Method for screening substance for regulating lipid scrambling activity

Abstract

To provide a screening system for identifying a substance regulating PLS activity or a therapeutic agent for diseases accompanied by abnormal PLS activity, and a diagnostic method for diseases accompanied by abnormal PLS activity, on the basis of a novel PLS system present on a cell membrane.SOLUTION: A screening method for a substance regulating lipid scrambling activity induced by Tmem63b, comprising the following steps: (1) bringing a cell expressing Tmem63b, Slc19a2, and Kcnn4 into contact with a candidate substance for the regulating substance under Ca2+ stimulation; (2) determining whether the candidate substance causes a change in lipid scrambling activity on a cell membrane of the cell; and (3) selecting the candidate substance that causes the change as the regulating substance.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to a method for screening for a substance that regulates lipid scrambling activity, a method for screening for a therapeutic agent for a disease associated with abnormal lipid scrambling activity, a method for testing for the onset of a disease associated with abnormal lipid scrambling activity, and a method for testing the severity of a disease associated with abnormal lipid scrambling activity. [Background technology]

[0002] Asymmetric distribution of molecules across membranes is a fundamental property of cells that allows them to adapt to changes in their environment. For example, lipids are asymmetrically distributed in the lipid bilayer of the cell membrane. Phosphatidylserine (PS) and phosphatidylethanolamine (PE) are confined to the inner membrane, while phosphatidylcholine (PC) and sphingomyelin (SM) are primarily located in the outer membrane (Non-Patent Documents 1-4). However, under physiological conditions, when cells respond to environmental changes or intrinsic cues, this asymmetry is rapidly altered by lipid scrambling, resulting in the exposure of PS on the cell surface. Exposed PS functions as a scaffold for coagulation factors on activated platelets during bleeding (Non-Patent Document 5). Cell surface PS also functions as an "eat me" signal for phagocytes to engulf dying cells (Non-Patent Documents 6-9).

[0003] The molecular identity of scramblase has remained unknown for decades. We previously discovered the ubiquitous scramblase Tmem16F and Xkr8 by cDNA library screening and demonstrated that they induce lipid scrambling in the coagulation reaction and clearance of dead cells, respectively (Non-Patent Documents 10-14). [Prior art documents] [Non-patent literature]

[0004] [Non-Patent Document 1] Nat. Rev. Mol. cell Biol. 9, 112-124 (2008). [Non-licensed document 2] Annu. Rev. Biophys. 39, 407-427 (2010). [Non-licensed document 3] Front. Physiol. 7, 275(2016).

Non-licensed Document 4

Non-licensed Document 5

Non-licensed Document 6

Non-licensed Document 7

Non-licensed literature 9

Non-licensed literature 10

Non-licensed Document 11

Non-licensed Document 12

Non-licensed Document 13

Non-licensed Document 14

[0005] However, even in Ba / F3 cells (a pro-B cell line) lacking Tmem16F and Xkr8, high Ca 2+ Lipid scrambling is still induced under ionophore stimulation. This suggests the existence of other lipid scrambling systems on the cell membrane. If such lipid scrambling systems are discovered, the construction of a screening system based on the lipid scrambling system will enable the screening of lipid scrambling activity regulators or therapeutic agents for diseases associated with abnormal lipid scrambling activity. It is expected that the use of factors associated with lipid scrambling activity in the lipid scrambling system as markers will enable the diagnosis of diseases associated with abnormal lipid scrambling activity (testing for the occurrence or severity of the disease).

[0006] Therefore, the object of the present invention is to provide a screening system for regulators of lipid scrambling activity or therapeutic agents for diseases associated with abnormalities in lipid scrambling activity, based on a new lipid scrambling system on the cell membrane, and a diagnostic method for diseases associated with abnormalities in lipid scrambling activity. [Means for solving the problem]

[0007] As a result of extensive investigations, the present inventors have discovered two novel lipid scrambling systems on the cell membrane: Tmem63b / Slc19a2-induced lipid scrambling (Fig. 2e[1], Fig. 5i) and Stim1 / Orai1-mediated lipid scrambling (Fig. 2e[2]). In Tmem63b / Slc19a2-induced lipid scrambling, Tmem63b and Slc19a2 form heterodimers. The wild-type Tmem63b-Slc19a2 heterodimer induces lipid scrambling with Kcnn4 activation (Fig. 5i, top). Furthermore, the heterodimers of certain disease-associated mutant Tmem63b and Slc19a2 exhibit lipid scrambling without Kcnn4 activation (Fig. 5i, bottom). Furthermore, we found that there was a correlation between the amount of heterodimer formed and the level of lipid scrambling activity for both the heterodimers of wild-type Tmem63b and Slc19a2 and the heterodimers of specific disease-associated mutant Tmem63b and Slc19a2 (Fig. 5f, g, and Fig. 5h).The present invention was completed through further investigation based on these findings.

[0008] That is, the present invention provides the following aspects. Item 1. A method for screening for a regulator of lipid scrambling activity induced by Tmem63b, comprising the steps of: (1) The cells expressing Tmem63b, Slc19a2, and Kcnn4 and the candidate regulatory substance are cultured in a Ca 2+ contacting under stimulation; (2) determining whether or not the candidate substance alters lipid scrambling activity in the cell membrane of the cell; and (3) selecting the candidate substance that caused the change as the regulator; A screening method comprising: Item 2. The method according to Item 1, wherein in step (3), if the lipid scrambling activity is lower than the lipid scrambling activity in the cells not contacted with the candidate substance, the candidate substance is selected as a modulator that inhibits the lipid scrambling activity. Item 3. The method according to Item 1, wherein in step (3), if the lipid scrambling activity is higher than the lipid scrambling activity in the cells not contacted with the candidate substance, the candidate substance is selected as a regulator that promotes the lipid scrambling activity. Item 4. The method according to any one of Items 1 to 3, wherein in step (2), the lipid scrambling activity is measured based on the amount of the heterodimer of Tmem63b and Slc19a2. Item 5. The method according to any one of Items 1 to 3, wherein in step (2), the lipid scrambling activity is measured based on at least one of the activity of uptake of phospholipids or glycolipids located on the outside of the cell membrane and the activity of exposure of phospholipids located on the inside of the cell membrane. Item 6. A method for screening a therapeutic agent for a disease associated with abnormal lipid scrambling activity, comprising the following steps: (1) Cells expressing mutant Tmem63b and Slc19a2 and the candidate substance for the therapeutic agent are cultured in a Ca 2+ contacting under non-stimulation; (2) determining whether the candidate substance reduces lipid scrambling activity in the cell membrane of the cell; and (3) selecting the candidate substance that caused the decrease as the therapeutic agent; Including, The mutated Tmem63b is [Ai] A polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1, which has at least any one of the following mutations: substitution of the amino acid residue at position 44 with a methionine residue, substitution of the amino acid residue at position 459 with a glutamic acid residue, deletion of the amino acid residue at position 475, and substitution of the amino acid residue at position 660 with a threonine residue; [A-ii] A polypeptide in which one or more amino acid residues other than the mutated amino acid residues in the amino acid sequence of the polypeptide shown in [Ai] are substituted, added, inserted or deleted, and the heterodimer formed with Slc19a2 is Ca 2+ A polypeptide having lipid scrambling activity in cell membranes without stimulation by [A-iii] A polypeptide having an amino acid sequence with 75% or more sequence identity with respect to the amino acid sequence of the polypeptide shown in [Ai] above, excluding the amino acid residue of the mutation, and wherein the heterodimer formed with Slc19a2 is Ca 2+ Polypeptides with lipid scrambling activity in cell membranes without stimulation by ATP The screening method is at least one of the above. Item 7. The method according to Item 6, wherein the disease is selected from the group consisting of diseases associated with hematological abnormalities and epilepsy. Item 8. The method according to Item 7, wherein the hematological abnormality is megaloblastic anemia or hemolytic anemia. Item 9. The method according to any one of Items 6 to 8, wherein in step (2), the lipid scrambling activity is measured based on the amount of a heterodimer of the Tmem63b mutant and Slc19a2. Item 10. The method according to any one of Items 6 to 8, wherein in step (2), the lipid scrambling activity is measured based on at least one of the activity of uptake of phospholipids or glycolipids located on the outside of the cell membrane and the activity of exposure of phospholipids located on the inside of the cell membrane. Item 11. A method for screening a therapeutic agent for a disease associated with abnormal lipid scrambling activity, comprising the following steps: (1) Cells expressing mutant Tmem63b, Slc19a2, and Kcnn4 and the candidate therapeutic agent are cultured in a Ca 2+ contacting under stimulation; (2) determining whether or not the candidate substance increases lipid scrambling activity in the cell membrane of the cell; and (3) selecting the candidate substance that caused the increase as the therapeutic agent; Including, The mutated Tmem63b is [Bi] A polypeptide consisting of an amino acid sequence shown in SEQ ID NO: 1, in which the amino acid residue at position 433 has been substituted with a histidine residue; [B-ii] A polypeptide having the amino acid sequence of [Bi] in which one or several amino acid residues other than the substituted amino acid residue are substituted, added, inserted or deleted, and the heterodimer formed with Slc19a2 is Ca 2+ A polypeptide that does not have lipid scrambling activity in cell membranes under stimulation of [B-iii] A polypeptide having an amino acid sequence of 75% or more sequence identity excluding the substituted amino acid residue in the amino acid sequence of the polypeptide shown in [Bi], and a heterodimer formed with Slc19a2 that is a heterodimer of Ca 2+ Polypeptides that do not have lipid scrambling activity in cell membranes under stimulation of The screening method is at least one of the above. Item 12. The method according to Item 11, wherein the disease is selected from the group consisting of diseases associated with hematological abnormalities and hearing loss. Item 13. A method for testing for the onset of a disease associated with abnormal lipid scrambling activity, comprising the following steps: (1) In a cell sample derived from a test subject, Ca 2+ Obtaining a quantitative value of the heterodimer of mutant Tmem63b and Slc19a2 under unstimulated conditions; and (2) comparing the quantitative value with a threshold value; Including, The mutated Tmem63b is [Ai] A polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1, which has at least one mutation selected from the following: substitution of the amino acid residue at position 44 with a methionine residue, substitution of the amino acid residue at position 459 with a glutamic acid residue, deletion of the amino acid residue at position 475, and substitution of the amino acid residue at position 660 with a threonine residue. [A-ii] A polypeptide in which one or more amino acid residues other than the mutated amino acid residues in the amino acid sequence of the polypeptide shown in [Ai] are substituted, added, inserted or deleted, and the heterodimer formed with Slc19a2 is Ca 2+ A polypeptide having lipid scrambling activity in cell membranes without stimulation by [A-iii] A polypeptide having an amino acid sequence identity of 75% or more in the portion excluding the amino acid residue of the mutation in the amino acid sequence of the polypeptide shown in [Ai], and a heterodimer formed with Slc19a2 that is a heterodimer of Ca 2+ Polypeptides with lipid scrambling activity in cell membranes without stimulation by ATP At least one of the following is true: The method, wherein the threshold value is such that if the quantitative value is higher than the threshold value, it indicates that the test subject is suffering from the disease. Item 14. The method according to Item 13, wherein the disease is selected from the group consisting of diseases associated with hematological abnormalities and epilepsy. Item 15. The method according to Item 14, wherein the hematological abnormality is megaloblastic anemia or hemolytic anemia. Item 16. A method for testing the severity of a lipid scrambling activity abnormality in a disease associated with the abnormality, comprising the steps of: (1) In a cell sample derived from a subject suffering from the disease, Ca 2+ Under unstimulated or Ca 2+ Obtaining a quantitative value of the heterodimer of mutant Tmem63b and Slc19a2 under stimulation; and (2) comparing the quantitative value with a reference value; Including, The mutated Tmem63b is [Ai] A polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1, which has at least any one of the following mutations: substitution of the amino acid residue at position 44 with a methionine residue, substitution of the amino acid residue at position 459 with a glutamic acid residue, deletion of the amino acid residue at position 475, and substitution of the amino acid residue at position 660 with a threonine residue; [A-ii] A polypeptide in which one or more amino acid residues other than the mutated amino acid residues in the amino acid sequence of the polypeptide shown in [Ai] are substituted, added, inserted or deleted, and the heterodimer formed with Slc19a2 is Ca 2+ A polypeptide having lipid scrambling activity in cell membranes without stimulation by [A-iii] A polypeptide having an amino acid sequence identity of 75% or more in the portion excluding the amino acid residue of the mutation in the amino acid sequence of the polypeptide shown in [Ai], and a heterodimer formed with Slc19a2 that is a heterodimer of Ca 2+ Polypeptides with lipid scrambling activity in cell membranes without stimulation by ATP At least one of the following is true: The method, wherein the amount obtained by subtracting the reference value from the quantitative value is positively correlated with the severity. Item 17. The method according to Item 16, wherein the disease is selected from the group consisting of diseases associated with hematological abnormalities and epilepsy. Item 18. The method according to Item 17, wherein the hematological abnormality is megaloblastic anemia or hemolytic anemia. Item 19. A method for screening for a substance that regulates lipid scrambling activity, comprising the steps of: (1) Cells expressing Stim1 and Orai1 and the candidate regulatory substance were cultured in a Ca 2+ contacting under stimulation; (2) determining whether or not the candidate substance alters lipid scrambling activity in the cell membrane of the cell; and (3) selecting the candidate substance that caused the change as the regulator; A screening method comprising: Item 20. The method according to Item 19, wherein in step (3), if the lipid scrambling activity is lower than the lipid scrambling activity in the cells not contacted with the candidate substance, the candidate substance is selected as a modulator that inhibits the lipid scrambling activity. Item 21. The method according to Item 19, wherein in step (3), if the lipid scrambling activity is higher than the lipid scrambling activity in the cells not contacted with the candidate substance, the candidate substance is selected as a modulator that promotes the lipid scrambling activity. [Effects of the Invention]

[0009] According to the present invention, based on a new lipid scrambling system on the cell membrane, a screening system for regulators of lipid scrambling activity or therapeutic agents for diseases associated with abnormalities in lipid scrambling activity, and a diagnostic method for diseases associated with abnormalities in lipid scrambling activity are provided. [Brief explanation of the drawings]

[0010] [Figure 1a] Establishment of high PLS (phospholipid scrambled) cells by repeated sorting (Figures 1a-d). Analysis of PLS ​​activity. PLS activity was examined using an NBD-PC uptake assay in Ba / F3 cells and cells lacking Tmem16F and Xkr8 (BDKO cells). Cells were resuspended in lipid buffer (HBSS containing 1 mM CaCl2 and 1 mM MgCl2) and stimulated with low and high concentrations of calcium ionophore A23187 (0.5 μM and 3.0 μM) at 4°C. Analysis was performed at 0 (light gray) and 10 minutes (dark gray). Bars indicate the area positive for phosphatidylcholine (PC) uptake; values ​​indicate the cell population within the bar. Experiments were performed three times independently, and representative data are shown. [Figure 1b] Strategy for constructing high-PLS cells. BDKO cells, which showed high NBD-PC uptake activity when stimulated with A23187 (0.5 μM) in lipid buffer, were collected by flow cytometry and subsequently expanded. High-PLS cells (hPC19) were obtained by repeated sorting 19 times. [Figure 1c] PC uptake assay in hPC19 cells. hPC19 cells were stimulated with low and high concentrations of A23187 (0.5 μM and 3.0 μM, respectively) in lipid buffer at 4°C and analyzed at 0 (light gray) and 10 (dark gray) minutes. Bars indicate PC uptake-positive areas, and values ​​indicate the cell population within the bars. [Figure 1d]Phosphatidylserine (PS) exposure activity. Parental BDKO cells and hPC19 cells were stimulated with 3.0 μM A23187 in Annexin V-Cy5 / PI (propidium iodide) buffer (10 mM Hepes, 140 mM NaCl, 2.5 mM CaCl) for 10 minutes at room temperature. PI-negative areas are indicated. Experiments were performed three times independently, and representative data are shown. [Figure 2a] Identification of Tmem63b as a PLS-induced protein (Figures 2a-e). Schematic diagram of revival screening using the sgRNA library. The sgRNA library was transfected into hPC19 cells expressing CRISPR-Cas9. For the NBD-PC assay, cells were stimulated with 3.0 μM A23187 in lipid buffer at 4°C for 10 minutes, and PC uptake-negative regions were selected by flow cytometry. Genomic DNA was purified from the sorted cells, and PCR was performed to amplify the integrated sgRNA region. The region was then inserted into a lentiviral vector to reconstruct an enriched sgRNA library. The newly reconstructed library was used for subsequent screening. These processes were repeated three times for next-generation sequencing (NGS). [Figure 2b] Revival screening. PC-negative cells (1%) were selected by flow cytometry and used to reconstruct the sgRNA library. sgPC0 represents cells transfected with the original sgRNA library, sgPC2 represents cells sorted twice, and sgPC3 represents cells sorted three times. Bars represent PC-negative areas, and numbers represent cell populations within the bars. [Figure 2c] NGS analysis of sgRNAs after the fourth round of sorting. The total number of reads (sum of reads from different sgRNAs targeting the same gene) was ranked. The mapped numbers indicate the number of sgRNA targets identified among the six sgRNAs. Map numbers 0 to 2 were excluded from the list. Genes that were further analyzed are underlined. [Figure 2d-1]PLS activity was analyzed by AnnexinV-Cy5 / PI staining in BDKO cells as a control. Stim1 knockout (KO) BDKO cells, Stim1-repaired cells, Tmem63b KO BDKO cells, and Tmem63b-repaired cells were stimulated with 3.0 μM A23187 in Annexin buffer containing AnnexinV-Cy5 / PI for 10 minutes at room temperature. PI-negative areas were analyzed. Experiments were performed three times independently, and representative data are shown. [Figure 2d-2] PLS activity was analyzed by AnnexinV-Cy5 / PI staining in BDKO cells as a control, Stim1 / Tmem63b double KO BDKO cells, and cells repaired with Tmem63b or Stim1. The cells were stimulated with 3.0 μM A23187 in Annexin buffer containing AnnexinV-Cy5 / PI for 10 minutes at room temperature. PI-negative areas were analyzed. Experiments were performed three times independently, and representative data are shown. [Figure 2e] Model of two independent Ca2+-mediated PLS systems. [1] Tmem63b-dependent PLS at the PM. [2] Stim1 / Orai1-dependent PLS at the ER-PM contact site. epSCR is an unknown ER-PM scramblase. [Figure 3a] PLS analysis of Tmem63b mutants (Figures 3a-e). Multiple alignment of Tmem63b with its orthologs in five vertebrate species (Homo sapiens NP_001305721.1; Mus musculus NP_937810.2; Gallus gallus NP_001366170.1; Xenopus tropicalis XP_031757905.1; Danio rerio NP_001313336.1). Mutant residues are shown in bold. An asterisk (*) below the sequence indicates a position where the amino acid is conserved across different species, and a colon (:) indicates that similar amino acids are conserved across different species. [Figure 3b] Schematic diagram of the human TMEM63B protein and the location of identified disease variants (V44M, R433H, D459E, I475del, R660T) on the structure (pdb:8ehx). Asterisks (*) indicate the location of the mutations. [Figure 3c] PS exposure assay. Tmem63b WT-expressing or Tmem63b mutant-expressing cells were stimulated with 3.0 μM A23187 ((+)A23187) or without A23187 ((-)A23187) in Annexin buffer containing Annexin V-Cy5 / PI and incubated at 4°C for 10 minutes. Bars indicate areas positive for PS exposure, and numbers indicate the cell population within the bars. Data for Tmem63b mutants are displayed according to activity intensity. [Figure 3d] Quantification of PS exposure. The mean fluorescence intensity (MFI) of Tmem63b mutants without A23187 stimulation in Figure 3c is shown as the average of three replicates (n = 3, independent experiments). The middle, bottom, and top lines indicate the median, minimum, and maximum values, respectively. Data for Tmem63b mutants are displayed according to activity intensity. Source data are provided as a Source Data file. [Figure 3e] Uniform manifold approximation and projection (UMAP) of human fetal bone marrow single-cell RNA-seq data (n = 9, different BM samples, k = 103,228, gestational weeks 12-19 (PCW)) was obtained from database E-MTAB-9389 and analyzed by broad categories: Baso basophil; eo eosinophil; MK megakaryocyte. TMEM63B is expressed in the erythroid lineage, with particularly high expression in mid- and late-stage erythroid cells. [Figure 4a] Identification of a factor activating Tmem63b-mediated PLS (Figures 4a-h). Revival screening. Tmem63b-GFP-expressing BDKO cells were stimulated with 3.0 μM A23187 in Annexin V-Cy5 / PI buffer at 4°C for 1 hour. Flow cytometry was performed to recover PS exposure-negative cells from the GFP-positive population and use them to reconstruct an enriched sgRNA library. sgPC0 refers to cells transfected with the original sgRNA library, and sgPC3 refers to cells sorted three times. The bars indicate the PS exposure-negative region, and the numbers indicate the cell population within the bar. [Figure 4b]NGS analysis after four rounds of sorting. The total number of reads (the sum of the number of reads from different sgRNAs for the same gene) was ranked. The mapped numbers indicate the number of sgRNA targets identified among six different sgRNAs. Genes with mapped numbers between 0 and 2 were excluded from the list. Genes that were further analyzed are underlined. [Figure 4c] PS exposure assay. Tmem63b-GFP-expressing BDKO cells, sgKcnn4-expressing cells, and cells expressing both sgKcnn4 and Kcnn4 WT-tagRFP were stimulated with 3 μM A23187 in Annexin buffer containing Annexin V-Cy5 / PI. Flow cytometry analysis was performed at 10-minute intervals. PI-negative cells were analyzed. Average values ​​from triplicates (n=3, independent experiments) are shown with error bars. Data are presented as mean ± SEM. Source data is provided as a Source data file. [Figure 4d] PS exposure assay. Tmem63b-GFP-expressing BDKO cells, sgSlc19a2-expressing cells, and cells expressing both sgSlc19a2 and Slc19a2 WT-tagRFP or S143F-tagRFP were stimulated with 3.0 μM A23187 in Annexin buffer containing Annexin V-Cy5 / PI at 4°C. Flow cytometry analysis was performed every 10 minutes. PI-negative cells are shown. Average values ​​from triplicates (n = 3, independent experiments) are shown with error bars. Data are presented as mean ± SEM. Source data is provided as a Source data file. [Figure 4e] Compare Figure 4c with Figure 4d. Average values ​​for 40 min of PS exposure are shown. Data are presented as mean ± SEM. Statistical analysis was performed using a two-tailed Student's t-test. p<0.05 was considered statistically significant. *p<0.05, **p<0.01. Source data are available in the Source Data file. [Figure 4f]PS exposure assay. Tmem63b mutant-GFP-expressing cells were incubated with Slc19a2-tagRFP or sgSlc19a2 and Kcnn4-tagRFP or sgKcnn4 in Annexin buffer containing Annexin V-Cy5 / PI for 10 min at 4°C without A23187 stimulation. [Figure 4g] Quantification of Figure 4f. Each experiment was performed independently three times, and the average value of PS exposure is shown with error bars. Data are presented as mean ± SEM. Statistical analysis was performed using a two-tailed Student's t-test. p<0.05 was considered statistically significant. *p<0.05, ***p<0.001, ****p<0.0001. The rows of cells expressing both the Tmem63b mutant and sgRNA are shaded. Source data is provided as a Source Data file. [Figure 4h] Quantification of Figure 4f. Each experiment was performed independently three times, and the average value of PS exposure is shown with error bars. Data are presented as mean ± SEM. Statistical analysis was performed using a two-tailed Student's t-test. p<0.05 was considered statistically significant. *p<0.05, ***p<0.001, ****p<0.0001. The rows of cells expressing both the Tmem63b mutant and sgRNA are shaded. Source data is provided as a Source Data file. [Figure 5a] Tmem63B and Slc19a2 form a heterodimer (Figure 5a-i). BN-PAGE analysis of lysates from Tmem63b-GFP-expressing BDKO cells. Tmem63b exists primarily as a monomer, with a small amount of dimer-like activity. Tmem63b was detected using anti-GFP. Experiments were performed independently three times, and representative data are shown. [Figure 5b]Tmem63b-interacting molecules. Tmem63b-GFP-expressing cells were solubilized with LMNG / CHS and subjected to immunoprecipitation with anti-GFP nanobody-conjugated beads, followed by mass spectrometry. The x-axis shows the abundance ratio of Tmem63b in the absence of Ca2+, expressed as the fold change (log2), compared to parental cells. The y-axis shows the abundance ratio of Tmem63b in the presence of Ca2+, expressed as the fold change (log2). Dots indicated by arrows represent Tmem63b and Slc19a2. [Figure 5c] BN-PAGE analysis of Tmem63b-expressing cells overexpressing Slc19a2-tagRFP, Kcnn4-tagRFP, and Csnk2b-tagRFP, or transfected with sgSlc19a2, sgKcnn4, and sgCsnk2b. Tmem63b was detected using an anti-GFP antibody. Experiments were performed three times independently, and representative data are shown. [Figure 5d] BN-PAGE analysis of Tmem63b-FLAG-GFP-expressing cells overexpressing Slc19a2-HA-tagRFP. After detergent solubilization, the cell lysate was mixed with anti-FLAG or anti-HA antibody and subjected to BN-PAGE to observe the gel shift. (i) Monomer, (ii) Heterodimer, (iii) Monomer bound to antibody, (iv) Heterodimer bound to antibody. Anti-GFP was used to detect Tmem63b. Experiments were performed twice, and representative data are shown. [Figure 5e] BN-PAGE analysis of Tmem63b mutant-expressing cells. Tmem63b was detected using anti-GFP. Experiments were performed three times independently, and representative data are shown. [Figure 5f] BN-PAGE analysis of Tmem63b mutant-expressing cells overexpressing Slc19a2 WT-tagRFP. Tmem63b was detected using an anti-GFP antibody. Experiments were performed three times independently, and representative data is shown. [Figure 5g] BN-PAGE analysis of Tmem63b mutant-expressing cells overexpressing Slc19a2 S143F-tagRFP. Tmem63b was detected using anti-GFP. [Figure 5h]BN-PAGE analysis of Tmem63b-expressing cells overexpressing Slc19a2 WT-tagRFP or S143F-tagRFP in the presence of 1 mM CaCl2 or 0.5 mM EGTA. Tmem63b was detected using anti-GFP. Experiments were performed twice independently, and representative data are shown. [Figure 5i] Schematic model of Tmem63b / Slc19a2-mediated PLS. In the activated state, Ca2+ stimulation induces PLS mediated by the Tmem63b / Slc19a2 heterodimer, resulting in Kcnn4 activation (top). In Tmem63b mutant-expressing cells, sustained PLS occurs even without Ca2+ stimulation or K+ efflux (bottom). [Figure 6a] Stim1- and Tmem63b-dependent PLS (Figures 6a-e). Sequence analysis of a Stim1- / - BDKO single clone. The sgRNA target region was amplified by PCR and sequenced. Sequence of Stim1(- / -) (top). [Figure 6b] Sequence analysis of Tmem63b- / - BDKO single clones. The sgRNA target region was amplified by PCR and sequenced. Sequence of Tmem63b(- / -) (top). [Figure 6c] Ca2+ influx assay. BDKO cells were incubated with 1M Fluo4-AM in culture medium at 37°C for 30 seconds, stimulated with 3.0M A23187 and Annexin V-Cy5 / PI in Annexin buffer (10 mM HEPES, 140 mM NaCl, 2.5 mM CaCl2) for 100 seconds, and recorded by flow cytometry for a total of 200 seconds at room temperature. Experiments were performed three times independently, and representative data are shown. [Figure 6d] PS exposure assay. Stim1- / - BDKO cells expressing Tmem63 family members fused to GFP (Tmem63a-GFP, Tmem63b-GFP, or Tmem63c-GFP) were stimulated with 3.0 μM A23187 at room temperature in the presence of Annexin V-Cy5 and PI. PI-negative areas were analyzed. Data for Stim1- / - are the same as in Figure 2d. Experiments were performed independently three times, and representative data are shown. [Figure 6e]PC uptake assay. Stim1- / - Tmem63b- / - BDKO cells were transfected with Tmem63b-tagRFP or Stim1-tagRFP, and an NBD-PC uptake assay was performed in lipid buffer (HBSS containing 1 mM CaCl2 and 1 mM MgCl2). The bar indicates the area positive for PC uptake, and the numbers indicate the cell population within the bar. Experiments were performed independently three times, and representative data are shown. [Figure 7] PS exposure assay. BDKO cells and cells expressing Tmem63b-GFP were stimulated in Annexin V-Cy5 / PI buffer with or without 3.0 M A23187 at 4°C. Flow cytometry analysis was performed every 10 min. PI-negative cells were also analyzed. Experiments were performed twice, and representative data are shown. DETAILED DESCRIPTION OF THE INVENTION

[0011] 1. Screening method for regulators of lipid scrambling activity (Tmem63b / Slc19a2-induced) A first embodiment of the present invention relates to a method for screening for a modulator of lipid scrambling activity, which utilizes the Tmem63b / Slc19a2-induced lipid scrambling system. More specifically, the first embodiment of the present invention utilizes a system in which Tmem63b and Slc19a2 form a heterodimer, and the heterodimer between wild-type Tmem63b and Slc19a2 induces lipid scrambling through activation of Kcnn4.

[0012] The method according to the first embodiment is a method for screening for a modulator of Tmem63b-induced lipid scrambling activity, comprising the steps of: (1) The cells expressing Tmem63b, Slc19a2, and Kcnn4 and the candidate regulatory substance are cultured in a Ca 2+ contacting under stimulation; (2) determining whether or not the candidate substance alters lipid scrambling activity in the cell membrane of the cell; and (3) A step of selecting the candidate substance that caused the change as the regulator.

[0013] 1-1.Tmem63b "Tmem63b" is a protein called a CSC1-like protein, which contains multiple transmembrane domains and is localized in the cell membrane. In the method according to the first embodiment, Tmem63b is used as a lipid scrambling inducer. Specifically, Tmem63b forms a heterodimer with Slc19a2 and binds to Ca 2+ It is activated by stimulation of Kcnn4 via α-glucan and carries out lipid scrambling.

[0014] In the method according to the first embodiment, Tmem63b forms a heterodimer with Slc19a2 and binds Ca 2+ The Tmem63b may be either wild-type or mutant, as long as it induces lipid scrambling through activation under stimulation. Wild-type Tmem63b includes human (Homo sapiens) Tmem63b and its homologs (e.g., homologs from mice (Mus musculus), chickens (Gallus gallus), frogs (Xenopus tropicalis), and fish (Danio rerio)). Mutations in mutant Tmem63b used in the method of the first embodiment exclude gain-of-function mutations in the second embodiment (described below in "2-1. Mutant Tmem63b") and loss-of-function substitutions in the third embodiment (described below in "3-1. Mutant Tmem63b"). Mutations in mutant Tmem63b used in the method of the first embodiment are hereinafter also referred to as "other Tmem63b mutations."

[0015] Specific examples of Tmem63b in the method according to the first embodiment include at least one of the following polypeptides. However, in the method according to the first embodiment, among the following polypeptides, [Tm-ii] and [Tm-iii] form heterodimers with Slc19a2 and are involved in Ca 2+ It is a polypeptide that is activated by stimulation of Kcnn4 via ATP and carries out lipid scrambling.

[0016] [Tm-i] a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1; [Tm-ii] A polypeptide in which one or several (for example, 1 to 208 or 1 to 166, preferably 1 to 83, 1 to 41, 1 to 8, or 1 to 4) amino acid residues have been substituted, added, inserted, or deleted in the amino acid sequence of the polypeptide shown in [Tm-i] above. [Tm-iii] A polypeptide consisting of an amino acid sequence that has a sequence identity of 75% or more or 80% or more (preferably 90% or more, 95% or more, 99% or more, or 99.5% or more) to the amino acid sequence of the polypeptide shown in [Tm-i].

[0017] The above-mentioned [Tm-i] polypeptide is human (Homo sapiens) Tmem63b (NP_001305721.1). The above-mentioned [Tm-ii] and [Tm-iii] polypeptides include various homologs such as the mouse (Mus musculus) homolog (NP_937810.2, SEQ ID NO: 6), chicken (Gallus gallus) homolog (NP_001366170.1), frog (Xenopus tropicalis) homolog (XP_031757905.1), and fish (Danio rerio) homolog (NP_001313336.1); the above-mentioned [Tm-i] polypeptide with additional Tmem63b mutations; and the above-mentioned various homologs with additional Tmem63b mutations at corresponding positions.

[0018] 1-2.Slc19a2 "Slc19a2" is a thiamine transporter (TT) present in the cell membrane, and its deficiency causes thiamine-responsive megaloblastic anemia (TRMA). In the method according to the first embodiment, Slc19a2 is used as a Tmem63b cofactor (a lipid scrambling regulator). Specifically, Slc19a2 forms a heterodimer with Tmem63b and mediates Ca 2+ It is activated by stimulation of Kcnn4 via α-glucan and carries out lipid scrambling.

[0019] In the method according to the first embodiment, Slc19a2 forms a heterodimer with the above-mentioned Tmem63b, thereby 2+ The Slc19a2 may be either wild-type or mutant, as long as it induces lipid scrambling by Tmem63b upon stimulation through activation. Wild-type Slc19a2 includes human (Homo sapiens) Slc19a2 and its homologs (e.g., homologs from mice (Mus musculus), chickens (Gallus gallus), frogs (Xenopus tropicalis), and fish (Danio rerio)). Mutations in mutant Slc19a2 include TT dysfunction / deficiency mutations and mutations other than TT dysfunction / deficiency mutations (hereinafter also referred to as "other Slc19a2 mutations").

[0020] Specific examples of Slc19a2 in the method according to the first embodiment include at least one of the following polypeptides. However, in the method according to the first embodiment, among the following polypeptides, [Sl-ii] and [Sl-iii] form heterodimers with the above-mentioned Tmem63b and are involved in Ca 2+ It is a polypeptide that is activated by stimulation of Kcnn4 via ATP and carries out lipid scrambling.

[0021] [Sl-i] a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2; [Sl-ii] A polypeptide in which one or several (for example, 1 to 124 or 1 to 99, preferably 1 to 49, 1 to 24, 1 to 4, or 1 to 2) amino acid residues are substituted, added, inserted, or deleted in the amino acid sequence of the polypeptide shown in [Sl-i] above. [Sl-iii] A polypeptide consisting of an amino acid sequence having a sequence identity of 75% or more or 80% or more (preferably 90% or more, 95% or more, 99% or more, or 99.5% or more) with the amino acid sequence of the polypeptide shown in [Sl-i] above.

[0022] The above-mentioned [Sl-i] polypeptide is human (Homo sapiens) Slc19a2. The above-mentioned [Sl-ii] and [Sl-iii] polypeptides include various homologs such as the mouse (Mus musculus) homolog (SEQ ID NO: 7), chicken (Gallus gallus) homolog, frog (Xenopus tropicalis) homolog, and fish (Danio rerio) homolog; the above-mentioned [Sl-i] polypeptide to which the TT dysfunction / deficiency mutation S143F or other Slc19a2 mutation has been added; and the above-mentioned various homologs to which the TT dysfunction / deficiency mutation or other Slc19a2 mutation has been added at the corresponding site.

[0023] Among these Slc19a2s, preferred are the above-mentioned [Sl-i] polypeptide and the above-mentioned [Sl-ii] and [Sl-iii] polypeptides, including the various homologs thereof, the above-mentioned [Sl-i] polypeptide to which other Slc19a2 mutations have been added, and the above-mentioned various homologs to which other Slc19a2 mutations have been added; more preferred are the above-mentioned [Sl-i] polypeptide and the above-mentioned various homologs thereof, including the above-mentioned [Sl-ii] and [Sl-iii] polypeptides.

[0024] 1-3.Kcnn4 "Kcnn4" is a Ca receptor on the cell membrane. 2+ activation K + Kcnn4 is a channel whose mutation is involved in hereditary dry cell disease. In the method according to the first embodiment, Kcnn4 is used as a Tmem63b cofactor (a lipid scrambling regulator). Specifically, Kcnn4 is a Ca 2+ Activated by stimuli and mediated by itself + Upon efflux, the Tmem63b / Slc19a2 heterodimer performs lipid scrambling.

[0025] In the method according to the first embodiment, Kcnn4 is a 2+The Kcnn4 may be either wild-type or mutant, as long as it is activated under stimulation and causes the Tmem63b / Slc19a2 heterodimer to carry out lipid scrambling. Wild-type Kcnn4 includes human (Homo sapiens) Kcnn4 and its homologs (e.g., homologs from mice (Mus musculus), chickens (Gallus gallus), frogs (Xenopus tropicalis), and fish (Danio rerio)). Mutations in mutant Kcnn4 exclude histidine phosphorylation mutations in the calmodulin-binding domain.

[0026] Specific examples of Kcnn4 in the method according to the first embodiment include at least one of the following polypeptides. However, in the method according to the first embodiment, the polypeptides [Kc-ii] and [Kc-iii] are derived from Ca 2+ Activated by stimuli and mediated by itself + This polypeptide causes the Tmem63b / Slc19a2 heterodimer to carry out lipid scrambling upon efflux.

[0027] [Kc-i] a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 3; [Kc-ii] A polypeptide in which one or several (e.g., 1 to 106 or 1 to 85, preferably 1 to 42, 1 to 21, 1 to 4, or 1 to 2) amino acid residues have been substituted, added, inserted, or deleted in the amino acid sequence of the polypeptide shown in [Kc-i] above. [Kc-iii] A polypeptide consisting of an amino acid sequence that has a sequence identity of 75% or more or 80% or more (preferably 90% or more, 95% or more, 99% or more, or 99.5% or more) to the amino acid sequence of the polypeptide shown in [Kc-i] above.

[0028] The [Kc-i] polypeptide is human (Homo sapiens) Kcnn4. The [Kc-ii] and [Kc-iii] polypeptides include various homologs such as the mouse (Mus musculus) homolog (SEQ ID NO: 8), chicken (Gallus gallus) homolog, frog (Xenopus tropicalis) homolog, and fish (Danio rerio) homolog; the [Kc-i] polypeptide with an additional mutation (excluding the histidine phosphorylation mutant H358N in the calmodulin-binding domain); and the various homologs with the additional mutation.

[0029] 1-4. Cells expressing Tmem63b, Slc19a2, and Kcnn4 "Cells expressing Tmem63b, Slc19a2, and Kcnn4" may be cells that naturally express Tmem63b, Slc19a2, and Kcnn4 from their genome, or cells that express Tmem63b, Slc19a2, and Kcnn4 after introduction of an exogenous Tmem63b gene, Slc19a2 gene, and / or Kcnn4 gene. The origin of the cells is not particularly limited, and examples include cells derived from humans, monkeys, mice, or rabbits. More specific examples of such cells include human HeLa, human EBV (Epstein Barr Virus)-transformed B cell lines, mouse MEF (embryonic fibroblasts), and the mouse pro-B cell line Ba / F3.

[0030] 1-5. Candidate substances for regulating lipid scrambling activity In all embodiments herein, the term "modulator of lipid scrambling activity" encompasses "modulators that inhibit lipid scrambling activity" and "modulators that promote lipid scrambling activity."

[0031] In the method of the first embodiment, the "regulator of lipid scrambling activity induced by Tmem63b" may be a substance that directly affects (attenuates or increases) the function of Tmem63b, Slc19a2, and / or Kcnn4 protein, or may be a substance that changes (decreases or increases) the expression level of Tmem63b, Slc19a2, and / or Kcnn4 protein.

[0032] The regulator may be either a natural substance or a synthetic substance. Specific examples of the regulator include low-molecular-weight compounds, proteins, nucleic acid molecules, peptides, antibodies, cell (microorganism, plant, animal, etc.) extracts, and cell (microorganism, plant, animal, etc.) culture supernatants. Further examples of the regulator include substances that act on regulatory sequences, such as promoters or enhancers, of genes encoding Tmem63b, Slc19a2, and / or Kcnn4, as well as antisense oligonucleotides (DNA or RNA), nucleic acids such as siRNA and miRNA, and ribozymes prepared based on the sequences of genes encoding Tmem63b, Slc19a2, and / or Kcnn4.

[0033] The "candidate substances" for the regulatory substance are a group of substances that have potential as the regulatory substance. The form of the candidate substances may be any form provided in a typical screening, such as a library. Furthermore, the group of substances contained in the library may be those that have been preliminarily selected by another screening method.

[0034] 1-6.Ca 2+ Touch under stimulation The cells and the candidate substance were treated with "Ca 2+ "Contacting under stimulation" refers to contacting the cells with the candidate substance and Ca 2+ Specifically, Ca 2+ The contact under stimulation involves adding the candidate substance and Ca to the culture medium of the cells. 2+ This can be achieved by allowing the above to coexist.

[0035] Ca 2+ Any substance can be used as a source as long as it does not impair cell viability. Typically, Ca 2+ As a source of Ca, which is inevitably involved in handling cells, 2+ Alternatively, it may be a water-soluble calcium salt (preferably CaCl2 or the like) added from the outside.

[0036] "Ca 2+ "Under stimulation" effectively 2+ Any conditions may be used as long as they are sufficient to induce stimulation, and those skilled in the art can appropriately set these conditions as long as they do not impair cell viability. For example, when a water-soluble calcium salt is added externally, the amount of the water-soluble calcium salt added can be, for example, 0.5 to 3 mM, preferably 1 to 2.5 mM. For example, a calcium ionophore can also be added coexistently. Examples of calcium ionophores include specific antibiotics such as A23187 and X-537A, inositol 1,4,5-trisphosphate, leukotriene B4, prostaglandin B2, thromboxane A2, etc., with A23187 being preferred. When a calcium ionophore is used, the concentration of the calcium ionophore to be added coexistently can be appropriately set by those skilled in the art, but can be, for example, 0.1 to 5 μM, preferably 0.5 to 3 μM. Furthermore, to effectively stimulate Ca 2+ To provide stimulation, either the water-soluble calcium salts or calcium ionophores may be used alone or in combination.

[0037] 1-7. Lipid scrambling activity "Lipid scrambling activity" refers to the activity of transferring lipids in a lipid bilayer, more specifically, the activity of incorporating phospholipids and / or glycolipids located on the outer side of the cell membrane and the activity of exposing phospholipids located on the inner side of the cell membrane. The lipids are selected from phosphatidylserine (PS), phosphatidylcholine (PC), and galactosylceramide (GalCer).

[0038] Under normal conditions, the phospholipid PS is distributed in the inner leaflet of the cell membrane (inside the cell membrane), while the phospholipid PC and glycolipid GalCer are distributed in the outer leaflet (outside the cell membrane). By phospholipid scrambling, the phospholipid (PS) located on the inner side of the cell membrane moves to the outer leaflet (i.e., becomes exposed), and the phospholipid (PC) and glycolipid (GalCer) located on the outer side of the cell membrane move to the inner leaflet (i.e., are internalized).

[0039] 1-7-1. Lipid scrambling activity can be measured by any method that examines the distribution of lipids in the cell membrane. The presence or absence of a change in lipid scrambling activity can be determined by whether the amount of lipid distributed in the cell membrane changes after the above-mentioned contact compared to when the above-mentioned contact is not performed.

[0040] More specifically, the lipid scrambling activity can be measured based on at least one of the activity of incorporating phospholipids or glycolipids located on the outside of the cell membrane and the activity of exposing phospholipids located on the inside of the cell membrane.

[0041] The distribution of PS in the cell membrane can be examined by detecting the binding between PS exposed on the cell surface and a substance capable of binding to PS (e.g., Annexin V or MFG-E8 (also known as lactadherin)). For example, the cells after the contact can be treated with fluorescently labeled Annexin V, and the amount of Annexin V bound to the cell surface can be measured.

[0042] The distribution of PS in the cell membrane can also be examined based on blood coagulation reactions. For example, the cells after the contacting can be mixed with substances required for blood coagulation (e.g., factor Xa, factor Va, and prothrombin) to measure thrombin production. Alternatively, fibrinogen can be added to the cell culture to measure fibrin production.

[0043] The distribution of PC and GalCer in the cell membrane can be measured using fluorescently labeled lipids. Examples of fluorescent labels that can be used include NBD and TopFluor. For example, when fluorescently labeled lipids are added to a culture medium, they are incorporated into the outer leaflet of the cell membrane. When lipid scrambling occurs, the fluorescently labeled lipids move to the inner leaflet of the cell membrane (i.e., are incorporated). Therefore, the contact can be carried out in the presence of fluorescently labeled lipids (e.g., fluorescently labeled PC or fluorescently labeled CalCer). After the contact, the cells are then treated with BSA to remove any unincorporated fluorescently labeled lipids, and the fluorescently labeled lipids incorporated into the cells can be measured by flow cytometry.

[0044] 1-7-2. The Tmem63b protein forms a heterodimer with Slc19a2 (Tmem63b / Slc19a2 heterodimer) and promotes lipid scrambling. There is a correlation between the amount of Tmem63b / Slc19a2 heterodimer formed and the level of lipid scrambling activity. Therefore, lipid scrambling activity can be measured by examining the amount of heterodimer formed. The presence or absence of a change in lipid scrambling activity can be determined by whether the amount of heterodimer formed changes after the above contact compared to without the above contact.

[0045] The amount of the heterodimer formed can be measured by any method capable of measuring the amount of protein, for example, a relative method in which the molecular weight is determined by comparison with a standard substance, specifically, electrophoresis or gel filtration chromatography, can be used.

[0046] 1-8. Selection of regulators If the lipid scrambling activity is lower than that in the cells not contacted with the candidate substance, the candidate substance is selected as a regulator that inhibits the lipid scrambling activity.If the lipid scrambling activity is higher than that in the cells not contacted with the candidate substance, the candidate substance is selected as a regulator that promotes the lipid scrambling activity.

[0047] 2. Screening method for therapeutic drugs for diseases associated with abnormal lipid scrambling activity (gain-of-function mutation) A screening method for therapeutic agents for diseases associated with abnormalities in lipid scrambling activity according to a second embodiment of the present invention utilizes the Tmem63b / Slc19a2-induced lipid scrambling system. More specifically, the method according to the second embodiment utilizes a heterodimer formed between disease-associated (gain-of-function) Tmem63b and Slc19a2, and the heterodimer of disease-associated (gain-of-function) Tmem63b and Slc19a2 promotes the synthesis of Ca2+ without activating Kcnn4. 2+ We utilize a system that exhibits constitutive lipid scrambling (without stimulation).

[0048] The method according to the second embodiment is a method for screening a therapeutic agent for a disease associated with abnormal lipid scrambling activity, and includes the following steps: (1) Cells expressing mutant (gain-of-function) Tmem63b and Slc19a2 and the candidate therapeutic agent are cultured in a Ca 2+ contacting under non-stimulation; (2) determining whether the candidate substance reduces lipid scrambling activity in the cell membrane of the cell; and (3) selecting the candidate substance that caused the decrease as the therapeutic agent.

[0049] 2-1. Mutant Tmem63b The "mutated Tmem63b" in the method according to the second embodiment is a polypeptide in which a gain-of-function mutation has been added to the Tmem63b described above in "1-1. Tmem63b." In the method according to the second embodiment, the gain-of-function mutant Tmem63b forms a heterodimer with Slc19a2 and activates Ca2+ without activating Kcnn4 (i.e., Ca2+). 2+ The predetermined mutant Tmem63b in the second embodiment is specifically at least one of the following polypeptides:

[0050] [Ai] A polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1, which has at least one mutation (gain-of-function mutation) of the amino acid residue at position 44 with a methionine residue, the amino acid residue at position 459 with a glutamic acid residue, the amino acid residue at position 475 deleted, and the amino acid residue at position 660 with a threonine residue; [A-ii] In the amino acid sequence of the polypeptide shown in [Ai], one or several (for example, 1 to 208 or 1 to 166, preferably 1 to 83, 1 to 41, 1 to 8, or 1 to 4) amino acid residues other than the amino acid residue of the mutation (gain-of-function mutation) are substituted, added, inserted, or deleted, and the heterodimer formed with Slc19a2 is Ca 2+ A polypeptide having lipid scrambling activity in cell membranes without stimulation by [A-iii] The amino acid sequence of the polypeptide shown in [Ai] has a sequence identity of 75% or more or 80% or more (preferably 90% or more, 95% or more, 99% or more, or 99.5% or more) with respect to the portion excluding the amino acid residue of the mutation (gain-of-function mutation), and the heterodimer formed with Slc19a2 is Ca 2+ Polypeptides with lipid scrambling activity in cell membranes without stimulation by ATP

[0051] 2-2.Slc19a2 In the method according to the second embodiment, "Slc19a2" forms a heterodimer with a gain-of-function mutant Tmem63b and activates Ca2+ without activating Kcnn4. 2+ This is the same as described for the polypeptide described above in "1-2. Slc19a2," except that it exhibits lipid scrambling (without stimulation by ).

[0052] Specific examples of Slc19a2 in the method according to the second embodiment include at least one of the polypeptides [Sl-i] to [Sl-iii] described in the above section "1-2. Slc19a2." However, in the method according to the second embodiment, the polypeptides [Sl-ii] and [Sl-iii] form heterodimers with the above-mentioned gain-of-function mutant Tmem63b, and are capable of activating Ca without activating Kcnn4 (i.e., Ca 2+ It is a polypeptide that exhibits lipid scrambling (without stimulation).

[0053] 2-3. Cells expressing mutant Tmem63b and Slc19a2 "Cells expressing mutant Tmem63b and Slc19a2" may be cells that naturally express at least gain-of-function mutant Tmem63b and Slc19a2 from their genome, or cells that express gain-of-function mutant Tmem63b and Slc19a2 after introduction of an exogenous gain-of-function mutant Tmem63b gene and / or Slc19a2 gene. The origin of the cells and more specific examples of the cells are as described above in "1-4. Cells expressing Tmem63b, Slc19a2, and Kcnn4."

[0054] 2-4. Candidate substances for therapeutic drugs for diseases associated with abnormalities in lipid scrambling activity The "disease associated with abnormalities in lipid scrambling activity" may be any disease associated with the above-mentioned gain-of-function mutation. Examples of such diseases include diseases associated with hematological abnormalities, epilepsy, etc. Examples of hematological abnormalities include megaloblastic anemia and hemolytic anemia.

[0055] The types of therapeutic agents are the same as those listed as candidate substances in "1-5. Candidate substances for regulating lipid scrambling activity" above.

[0056] The "candidate substances" for the therapeutic agent are a group of substances that have potential as the therapeutic agent. The forms of the candidate substances are the same as those described above in "1-5. Candidate substances for regulating lipid scrambling activity."

[0057] 2-5.Ca 2+ Touch without stimulation "Ca 2+ "Unstimulated" refers to conditions that do not impair cell viability, and is the same as the above "1-6. 2+ This condition does not correspond to the condition described in "Contact under Ca stimulation." 2+ The term "contacting under non-stimulation" refers to contacting the cells with the candidate substance under the "Ca 2+ They can be allowed to coexist under "non-stimulated" conditions.

[0058] 2-6. Lipid scrambling activity The "lipid scrambling activity" is as described above in "1-7. Lipid scrambling activity."

[0059] 2-6-1. Lipid scrambling activity can be measured by the same method as described in "1-7-1." above. That is, lipid scrambling activity can be measured by any method that examines the distribution of lipids in the cell membrane. Specifically, it can be measured based on at least one of the uptake activity of phospholipids or glycolipids located on the outside of the cell membrane and the exposure activity of phospholipids located on the inside of the cell membrane. The presence or absence of a decrease in lipid scrambling activity can be determined by whether the distribution amount of lipids in the cell membrane is decreased after the above contact compared to when the above contact is not performed.

[0060] 2-6-2. Mutant Tmem63b protein forms a heterodimer with Slc19a2 (mutant Tmem63b / Slc19a2 heterodimer) and exhibits lipid scrambling activity. There is a correlation between the amount of mutant Tmem63b / Slc19a2 heterodimer formed and the level of lipid scrambling activity. Therefore, lipid scrambling activity can be measured using the same method as described in "1-7-2." above. In other words, lipid scrambling activity can be measured by examining the amount of heterodimer formed. The presence or absence of a decrease in lipid scrambling activity can be determined by determining whether the amount of heterodimer formed after the above contact is reduced compared to without the above contact.

[0061] 2-7.Selection of therapeutic drugs Since the diseases associated with the above-mentioned gain-of-function mutations exhibit abnormalities in lipid scrambling activity (specifically, excessive lipid scrambling activity), the candidate substance that reduces lipid scrambling activity through the above-mentioned contact is selected as a therapeutic agent.

[0062] 3. Screening method for therapeutic agents for diseases associated with abnormalities in lipid scrambling activity (loss-of-function mutations) In a third embodiment of the present invention, a method for screening a therapeutic agent for a disease associated with abnormal lipid scrambling activity is provided, in which a disease-associated mutation (loss-of-function mutation) Tmem63b and Slc19a2 form a heterodimer, and the heterodimer of the disease-associated mutation (loss-of-function mutation) Tmem63b and Slc19a2 is converted to Ca 2+ This utilizes the property that it does not exhibit lipid scrambling activity, regardless of whether stimulation is present or not.

[0063] The method according to the third embodiment is a method for screening a therapeutic agent for a disease associated with abnormal lipid scrambling activity, and comprises the following steps: (1) Cells expressing mutant (loss-of-function mutant) Tmem63b, Slc19a2, and Kcnn4 and the candidate substance for the therapeutic agent are cultured in a Ca 2+ contacting under stimulation; (2) determining whether or not the candidate substance increases lipid scrambling activity in the cell membrane of the cell; and (3) selecting the candidate substance that caused the increase as the therapeutic agent.

[0064] 3-1. Mutant Tmem63b The "mutated Tmem63b" in the method according to the third embodiment is a polypeptide in which a loss-of-function mutation has been added to the Tmem63b described in "1-1. Tmem63b" above. In the method according to the third embodiment, the loss-of-function mutant Tmem63b forms a heterodimer with Slc19a2 and is involved in the Ca 2+ The loss-of-function mutant Tmem63b in the third embodiment does not exhibit lipid scrambling activity, regardless of whether or not it is stimulated by the ATP. Specifically, the loss-of-function mutant Tmem63b in the third embodiment is at least one of the following polypeptides:

[0065] [Bi] A polypeptide consisting of an amino acid sequence shown in SEQ ID NO: 1, in which the amino acid residue at position 433 has been substituted with a histidine residue; [B-ii] In the amino acid sequence of the polypeptide shown in [Bi], one or several (for example, 1 to 208 or 1 to 166, preferably 1 to 83, 1 to 41, 1 to 8, or 1 to 4) amino acid residues other than the substituted amino acid residues are substituted, added, inserted, or deleted, and the heterodimer formed with Slc19a2 is Ca 2+ A polypeptide that does not have lipid scrambling activity in cell membranes under stimulation of [B-iii] A polypeptide having an amino acid sequence of the polypeptide shown in [Bi] above, in which the sequence identity of the portion excluding the substituted amino acid residue is 75% or more or 80% or more (preferably 90% or more, 95% or more, 99% or more, or 99.5% or more) and in which the heterodimer formed with Slc19a2 is Ca 2+ Polypeptides that do not have lipid scrambling activity in cell membranes under stimulation of

[0066] 3-2.Slc19a2 In the method according to the third embodiment, "Slc19a2" forms a heterodimer with loss-of-function mutant Tmem63b and induces Ca 2+ The polypeptide is the same as that described above in "1-2. Slc19a2," except that it does not exhibit lipid scrambling regardless of whether or not it is stimulated by the α-glucan.

[0067] Specific examples of Slc19a2 in the method according to the third embodiment include at least one of the polypeptides [Sl-i] to [Sl-iii] described in the above section "1-2. Slc19a2." However, in the method according to the third embodiment, the polypeptides [Sl-ii] and [Sl-iii] form heterodimers with the above-mentioned loss-of-function mutant Tmem63b, and act as Ca 2+ It is a polypeptide that does not exhibit lipid scrambling, regardless of whether it is stimulated or not.

[0068] 3-3.Kcnn4 In the method according to the third embodiment, "Kcnn4" is a Ca 2+ This is the same as the polypeptide described above in "1-3.Kcnn4," except that even when activated by stimulation, the loss-of-function mutant Tmem63b / Slc19a2 heterodimer does not carry out lipid scrambling.

[0069] Specific examples of Kcnn4 in the method according to the third embodiment include at least one of the polypeptides [Kc-i] to [Kc-iii] described above in "1-3. Kcnn4." However, in the method according to the third embodiment, the polypeptides [Kc-ii] and [Kc-iii] are those that bind to loss-of-function mutant Tmem63b / Slc19a2 heterodimers and Ca 2+ It is a polypeptide that does not produce lipid scrambling activity under stimulation.

[0070] 3-4. Cells expressing mutant Tmem63b, Slc19a2, and Kcnn4 "Cells expressing mutant Tmem63b, Slc19a2, and Kcnn4" may be cells that naturally express loss-of-function mutant Tmem63b, Slc19a2, and Kcnn4 from their genome, or cells that express loss-of-function mutant Tmem63b, Slc19a2, and Kcnn4 after introduction of an exogenous loss-of-function mutant Tmem63b gene, Slc19a2 gene, and / or Kcnn4 gene. The origin of the cells and more specific examples of the cells are as described above in "1-4. Cells expressing Tmem63b, Slc19a2, and Kcnn4."

[0071] 3-5. Candidate substances for therapeutic drugs for diseases associated with abnormalities in lipid scrambling activity The "disease associated with abnormalities in lipid scrambling activity" may be any disease associated with the above-mentioned loss-of-function mutation. Examples of such diseases include diseases associated with hematological abnormalities, hearing loss, etc. Hematological abnormalities include red blood cell abnormalities not associated with anemia, etc.

[0072] The types of therapeutic agents are the same as those listed as candidate substances in "1-5. Candidate substances for regulating lipid scrambling activity" above.

[0073] The "candidate substances" for the therapeutic agent are a group of substances that have potential as the therapeutic agent. The forms of the candidate substances are the same as those described above in "1-5. Candidate substances for regulating lipid scrambling activity."

[0074] 3-6.Ca 2+ Touch under stimulation The cells and the candidate substance were treated with "Ca 2+ Regarding "contact under stimulation," please refer to "1-6.Ca" above. 2+ This is as stated in "Touch under Stimulation."

[0075] 3-7. Lipid scrambling activity The "lipid scrambling activity" is as described above in "1-7. Lipid scrambling activity."

[0076] Lipid scrambling activity can be measured by the same method as described in "1-7-1." above. That is, lipid scrambling activity can be measured by any method that examines the distribution of lipids in the cell membrane. Specifically, it can be measured based on at least one of the uptake activity of phospholipids or glycolipids located on the outside of the cell membrane and the exposure activity of phospholipids located on the inside of the cell membrane. The presence or absence of an increase in lipid scrambling activity can be determined by whether the distribution amount of lipids in the cell membrane increases after the above contact compared to when the above contact is not performed.

[0077] 3-8.Selection of therapeutic drugs Since the diseases associated with the above-mentioned loss-of-function mutations exhibit abnormalities in lipid scrambling activity (specifically, loss of lipid scrambling activity), the candidate substance that causes an increase in lipid scrambling activity upon contact is selected as a therapeutic agent.

[0078] 4. Method for testing for diseases associated with lipid scrambling activity abnormalities (gain-of-function mutations) A fourth embodiment of the present invention relates to a method for testing for the presence of a disease associated with abnormal lipid scrambling activity, which utilizes the Tmem63b / Slc19a2-induced lipid scrambling system. More specifically, the method of the fourth embodiment involves the formation of a heterodimer between disease-associated (gain-of-function) Tmem63b and Slc19a2, and the heterodimer between disease-associated (gain-of-function) Tmem63b and Slc19a2 is activated without activation of Kcnn4 (i.e., Ca). 2+ We utilize a system that exhibits constitutive lipid scrambling (without stimulation).

[0079] A method according to a fourth embodiment is a method for testing for the presence of a disease associated with abnormal lipid scrambling activity, comprising the steps of: (1) In a cell sample derived from a test subject, Ca 2+ Obtaining a quantitative value of the heterodimer of mutated (gain-of-function mutated) Tmem63b and Slc19a2 under unstimulated conditions; and (2) comparing the quantitative value with a predetermined threshold value;

[0080] 4-1. Cell samples derived from test subjects The sample tested by the method according to the fourth embodiment may be a cell sample derived from a subject to be tested (diagnosed) for a disease associated with abnormalities in lipid scrambling activity (gain-of-function mutation). The origin of the cells is not particularly limited, and examples thereof include cells derived from humans, monkeys, mice, or rabbits. The type of cells is not particularly limited, and examples thereof include B cells, T cells, and red blood cells, with B cells being preferred.

[0081] Mutant Tmem63b The "mutated Tmem63b" in the invention according to the fourth embodiment is as described above in "2-1. Mutant Tmem63b."

[0082] 4-3.Slc19a2 "Slc19a2" in the invention according to the fourth embodiment is as described above in "2-2. Slc19a2".

[0083] 4-4.Ca 2+ without stimulation "Ca" in the invention according to the fourth embodiment 2+ Regarding "non-stimulated" please refer to "2-5.Ca" above. 2+ This is as stated in "Contact without stimulation."

[0084] 4-5. Quantitative analysis of heterodimers of mutant Tmem63b and Slc19a2 The method for obtaining quantitative values ​​of the heterodimer of mutant Tmem63b and Slc19a2 is as described above in "2-6-2." of "2-6. Lipid scrambling activity."

[0085] 4-6.Predetermined Threshold The predetermined "threshold" in the invention according to the fourth embodiment is an indicator that, when the quantitative value is higher than the threshold, the test subject is suffering from a disease accompanied by abnormal lipid scrambling activity (gain-of-function mutation). As the threshold, a healthy reference value N1 can be used. The healthy reference value N1 is the Ca concentration in a cell sample derived from a healthy subject (i.e., a subject not suffering from the disease). 2+ It is determined from the quantitative value of the heterodimer under non-stimulation conditions.

[0086] 5. Methods for assessing the severity of abnormalities in diseases associated with lipid scrambling activity abnormalities (gain-of-function mutations) A method for testing the severity of disorders associated with abnormalities in lipid scrambling activity according to a fifth embodiment of the present invention utilizes the Tmem63b / Slc19a2-induced lipid scrambling system. More specifically, the method according to the fourth embodiment utilizes a heterodimer formed between disease-associated (gain-of-function) Tmem63b and Slc19a2, and the heterodimer between disease-associated (gain-of-function) Tmem63b and Slc19a2 promotes Ca2+ production without activating Kcnn4 (i.e., Ca2+). 2+ showed constitutive lipid scrambling (without Ca stimulation) and, furthermore, with Kcnn4 activation (i.e., Ca 2+ The present invention utilizes a system that further promotes lipid scrambling (under stimulation by ).

[0087] A method according to a fifth embodiment is a method for testing the severity of an abnormality in a disease associated with an abnormality in lipid scrambling activity, comprising the steps of: (1) In a cell sample derived from a subject suffering from the disease, Ca 2+ Under unstimulated or Ca 2+ Obtaining a quantitative value of the heterodimer of mutant Tmem63b and Slc19a2 under stimulation; and (2) A step of comparing the quantitative value with a predetermined reference value.

[0088] 5-1. Cell samples derived from test subjects The sample tested by the method according to the fifth embodiment may be a cell sample derived from a subject suffering from a disease accompanied by a lipid scrambling activity abnormality (gain-of-function mutation). The origin and type of the cells are as described above in "4-1. Cell sample derived from a test subject."

[0089] Mutant Tmem63b The "mutated Tmem63b" in the invention according to the fifth embodiment is as described above in "2-1. Mutant Tmem63b."

[0090] 5-3.Slc19a2 "Slc19a2" in the fifth embodiment of the invention is as described above in "2-2. Slc19a2".

[0091] 5-4. "Ca 2+ “Unstimulated”, “Ca 2+ Under stimulation In the invention according to the fifth embodiment, since it is known that the cell sample is derived from a subject suffering from a disease accompanied by abnormalities in lipid scrambling activity (gain-of-function mutation), under the conditions for obtaining a quantitative value of the heterodimer reflecting the lipid scrambling activity, Ca 2+ Mutant Tmem63b and Slc19a2 heterodimers are expressed in Ca2+-dependent manner, regardless of the presence or absence of stimulation. 2+ It exhibits lipid scrambling activity even without stimulation and 2+ Under stimulation, it exhibits even higher lipid scrambling activity.

[0092] "Ca" in the invention according to the fifth embodiment 2+ Regarding "non-stimulated" please refer to "2-5.Ca" above. 2+ As mentioned in "Contact without stimulation" and "Ca 2+ Regarding "under stimulation," please refer to "1-6.Ca" above. 2+ This is as stated in "Touch under Stimulation."

[0093] 5-5. Quantitative analysis of heterodimers of mutant Tmem63b and Slc19a2 The method for obtaining quantitative values ​​of the heterodimer of mutant Tmem63b and Slc19a2 is as described above in "2-6-2." of "2-6. Lipid scrambling activity."

[0094] 5-6.Prescribed standard values The predetermined "reference value" in the invention according to the fifth embodiment is an indicator that the higher the quantitative value compared to the reference value, the more severe the disease in the test subject with abnormal lipid scrambling activity (gain-of-function mutation). In other words, the amount obtained by subtracting the reference value from the quantitative value is positively correlated with the severity of the disease.

[0095] Under the conditions for obtaining quantitative values ​​of heterodimers, Ca 2+ When no stimulation is performed, the reference value can be the healthy reference value N1 or the disease reference value D1. The healthy reference value N1 is the Ca concentration in a cell sample derived from a healthy subject (i.e., a subject not suffering from the disease). 2+ The disease reference value D1 is determined from the quantitative value of the heterodimer under unstimulated conditions. The disease reference value D1 is the Ca concentration in a cell sample obtained at a different time from a subject suffering from the disease (which may be the same subject as the subject to be diagnosed, or may be a subject different from the subject to be diagnosed). 2+ It is determined from the quantitative value of the heterodimer under non-stimulation conditions.

[0096] In addition, under the conditions for obtaining quantitative values ​​of heterodimers, Ca 2+When stimulation is performed, the healthy reference value N2 or the disease reference value D2 can be used as the reference value. The healthy reference value N2 is the Ca concentration in a cell sample derived from a healthy subject (i.e., a subject not affected by the disease). 2+ The disease reference value D2 is determined from the quantitative value of the heterodimer under stimulation. The disease reference value D2 is determined from the Ca concentration in a cell sample obtained at a different time from a subject suffering from the disease (which may be the same subject as the subject to be diagnosed, or may be a subject different from the subject to be diagnosed). 2+ It is determined from the quantitative value of the heterodimer under stimulation.

[0097] 6. Screening method for modulators of lipid scrambling activity (Stim1 / Orai1 mediated) A screening method for a modulator of lipid scrambling activity according to a sixth embodiment of the present invention utilizes the Stim1 / Orai1-mediated lipid scrambling system. More specifically, the method according to the sixth embodiment involves the binding of Stim1 to Orai family members at the plasma membrane (PM)-plant endoplasmic reticulum (ER) contact site, and the Orai-mediated Ca modulation. 2+ It utilizes a system in which influx induces lipid scrambling.

[0098] A sixth embodiment of the method is a method for screening for a modulator of lipid scrambling activity, comprising the steps of: (1) Cells expressing Stim1 and Orai1 and the candidate regulatory substance were cultured in a Ca 2+ contacting under stimulation; (2) determining whether or not the candidate substance alters lipid scrambling activity in the cell membrane of the cell; and (3) A step of selecting the candidate substance that caused the change as the regulator.

[0099] 6-1.Stim1 "Stim1" is a protein that contains a single transmembrane domain and is present in the endoplasmic reticulum (ER). In the method according to the sixth embodiment, Stim1 binds to Orai1 and transports Ca 2+ By mediating influx, it promotes lipid scrambling at membrane contact sites.

[0100] In the method according to the sixth embodiment, Stim1 binds to Orai1 and expresses Ca 2+ The Stim1 protein may be either wild-type or mutant, as long as it mediates the influx of Stim1 and promotes lipid scrambling at the membrane contact site. Wild-type Stim1 includes human (Homo sapiens) Stim1 and its homologs (e.g., homologs in mouse (Mus musculus), chicken (Gallus gallus), frog (Xenopus tropicalis), fish (Danio rerio), etc.).

[0101] Specific examples of Stim1 in the method according to the sixth embodiment include at least one of the following polypeptides. However, among the following, the polypeptides [St-ii] and [St-iii] bind to Orai1 and express Ca. 2+ It is a polypeptide that mediates influx and promotes lipid scrambling at membrane contact sites.

[0102] [St-i] a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 4; [St-ii] A polypeptide in which one or several (for example, 1 to 171 or 1 to 137, preferably 1 to 68, 1 to 34, 1 to 6, or 1 to 3) amino acid residues are substituted, added, inserted, or deleted in the amino acid sequence of the polypeptide shown in [St-i] above. [St-iii] A polypeptide consisting of an amino acid sequence having a sequence identity of 75% or more or 80% or more (preferably 90% or more, 95% or more, 99% or more, or 99.5% or more) with the amino acid sequence of the polypeptide shown in [St-i] above.

[0103] The above-mentioned [St-i] polypeptide is human (Homo sapiens) Stim1. The above-mentioned [St-ii] and [St-iii] polypeptides include various homologs such as the mouse (Mus musculus) homolog (SEQ ID NO: 9), chicken (Gallus gallus) homolog, frog (Xenopus tropicalis) homolog, and fish (Danio rerio) homolog; the above-mentioned [St-i] polypeptide with additional mutations; and the above-mentioned various homologs with the additional mutations at the corresponding positions.

[0104] 6-2.Orai1 "Orai1" is a Ca 2+ In the method according to the sixth embodiment, a Ca channel is formed by binding to Stim1. 2+ By mediating influx, it promotes lipid scrambling at membrane contact sites.

[0105] In the method according to the sixth embodiment, Orai1 binds to Stim1 and induces Ca 2+ The Orai1 may be either wild-type or mutant, as long as it mediates the influx of Orai1 and promotes lipid scrambling at the membrane contact site. Wild-type Orai1 includes human (Homo sapiens) Orai1 and its homologs (e.g., homologs from mice (Mus musculus), chickens (Gallus gallus), frogs (Xenopus tropicalis), and fish (Danio rerio)). Mutations in mutant Orai1 exclude those associated with severe combined immunodeficiency.

[0106] Specific examples of Orai1 in the method according to the sixth embodiment include at least one of the following polypeptides. However, among the following, the polypeptides [Or-ii] and [Or-iii] bind to Stim1 and express Ca. 2+ It is a polypeptide that mediates influx and promotes lipid scrambling at membrane contact sites.

[0107] [Or-i] a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5; [Or-ii] A polypeptide in which one or several (for example, 1 to 75 or 1 to 60, preferably 1 to 30, 1 to 15, 1 to 3, or 1) amino acid residues are substituted, added, inserted, or deleted in the amino acid sequence of the polypeptide shown in [Or-i] above. [Or-iii] A polypeptide consisting of an amino acid sequence that has a sequence identity of 75% or more or 80% or more (preferably 90% or more, 95% or more, 99% or more, or 99.5% or more) with the amino acid sequence of the polypeptide shown in [Or-i].

[0108] The above-mentioned [Or-i] polypeptide is human (Homo sapiens) Orai1. The above-mentioned [Or-ii] and [Or-iii] polypeptides include various homologs such as the mouse (Mus musculus) homolog (SEQ ID NO: 10), chicken (Gallus gallus) homolog, frog (Xenopus tropicalis) homolog, and fish (Danio rerio) homolog; polypeptides of the above-mentioned [Or-i] polypeptide with an additional mutation (excluding the R91W mutant derived from severe combined immunodeficiency); and polypeptides of the above-mentioned various homologs with the additional mutation at the corresponding site.

[0109] 6-3. Cells expressing Stim1 and Orai1 "CC-expressing cells" may be cells that naturally express Stim1 and Orai1 from their genome, or cells that express Stim1 and Orai1 following the introduction of exogenous Stim1 and / or Orai1. The origin of the cells is not particularly limited, and examples include cells derived from humans, monkeys, mice, or rabbits. More specific examples of such cells include human HeLa, human EBV (Epstein Barr Virus)-transformed B cell lines, mouse MEF (embryonic fibroblasts), and the mouse pro-B cell line Ba / F3.

[0110] 6-4. Candidates for regulators of lipid scrambling activity In the method of the sixth embodiment, the "candidate substance for regulating lipid scrambling activity" may be a substance that directly affects (attenuates or increases) the function of Stim1, Orai1, and / or endoplasmic reticulum-plasma membrane scramblase (epSCR; a lipid scrambling-inducing protein that functions through the action of Stim1 and Orai1), or it may be a substance that changes (decreases or increases) the expression level of Stim1, Orai1, and / or epSCR.

[0111] The regulator may be either a natural substance or a synthetic substance. Specific examples of the regulator include low-molecular-weight compounds, proteins, nucleic acid molecules, peptides, antibodies, cell (microorganism, plant, animal, etc.) extracts, and cell (microorganism, plant, animal, etc.) culture supernatants. Further examples of the regulator include substances that act on regulatory sequences, such as promoters or enhancers, of genes encoding Stim1, Orai1, and / or epSCR, as well as antisense oligonucleotides (DNA or RNA), nucleic acids such as siRNA and miRNA, and ribozymes prepared based on the sequences of genes encoding Stim1, Orai1, and / or epSCR.

[0112] The "candidate substances" for the regulatory substance are a group of substances that have potential as the regulatory substance. The form of the candidate substances may be any form provided in a typical screening, such as a library. Furthermore, the group of substances contained in the library may be those that have been preliminarily selected by other screening methods.

[0113] 6-5.Ca 2+ Touch under stimulation "Ca 2+ Regarding "touch under stimulation," please refer to "1-6.Ca" above. 2+ This is similar to what was stated in "Touch under stimulation."

[0114] 6-6. Lipid scrambling activity The "lipid scrambling activity" is as described above in "1-7. Lipid scrambling activity."

[0115] Lipid scrambling activity can be measured by the same method as described in "1-7-1." above. That is, lipid scrambling activity can be measured by any method that examines the distribution of lipids in the cell membrane. Specifically, it can be measured based on at least one of the uptake activity of phospholipids or glycolipids located on the outside of the cell membrane and the exposure activity of phospholipids located on the inside of the cell membrane. The presence or absence of a change in lipid scrambling activity can be determined by whether the distribution amount of lipids in the cell membrane changes after the above contact compared to when the above contact is not performed.

[0116] 6-7. Selection of Regulatory Substances If the lipid scrambling activity is lower than that in the cells not contacted with the candidate substance, the candidate substance is selected as a regulator that inhibits the lipid scrambling activity.If the lipid scrambling activity is higher than that in the cells not contacted with the candidate substance, the candidate substance is selected as a regulator that promotes the lipid scrambling activity.

[0117] 7. Sequence information [Table 1]

[0118] [Table 2] [Example]

[0119] The present invention will be explained in more detail below by showing examples, but the present invention is not limited to these examples.

[0120] [1] Method [1-1]Cell culture HEK293T cells were cultured in DMEM (WAKO) containing 10% fetal bovine serum (FBS) (Gibco) and 1% penicillin-streptomycin solution (Nacalai). Xkr8- and Tmem16-deficient murine pro-B cell line Ba / F3 cells (BDKO cells) and their derivatives were maintained in RPMI 1640 medium (WAKO) containing 10% FBS (Gibco), 1% penicillin-streptomycin solution, 45 units / ml IL-3 (prepared in Nature 468, 834-838 (2010) and J. Biol. Chem. 265, 14008-14015 (1990)), and 55 μM 2-mercaptoethanol (Gibco). Cells were maintained in a 37°C incubator with 5% CO2 and 90-95% humidity.

[0121] [1-2] Plasmid preparation cDNAs for Tmem63a (NCBI accession number: NM_001417552.1), Tmem63b (NCBI accession number: NM_001413622.1), Tmem63c (NCBI accession number: NM_001361704.1), Slc19a2 (NCBI accession number: NM_054087.3), Kcnn4 (NCBI accession number: NM_001163510.2), Stim1 (NCBI accession number: NM_001374058.1), Orai1 (NCBI accession number: NM_175423.3), and Csnk2b (NCBI accession number: NM_001303445.1) were amplified by PCR using cDNA derived from BDKO cells. The amplified cDNA was tagged at the C-terminus with GFP, tagRFP (Evrogen), FLAG, HA, FLAG-GFP, or HA-tagRFP and inserted into a lentiviral vector (plenti) using the In Fusion system (Takara) ( Mol. Cell 81, 1397-1410. e1399 (2021)) and then sequenced. Tmem63b mutants were generated by the following amino acid substitutions: valine at position 44 was replaced by methionine (V44M), arginine at position 433 was replaced by histidine (R433H), aspartic acid at position 459 was replaced by glutamic acid (D459E), isoleucine at position 475 was deleted (I475del), and arginine at position 660 was replaced by threonine (R600T). Tmem63b mutants at the Tmem63b / Slc19a2 interface (F213A, L217A, M711A, F712A, and I719A) were generated by substituting each amino acid with alanine. Slc19a2 mutants were generated by amino acid substitution: serine at position 143 was substituted with phenylalanine (S143F). Kcnn4 mutant: histidine at position 358 was substituted with asparagine (H358N). Orai1 mutant: arginine at position 91 was substituted with tryptophan (R91W). These mutants were generated by Sanger sequencing of the cDNAs of each gene using the In-Fusion system and inserted into a plenti vector.

[0122] [1-3] Construction of sgRNA for KO cell lines sgRNAs were designed using CRISPRdirect (https: / / crispr.dbcls.jp / ) with the cDNA sequence of the target gene as input, and specific sgRNAs with minimal off-target activity were selected. Following the protocol described in Nat. Methods 11, 783-784 (2014), a BsmBI restriction enzyme site was added to the sgRNA oligos, and the annealed oligos were inserted into the lentiGuide-Puro vector 55 (Addgene #52963). sgRNA against mouse Tmem63b (5'-CGGAGGTGAGACGCTCATAC-3' (SEQ ID NO: 11)), sgRNA against mouse Stim1 (5'-CATCGTCATCCATCAGCTTA-3' (SEQ ID NO: 12)), sgRNA against mouse Slc19a2 (5'-AGGGCAGATCCTCGTCTCCG-3' (SEQ ID NO: 13)), sgRNA against mouse Kcnn4 (5'-TGCGGTAGGACGCGTTGAGC-3' (SEQ ID NO: 14)), sgRNA against mouse Csnk2b (5'-CCAGAGCGACTTGATCGAAC- sgRNAs against mouse E-syt1 (5'-CTTTAGCCATTACGAATCAT-3' (SEQ ID NO: 15)), mouse Orai1 (5'-CCTCAACGAGCACTCGATGC-3' (SEQ ID NO: 17)), mouse Snap23 (5'-GATTACAAATGGTCAGCCTC-3' (SEQ ID NO: 18)), and mouse Stx4a (5'-GCTGTTTGATCTCCTCTCGC-3' (SEQ ID NO: 19)) were designed and inserted into lentiviral vectors by ligation. To confirm knockout efficiency, gDNA was extracted using a gDNA extraction kit (Viogene). The region containing the sgRNA target site was amplified by PCR. The amplified PCR product (approximately 400 bp) was excised from an agarose gel, purified, and confirmed by Sanger sequencing. For rescue experiments in sgRNA-transfected cells, silence mutations were introduced into the target site of each gene to prevent the inserted lentiviral sgRNA from targeting the exogenous cDNA.

[0123] [1-4] Lentivirus production To generate lentivirus, HEK293T cells were transfected with the lentiGuide-Puro or plenti vectors encoding each gene, pCAG HIV-Gag-Pol (RIKEN), and pCMV VSVG-RSV-REV (RIKEN) using the polyethyleneimine (PEI) system (Polysciences). Two days after transfection, the supernatant was collected, passed through a 0.22 μm filter, and centrifuged (6000 × g, 4°C, 16 hours). The virus pellet from 10 ml of culture was resuspended in 500 μl of RPMI medium containing IL-3 and 10 μg / ml polybrene (Nacalai) to generate 20-fold concentrated virus, which was then incubated with cells in wells of a 24-well plate. After 6 hours of culture, the medium was replaced and the cells were allowed to grow. When sgRNA was introduced, 1 μg / ml puromycin (InvivoGen) was added to the culture medium one day after viral infection, and the drug-containing medium was replaced with fresh medium after two days of treatment.

[0124] [1-5]NBD-PC uptake assay In simple terms, 1 x 10 6 BDKO cells were harvested, washed with chilled Lipid buffer (HBSS buffer containing 1 mM MgCl2 and 1 mM CaCl2), incubated on ice for 7 min in Lipid buffer, treated with 1 μM NBD-PC (Avanti, 810132 C) on ice for 3 min, and then stimulated with 3.0 μM A23187 (Sigma, C7522). After A23187 stimulation for the indicated period, cells were incubated on ice for 5 min in Lipid buffer containing 5 mg / ml fatty acid (FA)-free BSA (Sigma, A6003) and 1 μM DAPI (Dojindo) to remove NBD-PC located in the outer layer of the cell membrane. NBD-PC uptake was examined using a flow cytometer such as a FACS Lyric or FACS Aria II (Beckton Dickinson).

[0125] In the revival screening based on NBD-PC uptake, 4 × 10 7 The cells were washed with 20 ml of chilled Lipid buffer, incubated in 10 ml of Lipid buffer on ice for 7 min, mixed, and then incubated in 10 ml of Lipid buffer containing 1 μM NBD-PC on ice for 3 min. After 10 min of stimulation with 3.0 μM A23187, the reaction was stopped by adding 20 ml of Lipid buffer containing 5 mg / ml FA-free BSA and 1 μM DAPI. The cells were then incubated on ice for 5 min, centrifuged (400 × g, 2 min, 4°C), and resuspended in 5 ml of Lipid buffer for flow cytometry analysis.

[0126] [1-6]PS exposure assay In simple terms, 1 x 10 6 BDKO cells were washed with PBS and resuspended in 1 ml of Annexin buffer (10 mM HEPES-NaOH (pH 7.4), 140 mM NaCl, 2.5 mM CaCl2) containing 1:1000 diluted Annexin V-Cy5 (Biovision) and 1 μg / ml propidium iodide (PI, Dojindo). Cells were then stimulated with 3.0 μM A23187, and PS exposure was measured over time by flow cytometry at room temperature. In some cases, PS exposure analysis was performed on ice to slow the rate of PS exposure. For this analysis, cells were washed with chilled PBS, resuspended in chilled Annexin buffer containing Annexin V-Cy5 and PI, and then stimulated with 3.0 μM A23187. Stimulated cells were incubated on ice, and PS exposure was measured every 10 min.

[0127] Revival screening based on PS exposure was 4 × 10 7 The cells were washed with 10 ml of chilled PBS, resuspended in 20 ml of chilled Annexin buffer containing Annexin V-Cy5 and PI, incubated at 4°C for 1 hour, centrifuged (400 × g, 4°C, 5 minutes), resuspended in 5 ml of Annexin buffer (used in the reaction), and subjected to cell sorting by flow cytometry.

[0128] extracellular K + To observe the effect of Ca on PS exposure, NaCl in Annexin buffer was replaced with various concentrations of KCl (0 mM, 0.5 mM, 5 mM, 50 mM, or 140 mM). For drug treatment, cells were suspended in Annexin buffer and incubated with Kcnn4 inhibitors TRAM-34 (10 μM, Selleck) and Senicapoc (0.5 μM, Selleck) for 4 min at room temperature or 4°C. 2+ Ionophore stimulation and PS exposure assays were performed.

[0129] [1-7] Construction of high PLS (phospholipid scrambled) cells To construct high-PLS cells from BDKO cells, Cas9-expressing BDKO cells were subjected to repeated selection. Briefly, 4 × 10 7 The cells were washed and resuspended in Lipid buffer (HBSS containing 1 mM CaCl2 and 1 mM MgCl2). Lipid buffer containing 1 μM NBD-PC was then added, and the cells were incubated with 0.5 μM A23187 for 8 minutes in a 10°C water bath. After the incubation, the cells were mixed with 20 ml of Lipid buffer containing 5 mg / ml FA-free BSA and 1 μM DAPI for 5 minutes on ice, followed by flow cytometry sorting. The sorted cells were collected in RPMI medium containing IL-3 and 0.5 mM EGTA. The next day, the medium was replaced with regular RPMI medium containing IL-3, and the cells were expanded in preparation for the next sorting. This process was repeated 19 times to establish a high-PLS cell line (hPC19).

[0130] [1-8] Revival Screening Cas9-expressing hPC19 cells were infected with a lentiviral sgRNA library (GeCKO v2 Mouse CRISPR Knockout Pooled Library55). ​​Within 4 days of infection, the cells were subjected to an NBD-PC uptake assay. Approximately 1% of NBD-PC-negative cells were selected by flow cytometry and subjected to gDNA purification. The purified gDNA was then amplified by PCR using the primer set shown below. sgRNA FW: GTTTTAAAATGGACTATCATATGC (SEQ ID NO: 20) sgRNA RV: TATCCATCTTTGCACCCGGGC (SEQ ID NO: 21)

[0131] The PCR band was excised from the agarose gel and mixed with the lentiviral vector digested with SmaI and NdeI (NEB). The resulting mixture was then incubated at 52°C for 1 hour using NEBuilder® HiFi DNA Assembly (NEB). The mixture was then electroporated into MegaX DH10B T1R Electrocomp™ cells (Invitrogen), which were then incubated in SOC medium at 32°C for 2 hours and plated on LB agar plates. The number of clones in the resulting library was confirmed by colony counting, which revealed a total of 1 x 10 6 This was expected to be the case. The enriched sgRNA library was then used for the next screening. After repeating this process three times, cells negative for PC uptake were enriched and used to amplify the inserted sgRNA from purified gDNA, followed by next-generation sequencing (NGS) analysis and mapping. A similar revival screening was performed using cells transfected with Cas9 into BDKO cells overexpressing Tmem63b.

[0132] [1-9]Next-generation sequencing The sgRNA region inserted into the gDNA was amplified by PCR using the primers shown below. FW PCR primer: GTTTTAAAATGGACTATCATATGC (SEQ ID NO: 22) RV PCR primer: TATCCATCTTTGCACCCGGGC (SEQ ID NO: 23)

[0133] The resulting PCR product was then subjected to a second PCR to add an adapter sequence using the primers shown below. Adapter FW: AATGATACGGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTATCGACTCTTGTGGAAAGGACGAAACACCG (SEQ ID NO: 24) Adapter RV: CAAGCAGAAGACGGCATACGAGATTCTACTATTCTTTCCCCTGCACTGT (SEQ ID NO: 25)

[0134] The amplified PCR products were then purified and sent to Macrogen for Illumina HiSeq2500 analysis.

[0135] [1-10] sgRNA data processing The sgRNA sequences were analyzed using guide-caller v1.0.0 (https: / / github.com / SuzukiLab-icems / guide-caller / tree / main / v1.0.0) (Cell Genomics 4, 100510 (2024)), which utilizes a standard analysis framework consisting of FastQC (https: / / www.bioinformatics.babraham.ac.uk / projects / fastqc / ), Cutadapt (EMBnet.J. 17, https: / / doi.org / 10.14806 / ej.17.1.200. (2011)), and MAGeCK (Genome Biol. 15, 554 (2014)). Specifically, the 20-bp sgRNA sequence was separated from the 51-bp sequence reads by trimming twice using Cutadapt, with the first trimming parameter "-u30" and the subsequent trimming parameter "-u-1." The resulting trimmed reads were then aligned to the revised annotation list using MAGeCK (Cell Genomics 4,100510(2024)).

[0136] [1-11]Fluo4-AM assay 1×10 6 Cells were incubated with 1 μM Fluo4-AM (Dojindo) in culture medium for 30 min at 37°C. Afterwards, cells were centrifuged (400 × g, room temperature, 2 min), washed, and resuspended in Annexin buffer. Cells were then loaded onto a flow cytometer (FACS Lyric) and recorded. After approximately 100 s, 3.0 μM A23187 was added to the sample, and the cells were recorded for an additional 50 s to measure Ca. 2+ Changes in inflow were detected.

[0137] [1-12]BAPTA-AM assay 1×10 6Cells were incubated with 1 μM BAPTA-AM (Dojindo) in culture medium at 37°C for 30 min. Then, cells were centrifuged (400 × g, 4°C, 2 min), washed, and resuspended in Annexin buffer. Before loading onto a flow cytometer (FACS Lyric), cells were recorded with or without treatment with 3.0 μM A23187 in Annexin buffer at 4°C.

[0138] [1-13] High-resolution live cell imaging of PS exposure High-resolution imaging of Stim1-mediated PLS (phospholipid scrambling) activity was performed using an Airyscan super-resolution confocal microscope (Zeiss, LSM980). 5 Cells were washed and resuspended in 500 μl of Annexin buffer containing 1:1000 diluted DAPI and Annexin V-Cy5 at room temperature, followed by stimulation with 3.0 μM A23187. Cells were immediately seeded onto glass-bottom chambers coated with 50 μg / mL poly-L-lysine (Sigma, P2636). Image acquisition began 90 seconds after cell seeding and was performed every 30 seconds for 10 minutes using a 63x / 1.46NA oil-immersion Plan-Apochromat objective with a Zeiss Airyscan 2 detection module. Cells were maintained at 25°C during image acquisition. After image acquisition, cell viability was determined by checking the DAPI signal.

[0139] [1-14]Identification of TMEM63B-positive fetal bone marrow cells TMEM63B-expressing cell types in human fetal bone marrow were identified by reanalysis of the 10x single-cell RNA sequencing (scRNA-seq) dataset "fig1b_fbm_scaled_gex_updated_dr_20210104.h5ad." This data was normalized and scaled. Further cell type annotation was then performed, and the reannotated cells were plotted as a UMAP along with the expression of these genes, following the methodology described by Jardine et al. (Nature 598, 327-331 (2021)). (https: / / github.com / haniffalab / FCA_bone_marrow / blob / master / fig1_fbm_disomic_and_trisomy21 / fig1a_suppfig1b_fbm_overall_dr_plots_SW.ipynb)

[0140] [1-15] Preparation of cell lysate A total of 1 × 10 BDKO cells 6 Cells were harvested and washed twice with chilled PBS. They were then centrifuged (400 × g, 4°C, 2 min) and resuspended in solubilization buffer (25 mM Tris-HCl (pH 8.0), 100 mM 6-aminocaproic acid, 140 mM NaCl, 1% Lauryl Maltose Neopentyl Glycol (LMNG) [Anatrace, NG310], Cholesteryl Hemisuccinate (CHS) [Sigma, C6512] (10:1), 10% (vol / vol) glycerol, 1 mM p-APMSF [Nacalai], EDTA-free protease inhibitor cocktail [Nacalai], 1 mM NaF, 2 mM DTT) and rotated at 4°C for 1 h. The solubilized solution was then centrifuged (20,000×g, 4° C., 20 minutes) to remove insoluble matter.

[0141] [1-16] Preparation of membrane fraction For membrane fraction preparation, 2 x 10 7The cells were washed twice with cold PBS and then homogenized using a Dounce homogenizer in hypotonic buffer (25 mM Tris-HCl (pH 8.0), 10 mM MgCl, 20 mM KCl, 250 mM sucrose, 1 mM p-APMSF, protease inhibitor cocktail (Nacalai), 1 mM NaF, 2 mM DTT) followed by addition of an equal volume of isotonic buffer (25 mM Tris-HCl (pH 8.0), 200 mM NaCl, 10 mM MgCl, 20 mM KCl, 250 mM sucrose, 1 mM p-APMSF, protease inhibitor cocktail (Nacalai), 1 mM NaF, 2 mM DTT). After removing nuclei (800 × g, 10 min, 4°C) and mitochondria (8,000 × g, 10 min, 4°C), the supernatant was ultracentrifuged (100,000 × g, 4°C, 1 h). The pellet was collected and solubilized for 2 h in solubilization buffer (25 mM Tris-HCl (pH 8.0), 100 mM 6-aminocaproic acid, 140 mM NaCl, 1% LMNG / 0.1% CHS, 10% (vol / vol) glycerol, 1 mM p-APMSF (Nacalai), EDTA-free protease inhibitor cocktail (Nacalai), 1 mM NaF, 2 mM DTT). Subsequently, the pellet was centrifuged (20,000 × g, 4°C, 20 min) to remove insoluble material and quantify protein.

[0142] [1-17]BN-PAGE analysis Before loading the resulting lysates onto Blue Native (BN)-PAGE Novex Bis-Tris gels (Life Technologies), the lysate concentrations were measured using a Bradford assay kit (Thermo Fisher Scientific, 23246) and adjusted to 0.5 mg / ml with solubilization buffer. In some cases, cell lysates were incubated with anti-DDDDK antibody (MBL, PM020) or anti-HA.11 epitope tag antibody (Biolegend, 16B12) on ice for 1 hour, followed by gel shift assay before loading onto BN-PAGE Bis-Tris gels. The loaded proteins were then separated by electrophoresis at 150 V for 35 minutes at 4°C in cathode buffer containing 0.02% CBB G-250. After 35 minutes, the cathode buffer was changed to one containing 0.002% CBB G-250, and the gel was run at 150 V for 120 minutes. After electrophoresis, the gel was incubated with SDS running buffer (25 mM Tris-HCl, 190 mM glycine, 0.1% SDS) for 20 min at room temperature, then transferred to an Immobilon-P PVDF membrane (Millipore) at 100 mA for 1 h and subjected to Western blotting.

[0143] [1-18] Western blotting After BN-PAGE analysis, proteins were transferred to an Immobilon-P PVDF membrane by electrophoresis at 100 mA for 1 hour. Blocking was performed with 5% skim milk in TBS-T (50 mM Tris-HCl, 300 mM NaCl, 0.05% Tween 20) and incubated with the indicated antibodies. Anti-GFP-HRP antibody (MBL, 598-7) was used at a 1:6000 dilution, or anti-Kcnn4 antibody (Proteintech, 23271-1-AP) was used at a 1:2000 dilution. The membranes were incubated overnight at 4°C with shaking. After washing four times with TBST for 5 minutes, goat anti-rabbit IgG HRP (DAKO) was added at a 1:10000 dilution and incubated at room temperature for 1 hour to detect Kcnn4. The membrane was then washed four times with TBST, and the chemiluminescent signal was detected using Immobilon Western chemiluminescent HRP substrate (Millipore) with a FUSION chemiluminescence imaging system (Vilber). The PVDF membrane was stained with CBB staining buffer (0.25% CBB R250, 50% methanol, 10% acetic acid) and washed with destaining buffer (30% methanol, 10% acetic acid). The resulting bands were used for normalization of loading.

[0144] [1-19] Real-time PCR RNA was purified using the RNeasy kit (Qiagen, 74104) at 1 × 10 6 After extraction from 100 cells, the DNA was converted to cDNA using the High-Capacity RNA-to-cDNA Kit (Thermo Fisher Scientific, 4387406). Primers for the target genes were designed using Primer-BLAST. Mouse Kcnn4 FW: 5'-GCAAGATTGTCTGCCTGTGC-3' (SEQ ID NO: 26) Mouse Kcnn4 RV: 5'-TCTCCGCCTTGTTGAACTCC-3' (SEQ ID NO: 27) Mouse Slc19a2 FW: 5'-ATGAGCCTCCGGTGGAAGAA-3' (SEQ ID NO: 28) Mouse Slc19a2 RV: 5'-GGGCGGGAGGAATAACACAT-3' (SEQ ID NO: 29) Mouse Actin FW: 5'-GGCTGTATTCCCCTCCATCG-3' (SEQ ID NO: 30) Mouse Actin RV: 5'-CCAGTTGGTAATGCCATGT-3' (SEQ ID NO: 31)

[0145] RNA expression levels were evaluated using the comparative Ct method (ΔΔCt method). The rate of change in Kcnn4 or Slc19a2 expression in BDKO cells expressing sgKcnn4 or sgSlc19a2 was analyzed compared to parental BDKO cells based on the mean Ct values. RT-PCR was then performed using a Takara Thermal Cycler Dice Real Time System Lite with TB Green Premix Ex Taq™ II (Tli RNase H Plus) (TAKARA) and normalized to an internal control (actin gene).

[0146] [1-20] Immunoprecipitation and mass spectrometry 4×10 6Cells (BDKO and Tmem63b-GFP-expressing BDKO, n = 1) were harvested, washed twice with PBS, and then incubated with 0.1% formaldehyde for 10 minutes at room temperature, followed by 1 M glycine-NaOH for 4 minutes. After centrifugation and PBS washing, cells were resuspended in 500 μl of solubilization buffer (25 mM Tris-HCl (pH 8.0), 140 mM NaCl, 1% LMNG / 0.1% CHS, 10% (vol / vol) glycerol, 1 mM p-APMSF, EDTA-free protease inhibitor cocktail (Nacalai), 100 mM 6-aminocaproic acid, 1 mM NaF, 2 mM DTT) with or without 1 mM CaCl2 in the presence of 1 / 500 Benesonase and rotated at 4°C for 1 hour. After centrifugation (20,000 × g, 4°C, 20 min), the supernatant was collected and incubated with GFP-Trap magnetic agarose beads (Proteintech). Before incubation with cell lysate, the beads were equilibrated twice with solubilization buffer and rotated with the cell lysate for 3 h at 4°C. The beads were then pelleted on a magnetic rack and washed three times with 500 μl of wash buffer (25 mM Tris-HCl (pH 8.0), 100 mM 6-aminocaproic acid, 140 mM NaCl, 0.01% LMNG / 0.001% CHS), followed by two additional washes with 50 μl of 50 mM ammonium bicarbonate. Samples were flash-frozen in liquid nitrogen and stored at -80°C until use.

[0147] The bead-bound proteins were then digested with trypsin / Lys-C mix (Promega) at 37°C for 16 hours. The resulting digest was then subjected to a series of steps, including reduction, alkylation, acidification, and desalting, using a GL-Tip SDB (GL Sciences). The eluate was concentrated using a SpeedVac concentrator and subsequently dissolved in a solution consisting of 0.1% trifluoroacetic acid and 3% acetonitrile (ACN). LC-MS / MS analysis of the resulting peptides was performed on an EASY-nLC 1200 UHPLC (Thermo Fisher Scientific) connected to an Orbitrap Fusion mass spectrometer via a nanoelectrospray ion source. Peptide separation was performed using a 75 μm i.d. x 150 mm C18 reversed-phase column (Nikkyo Technos) using a linear 4–32% ACN gradient over 0–100 min, followed by an increase to 80% ACN over 10 min. The mass spectrometer was operated in data-dependent acquisition mode with a maximum duty cycle of 3 s. MS1 spectra were measured with a resolution of 120,000 and an automatic gain control (AGC) target of 4 × 10 5 The mass range was measured from 375 to 1500 m / z.

[0148] HCD MS / MS spectra were obtained using a linear ion trap with an AGC target of 1 × 10 4Acquisition was performed with an isolation window of 1.6 m / z, a maximum injection time of 100 ms, and a normalized collision energy of 30. Dynamic exclusion was set to 20 s. Raw data were analyzed directly against the SwissProt database restricted to laboratory mice (Mus musculus) using the Sequest HT search engine in Proteome Discoverer version 2.5 (Thermo Fisher Scientific). Search parameters included trypsin as the enzyme, allowing up to two missed cleavages, a minimum peptide length of six amino acids, a precursor mass tolerance of 10 ppm, a fragment mass tolerance of 0.6 Da, fixed modification of cysteine ​​carbamidomethylation, and variable modifications of protein N-terminal acetylation and methionine oxidation. Peptides were filtered using a percolator node at a false discovery rate of 1%. Label-free precursor ion quantification was performed using the precursor ion quantification node and normalized to ensure consistent abundance across all peptides in each sample.

[0149] [1-21]Prediction of Tmem63b / Slc19a2 heterodimer The structure of the Tmem63b mutant (V44M) and Slc19a2 heterodimer was predicted using AlphaFold2 (Nature 596, 583-589 (2021)) (v2.3.2) via the default AlphaFold ColabFold v1.5.5 implementation and Amber relaxation (msa_method=mmseqs2_uniref_env, pair_mode=unpaired_paired, model_type=auto, num_recycles=3, recycle_early_stop_tolerance=auto, relax_max_iterations=200, pairing_strategy=greedy, max_msa=auto, num_seeds=1, dpi=200, rank_num=1, color=IDDT). AlphaFold2 generated five training models per run, and pLDDT, pTM, and ipTM scores were calculated to measure the accuracy of the predictions. The model with the highest scores (pLDDT = 69.9, pTM = 0.575, ipTM = 0.331) was selected for analysis of the interface between Tmem63b mutants and Slc19a2. All views of the structure were analyzed using ChimeraX software. Computational time was provided by the supercomputer system at the Institute for Chemical Research, Kyoto University.

[0150] [1-22] Statistics and Reproducibility Statistical analysis was performed using Student's t-test (unpaired t-test). Experiments for quantitative analysis of PLS ​​(phospholipid scramble) activity were performed independently three times, and qualitative confirmation was performed twice. BN-PAGE analysis was performed independently three times in most cases, but only twice in some cases (e.g., gel shift assay). In addition, for the PLS assay, 1 × 10 ATP was used to ensure stable processing and consistent results between experiments. 6100 cells were used in the assay. Flow cytometry values ​​were objective and quantitative, and no bias was observed in the interpretation of the data; therefore, no blinding method was applied. For microscopic analysis, experiments were performed three times independently. For each experiment, three images were taken, with each image containing at least 10 cells. Representative data are shown in the figures.

[0151] [1-23] Accession Code The GenBank accession codes for the genes are as follows: mouse Tmem63a NM_001417552.1[https: / / www-ncbi-nlm-nih-gov / nuccore / NM_001417552.1], mouse Tmem63b NM_001413622.1[https: / / www-ncbinlm-nih-gov / nuccore / NM_001413622.1], mouse Tmem63cNM_001361704.1[https: / / www.ncbi.nlm.nih.gov / nuccore / NM_001361704.1], mouse Slc19a2 NM_054087.3[https: / / www-ncbi-nlmnih-gov / nuccore / NM_054087.3], mouse Kcnn4 NM_001163510.2[https: / / www-ncbi-nlm-nih-gov / nuccore / NM_001163510.2], mouseStim1 NM_001374058.1[https: / / www-ncbi-nlm-nih-gov / nuccore / NM_001374058.1], mouse Orai1 NM_175423.3[https: / / www-ncbi-nlm-nihgov / nuccore / NM_175423.3], mouse Csnk2b NM_001303445.1[https: / / www-ncbi-nlm-nih-gov / nuccore / NM_001303445.1].

[0152] The GenBank accession codes of the protein Tmem63b in different species are as follows: human NP_001305721.1 [https: / / www-ncbi-nlm-nih-gov / protein / NP_001305721.1] (SEQ ID NO: 1), mouse NP_937810.2 [https: / / www-ncbinlm-nih-gov / protein / NP_937810.2] (SEQ ID NO: 6), chicken NP_001366170.1[https: / / www-ncbi-nlm-nih-gov / protein / NP_001366170.1], frog XP_031757905.1[https: / / www-ncbi-nlm-nih-gov / protein / XP_031757905.1], fish XP_005157122.1[https: / / www.ncbi.nlm.nih.gov / protein / XP_005157122.1].

[0153] The accession code for the single cell analysis in human fetal bone marrow is E-MTAB-9389 in BioStudies. The accession code for the cryo-electron microscopy structure of human TMEM63B is 8EHX in the PDB databank.

[0154] [2] Results [2-1] Establishment of lipid-rich scrambled cells Tmem16F and Xkr8 are Ca 2+ Lipid scrambling (PLS) activity induced by these two scramblases can be detected by uptake of the fluorescent lipid NBD-PC in the pro-B cell line Ba / F3. At low (0.5 μM) or high (3.0 μM) Ca concentrations, PLS activity is significantly enhanced by uptake of the fluorescent lipid NBD-PC in the pro-B cell line Ba / F3. 2+When stimulated with the ionophore A23187 in lipid buffer (HBSS containing 1 mM CaCl2 and 1 mM MgCl2) for 10 min at 4°C, the cells exhibited similar PLS activity (Fig. 1a, top). When both Tmem16F and Xkr8 were deleted in Ba / F3 cells (BDKO cells), PLS activity was significantly inhibited by stimulation with 0.5 μM A23187, indicating that these scramblase enzymes, especially Tmem16F, contribute to this process (Fig. 1a, bottom left). However, when stimulated with 3.0 μM A23187, BDKO cells promoted high PLS activity (Fig. 1a, bottom right), suggesting that BDKO cells lack an unknown Ca2+ receptor. 2+ It was suggested that a dependent scramblase exists.

[0155] To identify the unknown scramblase, we planned to isolate a cell population with high PLS activity by a repeated sorting approach. BDKO cells were stimulated with 0.5 μM A23187, a PC uptake assay was performed, and high PC-uptake cells were collected using flow cytometry and expanded for further sorting (Figure 1b). This process was repeated a total of 19 times, resulting in the high PLS cell line hPC19, which exhibited PLS activity even in the presence of 0.5 μM A23187 (Figure 1c). PLS activity can be measured not only by PC uptake but also by phosphatidylserine (PS) exposure. When stimulated with 3.0 μM A23187 in Annexin buffer (10 mM HEPES (pH 7.4), 140 mM NaCl, 2.5 mM CaCl2) at room temperature, PS exposure reached a maximum within 10 min in parental BDKO cells, but within 4 min in hPC19 cells (Fig. 1d), confirming the successful generation of PLS-rich cells.

[0156] [2-2] Identification of Tmem63b as a PLS-inducing protein Next, we performed a CRISPR / Cas9 sgRNA library screen using hPC19 cells to identify Ca 2+We attempted to discover factors involved in PLS-dependent cell death. In particular, to prevent target loss due to growth defects that may be caused by targeting sgRNAs, we performed a revival screening approach to identify important sgRNAs through the reconstitution of an enriched sgRNA library.

[0157] As shown in Figure 2a, hPC19 cells were infected with a lentiviral sgRNA library, a PC incorporation assay was performed, and flow cytometry was performed to screen for PC incorporation-negative cells. Genomic (g)DNA was purified from the sorted cells, and PCR was performed using the purified gDNA to amplify the sgRNA coding region. The amplified PCR product was then inserted into a lentiviral vector to create an enriched sgRNA library for subsequent screening. After three rounds of sgRNA screening using the enriched sgRNA library (sgPC3), approximately 23% of PC incorporation-deficient cells were recovered and analyzed by next-generation sequencing (NGS) and mapping (Figure 2b). In this sgRNA library, an average of six sgRNAs were designed for each gene. Identified sgRNAs with three or more target sgRNAs among the six were displayed as the total count of mapped targets. The sum of sgRNAs against mapped targets was displayed as the total read count and ranked based on the resulting read count (Figure 2c).

[0158] As a result, Stim1 was ranked at the top with the highest number of reads and six mapped targets. Stim1 is known as a protein containing a single transmembrane domain present in the endoplasmic reticulum (ER) and mediates Ca transport on the plasma membrane (PM). 2+ It interacts with the Ca channel Orai1 2+ To investigate whether Stim1 is involved in PLS activity, we transfected parental BDKO cells with sgRNA against Stim1 to generate knockout clones (Fig. 6a).

[0159] As a result, deletion of Stim1 delayed PS exposure compared to parental BDKO cells when stimulated with A23187 (Stim1 in Figure 2d-1). - / - ). Stim1 - / - Exogenous expression of Stim1 in BDKO cells restored PS exposure (Stim1 in Fig. 2d-1). - / - +Stim1), Stim1 is Ca 2+ It was shown that the dependence contributes to PLS.

[0160] Conversely, Stim1 itself is localized only in the ER, so it is clearly not a scramblase on the cell membrane. Therefore, we considered which molecules could be candidates for scramblase. Based on the results of NGS, we focused on a protein called Tmem63b (CSC1-like protein) that contains multiple transmembrane domains and is localized to the cell membrane. We introduced sgRNA against Tmem63b into BDKO cells and obtained a knockout clone (Figure 6b). As a result, Tmem63b - / - Although PS exposure was significantly reduced in BDKO cells (Tmem63b in Figure 2d-1), - / - ), and exogenous expression of Tmem63b restored PS exposure (Tmem63b in Figure 2d-1 - / - +Tmem63b).

[0161] It should be noted that deletion of Stim1 or Tmem63b did not significantly alter A23187-mediated calcium influx (Fig. 6c). Among the three members of the Tmem63 family, Tmem63b inhibits Stim1 more effectively than Tmem63a and Tmem63c. - / - Tmem63b showed the strongest PLS activity in cells (Fig. 6d), suggesting that Tmem63b does not require Stim1 for its activation.

[0162] To investigate whether Stim1 is essential for Tmem63b-mediated PLS, we - / - and Tmem63b - / - BDKO cells were constructed. - / - and Tmem63b - / -BDKO cells showed almost no PS exposure or PC uptake (Fig. 2d-2, Stim1 - / - +Tmem63b - / - , Fig. 6e), and exogenous Tmem63b expression induced high PS exposure and PC uptake activity (Stim1 in Fig. 2d-2). - / - Tmem63b - / - +Tmem63b, Fig. 6e), suggesting that Tmem63b suppresses Ca2+ signaling without Stim1. 2+ Similarly, exogenous Stim1 promotes Stim1-dependent PLS. - / - and Tmem63b - / - Introduction of Stim1 into BDKO cells promoted PLS activity, indicating that Stim1-induced PLS does not require Tmem63b (Fig. 2d-2, Stim1 - / - Tmem63b - / - +Stim1, Fig. 6e).

[0163] Stim1 - / - and Tmem63b repaired by Stim1 - / - Deletion of Orai1 in BDKO cells suppressed PS exposure, whereas exogenous expression of wild-type (WT) but not the severe combined immunodeficiency mutant R91W rescued the phenotype, suggesting that Orai1 mediates Ca uptake at ER-PM contact sites. 2+ These results suggest that PS influx is important for Stim1-dependent PLS. Indeed, real-time imaging using super-resolution microscopy demonstrated that PS exposure begins at the ER-PM contact sites where Stim1-tagRFP is concentrated and then spreads throughout the cell. This result supports our previous report that A23187 mediates Ca influx from the ER. 2+ Induce store-operated Ca release and then 2+ This indicates that it will promote inflow.

[0164] On the other hand, other ER-PM contact proteins, E-syt1 and SNARE proteins, such as Snap23 and Stx4a (identified by revival screening), unlike Orai1, were not significantly involved in Stim1-dependent PLS. This suggests that an unknown PLS inducer (defined as endoplasmic reticulum-plasma membrane scramblase, epSCR) is required for Stim1-dependent PLS at the plasma membrane. These proteins (Orai1, E-syt1, Snap23, and Stx4a) were expressed in Tmem63b-expressing Stim1. - / - and Tmem63b - / - Deletion in BDKO cells did not cause significant changes in PLS.

[0165] Taken together, these results suggest that there are two additional PLS pathways in addition to the known Tmem16- and Xkr-mediated pathway: Tmem63b-dependent PLS and Stim1 / Orai1-mediated epSCR-dependent PLS (Fig. 2e). In further analysis, we focused on Tmem63b-mediated PLS.

[0166] [2-3] High PLS activity due to disease mutants of Tmem63b As shown in Table 3 below (TMEM63B disease-associated mutations and their pathogenesis (modified from Am. J. Hum. Genet. 110, 1356-1376 (2023))), TMEM63B is mutated in patients with severe developmental disorders and epileptic encephalopathy (DEE), intellectual disability, severe motor disorders and cortical visual impairment, and progressive neurodegeneration of the brain, and the symptoms of most patients are accompanied by hematological abnormalities such as megaloblastic anemia and hemolytic anemia.

[0167] [Table 3]

[0168] Currently, 10 mutations in TMEM63B have been identified in 16 patients. The original amino acids of the mutations V44M, R433H, D459E, I475del, and R660T are well conserved across several species (Fig. 3a). It should be noted that most of the mutations are in the transmembrane domain of the protein (Fig. 3b). To investigate whether these mutations affect PLS activity, we cloned the mutants into Tmem63b. - / - It was expressed in BDKO cells and its activity was examined.

[0169] Previous results showed that Tmem63b-expressing BDKO cells showed PS exposure in less than 1 minute after A23187 stimulation at room temperature (Fig. 2d). It is difficult to compare the PLS activity of WT and mutant cells within this limited time frame. To overcome this issue, we slowed the reaction rate by lowering the temperature to 4°C (Fig. 7). Tmem63b WT showed a significant increase in Ca 2+ Although PS exposure was not possible without ionophore stimulation, most Tmem63b mutants showed sustained PS exposure even without stimulation ((-)A23187 in Figure 3c, Figure 3d). This was further enhanced by stimulation with 3.0 μM A23187 ((+)A23187 in Figure 3c). Interestingly, the degree of PLS ​​activity is highly correlated with the severity of blood diseases. For example, as shown in Table 1 above, mutants causing high PLS activity, I475del and V44M, cause severe hemolytic anemia, while mutants causing moderate PLS activity, D459E and R660T, cause mild megaloblastic anemia, suggesting that these mutants are gain-of-function mutants with different degrees of activity. On the other hand, R433H is a mutant that shows red blood cell abnormalities in patients but does not cause anemia, but Ca 2+ No PLS activity was observed, regardless of whether ionophore stimulation was present or not (Fig. 3c). Localization of R433H revealed that it was localized to the plasma membrane. This suggests that the loss of PLS ​​activity in the R433H mutant is due to a loss of function, not a change in localization.

[0170] TMEM63B is a Ca 2+It has been reported that Tmem63b acts as a cation channel that permeates Ca. 2+ Chelation of Ca with BAPTA-AM had only a slight effect on PS exposing activity. This suggests that ion influx via Tmem63b is not the primary factor inducing PLS. Considering that the same concentration (1 μM) of BAPTA-AM completely inhibits Tmem16F mutant-induced PLS (Nature 468, 834-838 (2010)), BAPTA-AM is thought to be responsible for Ca ion transport in the resting state. 2+ It can be concluded that the hydroxyl groups are sufficient to chelate the

[0171] To investigate the lineage of cells expressing TMEM63B, we performed single-cell RNA-seq analysis using a public database of human fetal bone marrow (E-MTAB-9389). We found that TMEM63B, but not TMEM63A or TMEM63C, was highly expressed in the erythroid lineage, particularly in mid- and late-stage erythroid cells. Given that anemia patients harbor TMEM63B mutations, dysregulation of TMEM63B in erythroid cells may be associated with anemia (Figure 3e).

[0172] [2-4] Identification of Tmem63b cofactors that induce PLS Tmem63b is Ca 2+ It is activated under stimulation, but Ca 2+ The molecular relationship between Tmem63b influx and Tmem63b activation remains unclear. To identify factors involved in Tmem63b activation, we performed a revival screen using an sgRNA library in BDKO cells overexpressing Tmem63b. After A23187 stimulation and three rounds of sorting of the PS-exposed negative population at 4°C, PLS-negative cells were enriched up to 16.3% (Figure 4a). gDNA was then prepared from the harvested cells and subjected to NGS analysis for mapping. Candidates were ranked by the total number of reads of mapped targets, and the top three candidates, Csnk2b, Kcnn4, and Slc19a2, were selected for further analysis (Figure 4b). Csnk2b is a serine / threonine kinase known to phosphorylate many substrates in the cytoplasm. Kcnn4 phosphorylates Ca2+ on the plasma membrane.2+ activation K + Slc19a2 is a thiamine transporter present in the plasma membrane, and its deficiency causes thiamine-responsive megaloblastic anemia (TRMA) (Nat. Genet. 22,300-304 (1999)). In contrast to Figure 2c, Stim1 was detected at much lower levels in all reads (Figure 4b), further demonstrating that Tmem63b-mediated PLS is distinct from Stim1-mediated PLS.

[0173] We transfected sgRNAs against these three candidates into Tmem63b-expressing BDKO cells. In particular, reduced expression of Kcnn4 was confirmed at the protein level by BN-PAGE and at the mRNA level by RT-PCR. Similarly, downregulation of Slc19a2 expression was also confirmed at the mRNA level by RT-PCR. As a result, Tmem63b-induced PLS activity was significantly inhibited by the deletion of Kcnn4 and Slc19a2, but not by the deletion of Csnk2b (Figure 4c-e). This suggests that Kcnn4 and Slc19a2 contribute to Tmem63b-mediated PLS.

[0174] Expression of Kcnn4 WT, but not the histidine-phosphorylated mutant H358N in the calmodulin-binding domain, in sgKcnn4-transfected Tmem63b-expressing BDKO cells ameliorated the phenotype, suggesting that functional Kcnn4 is involved in the induction of Tmem63b-mediated PLS (Fig. 4c, e).

[0175] To further investigate the involvement of Kcnn4, Na + K + Replace with K + As a result, PS exposure in Tmem63b-expressing cells was suppressed by K + At 4°C, the extracellular K concentration decreased in a concentration-dependent manner. +The effect of ATP1a1 on K was more pronounced at room temperature than at room temperature. + The influx of ATP is inhibited, and the exposure of PS is restricted to K + Furthermore, ATP-dependent flippase activity is negligible at low temperatures, increasing the sensitivity of scramblase-mediated initiation of PS exposure. In contrast, at room temperature, the initiation (0-100 s) and termination (620-720 s) of PS exposure are significantly delayed, especially at temperatures above 50 mM K. + Extracellular K + It was observed that the activity decreased with increasing K. + This suggests that Kcnn4-mediated K + This suggests that efflux is important under physiological conditions to promote Tmem63b-mediated PLS. This interpretation is supported by drug experiments in which treatment of cells with the Kcnn4 inhibitors Senicapoc and TRAM-34 significantly inhibited Tmem63b-mediated PLS at both 4°C and room temperature.

[0176] Restoring Slc19a2 in Tmem63-expressing BDKO cells transfected with sgSlc19a2 rescued or even enhanced the phenotype (Fig. 4d, e), confirming that Slc19a2 is involved in Tmem63b-mediated PLS. The TRMA-associated Slc19a2 mutant S143F exhibited weaker PLS activity than Slc19a2 WT in Tmem63b-expressing cells (Fig. 4d, e), suggesting that functional Slc19a2 is essential for PLS induction.

[0177] When Slc19a2 WT was overexpressed in place of Slc19a2 S143F in Tmem63b mutant-expressing cells, PLS activity was strongly enhanced (Fig. 4f + Slc19a2, Fig. 4g). On the other hand, knocking out Slc19a2 in Tmem63b mutant-expressing cells significantly reduced PLS activity (Fig. 4f + sgSlc19a2, Fig. 4g). Conversely, overexpression or deletion of Kcnn4 did not significantly alter activity (Fig. 4f, h). This suggests that Tmem63b mutants do not require Kcnn4 for activation. This result suggests that in Tmem63b mutant-expressing cells, high extracellular concentrations of K + This is consistent with the observation of high PLS activity even after the addition of WT. Collectively, these results indicate that Slc19a2 and Kcnn4 play important roles in Tmem63b WT-mediated PLS, but Kcnn4 is not required for the constitutive PLS induced by Tmem63b WT.

[0178] [2-5]Tmem63b forms a heterodimer with Slc19a2 Based on the known activation mechanisms of the identified scramblase, Tmem16, and Xkr family members, dimerization is crucial for inducing PLS. Tmem16F forms homodimers in both the resting and activated states. Meanwhile, Xkr family members Xkr4 and Xkr8 form homodimers after caspase cleavage. Tmem63b is known to exist primarily as a monomer (Cell Rep. 31, 107596 (2020); Nat. Commun. 14, 3943 (2023); Nat. Commun. 14, 7265 (2023); Neuron 111, 3195-3210.e3197 (2023)). Indeed, Blue Native-PAGE (BN-PAGE) analysis showed that the monomer-like band was predominant, with the dimer-like band being less prominent (Figure 5a).

[0179] To identify the components of the dimer-like band, we performed immunoprecipitation and mass spectrometry analysis. We found that Slc19a2 (Fig. 4b), which we identified in the revival screening, co-precipitated with Tmem63b (Fig. 5b). Co-expression of Tmem63b-GFP with Slc19a2, but not with Kcnn4 or Csnn4, resulted in a stronger dimer-like band (Fig. 5c).

[0180] To confirm that Tmem63b and Slc19a2 form a heterodimer, we performed a gel shift assay. Tmem63b-FLAG-GFP and Slc19a2-HA were expressed in BDKO cells, and cell lysates were prepared from the cells, incubated with anti-FLAG or anti-HA antibodies, and then subjected to BN-PAGE analysis. Incubation of the cell lysate with anti-FLAG antibody shifted both the monomer and dimer bands, confirming that these two bands contained Tmem63b (Fig. 5d, left).

[0181] On the other hand, when cell lysates were incubated with anti-HA antibody, only the dimer band shifted, indicating that this band contained both Tmem63b and Slc19a2 (Fig. 5d, right). Coexpression of Tmem63b-GFP with both Kcnn4-HA and Slc19a2-FLAG resulted in the appearance of a dimer band. This band shifted with anti-FLAG antibody but not with anti-HA antibody. This suggests that Kcnn4 is not involved in this complex, and that Tmem63b and Slc19a2 form a heterodimer. Supporting this idea, the amount of the Tmem63b / Slc19a2 heterodimer did not decrease upon Kcnn4 deletion.

[0182] To investigate whether Tmem63b / Slc19a2 complex formation is essential for PLS activity, we used AlphaFold2 to identify the amino acids at the interface. Mutation of five hydrophobic amino acids at the interface (F213 and L217 in TM2, and M711, F712, and I719 in TM10) to alanine significantly reduced PLS activity in Tmem63b Ala-expressing BDKO cells. It is noteworthy that Tmem63b Ala is localized to the plasma membrane. Consistent with PLS activity, complex formation was inhibited in Tmem63b Ala-expressing cells. This indicates that heterodimer formation between Tmem63b and Slc19a2 is essential for PLS induction.

[0183] We next investigated whether disease-related mutants of Tmem63b affect complex formation. Expression of Tmem63b mutants in cells slightly but not significantly increased the dimer band compared to Tmem63b WT (Figure 5e), whereas expression of Slc19a2 WT significantly increased the dimer band (Figure 5f). It is noteworthy that the dimer-to-monomer ratio correlated well with the PLS activity induced by Tmem63b mutants (Figure 3c). Overexpression of Slc19a2 WT increased heterodimer formation in Tmem63b mutant-expressing cells compared to endogenous Slc19a2 (Figure 5e), whereas overexpression of the anemia-associated mutant Slc19a2 S143F did not significantly increase dimer formation compared to Slc19a2 WT (Figure 5f). It should also be noted that among Tmem63b mutants, the I475del mutant showed the strongest activity, and Slc19a2 S143F was also able to form more heterodimers. These results suggest that functional Slc19a2 is important for heterodimer formation with Tmem63b. This tendency was also observed with Tmem63b WT, suggesting that Ca 2+ The presence of Ca or EGTA did not affect heterodimer formation or PLS activity (Fig. 5h). 2+ This suggests that the nuclei are formed without any stimulation.

[0184] These observations explain a model of Tmem63b / Slc19a2-induced PLS. 1. Tmem63b and Slc19a2 form a heterodimer. 2.Ca 2+ The stimulus activates Kcnn4. 3. K via Kcnn4 + Upon efflux, the Tmem63b / Slc19a2 heterodimer executes PLS. 4. Disease-associated variants of Tmem63b mediate Kcnn4-mediated K + It induces PLS activity independently of efflux (Fig. 5i).

[0185] [3] Consideration In Ba / F3 cells, the present inventors have demonstrated that in addition to the known PLS pathway requiring Tmem16 and Xkr, two Ca 2+ This indicates that an inducible PLS pathway exists.

[0186] Stim1 binds to Orai family members at PM-ER contact sites and mediates Orai-mediated Ca transport in the microenvironment. 2+ These results indicate that influx induces PLS. Although the PLS-inducing protein epSCR was not identified, it contributes to PLS promotion at membrane contact sites of the Stim1 / Orai1 pathway.

[0187] It was shown that Tmem63b-mediated PLS is independent of the Stim1 / Orai1 pathway. The Tmem63b protein was found to form a heterodimer with Slc19a2 and promote PLS. Previously, it has been shown that Tmem16 family proteins form homodimers. Xkr proteins also form homodimers when cleaved at the C-terminus by caspases. While OSCA, the plant orthologue of Tmem63, forms a homodimer, Tmem63b is likely to form a heterodimer with Slc19a2, and this heterodimer is involved in Ca2+ signaling. 2+ It is activated by stimulation of Kcnn4 via β-actin, and PLS is carried out.

[0188] Importantly, mutant Tmem63b proteins associated with epilepsy and anemia form more heterodimers and exhibit constitutive PLS without Kcnn4 activation. It is intriguing to speculate that the ion channel Tmem63b may alter its properties as both a channel and a PLS-inducing protein depending on the intracellular context.

[0189] The PLS activity of Tmem63b mutants (Figures 3c and 4f) strongly correlated with the dimerization of Tmem63b and Slc19a2 WT (Figure 5f). Coexpression of Tmem63b mutants with Slc19a2 S143F significantly reduced PLS activity and dimerization compared to Slc19a2 WT-expressing cells (Figure 5g). The PLS activity of Tmem63b WT (Figure 4d) also correlated with dimerization (Figure 5h). Based on these observations, we conclude that Tmem63b / Slc19a2 heterodimerization is crucial for PLS induction. Indeed, the heterodimerization model predicted by Alphafold2 and subsequent analysis of the Tmem63b Ala mutant demonstrated that heterodimerization is crucial for PLS induction.

[0190] The Tmem63 family proteins (Tmem63a, Tmem63b, and Tmem63c) exist primarily as monomers and are known to exhibit mechanosensitive channel activity. 2+ It is activated by Kcnn activation via Ca 2+ It is likely that this is dependent on Tmem63b. Currently, it is unclear how Tmem63b heterodimerizes with Slc19a2. Given that functional Slc19a2 is required for heterodimerization with Tmem63b, transport of substrates, such as thiamine, via Slc19a2 may promote heterodimerization.

[0191] Kcnn4 is known to contribute to PS exposure in erythrocytes as a Gardos channel. It is highly likely that Kcnn4 activates the Tmem63b and Slc19a2 complex to execute PLS in erythrocytes. The present inventors have demonstrated that Kcnn4-promoted Ca 2+ Dependent K + We hypothesized that the Ca efflux, together with the water efflux, causes cell shrinkage and contributes to PS exposure via Tmem63b / Slc19a2. 2+ The stimulation is K + It has been reported that Tmem63b induces Ca outflow, leading to cell shrinkage and PS exposure, but the mechanism of Tmem63b activation in this context remains unclear. One possible interpretation of the data obtained in this study is that Ca 2+ Dependent K + One possibility is that efflux causes water loss and cell shrinkage, resulting in changes in membrane tension that activate Tmem63b. Recent findings suggest that hyperosmolarity-mediated water loss activates Tmem63b in certain neurons. This suggests that Tmem63b is activated by sensing changes in membrane tension, particularly membrane compaction.

[0192] Conversely, several studies have reported that hypotonic cell swelling and membrane stretching activate Tmem63b-mediated ion channel activity. If membrane stretching primarily activates stretch-dependent channels such as Piezo1, and Ca 2+ If this leads to an influx of Ca 2+ dependent Kcnn4 is activated, and K + These sequential events may activate Tmem63b through membrane compaction, followed by Ca efflux via Piezo1 as a negative feedback mechanism. 2+ In humans, gain-of-function mutations in PIEZO1 and KCNN4 are associated with the genetic disease sicca erythrocyte syndrome. 38,51 ~ 55 , supporting the hypothesis that PIEZO1 and Kcnn4 function in the same pathway.

[0193] Finally, we found that a heterodimer consisting of proteins with independent functions exhibits a novel ability to induce PLS, in contrast to previously identified PLS proteins, Tmem16 and Xkr, which form homodimers to induce PLS activity.

Claims

1. A method for screening for a modulator of Tmem63b-induced lipid scrambling activity, comprising the steps of: (1) Incubating the cells expressing Tmem63b, Slc19a2, and Kcnn4 with the candidate regulatory substance in a Ca 2+ contacting under stimulation; (2) determining whether or not the candidate substance alters lipid scrambling activity in the cell membrane of the cell; and (3) selecting the candidate substance that caused the change as the regulator; A screening method comprising:

2. The method of claim 1, wherein in step (3), if the lipid scrambling activity is lower than the lipid scrambling activity in the cells not contacted with the candidate substance, the candidate substance is selected as a modulator that inhibits the lipid scrambling activity.

3. The method of claim 1, wherein in step (3), if the lipid scrambling activity is higher than the lipid scrambling activity in the cells not contacted with the candidate substance, the candidate substance is selected as a modulator that promotes the lipid scrambling activity.

4. The method of claim 1, wherein in step (2), the lipid scrambling activity is measured based on the amount of the heterodimer of Tmem63b and Slc19a2.

5. The method according to claim 1, wherein in step (2), the lipid scrambling activity is measured based on at least one of the uptake activity of phospholipids or glycolipids located on the outside of the cell membrane and the exposure activity of phospholipids located on the inside of the cell membrane.

6. A method for screening a therapeutic agent for a disease associated with abnormal lipid scrambling activity, comprising the following steps: (1) Cells expressing mutant Tmem63b and Slc19a2 and the candidate substance for the therapeutic agent are cultured in a Ca 2+ contacting under non-stimulation; (2) determining whether or not the candidate substance reduces lipid scrambling activity in the cell membrane of the cell; and (3) selecting the candidate substance that caused the decrease as the therapeutic agent; Including, The mutated Tmem63b is [A-i] A polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1, which has at least one mutation selected from the following: substitution of the amino acid residue at position 44 with a methionine residue, substitution of the amino acid residue at position 459 with a glutamic acid residue, deletion of the amino acid residue at position 475, and substitution of the amino acid residue at position 660 with a threonine residue; [A-ii] In the amino acid sequence of the polypeptide shown in [A-i], one or several amino acid residues other than the mutated amino acid residue are substituted, added, inserted or deleted, and the heterodimer formed with Slc19a2 is Ca 2+ A polypeptide having lipid scrambling activity in cell membranes without stimulation by [A-iii] A polypeptide having an amino acid sequence with a sequence identity of 75% or more, excluding the amino acid residue of the mutation, in the amino acid sequence of the polypeptide shown in [A-i], and wherein the heterodimer formed with Slc19a2 is Ca 2+ Polypeptides with lipid scrambling activity in cell membranes without stimulation by ATP The screening method is at least one of the above.

7. 7. The method of claim 6, wherein the disease is selected from the group consisting of diseases associated with hematological abnormalities and epilepsy.

8. 8. The method of claim 7, wherein the hematological abnormality is megaloblastic anemia or hemolytic anemia.

9. The method of claim 6, wherein in step (2), the lipid scrambling activity is measured based on the amount of a heterodimer between the Tmem63b mutant and Slc19a2.

10. The method according to claim 6, wherein in step (2), the lipid scrambling activity is measured based on at least one of the uptake activity of phospholipids or glycolipids located on the outside of the cell membrane and the exposure activity of phospholipids located on the inside of the cell membrane.

11. A method for screening a therapeutic agent for a disease associated with abnormal lipid scrambling activity, comprising the following steps: (1) Cells expressing mutant Tmem63b, Slc19a2, and Kcnn4 and the candidate therapeutic agent are cultured in a Ca 2+ contacting under stimulation; (2) determining whether or not the candidate substance increases lipid scrambling activity in the cell membrane of the cell; and (3) selecting the candidate substance that caused the increase as the therapeutic agent; Including, The mutated Tmem63b is [Bi] a polypeptide consisting of an amino acid sequence shown in SEQ ID NO: 1 in which the amino acid residue at position 433 has been substituted with a histidine residue; [B-ii] In the amino acid sequence of the polypeptide shown in [B-i], one or several amino acid residues other than the substituted amino acid residue are substituted, added, inserted or deleted, and the heterodimer formed with Slc19a2 is Ca 2+ A polypeptide that does not have lipid scrambling activity in cell membranes under stimulation of [B-iii] A polypeptide having an amino acid sequence of 75% or more sequence identity with respect to the amino acid sequence of the polypeptide shown in [B-i] except for the substituted amino acid residue, and a heterodimer formed with Slc19a2 containing Ca 2+ Polypeptides that do not have lipid scrambling activity in cell membranes under stimulation of The screening method is at least one of the above.

12. 12. The method of claim 11, wherein the disease is selected from the group consisting of diseases associated with hematological abnormalities and hearing loss.

13. A method for testing for the presence of a disease associated with abnormal lipid scrambling activity, comprising the steps of: (1) In a cell sample derived from a test subject, Ca 2+ Obtaining a quantitative value of the heterodimer of mutant Tmem63b and Slc19a2 under unstimulated conditions; and (2) comparing the quantitative value with a threshold value; Including, The mutated Tmem63b is [A-i] A polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1, which has at least one mutation selected from the following: substitution of the amino acid residue at position 44 with a methionine residue, substitution of the amino acid residue at position 459 with a glutamic acid residue, deletion of the amino acid residue at position 475, and substitution of the amino acid residue at position 660 with a threonine residue; [A-ii] In the amino acid sequence of the polypeptide shown in [A-i], one or several amino acid residues other than the mutated amino acid residue are substituted, added, inserted or deleted, and the heterodimer formed with Slc19a2 is Ca 2+ A polypeptide having lipid scrambling activity in cell membranes without stimulation by [A-iii] A polypeptide having an amino acid sequence of 75% or more sequence identity with respect to the amino acid sequence of the polypeptide shown in [A-i] except for the amino acid residue of the mutation, and a heterodimer formed with Slc19a2, which is Ca 2+ Polypeptides with lipid scrambling activity in cell membranes without stimulation by ATP At least one of the following is true: The method, wherein the threshold value is such that if the quantitative value is higher than the threshold value, it indicates that the test subject is suffering from the disease.

14. 14. The method of claim 13, wherein the disease is selected from the group consisting of diseases associated with hematological abnormalities and epilepsy.

15. 15. The method of claim 14, wherein the hematological abnormality is megaloblastic anemia or hemolytic anemia.

16. A method for testing the severity of a disorder associated with a lipid scrambling activity disorder, comprising the steps of: (1) In a cell sample derived from a subject suffering from the disease, Ca 2+ Under non-stimulated or Ca 2+ Obtaining a quantitative value of the heterodimer of mutant Tmem63b and Slc19a2 under stimulation; and (2) comparing the quantitative value with a reference value; Including, The mutated Tmem63b is [A-i] A polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1, which has at least one mutation selected from the following: substitution of the amino acid residue at position 44 with a methionine residue, substitution of the amino acid residue at position 459 with a glutamic acid residue, deletion of the amino acid residue at position 475, and substitution of the amino acid residue at position 660 with a threonine residue; [A-ii] In the amino acid sequence of the polypeptide shown in [A-i], one or several amino acid residues other than the mutated amino acid residue are substituted, added, inserted or deleted, and the heterodimer formed with Slc19a2 is Ca 2+ A polypeptide having lipid scrambling activity in cell membranes without stimulation by [A-iii] A polypeptide having an amino acid sequence of 75% or more sequence identity with respect to the amino acid sequence of the polypeptide shown in [A-i] except for the amino acid residue of the mutation, and a heterodimer formed with Slc19a2, which is Ca 2+ Polypeptides with lipid scrambling activity in cell membranes without stimulation by ATP At least one of the following is true: The method, wherein the amount obtained by subtracting the reference value from the quantitative value is positively correlated with the severity.

17. 17. The method of claim 16, wherein the disease is selected from the group consisting of diseases associated with hematological abnormalities and epilepsy.

18. 18. The method of claim 17, wherein the hematological abnormality is megaloblastic anemia or hemolytic anemia.

19. 1. A method for screening for a modulator of lipid scrambling activity, comprising the steps of: (1) Cells expressing Stim1 and Orai1 and the candidate regulatory substance are cultured in a Ca 2+ contacting under stimulation; (2) determining whether or not the candidate substance alters lipid scrambling activity in the cell membrane of the cell; and (3) selecting the candidate substance that caused the change as the regulator; A screening method comprising:

20. The method of claim 19, wherein in step (3), if the lipid scrambling activity is lower than the lipid scrambling activity in the cells not contacted with the candidate substance, the candidate substance is selected as a modulator that inhibits the lipid scrambling activity.

21. The method of claim 19, wherein in step (3), if the lipid scrambling activity is higher than the lipid scrambling activity in the cells not contacted with the candidate substance, the candidate substance is selected as a modulator that promotes the lipid scrambling activity.

Images