and CD3 + In some embodiments, the increased mitochondrial function includes increased mitochondrial ultrastructure and / or increased mitochondrial biogenesis. In some embodiments, the increased mitochondrial function includes increased nuclear PPAR-γ coactivator-1 (PGC-1) expression.

[0091] In some embodiments, treating a subject with an RNA polynucleotide further includes improving the subject's function, including improving the function of skeletal muscle tissue. In some embodiments, the functional improvement includes one or more of increased contractile force, improved walking ability, improved ability to stand from a sitting position, improved ability to sit from a lying or supine position, and improved manual dexterity, such as mouse pointing and / or clicking. In some embodiments, treating a subject further includes improving cognition in response to treatment of nerve injury, blood oxygen transfer in response to treatment of lung injury, and immune function in response to treatment of damaged immunologically related tissue.

[0092] In some embodiments, as disclosed elsewhere herein, described herein are RNA polynucleotide compositions comprising one or more RNA polynucleotides, such as 2, 3, 4, 5, 6, 7, 8, 9, 10 or more RNA polynucleotides. In some embodiments, the composition comprises one or more RNA polynucleotides, such as 2, 3, 4, 5, 6, 7, 8, 9, 10 or more RNA polynucleotides. In some embodiments, the RNA comprises non-coding RNA. In some embodiments, non-coding RNA includes tRNA, yRNA, rTNA, mirRNA, IncRNA, piRNA, snRNA, snoRNA, among others, including fragments thereof. In some embodiments, the one or more RNA polynucleotides is microRNA. In some embodiments, the microRNA is selected from the group consisting of miR-148a, miR-215, miR-33a, miR204, miR-376c, miR-4532, miR-4742, miR-582, miR-629, miR-223, miR-3125, miR-3677, miR-376b, miR-4449, miR-4773, miR-4787, miR-491, miR-495, miR-500a, miR-548ah, miR-550, miR-548ah, miR-550a, miR-551n, miR-5581, miR-616, or other microRNAs shown to be enriched in Figure 29. In some embodiments, the microRNA is selected from the group consisting of microRNAs miR-146a, miR148a, miR-22, miR-24, miR-210, miR-150, miR-140-3p, miR-19a, miR-27b, miR-19b, miR-27a, miR-376c, miR-128, miR-320a, miR-143, miR-21, miR-130a, miR-9, miR-185, and miR-23a. In some embodiments, the microRNA comprises miR-148a-3p. In some embodiments, the exosomes comprise a small non-coding RNA derived from DMD, i.e., srDMD. In some embodiments, the one or more polynucleotides are capable of increasing dystrophin expression in a subject.In some embodiments, one or more polynucleotides or vectors comprising one or more polynucleotides can be incorporated into a pharmaceutically active mixture or composition by adding a pharmaceutically acceptable carrier. In some embodiments, a pharmaceutical composition comprises one or more polynucleotides and / or a viral-based vector encoding one or more polynucleotides and a pharmaceutically acceptable carrier. In some aspects, a pharmaceutical composition comprising one or more polynucleotides and / or a vector encoding one or more polynucleotides and a pharmaceutically acceptable carrier or excipient comprises an excipient capable of forming complexes, vesicles, and / or liposomes that deliver one or more polynucleotides, and / or oligonucleotides complexed or entrapped in vesicles or liposomes through a cell membrane. In some embodiments, the excipient comprises one or more of polyethyleneimine and derivatives, or similar cationic polymers including polypropyleneimine or polyethyleneimine copolymers (PEC) and derivatives, synthetic amphiphiles, Lipofectin™, DOTAP, and / or viral capsid proteins capable of self-assembly into particles capable of delivering such one or more polynucleotides.

[0093] In some embodiments, the concentration of the one or more polynucleotides ranges from 0.1 nM to 10 M. In various embodiments, the concentration ranges from 0.3 nM to 400 nM, from 1 nM to 200 nM, and / or any range therebetween. In some embodiments, the one or more polynucleotides may be used at a dose ranging from 0.1 mg / kg to 20 mg / kg, and / or from 0.5 mg / kg to 10 mg / kg. In some embodiments, the one or more polynucleotides include a concentration, which refers to the total concentration of polynucleotides or the concentration of each added polynucleotide.

[0094] In some embodiments, the RNA polynucleotide is a microRNA (and / or a combination of microRNAs), as described elsewhere herein. In some aspects, the microRNA includes miR-148a. In some embodiments, the miR-148a microRNA has the following sequence: 5'GAGGCAAAGUUCUGAGAACACUGCGACUCUGAGUAUGAUAGAAGUCAGUGCACUACAGAACUUUGUCUC3' [SEQ ID NO: 1]. In some embodiments, the microRNA can be designated by the suffix "5P" or "3P," where "5P" indicates that the mature microRNA is derived from the 5' end of the precursor, and the corresponding "3P" indicates that it is derived from the 3' end of the precursor. In some embodiments, the microRNA includes miR-148-5p, which has the sequence 5'AAAGUUCUGAGACACUCCGACU3' [SEQ ID NO: 2]. In some embodiments, the microRNA includes miR-148a-3p, which has the sequence 5'UCAGUGCACUACAGAACUUUGU3' [SEQ ID NO: 3]. In various embodiments, the microRNA comprises an RNA polynucleotide whose sequence is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to miR-148a, miR-148-5p, and / or miR-148a-3p, and / or fragments of any of the foregoing. In some embodiments, the percentage of sequence identity is calculated by comparing a reference sequence to a polynucleotide sequence of interest over a comparison window, e.g., spanning at least 15 nucleotide positions, frequently at least 15-50, 50-100, or 100 or more nucleotides. In some embodiments, one or more comparison windows between the reference and polynucleotide sequences of interest, including discontinuous segments of the polynucleotide sequences of interest, may be combined to calculate a percentage of sequence identity that accounts for translocations. In some embodiments, the polynucleotide sequence of interest may contain deletions or additions totaling no more than 20 percent of the reference sequence over the comparison window.In some embodiments, the microRNAs of the present invention may include at least, up to, or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more additional nucleotides at the 5' end, 3' end, or both the 5' and 3' ends, including, for example, the addition of GCG-modified miR-148a, which has a GCG addition at the 5' or 3' end.

[0095] In some embodiments, the RNA polynucleotide is a short non-coding RNA derived from Duchenne dysrophy (DMD), or srDMD, which has the sequence 5'UGUACACAGAGGCUGAUCGAUUCUCCCUGAACAGCCUAUUACGGAGGCACUGCAGAUCAAGCCCGCCUGGAGAGGUGGAGUUUCAAGAGUCCCUUCCUGGUUCACCGUCUCCUUU3' [SEQ ID NO: 4].

[0096] In some embodiments, the short non-coding RNA comprises an RNA polynucleotide whose sequence is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to srDMD and / or a fragment thereof. This includes, for example, a 113 nucleotide long variant of srDMD (srDMD variant) having the sequence 5'UGUACACGGUGGAGUUUCAAGAGUCCCUUCCUGGUUCACCGUCUCCUUUAGAGGCUGAUCGAUUCUCCCUGAACAGCCUAUUACGGAGGCACUGCAGAUCAAGCCCGCCUGGA 3' [SEQ ID NO: 5]. Another example includes the srDMD mutant having the sequence 5'UCCCCACAGAGGCUGAUCGAUUCUCCCUGAACAGCCUCCUCCGGAGGCACUGCAGAUCAAGCCCGCCUGGAGAGGUGGAGUUUCAAGAGUCCCUUCCUGGUUCACCGUCUCCUUU 3' [SEQ ID NO: 6].In some embodiments, the short non-coding RNAs, including microRNAs, are at least or at most 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 , 40 pieces, 41 pieces, 42 pieces, 43 pieces, 44 pieces, 45 pieces, 46 pieces, 47 pieces, 48 ​​pieces, 49 pieces, 50 pieces, 51 pieces, 52 pieces, 53 pieces, 54 pieces, 55 pieces, 56 pieces, 57 pieces, 58 pieces, 5 9 pieces, 60 pieces, 61 pieces, 62 pieces, 63 pieces, 64 pieces, 65 pieces, 66 pieces, 67 pieces, 68 pieces, 69 pieces, 70 pieces, 71 pieces, 72 pieces, 73 pieces, 74 pieces, 75 pieces, 76 pieces, 77 pieces, 78 pieces, 79 pieces, 80 pieces, 81 pieces, 82 pieces, 83 pieces, 84 pieces, 85 pieces, 86 pieces, 87 pieces, 88 pieces, 89 pieces, 90 pieces, 91 pieces, 92 pieces, 93 pieces, 94 pieces, 95 pieces, 96 pieces, 97 pieces, 98 pieces pieces, 99 pieces, 100 pieces, 101 pieces, 102 pieces, 103 pieces, 104 pieces, 105 pieces, 106 pieces, 107 pieces, 108 pieces, 109 pieces, 110 pieces, 111 pieces, 112 pieces, 113 pieces, 114 pieces , 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 140, 145, 150, 160, 170, 180, 190, 200 or more residues in length (including all integers or ranges that can be derived therebetween). In some embodiments, short non-coding RNA, including microRNA, refers to an RNA polynucleotide that is at least, at most, or about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 50, 100, 150, or 200 nucleotides in length (including all integers or ranges that can be derived therebetween).

[0097] In some embodiments, the RNA polynucleotide has biological activity. In some embodiments, biological activity may include enhanced translational readthrough of a peptide or protein of interest. This includes, for example, assessing biological activity using expression of the peptide or protein in a heterologous expression system. For example, heterologous expression fusion protein systems, such as dystrophin-eGFP, can be used to transfect cells with wild-type or mutant proteins as a means of enhancing translational readthrough to assess biological activity. In various embodiments, biological activity may be assessed as a percentage of fluorescence normalized to vehicle alone when compared to the wild-type or mutant protein. In various embodiments, G418 serves as a positive control. In various embodiments, the percentage of fluorescence used to assess biological activity includes an increase in fluorescent signal of about 10% to 25%, 25% to 50%, 50% to 75%, 75% to 100%, or more than 100% compared to the mutant. In various embodiments, the percentage of fluorescence for assessing biological activity includes 0% to 25%, 25% to 50%, 50% to 75%, 75% to 100%, or 100% of the fluorescence of wild-type peptide or protein expression, a G418 positive control.

[0098] In some embodiments, the RNA polynucleotide is synthetic. For example, the nucleic acid can be synthesized using phosphotriester, phosphorous, or phosphoramidite chemistry and solid-phase techniques. In various embodiments, the RNA polynucleotide is produced by recombinant methods. For example, this includes the use of vectors (viral and non-viral), plasmids, cosmids, and other vehicles for delivering nucleic acids to cells, such as host cells (to produce large quantities of the desired RNA molecule).

[0099] In some embodiments, the vector encoding the RNA polynucleotide is a viral vector, such as an adenoviral vector (e.g., an adeno-associated viral vector). In various embodiments, the vector is a non-viral expression vector.

[0100] In some embodiments, the effective amount of RNA ranges from 0.1 mg / kg to 20 mg / kg and / or 0.5 mg / kg to 10 mg / kg. In some embodiments, the therapeutically effective amount is a single unit dose. In some embodiments, the effective amount of RNA includes a concentration ranging from 0.1 nM to 10 M. In some aspects, the concentration of RNA ranges from 0.3 nM to 400 nM, or from 1 nM to 200 nM. In some embodiments, the RNA polynucleotide or vector includes a concentration that refers to the total concentration of the added RNA polynucleotide or vector. In some embodiments, the amount of RNA polynucleotide or RNA vector is an amount effective for a particular result, and refers to the amount necessary to achieve a desired goal, such as inducing a particular cellular characteristic(s). In various embodiments, an effective amount of RNA polynucleotide includes an amount capable of increasing dystrophin expression in one or more tissues, including, for example, cardiac and skeletal muscle tissue.

[0101] In some embodiments, the RNA polynucleotide or a vector encoding the RNA polynucleotide is incorporated into a pharmaceutically active mixture or composition by adding a pharmaceutically acceptable carrier or excipient. In some embodiments, a pharmaceutical composition comprises an RNA polynucleotide and / or a viral-based vector encoding the RNA polynucleotide and a pharmaceutically acceptable carrier or excipient. In some embodiments, a pharmaceutical composition comprising an RNA polynucleotide and / or a vector encoding the RNA polynucleotide and a pharmaceutically acceptable carrier or excipient comprises an excipient capable of forming a complex, vesicle, and / or liposome that delivers the RNA polynucleotide, and / or an oligonucleotide complexed or entrapped in a vesicle or liposome via a cell membrane. Many of these excipients are known to those skilled in the art and include polyethyleneimine and derivatives, or similar cationic polymers including polypropyleneimine or polyethyleneimine copolymers (PEC) and derivatives, synthetic amphiphiles, Lipofectin™, DOTAP, and / or viral capsid proteins capable of self-assembly into particles capable of delivering such RNA polynucleotides. In other embodiments, the RNA polynucleotide is contained within an exosome. In some aspects, the RNA polynucleotides contained within the exosomes are enriched relative to RNA polynucleotides in exosomes derived from cells, hi some embodiments, enrichment may include 10% to 100%, 100% to 200%, 200% to 400%, or 400% to 1000% higher levels of RNA polynucleotides compared to RNA polynucleotides in exosomes derived from cells.

[0102] In some embodiments, methods are provided for treating a chronic muscle disease, comprising administering an RNA polynucleotide or a vector encoding the RNA polynucleotide. In some embodiments, administering the composition treats the chronic muscle disease in a subject. In some embodiments, the chronic muscle disease is a dystrophinopathy. In some embodiments, the dystrophinopathy is Duchenne muscular dystrophy. In some embodiments, the dystrophinopathy is Becker muscular dystrophy. In some aspects, the RNA polynucleotide is a microRNA. In various embodiments, the microRNA comprises miR-148a [SEQ ID NO: 1]. In some embodiments, the microRNA comprises miR-148-5p [SEQ ID NO: 2] and / or miR-148a-3p [SEQ ID NO: 3]. In some embodiments, the microRNA comprises an RNA polynucleotide whose sequence is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical (i.e., percent identity) to miR-148a [SEQ ID NO: 1] and / or fragments thereof (e.g., [SEQ ID NO: 2], [SEQ ID NO: 3]). In some embodiments, the microRNA may comprise at least, or at most about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more additional nucleotides at the 5', 3', or both the 5' and 3' ends. This includes, for example, the addition of GCG-modified miR-148a, where GCG is added to the 5' or 3' end. In some embodiments, the RNA polynucleotide is a short non-coding RNA derived from Duchenne muscular dystrophies (DMD), srDMD. In some aspects, the short non-coding RNA comprises an RNA polynucleotide whose sequence is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to srDMD [SEQ ID NO: 4] and / or fragments thereof. In some embodiments, the short non-coding RNA comprises an srDMD variant [SEQ ID NO: 5] and / or an srDMD variant [SEQ ID NO: 6].

[0103] In some embodiments, administering a composition includes administering an effective amount of an RNA polynucleotide or a vector encoding the RNA polynucleotide. In some embodiments, the effective amount of the RNA polynucleotide or the vector encoding the RNA polynucleotide ranges from 0.1 mg / kg to 20 mg / kg and / or 0.5 mg / kg to 10 mg / kg. In some embodiments, the therapeutically effective amount is a single unit dose. In some embodiments, the effective amount includes a concentration range of 0.1 nM to 10 M. In some embodiments, the concentration ranges from 0.3 nM to 400 nM and / or 1 nM to 200 nM. In some embodiments, the effective amount includes an amount capable of increasing dystrophin expression in one or more tissues, including, for example, cardiac and skeletal muscle tissue. In some embodiments, short non-coding RNAs and microRNAs comprise RNA polynucleotides that are at least, at most, or about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 50, 100, 150, or 200 nucleotides in length (including all integers or ranges that can be derived therebetween).

[0104] In some embodiments, the administration of a therapeutically effective amount in a dosing regimen depends on the subject being treated. In some embodiments, the administration in a dosing regimen may be a single administration or multiple administrations over a period of 10 minutes, 20 minutes, 30 minutes, 40 minutes, 50 minutes, 60 minutes, and / or 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 24 hours or more, and / or 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days or more. Furthermore, administration may be via a time-release or sustained-release mechanism, as implemented by the formulation and / or mode of administration.

[0105] In some embodiments, administering the composition includes injection, including intra-arterial, intravenous, and intramyocardial injection. In some embodiments, administering the composition includes injection. In some embodiments, injection includes intramyocardial injection, injection into the heart, including the cardiac cavities and chambers and associated blood vessels. In some embodiments, injection includes skeletal muscle injection. In some embodiments, injection includes intraperitoneal injection. In some embodiments, injection includes transdermal injection. In some embodiments, administering the composition includes inhalation.

[0106] In some embodiments, treating a subject results in increased dystrophin expression. In some embodiments, the increased dystrophin expression occurs in skeletal muscle. In some embodiments, this includes skeletal muscle of the limbs, such as the soleus. In other embodiments, the increased dystrophin expression occurs in the diaphragm. In some embodiments, treating a subject results in enhanced read-through translation of proteins, including dystrophin. In some embodiments, treating a subject further includes assessing the subject's functional improvement, including improved function of skeletal muscle tissue. In some embodiments, functional improvement includes one or more of increased contractile force, improved walking ability, improved ability to stand from a sitting position, improved ability to sit from a supine or supine position, and improved manual dexterity, such as mouse pointing and / or clicking. In some embodiments, treating a subject further includes assessing cognition in response to treatment of nerve injury, blood oxygen transfer in response to treatment of lung injury, and immune function in response to treatment of damaged immunologically relevant tissue. [Example]

[0107] The present embodiments demonstrate that CDCs and CDC-derived exosomes can be used to ameliorate key pathophysiological features of Duchenne muscular dystrophy in mdx mice. Exosomes secreted by human CDCs recapitulate the benefits of CDCs in mdx mice, ameliorating abnormalities in calcium cycling and mitochondrial respiration in human Duchenne cardiomyocytes. Both CDCs and their exosomes improve cardiac function in mdx mice; a single injection of CDCs is sufficient to increase maximal exercise capacity and improve survival. Delivery of non-coding RNA species found in CDC-derived exosomes (e.g., miR-148a) mimics the ability of CDCs and CDC-derived exosomes to increase dystrophin protein levels without affecting transcript length or exon / intron junctions. Thus, CDCs and CDC-derived exosomes ameliorate features of Duchenne muscular dystrophy through exosome-mediated transport of signaling molecules. Example 1 animal research

[0108] We studied the mdx mouse model of DMD (C57BL / 10ScSn-Dmdmdx / J) and wild-type strain-matched mice (C57BL / 10ScSnJ wild-type mouse hearts) (Jackson Laboratory, USA) from the age of 10 months. To optimize the CDC transplantation process, we performed a preliminary dose-response experiment and found that an effective dose of 1 × 10 5 cells, and 1 x 10 for the first injection. 4 A total of 1 × 10 cells (3 months after the first injection) was confirmed, consistent with previous dose-finding experiments in ischemic and non-ischemic mouse models. 5 cells / 40 μL phosphate-buffered saline (PBS: first injection), or 1 × 10 4Cells / 40 μL PBS (second injection) or PBS alone were injected into four equally divided left ventricular (LV) myocardium as described. The LV was visually divided into three segments: basal, mid-, and apical. One injection was given to the basal segment, two to the mid-segment, and one to the apical segment. Ten-month-old CDC / mdx and vehicle / mdr mice were injected twice (3 months apart) with CDC (Mdx + CDC, n = 12) or vehicle [placebo: Mdx + vehicle (PBS), n = 12]. Injections were performed using a 28-1 / 2-gauge needle during thoracotomy. All surgical procedures were performed while the animals were under general anesthesia (dexmedetomidine (0.5 mg / kg) / ketamine (75 mg / kg); IP; once preoperatively). A similar protocol was used for the injection of CDC-derived exosomes, NHDF-derived exosomes (as a control), miR-148a-3p (Sigma-Aldrich catalog no. HMI0237), microRNA mimic control (Sigma-Aldrich catalog no. HMC0002), srDMD, and mutant srDMD. CDC-derived exosomes [(10.32 ± 3.28) × 10 9 A single intraventricular injection of [1 × 100 µL / 150 µL PBS] or PBS alone into the LV cavity was performed during thoracotomy using a 28-1 / 2 gauge needle. CDC (1 × 100 µL) was administered using a PE-10 catheter (ALZET; Cupertino, CA) via the carotid artery in the neck. 4 Intra-arterial injections of exosomes (cells / 40 μL PBS) or PBS were performed. Intramuscular injections of exosomes into the soleus (SOL) muscle were performed at a single site in the lower third of the muscle using a 25 μL Hamilton syringe (marked 0.5 μL) with a 31-gauge needle. The needle was advanced to the upper third of the muscle, and then exosomes [(20.64 ± 2.12) × 10 7 / 3 μL] was injected while slowly withdrawn through the muscle belly. Example 2 CDC, CDC-derived exosomes, NHDF-derived exosomes, miR-148a-3p, miR mimic control, srDMD, and mutant srDMD

[0109] Murine CDCs were propagated from wild-type strain-matched mouse hearts (C57BL / 10ScSnJ wild-type mouse hearts) as described. Briefly, ventricular tissue was minced into approximately 1 mm explants, partially enzymatically digested, and seeded onto adherent (fibronectin-coated) culture dishes. These explants yielded spontaneously proliferating cells (explant-derived cells), which were harvested after confluence and seeded into suspension culture (10 cells on poly-D-lysine-coated dishes). 5 The cells were incubated at a constant temperature of 100°C (cells / mL) to allow for the self-assembly of three-dimensional cardiospheres. Subsequently, the cardiospheres were replated onto adherent culture dishes to obtain CDCs, which were used at passage 1 in all experiments. CDC-derived exosomes: Exosomes were isolated from serum-free medium conditioned overnight (24 h) by cultured human CDCs (CDC-derived exosomes) [or normal human dermal fibroblasts (NHDFs) as a control] in hypoxia (2% O2; default conditions) or normoxia (20% O2, for studies comparing the RNA content of exosomes alone). Ultracentrifugation (100,000 g for 1 h) was used to isolate exosomes from the conditioned medium after sequential centrifugation at 300 g (10 min) and 10,000 g (30 min) and filtration through a 0.22 micron filter. The isolated exosomes were resuspended in PBS (for in vivo and in vitro experiments), and the exosome-to-protein ratio was measured using a Nanosight particle counter and a Micro BCA Protein Assay Kit (Life technologies, Grand Island, NY), respectively. Preliminary dose application studies revealed a mean exosome-to-protein ratio of (2.24 ± 1.34) × 10 for in vitro and in vivo (intramyocardial CDC-derived exosome injection) experiments, respectively. 7 ] and [6.19 ± 3.68 × 10 8 ] was identified as an effective dose of hypoxic CDC-derived exosomes.

[0110] miR-148a-3p mimic control and miR mimic control (hsa-miR-148a-3p and miRNA negative control 1; 2 μg each; Sigma-Aldrich, St. Louis, MO), short noncoding RNA, srDMD, or srDMD mutant (12 μg each; GE Dharmacon, Lafayette, CO) mixed with RNAiMAX transfection reagent (life technologies, Grand Island, NY) in a total volume of 40 μl for 30 min at room temperature were injected at four points per heart as described above.

[0111] The nucleotide sequence of the srDMD mutant is 5'UCCCCACAGAGGCUGAUCGAUUCUCCCUGAACAGCCUCCUCCGGAGGCACUGCAGAUCAAGCCCGCCUGGAGAGGUGGAGUUUCAAGAGUCCCUUCCUGGUUCACCGUCUCCUUU 3' (SEQ ID NO: 6). Example 3 Echocardiography

[0112] Echocardiography studies were performed using a Vevo 770 imaging system (VisualSonics, Toronto, Canada) 2 days (baseline) and 3 weeks, 2 months, and 3 months after the first CDC / CDC-derived exosome or vehicle injection, and 3 weeks, 2 months, and 3 months after the second CDC / CDC-XO injection. Using the same imaging system, echocardiography studies were performed at baseline (2 days) and 3 weeks after the injection of the selected RNA (or control). After induction of light general anesthesia, hearts were imaged at the level of maximum LV diameter. LV ejection fraction (LVEF) was measured from 2D long-axis views using VisualSonics version 1.3.8 software.

[0113] Changes in left ventricular (LV) end-diastolic and end-systolic volumes after CDC injection. First and second CDC implantations resulted in sustained improvements in LV end-diastolic volume (LV EDV) and end-systolic volume (LV ESV) in mdx mice for at least 6 months compared with placebo. Example 4 Treadmill exercise test and survival analysis

[0114] Starting one week before surgery and three weeks after CDC / vehicle injection, exercise capacity was assessed weekly using an Exer-3 / 6 open treadmill (Columbus Instruments, Columbus, Ohio). (Exercise capacity measured in a subset of mdx mice one week before surgery was comparable to that measured in the Mdx + vehicle group three weeks after surgery.) After an acclimation period (20 min at 10 m / min), a stepwise increase in average speed (1 m / min) was applied every 2 min during treadmill exercise until the mice fatigued (spending more than 10 s in the shocker; gentle pressure was maintained throughout the treadmill to help the mice stay on the track). Subsequently, mice were returned to their cages, and total distance traveled was recorded. The treadmill protocol conformed to the guidelines of the American Physiological Society. After 3 months of weekly exercise, CDC / vehicle mdx mice were tracked alongside wild-type, age-matched mice for mortality assessment (Figure 1C). Example 5 In vitro isometric contraction properties of skeletal muscle

[0115] Mice were deeply anesthetized with ketamine / xylazine (80 mg / kg body weight and 10 mg / kg body weight IP), and the soleus (SOL) and / or extensor digitorum longus (EDL) and / or diaphragm (DIA) muscles were rapidly removed and the animals were euthanized. Briefly, after a midline skin incision on the lateral side of the lower leg, the SOL and / or EDL muscles were dissected and isolated, and their origin and insertion tendons were fastened with silk sutures (3-0) and rapidly removed. The SOL or EDL muscles were mounted vertically in a tissue bath containing mammalian Ringer's solution with the following composition (in mM): 137 NaCl, 5 KCl, 2 CaCl, 1 MgSO, 1 NaHPO, 24 NaHCO, and 11 glucose. The solution was constantly aerated with 95% O and 5% CO while maintaining a pH of 7.35 and a temperature of 24°C. For diaphragm studies, following incision of the skin and muscles at the left subcostal border, a section of the midcostal hemidiaphragm was transferred to a pre-filled Sylgar-lined dish containing cold Ringer's solution. The fibers were attached to the ribs and tightened with silk sutures to isolate narrow 3- to 4-mm-wide strips of diaphragm, leaving the tendon center intact and attached vertically to the tissue bath. One end of the SOL, EDL, or DIA was secured to a clamp at the bottom of the dish, and the other end was attached to a calibrated force transducer (Cambridge Technology Model 300B, Watertown, MA). A micromanipulator connected to the system was used to adjust muscle length. Platinum-plate electrodes placed on either side of the muscle were used for direct muscle stimulation (Grass Model S88 stimulator, Quincy, MA) using constant-current, 0.2-ms-duration, monophasic rectangular pulses delivered at supramaximal intensity. Muscle length was adjusted until a maximal isometric twitch response was obtained. Isometric contraction characteristics were determined at optimal length (Lo). Peak twitch force (Pt) was determined from the train of signal pulses. Force / frequency relationships were measured at stimulus frequencies ranging from 5 to 150 pulses per second (PPS). Stimuli were presented in stimulus trains of 1 second duration, with at least 1 minute between each stimulus train. Developed muscle forces, including Pt and maximal tetanic force (Po), were normalized to the estimated physiological cross-sectional area (CSA) of the myofibrillar (CSA = muscle weight / 1.056 × Lo; where 1.056 g / cm). 3represents muscle density), Newton (N) / cm 2 For the SOL and EDL, Lo was also normalized to muscle fiber length when estimating muscle specific force (Lo of 0.71 and 0.44, respectively). Absolute muscle forces generated by the SOL and EDL are also reported (mN). Example 6 iPSC-derived cardiomyocytes

[0116] Urine-derived cells were plated at 50,000 cells / well onto Matrigel (BD, San Jose, CA)-coated 12-well plates and allowed to attach overnight (day 0). On day 2, cells were transduced with high-titer OSKM viral supernatant in the presence of 8 μg / ml polybrene for 3 hours. The viral supernatant was replaced with fresh USC medium, followed 3 days later by mTeSRl medium (StemCell Technology, Vancouver, BC), which was changed daily. As iPSC-like colonies emerged over time, they were harvested using a glass capillary pipette under a stereoscopic dissecting microscope (Leica M205C, Buffalo Grove, IL) and transferred to new Matrigel-coated plates for further expansion. Urine-derived iPSCs were differentiated into cardiomyocytes according to established protocols with modifications. Briefly, iPSC colonies were detached by incubation with Versene (Life technologies, Carlsbad, CA) for 10 min and triturated into a single-cell suspension at 250,000 cells / cm in TeSR1 medium. 2 The cells were plated onto Matrigel-coated plastic dishes at a density of 1000 × 1000 and cultured for an additional 4 days. Differentiation was then initiated by replacing the medium with RPMI-1640 medium supplemented with 2% insulin-reduced B27 (Life Technologies) and fresh L-glutamine. Example 7 histology

[0117] Mice were sacrificed 3 weeks (CTL: n = 4; Mdx + vehicle: n = 6; Mdx + CDC / Mdx + CDC-derived exosomes: n = 6 each) or 3 months (CTL: n = 4; Mdx + vehicle: n = 6; Mdx + CDC / Mdx + CDC-derived exosomes: n = 6) after the first CDC / CDC-derived exosome injection and 3 weeks (n = 6) after miR-148 injection. Paraffin-embedded sections from the apex, mid-, and base of each heart were used for histology. Masson's trichrome staining (HT15 Trichrome Stain [Masson] Kit; Sigma-Aldrich, St. Louis, MO) was performed to assess fibrosis. T cells, B cells, and macrophages were assessed by immunostaining with antibodies against mouse CD3, CD20, and CD68, respectively. Cells were counted in 10 fields (20x magnification) from 10 randomly selected sections from the apical (3 sections; 50 μm intervals), central (4 sections; 50 μm intervals), and basal (3 sections; 50 μm intervals) regions of each heart, and the average cell number in each heart was calculated. Data were expressed as cells / mm. 2 Presented as number of fields. Active cycling (Ki67 + ) and proliferation (Aurora B + ) cardiomyocytes, as well as dystrophin-positive cardiomyocytes, were similarly counted and analyzed by Ki67 as described. + , Aurora B + and dystrophin + The cycling and proliferating fractions, and dystrophin-positive cardiomyocytes, were expressed as the number of cardiomyocytes divided by the total number of cardiomyocytes per high-power field (HPF), respectively. Measurements were averaged for each heart.

[0118] Immunofluorescence stainingHeat-induced epitope retrieval was performed in low or high pH buffer (DAKO, Carpinteria, CA), followed by permeabilization / blocking for 2 hours with a protein blocking solution containing 1% saponin (Sigma, St. Louis, MO; a protein blocking solution containing 3% saponin was applied for immunofluorescence staining of Ki67). Subsequently, the protein blocking solution for the primary antibody was applied overnight at 4°C for immunofluorescence staining of 5 μm sections from the apex, mid-, and base of each heart. After three washes with PBS (10 min each), an Alexa Fluor secondary antibody (Life Technologies, Grand Island, NY) was used for detection. Images were captured using a Leica TCS SP5X confocal microscope system. Immunofluorescence staining was performed using antibodies against mouse dystrophin (1 μg / ml; Thermo Fisher Scientific, Fremont, CA), Ki-67 (SP6; 1:50; Thermo Fisher Scientific, Fremont, CA), WGA (wheat germ agglutinin; 1:200; Life Technologies, Grand Island, NY), Nrf2 (C20; 1:50; Santa Cruz Biotechnology, Santa Cruz, CA), and aurora B (1:250; BD Biosciences, San Jose, CA).

[0119] Immunoperoxidase staining: Immunohistochemical detection of CD3, CD20, and CD68 was performed on 5 μm sections using prediluted rabbit monoclonal antibodies from Ventana Medical System (Tucson, AZ; CD68) and Cell Marque (Rocklin, CA; CD3, CD20). Staining was performed with a Leica Bond-Max Ventana automated slide stainer (Chicago, IL) using onboard heat-induced epitope retrieval in high-pH ER2 buffer (Leica Biosystems, Buffalo Grove, IL). Dako Envision +Staining was visualized using a rabbit detection system and Dako DAB (Carpinteria, CA). Slides were then counterstained with Mayer's hematoxylin for 1 minute and coverslipped.

[0120] Electron microscopy: 1mm 3 The apical (one cube), central (three cubes from the right, central, and left subsections), and basal (three cubes from the right, central, and left subsections) posterior wall sections from each heart (CTL: n = 3; Mdx + Vehicle: n = 3; Mdx + CDC: n = 3) were fixed by immersion in 2% glutaraldehyde, postfixed with osmium, and embedded in Epon. Sections were cut with silver foil, stained with uranyl acetate and citrate, and viewed using a JEOL 1010 with an AMT digital camera system. Example 8 Western blot

[0121] Western blot was performed to analyze Nrf2 signaling [Nrf2, phosphorylated Nrf2 (Nrf2-p s40 ) and Nrf2 downstream gene products: heme oxygenase-1 (HO-1), catalase, superoxide dismutase-2 (SOD-2), and the catalytic subunit of glutamate-cysteine ​​ligase (GCLC)], Nrf2 phosphorylation [phosphorylated Akt (Akt-p 308Myocardial abundance of dystrophin and target proteins contributing to oxidative phosphorylation [CI (NDUFB8 subunit), CII (SDHB subunit), CIV (MTCO1 subunit), CIII (UQCRC2 subunit), and CV (ATPSA subunit)], mitochondrial biogenesis (PGC-1), mitophagy (PINK1), inflammation (NF-κB and MCP-1), and fibrosis (collagen IA1 and collagen IIIA1) was compared. Myocardial density of malondialdehyde protein adducts, a marker of oxidative stress, was also measured by Western blotting (WB). Samples from the apex, mid-, and base of each heart (1 mm thick cross sections each) were mixed, homogenized, and nuclear and cytoplasmic fractions were extracted according to the manufacturer's instructions (CelLytic NuCLEAR Extraction Kit, Sigma-Aldrich, St. Louis, MO). Mitochondria were extracted from fresh whole hearts (CTL: n = 3; Mdx+vehicle: n = 8; Mdx+CDC: n = 8) as described in the respiration measurement section. Cytoplasmic, nuclear, and mitochondrial extracts for WB analysis were stored at -80°C. Protein concentrations in the extracts were determined using a microBCA protein assay kit (Life Technologies, Grand Island, NY). Target proteins in the cytoplasmic, nuclear, and mitochondrial fractions were measured by Western blot analysis using the following antibodies: mouse Nrf2, HO-1, catalase, SOD-2, GCLC, collagen IA1 and collagen IIIA1, and PGC-1. Antibodies against phosphorylated Nrf2 (Nrf2-p) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). s40 Biorbyt, San Francisco, CA), respiratory chain subunits (pan-OXPHOS rodent WB antibody cocktail antibodies), malondialdehyde, citrate synthase and TBP (Abeam, Cambridge, MA), Akt and Akt-p T308Antibodies against κB-α, p-κB-α (Cell Signaling Technology, Denver, CA), PINK1, MCP-1, and NF-κB p65 (Sigma-Aldrich, St. Louis, MO) were purchased from the cited suppliers. For measurements of housekeeping proteins, nuclear (TBP), cytosolic, and mitochondrial (citrate synthase) target proteins, antibodies against TBP (TATA-binding protein) and citrate synthase were used.

[0122] Western Blot:Briefly, aliquots containing 20 μg of protein were fractionated on 8%, 10%, and 4%–12% Bis-Tris gels (Life Technologies, Grand Island, NY) at 120 V for 2 h and transferred to PVDF membranes (Life Technologies, Grand Island, NY). The membranes were incubated in blocking buffer (1× TBS, 0.05% Tween-20, and 5% nonfat milk) for 1 h and then incubated overnight in the same buffer containing the desired antibodies at optimal dilutions. The membranes were washed three times for 5 minutes in 1x TBS, 0.05% Tween-20 before being incubated for 2 hours in a buffer (TBS, 0.05% Tween-20, and 3% nonfat milk) containing horseradish peroxidase-conjugated anti-rabbit IgG, anti-mouse IgG (Cell Signaling Technology, Denver, CO), and anti-goat IgG (Sigma-Aldrich, St. Louis, MO) at 1:1000–3000 dilutions. The membranes were washed three times for 5 minutes in 1x TBS, 0.05% Tween-20, and developed by autoluminography using ECL chemiluminescent substrate (Super Signal West Pico Chemiluminescent Substrate; Life Technologies, Grand Island, NY). Citrate synthase and TBP were used as housekeeping proteins against which the expression of the proteins of interest was normalized. Phosphorylated Akt, Nrf2, and IκB-α were normalized to the sum of Akt, Nrf2, and IκB-α. Western blot analysis of collagen I and collagen III was performed under non-reducing, non-denaturing conditions. Example 9 statistical analysis

[0123] All pooled data are presented as mean ± SEM, except for results for alternative data, which are presented as mean ± SD. Data sets were tested for normality and homogeneity of variance using the Kolmogorov-Smirnov test and Levene's test, respectively. If both were confirmed, t-tests or analysis of variance followed by Bonferroni post hoc tests were used to determine statistical significance; if either normality or homogeneity of variance was not assured, nonparametric tests (Wilcoxon test or Kruskal-Wallis test followed by Dunn post hoc tests) were applied (SPSS II, SPSS Inc., Chicago, IL). Preliminary data were not available for power analysis. The results of the pilot project allowed us to conduct subsequent studies. This study complied with preclinical reporting standards, as described. Age-matched mice were randomly assigned to experimental groups using a computer-generated randomization schedule. Experiments and analysis of results and outcomes were performed in a blinded manner (allocation concealment and blinded assessment). There were no post-hoc exclusions of mice or data after the open-label pre-analysis.

[0124] Ejection fraction data: Preliminary data were collected from a pilot study of five animals per group measuring ejection fraction at baseline and after 3 weeks of treatment with cells or vehicle control in mdx and corresponding wild-type mice (C57BL / 10ScSnJ). The measured treatment effect was approximately 4 units, with a time effect of approximately 1 unit and a group standard deviation of 3.5 units. We expected larger differences between groups at later time points, potentially due to increased measured variance. Therefore, assuming a compound symmetric covariance structure, a correlation of 0.7 between animal measurements over time, and a two-sided α of 0.05 (power computed via PASS v. 11.0), with a study design including six measurements per animal over time, 12 animals per treatment group in each mdx group, and seven wild-type control animals, the study had at least 80% power to detect differences of 4.5 units or more in the treatment effect and 1.4 units or more in the time effect.

[0125] Treadmill Data: Preliminary data were collected from a pilot study of five animals per group measuring treadmill distance (i.e., distance walked before fatigue, as described below) at baseline and after three weeks of treatment with cells or vehicle control in mdx and corresponding wild-type mice. The measured treatment effect was approximately 150 meters, with limited observed differences over time in the untreated group. The group standard deviation was approximately 75 meters, with larger deviations observed after treatment. We expected greater differences between groups at later time points, potentially due to increased measured variance. Therefore, assuming a compound symmetric covariance structure, a correlation of 0.7 between animal measurements over time, and a two-sided α of 0.05 (Power computed via PASS v.11.0.), with a study design including 12 time-course measurements per animal, 11 animals per treatment group in each transgenic group, and 7 wild-type control animals, the study had at least 80% power to detect a difference of 100 m or more in treatment effect and a change of at least 30 m over time. Example 10 Assessment of CDC engraftment by real-time polymerase chain reaction

[0126] To assess cell engraftment, quantitative polymerase chain reaction (PCR) was performed 1, 2, and 3 weeks after CDC injection. Male CDCs were injected into female mdx mice using a TaqMan assay (Applied Biosystems, Foster City, CA) to detect the SRY gene located on the Y chromosome as a marker of engraftment. Whole mouse hearts were harvested, weighed, and homogenized. A standard curve was generated using multiple dilutions of genomic DNA isolated from injected CDCs. All samples were spiked with an equal amount of genomic DNA from uninjected mouse hearts as a control. 50 ng of genomic DNA was used for each reaction. Real-time PCR was performed in triplicate.

[0127] Engraftment was quantified using a standard curve. The percentage of CDC engraftment at 1 week was approximately 8% and less than 1% at 2 weeks. No viable CDC could be detected at 3 weeks. Example 11 respiration measurement

[0128] After isoflurane anesthesia, mice were sacrificed by cervical dislocation. Hearts were immediately removed, rinsed with PBS, and homogenized in 1 mL of ice-cold HES buffer (250 mM sucrose, 1 mM EDTA, 10 mM HEPES, pH 7.4) using a Polytron. The lysate was spun down at 1000 g for 5 min at 4°C to remove unbroken cells and large debris. The supernatant was then spun down at 7000 g for 10 min at 4°C to separate the mitochondrial-rich fraction from the crude cytosol. The pellet was resuspended in 1 mL of HES buffer (a portion of the lysis buffer for WB). Protein quantification was performed and adjusted with HES buffer to obtain samples containing 10 μg of protein in 50 μL of buffer. These samples were loaded into 24-well Seahorse cell culture plates and spun down at 2000 g for 20 min at 4°C to allow mitochondrial adhesion to the plate surface. Then, 450 μL MAS buffer (70 mM sucrose, 220 mM mannitol, 5 mM KH2PO4, 5 mM MgCl2, 1 mM EGTA, 0.2% fatty acid-free BSA, pH 7.4) was added prior to the Seahorse XF24 mitochondrial stress test. Mitochondrial oxidative phosphorylation was stimulated using 5 mM / 5 mM pyruvate / malate and 0.25 mM ADP, followed by a mixture of 1 μM oligomycin, 1 μM FCCP, 1 μM antimycin, and 500 nM rotenone. Citrate synthase activity was measured in sample lysates and normalized for the actual amount of mitochondria loaded for the test. Seahorse respiration measurements were performed on normal and human Duchenne iPs cell-derived cardiomyocytes using a Seahorse™ XF96 Extracellular Flux Analyzer as described. Example 12 Bioluminescence imaging of mdx mouse organs after systemic injection of fluorescently labeled CDC-derived exosomes

[0129] Six hours after systemic injection of fluorescently labeled CDC-derived exosomes into the left ventricular cavity of mdx mice, mice were sacrificed, and organs were dissected and imaged using an IVIVS molecular imaging system (Caliper Life Sciences, Hopkinton, MA, USA).

[0130] Intracellular Ca2 + Record of: iPS-derived cardiomyocytes were loaded with 5 μM of the fluorescent calcium-sensitive dye Cal-520 (AAT Bioquest, Sunnyvale, CA) for 30 min and paced by electrical field stimulation at a frequency of 1 Hz using an Ion-Optix Myopacer (IonOptix Corp) delivering 0.2 ms squared voltage pulses with an amplitude of 20 V through two platinum wires (approximately 1 cm apart) placed on either side of the chamber bottom. We measured intracellular Ca using the xyt mode (2D) of a Leica TCS-SP5-II (Leica Microsystems Inc.; Wetzlar, Germany). 2+ The Cal520 was excited with a 488 nm laser and its emission (>505 nm) was collected using a 10x objective (Leica: N PLAN 10x / 0.25) at a scanning speed of 36 ms / frame to 7 ms / frame depending on the field size. 2+ The fluorescence intensity (F), which is proportional to the concentration, was normalized to the baseline fluorescence F (F / F). The time to peak and Ca2+ were calculated using the software Clampfit (ver. 10.2, Molecular Devices, Inc.). + The transient amplitude (F / F0) was analyzed. Beat-to-beat alternans in each group were calculated at 5- to 10-second intervals during 1-Hz pacing. The transient amplitude of each cell (n = 10 cells in each group) was measured during pacing, and the mean and standard deviation were calculated and compared between groups.

[0131] RNA sequencing and two-dimensional hierarchical clustering:The Nugen Ovation RNA-Seq System V2 kit was used to generate double-stranded cDNA using a mixture of random and poly(T) priming. Sequencing libraries were generated using the Kapa LTP library kit (Kapa Biosystems, Wilmington, MA). The workflow consisted of fragmentation of single-stranded cDNA, end repair to generate blunt ends, A-tailing, adapter ligation, and PCR amplification. Different adapters were used for multiplexing samples in one lane. Sequencing was performed on an Illumina HiSeq 2500 with 100 runs of paired reads. Data quality checks were performed on Illumina SAV. Demultiplexing was performed with Illumina CASAVA 1.8.2. Reads were first mapped to the latest UCSC transcript set using Bowtie2 version 2.1.0, and gene expression levels were estimated using RSEM v1.2.15. TMM (trimmed mean M value) was used to normalize gene expression. Differentially expressed genes were identified using the edgeR program. Genes showing expression changes with p<0.05 and a fold change of >2 were considered differentially expressed. Pathway and network analysis was performed using Ingenuity (IPA). IPA calculates a score for each network according to the fitness of the provided focus gene set. These scores indicate the likelihood of the focus gene belonging to the network relative to that obtained by chance. A score of >2 indicates approximately 99% confidence that the focus gene network was not generated simply by chance. The canonical pathways generated by IPA are the most significant for the uploaded dataset. Fisher's exact test with the FDR option was used to calculate the significance of the canonical pathways. Two-dimensional hierarchical clustering was performed using genes with at least a 2-fold fold change between vehicle / CDC or vehicle / CDC-derived exosome (intravenous injection) mdx heart, diaphragm, soleus, and EDL muscles. Each row represents an mdx analyzed tissue, and each column represents a gene.Probeset signal values ​​were normalized to the mean of the mdx analyzed tissues. Relative levels of gene expression are represented according to the scale shown, from lowest (green) to highest (red): Examples of fold changes in transcripts of genes involved in various pathways of interest are plotted.

[0132] Cardiac mitochondria after intramyocardial CDC injection: TEM images from the apex, mid- and base of each heart were used to calculate the average number of mitochondria in CTL (wild-type) and CDC / vehicle mdx mouse hearts. DNA extracted from whole heart tissue (QIAamp DNA Mini Kit, QIAGEN, Germantown, MD) was used to measure the mitochondrial to nuclear DNA ratio using a PCR format (NovaQUANT™ Mouse Mitochondrial to Nuclear Ratio Kit, EMD Millipore, Billerica, MA) according to the manufacturer's instructions. Example 13 CDC transplantation in mdx hearts

[0133] Following intramyocardial injection of CDC, we observed improved cardiac function (Figure 1A), increased exercise capacity (Figure 1B), and increased survival (Figure 1C). Oxidative stress and inflammation have also been identified as key players in DMD. CDC administration resulted in a decrease in inflammatory cell infiltration (Figure 1D) and a decrease in oxidative stress (Figures 1E, 1F, and 1G).

[0134] These results further included the restoration of mitochondrial integrity. Mitochondrial structure showed clear restoration of organized structure, as shown in Figure 2A, and confirmed by subunit measurements, as shown in Figure 2B. Repopulation with stable, competent mitochondria was also observed. As shown in Figure 3A, an initial turnover of damaged mitochondria was followed by repopulation with healthy mitochondria. As shown in Figure 3B, there was a similar number of mitochondria between the groups.

[0135] Furthermore, a decrease in cardiac collagen content and fibrosis was observed as shown in the microscopic image in Figure 4A, and the detection of collagen protein was confirmed as shown in Figure 4B. As shown in Figure 5A and in Figure 5B, Aurora B + and ki67 + Further improvement in cardiomyogenesis was observed by staining with .

[0136] In this aspect, CDC is shown to be effective in ameliorating the major features of DMD, including skeletal muscle myopathy, cardiomyopathy resulting in myocyte loss, fibrosis, oxidative stress, inflammation, mitochondrial ineffectiveness / loss, apoptosis, and fibrosis.

[0137] More specifically, intramyocardial injection of the first and second (lower) doses of CDC into the hearts of mdx mice improved left ventricular function (as manifested by ejection fraction [EF]) and volume compared with placebo for at least 6 months. The CDC-induced improvement in EF persisted beyond the point at which viable CDC could no longer be detected in mdx hearts (3 weeks after CDC delivery). In addition to improving EF, CDC injection enhanced ambulatory function. Ten-month-old wild-type (CTL) and mdx mice (separate from the mdx mice studied in other experiments) were subjected to weekly high-intensity treadmill exercise beginning 3 weeks after administration of a single dose of CDC or vehicle. CDC-treated mdx mice showed a substantial increase in maximal exercise capacity compared with vehicle-treated mdx mice over the 3-month period over which exercise capacity was measured; survival rates also differed between the two groups. By approximately 23 months of age, all vehicle-treated mdx mice had died, whereas over 50% of CDC-treated mdx mice remained alive. To investigate the mechanism, we first investigated the antioxidant, anti-inflammatory, anti-fibrotic, and myocardial morphogenesis effects of CDC. CDC injection was associated with significant changes in the expression of genes related to oxidative stress, inflammation, and mitochondrial integrity. The Nrf2 antioxidant pathway was activated in CDC-treated mdx hearts. Nrf2 is normally suppressed by Keap1, but oxidative stress (as well as Nrf2 phosphorylation by protein kinases such as Akt) causes dissociation of the Nrf2-Keapl complex, leading to nuclear translocation of Nrf2 and transcriptional activation of antioxidant enzymes. In mdx hearts, levels of phosphorylated Akt, total Nrf2, and individual Nrf2 proteins were elevated (as expected, in response to oxidative stress); CDC treatment further increased the levels of these proteins and their downstream gene products (heme oxygenase-1 [HO-1], catalase, superoxide dismutase-2 [SOD-2], and the catalytic subunit of glutamate-cysteine ​​ligase [GCLC]). Concomitantly, oxidative stress was attenuated, as evidenced by a clear reduction in malondialdehyde adducts. Histological analysis revealed extensive fibrosis in vehicle-treated mdx hearts, but much less in CDC-treated mdx hearts (comparable to age-matched wild-type [WT] controls).Similarly, CDC treatment significantly restored the accumulation of collagen I and III in mdx cardiac tissue after 3 weeks of treatment. CDC inhibited the inflammation and mitochondrial dysfunction characteristic of mdx cardiomyopathy. NFκB, a master regulator of pro-inflammatory cytokines and chemokines, was activated in vehicle mdx hearts. Increases in phosphorylated IκB and p65 were associated with upregulation of MCP1 (monocyte chemoattractant protein 1) and CD68. + Macrophages and CD3 + This was accompanied by the accumulation of T cells. Three weeks after CDC injection, CDC treatment reversed NFκB activation and reduced the number of inflammatory cells in mdx hearts. Mitochondrial structure and function are abnormal in muscular dystrophy-associated heart failure. Whole-transcriptome analysis revealed profound changes in gene expression associated with mitochondrial integrity in mdx hearts. Consistent with this finding, CDC restored mitochondrial ultrastructure, increased mitochondrial DNA copy number (but not mitochondrial number), enhanced respiratory chain subunit levels, and normalized the defective vital capacity of isolated mdx mitochondria. Notably, the improved mitochondrial integrity and reduced mitochondrial turnover observed after 3 weeks of CDC treatment in mdx mouse hearts were associated with upregulation of antioxidant enzymes and reduced oxidative stress and inflammation. We also explored the effects of CDC on cardiomyogenesis. Vehicle-treated mdx hearts exhibited reduced cycling (Ki67), possibly as a compensation for ongoing cardiomyocyte loss. + ) and proliferation (aurora B + ) showed a several-fold increase in the number of cardiomyocytes. CDC is known to increase endogenous cardiomyogenesis in ischemic and non-ischemic models. A similar effect was seen in mdx hearts: CDC treatment increased Ki67 + and aurora B + It promoted cardiomyogenesis as evidenced by a significant increase in cardiomyocytes.

[0138] Interestingly, we found clear dystrophin staining by immunohistochemistry (IHC) in CDC-treated mdx hearts (19.8 ± 2.7% dystrophin-positive cardiomyocytes). Western blot (using an antibody against the C-terminus of dystrophin) revealed a virtual absence of dystrophin in vehicle-treated mdx hearts, but much higher levels after CDC injection. All naturally occurring isoforms of dystrophin were increased by CDC; the physiologically relevant full-length isoform was restored to an average of 20.1 ± 0.8% of control levels by Western blot densitometry. Values ​​for dystrophin restoration measured by either IHC or the more quantitatively reliable immunoblot are significant, as CRISPR / Cas9-mediated restoration of dystrophin expression in this range is sufficient to provide substantial functional benefit, even at lower values. Intramyocardial CDC injection (LV4 injection site) resulted in increased dystrophin expression, as shown in Figure 7A, including for all measured isoforms, as shown in Figure 7B. Example 14 CDC-derived exosome transplantation in mdx hearts

[0139] Consistent with reports of CDCs mediating their therapeutic effects via secreted vesicular exosomes, a depiction of the role of CDCs and CDC-derived exosomes in delaying or reversing Duchenne muscular dystrophy is shown in Figure 8. CDCs, as mediated by CDC-derived exosomes, prevent myocyte loss and reduce apoptosis, fibrosis, and inflammation. Interestingly, intramyocardial exosomes recapped the effects of CDC. Intramyocardial CDC-derived exosome injection reduced collagen to levels similar to wild-type, as shown in Figure 9A. Furthermore, intramyocardial exosomes recapped the effects of CDC, as shown in Figures 9B and 9C. Exosome injection was able to delay the gradual decline in ejection fraction, as shown in Figure 9D.

[0140] Disproportionate increases in cardiac function and exercise capacity in CDC-treated mdx mice. This may be due to the CDCs themselves, mediators secreted from engrafted CDCs (exosomes, ECVs, proteins, etc.), a regulated cardiac secretome, and / or improved systemic hemodynamics. The disproportionate increases in cardiac function and exercise capacity in CDC-treated mdx mice are shown in Figure 10A and Figure 10B, respectively.

[0141] Exosomes secreted by CDCs (i.e., CDC-derived exosomes) mimic the functional and structural benefits of CDCs in rodent models of myocardial infarction. Similarly, in mdx mice, the benefits of CDCs were reproduced by exosomes (approximately 30-200 nm in diameter) isolated from culture medium conditioned by hypoxic CDCs. Two repeated doses (3 months apart) of human CDC-derived exosomes led to sustained improvements in EF compared with vehicle injections, with minimal but detectable hormonal responses in non-immunosuppressed mdx mice. Collagen I and III levels were reduced, while cycling (Ki67) was maintained. + ) and proliferation (aurora B + The number of cardiomyocytes was increased in CDC-derived exosome-injected mdx mice. The effect of CDC-derived exosomes was mediated, at least in part, through clathrin-mediated uptake by the surrounding myocardium. Similar to parental CDC, intramyocardial CDC-derived exosome injection increased dystrophin expression in mdx hearts. The degree of dystrophin protein upregulation was comparable after treatment with CDC or CDC-derived exosomes. Example 15 Systemic CDC-derived exosome injection

[0142] To further evaluate the potential of exosomes to mediate systemic benefits, we injected CDC-derived exosomes into the left ventricular cavity of mdx hearts.

[0143] Intraventricular injection of CDC-derived exosomes demonstrated similar beneficial results in the heart, as shown in Figure 11A. CDC-derived exosomes were able to modulate gene expression in a manner that mirrored CDC itself, as shown in Figure 11B, and with a high degree of correlation, as shown in Figure 11C. Furthermore, CDC-derived exosome injection improved both ejection fraction and distance, as shown in Figures 11D and 11E, respectively. These results were further observed in the diaphragm, as shown for gene expression results in Figures 11F and 11G. CDC-derived exosome injection improved both twitch force and specific muscle strength, as shown in Figure 11H. These results were further observed in the soleus muscle, as shown for gene expression results in Figures 11I and 11J. CDC-derived exosome injection improved both twitch force and specific muscle strength, as shown in Figure 11K. Biodistribution after intraventricular CDC-derived exosome injection demonstrated broad distribution across many tissue types.

[0144] Six hours after injection, fluorescently labeled CDC-derived exosomes were evident not only in the heart and skeletal muscle, but also in the brain, liver, lungs, spleen, intestine, and kidney. Three weeks after intraventricular CDC-derived exosome injection, changes in the mdx heart, diaphragm, and soleus muscle mimicked those observed in these organs after intramyocardial CDC injection. In the mdx heart, three weeks after CDC-derived exosome injection, we found significant transcriptomic changes that mirrored those observed after intramyocardial CDC injection. Meanwhile, cardiac dystrophin levels increased, EF improved, and exercise capacity increased. The diaphragm also showed extensive transcriptomic changes that correlated well with those observed in the mdx diaphragm after intramyocardial CDC injection, as did the increased dystrophin levels. Diaphragm function was essentially normalized three weeks after intraventricular CDC-derived exosome injection. Similarly, the soleus muscle showed characteristic changes in gene expression, robust restoration of dystrophin, and enhanced muscle function. The results collectively implicate CDC-derived exosomes as mediators of intramyocardial CDC injection. Example 16 Injection of CDC-derived exosomes into mdx skeletal muscle

[0145] To investigate the primary effect on skeletal muscle, we directly injected CDC-derived exosomes into the soleus muscle of mdx mice. The above results indicated that the observed effects on skeletal muscle tissue were, at least in part, mediated by CDC-derived exosomes. The results of direct CDC-derived exosome injection into the soleus muscle are shown in Figures 13A, 13B, and 13C. Further improvements in MyoD and myogenin levels are shown in Figure 13D. In Figures 13F and 13G, IGF1R and p-p65 levels reached nearly the same levels as wild-type. Visible improvements were observed in soleus muscle mass, shown in Figure 13H, and dystrophin expression and distribution, shown in Figure 13I. These improvements were further measured in terms of improvements in twitch contraction and absolute muscle strength, as shown in Figure 13J.

[0146] Upon intra-aortic arch injection of CDCs in mdx mice, CDC-derived exosome injection was able to modulate the diaphragm transcriptome, as shown in Figure 14 A. When evaluating human Duchenne cardiomyocytes derived from iPSC cells, a similar improvement in dystrophin protein expression was observed, as shown in Figures 14 B and 14 C.

[0147] Histological analysis revealed fewer surviving myofibers in vehicle-injected mdx soleus muscles compared with wild-type, and those that remained were hypertrophied. CDC-derived exosomes significantly increased the total number of myofibers and shifted their size distribution toward smaller diameters, indicative of myofiber proliferation 3 weeks after injection. Consistent with this interpretation, increased tissue levels of MyoD and myogenin, the master transcription factors orchestrating myoblast and myofiber differentiation, were observed. +The number of cells was increased after CDC-derived exosome injection. Although IGF-1 is commonly implicated as an upstream signal in physiological muscle growth, the effects of CDC-derived exosomes on mdx soleus muscle were independent of the IGF-1 receptor. Along with enhanced muscle regeneration, intrasoleus CDC-derived exosome injection increased dystrophin protein expression in mdx soleus muscle (as evidenced by both immunohistochemistry and Western blot), while reducing inflammation and fibrosis. The net effect was a full recovery of contractile force in CDC-derived exosome-injected soleus muscles. Example 17 CDC-derived exosomes in iPSC-derived human Duchenne cardiomyocytes

[0148] Demonstration of efficacy in multiple models of DMD may support the notion that CDC-derived exosomes may be viable therapeutic candidates. Duchenne human iPSC-derived cardiomyocytes (DMD CMs) exhibit many phenotypic defects characteristic of DMD, including reduced oxygen consumption rate (OCR) and abnormal calcium cycling, reminiscent of those observed in mitochondria from mdx hearts. Priming DMD CMs with CDC exosomes 1 week prior increased dystrophin expression (here, to 27.2 ± 1.1% of control levels, even greater than in mdx hearts), suppressed changes in interbeat calcium transients (a measure of arrhythmogenicity) during 1 Hz burst pacing, and normalized OCR. The concordance of experimental results in the two DMD models is noteworthy: mdx mice harbor a missense mutation in exon 23 of the mouse dystrophin gene, whereas the DMD patients whose iPSC cells were studied harbor a fundamentally different genetic lesion in the dystrophin gene (a frameshift deletion in exon 50). Therefore, the active ingredients of CDC-derived exosomes are not specific to a single dystrophin mutation or a single class of dystrophin mutations. Example 18 CD-derived exosomes prepared under serum-free and hypoxic conditions

[0149] As shown in Figure 28, microRNAs in exosomes derived from hypoxic-cultured CDCs are enriched compared to exosomes derived from CDCs grown under normoxic conditions. The log2 fold change (log2) ranges from -6-fold to 6-fold (representing two-dimensional hierarchical clustering using microRNAs) for 230 microRNAs. Of the 389 detected microRNAs in hypoxic exosomes (derived from CDCs cultured in serum-free hypoxic medium for 24 hours), 248 were previously reported as mitochondrial-associated microRNAs. Further depiction of the exosomes of interest is shown in Figure 29. In this embodiment, culturing CDCs under serum-free hypoxic exosomes may enhance the potency and improve the beneficial benefits of exosomes derived therefrom when compared to alternative culture conditions, such as normoxic conditions. Example 19 Heterologous Expression Systems

[0150] HEK-293NT cells were grown in 10% FBS in DMEM (without sodium pyruvate) supplemented with MEM-NEAA and 10 mM L-glutamine. Cells were harvested and plated at passage 3 at a density of 3.5 x 10 cells per well in 6-well tissue culture-treated plates. Cells were allowed to adhere overnight and then transfected the following day using Roche HP DNA Transfection Reagent according to the manufacturer's protocol. Briefly, all reagents were brought to room temperature. For each well, 1 μg of plasmid DNA was then suspended in 100 μL of Opti-MEM, and 4 μL of transfection reagent was added to the solution. The reaction was incubated at room temperature for 30 minutes, and then 100 μL was added dropwise to each well. Cells were incubated with the transfection solution at 30°C for 24 hours to stimulate protein translation, after which experimental treatments were added directly to each well. Treatments consisted of 1 mg G418 sulfate (Gibco), 125 ng miR-148a mimic, or 1.25 μg srDMD reconstituted in UltraPure distilled water (DNase- and RNase-free). Vehicle treatments consisted of an equal volume of PBS corresponding to the volume used for each treatment listed above. Following the 24-hour treatment period, cells were harvested for analysis of GFP fluorescence and luciferase activity. Briefly, 6-well plates were placed on ice, and each well was washed twice with ice-cold PBS. Next, 1 mL of ice-cold non-denaturing lysis buffer (20 mM Tris-HCl pH 8, 137 mM NaCl, and 1% Triton X-100 in PBS) was added to each well and incubated on ice for 15 minutes. Cell lysates were then transferred to microcentrifuge tubes using a cell scraper and centrifuged at 12,000 RPM for 1 hour at 4°C. The supernatant was transferred to a new, pre-chilled microcentrifuge tube and kept on ice. For each sample, 200 μL of cell lysate was transferred to one well of a black / clear-bottom 96-well plate. GFP fluorescence was measured using this plate on a SpectraMax M5 plate reader. Then, 20 μL of cell lysate was removed from each well and transferred to a black / clear-bottom 96-well plate.Luciferase substrate (Sigma-Aldrich:FUC-1), equilibrated to room temperature, was added to each well according to the manufacturer's protocol, and fluorescence was measured on a SpectraMax M5 plate reader (top read, 1 s integration time). Rotating luciferase measurements were performed to ensure that no more than 20 seconds elapsed between the addition of luciferase substrate and the measurement of fluorescence. For each experiment, the raw GFP fluorescence measurement (in RFU) of the untransfected control was subtracted from the fluorescence measurements for all transfected samples. These corrected values ​​were then divided by the corresponding luciferase activity measurements. Finally, the normalized values ​​were transformed using an exponential function.

[0151] Raw GFP fluorescence measurements were corrected by the corresponding luciferase activity and then transformed using an exponential function (Equation 1). On the Y-axis, 1 is the fluorescence level of the untransfected well. Raw GFP fluorescence measurements were corrected by the corresponding luciferase activity and then transformed using an exponential function (Equation 1). On the Y-axis, 1 is the fluorescence level of the untransfected well.

number

[0152] In Figure 35A, we observed differential expression of miR-148a-3p and srDMD in CDC-derived exosomes isolated from hypoxic (2% O2) medium compared to CDC-derived exosomes isolated from normoxic medium, along with depiction of the apparent secondary structure of srDMD. Further results of the changes under culture conditions are shown in Figures 28 and 29. Figure 35B shows Western blot and pooled data for the protein abundance of dystrophin isoforms: dp427, dp260, dp140, dp16, dp71, and dp40 in mdx mouse hearts 3 weeks after intramyocardial injection of vehicle, miR-148a-3p mimics, or srDMD. Additionally, in Figure 35C, Western blot and pooled data for the protein abundance of dystrophin isoforms: dp427, dp260, dpl40, dpi16, dp71, dp40, and levels of dystrophin expression in mdx mouse hearts 3 weeks after intramyocardial injection of vehicle, or miR-148a-3p or srDMD mimics. Example 21 Elimination of exon skipping / alternative splicing

[0153] In Figure 36, miR-148a-3p resulted in a decrease in the levels of both NF-κBp65 and phosphorylated Akt. NF-κBp65 and Akt are known targets of miR-148a-3p. In Figure 36B, RT-PCR using primers flanking exon 23 of dystrophin was used to assess the inclusion of exon 23 in dystrophin expressed in mdx hearts from mice treated with vehicle, miR-148a-3p, or srDMD (n = 4-6). Sashimi plots of RNA-Seq data for dystrophin from hearts of mice treated with vehicle, miR-148a-3p, or srDMD do not represent junction reads spanning exon 23. All data are means ± SEM. ‡P<0.002 vs. miR-148a-3p and srDMD; †P<0.03 vs. miR-148a-3p and CTL (wild-type).

[0154] In Figure 37B, percentage increase in dystrophin / eGFP expression after treatment with miR-148a-3p or srDMD in HEK293 NT cells transfected with dual reporter constructs harboring a point mutation in exon 23 of the dystrophin gene (PTC) or a deletion of exon 50 of the dystrophin gene (exon50Δ) [compared to vehicle (PBS)]. Example 22 Dystrophin Expression and Its Consequences

[0155] In Figure 38A, ejection fraction (EF) of mdx mice at baseline and 3 weeks after intramyocardial injection of miR-148a-3p or microRNA mimic control [miRMimic (CTL)]. Wild-type (WT) EF values ​​are also shown for reference, n=5 per group. In Figure 38B, Western blots showing protein abundance in wild-type (WT) mouse hearts and vehicle (Veh.), mutant srDMD, and srDMD-injected (srDMD) mdx mouse hearts 3 weeks after intramyocardial injection. Example 23 Mechanistic studies using heterologous expression

[0156] As shown in Figure 39A, full-length human dystrophin was cloned into the ORF as either wild-type or one of two mutants: a UAA premature stop codon in exon 23 (PTC) or an exon 50 deletion (exon50Δ). The constructs fused full-length dystrophin in frame with eGFP, allowing green fluorescence to be used as a reporter of dystrophin expression. Constitutive luciferase expression (driven independently by the SV40 promoter) was used to normalize for transfection efficiency.

[0157] As shown in Figure 39B, dystrophin / eGFP expression in HEK-293NT cells transfected with full-length (WT), PTC, or exon 50Δ constructs. Fluorescence and luminescence of whole cell lysates were quantified per well in a 96-well spectrophotometer; fluorescence in each well was also quantified using untransfected cells at equivalent seeding density and lysis volume. The response mimics that for the aminoglycoside G418 and is similar in nature for both mutations. Without being bound to any particular theory, these findings support the idea that short non-coding RNAs act on release factors or the ribosome itself. Example 24 miR-148a-3p and srDMD as effectors of dystrophin re-expression

[0158] To explore the mechanism, we utilized heterologous expression of a novel dual reporter construct (wild-type and mutant dystrophin fused in-frame to eGFP and independently expressed luciferase). The response mimics that to the aminoglycoside G418 and is similar in nature to both mutations. Given its efficacy against both types of mutation, the short noncoding RNA most likely increases dystrophin expression indirectly by acting on free factors or the ribosome itself to enhance transcription.

[0159] More specifically, PTC readthrough and ribosomal frameshifting are natural "read-through" processes that increase the transcription efficiency of certain genetic errors; both are enhanced by aminoglycoside antibiotics (even at concentrations that can be toxic in vivo). To quantify translation, we constructed a dual reporter plasmid expressing full-length human dystrophin fused in-frame to e-GFP, with luciferase coexpressed independently of assay transfection efficiency. We compared the green fluorescence seen only when dystrophin-eGFP is translated in HEK-293NT cells transfected with plasmids encoding wild-type dystrophin or two mutants: a point mutation in exon 23 that introduces a PTC to mimic the mdx mutation, and another mutant with a deletion in exon 50 that replicates the human DMD mutation. Normalized fluorescence, expressed as percent enhancement relative to vehicle alone, showed an appropriate increase in both mutants with the aminoglycoside G418 as a positive control. Application of miR-148a-3p mimic or srDMD similarly enhanced dystrophin eGFP expression in both mutants.

[0160] There is strong evidence that the effects of exosomes are attributable to their RNA payload. Because dystrophin transcripts were absent by RNA-seq and undetectable by quantitative PCR in CDC-derived exosomes, dystrophin restoration is not due to cell-to-cell transfer of their RNA. Nevertheless, regulatory RNAs may act to increase dystrophin expression directly or indirectly by splicing to remove incomplete exons or by readthrough of premature stop codons. RNA-seq of CDC-derived exosomes grown under our conditions (serum-free hypoxic medium for 24 hours) revealed significant differences compared to normoxic CDC-derived exosomes, including a 144-fold and 337-fold increase in miR-148a-3p and small RNAs from DMD of unknown function (srDMD) samples, respectively. Of the small RNAs (25 bp to 200 bp) sequenced in exosomes, miR-148a-3p appears worthy of investigation given its enrichment. In addition to this investigation, we were also impressed by the fact that srDMD contains a cognate sequence containing a UAA (a premature stop codon in exon 23 of dystrophin in mdx mice), suggesting that nonsense suppressor RNAs may function to promote readthrough. Intramyocardial injection of miR-148a-3p or srDMD restored dystrophin expression in mdx hearts 3 weeks after administration. The unexpected biological activity of miR-148a-3p on dystrophin protein levels paralleled its known effects (reducing both NFκB p65 and phosphorylated Akt levels). The effect of srDMD was striking given that this short RNA has no known function to date. Mutagenesis of srDMD to alter the cognate UAA site abolished srDMD. While consistent with nonsense suppression activity, these findings are insufficient to demonstrate its mechanism. However, we ruled out exon skipping as a potential factor: junction read analysis of sequenced dystrophin mRNA from miR-148a-3p- or srDMD-injected mdx hearts revealed no reads spanning exon 23.The elimination of evidence against alternative splicing leaves enhanced readthrough as a possible mechanism underlying the increased dystrophin expression seen with administration of miR-148a-3p or srDMD. Figures 28 and 29 list various other RNA polynucleotides and potential candidates for therapeutic agents that are enriched under hypoxic conditions.

[0161] To compare the content of exosomes that may be responsible for the aforementioned effects, miR-148a-3p was measured compared to srDMD, and both showed similar levels of activity and dystrophin expression.

[0162] To explore the mechanism, we utilized heterologous expression of a novel dual reporter construct (wild-type and mutant dystrophin fused in-frame to eGFP and independently expressed luciferase). The data support the idea that exosomes increase translation of dystrophin mutants, as do their individual components, miR-148a-3p and srDMD. The response mimics that to the aminoglycoside G418 and is similar in nature to both mutations. Given their effectiveness against both types of mutation, CDC exosomes most likely increase dystrophin expression indirectly by acting on free factors or the ribosome itself to enhance transcoding.

[0163] More specifically, PTC read-through and ribosomal frameshifting are natural "read-through" processes that increase the transcription efficiency of certain genetic errors; both are enhanced by aminoglycoside antibiotics (albeit at concentrations that can be toxic in vivo). To quantify translation, we constructed a dual reporter plasmid expressing full-length human dystrophin fused in-frame to e-GFP, with co-expression of luciferase, independent of assay transfection efficiency. We compared the green fluorescence seen only when dystrophin-eGFP is translated in HEK-293NT cells transfected with plasmids encoding wild-type dystrophin or two mutants: a point mutation in exon 23 that introduces a PTC to mimic the mdx mutation, and another mutant with a deletion in exon 50 that replicates the human DMD mutation. Normalized fluorescence, expressed as percent enhancement relative to vehicle alone, showed an appropriate increase in both mutants with the aminoglycoside G418 as a positive control. Application of CDC-exosomes (XO), miR-148a-3p mimics, or srDMD similarly enhanced dystrophin-eGFP expression in both mutants. Given their efficacy against both types of mutation, CDC-exosomes and their contents most likely increase dystrophin expression indirectly by acting on free factors or the ribosome itself. In contrast, the observed increase in dystrophin-eGFP translation in non-dystrophic HEK-293NT cells argues against translational derepression due to relief of oxidative stress. Here, the expression vector used an intron-free open reading frame for dystrophin, further ruling out splicing as a beneficial mechanism. The data support the idea that exosomes themselves increase the translational efficacy of dystrophin mutants, as do their components, miR-148a-3p and srDMD. Example 25 Further Purpose Short Non-coding RNA Identification and Validation Platform

[0164] The construction of a dual reporter system using eGFP and luciferase provides a robust platform for identifying novel short non-coding RNAs with potential translation-enhancing bioactivity. In this manner, RNA profiling of therapeutically active cells can be compared with unactive cells to identify enriched RNAs. Alternatively, the same therapeutically active cells can be compared against variable culture conditions that enhance or diminish therapeutic activity, again to identify enriched RNAs. Short non-coding RNAs identified by these approaches can then be validated by contact with cells expressing the dual reporter system. Specifically, by measuring the green fluorescence observed when a fusion in-frame protein (dystrophin-eGFP) is translated. Further comparison with an aminoglycoside as a control can identify the bioactivity of the translation-enhancing short non-coding RNA. Example 26 Distant effects of CDC transplantation in mdx hearts

[0165] Intramyocardial injection of CDCs and their exosomes improved Duchenne cardiomyopathy by increasing dystrophin in mdx mouse hearts and reversing key pathophysiological processes. These changes were associated with a substantial increase in exercise capacity, which appeared disproportionate to the CDC-associated improvements in cardiac function: EF increased by less than 10%, whereas walking capacity doubled. To further evaluate the mechanism of enhanced exercise capacity in CDC-treated mdx mice, we examined three different skeletal muscles: the diaphragm (DIA, a key respiratory muscle), and two limb muscles (soleus and extensor digitorum longus [EDL], representing slow-twitch and fast-twitch muscles, respectively) 3 weeks after intramyocardial injection of CDC or vehicle.

[0166] To understand the contribution of CDC-derived exosomes to the above effects, we evaluated skeletal muscle, diaphragm, and soleus muscles 3 weeks after intramyocardial CDC injection. Secondary effects on diaphragm gene expression after intramyocardial CDC injection were observed in Ca2+ Differences in the oxidative stress response were demonstrated. Additional results were observed in inflammatory pathways and responses. Intramyocardial CDC-derived exosome injection resulted in a reduction of the oxidative stress marker MDA to levels similar to those of wild-type mice. Further reductions in the inflammatory markers p65 and lkB were observed. A reduction in fibrosis was observed, as was a reduction in inflammatory cells. Improvements in diaphragm force generation and soleus muscle function were observed. Similarly, the soleus and EDL muscles showed notable improvements at both the transcriptome and functional levels: soleus contractile force was completely normalized. Changes in gene expression were significantly correlated in the diaphragm and soleus muscles.

[0167] To further evaluate the potential of exosomes to mediate systemic benefits, we injected CDC-derived exosomes into the left ventricular cavity of mdx hearts. Intraventricular injection of CDC-derived exosomes demonstrated similar beneficial results in the heart, as shown. CDC-derived exosomes were able to regulate gene expression in a manner reflective of CDC itself. Furthermore, both ejection fraction and distance were improved by CDC and CDC-derived exosome injection. These results were further observed in the diaphragm, where CDC-derived exosome injection improved both tetanic force and specific strength. These results were further observed in the soleus muscle, where gene expression was shown to improve, where CDC-derived exosome injection also improved both tetanic force and specific strength. Example 27 Animals and injections

[0168] All animal procedures were approved by the Cedars-Sinai Medical Center Animal Care and Use Committee. Mdx (C57BL10 / ScSn-DMD) mice, aged 10 to 12 months, were used. mdx / J) and wild-type, strain-matched (C57BL10 / ScSn / J) animals were used in this study. Mice were housed under pathogen-free conditions in a temperature-controlled room with a 12-hour photoperiod. Baseline measurements of maximal exercise capacity and in vivo cardiac function were recorded before injection. CDC (2.5 × 10 5 ) and CDC-exos (2 × 10 9(100 μL of DPBS) was suspended in 100 μL of DPBS and injected into the femoral vein of mdx mice. Vehicle-treated mdx mice received the same volume of DPBS injection into the femoral vein. Mice were reassessed for maximal exercise capacity and in vivo cardiac function 3 weeks after injection, and tissues were then harvested and processed for muscle physiology experiments, histology, and immunohistochemistry, or frozen in liquid nitrogen and stored at -80°C. Cardiosphere-derived cell culture and exosome purification

[0169] Murine CDCs were propagated from 8-week-old strain-matched wild-type donors. The ventricles were separated by 1 mm 3The explants were cut into smaller fragments, washed, and partially digested with trypsin (0.05%; Gibco). These fragments were individually plated on fibronectin (Corning)-coated culture dishes and cultured in growth medium [Iscove's modified Dulbecco's medium (GIBCO)], 20% fetal bovine serum (Atlas Biologicals), 1% penicillin / streptomycin (GIBCO), and 1% 2-mercaptoethanol (GIBCO)]. After a variable growth period, a monolayer of cells emerged from the explants, and phase-bright cells proliferated. Loosely adherent cells surrounding the explants (referred to as explant-derived cells) were harvested using a mild enzymatic digestion (TrypLE; GIBCO) and seeded onto poly-D-lysine-coated culture flasks (ultra-low attachment) for 3 days. In suspension culture, explant-derived cells spontaneously formed three-dimensional clusters called cardiospheres, which were harvested and seeded onto fibronectin-coated culture flasks. In adherent culture, as described elsewhere herein, cardiospheres formed monolayers of cells called CDCs. CDCs were expanded for passages 3 to 5 and used for all experiments. To block exosome biogenesis, confluent CDCs were washed with DPBS and the medium was replaced with serum-free medium. CDCs used for in vivo experiments were washed, enzymatically dissociated from the adherent culture dish, counted, and suspended in DPBS. To generate exosomes, human CDCs were cultured until confluence at passage 5. The cells were washed with DPBS, and the medium was replaced with serum-free medium. CDCs were then cultured under physiologically hypoxic conditions (2% O2) for 24 hours. The conditioned medium was then collected, sterile filtered using a 0.45 μm filter, and frozen until further use. The conditioned medium was then thawed, and the exosomes were purified and concentrated by ultrafiltration via centrifugation using a 3 kDa centrifugal filter (EMD Millipore). The exosome concentration of the filtrate was measured by nanoparticle tracking analysis (NanoSight NS300). The exosomes were then aliquoted into ready-to-use tubes, frozen, and stored at -80°C until further use. Treadmill exercise test

[0170] Mice were placed inside an Exer-3 / 6 rodent treadmill (Columbus Instruments) equipped with a shock plate. During the acclimation period, the shock plate was deactivated, the belt speed was set to 10 m / min, and the mice were left undisturbed for 20 min to acclimate to the environment. After the acclimation period, they were engaged in an exercise protocol (the shock plate was activated at 0.15 mA with a frequency of 1 shock / sec). The protocol was designed to induce volitional exhaustion by accelerating the belt speed at 1 m / min per minute. Mice resting on the shock plate for more than 10 s while being gently pushed were considered to have reached maximal exercise capacity (the cumulative distance traveled was recorded), and the exercise test was terminated. In vitro isolated skeletal muscle physiology

[0171] Mice were deeply anesthetized with isoflurane inhalation, and the soleus or diaphragm muscle was rapidly excised. Briefly, after a midline skin incision on the lateral side of the lower leg, the soleus muscle was dissected open and isolated. Its origin and insertion tendons were fastened with silk sutures (3-0) and rapidly excised. The soleus muscle was mounted vertically in a tissue bath containing mammalian Ringer's solution with the following composition (in mM): 137 NaCl, 5 KCl, 2 CaCl, 1 MgSO, 1 NaHPO, 24 NaHCO, and 11 glucose. The solution was continuously aerated with 95% O and 5% CO while maintaining a pH of 7.35 and a temperature of 24°C. Following incision of the left subcostal border skin and muscle, a section of the subcostal hemidiaphragm was transferred to a pre-lined Sylgar dish containing aerated, cold Ringer's solution. Narrow 3- to 4-mm-wide strips of diaphragm were isolated by attaching the fibers to the ribs and leaving the central tendon intact, which was fastened with silk sutures and attached vertically to a tissue bath. One end of the soleus muscle was secured to a clamp at the bottom of the dish, and the other end was attached to a calibrated force transducer (Cambridge Technology Model 300B, Watertown, MA). A micromanipulator connected to the system was used to adjust the muscle length. Platinum-plate electrodes placed on either side of the muscle were used for direct muscle stimulation (Grass Model S88 stimulator, Quincy, MA) using constant-current, 0.2-ms-duration monophasic rectangular pulses delivered at supramaximal intensity. The muscle preload was incrementally adjusted until a maximal isometric twitch response was reached. Lo was measured with a digital caliper (Mitutoyo, Japan) to an accuracy of 0.1 mm. Peak twitch force (Pt), contraction time (i.e., time to Pt), and half-relaxation time (i.e., time until Pt reaches half-maximum) were then determined from the train of signal pulses. Force / frequency relationships were measured at stimulation frequencies ranging from 5 to 180 pulses per second. Stimuli were presented in pulse trains of 1 second duration, with at least 1 minute between each train. Developed muscle forces, including Pt and maximum tetanic force (Po), were normalized to the estimated physiological cross-sectional area (CSA) of the myofibrillar (CSA = muscle weight / 1.056 × Lo; where 1.056 g / cm). 3 represents muscle density), Newton (N) / cm2 For the soleus, Lo was also normalized to muscle fiber length when estimating the muscle's specific force (Lo of 0.71). Absolute muscle force generated is also reported (mN).

[0172] Figure 40 demonstrates functional improvements to the cardiorespiratory system following a single intravenous administration of syngeneic cardiosphere-derived cells (CDCs) and human CDC-derived exosomes (CDC-XO) in mdx mice. Wild-type (WT) and mdx mice aged 10 to 12 months underwent baseline assessment of maximal exercise capacity and in vivo cardiac function by echocardiography. At this age, mdx mice had a significantly reduced ability to tolerate exercise due to impaired left ventricular ejection fraction (Figure 40A). A single intravenous administration of CDCs or CDC-XO dramatically improved the maximal exercise capacity of mdx mice 3 weeks after treatment. In addition to improving exercise capacity, CDC and CDC-XO treatment promoted left ventricular function (evidenced by ejection fraction) compared to vehicle-treated mdx mice (Figure 40B). The robust improvement in cardiac function was accompanied by a significant reduction in interstitial fibrosis (Figure 40D), reflected by an overall reduction in histopathology of mdx hearts (Figure 40C; Vehicle: top panel, CDC: middle panel, and CDC-XOCDC-XO: bottom panel). Example 28

[0173] Animals were treated as described in Example 27. Figures 41 and 42 reveal the effects of CDC and CDC-XO on the transcriptome, inflammation, oxidative stress, and regeneration of mdx hearts. Whole-transcriptome analysis of RNA-sequencing data demonstrated that CDC and CDC-XO partially restored the transcriptome profile of mdx hearts and skewed gene expression toward that of WT hearts (Figure 41A). Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis of 722 differentially regulated genes revealed significant upregulation in several pathways involved in inflammation, such as cytokine-receptor interactions, complement and coagulation cascades, and NF-κB (data not shown). Therefore, we explored the activation (phosphorylation) of NF-κB, a master transcriptional regulator of a host of pro-inflammatory genes. NF-κB is strongly activated in mdx hearts (Figure 41B). Conversely, CDC and CDC-XO treatment reduced the protein levels of phosphorylated NF-κB (Figure 41B), indicating a reduction in pro-inflammatory signaling. To determine whether reduced NF-κB signaling has a physiological effect on inflammation in mdx hearts, frozen sections of mdx hearts from vehicle (control: labeled mdx), CDC, and CDC-XO-treated mice were immunostained for CD68, an activated macrophage marker, and immunofluorescence was visualized by confocal microscopy. Compared to vehicle-treated mdx hearts, CDC and CDC-XO-treated mdx hearts showed significantly less CD68. +We demonstrated the direct effect of CDC and CDC-XO in modulating inflammation in mdx hearts, including macrophages (Figures 41C and 41D). Because hearts from mdx mice have previously been described to have mitochondrial dysfunction, we assayed for protein expression of complexes involved in electron transport and oxidative phosphorylation. Consistently, a modest but significant decrease in most electron transport chain complexes and ATP synthase (complex V) was demonstrated (Figure 42A). In contrast, CDC and CDC-XO treatment restored protein expression of electron transport chain complexes and ATP synthase (Figure 42A). Mitochondrial dysfunction is associated with increased cellular oxidative stress. We examined the formation of protein-carbonyl adducts, irreversible oxidative modifications to proteins caused by severe oxidant stress. Treatment with CDC and CDC-XO reduced carbonylated protein accumulation to levels consistent with WT hearts (Figure 42B). Finally, we tested whether CDC or CDC-XO, when delivered intravenously, could induce cardiomyocyte proliferation, a marker of cardiac regeneration. CDC and CDC-XO treated mdx hearts showed significantly increased Ki-67 expression compared to vehicle treated mdx hearts. + There were 2.5- to 3-fold more cardiomyocytes (proteins expressed exclusively during cell division) (Fig. 42C and D). Example 29

[0174] Animals were treated as described in Example 27. Figure 43 shows that the therapeutic benefit of intravenous delivery of CDC and CDC-XO is not limited to mdx hearts but is also effective in improving skeletal muscle function. Given that skeletal muscle of mdx mice shares common pathophysiological processes with mdx hearts, we tested whether systemic delivery of CDC and CDC-XO would benefit the skeletal muscle of mdx mice. Vehicle-treated mdx mice showed significant decreases in isometric twitch and tetanic forces of the diaphragm (Figures 43A-C) and soleus (Figures 43D-F), the primary respiratory and locomotor muscles, respectively. Intravenous delivery of CDC and CDC-XO potently enhanced the isometric force exerted by the diaphragm and soleus (Figures 43A-F). As in mdx hearts, these improvements are reflected by a reduction in histopathology (Figure 43G; vehicle: left panel, CDC: middle panel, and CDC-XO: right panel) and associated fibrosis (Figure 43H). In parallel, CDC and CDC-XO treatment increased the number of muscle fibers, including the soleus muscle, in mdx mice (Figure 43I). Example 30

[0175] Animals were treated as described in Example 27. Figures 44 and 45 show the effects of CDC and CDC-XO on the transcriptome and inflammation in the soleus muscle of mdx mice. As in mdx hearts, whole-transcriptome analysis shows that CDC and CDC-XO partially reverse the transcriptome profile of the soleus muscle of mdx mice (Figure 44A). KEGG enrichment shows a dramatic upregulation of pathways involved in inflammation in mdx soleus muscles treated with CDC (data not shown) and CDC-XO (Figure 44B). The fold changes in genes involved in TNF and NF-κB signaling by CDC and CDC-XO treatment (relative to vehicle-treated mdx soleus muscles) are shown in Figures 43C and 43D, respectively. Consistently, in vehicle-treated mdx hearts, phosphorylated NF-κB was significantly greater in vehicle-treated mdx soleus muscles than in WT soleus muscles (Figure 45A). Next, we examined CD68 immunohistochemistry in frozen sections of mdx soleus muscles treated with vehicle, CDC, and CDC-XO. As in vehicle-treated mdx hearts, soleus muscles also expressed CD68. + However, unlike CDC- and CDC-XO-treated mdx hearts, these treatments did not significantly increase CD68 expression in the soleus muscle. + The CDC-XO treatment appears to promote macrophage accumulation, an observation consistent with the RNA sequencing data (Figures 45 and 45C). Careful examination of the bundles of these muscles (α-sarcomeric actin [green] channel in Figure 45C) reveals the presence of CD68 expression, which results from CDC and CDC-XO treatment. + We demonstrate that the increased accumulation of macrophages does not appear to be pathological. Indeed, these treatments enhance muscle contractile function (Figures 43D-F) and attenuate protein-carbonyl adducts (data not shown).

[0176] Figure 46 shows the ability of CDC and CDC-XO (when delivered intravenously) to modestly increase protein expression of full-length dystrophin isoforms in the soleus muscle (Figure 46A) and diaphragm (Figure 46B) 3 weeks after a single administration. Further Background and Examples As discussed above, some embodiments of the methods and compositions provided herein are based on the surprising discovery that, despite the discovery that intravenous administration of cardiosphere-derived cells (CDCs) to mdx mice results in the accumulation of a large proportion of CDCs in their lungs, various data presented herein demonstrate that administering a therapeutically effective amount of CDCs to a human subject suffering from skeletal muscular dystrophy achieves functional improvement of dystrophic skeletal muscle, thereby enabling the effective treatment of human subjects suffering from muscular dystrophy, such as DMD.

[0177] CDCs accumulated in the lungs may release paracrine factors alongside extracellular vesicles (EVs), including exosomes and microvesicles, through direct interaction with dystrophic skeletal muscle, e.g., in the legs, or through indirect mechanisms (e.g., immunomodulatory responses and reduction of chronic inflammation), resulting in a therapeutically effective amount for treating a subject in need thereof. Thus, in this context, without wishing to be bound by theory, a "therapeutically effective amount of CDCs" refers to CDCs administered to a subject that result in the delivery of a sufficient amount of EVs to the target dystrophic skeletal muscle of the subject to increase and / or restore skeletal muscle function and immunomodulate a chronic inflammatory immune response in the subject.

[0178] Thus, one aspect of some embodiments provides a method for safely treating skeletal muscle dystrophy in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of autologous or allogeneic CDCs and / or EVs, such as exosomes and microvesicles. In particular, the therapeutically effective amount of CDCs and / or EVs is sufficient to treat or alleviate targeted dystrophic skeletal muscle in the subject. In this context, "targeted dystrophic skeletal muscle" means that a therapeutically effective amount of CDCs and / or EVs is sufficient to treat or alleviate dystrophinopathy and / or restore skeletal muscle function in the subject's specific dystrophic skeletal muscle at the site of the dystrophic skeletal muscle, rather than accidental or inadvertent delivery of CDCs and / or EVs that may be secreted from CDCs, which may not be in sufficient amounts to treat dystrophinopathy at the site of the dystrophic skeletal muscle.

[0179] Non-limiting examples of such skeletal muscular dystrophies include DMD and Becker muscular dystrophy, in which one or more skeletal muscles, e.g., the diaphragm, arms, and / or legs, are dystrophic. Non-limiting examples of means of administering a therapeutically effective amount of CDCs and / or EVs in this context include direct intramuscular injection or infusion into the dystrophic skeletal muscle, either in a single dose or multiple doses, and systemic administration.

[0180] Another aspect provides a method for safely treating dystrophic cardiomyopathy, comprising systemically administering a therapeutically effective amount of CDC to a subject. In particular, the therapeutically effective amount of CDC is sufficient to treat or alleviate the subject's dystrophic myocardium. Non-limiting examples of dystrophic cardiomyopathy include heart failure secondary to or associated with acute or chronic muscular dystrophies, such as DMD or Becker muscular dystrophy.

[0181] As discussed above, dystrophic tissue includes an absence or deficiency of dystrophin in skeletal and / or cardiac muscle.

[0182] In some embodiments, the subject is a mammal, such as a human. Non-limiting examples of systemic administration of the CDC include intravascular administration (e.g., intravenous or intra-arterial injection or infusion), intra-aortic administration, intraventricular administration (e.g., injection or infusion into the right or left ventricle or atrium), intraspinal administration, and intraperitoneal administration. Non-limiting examples of intravenous administration of the CDC include injection and / or infusion into the jugular and / or femoral veins. Non-limiting examples of frequent administration of the CDC include 2 to 10 administrations at intervals of 1 to 5 months, e.g., 3 administrations at intervals of about 3 months, or 5 administrations at intervals of about 1 week. Non-limiting examples of frequent administration of the CDC include 3 administrations at weeks 0, 6, and 12. Non-limiting examples of the therapeutically effective amount of CDC include at least about 75×10 6 pieces~500×10 6 CDCs, e.g., about 75 x 10 6 CDCs, approximately 150 x 10 6 CDCs, approximately 300 x 10 6CDC, 400 x 10 6 CDCs, and 500 x 10 6 CDCs are listed.

[0183] Some embodiments provide formulations comprising CDCs for use in treating skeletal muscular dystrophy and / or dystrophic cardiomyopathy according to the methods described above.

[0184] Some embodiments use the formulations described above to treat skeletal muscular dystrophy and / or dystrophic cardiomyopathy according to the methods described above. Cardiomyocyte In some embodiments, the cardiospheres comprise undifferentiated cardiac cells derived from cardiac tissue and grown as self-adherent clusters, as described in International Publication No. WO 2005 / 012510 and Messina et al., "Isolation and Expansion of Adult Cardiac Stem Cells From Human and Murine Heart," Circulation Research, 95:911-921 (2004), the disclosures of which are incorporated herein by reference in their entireties.

[0185] Briefly, cardiac tissue can be collected from a patient during surgery or cardiac biopsy. Cardiac tissue can be taken from the left ventricle, right ventricle, septum, left atrium, right atrium, crista terminalis, right ventricular endocardium, septal or ventricular wall, atrial appendage, or a combination thereof. Biopsies can be obtained, for example, by using percutaneous biopsy forceps, as described in Patent Applications 2009 / 012422 and 2012 / 0039857, the disclosures of which are incorporated herein by reference in their entireties. The tissue can then be cultured directly, or the cardiac tissue can be frozen, thawed, and then cultured. The tissue can be digested with protease enzymes, such as collagenase or trypsin. Cardiac tissue can be cultured as explants, allowing cells, including fibroblast-like cells and cardiomyocyte-forming cells, to grow from the explant. In some instances, explants are cultured in culture vessels coated with one or more components of the extracellular matrix (e.g., fibronectin, laminin, collagen, elastin, or other extracellular matrix proteins). The tissue explants may be cultured for approximately 1, 2, 3, 4, or more weeks before harvesting the cardiosphere-forming cells. A layer of fibroblast-like cells may grow from the explant where cardiosphere-forming cells emerge. Cardiosphere-forming cells may appear as small, round, phase-bright cells under a phase-contrast microscope. Cells surrounding the explant, including cardiosphere-forming cells, may be collected by manual methods or enzymatic digestion. The collected cardiosphere-forming cells may be cultured under conditions that promote cardiosphere formation. In some embodiments, cells are cultured in a cardiosphere growth medium containing a buffered medium, amino acids, nutrients, serum or serum replacement, growth factors including, but not limited to, EGF and bFGF, cytokines including, but not limited to, cardiotrophin, and other cardiosphere-promoting factors such as thrombin. Cardiosphere-forming cells can be seeded at an appropriate density required for cardiosphere formation, such as approximately 20,000 cells / mL to 100,000 cells / mL. Cells can be cultured in sterile dishes coated with poly-D-lysine or other natural or synthetic molecules that prevent cells from adhering to the surface of the dish. Cardiospheres spontaneously appear approximately 2 to 7 days or more after seeding the cardiosphere-forming cells. Cardiosphere-derived cells (CDCs)

[0186] In some embodiments, CDCs comprise a population of cells generated by manipulating cardiospheres, e.g., by methods described in U.S. Patent Application Publication No. 2012 / 0315252, the disclosure of which is incorporated herein by reference in its entirety. For example, CDCs can be generated by seeding cardiospheres on a solid surface coated with a substance that promotes cell attachment to the solid surface of a culture vessel, such as fibronectin, hydrogel, polymer, laminin, serum, collagen, or gelatin, and growing them as an adherent monolayer culture. CDCs can be passaged repeatedly, e.g., two or more times, according to standard cell culture methods. Extracellular vesicles (EVs)

[0187] In some embodiments, EVs, including exosomes and microvesicles, include vesicles formed via specific intracellular pathways involving multivesicular bodies or endosome-associated regions of the cell plasma membrane. EVs range in size, for example, from about 20 nm to 150 nm in diameter. In some cases, EVs have a characteristic buoyant density of about 1.1 g / mL to 1.2 g / mL and a characteristic lipid composition. Their lipid membranes are cholesterol-rich and may contain sphingomyelin, ceramide, lipid rafts, and exposed phosphatidylserine. EVs express specific marker proteins, such as integrins and cell adhesion molecules, but generally lack lysosomal, mitochondrial, or caveolar markers. In some embodiments, EVs contain cellular components, such as, but not limited to, proteins, DNA, and RNA (e.g., microRNAs and non-coding RNAs). In some embodiments, EVs can be obtained from cells obtained from allogeneic, autologous, xenogeneic, or syngeneic sources relative to the recipient of the exosomes.

[0188] In some embodiments, specific types of RNA, such as microRNAs (miRNAs), are carried by EVs. miRNAs often function as post-transcriptional regulators by binding to complementary sequences on target messenger RNA transcripts (mRNAs), thereby resulting in translational repression, target mRNA degradation, and / or gene silencing. For example, as described in WO 2014 / 028493, miR146a shows over 250-fold increased expression and miR210 is approximately 30-fold upregulated in CDCs compared to EVs isolated from normal human skin fibroblasts.

[0189] Examples of EVs derived from cardiospheres and CDCs are described, for example, in International Publication No. 2014 / 028493, the disclosure of which is incorporated herein by reference in its entirety. Methods for preparing EVs include culturing circulating cardiospheres or CDCs in conditioned medium, isolating the cells from the conditioned medium, purifying the EVs by continuous centrifugation or other methods, and optionally clarifying the EVs on a density gradient, e.g., a sucrose density gradient. In some cases, the isolated and purified EVs are essentially free of non-exosomal components, such as components of cardiospheres or CDCs. EVs may be resuspended in a buffer, such as sterile PBS buffer containing 0.01% to 1% human serum albumin. EVs can be frozen and stored for future use. Example 31: Preparation of mouse CDC

[0190] Some embodiments of the compositions and methods provided herein include CDCs prepared from mammals, such as mice or humans. In an example using mouse CDCs, mouse CDCs were grown from wild-type, strain-matched mouse hearts (C57BL / 10ScSnJ wild-type mouse hearts) as described, for example, in Smith, RR et al., Regenerative potential of cardiosphere-derived cells expanded from percutaneous endomyocardial biopsy specimens, Circulation 115, 896-908 (2007). Briefly, ventricular tissue was minced into approximately 1 mm explants, partially digested with enzymes, and seeded onto adherent (fibronectin-coated) culture dishes. These explants spontaneously generate outgrowth cells (explant-derived cells), which were harvested once confluent and cultured in suspension (poly-D-lysine-coated dishes) for 10 min. 5 The cardiomyocytes were seeded at 0.05% CO2 (0.05% CO2 / mL) to allow for self-organization of 3D cardiomyocytes. The cardiomyocytes were then reseeded onto adherent culture dishes, resulting in CDCs that were used at passages 3, 4, or 5. Example 32: Exercise performance of mdx mice

[0191] As shown in Figure 47, baseline measurements of left ventricular ejection fraction (LVEF) were obtained by echocardiography in 8- to 10-month-old mdx mice before treatment, and exercise capacity was measured using treadmill exercise. CDC treatment or vehicle control was administered at week 0. CDC treatment included one of three CDC doses: 75,000 cells (intravenously injected into the jugular vein), 150,000 cells (intravenously injected into the jugular vein unless otherwise specified), or 250,000 cells (intravenously injected into the femoral vein). Vehicle control included PBS (intravenously injected into the jugular vein). Left ventricular ejection fraction (LVEF) was measured 3 weeks after treatment. Exercise capacity was measured weekly for 6 weeks after treatment. At the end of the study, mice were sacrificed, and isolated muscle function was measured in the soleus and diaphragm of each mouse. Heart tissue was analyzed by Masson's Trichrome staining to measure collagen deposition. The experimental protocol shown in Figure 47 was used to generate the data described in Figures 48A, 48B, 49 and 50A-54, and Examples 32A-36B.

[0192] In one experiment, to determine whether the route of administration affected exercise performance, mdx mice were intravenously administered CDCs into either the jugular or femoral vein. Mice were treated with 150,000 CDCs via the jugular vein (n = 4) or femoral vein (n = 4) at week 0, or received PBS vehicle without CDCs (n = 10). Exercise performance was assessed weekly and is shown in Figure 48A. Exercise performance was assessed on an Exer-3 / 6 open treadmill (Columbus Instruments, Columbus, OH). After an acclimation period (10 m / min for 20 min), each mouse was subjected to a stepwise increase in average speed (2 m / min) every 2 min during treadmill exercise until fatigue (until the mouse spent more than 10 s in the shocker; gentle pressure was maintained during the treadmill to help the mouse stay on the track). Afterward, the mouse was returned to its cage, and the total distance traveled on the treadmill was recorded. Both treatment routes (cervical and femoral) resulted in similar increases in motor performance over the 6-week study period. *= p<0.05 vs. control. Thus, in some embodiments, systemic CDC treatment improves exercise performance in subjects with muscular dystrophies, such as DMD or Becker muscular dystrophy, which are associated with skeletal muscle dystrophinopathy. Therapeutically effective administration includes intravenous injection into a blood vessel or vein, such as the jugular or femoral vein.

[0193] A series of experiments were conducted to determine the effects of various CDC doses on exercise capacity, muscle function, body weight, and cardiac fibrosis, structure, and function (described in Examples 32-36B). Mice were treated with IV administration of 75,000 CDCs (n=8), 150,000 CDCs (n=8), or 250,000 CDCs (n=4) or PBS vehicle (n=12) at week 0, and exercise capacity was assessed weekly on an Exer-3 / 6 open treadmill. After an acclimation period (10 m / min for 20 min), each mouse was subjected to a stepwise increase in average speed (2 m / min) every 2 min during treadmill exercise until the mouse fatigued (until it spent more than 10 s in the shocker; gentle pressure was maintained while treadmilling to help the mouse stay on the track). The mouse was then returned to its cage, and the total distance traveled was recorded. The results are graphically presented in Figure 48B. After an initial increase in exercise capacity 1–3 weeks after treatment, the exercise capacity of mice treated with 75K CDC returned to that of PBS-treated mice. Mice treated with 150K and 250K CDC showed increased exercise capacity over the 6-week study compared with mice treated with 75K or PBS, demonstrating a dose-response. * = p<0.05 vs. control. All of these results, in some embodiments, are measured using CDCs at about 75,000, 100,000, 125,000, 150,000, 200,000, 250,000, or at about 500,000 or 1 x 10 6These results also indicate that, in some embodiments, a dose of about 150,000, 200,000, 250,000, 500,000, or 1 x 10 CDCs is therapeutically effective in improving athletic performance in subjects with muscular dystrophies, such as DMD or Becker muscular dystrophy, associated with skeletal muscle dystrophinopathy. These results also indicate that, in some embodiments, a dose of about 150,000, 200,000, 250,000, 500,000, or 1 x 10 CDCs is therapeutically effective in improving athletic performance in subjects with muscular dystrophies, such as DMD or Becker muscular dystrophy, associated with skeletal muscle dystrophinopathy. 6 These results indicate that a dose of CDCs, or more, can be more effective than a dose of 75,000 CDCs. Thus, in some embodiments, systemic administration of about 75,000 to about 250,000 CDCs, or about 150,000 to about 250,000 CDCs, may be used to improve a subject's athletic performance, including running performance.

[0194] The therapeutically effective doses exemplified herein and in other examples may be increased or adjusted depending on the size and / or weight of the subject being treated. For example, if about 75,000 to about 250,000 CDCs are therapeutically effective in mice, then the therapeutically effective dose for humans would also be about 75,000 to about 250,000 CDCs, adjusted for the weight of an average human, to about 1.86 x 10 8 pieces ~ approx. 6.2×10 8 Doses such as CDC (adjusted for a typical mouse weight of 25 g to an average human weight of 62 kg) may also be included. Example 33: Function of isolated muscles in vitro

[0195] The effects of various systemically administered doses of CDC on muscle function were also determined. The same mice used to generate the data shown in Figure 48B were deeply anesthetized with ketamine / xylazine (80 mg / kg body weight and 10 mg / kg body weight intraperitoneally). For each mouse, the diaphragm muscles were quickly removed and the animal was euthanized. Following incision of the left subcostal border skin and muscle, sections of the subcostal hemidiaphragm were transferred to a pre-filled Sylgar-lined dish containing cold Ringer's solution. Narrow diaphragm strips, 3 mm to 4 mm wide, were isolated by attaching the fibers to the ribs and leaving the central tendon intact, which was then fastened with silk sutures and attached vertically to a tissue bath. One end of the diaphragm was secured to a clamp at the bottom of the dish, and the other end was attached to a calibrated force transducer (Cambridge Technology Model 300B, Watertown, MA). The muscle length was adjusted using a micromanipulator connected to the system. Platinum-plate electrodes placed on both sides of the muscle were used for direct muscle stimulation (Grass Model S88 stimulator, Quincy, MA) using constant-current, 0.2-ms-duration, monophasic rectangular pulses delivered at maximal intensity. The muscle length was adjusted until a measurement of the maximal isometric twitch force response was obtained. Isometric contractile characteristics were determined at the optimal length (Lo). Peak twitch force (Pt) was determined from a series of single pulses. The force / frequency relationship was measured at stimulation frequencies ranging from 5 pulses / s to 150 pulses / s (pps). Stimuli were presented in 1-second trains with at least a 1-minute interval between each stimulation train. Muscle forces, including Pt and maximal tetanic force (Po), generated were normalized to the estimated physiological cross-sectional area (CSA) of the muscle segment (CSA = muscle weight / 1.056 × Fo; 1.056 g / cm). 3 represents muscle density), Newton (N) / cm 2As shown in Figure 49, diaphragm muscle function tended to increase in mice treated with 75K (n=8) and 150K (n=8) CDCs compared to PBS vehicle (n=6). The 250K (n=4) CDCs had a greater effect on diaphragm muscle function compared to 150K and 75K CDCs, demonstrating a dose-response. The data for the 250K dose were statistically significant (p<0.05) compared to the PBS control treatment. Thus, in some embodiments, systemic administration of CDCs improves muscle function, including skeletal muscle function, in subjects with muscular dystrophies, such as DMD or Becker muscular dystrophy, associated with skeletal muscle dystrophinopathy. Therapeutically effective doses for improving muscle function include, but are not limited to, about 75,000 to about 250,000 CDCs, about 150,000 to about 250,000 CDCs, or greater than about 250,000 CDCs. Example 34: Body weight of Mdx mice

[0196] The weights of CDC-treated mice were measured weekly immediately after exercise to determine whether CDC treatment had any effect on body weight. The weight data are shown in Figures 50A-B. No differences in body weight were observed between groups. Thus, in some embodiments, a therapeutically effective dose of CDC can be administered systemically without affecting the body weight or weight of the subject. Example 35: Masson's Trichrome staining of mdx mouse hearts from PBS- or CDC-treated mice

[0197] As described in Example 31, mice treated with CDCs were sacrificed 6 weeks after treatment. Paraffin-embedded sections of each heart were used for histology to identify the effect of CDC treatment on cardiac fibrosis. Masson's trichrome staining (HT15 Trichrome Stain [Masson] Kit; Sigma-Aldrich, St. Louis, MO) was performed to assess fibrosis. As shown in Figure 51, left ventricular cardiac tissue from PBS-treated mice exhibited greater fibrosis and collagen deposition than mice treated with 150K CDCs, as indicated by the reduced blue color of the CDC-treated mouse heart sections. Thus, in some embodiments, systemic administration of CDCs reduces or prevents fibrosis, including cardiac or left ventricular fibrosis, in subjects with muscular dystrophies, such as DMD or Becker muscular dystrophy, which involve skeletal muscle dystrophinopathy. A therapeutically effective amount for reducing or preventing cardiac fibrosis includes at least 150,000 CDCs.

[0198] The histology slide used to generate the image in Figure 51 was recut and restained with Masson's Trichrome. A whole-heart section from the recut and restained slide is shown in Figure 53. Similar results were observed in the whole-heart section shown in Figure 53, as was the image shown in Figure 51. Thus, in some embodiments, systemic administration of CDCs prevents or reduces fibrosis throughout the heart. A therapeutically effective amount for preventing or reducing whole-heart fibrosis includes about 75,000 to about 250,000 CDCs, about 150,000 to about 250,000 CDCs, or about 250,000 CDCs. Furthermore, no adverse effects on overall cardiac structure were observed in the hearts of mice treated with CDCs. Thus, in some embodiments, a therapeutically effective amount of CDCs does not adversely affect the cardiac structure of a subject. Example 36: Change in ejection fraction from baseline to 3 weeks after injection in mdx mice

[0199] As shown in Figure 52A (also Figure 47), echocardiographic studies were performed using a Vevo 3100 Imaging System (VisualSonics, Toronto, Canada) 1 to 3 days before treatment and 3 weeks after treatment to determine the effect of CDCs on cardiac function. After induction of light general anesthesia, hearts were imaged at the level of maximum left ventricular (LV) diameter. LV ejection fraction (EF) was measured using VisualSonics version 3.0.0 software from two-dimensional long-axis sections. Treatment with 150,000 CDCs did not reduce the ejection fraction (Figure 52B). Thus, in some embodiments, a therapeutically effective amount of CDCs can be administered to subjects with muscular dystrophies, such as DMD with skeletal muscle dystrophinopathy or Becker muscular dystrophy, without adversely affecting the subject's cardiac function. Example 37: Changes in ejection fraction in SCID mice by permanent LAD ligation

[0200] To determine whether different routes of administration can beneficially affect cardiac function, human CDCs were administered to SCID mice via three separate routes: intramuscular (IM), femoral vein, or right ventricle. Administration via all three routes resulted in positive changes in left ventricular ejection fraction (Figure 54). The changes were statistically significant in all three groups compared to mice receiving control treatment. The intramuscular and intravenous routes of administration were similarly effective, demonstrating efficacy with intravenous administration. Thus, in some embodiments, treatment with human CDCs improves cardiac function in subjects with SCID. Administration routes for treatment include intramuscular injection, systemic intravenous injection into the femoral vein, or cardiac injection, such as right ventricle injection. Example 38: Biodistribution of CDC after jugular intravenous administration in wild-type mice assessed using human Alu sequencing qPCR

[0201] One goal of the study in this example was to determine the biodistribution of CDCs after systemic delivery. Human CDCs were administered systemically to wild-type mice via intravenous injection into the jugular vein. Biodistribution determinations included measuring the abundance of DNA containing human Alu sequences, a transposable element that is abundant in most human DNA but generally absent in mouse DNA. qPCR was used to determine the abundance of DNA containing human Alu sequences in tissues collected 10 minutes and 24 hours after CDC administration. Preparation of CDC

[0202] Human CDCs were obtained in a similar manner to the mouse CDCs described above. After rinsing the flask with an amount of medium equal to the volume of medium in the cell solution, the cell solution was centrifuged at 1000 rpm (197 × g) for 5 minutes to pellet the cells in the cell solution. CDCs were resuspended in Iscove's Modified Dulbecco's Medium (IMDM) without phenol red or additional supplements and counted using an iNCYTO C-Tip disposable hemocytometer. CDCs were collected at a concentration of 1.5 × 10 in IMDM without phenol red or additional supplements. 6 The CDC was stored on ice prior to injection or the cell pellet was frozen at -20°C for tissue spike studies. Validation of qPCR method

[0203] At passage 5, 1 × 10 cells were cultured using the DNeasy Blood and Tissue Kit (Qiagen). 6 Genomic DNA was isolated from CDCs. Ten-fold serial dilutions of CDC DNA were prepared in sterile water and subjected to qPCR using Taqman Fast Advanced Master Mix (ThermoFisher) containing custom Alu primers and a custom Alu probe (ThermoFisher). The DNA sequences of the probe and primers are as follows:

[0204] Forward: 5'-GTCAGGAGATCGAGACCATCCT-3';

[0205] reverse: 5'-AGTGGCGCAATCTCGGC-3';

[0206] Probe:5'-6-FAM-AGCTACTCGGGAGGCTGAGGCAGGA-MGB-3'

[0207] qPCR reactions were performed on a QuantStudio 6 Flex real-time PCR (RT-PCR) system (ThermoFisher). Ct values ​​were plotted against the logarithm of the CDC number for each qPCR sample. Linear regression analysis was performed using GraphPad Prism 5, using the slope of the line and the equation: % efficiency = -l + 10 (”1 / slope) × 100 was used to calculate the efficiency of qPCR. Tissue spike curve

[0208] Dilutions of DNA isolated from human CDC samples were spiked into DNA isolated from naive C57BL / 6J mouse tissues aged 8–12 weeks. qPCR was performed in triplicate using 1 μL of spiked DNA on a QuantStudio 6 Flex RT-PCR System. qPCR reactions contained Taqman Fast Advanced Master Mix and the same primers / probes described above in the "Validation of qPCR Method" section for Alu sequences. Mouse β-actin (ThermoFisher, Mm00607939_sl) Taqman primers were used as a housekeeping gene to normalize Ct values. ΔCt was calculated by subtracting the β-actin Ct value from the Alu Ct value for each sample. ΔCt values ​​were plotted against the known cell number for 1 μL of qPCR sample. Linear regression analysis was performed using GraphPad Prism 5. Mouse injections and tissue collection

[0209] C57BL / 6J mice (8-12 weeks old, Jackson Laboratory) were inoculated with 100 μL of human CDC (1.5 × 10 6A total of 100 cells / mL were injected into the jugular vein under inhaled isoflurane anesthesia. CDCs at this dose were effective in mdx mice when administered via jugular vein injection. After 10 minutes (n = 8) or 24 hours (n = 8), mice were sacrificed by cervical dislocation. Blood was collected from the submandibular vein, followed by removal of the heart, lungs, spleen, liver, diaphragm, and soleus muscle. Tissues were also collected from two control mice that did not receive cell injections. The tissues were washed with PBS and then frozen at -80°C. EDTA was added to the blood at a final concentration of 0.05 M as an anticoagulant before freezing at -80°C. Alu and β-actin qPCR

[0210] Tissue samples were thawed, weighed, and cut into small pieces for homogenization. The average tissue weight, amount of tissue used for homogenization, and amount of tissue used for DNA isolation are shown in Table 1. DNA was isolated using the DNeasy Blood and Tissue Kit (Qiagen) according to the DNeasy Kit manufacturer's instructions. DNA was eluted from the DNeasy column with 100 μL of elution buffer. qPCR was performed as described above for the tissue spike curve. Data analysis ΔCt was calculated by subtracting the β-actin Ct value from the Alu Ct value for each sample. The slope and y-intercept from the standard curve were used to calculate the logarithm of the cell number of the qPCR samples. The number of cells per gram of tissue was calculated by multiplying the cell number of the qPCR sample by a tissue-specific factor, taking into account the amount of tissue used for DNA isolation and the final amount of eluted DNA (Table 1). Triplicate runs were averaged, and cells per gram of tissue were graphed for each organ at each time point. Significance was determined using a one-tailed Student's t-test with p ≤ 0.05.

[0211] Referring to Table 1, the weight of each tissue was measured and averaged to approximate the tissue weight. In most cases, the entire tissue was homogenized, except for the liver, which was larger than the other tissues. From the homogenized tissue, an amount equivalent to 10 mg to 25 mg was used for DNA isolation. The factor used to calculate CDC per gram of tissue is based on 1 µL of the 100 µL of purified DNA used for qPCR and the amount of tissue used for DNA isolation. [Table 1] Validation of qPCR method

[0212] To validate the qPCR primers and evaluate the proportionality range of the assay, human CDC DNA was isolated from a known number of cells. Serial dilutions were prepared and qPCR was performed using Alu primers. As shown in Figure 55A, the assay is linear over the range of 0.0025 to 2500 cells per qPCR sample, covering all study samples and capable of detecting DNA from less than one cell. Tissue Spike Curve - Results

[0213] To eliminate any tissue-specific variation due to β-actin levels in each tissue, spiking studies were performed in each tissue of interest. Standard curves for lung, liver, heart, spleen, diaphragm, blood, and soleus muscle were generated by spiking known amounts of CDC DNA into naive tissue DNA, as shown in Figure 55B. Table 2 lists the slope, intercept, and R of each line. 2 These standard curves were used to calculate the amount of CDC DNA in the qPCR of the study samples. [Table 2] Biodistribution of CDC in WT mice 10 minutes and 24 hours after jugular vein administration

[0214] C57BL / 6J mice were injected with 150,000 human CDCs via the jugular vein. At 10 minutes (n=8) or 24 hours (n=8) post-injection, each mouse was euthanized and tissues were removed (Figure 56A). Tissues were homogenized, DNA was isolated, and qPCR was performed using the Alu sequences and mouse β-actin primers described above.

[0215] As shown in Figure 56B, the majority of human CDCs were found in the lungs (155,000 ± 12,500 cells / g tissue at 10 min). Less than 1% of the injected CDCS was distributed to all other tissues, with 120 ± 47 CDCs / g tissue distributed in the liver 10 min after CDC injection. Blood, heart, and soleus muscle also contained CDCS above background levels (67 ± 15 cells / g tissue, 19 ± 4 cells / g tissue, and 14 ± 2 cells / g tissue, respectively), but not as high as in the lungs. At 24 h after administration, approximately 23% of the CDCs remained in the lungs (36,000 ± 7,900 cells / g tissue). Low levels of CDCs remained in the liver, blood, heart, spleen, and soleus muscle (31 ± 4 cells / g tissue, 15 ± 6 cells / g tissue, 11 ± 4 cells / g tissue, 17 ± 5 cells / g tissue, and 23 ± 11 cells / g tissue, respectively). The rapid clearance of cells may be due in part to immune system clearance by WT mice, although further studies are needed to confirm this hypothesis.

[0216] After jugular vein administration, human CDCs were rapidly trapped in the mouse lungs, with less than 1% of the injected cells remaining in the remaining test tissues. CDCs were rapidly eliminated; at 24 hours, only 22%–26% of the cells present in the lungs, liver, or blood at 10 minutes remained. Lower CDC clearance rates were observed in the heart (58% of the cells present at 10 minutes after administration remained at 24 hours) and soleus. Indeed, more cells per gram of tissue were found in the soleus muscle at 24 hours than at 10 minutes after cell delivery. These results indicate that, in some embodiments, although systemic administration of CDCs results in the majority of CDCs entering the lungs, some CDCs reach the heart and skeletal muscles, such as the soleus and diaphragm. Thus, in some embodiments, at least some of the therapeutic effects of systemic CDC administration on the heart and skeletal muscles may be due to direct effects on those tissues. Example 39: Biodistribution and clearance of CDC after jugular vein administration in SCID mice assessed using human Alu sequencing qPCR

[0217] One goal of the study in this example was to determine the biodistribution and clearance of CDC in severe combined immunodeficient (SCID) mice after systemic delivery into the jugular vein. The biodistribution of human CDC was determined by measuring the human Alu sequence. The biodistribution and clearance of CDC was determined using qPCR in tissues collected 24 hours, 1 week, and 3 weeks after jugular vein administration in SCID mice (Figure 57A). SCID mice were chosen for this study because an impaired immune system can limit the immune response to human CDC, and longer time points could be studied if the immune response cleared CDC from the body more quickly.

[0218] The methods for CDC preparation, qPCR method validation, and tissue spike curves for this study were performed in the same manner as described in Example 39. Mouse injections and tissue collection

[0219] Male SCID mice (Jackson Laboratory) aged 8 to 12 weeks were anesthetized with isoflurane inhalation and administered 100 μL of CDC (1.5 × 10) in IMDM. 6 Cells were injected into the jugular vein at a concentration of 1000 x g (1000 x 1000 cells / mL). After 24 hours (n = 4), 1 week (n = 8), or 3 weeks (n = 8), blood was collected from the submandibular vein, followed by removal of the heart, lungs, spleen, liver, diaphragm, soleus muscle, and testes. Tissues were also collected from two control mice that did not receive cell injections. Tissues were washed with PBS before freezing at -80°C. EDTA was added to the blood as an anticoagulant to a final concentration of 0.05 M before freezing at -80°C.

[0220] Methods related to Alu and β-actin qPCR and data analysis for this study were performed in the same manner as described in Example 38, Figures 55A-55B, and Table 2. Table 3 is the same as Table 1, except that data for testis are included in Table 3 but not in Table 1. [Table 3] Biodistribution of CDC in SCID mice 24 hours, 1 week, and 3 weeks after jugular vein administration

[0221] SCID mice were injected with 150,000 human CDCs via the jugular vein as described above. Mice were sacrificed 24 hours (n=4), 1 week (n=8), and 3 weeks (n=8) after injection, and tissues were removed. Tissues were homogenized, DNA was isolated, and qPCR was performed using primers for the Alu sequence and mouse β-actin described in Example 38.

[0222] In Figures 57B and 57C, the majority of CDCs were found in the lungs (217,000 ± 71,000 CDCs / g tissue at 24 hours). Less than 1% of the injected CDCs was found to be distributed to all other tissues. Liver and blood contained CDCs above background levels 24 hours after CDC administration (50 ± 15 cells / g tissue and 39 ± 8 cells / g tissue, respectively). One week after administration, 4% of the CDCs found in the lungs at 24 hours (8,600 ± 1,900 cells / g tissue) remained. Interestingly, one week after administration, there was a trend toward more CDCs in the heart (7,700 ± 5,000 at one week vs. 110 ± 58 at 24 hours), diaphragm (107 ± 82 vs. 42 ± 18), and spleen (170 ± 80 vs. 107 ± 37) than in these tissues at 24 hours after administration. The increase in CDCs seen in these tissues one week after administration suggests that, in some embodiments, the cells are released from the lung and redistributed to other tissues, particularly lodgement in the heart, which is the first organ they encounter after leaving the lung via the pulmonary veins. None of the tissues tested had a statistically significant number of cells three weeks after CDC administration compared to vehicle, suggesting that most CDCs are cleared within three weeks after delivery.

[0223] This study confirms the findings of biodistribution studies performed in WT mice (see Example 38), in which CDCs were trapped in the lungs, with relatively few CDCs distributed to other tissues. Compared to 24 hours after administration in WT mice, SCID mice did not clear CDCs as quickly (36,000±7,900 cells / g tissue in WT mice vs. 218,000±71,000 cells / g tissue in SCID mice at 24 hours), likely due to the immunocompromised nature of SCID mice.

[0224] This study demonstrates that CDCs are trapped in the lungs 24 hours after cell administration via the jugular vein. Similar CDC biodistribution was observed at 24 hours in immunodeficient SCID mice and WT C57BL / 6 mice, suggesting that the immune system may be responsible for the faster clearance observed in immunocompetent mice, but that cell distribution is not significantly affected.

[0225] Approximately 4% of the CDCs found in the lungs 24 hours after jugular vein administration remained there one week later. This study demonstrated the potential for redistribution within one week after cell delivery, with more cells found in the heart, spleen, and diaphragm at one week than at 24 hours. Thus, the results indicate that, although systemic administration of CDCs, in some embodiments, leads to some CDCs entering the lungs, some CDCs reach the heart and skeletal muscle (soleus and diaphragm, for non-limiting examples). Thus, in some embodiments, at least some of the therapeutic effects of systemic CDC administration on the heart and skeletal muscle may be due to effects on the heart and skeletal muscle of CDCs localized within those tissues. Example 40: Dose-dependent safety and efficacy of CDC in a porcine model of acute myocardial infarction (AMI) using intravenous administration

[0226] The objective of this study was to investigate the maximum tolerable dose (MTD) and dose efficacy response of CDC. In this non-limiting example, intravenous administration was used in a widely used porcine model of AMI. Preparation of CDC

[0227] Sinclair minipig CDCs (pCDCs) were produced and formulated in a similar manner to the mouse CDCs and human CDCs (hCDCs) described above. Pig hearts were harvested and dissected. Fragments of both the atria and septum were isolated and minced into explants. These explants were seeded onto cell bind 1-stacks containing 20% ​​growth medium. After 3-4 days, explant-derived cells (EDCs) began to proliferate around each explant. EDCs were harvested and frozen in CS10 in 2 mL cryovials until ready for use. EDCs were thawed at 37°C until a small amount of ice remained in the vial. The cell solution was added dropwise to a small amount of 20% medium (approximately 10 mL). The cells were centrifuged at approximately 280 g for 5 minutes to remove residual CS10. Cells were resuspended, counted, and plated into fibronectin-coated Nunc triple flasks at approximately 3 x 10 cells per flask. 6 pieces~6×10 6pCDCs were grown in 20% medium supplemented with hyclone serum until P5 and P6. Cells were suspended and frozen in a CryoStor CS 10. Frozen cells were thawed at 37°C until a small amount of ice remained in the vial. Cells were resuspended in the following dosing buffer: CryoStor® CS10 (22.5 mL), heparin (2.5 mL), nitroglycerin (250 μL); and 5% human serum albumin (103 mL), HypoThermosol® (13.5 mL), CS10 (13.5 mL) (This concentration is proportional to the human equivalent dose. The volume was modified after the optimal volume of 130 mL for IV injection was determined.)

[0228] To keep cell concentrations relatively constant, most doses were applied to the cells over a 45 minute period, and cells delivered in a 130 mL volume were delivered over a 45 minute period. Animal models

[0229] Myocardial infarction was induced in Yucatan minipigs by occluding the left anterior descending (LAD) artery for 90 minutes using an angioplasty balloon followed by 30 minutes of reperfusion, as previously described (Kanazawa, Tseliou et al. 2015). Animals then underwent a baseline left ventriculogram (LVogram) to assess changes in cardiac function (as indicated by changes in ejection fraction) before being infused with vehicle (CryoStor® CS10, n=10) or allogeneic CDC (n=18). Three CDC doses were used: 50×10 6 (n=8), 100×106 (n=3), and 200×10 6 (n=3) were administered sequentially. Infusions were performed using a Swan-Ganz catheter (6-8 French) placed in the right ventricular outflow tract (RVOT). An additional group (n=4) of animals received 200 × 10 6CDCs were injected. Two days after injection, animals underwent a follow-up LV-gram. To identify myocardial tissue damage, troponin I (TnI) levels were assessed by chemiluminescence using an Abbot Architect i2000SR at baseline and 48 hours. Briefly, blood samples were centrifuged to collect plasma, and once collected, the plasma was analyzed using an Abbot Architect i2000SR. Animals underwent physical examinations 24 and 48 hours after administration. One animal received 200 × 10 CDCs via femoral vein injection. 6 The animals were administered CDC and followed up two weeks later, with the aim of demonstrating the long-term effects of CDC. Histopathology analysis

[0230] Heart and lung tissues were subjected to histological examination. Gentian violet and thioflavin T dyes were injected into the left atrium before the animals were sacrificed to assess the cardiac area at risk (AAR) and microvascular obstruction (MVO). The excised hearts were sliced ​​and stained with triphenyltetrazolium chloride (TTC) to measure infarct size (IS). Lungs from two pig RVOTs injected with vehicle or 200 μM CDC were collected and infused with 4% paraformaldehyde. After 48 hours in 4% PFA, tissue samples were collected from the anterior and posterior regions (Figure 58). Fifteen samples were collected from each lung and embedded in paraffin. 5 μm tissue sections on slides were stained with H&E. result

[0231] 50×10 6The first animal to receive a dose was infused over 15 minutes, as opposed to the 45 minutes used for all subsequent animals. This pig experienced a sustained decrease in oxygen saturation during the infusion (SpCb decreased from 100% to 76%). During physical examination 24 hours post-infusion, chest auscultation revealed normal lung sounds. At the 48-hour endpoint, this animal continued to demonstrate a decrease in SpCh from baseline (85%). As a result, the infusion time was increased to 45 minutes for all subsequent animals. 100 x 10 6 One animal infused with a dose of 200 × 10 showed a transient decrease in SpO2 (from 98% to 81%) that returned to baseline 20 minutes after infusion. This animal was normal on follow-up physical examination. 6 One animal injected with a dose of 100×10 showed a slight, transient decrease in SpO2 (from 100% to 94%), but remained within the normal range of SpO2. Increases in cardiac enzymes (i.e., TnI) were moderate and similar in vehicle- and CDC-treated animals. As shown in Figure 59, increases in TnI did not statistically correlate with CDC dose. Instead, CDC treatment tended to decrease TnI, indicating that, in some embodiments, systemic CDC administration does not cause cardiac tissue damage and may prevent or reduce cardiac tissue damage. As shown in Figures 60-62, the AAR, NR / AAR, and TTC / AAR were similar between groups. This provides further evidence that the degree of myocardial injury 48 hours after injection was not adversely affected by CDC treatment in this study. As shown in Figure 63, when CDC was administered at 100×10 6 and 200 x 10 6 However, when administered at a dose of 200 × 10 6 Femoral vein administration of cells showed a decrease in EF. Overall, these results indicate that in some embodiments, systemic administration of CDCs, for example, into the RVOT or femoral vein, does not cause cardiac tissue damage or dysfunction and may prevent or reduce cardiac tissue damage or dysfunction.

[0232] Vehicle or 200 x 10 6The lungs of pigs injected with CDCs into the RVOT were collected 48 hours after the ischemia / reperfusion event and product administration and fixed in paraformaldehyde for histological analysis. Thirty-two samples were obtained, paraffin-embedded, sliced, and analyzed after H&E staining. No obvious lesions were found on the surface of the sections alongside the lung surface. 6 Sixty-eight slides from the RVOT of two CDC-injected pigs were analyzed by an independent pathologist. H&E slides analyzed from vehicle-injected or CDC-injected pigs showed normal lung architecture without obvious histologic abnormalities. No CDCs were found in blood vesicles or other lung regions. Thus, in some embodiments, systemic administration of CDCs does not adversely affect lung tissue.

[0233] Among the various doses of cells administered, the minimum effective dose when CDCs were delivered by RVOT was 100 × 10 6 and at higher doses (200 × 10 6 ) did not confer any significant additional benefit. Both doses had similar effects on ejection fraction in the AMI model. Scar size was similar in all conditions. However, 200 × 10 6 Pigs injected with CDCs into the femoral vein showed limited improvement in EF, suggesting that in some embodiments, administration via different routes may have different efficacy.

[0234] Histological analysis of lung samples was performed using 200 x 10 mice administered via the RVOT or using the femoral vein route. 6 demonstrated no tissue damage in pigs bearing CDCs. Administration of cells via the RVOT is a more direct route from the heart to the lungs than, for example, the femoral vein, and administration of CDCs via that route is expected to show greater impact than administration of CDCs via the femoral vein in some embodiments.

[0235] The results of this study showed that systemic administration of CDC was associated with a mortality of at least 400 × 10 6 (200 x 10 for pigs) 6Human equivalent doses of up to 100 mg / kg (100 mg / kg) have been shown to be reasonably safe (i.e., generally not associated with more than a few mild, transient adverse events during the infusion).

[0236] This study is 100 x 10 6 demonstrated that systemic delivery of 100 × 10 cells effectively improved EF in an AMI pig model. 6 or 200 x 10 6 No significant differences in efficacy were observed between pigs receiving 1×10 cells. Thus, in some embodiments, a therapeutically effective dose may include 1×10 cells or more. 5 pieces, 1×10 6 pieces, 1×10 7 pieces, 1×10 8 pieces, 2×10 8 pieces, 5×10 8 pieces, 1×10 9 pcs or 1 x 10 10 The CDCs include those that prevent or reduce cardiac dysfunction and cardiac and / or pulmonary tissue damage in subjects with cardiac injury.

[0237] The evidence in the studies of this example suggests that in some embodiments, the maximum effective dose is 100×10 6 pieces~200×10 6 CDC (human equivalent dose is 200 x 10 6 pieces~400×10 6 Furthermore, administration of these doses did not produce any toxicological effects on the lung tissue of subjects to whom they were administered. Example 41: CDC interaction with human T cells

[0238] One goal of the study in this example was to determine the immunological activity of CDCs linked to human allogeneic T cells. This study was performed using HLA-genotyped human peripheral blood mononuclear cells (PBMCs) (n=3) and human CD3 T cells isolated from PBMCs. + CDCs were prepared using T cells (n=2) as described above. CDC immunophenotype

[0239] Steady-state CDC (10 5 Cells (100 cells) were stained with antibodies specific for immune-related molecules or their respective isotype controls. Cells were acquired using a Canto II BD FACS and analyzed using FlowJo software. All cells expressed significant levels of HLA class I molecules but were negative for HLA II molecules (Figure 64).

[0240] A moderate proportion of cells showed faint expression of the non-classical HLA I molecules HLA-E and HLA-G. A significant proportion of cells expressed moderate levels of the costimulatory CD86 and costimulatory / regulatory CD274 (PD-L1) molecules, while very few cells showed weak expression of the costimulatory CD80 and costimulatory / regulatory CD275 (ICOS-L) molecules. Nearly 65% ​​of CDCs also showed significant expression of NK cell activating receptor ligands (ULBPs and MIC-A / B). Thus, in some embodiments, at least some immunostimulatory or immunomodulatory markers may be present in CDCs. The ability of CDCs to stimulate T cells in an allogeneic environment

[0241] The ability of CDCs to stimulate allogeneic T cells was investigated using conditioned one-way mixed lymphocyte cultures. Briefly, human HLA-mismatched PBMCs were prepared from blood samples of three different healthy donors by centrifugation on a Ficoll-Hypaque density gradient. Responder unfractionated PBMCs (1 × 10) labeled with carboxyfluorescein succinimidyl ester (CFSE) (2.5 μM for 10 min) were added. s ) were used as a positive control, and HLA-mismatched mitomycin C-treated stimulated PBMCs (1 × 10 5 ) (AlloPBMC) or mitomycin C-treated CDC (1 × 10 4 ) in RPMI-10% FBS in a U-bottom 96-well plate.

[0242] At the end of 5 days of coculture, we monitored the expression of two T cell activation markers, CD69 and HLA-DR, by staining with conjugated anti-CD3, anti-CD4, anti-CD8-APC, anti-CD69, and anti-HLA-DR; T cell proliferation by loss of CFSE labeling; and cell death by 7AAD staining. The results in Figure 66 show slight staining of CDCs, but not as pronounced as the AlloPBMC positive control. Thus, in some embodiments, CDCs may have a slight ability to stimulate allogeneic T cells.

[0243] As shown in Figure 66, CD4 + and CD8 + Both T cells from donor A and donor B upregulated at least one of the two activation markers to some extent in response to allogeneic CDC. The upregulation of HFA-DR was more pronounced than that of CD69. Thus, in some embodiments, CDC can activate T cells in unfractionated PBMCs. However, compared to allogeneic PBMC-induced activation (positive control), the observed upregulation of these markers was generally very weak for HFA-DR expression by donor A.

[0244] We then determined whether this activation could lead to T cell proliferation. By monitoring CFSE, we determined that CDC was able to differentiate weak CD4 + We observed that CDC could induce T cell proliferation, but in a donor-dependent manner. As shown in Figure 66, the observed proliferation appeared to coincide with the expression of activation markers. In Figure 67B, only T cells from unfractionated PBMC donor A showed significant expression of both CD69 and HFA-DR and were able to proliferate in response to CDC. T cells from unfractionated PBMC donor C showed only significant expression of HFA-DR, whereas donor D expressed neither CD69 nor HFA-DR, and neither showed significant proliferation in response to CDC. In contrast, as shown in Figures 67A-B, CDC inhibited the expression of CD8 + In summary, in some embodiments, CDC did not induce a substantial response in CD4 T cells. +Although the response varies somewhat between donors, according to some embodiments, systemic administration of a therapeutically effective amount of CDCs appears to induce a much weaker response in CD4 T cells than observed in allogeneic PMBC controls. + or CD8 + Neither T cells nor any significant immune response are activated.

[0245] Using the same experimental environment as above, purified CD3 + CDC-induced activation and proliferation of T cells (donor C and donor A) was assessed. Briefly, responder allogeneic T cells (1 × 10) labeled with CFSE (2.5 μM, 10 min) were cultured in 100% PBS-containing medium. 5 ) were cultured in a 1×10 -well culture of HLA-mismatched mitomycin C-treated stimulated PBMCs (1×10 5 ) (AlloPBMC) or CDC (1 × 10 4 ) in RPMI-10% FBS in U-bottom 96-well plates, and after 5 days their activation (expression of CD69 and HLA-DR) and proliferation (loss of CFSE) were monitored. + and CD8 + T cells more or less upregulated expression of the HLA-DR activation marker, but not CD69. However, as shown in Figure 68, this activation did not result in significant proliferation of CD4 or CD8 T cells. Thus, in some embodiments, administration of CDCs results in a surprisingly weak or absent immune response, or does not activate an immune response, despite re-exposure to allogeneic CDCs. Immune regulation by CDC

[0246] We then investigated the ability of CDCs to modulate ongoing immune responses in an allogeneic environment, as a lack of immune response activation may indicate an improved safety profile with reduced side effects in response to CDC treatment. To this end, we cultured CDCs (1 x 10) in a U-bottom 96-well plate to determine whether CDCs could enhance PHA stimulation. 4 HLA-mismatched unfractionated CLSE-labeled PBMCs (1 × 10 5) were stimulated with PHA (1 μg / ml) and allogeneic T cell proliferation was assessed by monitoring CFSE. As shown in Figure 69, CDC was associated with CD4 + and CD8 + These results demonstrate that, in some embodiments, CDC significantly reduces, but does not enhance, immune stimulation.

[0247] Therefore, similar experiments were performed with purified CD3 from two donors (donor C and donor A). + This was carried out using T cells, and the modulation of PHA-induced proliferation was assessed in addition to the modulation of PHA-induced CD69 and HLA-DR expression in these HLA-mismatched T cells.

[0248] PHA significantly down-regulated CD69, while CDC down-regulated CD4 + and CD8 + This modulation of activation markers was consistent with the increased expression of HLA-DR on both CD4 T cells and CD4+ T cells. + and CD8 + This resulted in a potent inhibition of T cell proliferation in both CD4 + Inhibition of T cell proliferation is due to CD8 + This inhibition was more pronounced than that observed in T cells. Thus, despite donor-to-donor variability, within the limits of results obtained with only two donors, CDC appears to be a potent immunomodulator. HLA-DR is a marker for effector regulatory T cells (Tregs). Therefore, the observed increase in HLA-DR expression may suggest an eventual expansion of regulatory T cells induced by the presence of CDC, which may explain the observed strong inhibition of ongoing T cell proliferation. These results are consistent with the data above analyzing the induction of allogeneic T cell activation and proliferation by CDC, as shown in Figure 70. Overall, these results demonstrate that, in some embodiments, therapeutically effective doses of allogeneic CDC can surprisingly downregulate immune responses. Example 42: Interaction of CDC-derived extracellular vesicles (CDC-EVs) with T cells One objective of the studies in this example was to determine the immunological activities of CDC-EVs that lead to T cell activation and modulation. CDC-EV and immunophenotypic characterization The expression of informative exosomal markers was analyzed in CDC-EVs using Western blotting. CDC-EVs (20 μl = 10 μg) were dissolved using RIP A buffer, loaded onto a 10% SDS-Page gel, and transferred to a nitrocellulose membrane. The membrane was blocked with 5% BSA and then hybridized with specific antibodies against HSP70, CD81, CD63, ALIX, HLA II, and β-actin. Exosome-free supernatants (SN) were used as controls alongside CDC and dendritic cell (DC) lysates. CDC-EVs expressed the expected exosomal markers CD81, CD63, and ALIX, whereas SNs were completely negative (Figure 71).

[0249] Next, CDC-EVs were analyzed for the surface expression of immune-related markers. CDC-EVs (30 μl = 15 μg) were coupled to 5 μl of latex beads (4 μm). To block eventual nonspecific binding of these EVs / beads to antibodies or beads, the CDC-EVs / beads were sequentially treated with 100 mM glycine and 2% BSA buffer. After washing, the EVs / beads were stained with specific antibodies against relevant immune molecules captured on a Canto II BD Facs and analyzed using FlowJo software. Beads incubated with the same amount of each antibody served as controls.

[0250] Compared with bead-antibody controls, CDC-EVs expressed HLA class I molecules and CD86 but were negative for HLA II molecules and CD80 molecules (Figure 72). CDC-EVs appeared to express the costimulatory PD-L1 molecule but not ICOS-L. NK activating receptor ligands were prominently expressed in CDC-EVs. Significant expression of both the EV markers CD81 and CD63 was detected. Thus, in some embodiments, at least some immunostimulatory or immunomodulatory markers may be present in CDC-EVs. The ability of CDCs and CDC-EVs to activate T cells in an allogeneic environment

[0251] PBMCs were prepared from blood samples of three different healthy donors by centrifugation on a Ficoll-Hypaque density gradient and cryopreserved for use in various experiments. The activation and proliferation of T cells in response to CDC and CDC-EV were investigated by monitoring the expression of two T cell activation markers, CD69 and HLA-DR, and CFSE levels, respectively, by flow cytometry. Briefly, responding PBMCs (1 x 10 ) labeled with CFSE (2.5 μM, 10 min) were cultured in a 5% CO2-free medium. 5 ) were incubated with the indicated HLA-mismatched mitomycin C-treated stimulated PBMCs (1x10 5 ) or HLA-mismatched CDC (1 × 10 4 ), or various doses of CDC-EVs were co-cultured in RPMI-10% FBS in U-bottom 96-well plates. At the end of 5 days of co-culture staining with conjugated anti-CD3, anti-CD4, anti-CD8-APC, anti-CD69, anti-HLA-DR, and 7AAD, T cell activation, proliferation, and cell death were monitored. Results show some staining by CDC-EVs, but not as much as the alloPBMC positive control. Thus, in some embodiments, CDC-EVs may be able to stimulate allogeneic T cells.

[0252] As shown in Figure 74, compared to the control, CDC and CDC-EV showed weak CD4 + Although it appears to be able to induce T cell proliferation, CD8 + No substantial T cell responses were elicited, and the responses observed were much weaker than those observed in the allogeneic PMBC controls.

[0253] Therefore, purified CD3 + CDC- and CDC-EV-induced activation and proliferation of T cells (from two different donors) was assessed using the same experimental setup as described above. Briefly, responder allogeneic T cells (1 × 10) labeled with CFSE (2.5 μM, 10 min) were cultured in 10% CDC-EV-induced immunization media. 5) were cultured in RPMI-10% FBS in a U-bottom 96-well plate with various doses of HLA-mismatched mitomycin C-treated stimulated PBMCs (1 × 10 5 ) or CDC (1 × 10 4 ) or CDC-EV. As shown in Figure 75, + Weak T cell activation and proliferation was observed only with CDC-EV, but not with CDC. However, the magnitude of both activation and proliferation was significantly lower than that obtained when unfractionated PBMCs were used. Thus, in some embodiments, administration of CDC and / or CDC-EV results in a surprisingly weak or absent immune response, or does not activate an immune response.

[0254] Together, these results indicate that in some embodiments, the observed CDC-EV-induced T cell activation and proliferation occurs primarily via an indirect pathway that may involve antigen-presenting cells such as monocytes / macrophages and dendritic cells (DCs). Indirect T cell activation and proliferation in response to allogeneic EVs

[0255] Monocytes were isolated from blood samples obtained from two different healthy donors. They were then stimulated with a combination of GM-CSF (20 ng / ml) and IL4 (20 ng / ml) for 6 days to differentiate into dendritic cells (DCs). Monocyte differentiation with GM-CSF and IL4 generates immature DCs (iDCs), characterized by moderate expression of HLA II, CD80, and CD86, lack of CD16 (a monocyte / macrophage marker), and low expression of TLR-2. These monocyte-derived iDCs were then incubated overnight with HLA-mismatched CDC-EVs.

[0256] iDCs cultured with EVs exhibited characteristics of mature DCs (mDCs); as shown in Figure 76, they upregulated HLAII, CD80, and CD86 molecules, which are recognized as mDC characteristics. 4 iDCs or iDCs that had been in contact with EVs (iDC-EVs) were incubated in a U-bottom 96-well plate with autologous T cells (1 × 105 ) were co-cultured with iDCs or iDC-EVs. Autologous T cells co-cultured with iDCs or iDC-EVs were analyzed for CD69 and HLA-DR expression and their proliferation. As shown in Figure 77, although the responses of T cells derived from two different donors varied, whole iDC-EVs were more potent in activating and inducing T cell proliferation than iDCs alone. Compared with direct CDC-EV-induced T cell proliferation, the magnitude of indirect CDC-EV-induced T cell proliferation was significantly higher.

[0257] The ability of CDC-EVs to stimulate T cells when presented by mature DCs (mDCs) was evaluated. Considering the very low phagocytosis of mDCs, and based on previous experience with phagocytosis of apoptotic bodies, to ensure proper uptake of EVs, we induced DC maturation by treating iDCs and iDC-EVs overnight with IFNγ (500 IU / ml), a recognized inducer of DC maturation. Compared with iDCs, these mDCs showed higher expression of HLA II, CD80, and CD86, as well as TLR-2, which are characteristic of mDCs. The presence of CDC-EVs during iDC maturation into mDCs further upregulated HLA II, CD86, CD80, and TLR-2, as shown in Figure 78, indicating that CDC-EVs can promote DC maturation.

[0258] Then, mDCs or mDC-EVs were incubated with autologous T cells (1 × 10 5 ) in U-bottom 96-well plates for 6 days, and their activation (CD69 and HLA-DR expression) and proliferation were analyzed. Again, responses from the two donors varied, but the overall mDC-EVs were more potent in activating and inducing T cell proliferation than mDCs alone. Compared with iDC-EV-induced responses, mDC-EV-induced T cell activation and proliferation from the same donors were higher.

[0259] Overall, these results regarding T cell activation and proliferation suggest that CDC-EV can activate and induce T cell proliferation through the indirect pathway without precluding at least some activation of the direct pathway. Thus, in some embodiments, the indirect pathway is activated. In other embodiments, the direct pathway is partially activated. In yet additional embodiments, a combination of the direct and indirect pathways is activated. Immune regulation by CDC and CDC-EV

[0260] Although CDCs or CDC-EVs may enhance DC maturation, this does not necessarily mean that they will result in adverse reactions in subjects. To assess this, we investigated the ability of CDCs and CDC-EVs to modulate ongoing immune responses in a homologous environment. As shown in the top panel of Figure 80, CDCs (1 x 10 4 ) or various doses of CDC-EV in the absence or presence of HLA-mismatched unfractionated CFSE-labeled PBMCs (1 × 10 5 ) were stimulated with PHA (1 μg / ml). Experiments were performed in U-bottom 96-well plates, and allogeneic T cell proliferation was assessed by monitoring CFSE. Both CDC and CDC-EV stimulated PHA-induced CD4 + and CD8 + CDC-EV-induced downregulation of T cell proliferation was dose-dependent, with the highest dose used (20 × 10 9 particles), CDC-EVs were more potent at downregulating the ongoing response than parental cells, as shown in Figure 80.

[0261] The immunomodulation induced by CDC and CDC-EV was significantly enhanced by using purified CD3 instead of PBMCs in the same experimental setting. + Similar results were obtained when T cells were used, likely due to a direct effect. Indeed, CDC and CDC-EV were able to downregulate PHA-induced expression of CDC69 and / or HLA-DR on T cells obtained from two different donors, as shown in Figure 81.

[0262] As shown in Figure 82, down-modulation of T cell activation markers by CDC and CDC-EV was consistent with PHA-induced CD4 + and CD8 + This resulted in a significant downregulation of T proliferation. As also shown in Figure 83, despite donor-to-donor variability obtained with only two donors, within the limits of the results, both CDC and CDC-EV are potent immunomodulators.

[0263] These studies of the ability of CDC-EVs to induce immune modulation have demonstrated that they are potent immune modulators. Thus, in some embodiments, administration of CDCs and / or CDC-EVs surprisingly suppresses the immune response overall. Example 43: Further improvement with multiple administrations of allogeneic CDC compared to single administration

[0264] In some cases, CDCs and CDC-EVs can suppress immune responses, allowing them to be administered repeatedly to subjects without significantly weakening the therapeutic effect or causing an inflammatory response. One of the goals of this study was to evaluate whether multiple systemic administrations of allogeneic CDCs could have additive or potentiating effects compared to a single administration. For example, multiple administrations, as modeled in mdx mice, may promote further improvements in muscle activity and exercise capacity in subjects with muscular dystrophy. Therefore, the goal was to analyze the immune response after multiple administrations of allogeneic CDCs.

[0265] Cardiac explant-derived cells wer...

Claims

1. A composition for use in reducing the progression of muscular dystrophy in a subject in need thereof, the composition comprising a therapeutically effective amount of cardiomyocyte-derived cells (CDCs).

2. The composition described in claim 1, wherein the therapeutically effective amount of CDC is sufficient to treat dystrophic skeletal muscle of the subject.

3. The composition described in claim 2, wherein the dystrophic skeletal muscle is skeletal muscle of the diaphragm, arm or leg.

4. The composition described in claim 1, wherein the therapeutically effective amount of CDC is sufficient to treat dystrophic cardiomyopathy.

5. A composition described in any one of claims 1 to 4, wherein the muscular dystrophy is Duchenne muscular dystrophy (DMD).

6. A composition described in any one of claims 1 to 4, wherein the muscular dystrophy is Becker muscular dystrophy.

7. A composition described in any one of claims 1 to 6, wherein the therapeutically effective amount of CDC is configured to be administered via intravenous injection.

8. A composition described in any one of claims 1 to 7, wherein the therapeutically effective amount of CDC is configured to be delivered via two or more administrations.

9. The composition of claim 8, wherein the two or more administrations of CDC are administered at intervals of approximately three months to deliver a therapeutically effective amount of CDC.

10. A composition described in any one of claims 1 to 7, configured to deliver the therapeutically effective amount of CDC to targeted skeletal muscle with two or more administrations of CDC at weeks 0, 6, and 12.

11. A composition described in any one of claims 1 to 7, wherein the therapeutically effective amount of CDC is configured to be delivered via a single administration.

12. The composition according to any one of claims 1 to 11, wherein the therapeutically effective amount of CDCs comprises 7.5 x 10 7 to 1 x 10 9 CDCs.

13. A composition described in any one of claims 1 to 12, wherein the CDCs are allogeneic human CDCs.

14. A composition for use in reducing the progression of muscular dystrophy in a subject in need thereof, comprising a combination of cardiomyospheric-derived cells (CDCs) and CDC exosomes or acellular CDC exosomes, and configured for intravenous administration.