Methods, compositions, and devices for solid-state synthesis of expandable polymers for use in single molecule sequencing

Abstract

To provide methods, compositions, and devices for single-molecule sequencing, particularly methods, compositions, and devices for solid-state synthesis and processing of expandable polymers (e.g., Xpandomers), and methods and compositions for producing new expandable polymer constructs that provide more accurate sequence information when passed through a nanopore sensor.SOLUTION: Provided is a method of synthesizing a copy of a nucleic acid template on a solid support, the method comprising immobilizing a linker on the solid support, attaching an oligonucleotide primer to the linker, performing a primer extension reaction to produce the copy of the nucleic acid template, and performing the primer extension reaction to produce the copy of the nucleic acid template, the solid support being a cyclic olefin copolymer.SELECTED DRAWING: Figure 1C

Description

[Technical Field]

[0001] Sequence Listing Description The sequence listing associated with this application is provided in text format in lieu of a paper copy and is incorporated herein by reference. The name of the text file containing the sequence listing is 870225_424WO_Sequence_Listing_ST25.txt. The text file is 5 KB, was created on February 20, 2020, and has been submitted electronically using EFS-Web.

[0002] The present invention relates generally to new methods, compositions, and devices for single molecule sequencing, and more specifically to improved methods and devices for solid-state synthesis and processing of expandable polymers (e.g., Xpandomer), and further to methods and compositions for generating new expandable polymer constructs that provide more accurate sequence information when passed through nanopore sensors. [Background technology]

[0003] Measurement of biomolecules is fundamental to modern medicine and is widely used in medical research, more specifically in diagnosis and therapy, as well as drug development. Nucleic acids encode the information necessary for organisms to function and reproduce, essentially serving as the blueprint of life. Determining such blueprints is useful in pure research and applied science. In medicine, sequencing can be used to diagnose and develop treatments for a variety of conditions, including cancer, heart disease, autoimmune disorders, multiple sclerosis, and obesity. In industry, sequencing can be used to design improved enzymatic processes or synthetic biology. In biology, this tool can be used, for example, to study ecosystem health and thus has broad utility. Similarly, measurement of proteins and other biomolecules provides markers and understanding of disease and pathogen transmission.

[0004] An individual's unique DNA sequence provides valuable information regarding susceptibility to specific diseases. It also provides patients with the opportunity to undergo screening for early detection and / or preventive treatment. Furthermore, considering a patient's individual biomarker, clinicians could administer personalized treatments to maximize drug efficacy and / or minimize the risk of adverse drug reactions. Similarly, determining the biomarkers of pathogenic organisms could lead to new treatments for infectious diseases and more robust pathogen surveillance. Low-cost whole-genome DNA sequencing will provide the foundation for modern medicine. To achieve this goal, sequencing technology must continue to advance in terms of throughput, accuracy, and read length.

[0005] Over the past decade, numerous next-generation DNA sequencing technologies have become commercially available, dramatically reducing the cost of whole-genome sequencing. These include sequencing-by-synthesis ("SBS") platforms (Illumina, Inc., 454 Life Sciences, Ion Torrent, Pacific Biosciences) and analog ligation-based platforms (Complete Genomics, Life Technologies Corporation). Many other technologies have been developed that utilize a wide variety of sample processing and detection methods. For example, GnuBio, Inc. (Cambridge, Massachusetts) uses picoliter reaction vessels to control millions of discreet probe sequencing reactions, while Halcyon Molecular (Redwood City, California) has attempted to develop a technique for direct DNA measurement using transmission electron microscopy.

[0006] Nanopore-based nucleic acid sequencing is a compelling approach that has been extensively studied. Kasianowicz et al. (Proc. Natl. Acad. Sci. USA 93:13770-13773, 1996) characterized single-stranded polynucleotides electrically translocated through an alpha-hemolysin nanopore embedded in a lipid bilayer. It was demonstrated that partial blockage of the nanopore opening during polynucleotide translocation can be measured as a decrease in ionic current. However, polynucleotide sequencing in nanopores is burdened by the need to resolve closely spaced bases (0.34 nm) with small signal differences immersed in significant background noise. The challenge of measuring single-base resolution in nanopores is made more demanding by the rapid translocation rates observed for polynucleotides, typically on the order of one base per microsecond. Translocation rates can be reduced by adjusting operating parameters such as voltage, salt composition, pH, temperature, and viscosity, to name a few. However, such adjustments failed to reduce the translocation rate to a level that would allow single-base resolution.

[0007] Stratos Genomics has developed a method called Sequencing by Expansion (SBX), which uses a biochemical process to transcribe DNA sequences onto measurable polymers called "Xpandomers" (Kokoris et al., U.S. Patent No. 7,939,259, "High Throughput Nucleic Acid Sequencing by Expansion"). The transcribed sequences are encoded along the Xpandomer backbone in high-signal-to-noise reporters spaced approximately 10 nm apart, designed for high signal-to-noise and highly differentiated response. These differences provide significant performance improvements in sequence read efficiency and accuracy of Xpandomers compared to native DNA. Xpandomers can enable several next-generation DNA sequencing detection technologies and are well suited for nanopore sequencing.

[0008] Xpandomers are generated from unnatural nucleotide analogs called XNTPs, which feature long substituents that allow for post-synthetic extension of the Xpandomer backbone (see PCT Application WO 2016 / 081871 by Kokoris et al., incorporated herein by reference in its entirety). Due to their atypical structure, polymerization of XNTPs into Xpandomers and processing of Xpandomers into extended forms for nanopore sequencing is an inefficient process, especially in solution.

[0009] Thus, new methods and apparatus for improving the efficiency of synthesis and processing of Xpandomer copies of nucleic acid templates to generate enriched populations of full-length products for nanopore sequencing, as well as strategies for increasing the accuracy of sequence information, would be appreciated. The present invention fulfills these needs and further provides related advantages.

[0010] Not all of the subject matter described in the Background Art section is necessarily prior art, and it should not be assumed to be prior art merely as a result of its description in the Background Art section. Along these lines, awareness of prior art problems described in the Background Art section or related to such subject matter should not be treated as prior art unless expressly stated to be prior art. Instead, the discussion of any subject matter in the Background Art section should be treated as part of the inventor's approach to a particular problem, which may itself also be inventive. Summary of the Invention

[0011] Briefly, the present disclosure provides novel methods, compositions, and methods for single-molecule nanopore sequencing. In certain embodiments, the present disclosure provides improved methods, compositions, and devices for solid-state synthesis and processing of Xpandomers, as well as methods and compositions for synthesizing Xpanodmers that provide more accurate sequence information.

[0012] In one aspect, the disclosure provides a method for synthesizing a copy of a nucleic acid template on a solid substrate, the method comprising: a) immobilizing a linker on the solid support, the linker comprising a first end proximal to the solid support and a second end distal to the solid support, the first end being attached to a maleimide moiety and the second end being attached to an alkyne moiety, the maleimide moiety being crosslinked to the solid support; b) attaching an oligonucleotide primer to the linker, the oligonucleotide primer comprising a nucleic acid sequence complementary to a portion of the 3' end of the nucleic acid template, the 5' end of the oligonucleotide primer being coupled to an azide moiety, the azide moiety reacting with the alkyne moiety to form a triazole moiety; c) providing a reaction mixture comprising the nucleic acid template, a nucleic acid polymerase, nucleotide substrates or analogs thereof, a suitable buffer, and optionally one or more additives, wherein the nucleic acid template specifically hybridizes to the oligonucleotide primer; and d) performing a primer extension reaction to generate a copy of the nucleic acid template.

[0013] In certain embodiments, the maleimide moiety is crosslinked to the solid substrate by a photoinitiated proton abstraction reaction. In other embodiments, the solid substrate comprises a polyolefin, which in another embodiment may be a cyclic olefin copolymer (COC) or polypropylene. In some embodiments, the nucleic acid template is a DNA template, and the copy of the DNA template is an expandable polymer, which comprises a chain of unnatural nucleotide analogs, each of which is operably linked to an adjacent unnatural nucleotide analog by a phosphoramidate ester bond (e.g., Xpandomer). In other embodiments, the linker further comprises a spacer arm interposed between the first end and the second end, the spacer arm comprising one or more monomers of ethylene glycol. In some embodiments, the linker further comprises a cleavable moiety. In other embodiments, the solid support is selected from the group consisting of beads, tubes, capillaries, and microfluidic chips.

[0014] In another aspect, the disclosure provides a method for selectively modifying the 3' end of a copy of a nucleic acid target sequence, comprising the steps of: a) providing a first oligonucleotide having a sequence complementary to a first sequence of the nucleic acid target sequence and a second oligonucleotide having a sequence complementary to a second sequence of the nucleic acid target sequence, wherein the first sequence of the nucleic acid target sequence is 3' to the second sequence of the nucleic acid target sequence, the first oligonucleotide providing an extension primer for a nucleic acid polymerase, the 5' end of the second oligonucleotide being operably linked to a dideoxynucleoside 5' triphosphate, the dideoxynucleoside 5' triphosphate being a primer for the nucleic acid polymerase. a) providing a primer extension reaction comprising: b) providing a nucleic acid target sequence; c) providing a reaction mixture comprising a first oligonucleotide and a second oligonucleotide, a nucleic acid target sequence, a nucleic acid polymerase, a nucleotide substrate, or analog thereof, a suitable buffer, and optionally one or more additives, wherein the first oligonucleotide and the second oligonucleotide specifically hybridize to the nucleic acid target sequence; and d) performing a primer extension reaction to generate a copy of the target sequence, wherein the 5' end of the second oligonucleotide is operably linked to the 3' end of the copy of the nucleic acid target sequence by the nucleic acid polymerase.

[0015] In some embodiments, the dideoxynucleoside 5' triphosphate is operably linked to the 5' end of the second oligonucleotide by a flexible linker. In some embodiments, the flexible linker comprises one or more hexyl (C6) monomers. In other embodiments, the second oligonucleotide comprises one or more 2' methoxyribonucleic acid analogs. In still other embodiments, the 3' end of the second oligonucleotide is immobilized to the first solid support, and in some embodiments, the method further comprises washing the first solid support to purify the copy of the nucleic acid target operably linked to the second oligonucleotide. In another embodiment, the first oligonucleotide is immobilized on a first solid support. In some embodiments, the method further comprises releasing a copy of the nucleic acid target sequence from the first solid support and contacting the copy of the nucleic acid target sequence with a third oligonucleotide, wherein the third oligonucleotide has a sequence complementary to that of the second oligonucleotide, the third oligonucleotide specifically hybridizes to the second oligonucleotide, and the 5' end of the third oligonucleotide is immobilized on a second solid support. In yet other embodiments, the method further comprises washing the second solid support to purify the copy of the nucleic acid target sequence operably linked at its 3' end to the second oligonucleotide. In other embodiments, the second oligonucleotide comprises one or more nucleotide analogs that increase the binding affinity of the second oligonucleotide for the nucleic acid target sequence. In still other embodiments, the second oligonucleotide is complementary to a heterologous nucleic acid sequence operably linked to the 5' end of the nucleic acid target sequence. In some embodiments, the nucleic acid target sequence is single-stranded DNA, and the copy of the target sequence is an expandable polymer, the expandable polymer comprising a chain of non-natural nucleotide analogs, each non-natural nucleotide analog operably linked to an adjacent non-natural nucleotide analog by a phosphoramidate ester bond. In some embodiments, the first solid support and the second solid support are selected from the group consisting of beads, tubes, capillaries, and microfluidic chips.

[0016] In another aspect, the disclosure provides a method for generating a library of single-stranded DNA template constructs, each of the template constructs comprising two copies of the same strand of a DNA target sequence, the method comprising: a) ... comprising:a) providing a population of Y adaptors, each of the Y adaptors comprising a first oligonucleotide and a second oligonucleotide, wherein the 3' region of the first oligonucleotide and the 5' region of the second oligonucleotide form a double-stranded region by sequence complementarity, the 5' region of the first oligonucleotide and the 3' region of the second oligonucleotide are single-stranded and comprise a binding site for an oligonucleotide primer, and the ends of the single-stranded regions of the first oligonucleotide and the second oligonucleotide are optionally immobilized on a solid substrate; b) providing a population of double-stranded DNA molecules, each of the double-stranded DNA molecules comprising a first strand and a second strand, wherein a first end of each of the double-stranded DNA molecules matches the double-stranded end of the Y adaptor; and c) providing a population of cap primer adaptors, each of the cap primer adaptors comprising a first oligonucleotide, a second oligonucleotide, and a third oligonucleotide, wherein the second oligonucleotide binds to the first strand. providing a double-stranded DNA molecule comprising a first oligonucleotide and a third oligonucleotide, wherein a nucleotide is interposed between the first oligonucleotide and the third oligonucleotide, the first oligonucleotide, the second oligonucleotide, and the third oligonucleotide are operably linked to the 5' end of the first oligonucleotide and the 3' end of the second oligonucleotide by a chemical branching agent, wherein a portion of the sequence of the first oligonucleotide is identical to a portion of the sequence of the third oligonucleotide, a portion of the sequence of the second oligonucleotide is a reverse complement of a portion of the sequence of the first oligonucleotide and the third oligonucleotide, and the 5' end of the second oligonucleotide and the 3' end of the third oligonucleotide form a double-stranded region compatible with each second end of the double-stranded DNA molecule; d) linking the second end of each of the double-stranded DNA molecules to the 5' end of the second oligonucleotide of one of the cap primer adaptors and the 3' end of the third oligonucleotide; e) linking the first end of each of the double-stranded DNA molecules to the double-stranded end of one of the DNA Y adaptors; and f) linking the second end of each of the double-stranded DNA molecules to the 5' end of the second oligonucleotide of one of the cap primer adaptors and the 3' end of the third oligonucleotide. g) extending with a DNA polymerase from the 3' end of the first oligonucleotide of each of the ligated cap primer adaptors, wherein the first strand of the ligated double-stranded DNA molecule provides a template for the DNA polymerase, and the DNA polymerase generates a third strand comprising the reverse complement of the sequence of the first strand of the double-stranded DNA molecule and the sequence of the first oligonucleotide of the Y adaptor; and g) digesting with an exonuclease from the 5' end of each of the ligated Y adaptor first oligonucleotides, wherein the digesting removes the first oligonucleotide, the first strand of the double-stranded DNA molecule, and the second oligonucleotide of the cap primer adaptor to generate single-stranded template constructs, each of the single-stranded template constructs comprising two template molecules each comprising the sequence of the second strand of the double-stranded DNA molecule, the two template molecules being operably linked by the first oligonucleotide and the third oligonucleotide of the cap primer adaptor.

[0017] In another embodiment, the disclosure provides a library of single-stranded DNA template constructs, each of the template constructs comprising a first copy and a second copy of the same strand of a DNA target sequence, wherein the first copy and the second copy of the target sequence are operably linked, and wherein the library of single-stranded DNA template constructs is generated by the method described above.

[0018] In another aspect, the disclosure provides a method for generating a library of mirrored Xpandomer molecules, each of the Xpandomer molecules comprising two copies of the same strand of a DNA target sequence, the method comprising the steps of: a) providing a library of single-stranded DNA template constructs as described in the paragraph above; b) providing a population of first extend oligonucleotides complementary to a single-stranded portion of a first strand of a Y adaptor and a population of second extend oligonucleotides complementary to a single-stranded portion of a second strand of the Y adaptor, wherein the first or second extend oligonucleotides are optionally immobilized on a solid substrate; c) specifically hybridizing the library of single-stranded DNA template constructs to the first population of extend oligonucleotides and the second population of extend oligonucleotides; and d) providing a population of cap-branch constructs, wherein the cap-branch constructs are complementary to the second oligonucleotides. a) providing a population of cap-primer-adapter constructs comprising a first oligonucleotide operably linked to a third oligonucleotide, wherein the first and second oligonucleotides comprise sequences complementary to portions of the sequences of the first and third oligonucleotides of the cap-primer-adapter construct, and the first and second oligonucleotides of the cap-branch construct provide a free 5' nucleoside triphosphate moiety; b) specifically hybridizing the population of cap-branch constructs to a population of single-stranded DNA template constructs; and c) performing a primer extension reaction to generate Xpandomer copies of the first and second copies of the DNA target sequence, wherein the Xpandomer copies are operably linked by the cap-branch constructs.

[0019] In another aspect, the disclosure provides a method for generating a library of tagged double-stranded DNA amplicons on a solid support, comprising the steps of: a) providing a population of double-stranded DNA molecules, each of the double-stranded DNA molecules comprising a first strand specifically hybridized to a second strand; and b) providing a forward PCR primer and a reverse PCR primer, wherein the forward PCR primer is operable to hybridize to a 3' sequence complementary to a portion of the 3' end of the second strand of the double-stranded DNA molecules. a first PCR reaction in which the population of double-stranded DNA molecules comprises a first 5' heterologous tag sequence operably linked to a 3' sequence complementary to a portion of the 3' end of the first strand of the double-stranded DNA molecules, and a reverse PCR primer comprises a second 5' heterologous tag sequence operably linked to a 3' sequence complementary to a portion of the 3' end of the first strand of the double-stranded DNA molecules; c) performing a first PCR reaction in which the population of double-stranded DNA molecules is amplified to produce a population of first DNA amplicon products, the first DNA amplicon products comprising the first heterologous sequence tag at the first end and the second heterologous sequence tag at the second end; and d) immobilizing the population of double-stranded DNA molecules on a solid support. a) providing a covalently coupled capture oligonucleotide structure, the capture oligonucleotide structure comprising a first end and a second end, the first end being covalently attached to a solid support and the second end comprising a capture oligonucleotide comprising a sequence complementary to a portion of a second heterologous sequence tag of a first population of DNA amplicon products, the capture oligonucleotide structure further comprising a cleavable element interposed between the first end and the capture oligonucleotide; and b) coupling the first population of DNA amplicon products with the first heterologous sequence tag. performing a second PCR reaction comprising a forward primer comprising a sequence complementary to the sequence of one strand of the sequence tag and a reverse primer comprising a sequence complementary to one strand of a second heterologous sequence tag, wherein a first strand of the population of first DNA amplicon products specifically hybridizes to the capture oligonucleotide, the second PCR reaction producing a population of immobilized DNA amplicon products, the second strand of the immobilized DNA amplicon products being operably linked to a solid support.

[0020] In another aspect, the disclosure provides a method for generating a library of single-stranded DNA template constructs, each of the template constructs comprising two copies of the same strand of a DNA target sequence, the method comprising the steps of: a) providing a library of DNA amplicon products immobilized on a solid support as described in the paragraph above; and b) providing a population of cap primer adaptors, each of the cap primer adaptors comprising a first oligonucleotide, a second oligonucleotide, and a third oligonucleotide, wherein the second oligonucleotide is interposed between the first oligonucleotide and the third oligonucleotide, the first oligonucleotide, the second oligonucleotide, and the third oligonucleotide being operably linked to the 5' ends of the first oligonucleotide and the third oligonucleotide and to the 3' ends of the second oligonucleotide by a chemical branching agent, wherein a portion of the sequence of the first oligonucleotide is identical to a portion of the sequence of the third oligonucleotide, and a portion of the sequence of the second oligonucleotide is identical to a portion of the sequence of the first oligonucleotide and the third oligonucleotide. a) providing a cap primer adaptor comprising a first oligonucleotide and a second oligonucleotide, each of which is a reverse complement of a portion of the sequence of the first oligonucleotide, wherein the 5' end of the second oligonucleotide and the 3' end of the third oligonucleotide form a double-stranded region compatible with the free end of each of the tagged immobilized DNA amplicon products; b) ligating the free end of each of the immobilized DNA amplicon products to the 5' end of the second oligonucleotide and the 3' end of the third oligonucleotide of the cap primer adaptor; c) ligating the free end of each of the immobilized DNA amplicon products to the 5' end of the second oligonucleotide and the 3' end of the third oligonucleotide of the cap primer adaptor; d) extending from the 3' end of each of the first oligonucleotides of the cap primer adaptor with a DNA polymerase, wherein the second strand of the immobilized DNA amplicon product provides a template for the DNA polymerase, and the DNA polymerase generates a third strand, the third strand being a copy of the second strand; and e) cleaving the cleavable element of each of the capture oligonucleotide structures, wherein cleaving releases the DNA amplicon products from the solid support and generates a free 5' end on the second strand of each of the DNA amplicon products.f) digesting with an exonuclease from the free 5' end of the cleaved second strand of each of the DNA amplicon products, wherein the digestion removes the second strand of the DNA amplicon product and the second oligonucleotide of the cap primer adaptor to generate a library of single-stranded template constructs, each of the single-stranded template constructs comprising two copies of the first strand of the DNA amplicon product operably linked by the first oligonucleotide and the third oligonucleotide of the cap primer adaptor.

[0021] In another aspect, the disclosure provides a library of single-stranded DNA template constructs, each of the template constructs comprising a first copy and a second copy of the same strand of a DNA target sequence, wherein the first copy and the second copy of the DNA target sequence are operably linked, and wherein the library of single-stranded DNA template constructs is generated by the method described in the previous paragraph.

[0022] In another aspect, the disclosure provides a method for generating a library of mirrored Xpandomer molecules, each of the Xpandomer molecules comprising two copies of the same strand of a DNA target sequence, the method comprising the steps of: a) providing a library of single-stranded DNA template constructs as described in the paragraph above; b) providing a population of extend oligonucleotides complementary to second tags of the DNA amplicon products, the extend oligonucleotides being immobilized on a solid substrate; c) specifically hybridizing the library of single-stranded DNA template constructs to the extend oligonucleotides; and d) providing a population of cap-branch constructs, the cap-branch constructs comprising a first oligonucleotide operably linked to a second oligonucleotide, the first oligonucleotides being immobilized on a solid substrate. a) providing a population of cap-primer-adapter constructs, wherein the first and second oligonucleotides comprise sequences complementary to portions of the sequences of the first and third oligonucleotides of the cap-primer-adapter construct, and the first and second oligonucleotides of the cap-branch construct provide a free 5' nucleoside triphosphate moiety; b) specifically hybridizing the population of cap-branch constructs to a population of DNA template constructs; and c) performing a primer extension reaction to generate Xpandomer copies of the first and second copies of the DNA target sequence, wherein the Xpandomer copies are operably linked by the cap-branch constructs.

[0023] In some embodiments, the capture oligonucleotide structure and the extension oligonucleotide are immobilized on the same solid support, the extension oligonucleotide comprises a cleavable hairpin structure, and the cleavable hairpin structure is cleaved during the cleavage step to provide a binding site for the DNA amplicon product. In other embodiments, the capture oligonucleotide structure is immobilized on a first substrate in a first chamber of a microfluidic card, and the extension oligonucleotide is immobilized on a second substrate in a second chamber of the microfluidic card, the first chamber configured to generate a population of single-stranded DNA template constructs, and the second chamber configured to generate a population of Xpandomer copies of the single-stranded DNA template constructs. In yet other embodiments, the capture oligonucleotide structure is immobilized on a bead support, and the extension oligonucleotide is immobilized on a COC chip support, the bead support configured to generate a population of single-stranded DNA template constructs, and the COC chip support configured to generate a population of Xpandomer copies of the DNA template constructs. In another embodiment, the capture oligonucleotide structure and the extender oligonucleotide are immobilized on a beaded support, the beaded support being configured to generate a population of single-stranded DNA template constructs and a population of Xpandomer copies of the DNA template constructs. In another embodiment, the extender oligonucleotides are provided by a branched oligonucleotide structure, the branched oligonucleotide structure comprising a first extender oligonucleotide operably linked to a second extender oligonucleotide by a chemical branching agent, the first extender oligonucleotide comprising a leader sequence, a concentrator sequence, and a first cleavable moiety interposed between the chemical branching agent and the leader sequence and the concentrator sequence, and the second extender oligonucleotide comprising a second cleavable moiety.

[0024] The above and additional features of the present invention and the manner of obtaining them will become apparent and the present invention will be best understood by reference to the following more detailed description, in which all references disclosed herein are incorporated by reference in their entirety as if each were individually incorporated.

[0025] This brief summary is provided to introduce certain concepts in a simplified form that are more fully described below in the detailed description. Unless otherwise specified, this brief summary is not intended to identify key or essential features of the claimed subject matter. It is not intended to be limiting, nor is it intended to limit the scope of the claimed subject matter.

[0026] Details of one or more embodiments are set forth in the description below. Features illustrated or described in connection with one exemplary embodiment may be combined with features of other embodiments. Accordingly, any of the various embodiments described herein may be combined to provide further embodiments. Aspects of the embodiments may be modified, if necessary, to employ concepts from the various patents, applications, and publications identified herein to provide further embodiments. Other features, objects, and advantages will become apparent from the description, drawings, and claims. [Brief explanation of the drawings]

[0027] Exemplary features of the present disclosure, its nature, and various advantages will become apparent from the accompanying drawings and the following detailed description of various embodiments. Non-limiting and non-exhaustive embodiments are described with reference to the accompanying drawings, in which like labels or reference numbers refer to like parts throughout the various views unless otherwise specified. The sizes and relative positions of elements in the drawings are not necessarily drawn to scale. For example, the shapes of various elements are selected, enlarged, and positioned to improve the legibility of the drawings. The particular shapes of the depicted elements are selected for ease of recognition in the drawings.

[0028] [Figure 1A] FIG. 1 is a summarized schematic diagram showing the key features of generalized XNTP and their use in sequencing by extension (SBX). [Figure 1B]FIG. 1 is a summarized schematic diagram showing the key features of generalized XNTP and their use in sequencing by extension (SBX). [Figure 1C] FIG. 1 is a summarized schematic diagram showing the key features of generalized XNTP and their use in sequencing by extension (SBX). [Figure 1D] FIG. 1 is a summarized schematic diagram showing the key features of generalized XNTP and their use in sequencing by extension (SBX).

[0029] [Figure 2] FIG. 2 is a schematic diagram showing further details of one embodiment of XNTP.

[0030] [Figure 3] FIG. 1 is a schematic diagram showing one embodiment of an Xpandomer passing through a biological nanopore.

[0031] [Figure 4A] FIG. 1 is a schematic diagram showing an exemplary embodiment of surface chemistry for solid-phase Xpandomer synthesis. [Figure 4B] FIG. 1 is a schematic diagram showing an exemplary embodiment of surface chemistry for solid-phase Xpandomer synthesis. [Figure 4C] FIG. 1 is a schematic diagram showing an exemplary embodiment of surface chemistry for solid-phase Xpandomer synthesis. [Figure 4D] FIG. 1 is a schematic diagram showing an exemplary embodiment of surface chemistry for solid-phase Xpandomer synthesis. [Figure 4E] FIG. 1 is a schematic diagram showing an exemplary embodiment of surface chemistry for solid-phase Xpandomer synthesis.

[0032] [Figure 5] FIG. 1 is a schematic diagram providing a generalized illustration of one embodiment of functionalizing acid-resistant beads and immobilizing extended oligonucleotide / DNA template complexes to the acid-resistant beads.

[0033] [Figure 6A]FIG. 1 is a schematic diagram providing a generalized illustration of the end-capping method.

[0034] [Figure 6B] 1 is a gel showing primer extension products.

[0035] [Figure 7A] 1 is a schematic diagram of the general features of an exemplary embodiment of an end cap. [Figure 7B] 1 is a schematic diagram of the general features of an exemplary embodiment of an end cap. [Figure 7C] 1 is a schematic diagram of the general features of an exemplary embodiment of an end cap. [Figure 7D] 1 is a schematic diagram of the general features of an exemplary embodiment of an end cap.

[0036] [Figure 8-1] FIG. 1 is a schematic diagram summarizing the steps of one embodiment of solid-phase Xpandomer synthesis. [Figure 8-2] FIG. 1 is a schematic diagram summarizing the steps of one embodiment of solid-phase Xpandomer synthesis. [Figure 8-3] FIG. 1 is a schematic diagram summarizing the steps of one embodiment of solid-phase Xpandomer synthesis.

[0037] [Figure 9-1] FIG. 1 is a schematic diagram summarizing the steps of another embodiment of solid-phase Xpandomer synthesis. [Figure 9-2] FIG. 1 is a schematic diagram summarizing the steps of another embodiment of solid-phase Xpandomer synthesis.

[0038] [Figure 10A] FIG. 1 is a schematic diagram showing an alternative strategy to prevent "short-circuiting" of the polymerase during the end-capping protocol. [Figure 10B] FIG. 1 is a schematic diagram showing an alternative strategy to prevent "short-circuiting" of the polymerase during the end-capping protocol.

[0039] [Figure 11A] FIG. 1 is a schematic diagram summarizing the steps of one embodiment of mirrored library construction and use for Xpandomer synthesis. [Figure 11B] FIG. 1 is a schematic diagram summarizing the steps of one embodiment of mirrored library construction and use for Xpandomer synthesis. [Figure 11C] FIG. 1 is a schematic diagram summarizing the steps of one embodiment of mirrored library construction and use for Xpandomer synthesis.

[0040] [Figure 12] FIG. 1 is a schematic diagram of the general features of one embodiment of a cap adapter construct.

[0041] [Figure 13] One embodiment of the workflow for generating a mirrored library for Xpandomer is summarized below.

[0042] [Figure 14A-1] FIG. 1 is a schematic diagram summarizing the steps of one embodiment for generating an immobilized library of DNA amplicons. [Figure 14A-2] FIG. 1 is a schematic diagram summarizing the steps of one embodiment for generating an immobilized library of DNA amplicons. [Figure 14B-1] FIG. 1 is a schematic diagram summarizing the steps of one embodiment for generating an immobilized library of DNA amplicons. [Figure 14B-2] FIG. 1 is a schematic diagram summarizing the steps of one embodiment for generating an immobilized library of DNA amplicons.

[0043] [Figure 15A] FIG. 1 is a schematic diagram summarizing the steps of one embodiment of the solid synthesis of a library of mirrored template constructs for mirrored library Xpandomer production. [Figure 15B] FIG. 1 is a schematic diagram summarizing the steps of one embodiment of the solid synthesis of a library of mirrored template constructs for mirrored library Xpandomer production.

[0044] [Figure 16A] FIG. 1 is a schematic diagram summarizing the steps of another embodiment of solid-state synthesis of a library of constructs for mirrored library Xpandomer synthesis. [Figure 16B] FIG. 1 is a schematic diagram summarizing the steps of another embodiment of solid-state synthesis of a library of constructs for mirrored library Xpandomer synthesis.

[0045] [Figure 17] summarizes one embodiment of a workflow for generating mirrored libraries of Xpandomer using different solid supports.

[0046] [Figure 18] FIG. 1 is a schematic diagram of generalized features of branched extension oligonucleotide structures.

[0047] [Figure 19A] FIG. 1 is a schematic diagram summarizing the steps of one embodiment of the solid-state synthesis of a mirrored library of Xpandomer using branched extension oligonucleotides. [Figure 19B] FIG. 1 is a schematic diagram summarizing the steps of one embodiment of the solid-state synthesis of a mirrored library of Xpandomer using branched extension oligonucleotides.

[0048] [Figure 20] 1 is a gel showing primer extension products.

[0049] [Figure 21A] 1 is a gel showing primer extension products.

[0050] [Figure 21B] Histogram alignment of sequencing reads from Nanopore.

[0051] [Figure 22] 1 is a gel showing primer extension products with end-capping.

[0052] [Figure 23] 1 is a gel showing primer extension products with end-capping.

[0053] [Figure 24A] FIG. 1 is a schematic diagram showing one embodiment of a three-pronged adaptor ligated to a library fragment.

[0054] [Figure 24B] 1 is a gel showing ligation of three-pronged adaptors to library fragments.

[0055] [Figure 25A] FIG. 1 is a schematic diagram showing one embodiment of the extension and digestion reaction of an M1 mirrored library construct to generate an M3 mirrored library construct.

[0056] [Figure 25B] 1 is a gel showing the products of the extension and digestion reactions.

[0057] [Figure 26A] FIG. 1 is a schematic diagram showing one embodiment of solid-state synthesis of M1 mirrored library constructs.

[0058] [Figure 26B] 1 is a gel showing the products of solid state synthesis of the M1 mirrored library construct.

[0059] [Figure 27] FIG. 1 is a schematic diagram showing one embodiment of a template for synthesizing the mirrored library Xpandomer.

[0060] [Figure 28] 1 is a gel showing the products of various stages of mirrored library construction.

[0061] [Figure 29] 1 is a nanopore trace showing part of the sequence of the mirrored library Xpandomer.

[0062] [Figure 30] 1 is a gel showing Xpandomer products synthesized on acid-resistant magnetic beads.

[0063] [Figure 31] 1 is a gel showing the synthesis and processing of Xpandomer products on acid-resistant magnetic beads. DETAILED DESCRIPTION OF THE INVENTION

[0064] The present invention may be more readily understood by reference to the following detailed description of preferred embodiments of the invention and the examples contained herein. Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0065] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology, microbiology, recombinant DNA, and the like, which are within the skill of the art. Such techniques are fully explained in the literature. See, for example, Sambrook, Fritsch, and Maniatis, MOLECULAR CLONING: A LABORATORY MANUAL, Second Edition (1989), OLIGONUCLEOTIDE SYNTHESIS (M.J. Gait Ed., 1984), the series METHODS IN ENZYMOLOGY (Academic Press, Inc.), and CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Siedman, J.A. Smith, and K. Struhl, eds., 1987). All patents, patent applications, and publications mentioned herein, above and below, are hereby incorporated by reference.

[0066] 1.Definition As used herein, a "nucleic acid," also referred to as a polynucleotide, is a covalently linked series of nucleotides in which the 3' position of the pentose of one nucleotide is linked to the 5' position of the next by a phosphodiester group. A nucleic acid molecule can be deoxyribonucleic acid (DNA), ribonucleic acid (RNA), or a combination of both. DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are biologically occurring polynucleotides in which nucleotide residues are linked in a specific sequence by phosphodiester bonds. As used herein, the terms "nucleic acid," "polynucleotide," or "oligonucleotide" encompass any polymeric compound having a linear backbone of nucleotides. Oligonucleotides, also referred to as oligomers, are generally shorter polynucleotides. When nucleic acids are intended for sequencing, they are generally referred to as "target nucleic acids," "target sequences," "templates," or "library fragments."

[0067] The term "template" refers to the strand of DNA that sets the genetic sequence of the new strand.

[0068] As used herein, the term "template-dependent" is intended to refer to a process involving template-dependent extension of a primer molecule (e.g., DNA synthesis by a DNA polymerase). The term "template-dependent" refers to polynucleotide synthesis of RNA or DNA, in which the sequence of the newly synthesized strand of the polynucleotide is determined by the well-known rules of complementary base pairing (see, e.g., Watson, J.D. et al., In: Molecular Biology of the Gene, 4th Ed., WA Benjamin, Inc., Menlo Park, Calif. (1987)).

[0069] As used herein, the term "primer" refers to a short strand of nucleic acid that is complementary to the sequence of another nucleic acid and serves as a starting point for DNA synthesis. Preferably, primers are at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least At least 13, at least 14, at least 15, at least 16, at least 18, at least 20, at least 25, at least 30, or more bases in length.

[0070] As used herein, the term "strand" refers to a nucleic acid composed of nucleotides covalently linked to each other by phosphodiester bonds. One strand of a nucleic acid contains no nucleotides that are bound only through hydrogen bonds, i.e., through base pairing, but the strand can base pair with a complementary strand through hydrogen bonds. When a first strand and a second strand base pair through complementarity, the first strand may be referred to as the "plus" strand, the "sense" strand, or the "5' to 3'" strand, and the second strand may be referred to as the "minus" strand, the "antisense" strand, or the "3' to 5'" strand (or vice versa).

[0071] The term "3' end" as used herein refers to the end of a nucleotide chain having at its end a hydroxyl group on the third carbon of the deoxyribose sugar ring.

[0072] The term "5' end" as used herein refers to the end of a nucleotide chain having the fifth carbon in the deoxyribose sugar ring at that end.

[0073] The term "complementary" refers to base pairing between nucleotides or nucleic acids that allows the formation of a duplex, such as between the two strands of a double-stranded DNA molecule, between an oligonucleotide primer and a primer-binding site on a single-stranded nucleic acid, or between an oligonucleotide probe and its complementary sequence in a DNA molecule. Complementary nucleotides are generally A and T (or A and U), or C and G. Two single-stranded DNA molecules are said to be substantially complementary when the nucleotides of one strand are paired with about 60%, at least 70%, at least 80%, at least 85%, usually at least about 90% to about 95%, or even about 98% to about 100% of the nucleotides of the other strand, optimally aligned and compared, and with appropriate nucleotide insertions or deletions. The degree of identity between two nucleotide regions can be determined using computer-implemented algorithms and methods well known to those skilled in the art. The identity between two nucleotide sequences is preferably determined using the BLASTN algorithm (BLAST Manual, Altschul, S. et al., NCBI NLM NIH Bethesda, Md. 20894, Altschul, S., et al., J., 1990, Mol. Biol. 215:403-410).

[0074] "Hybridization" refers to the process by which two single-stranded polynucleotides bind noncovalently to form a stable double-stranded polynucleotide. "Hybridization conditions" typically include a salt concentration of about 1 M or less, more usually less than about 500 mM, and may be less than about 200 mM. A "hybridization buffer" is a buffered salt solution such as 5% SSPE, or other such buffers known in the art. Hybridization temperatures can be as low as 5°C, but are typically above 22°C, more typically above about 30°C, and typically above 37°C. Hybridization is often performed under stringent conditions, i.e., conditions under which a primer will hybridize to its target subsequence but will not hybridize to other non-complementary sequences. Stringent conditions are sequence-dependent and will vary depending on the situation. For example, longer fragments may require higher hybridization temperatures for specific hybridization than shorter fragments. Because other factors, including base composition and length of complementary strands, the presence of organic solvents, and the degree of base mismatching, can affect the stringency of hybridization, the combination of parameters is more important than the absolute measure of any one parameter alone. Generally, stringent conditions are selected to be about 5°C lower than the Tm of the specific sequence at a defined ionic strength and pH. Exemplary stringent conditions include a pH of about 7.0 to about 8.3 and a salt concentration of at least 0.01M to 1M or less sodium ion (or other salt) at a temperature of at least 25°C. The degree can be mentioned.

[0075] Nucleic acids are "operably linked" when they are placed into a functional relationship with each other. Generally, "operably linked" means that the nucleic acid sequences being linked are contiguous with each other. Linking can be accomplished enzymatically, for example, by nucleic acid ligase or polymerase.

[0076] As used herein, the term "double-stranded DNA library" refers to a library containing both strands of DNA molecules (i.e., sense and antisense strands) that are physically linked by one of their ends and can form part of the same molecule. The library of double-stranded DNA molecules can be, but is not limited to, genomic DNA (nuclear DNA, mitochondrial DNA, chloroplast DNA, etc.), plasmid DNA, or double-stranded DNA molecules (e.g., DNA, cDNA, mRNA) obtained from a single-stranded nucleic acid sample.

[0077] As used herein, a "nucleic acid polymerase" generally refers to an enzyme for joining 3'-OH 5'-triphosphate nucleotides, oligomers, and their analogs. Polymerases include DNA-dependent DNA polymerase, DNA-dependent RNA polymerase, RNA-dependent DNA polymerase, RNA-dependent RNA polymerase, T7 DNA polymerase, T3 DNA polymerase, T4 DNA polymerase, T7 RNA polymerase, T3 RNA polymerase, SP6 RNA polymerase, DNA polymerase 1, Klenow fragment, Thermophilus aquaticus DNA polymerase, Tth DNA polymerase, Vent® DNA polymerase (New England Biolabs), Deep Examples of polymerases include VentR® DNA polymerase (New England Biolabs), Bst DNA Polymerase Large Fragment, Stoeffel Fragment, 90N DNA polymerase, 90N DNA polymerase, Pfu DNA polymerase, Tfl DNA polymerase, Tth DNA polymerase, Phi29 polymerase, Tli DNA polymerase, eukaryotic DNA polymerase beta, telomerase, Therminator™ polymerase (New England Biolabs), KOD HiFi™ DNA polymerase (Novagen), KOD1 DNA polymerase, Q-beta replicase, terminal transferase, AMV reverse transcriptase, M-MLV reverse transcriptase, Phi6 reverse transcriptase, and HIV-1 reverse transcriptase. The polymerases according to the present invention may be mutant, mutated, or chimeric polymerases.

[0078] As used herein, a "DPO4-type DNA polymerase" refers to a DNA polymerase naturally expressed by the archaea Sulfolobus solfataricus or related Y-family DNA polymerases, which function in the replication of damaged DNA by a process commonly known as translesion synthesis (TLS). Y-family DNA polymerases are homologous to DPO4 polymerase. Examples include the prokaryotic enzymes Pol II, Pol IV, and Pol V, the archaeal enzymes Dbh, and the eukaryotic enzymes Rev3p, Rev1p, Pol η, REV3, REV1, Pol I, and Pol κ DNA polymerases, and chimeras thereof.

[0079] As used herein, a "DPO4 variant" is a modified recombinant DPO4-type DNA polymerase that contains one or more mutations compared to a naturally occurring wild-type DPO4-type DNA polymerase, e.g., one or more mutations that enhance the ability to utilize bulky nucleotide analogs as substrates or another polymerase property, and additional changes or modifications to the wild-type DPO4-type DNA polymerase, e.g., additional peptides or proteins. They may include one or more deletions, insertions, and / or fusions of sequences (e.g., to immobilize the polymerase on a surface or otherwise tag the polymerase enzyme). Exemplary DPO4 mutant polymerases according to the present invention are the mutants of Sulfolobus sulfataricus DPO4 described in published PCT patent application WO 2017 / 087281A1 and PCT patent application numbers PCTUS2018 / 030972 and PCTUS2018 / 64794, which are incorporated by reference in their entireties.

[0080] As used herein, "nucleic acid polymerase reaction" refers to an in vitro method for creating a new strand of nucleic acid in a template-dependent manner or extending an existing nucleic acid (e.g., DNA or RNA). The nucleic acid polymerase reaction according to the present invention includes a primer extension reaction, which results in the incorporation of a nucleotide or nucleotide analog at the 3' end of a primer such that the incorporated nucleotide or nucleotide analog is complementary to the corresponding nucleotide of a target polynucleotide. The primer extension product of the nucleic acid polymerase reaction can be further used for single-molecule sequencing or as a template for synthesizing additional nucleic acid molecules.

[0081] As used herein, the term "plurality" refers to "at least two."

[0082] "XNTP" is an extendable 5' triphosphate modified nucleotide substrate that is compatible with template-dependent enzymatic polymerization.XNTP has two different functional components. That is, a nucleobase 5'-triphosphoramidate and a tether that is attached to each nucleoside triphosphoramidate at a position that allows controlled extension by intranucleotidic cleavage of phosphoramidate bond.As used herein, XNTP is an exemplary "non-natural highly substituted nucleotide analog substrate".Exemplary XNTP and its preparation method are described, for example, in PCT Application No. WO 2016 / 081871 published by the applicant, the entire contents of which are incorporated herein by reference.

[0083] An "Xpandomer intermediate" is an intermediate product (also referred to herein as a "daughter strand") assembled from an XNTP and formed by polymerase-mediated template-directed assembly of the XNTP using a target nucleic acid template. The newly synthesized Xpandomer intermediate is a constrained Xpandomer. Under a process step in which the phosphoramidate bond provided by the XNTP is cleaved, the constrained Xpandomer is no longer constrained and becomes an Xpandomer product that extends as the tether is extended.

[0084] An "Xpandomer" or "Xpandomer product" is a synthetic molecular construct generated by the propagation of a constrained Xpandomer, which itself is synthesized by template-directed assembly of an XNTP substrate. The Xpandomer extends relative to the target template from which it was generated. It is composed of a series of subunits, each subunit being a motif, and each motif is a member of a library containing sequence information, tethers, and optionally, some or all of the substrate, all of which originate from the formative substrate construct. The Xpandomer is designed to extend longer than the target template, thereby reducing the linear density of the sequence information of the target template along its length. Furthermore, the Xpandomer optionally provides a platform for increasing the size and abundance of reporters, which in turn improves signal-to-noise for detection. The lower linear information density and stronger signal enhance resolution and reduce the sensitivity requirements for detecting and combining sequences on the template strand.

[0085] A "tether" or "tether member" refers to a polymer or molecular construct having a generally linear dimension and having a terminal moiety at each of two opposite ends. A nucleoside triphosphoramidate bond binds to the tether to form an XNTP. The bond serves to constrain the tether into a "constrained configuration." The tether has a "constrained configuration" and an "extended configuration." The constrained configuration is found in XNTPs and daughter strands or Xpandomer intermediates. The constrained configuration of the tether is a precursor to the extended configuration, as seen in the Xpandomer product. The transition from the constrained configuration to the extended configuration results in cleavage of the selectively cleavable phosphoramidate bond. The tether contains one or more reporters or reporter constructs along its length that can encode the sequence information of the substrate. The tether provides a means to extend the length of the Xpandomer, thereby reducing the linear density of the sequence information.

[0086] A "tether element" or "tether segment" is a polymer having approximately linear dimensions with two ends that form terminal linkages for connecting tether elements. A tether element is a segment of a tether. Such polymers include polyethylene glycol, polyglycol, polypyridine, polyisocyanate, polyisocyanate, poly(triarylmethyl)methacrylate, polyaldehyde, polypyrrolinone, polyurea, polyglycol phosphodiester, polyacrylate, polymethacrylate, polyacrylamide, polyvinyl ester, polystyrene, polyamide, polyurethane, polycarbonate, polybutyrate, polybutadiene, polybutyrolactone, polypyrrolidinone, polyvinylphosphonate, polyacetamide, polysaccharide, polyhyaluronate, polyamide, polyimide, polyester, polyethylene, polypropylene, polystyrene, polycarbonate, polyterephthalate, polysilane, polyurethane, polyether, polyamino acid, polyglycine, polyproline, N-substituted polylysine, polypeptide, side chain N-substituted peptide, poly-N-substituted glycine, peptoid, side chain carboxyl The polymers may include, but are not limited to, substituted peptides, homopeptides, oligonucleotides, ribonucleic acid oligonucleotides, deoxynucleic acid oligonucleotides, oligonucleotides modified to prevent Watson-Crick base pairing, oligonucleotide analogs, polycytidylic acid, polyadenylic acid, polyuridylic acid, polythymidine, polyphosphate, polynucleotides, polyribonucleotides, polyethylene glycol-phosphodiesters, peptide polynucleotide analogs, threosil-polynucleotide analogs, glycol-polynucleotide analogs, morpholino-polynucleotide analogs, locked nucleotide oligomer analogs, polypeptide analogs, branched polymers, comb polymers, star polymers, dendritic polymers, random, gradient and block copolymers, anionic polymers, cationic polymers, polymers forming proximal loops, rigid segments and flexible segments.

[0087] A "reporter" is composed of one or more reporter elements, which serve to analyze the genetic information of a target nucleic acid.

[0088] A "reporter construct" comprises one or more reporters capable of generating a detectable signal, which generally comprises sequence information. This signal information, referred to as a "reporter code," is subsequently decoded into genetic sequence data. Reporter constructs may also comprise tether segments or other structural components, including polymers, graft copolymers, block copolymers, affinity ligands, oligomers, haptens, aptamers, dendrimers, linking groups, or affinity binding groups (e.g., biotin).

[0089] A "reporter code" is the genetic information from the measured signal of a reporter construct. The reporter code is decoded to provide sequence-specific genetic information data.

[0090] As used herein, the terms "solid support," "solid state," "support," and "substrate" are used interchangeably and refer to a material or group of materials having a rigid or semi-rigid surface. In many embodiments, at least one surface of the solid support will be substantially flat, e.g., the surface of a polymeric microfluidic card or chip. In some embodiments, it may be desirable to physically separate regions of the card or chip for different reactions, e.g., with etched channels, trenches, wells, raised areas, pins, etc. According to other embodiments, the solid support will take the form of insoluble beads, resins, gels, membranes, microspheres, or other geometric configurations configured, e.g., from controlled pore glass (CPG) and / or polystyrene.

[0091] As used herein, the term "immobilized" refers to an association, bond, or attachment between a molecule (e.g., a linker, adapter, oligonucleotide) and a support in a manner that provides a stable association under the conditions of extension, amplification, ligation, and other processes described herein. Such attachment can be covalent or non-covalent. Non-covalent attachment includes electrostatic, hydrophilic, and hydrophobic interactions. Covalent attachment is the formation of a covalent bond characterized by the sharing of electron pairs between atoms. Such covalent attachment can be directly between the molecule and the support, or can be formed by a cross-linker or by including specific reactive groups on the support, the molecule, or both. Covalent attachment of molecules can be achieved using a binding partner such as avidin or streptavidin immobilized on the support and non-covalent attachment of a biotinylated molecule to the avidin or streptavidin. Immobilization can also involve a combination of covalent and non-covalent interactions.

[0092] As used herein, the term "click reaction" is art-recognized and describes a collection of highly reliable, self-directed organic reactions, the most recognized of which is the copper-catalyzed azide-alkyne [3+2] cycloaddition. Non-limiting examples of click chemistry reactions can be found, for example, in H.C. Kolb, M.G. Finn, K.B. Sharpless, Angew. Chem. Int. Ed. 2001, 40, 2004 and E.S. Letten, C.R. Bertozzi, Angew. Chem. Int. Ed. 2009, 48, 6974, the disclosures of which are incorporated herein by reference in their entireties for all purposes.

[0093] An exemplary click chemistry reaction is the azide-alkyne Huisgen cycloaddition (e.g., using a copper (Cu) catalyst at room temperature). (Rostovtsev, et al. 2002 Angew. Chemie Int'l Ed. 41(14):2596-2599; Tornoe, et al. 2002 J. Org. Chem. 67(9):3057-3064.) Other examples of click chemistry include the thiol-ene click reaction, the Diels-Alder reaction, and the inverse electron demand Diels-Alder reaction, the [4 + 1] cycloaddition between an isonitrile (isocyanide) and a tetrazine. (See, e.g., Hoyle, et al. 2010 Angew. Chemie Int'l Ed. 49(9):1540-1573; Blackman, et al. 2008 J. Am. Chem. Soc. 130(41):13518-13519; Devaraj, et al. 2008 Bioconjugate Chem. 19(12):2297-2299; Stockmann, et al. 2011 Org. Biomol. Chem. 9, 7303-7305.)

[0094] The term "alkyne" refers to a hydrocarbon having at least one carbon-carbon triple bond. As used herein, the term "terminal alkyne" refers to an alkyne having at least one hydrogen atom attached to a triple-bonded carbon atom.

[0095] As used herein, the term "azido" or "azido" refers to a group of formula (--N3).

[0096] The term "triazole" refers to any heterocyclic compound with the molecular formula CHN, which has a five-membered ring of two carbon atoms and three nitrogen atoms. The product of a chemical click reaction between an alkyne moiety and an azide moiety is a triazole moiety.

[0097] Sequencing by extension One exemplary primer extension reaction that can be enhanced by solid-state synthesis is the polymerization of unnatural nucleotide analogs known as "XNTPs," which form the basis of the "Sequencing by Expansion" (SBX) protocol developed by Stratos Genomics (see, e.g., Kokoris et al., U.S. Patent No. 7,939,259, "High Throughput Nucleic Acid Sequencing by Expansion"). Generally, SBX uses this biochemical polymerization to transcribe the sequence of a DNA template onto measurable polymers called "Xpandomers." The transcribed sequences are encoded along the Xpandomer backbone in high-signal-to-noise reporters spaced approximately 10 nm apart, designed for high signal-to-noise and highly differentiated response. These differences provide significant performance improvements in sequence read efficiency and accuracy of Xpandomers compared to native DNA. A generalized overview of the SBX process is shown in Figures 1A, 1B, 1C, and 1D.

[0098] XNTPs are extendable 5' triphosphate-modified nucleotide substrates compatible with template-dependent enzymatic polymerization. A highly simplified version of XNTP is shown in Figure 1A, highlighting the unique features of these nucleotide analogs. XNTP 100 has two distinct functional regions: a selectively cleavable phosphoramidate bond 110 connecting the 5' α-phosphate 115 to the nucleobase 105, and a tether 120 attached within the nucleoside triphosphoramidate at a position that allows controlled extension via intranucleotidic cleavage of the phosphoramidate bond. The XNTP tether is composed of linker arm moieties 125A and 125B separated by a selectively cleavable phosphoramidate bond. Each linker is attached to one end of a reporter 130 via a linking group (LG), as disclosed in U.S. Patent No. 8,324,360 to Kokoris et al., incorporated herein by reference in its entirety. XNTP 100 is shown in the "constrained configuration" characteristic of the XNTP substrate and daughter strand after polymerization. The constrained configuration of the polymerized XNTP is a precursor to the extended configuration seen in the Xpandomer product. The transition from the constrained to the extended configuration occurs upon cleavage of the phosphoramidate P--N bond within the primary backbone of the daughter strand.

[0099] The synthesis of Xpandomers is summarized in Figures 1B and 1C. During assembly, monomeric XNTP substrates 145 (XATP, XCTP, XGTP, and XTTP) are polymerized at the extendable end of a nascent daughter strand 150 by a process of template-directed polymerization using a single-stranded template (SEQ ID NO: 1) 140 as a guide. Generally, this process is initiated from a primer and proceeds in the 5' to 3' direction. Typically, a DNA polymerase or other polymerase is used to form the daughter strand, and conditions are selected to yield a complementary copy of the template strand. After the daughter strand is synthesized, the coupled tether contains a constrained Xpandomer that further comprises the daughter strand. The tether in the daughter strand has the "constrained configuration" of the XNTP substrate. The constrained configuration of the tether is a precursor to the extended configuration, as seen in the Xpandomer product.

[0100] As shown in Figure 1C, the transition from the constrained configuration 160 to the extended configuration 165 results from the cleavage of a selectively cleavable phosphoramidate bond (shown by an unshaded oval for simplicity) within the primary backbone of the daughter strand. In this embodiment, the tethers contain one or more reporter constructs or reporters specific for the nucleobases to which they are linked. Constructs 130A, 130C, 130G, or 130T encode the sequence information of the template. In this way, the tether provides a means to extend the length of the Xpandomer and reduce the linear density of the sequence information of the parent strand.

[0101] Figure 1D shows Xpandomer 165 translocating through nanopore 180 from cis reservoir 175 to trans reservoir 185. Upon passing through the nanopore, each of the linearized Xpandomer's reporters (labeled "G," "C," and "T" in this illustration) generates a distinct, reproducible electronic signal (shown by superimposed trace 190) specific to the nucleobase to which it is linked.

[0102] Figure 2 shows the generalized structure of XNTP in more detail. XNTP 200 is composed of nucleobase triphosphoramidate 210 with linker arm moieties 220A and 220B separated by a selectively cleavable phosphoramidate bond 230. A tether is linked to the nucleoside triphosphoramidate at linking groups 250A and 250B, with a first tether end linked to heterocycle 260 (represented here by cytosine, although the heterocycle may be any one of the four standard nucleobases: A, C, G, or T), and a second tether end linked to the alpha phosphate 270 of the nucleobase backbone. Those skilled in the art will appreciate that many suitable coupling chemistries known in the art can be used to form the final XNTP substrate product; for example, the tether linkage can be achieved by a triazole bond.

[0103] In this embodiment, tether 275 is composed of several functional elements, including enhancers 280A and 280B, reporter codes 285A and 285B, and translational control elements (TCEs) 290A and 290B. Each of these features serves a unique function during Xpandomer translocation through the nanopore and the generation of a unique, reproducible electronic signal. Tether 275 is designed for translocation control by hybridization (TCH). As shown, the TCE can duplex to a complementary oligomer (CO), providing a region of hybridization adjacent to the reporter code. Different reporter codes are sized to block ion flow through the nanopore at different, measurable levels. Specific reporter codes can be efficiently synthesized using phosphoramidite chemistry, typically used in oligonucleotide synthesis. Reporters can be designed by selecting specific phosphoramidite sequences from a commercially available library. Such libraries include, but are not limited to, polyethylene glycols having lengths of 1 to 12 or more ethylene glycol units, aliphatics having lengths of 1 to 12 or more carbon units, deoxyadenosine (A), deoxycytosine (C), deoxyguanosine (G), deoxythymine (T), and abasic (Q). Because the duplexed TCE associated with the reporter code also contributes to ionic current blockade, the combination of the reporter code and TCE can be referred to as a "reporter." Following the reporter code is an enhancer, in one embodiment, comprising a spermine polymer.

[0104] Figure 3 shows one embodiment of a truncated Xpandomer in the process of translocating an α-hemolysin nanopore. This biological nanopore is embedded in a lipid bilayer membrane that separates and electrically isolates two reservoirs of electrolyte. A typical electrolyte is 1 molar KCl buffered to pH 7.0. When a small voltage, typically 100 mV, is applied across the bilayer, the nanopore restricts the flow of ionic current and is the primary resistance in the circuit. Xpandomer reporters are designed to confer specific ionic current blockage levels, and sequence information can be read by measuring the sequence of the ionic current levels as the reporter sequence translocates through the nanopore.

[0105] The α-hemolysin nanopore is typically oriented so that translocation occurs by entering the antrum and exiting the base. As shown in Figure 3, the nanopore is oriented to capture the Xpandomer from the base first. This orientation is advantageous because it reduces blockage artifacts that occur when first entering the antrum using the TCH method. Unless otherwise indicated, the base will be the initial expected translocation direction. As the Xpandomer translocates, the reporter enters the base until its duplexed TCE is stopped at the base entrance. Because the duplex is approximately 2.4 nm in diameter, while the base entrance is approximately 2.2 nm, the reporter is retained at the base until the complementary strand of the duplex dissociates (is released), after which translocation proceeds to the next reporter. Because the Xpandomer is still translocating and diffusing out of the pore, it is highly undesirable for the free complementary strand to enter the nanopore.

[0106] In one embodiment, each member of the reporter code (following the duplex) is formed by an ordered selection of phosphoramidites, which can be selected from many commercially available libraries. Each constituent phosphoramidite contributes to the net ionic resistance according to its position within the nanopore (where it is located after duplex termination), its displacement, its charge, its interaction with the nanopore, its chemical and thermal environment, and other factors. The charge on each phosphoramidite is due, in part, to the phosphate ion, which has a nominal charge of -1 but is effectively reduced by counterion shielding. The force pulling the duplex results from these effective charges along the reporter, which are exerted by the local electric field. Each reporter can have a different charge distribution, and therefore can exert different forces on the duplex for a given applied voltage. The force transmitted along the reporter backbone also serves to stretch the reporter, giving a repeatable blocking response.

[0107] For sequencing, a protein nanopore is prepared by inserting α-hemolysin into the DPhPE / hexadecane bilayer member in Buffer B1 containing 2 M NH4Cl and 100 mM HEPES (pH 7.4). The cis-well is perfused with Buffer B2 containing 0.4 M NH4Cl, 0.6 M GuCl, and 100 mM HEPES, pH 7.4. The Xpandomer sample is heated to 70 °C for 2 min, allowed to cool completely, and then 2 μL of sample is added to the cis-well. A voltage pulse of 90 mV / 390 mV / 10 μs is then applied, and data are acquired using Labview acquisition software.

[0108] Sequence data are analyzed by histogram display of the population of sequence reads from a single SBX reaction. The analysis software aligns each sequence read to the template sequence and trims the sequence stretches at the ends of the reads that do not align with the correct template sequence.

[0109] 2. Embodiments of the present invention The present invention may employ specific methods, devices, and compositions as described in the following exemplary embodiments.

[0110] A. Solid-state synthesis

[0111] The sequencing-by-extension (SBX) methodology developed by the present inventors offers significant performance improvements in the efficiency and accuracy of Xpandomer sequence reads compared to native DNA. However, samples enriched with high-quality full-length Xpandomer copies of template DNA can be difficult to generate in solution. Advantageously, through trial and error, the present inventors have found that by adapting various steps of the workflow (e.g., primer extension reactions and / or post-synthesis processing steps) to solid supports, the efficiency of full-length Xpandomer synthesis and / or processing can be increased. The solid-state platform has been found to improve the optimization of various reaction conditions.

[0112] Solid-state synthesis of Xpandomer can be performed using any suitable support platform known in the art. In certain embodiments, the solid support may be a conventional bead, a tube, a capillary, or a microfluidic chip or card. As discussed further herein, in some embodiments of the present invention, an oligonucleotide primer, i.e., an extension, or "E-oligo," is attached to the support to initiate solid-state Xpandomer synthesis.

[0113] surface chemistry

[0114] Multiple surface chemistries can be used to immobilize oligonucleotides or oligonucleotide / template complexes on solid supports. Specific exemplary embodiments of suitable surface chemistries are shown in Figures 4A-4E. The embodiment shown in Figure 4A uses conventional streptavidin / biotin interaction chemistry and illustrates functionalization of solid support 400 with a linker containing a terminal biotin moiety 410A. In this embodiment, the 5' end of oligonucleotide primer 420 is attached to a second linker containing a terminal biotin moiety 410B. Binding of primer-template complex 425 (in this depiction showing polymerase-mediated Xpandomer synthesis) to the support is mediated by streptavidin moiety 430. Linker moieties disclosed herein can be of sufficient length to link the oligonucleotide to the support so that the support does not significantly interfere with overall binding and recognition of the oligonucleotide by a complementary oligonucleotide or nucleic acid replication enzyme. Accordingly, the linker can also include a spacer unit. The spacer may, for example, separate the oligonucleotide from a cleavage site or label.

[0115] Alternatively, the embodiment shown in Figure 4B illustrates the immobilization of a primer-template complex 425 to a solid support (i.e., "substrate") 400 by covalently linking the primer to the substrate via a Click reaction. In this embodiment, the covalent linkage is mediated by a maleimide-PEG-alkyne linker 423 crosslinked to the solid support. The alkyne moiety 429 provided by the end of the linker distal to the substrate can react with an azide group 435 provided by the 5' end of the primer. The ability to utilize simple Click chemistry to immobilize nucleic acids on a substrate offers advantages over traditional solid-state nucleic acid synthesis protocols. For example, nucleic acids can be pre-synthesized (e.g., chemically or enzymatically) and purified prior to Click conjugation. Furthermore, combinations of different oligonucleotides can be immobilized on a single support. Multiple configurations of oligonucleotide structures bound to a solid support are contemplated by the present invention. Figure 4C illustrates how dendrimers of primer-template complexes can be formed on a support by Click chemistry, as discussed herein.

[0116] Any suitable linker providing a maleimide moiety at one end and an alkyne moiety at the second end can be used in accordance with the present invention. The chemical chain between the two reactive groups of the linker may be referred to herein as a "spacer arm." The length of the spacer arm will determine how flexible the conjugate is and can be optimized for a particular application. Typically, the spacer arm comprises a hydrocarbon chain or a polyethylene glycol (PEG) chain. Figure 4D shows an exemplary maleimide-PEG-alkyne linker 423, propargyl-PEG4-maleimide, providing an alkyne moiety 429 and a maleimide moiety 427. Figure 4E shows how an extended oligonucleotide linked to a terminal azide moiety at its 5' end can be immobilized on a solid support via a click reaction to generate a covalent bond. In this embodiment, the solid support is functionalized by crosslinking a linker comprising a terminal maleimide moiety at the end proximal to the support and a terminal alkyne group at the end distal to the support.

[0117] According to the present invention, maleimide moieties can be converted into reactive groups and then crosslinked to solid surfaces, such as polyolefin surfaces, via a catalyst-free photochemical (e.g., photoinitiated) proton abstraction reaction. This reaction simplifies the initiation step on which conventional conjugation methodologies rely. Conventional crosslinking techniques teach that maleimide chemical groups are sulfhydryl-reactive targeting (-SH) functional groups. However, the present inventors have discovered that maleimide groups can advantageously be crosslinked to rigid polyolefin substrates after activation via a proton abstraction reaction. Importantly, maleimide-mediated crosslinks have been found to be stable under acidic conditions as well as during click reactions. Suitable polyolefin surfaces include, but are not limited to, substrates made from polypropylene or cyclic olefin copolymers (COC).

[0118] To functionalize a substrate, e.g., a COC chip, with an alkyne moiety, an exemplary catalyst-free photochemical proton abstraction reaction can include: 1) priming the chip with an organic solvent such as DMSO or DMF; 2) adding a linker having a maleimide moiety at one end, e.g., propargylmaleimide, solubilized in, e.g., DMSO and water; 3) incubating the chip under a UV lamp; 3) washing the chip with a series of solvents, which in certain embodiments can include DMSO, DMF, and solutions of NaHPO, Tween-20, and SDS; and 4) washing the chip with an aqueous solution, such as water and / or PBS, prior to the click reaction.

[0119] Although these embodiments show the 5' end of the extended oligonucleotide, i.e., the primer, linked to the support, it should be understood that in alternative embodiments, the surface chemistry can be adapted to link the 3' of the oligonucleotide to the support, for example, the terminal oligonucleotide of a terminal cap structure discussed further herein (or the 5' end of an oligonucleotide having a sequence that is the reverse complement of the terminal oligonucleotide).

[0120] In certain embodiments, the link between the oligonucleotide and the solid support is cleavable, allowing the primer extension product to be released from the support after synthesis. Cleavable linkers and methods for cleaving such linkers are known and can be used in the provided method using the knowledge of those skilled in the art. For example, the cleavable linker can be cleaved by an enzyme, a catalyst, a chemical compound, temperature, electromagnetic radiation, or light. Optionally, the cleavable linker includes a moiety that can be hydrolyzed by beta-elimination, a moiety that can be cleaved by acid hydrolysis, an enzymatically cleavable moiety, or a photocleavable moiety. In some embodiments, a suitable cleavable moiety is a photocleavable (PC) spacer or linker phosphoramidite available from Glen Research.

[0121] The inventors have found that solid-state synthesis and processing of Xpandomer advantageously allows for the optimization of many steps in the workflow to yield nanopore sequence reads of over 400 bases. In certain embodiments, solid-state synthesis can be performed using acid-resistant magnetic beads as a support. The bead structure's geometry offers several advantages, including favorable template binding and rapid in-solution reaction kinetics, increased surface area, and magnetic collection. The acid resistance of the beads makes them a particularly suitable support for the Xpandomer processing reaction. One embodiment of a method for preparing acid-resistant magnetic beads for Xpandomer synthesis is shown in Figure 5. Here, acid-resistant magnetic beads 510 (e.g., TurboBeads® Peg Amine) are functionalized with linker 520 to generate functionalized beads 530, providing terminal alkyne groups. The beads can be functionalized using any form of amine-based coupling or chemical condensation. In one embodiment, the beads can be functionalized by NHS-ester linkage with amines provided by the surface of the beads. By click chemistry, an extended oligonucleotide ("E-oligo") 540 bearing a 5' azide moiety is covalently attached to a functionalized bead 530 to generate a support-bound E-oligo 550. The E-oligo bound to can hybridize to a single-stranded template 560, for example, for a primer extension reaction to generate an Xpandomer copy of the template. Advantageously, the subsequent Xpandomer processing step, involving acid-mediated cleavage of the phosphoramidate bond, can be performed on the same bead support.

[0122] End-capping

[0123] In this embodiment, a single-stranded copy of a nucleic acid template is operably linked (e.g., connected or attached) at its 3' to 5' end to an oligonucleotide "cap" that specifically hybridizes to a portion of the template. Ligation of the single-stranded copy to the oligonucleotide cap is mediated by a nucleic acid polymerase upon reaching the 5' end of the oligonucleotide cap during template-dependent ligation. The oligonucleotide cap is alternatively referred to herein as an "end cap," "capped blocker oligonucleotide," or "end tag." The end cap functions as a molecular tag for identifying and / or isolating a copy of the nucleic acid template having a defined length from a heterogeneous population of products that may include copies of undesired lengths, such as incomplete or truncated products.

[0124] In alternative embodiments, the template nucleic acid can be a DNA molecule or an RNA molecule. An end cap can be designed to hybridize to any portion of the template nucleic acid (i.e., to an "end cap target sequence") to selectively modify, e.g., "tag," a copy of a region of the template having a defined or desired length, i.e., "target sequence." In some embodiments, the end cap is designed to hybridize to a sequence near the 5' end of the target sequence to "tag" a complete or near-complete copy of the target sequence. In some embodiments, the end cap target sequence is part of the native nucleic acid sequence of the template nucleic acid. In other embodiments, the end cap target sequence is a heterologous sequence (e.g., an adapter or linker) that is linked or connected to the template nucleic acid.

[0125] In certain embodiments, the copies of the single-stranded nucleic acid template are Xpandomers, and the end caps are designed to hybridize to the 5' ends of the library fragments of the template DNA. Advantageously, the population of Xpandomer products, enriched for full-length copies of the library fragments, provides improved sequence information or "reads" from the nanopore-based sequencing systems of the invention.

[0126] One embodiment of an end-capping strategy is outlined in simplified form in Figure 6A. In this embodiment, end-capping allows for selective tagging of Xpandomer copies of a DNA target sequence, represented herein by target sequence template 610. Xpandomers are synthesized by a primer extension reaction initiated from an oligonucleotide primer 620 (i.e., an extension or "E-oligo") hybridized to a single-stranded template using an appropriate DNA polymerase, XNTP substrates, and other extension reagents and additives. The inventors have discovered that mutants of DPO4 polymerase can utilize XNTPs as substrates to synthesize Xpandomers in a template-dependent manner, particularly when the primer extension reaction includes one or more PEM additives (PEM additives are described, for example, in applicant's pending patent application PCT / US18 / 67763, entitled "Enhancement of Nucleic Acid Polymerization by Aromatic Compounds," which is incorporated herein by reference in its entirety). The primer extension products can be visualized by gel electrophoresis if the oligonucleotide incorporated into the extension product is linked to a detectable dye 630 .

[0127] The general features of one embodiment of the end cap structure are shown in Figure 6A, outline number 4. In this embodiment, the end cap 640 is complementary to a sequence near the 5' end of the target sequence template. and specifically hybridizes to a terminal oligonucleotide 645 (which may be referred to herein as a "blocker" oligonucleotide). The terminal cap also contains a 5' triphosphate group 647 attached to a dideoxyribonucleoside analog (i.e., the "cap") that can be utilized as a substrate by a DNA polymerase. During a primer extension reaction, e.g., an Xpandomer synthesis reaction, a DNA polymerase synthesizes an extending Xpandomer from the attached extension oligonucleotide in a template-dependent manner. Upon reaching the end of the template, the DNA polymerase encounters the terminal cap and ligates the 5' end of the terminal oligonucleotide to the 3' end of the Xpandomer by forming a phosphodiester bond between the triphosphate group of the cap and the 3' end XNMP of the Xpandomer, as shown in the fifth schematic. In contrast, a terminal oligonucleotide lacking a free 5' triphosphate group cannot be ligated to an Xpandomer by a DNA polymerase, as shown for oligonucleotide 645 in the third schematic in Figure 6A.

[0128] In certain embodiments, the terminal caps can be linked to a detectable dye 630 to visualize the terminally capped copies of the target sequence, for example, by gel electrophoresis. Figure 6B shows an exemplary gel in which Xpandomer copies of a 100-mer template are labeled with either the terminal cap (lanes 1-4, corresponding to the fourth schematic diagram in Figure 6A) or the primer (lanes 5-8, corresponding to the first schematic diagram in Figure 6A). End-capping depends on the availability of a 5' nucleoside triphosphate group attached to the terminal oligonucleotide, as demonstrated by the lack of fluorescent signal when a primer extension reaction is performed using a blocker oligonucleotide 645 lacking a free 5' triphosphate group (corresponding to the second and third schematic diagrams in Figure 6A, data not shown).

[0129] In some embodiments, as described in further detail herein, an end cap or an oligonucleotide complementary to the terminal oligonucleotide of the end cap can be linked to a solid support to allow for isolation or purification (e.g., "capture") of the full-length Xpandomer product.

[0130] Terminal or "blocker" oligonucleotides are designed to hybridize strongly with terminally capped target sequences in template nucleic acids. Characteristics such as the length of the oligonucleotide and / or the chemical structure of one or more nucleotide monomers of the oligonucleotide can be optimized to achieve the desired hybridization strength. Generally speaking, the melting temperature of the terminal oligonucleotide-target sequence template will be at least 37°C for optimal hybridization, although lower melting temperatures are possible. In certain embodiments, the length of the terminal oligonucleotide is about 10 to about 30 nucleotides. In some embodiments, nucleotide analogs, such as one or more 2'-methoxyribonucleotides, LNAs (i.e., "locked" nucleic acid analogs), or G-clamps, are incorporated into the terminal oligonucleotide to enhance binding efficiency. In one embodiment, substantially all of the terminal nucleotides are 2'-methoxyribonucleotides.

[0131] Specific features of exemplary terminal cap structures are detailed in Figures 7A-7D. Figures 7A and 7B show a terminal oligonucleotide (SEQ ID NO: 2) 700 in which the 5' end of the oligonucleotide is linked to a flexible linker 710. The flexible linker includes a terminal azide moiety 720 that provides a substrate for a click reaction, allowing covalent attachment to a modified 5' nucleoside triphosphate cap (i.e., "cap"), as further described with reference to Figure 7C. Exemplary embodiments of flexible linkers 710A and 710B attached to the 5' end of a 23-mer terminal oligonucleotide 700 are shown in Figures 7A and 7B, respectively. The flexible linker can be, for example, an inert linear polymer composed of alkyl and / or PEG moieties of appropriate length. In one embodiment, the flexible linker is formed from a C6 bromohexylphosphoramidite. In some embodiments, the oligonucleotide The 5' end of may contain one or more G-clamp nucleotide analogs.

[0132] In an exemplary method of synthesis, the terminal oligonucleotide is synthesized by conventional automated phosphoramidite chemistry, in which the 5'-hydroxyl of the completed oligonucleotide is coupled to bromohexyl phosphoramidite (e.g., available from Glen Research). The solid support is treated with sodium azide to convert the bromo group to an azide. Finally, the oligonucleotide is deprotected and cleaved from the solid support to yield the azide oligonucleotide, as shown in Figure 7B.

[0133] Figure 7C shows one embodiment of a modified 5' nucleoside triphosphate cap 740, referred to herein as "ddNTP-O" (represented in this depiction by ddCTP-0). The heterocyclic portion of the cap is modified with a terminal alkyne moiety 745 linked via an octadiyne arm 747 to mediate attachment to the azide of a terminal oligonucleotide via a Click reaction. In certain embodiments, the resulting terminal-capped alkynyl nucleoside triphosphate (i.e., cap 740) can base-pair with a template at the 5' end of a terminal oligonucleotide. The alkynyl nucleoside triphosphate cap can be synthesized using methods described by Ludwig and Eckstein or other methods for 5'-triphosphate synthesis; see, e.g., A.R. Kore, A.R., Srinivasan B., Recent Advances in the Syntheses of Nucleoside Triphosphates, Current Organic Synthesis, 10(6), 903-34 (2013), which is incorporated herein by reference in its entirety.

[0134] Figure 7D shows one embodiment of a complete terminal cap structure 780 formed by a click reaction operatively linking a triphosphate cap 740 (i.e., an alkynyl nucleoside triphosphate cap) to a terminal oligonucleotide (SEQ ID NO: 2) 700. Without being bound by theory, it is hypothesized that the terminal cap's flexible linker 710B provides sufficient steric flexibility or freedom to the structure so that the triphosphate group 750 can enter the active site of a DNA polymerase and serve as a substrate for phosphodiester bond formation between the terminal cap and the 3' end of the Xpandomer during a primer extension reaction. A mutant of DPO4 DNA polymerase is particularly well suited for attaching a terminal cap structure to the 3' end of the Xpandomer.

[0135] Certain embodiments of the present invention contemplate alternative terminal cap structures and means for attaching a terminal oligonucleotide to the 3' end of an Xpandomer. In one embodiment, a psoralen cross-linking method is utilized. Briefly, the 5' end of a terminal oligonucleotide is modified to display a psoralen moiety, which, upon exposure to ultraviolet (UVA) radiation, can form a monoadduct with thymine and a covalent interstrand cross-link (ICL). Thus, upon exposure to UVA radiation, a psoralen-modified terminal oligonucleotide can be chemically cross-linked to the 3' thymine in an Xpandomer. Advantageously, the psoralen cross-link is resistant to acid cleavage.

[0136] In other embodiments, the psoralen-modified terminal oligonucleotide may include other features to enable binding to and release from a solid substrate. For example, the 3' end of the oligonucleotide may include a linker nucleic acid sequence containing a cleavage site for a nuclease enzyme. In some embodiments, the cleavage site is recognized and cleaved by an RNase. Any suitable RNase recognition site may be used, for example, for RNase A, RNase H, or RNase T1. In other embodiments, the cleavage site is recognized and cleaved by a nicking endonuclease or trypsin. When bound to a solid support via the 3' end of the linker, the terminal oligonucleotide can be selectively released by enzymatic treatment with an appropriate nuclease.

[0137] Terminal tagging

[0138] As an alternative strategy to end-capping, we have devised compositions and methods for operably linking (e.g., ligating or covalently binding) a leader sequence to the 3' end of an Xpandomer after synthesis. In this way, only substantially full-length Xpandomers will contain the 3' leader sequence, which is necessary for passing the Xpandomer through a nanopore sensor. In one embodiment, the end-tag structure is essentially a modified Xpandomer in which the reporter code element is replaced by a leader and enhancer element and the translocation control element is replaced by a poly-G oligomer. Both the phosphoramidate linkage and the poly-G oligomer element of the end-tag are acid-labile. Thus, upon acid treatment, the 5' half of the end-tag will remain associated with the Xpandomer containing one of the leader and enhancer elements. This allows the Xpandomer to penetrate the nanopore from the 3' end.

[0139] In one embodiment, a method for end-tagging an Xpandomer can include: 1) performing solid-state Xpandomer synthesis in which the substrate-bound extension oligonucleotides lack leader and enhancer sequences; 2) performing an extension reaction for a period of time sufficient to provide a population of substantially full-length Xpandomer products; 3) washing the substrate-bound products to remove all extension reagents; and 4) adding to the substrate a terminal tag structure and other reaction components required for polymerase-mediated attachment of the terminal tag to the 3' end of the Xpandomer. In some embodiments, the method can include hybridizing a terminal blocker nucleotide to the template before the extension reaction, and removing the terminal blocker nucleotide after the extension and before the washing and terminal tagging reaction.

[0140] B. Solid-state synthesis by end-capping

[0141] The end-capping methodology described herein can be integrated into a solid-state Xpandomer synthesis workflow using any suitable support platform known in the art. In certain embodiments, the solid support may be a conventional bead, a tube, a capillary, or a microfluidic chip. In one embodiment, the solid support is an acid-resistant magnetic bead. As discussed further herein, in some embodiments of the present invention, an oligonucleotide primer can be attached to the support. In other embodiments, the terminal oligonucleotide of the end cap, or its reverse complement, can be attached to the support.

[0142] Xpandomer synthesis workflow off support (AFS)

[0143] In this embodiment, Xpandomer synthesis initiates from a support-bound primer-template complex and extends away from the support toward an end-cap structure hybridized to the opposite (i.e., 3') end of the template. The initial configuration of the AFS model is shown in Figure 8A, with each of the three schematic diagrams showing identical features. In this embodiment, the 5' end of an oligonucleotide primer 810 is attached to a solid support 820 by a linker 830. A single-stranded template 840 hybridizes to the primer via standard hydrogen bonding. Similarly, an end-cap oligonucleotide 850 hybridizes to the 5' end of the template via standard hydrogen bonding, providing a free 5' triphosphate group 855. The directionality of nucleic acid polymerization (i.e., Xpandomer synthesis) is indicated by an arrow.

[0144] An exemplary product of an Xpandomer synthesis reaction starting with primer 810 is shown in Figure 8B. The top and middle schematics show a full-length Xpandomer copy 870 covalently attached to primer 810 and hybridized to template 840 by hydrogen bonding. The Xpandomer product is also covalently linked via a phosphodiester bond to an end-cap oligonucleotide 850. The schematic below depicts an incomplete Xpandomer copy 860 that remains covalently attached to the primer but, importantly, is not ligated to an end-cap oligonucleotide 850.

[0145] As discussed elsewhere herein, after synthesis, the Xpandomer is treated with acid to transition it from the constrained form shown in Figure 8B to the extended, linearized form shown in Figure 8C. Here, template 840 is shown dissociated from the support-bound Xpandomer. The top schematic shows linearized, full-length Xpandomer 875 still covalently attached to solid support 820 and end-cap oligonucleotide 850. The middle schematic shows an alternative result to acid treatment, in which the full-length Xpandomer is cleaved to generate linearized fragments 865A and 869. Fragment 865A remains tethered to the solid support, while fragment 869 is released from the support into solution. The bottom schematic shows linearized Xpandomer fragment 865B, also bound to the solid support. Figure 8D shows that after washing, full-length linearized Xpandomer 875 and linearized fragments 865A and 865B remain bound to the solid support. Importantly, only the full-length Xpandomer 875 is linked to the end-cap oligonucleotide 850.

[0146] Figure 8E illustrates how end-cap oligonucleotide 850 can be used as a molecular tag to isolate or "locate" full-length Xpandomer products from a heterogeneous population containing incomplete fragments. The Xpandomer products, which remain bound to the initial support as shown in Figure 8D, are released from the support by photolysis. As described elsewhere herein, the linkage between the oligonucleotide primer and the initial solid support is designed to be photosensitive. Released Xpandomers 865 and 875 remain covalently linked to oligonucleotide primer 810, while full-length Xpandomer 875 remains covalently linked to end-cap oligonucleotide 850. To isolate full-length Xpandomer, the sample is contacted with a second solid support 890 conjugated to oligonucleotide 880, the reverse complement of end-cap oligonucleotide 850. As shown in the figure, only full-length Xpandomer 875 will bind to the solid support via hydrogen bonds between oligonucleotides 850 and 880. As shown in Figure 8F, all incomplete Xpandomer products are washed from the solid support, leaving isolated full-length Xpandomer 875, which can then be eluted from the support and used, for example, for single-molecule nanopore sequencing. In this embodiment, the extended oligonucleotide contains features necessary for nanopore localization and translocation (e.g., leader and concentrator elements).

[0147] In an alternative embodiment, the end-cap oligonucleotide is modified to contain leader and concentrator features for nanopore threading, while the extension oligonucleotide lacks these features. In this embodiment, only the full-length extension product will be ligated to the leader and concentrator elements and thus can be translocated through the nanopore to generate sequence information.

[0148] In another embodiment, the extended oligonucleotide structure is modified to include leader and concentrator features for nanopore threading, while the end-capped oligonucleotide lacks these features. In this embodiment, Xpandomer synthesis and end-capping reactions may be performed in solution. After Xpandomer synthesis, the end-capped product may be purified by contacting the sample with oligonucleotides immobilized on a beaded support, e.g., by biotin-streptavidin chemistry, where the oligonucleotide contains a sequence that is the reverse complement of a portion of the sequence of the end-capped oligonucleotide. In this way, only Xpandomer products containing both an extended oligonucleotide structure (which provides leader and concentrator features) and an end cap will penetrate the nanopore sensor and provide sequence information.

[0149] Towards a Support (TS) Xpandomer Synthesis Workflow

[0150] In an alternative embodiment of the invention, the terminal oligonucleotide of the terminal cap structure is covalently linked to the substrate. In this embodiment, Xpandomer synthesis is initiated from a primer-template complex hybridized to the terminal oligonucleotide of the terminal cap structure, and Xpandomer synthesis is directed toward the support. The initial configuration of the TS model is shown in Figure 9A, where each of the two support-bound terminal caps 980 exhibits identical features. In this embodiment, the 3' end of the terminal oligonucleotide 950 is attached to the solid support 920 by a photocleavable linker 930. The terminal cap 980 provides a free 5' triphosphate 955.

[0151] The sequence of the terminal oligonucleotide of the end cap is designed to be the reverse complement of the sequence at the 5' end of the single-stranded target nucleic acid template. Figure 9B shows the association between the 5' end of the target nucleic acid template 940 and the terminal oligonucleotide of the end cap by standard base pairing. In this embodiment, the extension oligonucleotide 910 hybridizes to a complementary sequence at the 3' end of the template. Xpandomer synthesis initiates from the 3' end of the primer 910 and proceeds toward the support-bound end cap. The directionality of nucleic acid polymerization (i.e., Xpandomer synthesis) in this model is indicated by an arrow.

[0152] Exemplary products of an Xpandomer synthesis reaction starting from primer 910 are shown in Figure 9C. The top schematic shows a full-length Xpandomer copy 970 covalently attached via a phosphodiester bond to primer 910 and an end-cap oligonucleotide 950. The bottom schematic depicts an incomplete Xpandomer copy 960 that remains covalently attached to the primer but, importantly, is not ligated to the end-cap oligonucleotide 950.

[0153] As discussed elsewhere herein, after synthesis, the Xpandomer is treated with acid to transition it from the constrained form shown in Figure 9C to the extended, linearized form shown in Figure 9D. Here, the template 840 and incomplete Xpandomer 960 have dissociated from the support and been washed away from the bound material. The top schematic shows the linearized, full-length Xpandomer 975 covalently attached to the solid support 920 by the end-capped terminal oligonucleotide 950. Importantly, only the full-length Xpandomer copy remains attached to the solid support. These can then be released by light-mediated cleavage of the photocleavable moiety 930 and used for nanopore sequencing.

[0154] In some situations, for example, if a DNA polymerase binds a terminal cap structure to an incomplete copy of the template earlier than normal, a cleaved by-product may form during the end-capping process. This phenomenon is referred to herein as "short-circuiting" of the polymerase. To prevent short-circuiting, the inventors have devised several strategies to delay the incorporation of the terminal cap structure into the Xpandomer, thereby promoting the synthesis of a substantially full-length copy of the template. In one embodiment, outlined in Figure 10A, a blocker nucleotide 1010 hybridizes to a region near the 3' end of the single-stranded template 1020. The blocker oligonucleotide is designed to prevent incorporation into the growing Xpandomer by the DNA polymerase. In some embodiments, the 5' end of the blocker oligonucleotide lacks a 5' triphosphate group and therefore cannot be ligated to the 3' end of the Xpandomer. Therefore, when the polymerase reaches the blocker oligonucleotide, extension of oligonucleotide 1030 stops. At this point, the blocker oligonucleotide can be removed from the template, for example by thermal melting, and replaced with an end-cap oligonucleotide 1040 that can be ligated by a DNA polymerase to a substantially full-length Xpandomer 1050. An appropriate melting temperature can be calculated that results in dissociation of the short blocker oligonucleotide without affecting hybridization of the longer Xpandomer to the template.

[0155] In another embodiment, as shown in Figure 10B, the blocker oligonucleotide 1015 is designed to provide a 5' phosphate group. As described above, DNA polymerase cannot incorporate the blocker oligonucleotide into the growing Xpandomer, and therefore synthesis stops when the polymerase encounters the blocker. In this embodiment, the blocker can be removed, for example, by exonuclease-mediated digestion. After exonuclease treatment, the end-cap oligonucleotide 1040 hybridizes to the template and is ligated by the DNA polymerase to form a substantially full-length Xpandomer 1050.

[0156] C. Library of mirror-imaged Xpandomers constructed with end-capping

[0157] This generalized embodiment describes novel methods and nucleic acid compositions that can be used to generate libraries of template constructs, in which each individual construct incorporates two single-stranded copies of the same strand of a nucleic acid target sequence (i.e., template) linked in tandem by an oligonucleotide-based linker. Such libraries of template constructs are referred to herein as "mirrored libraries." The mirrored libraries provide templates for novel Xpandomer synthesis protocols that employ the end-capping strategies disclosed herein. Briefly, a single Xpandomer polymer is synthesized from each of the template constructs to generate an Xpandomer product containing two copies of the same strand of the target operably linked by covalent bonds to a cap-branching agent structure. Each of the two copies of the target sequence is linked to the cap-branching agent structure during synthesis using the end-capping methodology described herein. Advantageously, the Xpandomers synthesized from the mirrored library constructs provide two sequence reads of a single target sequence as they pass through a nanopore. Differences between the sequences of the first and second reads indicate potential sequencing errors and can be excluded or subjected to some method of quality scoring or discrepancy resolution.

[0158] Mirrored library template constructs are generated by a series of enzymatic reactions, each of which creates a distinctive precursor construct. Figure 11A shows the basic structural features of one embodiment 1100 of a mirrored library template construct precursor, referred to as "M1." The M1 precursor is formed by operatively linking (i.e., linking or joining by the formation of a covalent bond) a Y adaptor construct 1110, a library fragment 1120, and a cap primer adaptor construct (referred to herein as a "trident") 1130. In this embodiment, the Y adaptor 1110 comprises a 3' to 5' oligonucleotide strand 1111 and a 5' to 3' oligonucleotide strand 1113, conventionally referred to herein as the "minus" and "plus" strands, respectively. The adaptor strands 1111 and 1113 specifically hybridize at the portion of the "base" of the Y adaptor proximal to the library fragment, while the "arm" portion distal to the library fragment remains single-stranded. A portion of the double-stranded base of the Y adaptor can be ligated to the library fragment. In this embodiment, the 3' end of the adapter strand 1113 has an unpaired nucleotide, represented here by a free "T," which can base pair with a free nucleotide provided by the library fragment to facilitate ligation. The arms of the Y adapter provide the binding site for the oligonucleotide primer (i.e., extension oligo) used in later steps of Xpandomer synthesis. The Y adaptor strands can be engineered to provide several useful features for the mirrored library workflow, including a 5′ nucleotide substrate, such as a nucleotide sequence. In some embodiments, the terminus of the single-stranded region of one or both strands of the Y adaptor strands provides an azide group, which allows for immobilization of the Y adaptor to a functionalized solid support via a click reaction, as described herein. In other embodiments, one or both strands of the Y adaptor may contain a selectively cleavable element, which allows, for example, release of the construct from the solid support. In some embodiments, the minus strand 1111 is linked to a solid support, and the plus strand 1113 provides a 5′ nucleotide substrate for exonuclease digestion, as further described herein.

[0159] Library fragments 1120, in one embodiment, are double-stranded nucleic acids with 5' phosphate termini and 3' nucleotide overhangs on both strands, which can be generated by art-recognized techniques. Library fragments, also referred to herein as "nucleic acid target sequences," are targets for sequencing by SBX. Library fragments include a "plus" strand 1120A and a "minus" strand 1120B. In some embodiments, the 3' end of the minus strand can provide an unpaired nucleotide (represented here by a free "A") that base pairs with the unpaired nucleotide at the 3' end of adapter strand 1113. In other embodiments, the 3' end of the plus strand also provides an unpaired nucleotide (represented here by a free "T") to facilitate ligation to cap primer adapter 1130. Library fragments can include known or unknown sequences. For SBX, library fragments can be up to about 50, 100, 200, 500, or 1000 base pairs in length. In some embodiments, library fragments are about 100 to about 200 base pairs in length.

[0160] Cap primer adaptor construct 1130 comprises three oligonucleotide strands 1131A, 1133, and 1131B operably linked by a chemical branching agent. The sequences of strands 1131B and 1133 are complementary and can hybridize. The sequence of strand 1131A is identical to that of 1131B, and this strand can remain single-stranded within cap primer adaptor 1130 (or optionally hybridize to strand 1133). In some embodiments, the 3' end of strand 1131B provides an unpaired nucleotide (represented here by a free "A") that base pairs with the unpaired nucleotide at the 3' end of plus strand 1120A of the library fragment.

[0161] Cap primer adapters can be generated by standard automated phosphoramidite-based oligonucleotide synthesis. In some embodiments, strand 1133 is first synthesized in the 5' to 3' direction, followed by the incorporation of a symmetric chemical branching agent (e.g., Chemgenes CLP-5215) to allow for simultaneous 5' to 3' synthesis of strands 1131A and 1131B. In some embodiments, the incorporation of a standard hydrophilic spacer (e.g., a PEG6 spacer) between the branching agent and the 5' ends of strands 1131A and 1131B provides a flexible linker that allows these strands to fold back onto strand 1133 to form the characteristic "three-pronged" structure of the cap primer adapter. The length and composition of both the oligonucleotide and branching agent components of the cap primer adapter can be optimized for specific applications. In certain embodiments, the oligonucleotide is approximately 15-25 nucleotides in length, allowing for efficient hybridization with cap branch constructs, as described below.

[0162] The mirrored library template construct can be formed in solution or on a solid support. In one embodiment, the mirrored library template construct is formed on a solid support by first generating an M1 precursor according to the following exemplary steps: 1) Y adapter strand 1111 is immobilized on a functionalized solid support (e.g., a microfluidic chip or bead) using a click reaction, and then Y adapter strand 1113 specifically hybridizes to adapter strand 1111. 2) Cap primer adapter 1130 is attached to plus strand 1120A. to the 5' end of strand 1133 and ligation of the 5' end of the minus strand of 1120B to the 3' end of fragment 1131A. 3) The ligated library fragment-cap primer adaptor structure is then attached to a support by enzymatic ligation to the end of one of the double stranded portions of Y adaptor 1110.

[0163] M1 mirrored library template construct precursor 1100 provides the substrate for forming the final mirrored library template construct, designated "M3" 1150, shown in FIG. 11B. In one embodiment, template construct 1150 can be generated by two enzymatic steps: a first DNA polymerization step that generates the complement of plus strand 1120A, followed by a second exonuclease step that removes this same plus strand. During the first step, cap primer adapter strand 1131A is extended from its 3' end in the direction indicated by the arrow by a DNA polymerase, e.g., a strand-displacing thermostable polymerase, using strand 1120A as a template. This generates a triple-stranded structure, designated herein as template construct precursor "M2" 1140. The M2 precursor contains a daughter strand 1120C that has the same sequence as minus strand 1120B. During the second step, the central oligonucleotide strand of the M2 precursor is enzymatically removed by exonuclease digestion starting from the 5' end of the Y adapter strand 1113, which provides the 5' phosphate substrate for the exonuclease. Thus, the entire original plus strand 1120A is removed, as well as the capped primer adapter strand 1133. The resulting product is a mirrored library template construct "M3" 1150, which contains two identical copies 1120B and 1120C of the original minus strand of the library fragment, linked by strands 1131A and 1131B of the capped primer adapter, which remain ligated together. The M3 mirrored library construct 1150 can be used as a template to synthesize a single Xpandomer containing two copies of the same strand of the library fragment 1120.

[0164] As discussed herein, the M3 construct serves as a template for the synthesis of Xpandomers, each of which contains two copies of the same strand of a target sequence for nanopore sequencing, i.e., sequencing by extension (SBX). In some embodiments, SBX of the mirrored library construct is performed on a solid support and uses the end-capping protocol described herein. In this embodiment, shown in Figure 11C, the 5' ends of extension oligonucleotides 1170 and 1180 are linked to solid support 1190 by click chemistry, as described herein. In these embodiments, the extension oligonucleotides contain a 5' azido group to mediate click binding. In other embodiments, only one extension oligonucleotide is linked to the support, while the other extension oligonucleotide contains a leader sequence for threading through the nanopore. Each extension oligonucleotide is designed to specifically hybridize with one of the single-stranded portions of the Y adaptor element of the M3 template construct. In certain embodiments, the extension oligonucleotides may contain a photocleavable or acid-cleavable element interposed between the solid support and the 5' end of the oligonucleotide sequence, allowing for light- or acid-mediated release of the final Xpandomer product from the substrate. The M3 template construct 1150 hybridizes to the immobilized extension oligonucleotides 1170 and 1180 via standard hybridization between complementary sequences in the extension oligonucleotides and the arms of the Y adaptor of the M3 construct. The cap branch construct 1195 hybridizes to the M3 construct. The cap branch construct 1195 contains two identical oligonucleotides 1197A and 1197B that are complementary to and hybridize to the 5' ends of both strands of the mirrored library construct 1150. The terminal oligonucleotide arms 1197A and 1197B each provide a free 5' triphosphate group. The capped branching agent structure can be synthesized by conventional phosphoramidite chemistry where the two strands 1197A and 1197B are linked by a chemical branching agent.

[0165] 12 shows further details of the structural features of the capped branching agent. In this embodiment, the capped branching agent 1295 comprises a branching agent structure 1220 and a terminal branching group containing a triazole moiety ("R"). The branching agent comprises oligonucleotide arms 1230A and 1230B, a terminal cap ("ddCTP"), and an oligonucleotide (SEQ ID NO: 3). The capped branching agent is synthesized by standard phosphoramidite chemistry starting from the 3'-terminal moiety, exemplified herein by a PEG6 polymer. A symmetric chemical branching agent is added to the 5'-end of the terminal moiety to allow for parallel synthesis of a branching agent spacer, exemplified herein by a PEG6 polymer. In some embodiments, the length and composition of the spacer can be optimized for a particular application. In certain embodiments, the spacer may comprise a C2, C6, or PEG3 monomer. The terminal oligonucleotide arms 1230A and 1230B extend from the 5'-end of the branching agent arm. The sequence of the terminal oligonucleotide is designed to hybridize to the 5'-end of the M3 template construct, and its sequence is provided by the cap primer adapter. In some embodiments, the terminal oligonucleotide is about 15 to about 50 nucleotides in length and contains one or more methoxynucleotide analogs. The 5' end of the terminal oligonucleotide is linked to a terminal cap structure, exemplified herein by ddCTP (although any other nucleobase may be substituted in certain embodiments), thereby enabling attachment of the nascent Xpandomer to the terminal oligonucleotide via end-capping. Details of the end-capping method are discussed herein with reference to Figures 7A-7D. The end-cap is attached to the terminal oligonucleotide via a triazole moiety ("R"), which is the product of a click reaction between an alkyne moiety provided by the terminal cap and an azide moiety provided by the terminal oligonucleotide. In some embodiments, the cap branching agent is designed to include other linker structures, such as a spermine polymer, positioned between the terminal cap and the terminal oligonucleotide, for example, to provide increased steric flexibility and attachment to the terminal cap.

[0166] Continuing with reference to FIG. 11C, an Xpandomer synthesis reaction is performed, which initiates at the 3' ends of extender oligonucleotides 1170 and 1180, proceeds in the same direction (as indicated by the arrows), and terminates at the 5' ends of terminal oligonucleotides 1197A and 1197B of cap branching agent 1195, upon which a polymerase attaches complete Xpandomer copies 1199A and 1199B to the cap branching agent according to the end-capping method described herein. In one embodiment, the first extender oligonucleotide contains a photocleavable linker element, and the second extender oligonucleotide contains an acid-labile linker element. Acid treatment of the Xpandomer will simultaneously transition the Xpandomer copies from the "constrained" to the "open" configuration 1000 and cleave the acid-labile linker in the extender oligonucleotide. The resulting product, containing two linked Xpandomers 1199A and 1199B of the library fragment, can then be removed from the support by photolysis of the photocleavable linker of the second extender oligonucleotide. In some embodiments, a final purification step is performed in which the released mirror-image Xpandomer 1000 is hybridized to an oligonucleotide complementary to one of the extended oligonucleotides bound to a second solid support.

[0167] The reaction conditions for generating the M1, M2, and M3 mirror-imaged library constructs and SBX for synthesizing Xpandomers can be optimized by trial and error. In some embodiments, these constructs can be generated by the following workflow outlined in Figure 13. In step 1, the M1 precursor is generated by ligation of a Y adaptor, library insert, and Trident. The molar ratio of YAD1:YAD2:insert:Trident can be optimized for specific conditions or applications. In some embodiments, the M1 precursor can be generated on a microfluidic chip by first assembling the Y adaptor on an alkyne-functionalized chip. In one embodiment, the first Y adaptor strand, which provides a terminal azide group, is coupled to the functionalized chip by click chemistry according to the following exemplary protocol: 1) 3.0 mM THPTA, 6.0 mM sodium ascorbate, 1 mM CuSO4, 5.0 mM aminoguanidine 1) Prepare a catalyst mixture containing 10% DMF or DMSO, and a substrate mixture containing 10% DMF or DMSO, 25 mM sodium phosphate, pH 7.0, 1 μM azide-Y adapter oligonucleotide strand 1, 2.5 mM MgCl2, 5 mM aminoguanidine, and 6.0 mM sodium ascorbate. 2) Add 11 μl of the catalyst mixture to 44 μl of the substrate mixture, and add 50 μl of this reaction mixture to an alkyne-functionalized microfluidic chip, such as a COC chip, and incubate at room temperature for 20 minutes. 3) Wash the chip with 300 μl of Solution I0002 (0.3 M sodium phosphate, pH 8.0, 1% Tween 20, 0.5% SDS, 1 mM EDTA) for 5 minutes at 37°C, then add Buffer A.1 (0.5 M NHOAc, pH 6.5, 1 M urea, 5% NMS, and 2% The tube is washed with 900 μl of PEG 8000. Following click coupling, the second Y adapter strand is hybridized to the substrate-bound first strand by preparing a hybridization mixture containing 100 pmol of the second oligonucleotide in Buffer A.1. The hybridization mixture is incubated at 90°C for 15 seconds and then cooled to 72°C. The mixture is then added to the preheated chip, and the chip is cooled to 32°C for 5 minutes using a thermocycler. The chip is then washed with Buffer A.1. The library insert and Trident adapter are then ligated to the bound Y adapter. The insert fragments are denatured in a buffer containing 100 mM NaCl / 20 mM Tris, pH 8.0, at 90°C for 3 minutes, and then ramped down to 50°C over 5 minutes using a thermocycler. A ligation mix is ​​prepared in 1x ligation buffer (66mM Tris, 10mM MgCl2, 1mM DTT, and 7.5% PEG6000) containing 20pmol of double-stranded insert, 50pmol of Trident adapter, 3mM ATP, 2U / μl T4 PNK, and 200U / μl T4 DNA ligase. The ligation reaction is carried out at 16°C for 15 minutes, and then the reaction is added to the chip with the Y adapter attached. The chip is incubated at 16°C for 15 minutes. The ligation mix is ​​then removed, and 3μl of 5' deadenylase (50,000U / ml) is added to the ligation mix, and the ligation mix is ​​returned to the chip. The chip is then incubated at 16°C for 15 minutes. The chip is then washed with 4ml of Buffer 10002 at 37°C for 5 minutes. The chip can then be washed with water and stored in 10mM Tris at 4°C.

[0168] In step 2, the M1 precursor is extended to prepare the M2 precursor. In one embodiment, approximately 2.5-10 pmol of chip-bound M1 is used in an extension reaction containing 1.0X polymerase buffer, 0.2 mM of each dNTP, 0.28 U / μl DNA polymerase, and 1 mM MgCl2. Suitable DNA polymerases include Vent(exo-) DNA polymerase or KAPA HiFi. The chip is placed in a thermocycler and incubated at 95°C for 1 minute, followed by 10-40 cycles of 20 seconds at 90-98°C, followed by 6 seconds at 76°C. The chip is washed with water to remove excess reagent. The chip is then treated with proteinase K by adding an aqueous solution containing 0.05 U / μl to 0.80 U / μl proteinase K to the water and incubating at 55°C for 5 minutes, followed by 5 minutes at 95°C. The chip is then washed with water.

[0169] In step 3, the M3 template construct is generated by exonuclease digestion. In some embodiments, an exonuclease digestion mixture containing 0.45 U / μl of lambda-type exonuclease in exonuclease buffer is added to the chip and incubated at 37° C. for 5 minutes, followed by incubation at 75° C. for 10 minutes. The chip is washed with buffer 10002, followed by water, and then stored in a buffer containing 10 mM Tris.

[0170] In step 4, the bound M3 construct is released by photocleavage. In some embodiments, the chip is exposed to UV light (e.g., 365 nm) for 15 seconds using a UV curing lamp (e.g., a Phoseon Technology FireFly lamp). The released M3 construct is recovered by aspirating the liquid from the chip.

[0171] In step 5, Xpandomer copies of the M3 template construct are generated by the SBX method. In some embodiments, Xpandomers are generated on a microfluidic chip using click chemistry to which a first extension oligonucleotide (e.g., "E52" EO) is covalently attached, as described in step 1. This EO is sometimes referred to herein as a "capture oligo." The capture oligonucleotide is used to assemble the M3 template, second extension oligonucleotide, and cap branching agent structure onto the chip by hybridization. The capture chip is washed with Buffer A1 (0.5 M NHOAc, pH 6.5, 1 M urea, 5% NMS, and 2% PEG8000) and incubated at 65°C. Approximately 5 pmol to about 30 pmol of the M3 construct, about 20 pmol to about 80 pmol of the second extension oligonucleotide (e.g., "E6 EO"; the actual amount will be determined by the amount of E52 capture oligo bound to the chip), and about 10 pmol of the cap branching agent are added. Prepare a hybridization mixture containing approximately 20 pmol to 80 pmol of EO (the actual amount will be approximately the same as the amount of EO). The hybridization mixture is incubated at 95°C for 15 seconds, then added to the chip, incubated at 65°C for 30 seconds, ramped down to 37°C at a rate of 0.1°C / second, and held there for 5 minutes. The chip incubation temperature is controlled in situ by a standard thermocycler fitted with a hybridization adapter plate.

[0172] For Xpandomer synthesis, buffer P (0.6 mM MnCl and 0.18 μg / μl DPO DNA polymerase mutant) was mixed with buffer X (PP-60.22 80 μM and each XNTP 80 μM), followed by buffer A (50 mM Tris, pH 8.84, 200 mM NHOAc, pH 6.88, 20% PEG8K, 5% NMS, 0.2 μg / μl SSB, 0.5 M betaine, 0.25 M urea, 1 mM PEM). Prepare the extension mixture by adding AZ-8,8, and 4 mM PEM additive. Add the extension mixture to the chip and incubate at 20-45 °C for 15-60 min. Wash the chip with Buffer B (100 mM HEPES, 100 mM NaHPO, 5% Triton, and 10% DMF).

[0173] In step 6, the Xpandomer is cleaved and eluted in 0-75% ACN. In one embodiment, the capture oligonucleotide contains a photocleavable element. To release the Xpandomer from the chip, the chip is exposed to UV light for 15 minutes. The chip is then incubated at 37°C for 2 minutes, and the Xpandomer sample is removed with a pipette.

[0174] For nanopore sequencing, one or both extender oligonucleotides contain a leader sequence designed to facilitate penetration of the Xpandomer through the nanopore. Further details of specific embodiments of leader sequences are disclosed in Applicant's U.S. Patent No. 9,670,526, "Concentrating a Target Molecule for Sensing by a Nanopore," which is incorporated herein by reference in its entirety. In one embodiment, the sequence of an exemplary extender oligonucleotide is represented by the following: RD 10 (PC)L 25Z6 [TCATAAGACGAACGGA (SEQ ID NO: 4)] (where "R" represents a 5'-azido group that allows for attachment to a functionalized solid substrate via click chemistry. "D" represents a polyPEG6 spacer. "PC" represents a photocleavable spacer that allows for release from the solid substrate. "L" represents a polyC2 spacer that serves as a leader sequence during nanopore translocation. "Z" represents a polyC12 spacer, and TCATAAGACGAACGGA (SEQ ID NO: 4) represents an oligonucleotide that hybridizes to the target sequence and serves as an extension primer for DNA polymerase. In other embodiments, the PC spacer may be replaced with an acid-labile spacer, such as [dT p-ethoxy][DMS(O)MT-NH2-C6 or Glenamidite 10-1907] phosphoramidite. Extension Oligonucleotide The number of each phosphoramidite monomer (i.e., "spacer") designed into the structure is variable and can be optimized for a particular application. During mirrored library synthesis, a leader sequence can be included in one or, in other embodiments, both of the extender oligonucleotides that initiate Xpandomer synthesis. In certain embodiments, the leader sequence is provided by a first extender oligonucleotide that is not covalently attached to the substrate, and the second extender oligonucleotide that is attached to the substrate lacks a leader sequence. Following synthesis and processing of the Xpandomer, any cleavage products that are not attached to the second extender oligonucleotide can be removed from the substrate by washing. After release of the Xpandomer from the substrate, the cleavage products that are not attached to the first extender oligonucleotide lack a leader sequence and advantageously cannot penetrate the nanopore to provide sequence data.

[0175] D. Next-generation YAD-free mirrored library construction and methods

[0176] Several features of the mirrored library workflow described herein are amenable to modification and / or optimization to provide advantages for specific experimental requirements. In the embodiment shown in Figures 11A-11C, the binding site for the Xpandomer extension oligonucleotide and the functional group for solid-phase attachment are provided by Y-adapters that are ligated to the library fragments by enzymatic ligation. In an alternative "next-generation" embodiment, the binding site for the extension oligonucleotide is instead provided by an oligonucleotide primer ligated to the library fragment via PCR. This approach allows for both amplification of the target sequence and elimination of the ligation step of linking the YAD to the library fragment. After incorporating the primer sequence into the library fragment, the resulting PCR product is referred to as a "tailed" or "tagged" library fragment (or alternatively, a "tagged target sequence"). In some embodiments, the functionalized end group for solid-phase attachment is provided by a separate oligonucleotide structure containing an oligonucleotide sequence, referred to herein as a "capture oligo," designed to specifically hybridize with the library tag after PCR amplification. In general terms, these embodiments are referred to herein as "YAD-free" mirrored library construction.

[0177] One embodiment of YAD-free tagging and capture of library fragments, i.e., DNA target sequences, is shown in Figure 14. In this embodiment, the library fragment is exemplified by a double-stranded 100mer 1410 having a plus strand (SEQ ID NO: 5) 1410A and a minus strand (SEQ ID NO: 6) 1410B. The forward and reverse PCR primers are designed to contain oligonucleotide sequences complementary to the target sequence linked to heterologous sequences at their 5' ends. In one embodiment, primer (SEQ ID NO: 7) 1420 contains a 3' oligonucleotide sequence that specifically hybridizes to a complementary sequence in the plus strand 1410A of the library fragment and a 5' heterologous sequence that introduces a tag into the PCR product, enabling capture of the tagged library fragment. In this embodiment, the 5' heterologous sequence is referred to as "UP38" and is the same sequence present in both the capture oligonucleotide structure and the Xpandomer extension oligonucleotide. In some embodiments, primer (SEQ ID NO:8) 1425 contains a 3' oligonucleotide sequence that specifically hybridizes to the complementary sequence of the minus strand 1410B of the target sequence and a 5' heterologous sequence that provides a binding site for a cap adaptor structure incorporated during Xpandomer synthesis. Figure 14A shows PCR primers hybridized to single-stranded plus strand 1410A (SEQ ID NO:5) and minus strand 1410B (SEQ ID NO:6). PCR amplification of the library fragments generates tagged fragments 1430 (plus strand (SEQ ID NO:9) 1430A and minus strand (SEQ ID NO:10) 1430B) containing a first tag (SEQ ID NO:11) 1438 and a second tag (nucleotides 1-22 of SEQ ID NO:9) 1439, the sequences of which are determined by the heterologous sequence tails of the PCR primers. Standard primer design principles well established in the art are followed when designing primers 1420 and 1425.

[0178] For capture of tagged library fragments, the capture oligonucleotide structure is covalently attached to a solid support, for example, by click chemistry as described herein. One embodiment of a generalized capture oligonucleotide structure can be represented as follows: [azido]D n Ln Z n (SCL)(CO), where the azide provides a means for covalent attachment (i.e., immobilization) to a functionalized solid support (e.g., functionalized with an azide group or a dual biotin group). D represents PEG6, L represents C2, and Z represents C6; polymers of D, L, and Z can form a flexible linker structure. (SLC) represents a selectively cleavable linker, which in this embodiment is a polymer of uracil residues. (CO) is the oligonucleotide sequence of the capture oligo. In this embodiment, the CO sequence is the same sequence as the UP38 heterologous sequence (SEQ ID NO: 11) and specifically hybridizes to the tag sequence of the plus strand of the library fragment. In some embodiments, the flexible linker is a PEG6 monomer, e.g., D 16 These are formed solely from beads, which offers advantages when performing PCR reactions on beads or microfluidic chips, as discussed herein.

[0179] To capture the tagged library fragments, a second PCR reaction is performed, the second PCR reaction being carried out on a solid support that provides a capture oligonucleotide. A simplified version of library fragment capture is shown in Figure 14B. Here, a capture oligonucleotide structure 1440 is immobilized on a solid support 1445. The capture oligonucleotide structure contains a 3' oligonucleotide sequence identical to the sequence of tag (SEQ ID NO: 11) 1438 in the minus strand 1430B of the library fragment. When the double-stranded library fragment is denatured, the plus strand 1430A specifically hybridizes to the capture oligonucleotide. The capture oligonucleotide provides a primer for synthesizing a copy of the complement of plus strand 1430A, here represented as 1430C (SEQ ID NO: 10). An appropriate number of PCR cycles produces a double-stranded library fragment 1450 immobilized on the solid support.

[0180] After in-solution tagging of the library fragments, reaction conditions for on-chip capture of the tagged amplicon products can be optimized by trial and error. In one embodiment, in-solution PCR tagging reactions can be performed as follows: Prepare a reaction mixture containing 1-15 amol of synthetic template DNA (or, in other embodiments, sheared native library DNA), 2 μM of each primer, 350 μM dNTPs, 1× KOD buffer (120 mM Tris, pH 8.0, 20 mM KCl, 6 mM NH4SO4, 1.5 mM MgSO4, and 1% Triton X100), and 0.05 U / μl KOD polymerase. The reaction is run at 95°C for 2 minutes, followed by 30 cycles of 95°C for 10 seconds, 68°C for 8 seconds, and 72°C for 8 seconds, followed by one 3' extension at 72°C. The final yield of approximately 25 pmol of tagged amplicon can be purified, for example, by a QIAquick column (available from QIAGEN).

[0181] In one embodiment, the capture chip can be prepared as follows: 100 pmol of UP38 capture oligonucleotide is covalently attached to an alkyne-functionalized chip by click reaction containing 10% DMF, 3 mM THPTA, 25 mM NaPO, 5 mM aminoguanidine, 6 mM NaAsc, and 1 mM CuSO. The reaction is carried out at room temperature for 20 minutes, and then the chip is washed and subsequently BSA passivated (10 mg / ml non-acetylated BSA in PBS at room temperature for approximately 1 hour).

[0182] In one embodiment, on-chip PCR reactions can be performed as follows: A chip containing about 100 pmol of bound UP38 capture oligonucleotide is loaded with about 1×10 6 Add 100 copies of the tagged amplicon product, 200 pmol of UP39 primer, and 5 pmol of UP38 primer. KAPA HiFi HS U+, 1X ReadyMix buffer (2.5 mM Mg), 0.1 μg / ml non-acetylated BSA, 1M PCR containing betaine, 2% DMSO, 1% PEG, and 0.5% Tween The mixture is added. The PCR cycling conditions are as follows: 98°C for 2 minutes, 35 cycles of 100°C for 1 minute / 48°C for 12 seconds / 67°C for 30 seconds / 80°C for 2 minutes, followed by a final 2 minutes at 80°C; the chip is then washed in a buffer containing 1 M NaCl and 10 mM Tris (pH 8.0).

[0183] The tagged library fragments captured on the solid support provide a substrate for the generation of M3 mirrored library template constructs, which provide templates for Xpandomer synthesis, as discussed herein. Several alternative workflows for M3 and Xpandomer production are contemplated by the present invention. The following is a non-limiting description of specific embodiments of alternative "next-generation" mirrored library workflows.

[0184] Single-support mirrored library generation utilizing bystander extension oligonucleotides.

[0185] In this embodiment, both the M3 mirrored library template construct and Xpandomer are synthesized on the same solid support, such as beads or a microfluidic chip. Both the capture oligonucleotides for M3 generation and the extension oligonucleotides for Xpandomer synthesis are immobilized on the support. In some embodiments, the extension oligonucleotides are designed to form hairpin structures that prevent hybridization with library fragments during PCR-based capture, and are therefore referred to herein as "bystander" oligonucleotides. As discussed further below, the bystander oligonucleotides can be selectively converted into functional extension oligonucleotides after capture of tagged library fragments.

[0186] Figures 15A and 15B show the basic features of single-support synthesis using bystander extension oligonucleotides. In Figure 15A, tagged library fragments 1510 are shown immobilized on solid support 1505. PCR-based tagging of the library fragments and linkage to the solid support with capture oligonucleotide structures 1515 is performed as described herein and with reference to Figure 14. In one embodiment, the capture oligonucleotide structure can have the following sequence: 5'[azido]D 16 (UUUUU)(UP38)3' (where the azido group mediates attachment to the solid support, "D" represents the PEG6 linker, "U" represents deoxyuracil, and "UP38" represents the capture oligonucleotide sequence). The U5 sequence is selectively cleavable, for example, by USER® (Uracil-Specific Excision Reagent) available from NEB, which creates a single nucleotide gap at the position of the uracil residue and cleaves the resulting abasic site. Bystander extension oligonucleotides 1520A and 1520B are also immobilized on the support. The sequence of the bystander oligonucleotides is designed to form a double-stranded hairpin structure that prevents hybridization with library fragments during PCR. In one embodiment, the bystander oligonucleotide may have the following sequence: 5'[azido]D n L n Z n The "D", "L", and "Z" portions form a polymer that performs specific functions during SBX, as discussed further herein. Meanwhile, the 3'-terminal TCCGTTCG sequence folds back and base pairs with the internal CGAACGGA sequence, thus forming a hairpin structure in which the intervening GAUU sequence remains single-stranded. The single-stranded uracil-containing sequence can be cleaved with USER®. The terminal "X" portion of the bystander oligonucleotide represents a "blocker" (e.g., PEG or a C3 spacer blocker) that prevents extension from the oligonucleotide during PCR.

[0187] A three-pronged adaptor 1525 is ligated to the immobilized library fragment to form the M1 precursor construct 1530. In some embodiments, this may be accomplished by first adding an "A" tail to the free 3' end of the library fragment, which is done using Trident The A-tailing reaction involves base-pairing with the free 3' "T" provided by the construct. An exemplary A-tailing reaction can include 10 pmol PCR amplicon, 1x MolTaq buffer, 1 mM dATP, and 2.5 U MolTaq and can be carried out at 72°C for 30 minutes. An exemplary ligation reaction can include 40 pmol of the three-pronged construct, 1x ligation buffer, 3 mM ATP, 2 U / µl T4 PNK, and 30 U / µl T4 DNA ligase and can be carried out at room temperature for 20 minutes, followed by the addition of 150 U of 5' deadenylase and incubation for 10 minutes. The M1 precursor is then extended to form the triple-stranded M2 construct with DNA polymerase, as described herein and with reference to Figure 11B.

[0188] Figure 15B shows an M2 precursor construct 1540 with a bystander extension oligonucleotide and a selectively cleavable uracil moiety in the capture oligonucleotide, designated by the letter "U." To generate an M3 template construct 1550, the M2 precursor is cleaved with USER® to nick the uracil moiety. This results in 1) cleavage of the hairpin structure in the extension oligonucleotide and 2) cleavage of the capture oligonucleotide, generating a free 5' end in the middle strand of the M2 construct. Simultaneously, the M2 precursor is subjected to exonuclease treatment, which 1) digests the terminal TCCGTTGC sequence of the bystander oligonucleotide to expose the extension oligonucleotide sequence, and 2) digests the middle strand of the M2 complex from the 5' end to the 3' end. The exposed extension oligonucleotide then specifically hybridizes to the complementary sequence provided by the 3' end of the M3 template construct. In some embodiments, the nicking and exonuclease digestion reaction can be carried out by treating the M2 precursor with a reaction mixture containing 1x Lambda Exo Buffer (67 mM glycine-KOH, 2.5 mM MgCl2, and 50 μg / ml BSA), 20% PEG8000, 0.15 U / μl USER®, and 0.4 U / μl Lambda Exonuclease for 15 minutes at 37° C. After the nicking and exonuclease digestion reaction, a subsequent phosphatase reaction is carried out to remove the 3' phosphate remaining from USER® cleavage of the bystander oligonucleotide, rendering it a functional extension oligonucleotide for Xpandomer synthesis. In some embodiments, the phosphatase reaction may be carried out at 37°C for 5 minutes using a reaction mixture containing 1x CutSmart buffer (50 mM potassium acetate, 20 mM Tris acetate, 10 mM magnesium acetate, 100 μg / mL BSA), 0.1 U / μL Quick calf intestinal alkaline phosphatase (CIP), followed by heat inactivation at 80°C for 2 minutes.

[0189] The M3 construct provides a template for Xpandomer synthesis, which may be performed as described herein and with reference to Figure 11C. The extended oligonucleotide may, in some embodiments, provide additional features for selective release from the support and nanopore translocation, as described throughout this disclosure.

[0190] On-card two-zone mirrored library generation

[0191] In this embodiment, the microfluidic chip, or card, is designed with two physically separate zones for the mirrored library workflow, including a first zone for library fragment capture and M3 template construct generation, and a second zone for Xpandomer synthesis. This separation of the workflow into two zones offers several advantages, such as eliminating the need for bystander extension oligonucleotides.

[0192] One embodiment of a two-zone card configuration is shown in Figure 16A, where the card 1600 is divided into physically distinct compartments 1610 and 1620, referred to as "Zone 1" and "Zone 2," respectively. Zone 1 1610 is dedicated to the generation of M3 template constructs, and Zone 2 1620 is dedicated to Xpandomer synthesis. Primers such as the UP38 primer described herein are also used. The capture oligonucleotide structure is immobilized on the surface of zone 1, for example, by click chemistry. Similarly, the extension oligonucleotide for Xpandomer synthesis is immobilized on the surface of zone 2. In some embodiments, the extension oligonucleotide may contain a photocleavable, acid-cleavable, or enzymatically cleavable element for selective release of the Xpandomer product. Generation of the M3 template construct is performed in zone 1, as described herein. Briefly, tagged library fragments and a PCR mixture are added to zone 1, and on-chip PCR is performed to ligate the tagged library fragments to the capture oligonucleotides. The M1 precursor is formed by A-tailing the library fragments, followed by ligation of a trident adapter. The trident adapter is extended by DNA polymerase to generate the M2 precursor. The M2 precursor construct is subjected to uracil cleavage followed by exonuclease digestion to cleave the capture oligonucleotide and remove the middle strand, thereby generating the M3 template construct 1615.

[0193] Figure 16B shows the transfer of the M3 template precursor from zone 1 to zone 2 of the card, where it then specifically hybridizes to extension oligonucleotides 1625A and 1625B. Cap adaptor structure 1630 specifically hybridizes to the M3 template construct, and Xpandomer synthesis is initiated from the extension oligonucleotide in the direction indicated by the arrow. Details of the cap adaptor structure and reaction conditions for Xpandomer synthesis are described throughout this disclosure.

[0194] In another embodiment, the capture oligonucleotide attached to Zone 1 is designed to contain a photocleavable element in place of a uracil residue. In this embodiment, treatment of the M2 precursor with UV light cleaves the capture oligonucleotide, providing a 5' substrate for exonuclease digestion to generate the M3 template construct. During photocleavage, the Zone 2 compartment can be protected from exposure by a UV-blocking interface. An exemplary capture oligonucleotide containing a photocleavable element can have the following structure: [azido]D10 _L 30 _Z6_PC_UP038, where the polymer of D, L, and Z moieties, e.g., "spacer," forms a flexible linker, "PC" represents a photocleavable element, and UP038 represents an oligonucleotide having the sequence 5'TCATAAGACGAACGGAGACT 3' (SEQ ID NO: 13), designed to hybridize with the tag sequence of a library fragment.

[0195] Bead-based mirrored library generation

[0196] This embodiment describes a workflow in which M3 template constructs are generated through a series of steps carried out on a bead-based support. In this embodiment, various constructs are attached to beads via streptavidin-biotin linkages, as discussed with reference to Figure 4A. Beads offer certain advantages as solid substrates, for example, they are suitable for PCR conditions, are highly scalable, and therefore provide higher product yields than other substrates.

[0197] One embodiment of a bead-based workflow is summarized in Figure 17. Advantageously, the beads can be washed between steps to remove excess reagents. In step 1, the library fragments are tagged by in-solution PCR, as described herein and with reference to Figure 14A. In step 2, on-bead PCR is performed to generate the tagged library fragments on the capture oligonucleotides. In this embodiment, the capture oligonucleotides contain biotin moieties for binding to SA beads. Any suitable SA bead substrate can be used, for example, Dynabeads® MyOneC1 SA available from ThermoFisher Scientific. A 35-cycle PCR reaction using KAPA HiFi Uracil+ polymerase can generate up to 10 6 Generate up to 1-20 pmol of bead-bound amplicon from the copy input. Following step 2, the beads are then loaded onto the protein The library fragments are treated with Enase K at 55°C for 5 minutes, followed by a post-PCR wash (1M NaCl, 10mM Tris, 0.1% Tween-20). In another embodiment, in-solution PCR can be performed using biotinylated capture oligonucleotides, followed by spin-column-based PCR purification. The purified biotinylated amplicons can then be bound to t0SA beads. In step 3, 3' A "tails" are added to the library fragments, followed by ligation of Trident adapters containing 5' T overhangs. An exemplary A-tailing reaction contains 2.5 U of MolTaq enzyme and 1 mM dATP and is incubated at 65°C for 30 minutes. An exemplary ligation reaction contains Trident adapter constructs (with "T" overhangs), 30 U / μl T4 DNA ligase, 2 U / μl T4 PNK, and 3 U / μl 5' deadenylase and is incubated at room temperature for 20 minutes. In step 4, the Trident adapters are extended to generate M2 precursors. An exemplary extension reaction contains KAPA HiFi U+ polymerase in 1x ReadyMix, commercially available from Roche. Following step 4, the beads are again treated with proteinase K and washed. In step 5, the M3 template construct is generated by nicking the uracil moiety in the M2 precursor to generate a free 5' end in the middle strand of the construct, followed by exonuclease digestion of this strand. An exemplary nicking / digestion reaction contains 0.1 U / μl USER® and 0.3 U / μl lambda exonuclease and is incubated at 37°C for 15 minutes. The exonuclease can then be inactivated by incubating the beads at 75°C for 10 minutes. In step 6, the free M3 template precursor and cap adapter construct are added to a microfluidic chip containing covalently linked extender oligonucleotides. The M3 construct specifically hybridizes to the extender oligonucleotides and cap adapters. In step 7, Xpandomer synthesis and processing reactions are carried out as described throughout this disclosure. The final Xpandomer product can be released from the chip by photocleavage.In an alternative embodiment, steps 6 and 7 can also be carried out on a bead-based support.

[0198] Solid-state Xpandomer synthesis using branched extension oligonucleotides

[0199] As discussed herein, the sequencing by extension (SBX) protocol developed by the inventors utilizes an extension oligonucleotide (EO) for Xpandomer synthesis that contains several features that serve unique functions during Xpandomer synthesis, processing, and nanopore translocation. For example, in certain embodiments, the 5' end of the EO provides a "leader" sequence that initiates threading of the final Xpandomer product through the nanopore. The leader sequence is a polymer of C2 (represented herein as "L"), e.g., L 25 In some situations, it may be desirable to generate a population of mirrored Xpandomers in which only full-length copies penetrate the nanopore and generate sequence information. To achieve this goal, we designed branched extension oligonucleotides that include first and second extension oligonucleotides linked by a chemical branching agent. In this embodiment, only one of the EOs contains a leader sequence, and each EO contains a unique, selectively cleavable element. One embodiment of a branched EO is shown in Figure 18.

[0200] FIG. 18 shows a branched EO1800 comprising a first EO1810 and a second EO1820 linked by a branching agent 1815. The branched EO1800 can be synthesized by conventional phosphoramidite chemistry using an asymmetric chemical branching agent. In this embodiment, only the first EO1810 comprises a leader sequence represented by a polymer of "L" units ("L" represents a C2 spacer). Similarly, only the first EO comprises a polymer of "Z" units ("Z" represents a C12 spacer). The polymer of Z units also plays a role in nanopore translocation. In this embodiment, the first EO comprises a polymer of uracil ("U") residues, allowing for selective cleavage of the EO via, for example, USER®, and the second EO comprises a polymer of uracil ("U") residues, allowing for selective cleavage of the EO via, for example, USER®. The EOs contain a photocleavable element ("PC-spacer") for UV-mediated cleavage. The 3' oligonucleotide primer (SEQ ID NO: 14) of each EO has the same sequence and is designed to hybridize with the M3 template construct. In some embodiments, the oligonucleotide primers are synthesized using one or more 2'-OMe base analogs. The inventors have found that, advantageously, the mutant DPO4 polymerase used in Xpandomer synthesis can utilize 2'-OMe analogs as substrates. The branched EOs contain a 5'-terminal azide group for click coupling to the substrate. The lengths of the L, Z, D, and U polymers shown in this exemplary embodiment are not intended to be limiting. It is understood that the present invention contemplates a variety of suitable polymer lengths and branched EO structures.

[0201] Figures 19A and 19B show how branched EOs enable the generation and isolation of a population of full-length Xpandomers for nanopore sequencing. In step 1, an M3 template construct 1910 is hybridized to a branched EO 1920 attached to a support 1930. Only one EO of the branched structure contains a leader sequence 1925. In step 2, a cap adapter structure 1940 is hybridized to the M3 template construct. In step 3, Xpandomer copies 1950A and 1950B are synthesized by extension from oligonucleotide primers 1927A and 1927B. The 3' ends of the Xpandomers are linked to the free ends of the cap primer constructs by end-capping, as described herein. In step 4, the Xpandomers are subjected to USER® treatment, which selectively cleaves the first extension oligonucleotide and exposes the leader sequence 1925. In step 5, the Xpandomer is cleaved and processed to transition from the "constrained" to the "extended" configuration. This step allows for the washing away of incomplete or cleaved Xpandomer by-products. In step 6, the Xpandomer is released from the substrate by photocleavage of the second extension oligonucleotide. Advantageously, only the full-length Xpandomer 1950 contains the leader sequence 1925 and penetrates the nanopore to provide sequence information.

[0202] All documents disclosed herein, including patent and non-patent documents, are incorporated by reference in their entirety as if each were individually incorporated.

[0203] It should be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. It should be further understood that, unless specifically defined herein, terms used herein are to be given their conventional meaning as known in the relevant art.

[0204] References throughout this specification to "one embodiment" or "an embodiment" mean that a particular feature, structure, or characteristic described in connection with an embodiment is included in at least one embodiment. Thus, the appearances of the phrase "in one embodiment" or "in an embodiment" in various places throughout this specification do not necessarily all refer to the same embodiment. Furthermore, particular features, structures, or characteristics may be combined in any suitable manner in one or more embodiments.

[0205] As used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents, i.e., one or more, unless the content and context clearly dictate otherwise. It should also be noted that the conjunctive terms "and" and "or" are generally used in their broadest sense to include "and / or," unless the content and context clearly dictate inclusiveness or exclusiveness, as the case may be. Thus, the use of alternatives (e.g., "or") should be understood to mean either, both, or any combination of the alternatives. Furthermore, when "and / or" is used herein, "and" and "also" should be understood to mean "and" or "also." The construction of "is" is intended to encompass embodiments including all of the associated items or ideas, as well as one or more other alternative embodiments that include fewer than all of the associated items or ideas.

[0206] Unless the context requires otherwise, throughout the specification and claims, the word "comprise," as well as its synonyms and variations, such as "have" and "include," and variations, such as "comprises" and "comprising," are to be construed in an open and inclusive sense, e.g., "including, but not limited to." The term "essentially" limits the scope of a claim to particular materials or steps, or those that do not materially affect the basic and novel characteristics of the claimed invention.

[0207] The abbreviation "eg" is derived from the Latin exempli gratia and is used herein to indicate a non-limiting example. Thus, the abbreviation "eg" is synonymous with the term "for example." As used herein and in the appended claims, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise; the term "X and / or Y" means "X" or "Y" or both "X" and "Y," and it is also understood that the letter "s" following a noun refers to both the plural and the singular form of that noun. Furthermore, when features or aspects of the invention are described in terms of a Markush group, the invention is intended to encompass and be described by any individual member and any subgroup of members of the Markush group, as one of skill in the art will recognize, and applicant reserves the right to amend this application or the claims to specifically refer to any individual member or any subgroup of members of the Markush group.

[0208] Any headings used within this document are merely utilized to facilitate the reader's review thereof and should in no way be construed as limiting the scope of the invention or claims. Accordingly, the headings and abstracts of the disclosure provided herein are for convenience only and do not interpret the scope or meaning of the embodiments.

[0209] Where a range of values ​​is provided herein, unless the context clearly dictates otherwise, it is understood that each intervening value, to the tenth of the unit of the lower limit, between the upper and lower limit of that range, and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges, which may independently be included in the smaller ranges, are also encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of the included limits are also included in the invention.

[0210] For example, any concentration range, percentage range, ratio range, or integer range provided herein should be understood to include every integer within the recited range, and, where appropriate, fractions thereof (such as tenths and hundredths of integers), unless otherwise specified. Also, any numerical range recited herein for any physical characteristic, such as polymer subunits, size, or thickness, should be understood to include every integer within the recited range, unless otherwise specified. As used herein, the term "about" means ±20% of the indicated range, value, or structure, unless otherwise specified.

[0211] All U.S. patents, U.S. patent application publications, U.S. patent applications, foreign patents, foreign patent applications, and non-patent publications referred to herein and / or listed in the Application Data Sheet are incorporated herein by reference in their entirety. Such publications include, for example, materials and methods described therein that may be used in connection with the inventions described herein.

[0003] The publications discussed above and throughout the text are provided solely for their disclosure prior to the filing date of the present application. Nothing herein should be construed as an admission that the present disclosure is not entitled to antedate such publication by virtue of prior invention.

[0212] All patents, publications, scientific articles, websites, and other documents and materials referenced or mentioned in this specification are indicative of the level of skill of those skilled in the art to which this invention pertains, and each such referenced document and material is individually incorporated by reference in its entirety or is incorporated by reference herein to the same extent as if fully set forth herein. Applicant reserves the right to physically incorporate into this specification any and all materials and information from such patents, publications, scientific articles, websites, electronically available information, and other referenced materials or documents.

[0213] In general, in the following claims, the terms used should not be construed to limit the claims to the specific embodiments disclosed in the specification and the claims, but should be construed to include all possible embodiments, along with the full scope of equivalents to which such claims are entitled. Accordingly, the claims are not limited by this disclosure.

[0214] Furthermore, the description portion of this patent includes all claims. Moreover, all claims, including all original claims and all claims from any and all priority documents, are incorporated by reference in their entirety into the specification portion of this specification, and applicant reserves the right to physically incorporate any and all such claims into the specification or other portions of this application. Thus, for example, a patent shall not under any circumstances be construed as not providing a specification of a claim for the assertion that the precise wording of the claim is not set forth verbatim in the specification portion of the patent.

[0215] The claims shall be construed in accordance with law. However, notwithstanding any assertion or recognition that a claim or portion thereof is easy or difficult to construe, under no circumstances shall any adjustment or modification of a claim or portion thereof during the application leading to this patent or the prosecution of such application be construed as a waiver of any and all equivalents thereof that do not form part of the prior art.

[0216] Other non-limiting embodiments are within the scope of the following claims. The patent shall not be construed as limited to the particular examples or non-limiting embodiments or methods specifically and / or expressly disclosed herein. Under no circumstances shall this patent be construed as limited by any statements made by any examiner or other officer or employee of the Patent and Trademark Office, unless such statements are specifically and expressly qualified or reserved in applicant's reply brief.

[0217] The invention is described broadly and generically herein. Each of the narrower species and subgeneric groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation that removes any subject matter from the genus, regardless of whether the excised material is specifically described herein. [Example]

[0218] Example 1 Solid-state Xpandomer synthesis - extended direct conjugation of oligonucleotides to microfluidic chips This example describes the solid-state synthesis of Xpandomer, an extendable copy of a single-stranded polynucleotide template composed of XNTP nucleotide analogs and possessing unique features for improved nanopore sequencing. Solid-state Xpandomer synthesis was performed on a microfluidic chip substrate functionalized by covalent attachment of an extension oligonucleotide ("E-oligo") to the chip. Polymerase-mediated extension of the bound E-oligo with XNTP generates an Xpandomer product that remains attached to the chip and can be washed, processed, and released in an efficient and controlled manner.

[0219] The E-oligo ("E52 SIMA PC Azide") utilized in this experiment contained the following features: a polymer of PEG-6 monomers followed by a 5' azide group, a photocleavable spacer, a "leader" polymer sequence, a "concentrator" polymer sequence, a fluorescently labeled nucleotide, and an oligonucleotide primer. The leader and concentrator polymers function, for example, to improve the efficiency of Xpandomer translocation through nanopore sensors and are described in further detail in applicant's U.S. Pat. No. 9,670,526, entitled "Concentrating a target molecule for sensing by a nanopore," which is incorporated herein by reference in its entirety.

[0220] A. Chip Functionalization

[0221] A commercially available continuous-flow PCR chip made from Zeonor (a cycloolefin thermoplastic polymer) was used as the solid support in this experiment. The chip was functionalized with alkyne moieties using the direct conjugation by photoabstraction protocol described herein. Briefly, the chip was primed with 350 μL of 80% DMS. Then, 60 μL of 10 mM propargylmaleimide in 80% DMSO was added, and the chip was incubated under a 20 W UV lamp for 20 minutes. The chip was then primed with 80% DMSO. The chip was washed successively with 300 μL of 100% DMF, 300 μL of water, 300 μL of 300 mM NaHPO, 1% Tween-20, and 0.5% SDS solution and incubated for 5 min at 37° C. The chip was finally washed with 300 μL of water, followed by 300 μL of 3× PBS.

[0222] B. Click reaction

[0223] The solutions for the click reaction were prepared as follows: 1) A catalyst mixture was prepared by mixing 5.0 μL of water, 1.5 μL of 100 mM THPTA, 1.5 μL of 100 mM sodium ascorbate, 0.5 μL of 10 mM CuSO4, 0.5 μL of 100 mM aminoguanidine, and 1.0 μL of 100% DMF and incubated at room temperature for 5–15 min. 2) The substrate mixture was prepared by mixing 29.22 μL of water, 4.00 μL of 100% DMF, 1.25 μL of 1000 mM sodium phosphate, pH 7.0, 0.78 μL of 25.6 μM extension oligonucleotide (20 pmol of E52 SIMA PC azide), 1.25 μL of 100 mM MgCl2, 2.0 μL of 100 mM aminoguanidine, and 1.5 μL of 100 mM sodium ascorbate. 3) The substrate mixture was added to the catalyst mixture and vortexed. The functionalized chip was washed with 300 μL of water, and 50 μL of the click reaction mixture was added, followed by incubation at room temperature for 20 minutes.

[0224] C. Extension reaction

[0225] The extension reaction used a ratio of 20 pmol:20 pmol of DNA template to E-oligo. The template was a single-stranded 100-mer sequence derived from the HIV-2 genome. The sequence of the primer was 5'TCATAAGACGAACGGA 3' (SEQ ID NO: 4). Single-stranded DNA template molecules were hybridized to the support-bound E-oligo by incubating 20 pmol template with the chip for 5 minutes at 37°C, followed by washing with 300 μL of MEB buffer.

[0226] The extension reaction contained the following reagents: 4 nmol XNTP, 0.08 mM polyphosphate, 0.6 mM MnCl2, 0.5 M betaine, 0.25 M urea, 10 μg single-stranded binding protein (SSB), 9 μg DNA polymerase protein (C4760), and 1.4 mM PEM combo (AZ8-8 and AZ43-43). The final reaction volume was brought to 50 μL with 5% NMS, and extension was carried out at 42 °C.

[0227] After extension, the chip was treated and washed to remove the extension reagents, and the bound Xpandomer product was released from the chip by photocleavage (15 minutes with a Firefly UV curing lamp). The cleaved Xpandomer product was eluted from the chip with 60 μL of 40% acetonitrile. Xpandomer products were analyzed by gel electrophoresis by running approximately 0.75 pmol of product per lane in a 2.5% Nusieve gel containing 1x TAE buffer. A representative gel is shown in Figure 20, with the product of solid-state Xpandomer synthesis shown in lane 3 and the full-length product indicated by an arrow. For reference, the product of an Xpandomer synthesis reaction performed in solution using the same template is shown in lane 1. The narrower band observed in lane 3 suggests that solid-state Xpandomer synthesis may improve distribution, with a reduction in partial or truncated products (the apparent larger size of the faint band in lane 1 reflects differences in the composition of the E-oligo used in solution-based extension reactions). Lane 2 is a negative control in which the template used does not hybridize to the E-oligo, and lane 4 is a positive control showing the products of solid-state extension performed under different reaction conditions. These results demonstrate the proof-of-concept of the sol synthesis of Xpandomer.

[0228] Example 2 Solid-state Xpandomer synthesis (SBX) for sequencing by extension This example describes the solid-state synthesis and processing of Xpandomer copies of a 222-mer template, followed by product sequencing using a nanopore sensor system. All steps of the workflow prior to sequencing were performed using Xpandomer intermediates and the final product bound to a substrate. This protocol offers many advantages over solution-based workflows, such as the ability to sequentially add pure reagents for each reaction in reduced volumes. In this experiment, the Xpandomer extension reaction was performed on a microfluidic chip substrate primed by direct covalent attachment of an E-oligo. Chip functionalization and click attachment of the E-oligo were performed as described in Example 1.

[0229] A. Extension reaction

[0230] The extension reaction was performed at a molar ratio of 10 pmol:20 pmol DNA template to E-oligo. The template used was a single-stranded 222-mer sequence derived from the HIV-2 genome, and the E-oligo used was the E52 oligo described in Example 1. Single-stranded DNA template molecules were hybridized to the bound E-oligo by incubating 10 pmol template with the chip in a solution of 500 mM NHOAc, 5% NMS, 1 M urea, and 2% PEG8K at 37°C for 5 minutes, followed by washing with 300 μL of MEB buffer. Prior to the extension reaction, the chip was washed with 300 μL of a solution of 50 mM TrisCl, 200 mM NHOAc, 5% NMS, 10% PEG8K, and 1 M urea.

[0231] The extension reaction contained the following reagents: 4 nmol XNTP, 0.08 mM polyphosphate, 0.6 mM MnCl2, 0.5 M betaine, 0.25 M urea, single-stranded ligation. The reaction mixture contained 10 μg of SSB protein, 9 μg of DNA polymerase protein (C4760), 1.0 mM AZ-8,8, and 4 mM AZ-43,43 PEM additive. The final reaction volume was 50 μL with a buffer consisting of 5% NMS and 50 mM Tris HCl, pH 8.84, 200 mM NHOAc, pH 6.73, and 20% PEG. The extension reaction was carried out at 42°C for 30 min.

[0232] After extension, the chip was washed three times with 300 μL of wash solution containing 100 mM HEPES, pH 8.0, 100 mM Na 2 HPO 4 , 1% Tween 20, 3% SDS, 15% DMF, and 5 mM EDTA in D 2 O.

[0233] B. Xpandomer Processing

[0234] The bound extension products were first treated with acid to cleave the phosphoramidite bond in the Xpandomer to linearize the molecule, as shown in Figure 1C. Acid-mediated cleavage was achieved by adding 200 μL of a solution of 7.5 M DCl in DO to the chip and incubating at room temperature for 30 minutes. The bound products were then neutralized and washed by adding 900 μL of a solution of 100 mM NaHPO, pH 8.0, 100 mM NaHPO, pH 8.0, 1% Tween-20, 3% SDS, 15% DMF, and 5 mM EDTA in DO. 200 μmol of succinic anhydride (loaded separately into a syringe) was then added directly to the chip while 100 mM HEPES, pH 8.0, 100 mM NaHPO, pH 8.0, 1% Tween-20, 3% SDS, 15% DMF, 5 mM EDTA, was added. The conjugated product was modified by adding 300 μL of a solution of EDTA in DO, followed by incubation for 5 minutes at 23° C. The modified product was then washed with 500 μL of a solution of 15% ACN and 5% DMSO in HO.

[0235] C. Release of Xpandomer from the chip

[0236] The bound Xpandomer product was released from the chip substrate by photocleavage. After adding 60 μL of a solution of 15% ACN and 5% DMSO in HO, the chip was irradiated with a UV curing lamp for 15 minutes. The released Xpandomer was then eluted from the chip using a solution of 5% DMS and 15% acetonitrile. The eluted material was first analyzed by gel electrophoresis, as shown in Figure 21A. 15% of the sample was loaded onto lane 3 of the gel (2.5% NuSieve agarose in 0.5x TBE), containing the full-length Xpandomer product indicated by the arrow. For reference, the product of a solution-based Xpandomer synthesis reaction using the same template is shown in lanes 1 and 2. As can be seen, solid-phase synthesis produces narrower bands compared to solution-based synthesis, indicating a greater proportion of full-length product in the sample.

[0237] Nanopore sequencing

[0238] For sequencing, a protein nanopore is prepared by inserting α-hemolysin into a DPhPE / hexadecane bilayer member in buffer B1 containing 2 M NH 4 Cl and 100 mM HEPES (pH 7.4). シス The wells are perfused with Buffer B2, containing 0.4 M NH4Cl, 0.6 M GuCl, and 100 mM HEPES, pH 7.4. The Xpandomer sample is heated to 70 °C for 2 min, allowed to cool completely, and then 2 μL of sample is added to the well. A voltage pulse of 90 mV / 390 mV / 10 μs is then applied, and data are acquired using Labview acquisition software.

[0239] Sequence data are analyzed by histogram display of the population of sequence reads from a single SBX reaction. The analysis software aligns each sequence read to the template sequence and identifies the correct template sequence. The sequence ranges at the ends of non-aligned reads are trimmed. A representative histogram of nanopore sequencing of a 222mer template is shown in Figure 21B. Notably, solid-state synthesis and processing produced Xpandomer products that generated highly accurate sequence reads across the entire length of the 222mer molecule when read by the nanopore sensor.

[0240] Example 3 Xpandomer synthesis by end-capping This example describes end-capping of Xpandomer products during synthesis and attempts to optimize the process using different reaction additives. The template used in the following experiments was a 121-mer sequence derived from the HIV-2 genome, and the E-oligo ("EO") used was E52 EO with the following characteristics: a leader polymer, a concentrator polymer, and a 5' SIMA (fluorescent tag) with an oligonucleotide primer having the sequence 5' TCATAAGACGAACGGA 3' (SEQ ID NO: 4). The end cap comprises a terminal oligonucleotide with the following sequence: 5' K[GCGTTAGGTCCCAGTGTTTAC (SEQ ID NO: 15)] X 3', where K represents a G-clamp and X represents a PEG3 moiety. The terminal oligonucleotide is complementary to and hybridizes with the 5' end of the template. The 5' end of the terminal oligonucleotide is linked to a ddCTP cap via the linker shown in feature 710A of Figure 7A to form the complete end-cap structure.

[0241] In this experiment, five extension reactions were performed, each containing the following reagents: 1:1 molar ratio of template to E-oligo, 2 mM AZ-8, 8 and 10 mM AZ-43, 43 PEM additive, 5% NMS, 1.8 μg DNA polymerase, 0.08 mM XNTPs, 0.08 mM polyphosphate, and 0.6 mM MnCl2. Reactions 2–5 contained a 2-fold molar excess of end-caps relative to template and EO, while reaction 1 contained no end-caps. Reactions also contained various additives: Reaction 1: 0.5 M betaine, 0.25 M urea, and 2 μg of single-stranded binding protein (SSB); Reaction 2: 0.5 M betaine, 0.25 M urea, and 2 μg of SSB; Reaction 3: 0.25 M urea; Reaction 4: 0.5 M betaine and 0.25 M urea; Reaction 5: 0.25 M urea and 2 μg of SSB. The final reaction volume for each was 10 μL, and the reactions were performed at 42°C.

[0242] The products of the extension reactions were analyzed by gel electrophoresis, as shown in Figure 22. Lane 1 shows the product of Reaction 1, which does not contain an end cap. In this reaction, the SIMA dye is linked to the EO, and the extension product is a 121-mer Xpandomer. Lanes 2–5 show the products of Reactions 2–5, respectively, which contain end caps. In contrast to Reaction 1, in these reactions, the SIMA dye is linked to the end cap. As can be seen, in each of Reactions 2–5, the end cap was successfully linked to the Xpandomer by the DNA polymerase, indicating that the Xpandomer represents a perfect copy of the DNA template. By incorporating the terminal oligonucleotide of the end cap into the extension product, the product of Reactions 2–5 is a 100-mer Xpandomer, which migrates more rapidly on the gel than the 121-mer from Reaction 1. These results show a significantly denser Xpandomer band on the gel, indicating that the end-capping reaction is highly efficient under the experimental conditions tested. Importantly, end-capping provides a means to tag and capture full-length Xpandomers, for example, for nanopore sequencing.

[0243] Example 4 Solid-state Xpandomer synthesis using end-capping This example describes the solid-state synthesis of a 222-mer Xpandomer combined with end-capping of the full-length product on a microfluidic chip substrate functionalized by covalent attachment of an extension oligonucleotide ("E-oligo") to the substrate, as described in Example 1. Solid-state synthesis was performed. Upon completion of the full-length copy of the template, DNA polymerase encountered the end cap hybridized to the 5' end of the template and ligated the 5' end of the end cap to the 3' end of the Xpandomer. A fluorescent dye attached to the end cap allowed visualization of the full-length copy of the template by gel electrophoresis.

[0244] A. Elongation and end-capping reaction.

[0245] The template used in the following experiments was a 243-mer sequence derived from the Streptococcus pneumoniae genome, and the E-oligo ("EO") used was E52 EO, which contained a photocleavable linker and an oligonucleotide primer with the sequence 5'TCATAAGACGAACGGA 3' (SEQ ID NO: 4). The terminal cap comprises a terminal oligonucleotide with the following sequence: 5'K[GCGTTAGGTCCCAGTGTTTAC (SEQ ID NO: 15)] 3', where K represents a G-clamp. The terminal oligonucleotide is complementary to and hybridizes with the 5' end of the template. The 5' end of the terminal oligonucleotide is linked to a ddCTP cap via the linker shown in feature 710A of Figure 7A to form the complete terminal cap structure.

[0246] In this experiment, four on-chip extension reactions were performed using the same template, primers, and end caps. Reaction 1 contained the following reagents: template:EO:end cap molar ratio of 16:20:32, 0.08 mM XNTP, 1 mM AZ-8, 8 mM AZ-43, 4 mM PEM, 9 μg of DNA polymerase (DPO4 mutant C4760), 10 μg of SSB, 0.6 mM MnCl, 0.08 mM polyphosphate, 50 mM Tris HCl, pH 8.84, 200 mM NHOAc, pH 6.73, 20% PEG, 5% NMS, 0.25 M urea, 0.5 M betaine. A 50 μL reaction was performed at 42 °C. Reaction 2 contained the following reagents: Template:EO:end-cap molar ratio of 6:10:12, 0.08 mM XNTP, 1 mM AZ-8, 8 and 4 mM AZ-43, 43 PEM, 9 μg DNA polymerase (C4760), 10 μg SSB, 0.6 mM MnCl, 0.08 mM polyphosphate, 50 mM Tris HCl, pH 8.84, 200 mM NHOAc, pH 6.73, 20% PEG, 5% NMS, 0.25 M urea, 0.5 M betaine. 20 μL reactions were performed at 37°C. Reaction 3 contained the following reagents: Template:EO:end-cap molar ratio of 6:10:12, 0.08 mM XNTP, 1 mM AZ-8, 8 mM, and 4 mM AZ-43, 43 mM PEM, 9 μg of DNA polymerase (C4760), 10 μg of SSB, 0.6 mM MnCl, 0.08 mM polyphosphate, 50 mM Tris HCl, pH 8.84, 200 mM NHOAc, pH 6.73, 20% PEG, 5% NmM, 0.25 M urea, 0.5 M betaine. 25 μL reactions were performed at 42 °C. Reaction 4 contained the following reagents: Template:EO:end-cap molar ratio of 10:10:20, 0.08 mM XNTP, 1 mM AZ-8, 8 mM, and 4 mM AZ-43, 43 mM PEM, 9 μg of DNA polymerase (C4760), 10 μg of SSB, 0.6 mM MnCl, 0.08 mM polyphosphate, 50 mM Tris HCl, pH 8.84, 200 mM NHOAc, pH 6.73, 20% PEG, 5% NMS, 0.25 M urea, 0.5 M betaine. 25 μL reactions were performed at 42 °C.

[0247] The products of the extension reactions were analyzed by gel electrophoresis on a 2.5% NuSieve agarose gel, as shown in Figure 23. Lanes 1-4 show the products of reactions 1-4, respectively, which contain end caps. In these reactions, SIMA dye is ligated to the end caps. As can be seen, in each reaction, the end caps were successfully ligated to the Xpandomer by the DNA polymerase, indicating that the Xpandomer represents a perfect copy of the DNA template. These results show a remarkably dense Xpandomer band on the gel, indicating that the end-capping reaction is also highly efficient during solid-state synthesis. Interestingly, the efficiency of elongation and capping appears to be influenced by the nature of the additives present in the reaction. These results indicate that the solid-state synthesis of Xpandomer can be optimized by trial and error.

[0248] Example 5 Mirrored Library Construct—Ligation of Trident Adapters to Library Inserts This example describes the first step in generating a mirrored library construct of the invention, in which a three-pronged adapter is ligated to a double-stranded DNA library fragment. Figure 24A shows the basic structural features of the construct used in this experiment. The library fragments are double-stranded 60-mer sequences derived from the HIV-2 genome, with the "minus" strand (corresponding to the top strand in the figure) and the "plus" strand (corresponding to the bottom strand in the figure) incorporating 3' single-base overhangs. The polarity of the library strands is indicated by the "5'" number in the figure. The three-pronged adapter, as shown in Figure 24A, is composed of three DNA strands, with the polarity of each strand indicated by the "3'" number. The top and bottom strands of the triplicate are 24-mer oligonucleotides with identical sequences, while the sequence of the oligonucleotide comprising the middle strand is the reverse complement of the top and bottom strand sequences. The top and bottom strands also have 3' single-base overhangs that allow for directional ligation to the library fragments. The 5' ends of the three strands are linked together by a chemical branching agent to form a three-pronged adapter, and the middle and bottom strands form a double-stranded hybrid while the top strand remains single-stranded.

[0249] In this experiment, the ligation reaction was performed in solution using a 5:1 molar ratio of three-pronged adapter to library fragment. The final reaction volume of 15 μL contained the following reagents: ligase reaction buffer, 3 mM ATP, 6% glycerol, 6% 1,2-propanediol, 0.1 μM library fragment, 0.5 μM three-pronged adapter, 1 U / μL PNK, and 120 U / μL DNA ligase. The reaction was carried out at 15°C for 5 minutes, and the ligation products were analyzed by gel electrophoresis in a 6% TBE-U gel stained with SYBR to visualize the products. A representative gel is shown in Figure 24B, where the unligated three-pronged and library reference fragments were run in lane 1, and the ligation reaction products were run in lane 2. As can be seen, the ligated three-pronged / library fragment products are clearly distinguishable from the unligated products. Notably, the band corresponding to the unligated library fragments is very faint in lane 2, indicating that the majority of the library fragments were converted to three-pronged / library ligations.

[0250] Example 6 Mirrored Library Constructs—Extension from Tridentate Adapters and Exonuclease Digestion to Generate Mirrored Library Constructs This example describes the extension and digestion steps in generating a mirrored library construct, shown in simplified form in Figure 25A. In the extension step, the single-stranded top strand of the three-pronged adapter of the M1 construct is used as an extension primer by a DNA polymerase to synthesize a new strand of DNA using the library fragment as a template. Extension of the M1 construct generates the M2 construct in the diagram. For the digestion step, the original template strand of M2 (shown with a 5' notation) is then removed by exonuclease treatment to generate the M3 construct. M3 contains two identical single-stranded copies of the library fragment "plus" strand and is referred to as the "mirrored library construct."

[0251] The extension reaction was carried out using the following reagents: 0.3 pmol M1 ligation product, 0.2 mM dNTPS, and 0.4 U / μL DNA polymerase (Vent® (exo-)) in Thermo Pol reaction buffer. Vent® (exo-) was selected as the DNA polymerase for the extension reaction based on the absence of exonuclease activity and strong strand displacement activity. The extension reaction (total volume 5 μL) was incubated at 95°C for 2 min with an initial incubation time of 1 min. It was subjected to a denaturation step, followed by 25 cycles of 95° C. for 15 seconds and 72° C. for 6 seconds. After the denaturation / extension cycles, the reaction was quenched, denatured, and run on a gel to visualize the extension products.

[0252] For the digestion reaction, 0.3 pmol of M2 extension product was treated with lambda exonuclease (1 U / µL) in lambda exonuclease reaction buffer. After exonuclease addition, the digestion reaction (total volume 10 µL) was performed for 5 min. The digestion products were analyzed by gel electrophoresis as described above. The results of a representative experiment are shown in Figure 25B. Lane 1 of the gel shows the M1 reference product (0.2 pmol product / lane), while lanes 2 and 3 show the products of the extension and digestion reactions, respectively. The large band in lane 2 demonstrates successful conversion of the M1 ligation product to the larger M2 extension product, while the smaller band in lane 3 demonstrates successful conversion of the M2 extension product to the M3 digestion product.

[0253] Example 7 Solid-state synthesis of M1 mirrored library constructs This example describes a workflow for constructing an M1 construct on a solid support. The workflow is simplified and shown in Figure 26A. In the following experiment, a Y-adapter ("YAD") was first covalently attached to the support using click chemistry. Library fragments and a three-pronged adapter were then ligated to the attached YAD to generate the M1 construct on the support. M1 was finally released from the support by cleavage of the photolabile bond between the YAD and the support.

[0254] A. Click-conjugation of YAD to solid support

[0255] A commercially available continuous-flow PCR chip made of Zeonor (a cycloolefin thermoplastic polymer) was used as the solid support in this experiment. The assay was performed as described in Example 1. The copper click reaction was performed as follows: 60 μL of catalyst mixture was prepared by mixing 3 mM THPTA, 6 mM sodium ascorbate, 1 mM CuSO, 5 mM aminoguanidine, and 10% DMF. 120 μL of substrate mixture was prepared by mixing 10% DMF, 25 mM sodium phosphate, pH 7.0, 50 mol E6 oligonucleotide arm of YAD (linked to an azide moiety), 2.5 mM MgCl, 5 mM aminoguanidine, and 6 mM sodium ascorbate. 30 μL of catalyst mixture was then added to the substrate mixture, and 75 μL of this click mixture was added to the chip, followed by incubation at room temperature for 30 minutes.

[0256] B. Extension of M1 construct

[0257] After the click reaction, the chip was washed with water and solution "10002" (300 mM sodium phosphate, pH 8.0, 1% Tween-20, 0.5% SDS, and 1 mM EDTA). 50 μL of E52 YAD mixture (containing the second oligonucleotide arm of the Y adapter) was prepared by mixing 25 μL of solution "CHB002" (500 mM NHOAc, 2% PEG8K, 1 M urea, and 5% NMS) and 100 pmol E52 oligonucleotide and applied to the chip. The chip was incubated at 30 °C for 20 minutes to allow the E52 oligonucleotide to hybridize to the E6 oligonucleotide. The chip was then washed three times with 300 μL of CHB002.

[0258] To ligate the library fragments and three-pronged adapters to the substrate-bound YAD, prepare 50 μL of ligation reaction mixture by combining 15 pmol library insert (HIV2 60mer), 50 pmol three-pronged adapter, 11 mM ATP, 1 U / μL T4 PNK, and Blunt End / T4 Ligase Master Mix (available from NEB). The ligation mixture was added to the chip, followed by incubation at 16°C for 15 minutes. The ligation mixture was then removed from the chip, and 5 μL of 5'-deadenylase (50,000 U / mL) was added. The ligation mixture was then returned to the chip, followed by incubation at 16°C for 15 minutes. The chip was then washed twice with 300 μL of CHB002, followed by 300 μL of water. 300 μL of 10002 was then added, and the chip was incubated at 37°C for 5 minutes. The chip was then washed three times with 300 μL of CHB002, followed by 300 μL of water. All liquid was then removed from the chip, and 75 μL of water was added.

[0259] To release the bound product from the chip, the photosensitive linkage of YAD to the chip was cleaved by exposing the chip to UV light for 15 minutes with a FireFly curing lamp. The released product was eluted from the chip, and 1% of the recovered material was analyzed by gel electrophoresis. A representative gel is shown in Figure 26B. The sample in lane 1 corresponds to 1% of the material recovered from the chip by photocleavage, while samples in lanes 2-5 are control titrations of purified, uncleaved M1 synthesized in solution. As can be seen, the solid-state synthesis protocol successfully generates a fully assembled M1 mirrored library product.

[0260] Example 8 Sequencing by expansion of mirrored library constructs This example demonstrates proof-of-concept for mirrored library sequencing by extension (SBX). The starting material in this experiment was the M1 product constructed around the HIV2 60-mer library fragment described in Example 7. The extension conditions to generate the M2 product were as follows: approximately 7.5 pmol M1 product, 0.2 mM dNTPs, and 0.16 U / μL Vent polymerase in Thermopol reaction buffer. 37.3 μL of the reaction was incubated at 95°C for 2 minutes and then subjected to 25 cycles of 95°C for 15 seconds and 72°C for 6 seconds. The M2 digestion conditions to generate the M3 product were as follows: 36.68 μL of the extension reaction was treated with 0.26 U / μL lambda exonuclease in lambda exo buffer. The reaction was carried out at 37°C for 5 minutes and then heat-inactivated to generate the M3 mirrored library construct.

[0261] Xpandomer copies of the M3 product were generated by solid-state synthesis. As a first step, the M3 digestion product was hybridized to a microfluidic chip, as shown in Figure 27. In this experiment, the chip was primed by click-coupling of the E52 oligonucleotide, which was designed to hybridize to the top arm of the M3 YAD. The E52 oligonucleotide provided a primer for synthesizing copies of the top strand of the M3 construct, as indicated by the arrow in Figure 27. To hybridize the M3 digestion product to the chip and generate templates for Xpandomer extension, 42.75 μL of the digestion reaction was mixed with 10 pmol E6 oligonucleotide (designed to hybridize to the bottom-strand arm of the YAD and provide a primer for synthesizing bottom-strand copies of the M3 construct) and 10 pmol cap oligonucleotide (designed to hybridize to the M3 three-pronged adapter and provide a free 5' triphosphate for end-capping of each copy of the M3 library fragment) in a hybridization buffer consisting of 200 mM NHOAc, pH 6.62, 2% PEG8K, and 0.25 M urea. Fifty μL of the hybridization reaction was incubated at 95°C for 15 seconds and then added to the chip, which had been preheated to 65°C. The chip was then warmed to 37°C and incubated for 5 minutes.

[0262] A representative gel showing samples from the mirrored library workflow is shown in Figure 28. Lanes 1-3 of the gel show reference samples of purified M1 product (0.5, 0.1, and 0.15 pmol of M1, respectively). Lane 4 represents 1.3% of the extension reaction that produced the M2 product, and lane 5 represents 1.2% of the digestion reaction that produced the M3 product. Lane 6 represents the hybridization reaction. This represents 5% of the M3 material retained on the chip after dephosphorylation. Importantly, despite the presence of secondary products during the digestion reaction, only the intact M3 product was retained on the chip.

[0263] For sequencing by amplification, all steps of Xpandomer synthesis and processing were performed on a microfluidic chip. Xpandomer extension conditions were as follows: 6% NMP, a 1:4 molar ratio of AZ (8-8):AZ (43-43), PEM (43-43), 0.25 M urea, 0.5 M betaine, 80 μM XNTPs, 10 μg SSB, and C4760 polymerase at 42°C for 30 minutes. After extension, the chip was washed. Xpandomer was then cleaved by treating the chip with 200 μL of 7.5 M DCl at 23°C for 30 minutes. The chip was then neutralized and washed. Xpandomer was then modified by adding 300 μL of 125 mM succinic anhydride and incubating at 23°C for 5 minutes. After washing, the Xpandomer was photocleaved from the chip (UV treatment for 15 seconds) and eluted with 100 μL of a solution containing 100 μM NaPO4, 15% ACN, and 5% DMSO. Nanopore sequencing of the Xpandomer product was performed as described in Example 2. A representative nanopore trace from this sample is shown in Figure 29. The trace shows portions of two identical sequence reads, "Read 1" and "Read 2," that reflect the sequence of the HIV2 library fragment (SEQ ID NO: 16). The reads are separated by a signal generated by the capped oligo structure, referred to in the figure as "mirror."

[0264] Example 9 Solid-state Xpandomer synthesis using end-capping on acid-resistant magnetic beads This example demonstrates that solid-state synthesis of Xpandomer on beads is at least as efficient as synthesis in solution. Four different Xpandomer synthesis reactions were performed: 1) in-solution synthesis (fluorescent SIMA dye on the extension oligonucleotide); 2) on-bead synthesis without end-capping (dye on the extension oligonucleotide); 3) on-bead synthesis with end-capping (dye on the end-capped oligonucleotide); and 4) on-bead synthesis using a blocker oligonucleotide instead of an end-cap. The extension oligonucleotide used in this experiment had the following sequence: 5'[azido]D 10 [PC-Spacer] L25 Z6[TCATAAGACGAACGGA (SEQ ID NO: 4)] 3', (where "PC" represents a photocleavable spacer; "D" represents a PEG6 spacer; "L" represents a C2 spacer; and "Z" represents a C12 spacer). Beads were functionalized with alkyne groups and covalently attached to the extension oligonucleotides as discussed herein and with reference to FIG. 5. 4 pmol of on-bead extension oligonucleotide was hybridized to 4 pmol of 100-mer template DNA + / - end cap oligonucleotide. The end cap included in reaction 3 had the following sequence: 3' ddCTPRK[GCGTTAGGTCCCAGTTTTAC (SEQ ID NO: 17)]W 5' and the blocker oligonucleotide included in reaction 4 had the following sequence: 3' RK[GCGTTAGGTCCCAGTGTTTTAC (SEQ ID NO: 18)] x 5', where "R" represents an amidite, "K" represents a G-clamp, "W" represents a SIMA dye, and "X" represents PEG. A 2-fold molar excess of cap or blocker oligo over template DNA was used. All extension reactions contained the following: 50 mM Tris-HCl, 200 mM NHOAc, 20% PEG, 1 M urea (0.25 M for reaction 4), 5% NMS, 10 mM PEM, 0.26 μg / ul DPO4 polymerase mutant, 1.6 mM MnCl, 100 μM dXTP, and 300 μM polyphosphate. Reactions 3 and 4 also contained 0.02% Tween, and reaction 4 also contained 0.5 M betaine. The extension reaction was carried out at 37°C for 60 minutes, and the extension products were analyzed by gel electrophoresis, as shown in Figure 30. As can be seen, on-bead extension (lane 2) is as efficient as in-solution extension (lane 1). Furthermore, end-capping on-beads (lane 3, dye on the end-cap) is also very efficient.

[0265] Example 10 Synthesis and processing of solid-state Xpandomer on acid-resistant magnetic beads This example demonstrates efficient on-bead synthesis and processing of Xpandomer. After primer extension, the Xpandomer product was treated with acid to cleave the phosphoramidate bond and generate extended polymers. The extended products were released from the beads by photocleavage and analyzed by gel electrophoresis.

[0266] Bead functionalization and extension oligonucleotide ligation were performed as described in Example 9. Template DNA was hybridized to extension oligonucleotides at a 1:1 molar ratio (4 pmol each). The extension reaction contained the following: 50 mM Tris-HCl, 200 mM NHOAc, 50 mM TMACl, 50 mM GuCl, 20% PEG, 0.1 M urea, 6% NMP, 15 mM PEM, 0.26 μg / ul DPO4 polymerase mutant, 1.4 mM MnCl, 100 μM dXTP, 0.05 μg / μl Kod single-stranded binding protein, 0.02% SDS, and 300 μM polyphosphate. The extension reaction was carried out at 37°C for 60 minutes. The samples were then washed with buffer B (100 mM HEPES, 100 mM NaHPO, 5% Triton, and 15% DMF), treated with proteinase K at 55 °C for 5 min, and washed again with buffer B. As shown in Figure 31, the samples were acid-cleaved with 7.5 M DCl / 1% Triton, neutralized with buffer B, and modified with succinic anhydride in buffer B. The samples were then washed with buffer E (40% ACN), followed by photocleavage (1' exposure to UV light), and the released Xpandomer products were collected and analyzed by gel electrophoresis. Lane 1 represents Xpandomer products synthesized and processed in solution, while lanes 2-4 represent Xpandomer products synthesized and processed on acid-resistant magnetic beads containing different additives included in the elution buffer (100 mM PI in lane 2; 100 mM GuHCl in lane 3; 100 mM HEPES in lane 4). As can be seen, the on-beads workflow shows improved results over the in-solution workflow as the Xpandomer bands are denser, indicating that the sample is enriched for the full-length product.

[0267] All U.S. patents, U.S. patent application publications, U.S. patent applications, foreign patents, foreign patent applications, and non-patent publications mentioned herein and / or listed in the Application Data Sheets, including, but not limited to, U.S. Provisional Patent Application No. 62 / 808,768, filed February 21, 2019, and U.S. Provisional Patent Application No. 62 / 826,805, filed March 29, 2019, are incorporated by reference herein in their entirety. Such documents may be incorporated by reference, for example, for the purpose of describing and disclosing the materials and methodology described in the publications that might be used in connection with the inventions described herein.

Claims

1. 1. A method for synthesizing copies of a nucleic acid template on a solid support, comprising: (a) immobilizing a linker on the solid support, the linker comprising a first end proximal to the solid support and a second end distal to the solid support, the first end being attached to a maleimide moiety and the second end being attached to an alkyne moiety, the maleimide moiety being crosslinked to the solid support; (b) attaching an oligonucleotide primer to the linker, wherein the oligonucleotide primer comprises a nucleic acid sequence complementary to a portion of the 3' end of the nucleic acid template, and the 5' end of the oligonucleotide primer is coupled to an azide moiety, which reacts with the alkyne moiety to form a triazole moiety; (c) providing a reaction mixture comprising the nucleic acid template, a nucleic acid polymerase, nucleotide substrates, or analogs thereof, a suitable buffer, and optionally one or more additives, wherein the nucleic acid template specifically hybridizes to the oligonucleotide primer; (d) performing a primer extension reaction to generate said copy of said nucleic acid template.

2. 10. The method of claim 1, wherein the maleimide moiety is crosslinked to the solid substrate by a photoinitiated proton abstraction reaction.

3. The method of claim 1 , wherein the solid substrate is composed of a polyolefin.

4. 4. The method of claim 3, wherein the polyolefin is a cyclic olefin copolymer (COC) or polypropylene.

5. The method of claim 1 , wherein the nucleic acid template is a DNA template.

6. 6. The method of claim 5, wherein the copy of the DNA template is an extendable polymer, the extendable polymer comprising a chain of non-natural nucleotide analogs, each non-natural nucleotide analog being operably linked to an adjacent non-natural nucleotide analog by a phosphoramidate ester bond.

7. The method of claim 6 , wherein the expandable polymer is Xpandomer.

8. 2. The method of claim 1, wherein the linker further comprises a spacer arm interposed between the first end and the second end, the spacer arm comprising one or more monomers of ethylene glycol.

9. The method of claim 1 , wherein the linker further comprises a cleavable moiety.

10. 10. The method of claim 1, wherein the solid support is selected from the group consisting of beads, tubes, capillaries, and microfluidic chips.

11. 1. A method for selectively modifying the 3′ end of a copy of a nucleic acid target sequence, comprising: (a) providing a first oligonucleotide having a sequence complementary to a first sequence of the nucleic acid target sequence and a second oligonucleotide having a sequence complementary to a second sequence of the nucleic acid target sequence, wherein the first sequence of the nucleic acid target sequence is 3' to the second sequence of the nucleic acid target sequence, and wherein the first oligonucleotide is a nucleic acid polymerase. providing an extension primer for a nucleic acid polymerase, wherein the 5' end of the second oligonucleotide is operably linked to a dideoxynucleoside 5' triphosphate, the dideoxynucleoside 5' triphosphate providing a substrate for the nucleic acid polymerase; (b) providing a reaction mixture comprising the first and second oligonucleotides, the nucleic acid target sequence, the nucleic acid polymerase, a nucleotide substrate or analog thereof, a suitable buffer, and optionally one or more additives, wherein the first and second oligonucleotides specifically hybridize to the nucleic acid target sequence; (c) performing a primer extension reaction to generate the copy of the target sequence, wherein the 5' end of the second oligonucleotide is operably linked to the 3' end of the copy of the nucleic acid target sequence by the nucleic acid polymerase.

12. 12. The method of claim 11, wherein the dideoxynucleoside 5' triphosphate is operably linked to the 5' end of the second oligonucleotide by a flexible linker.

13. The flexible linker may comprise one or more hexyl (C ６ 13. The method of claim 12, comprising:

14. 14. The method of claim 13, wherein the second oligonucleotide comprises one or more 2' methoxyribonucleic acid analogs.

15. The method of claim 11 , wherein the 3′ end of the second oligonucleotide is immobilized to a first solid support.

16. 16. The method of claim 15, further comprising washing the first solid support to purify the copy of the nucleic acid target operably linked to the second oligonucleotide.

17. 12. The method of claim 11, wherein the first oligonucleotide is immobilized on a first solid support.

18. 18. The method of claim 17, further comprising releasing the copy of the nucleic acid target sequence from the first solid support and contacting the copy of the nucleic acid target sequence with a third oligonucleotide, wherein the third oligonucleotide has a sequence complementary to the sequence of the second oligonucleotide, the third oligonucleotide specifically hybridizes to the second oligonucleotide, and the 5' end of the third oligonucleotide is immobilized on a second solid support.

19. 20. The method of claim 18, further comprising washing the second solid support to purify the copy of the nucleic acid target sequence operably linked at its 3' end to the second oligonucleotide.

20. 12. The method of claim 11, wherein the second oligonucleotide comprises one or more nucleotide analogs that increase the binding affinity of the second oligonucleotide for the nucleic acid target sequence.

21. 12. The method of claim 11, wherein the second oligonucleotide is complementary to a heterologous nucleic acid sequence operably linked to the 5' end of the nucleic acid target sequence.

22. The nucleic acid target sequence is single-stranded DNA, and the copy of the target sequence is an extensible polymerase.

12. The method of claim 11, wherein the extendable polymer is a polymer, wherein the extendable polymer comprises a chain of non-natural nucleotide analogs, each of the non-natural nucleotide analogs being operably linked to an adjacent non-natural nucleotide analog by a phosphoramidate ester bond.

23. 19. The method of claim 11 or claim 18, wherein the first solid support and the second solid support are selected from the group consisting of beads, tubes, capillaries, and microfluidic chips.

24. 1. A method for generating a library of single-stranded DNA template constructs, each of said template constructs comprising two copies of the same strand of a DNA target sequence, said method comprising: (a) providing a population of DNA Y adaptors, each of the Y adaptors comprising a first oligonucleotide and a second oligonucleotide, wherein a 3' region of the first oligonucleotide and a 5' region of the second oligonucleotide form a double-stranded region by sequence complementarity, and wherein the 5' region of the first oligonucleotide and the 3' region of the second oligonucleotide are single-stranded and comprise a binding site for an oligonucleotide primer, and wherein the ends of the single-stranded regions of the first oligonucleotide and the second oligonucleotide are optionally immobilized on a solid substrate; (b) providing a population of double-stranded DNA molecules, each of the double-stranded DNA molecules comprising a first strand and a second strand, wherein a first end of each of the double-stranded DNA molecules is compatible with the double-stranded end of the Y adaptor; (c) providing a population of capped primer adaptors, each of the capped primer adaptors comprising a first oligonucleotide, a second oligonucleotide, and a third oligonucleotide, wherein the second oligonucleotide is interposed between the first oligonucleotide and the third oligonucleotide, the first oligonucleotide, the second oligonucleotide, and the third oligonucleotide are operably linked to the 5' ends of the first oligonucleotide and the third oligonucleotide and the 3' ends of the second oligonucleotide by a chemical branching agent, a portion of the sequence of the first oligonucleotide is identical to a portion of the sequence of the third oligonucleotide, a portion of the sequence of the second oligonucleotide is the reverse complement of a portion of the sequence of the first oligonucleotide and the third oligonucleotide, and the 5' end of the second oligonucleotide and the 3' end of the third oligonucleotide form a double-stranded region compatible with each second end of the double-stranded DNA molecule; (d) ligating the second end of each of the double-stranded DNA molecules to the 5' end of the second oligonucleotide and the 3' end of the third oligonucleotide of one of the cap primer adapters; (e) ligating the first end of each of the double-stranded DNA molecules to the double-stranded end of one of the DNA Y adaptors; (f) extending from the 3' end of the first oligonucleotide of each of the ligated cap primer adapters with a DNA polymerase, wherein the first strand of the ligated double-stranded DNA molecule provides a template for the DNA polymerase, and the DNA polymerase generates a third strand comprising the reverse complement of the sequence of the first strand of the double-stranded DNA molecule and the sequence of the first oligonucleotide of the Y adapter; (g) digesting with an exonuclease from the 5' end of each of the first oligonucleotides of the ligated Y adaptor, wherein said digesting removes the first oligonucleotide, the first strand of the double-stranded DNA molecule, and the second oligonucleotide of the cap primer adaptor to generate single-stranded template constructs, each of the single-stranded template constructs comprising two template molecules each comprising the sequence of the second strand of the double-stranded DNA molecule, and wherein the two template molecules are separated from the 5' end of the cap primer adaptor. and digesting the first oligonucleotide and the third oligonucleotide of the adapter operably linked by the first oligonucleotide and the third oligonucleotide.

25. 25. A library of single-stranded DNA template constructs, each of the template constructs comprising a first copy and a second copy of the same strand of a DNA target sequence, the first copy and the second copy of the target sequence being operably linked, wherein the library of single-stranded DNA template constructs is generated by the method of claim 24.

26. 1. A method for generating a library of mirrored Xpandomer molecules, each of said Xpandomer molecules comprising two copies of the same strand of a DNA target sequence, said method comprising: (a) providing the library of single-stranded DNA template constructs of claim 25; (b) providing a population of first extend oligonucleotides complementary to the single-stranded portion of the first strand of the Y adaptor and a population of second extend oligonucleotides complementary to the single-stranded portion of the second strand of the Y adaptor, wherein the first extend oligonucleotides or the second extend oligonucleotides are optionally immobilized on a solid substrate; (c) specifically hybridizing the library of single-stranded DNA template constructs to the population of the first extend oligonucleotides and the population of the second extend oligonucleotides; (d) providing a population of capped branch constructs, the capped branch constructs comprising a first oligonucleotide operably linked to a second oligonucleotide, the first oligonucleotide and the second oligonucleotide comprising sequences complementary to a portion of the sequences of the first oligonucleotide and the third oligonucleotide of the capped primer adapter construct, and the first oligonucleotide and the second oligonucleotide of the capped branch construct providing a free 5' nucleoside triphosphate moiety; (e) specifically hybridizing the population of cap-branched constructs to the population of single-stranded DNA template constructs; (f) performing a primer extension reaction to generate Xpandomer copies of the first copy and the second copy of the DNA target sequence, wherein the Xpandomer copies are operably linked by the cap-branch construct.

27. 1. A method for generating a library of tagged double-stranded DNA amplicons on a solid support, comprising: (a) providing a population of double-stranded DNA molecules, each of the double-stranded DNA molecules comprising a first strand specifically hybridized to a second strand; (b) providing a forward PCR primer and a reverse PCR primer, wherein the forward PCR primer comprises a first 5' heterologous tag sequence operably linked to a 3' sequence complementary to a portion of the 3' end of the second strand of the double-stranded DNA molecule, and the reverse PCR primer comprises a second 5' heterologous tag sequence operably linked to a 3' sequence complementary to a portion of the 3' end of the first strand of the double-stranded DNA molecule; (c) performing a first PCR reaction in which the population of double-stranded DNA molecules is amplified to produce a population of first DNA amplicon products, the first DNA amplicon products comprising the first heterologous sequence tag at a first end and a second heterologous sequence tag at a second end; (d) providing a capture oligonucleotide structure immobilized on a solid support. providing a capture oligonucleotide structure, the capture oligonucleotide structure comprising a first end and a second end, the first end being covalently attached to the solid support and the second end comprising a capture oligonucleotide comprising a sequence complementary to a portion of the second heterologous sequence tag of the first population of DNA amplicon products, the capture oligonucleotide structure further comprising a cleavable element interposed between the first end and the capture oligonucleotide; (e) performing a second PCR reaction comprising the first population of DNA amplicon products, a forward primer comprising a sequence complementary to one strand of the first heterologous sequence tag, and a reverse primer comprising a sequence complementary to one strand of the second heterologous sequence tag, wherein a first strand of the first population of DNA amplicon products specifically hybridizes to the capture oligonucleotide, and the second PCR reaction produces a population of immobilized DNA amplicon products, the second strand of the immobilized DNA amplicon products being operably linked to the solid support.

28. 1. A method for generating a library of single-stranded DNA template constructs, each of said template constructs comprising two copies of the same strand of a DNA target sequence, said method comprising: (a) providing a library of DNA amplicon products immobilized on a solid support according to claim 27; (b) providing a population of capped primer adapters, each of the capped primer adapters comprising a first oligonucleotide, a second oligonucleotide, and a third oligonucleotide, wherein the second oligonucleotide is interposed between the first oligonucleotide and the third oligonucleotide, the first oligonucleotide, the second oligonucleotide, and the third oligonucleotide are operably linked to a 5' end of the first oligonucleotide and the third oligonucleotide and a 3' end of the second oligonucleotide by a chemical branching agent, a portion of the sequence of the first oligonucleotide is identical to a portion of the sequence of the third oligonucleotide, a portion of the sequence of the second oligonucleotide is a reverse complement of a portion of the sequence of the first oligonucleotide and the third oligonucleotide, and the 5' end of the second oligonucleotide and the 3' end of the third oligonucleotide form a double-stranded region compatible with each free end of the tagged, immobilized DNA amplicon product; (c) ligating each free end of the immobilized DNA amplicon product to the 5' end of the second oligonucleotide and the 3' end of the third oligonucleotide of the cap primer adapter; (d) extending from the 3' end of each of the first oligonucleotides of the cap primer adapter with a DNA polymerase, wherein the second strand of the immobilized DNA amplicon product provides a template for the DNA polymerase, and the DNA polymerase generates a third strand, the third strand being a copy of the second strand; (e) cleaving the cleavable element of each of the capture oligonucleotide structures, releasing the DNA amplicon products from the solid support and generating a free 5' end on the second strand of each of the DNA amplicon products; (f) digesting with an exonuclease from the free 5' end of the cleaved second strand of each of the DNA amplicon products to remove the second strand of the DNA amplicon product and the second oligonucleotide of the cap primer adaptor to generate a library of single-stranded template constructs, each of the single-stranded template constructs comprising two copies of the first strand of the DNA amplicon product operably linked by the first oligonucleotide and the third oligonucleotide of the cap primer adaptor.

29. 29. A library of single-stranded DNA template constructs, each of the template constructs comprising a first copy and a second copy of the same strand of a DNA target sequence, the first copy and the second copy of the DNA target sequence being operably linked, wherein the library of single-stranded DNA template constructs is generated by the method of claim 28.

30. 1. A method for generating a library of mirrored Xpandomer molecules, each of said Xpandomer molecules comprising two copies of the same strand of a DNA target sequence, said method comprising: (a) providing a library of single-stranded DNA template constructs according to claim 29; (b) providing a population of extender oligonucleotides complementary to the second tags of the DNA amplicon products, wherein the extender oligonucleotides are immobilized on a solid substrate; (c) specifically hybridizing the single-stranded DNA template construct to the extend oligonucleotide; (d) providing a population of capped branch constructs, the capped branch constructs comprising a first oligonucleotide operably linked to a second oligonucleotide, the first oligonucleotide and the second oligonucleotide comprising sequences complementary to a portion of the sequences of the first oligonucleotide and the third oligonucleotide of the capped primer adapter construct, and the first oligonucleotide and the second oligonucleotide of the capped branch construct providing a free 5' nucleoside triphosphate moiety; (e) specifically hybridizing the population of cap-branch constructs to the population of DNA template constructs; (f) performing a primer extension reaction to generate Xpandomer copies of the first and second copies of the DNA target sequence, wherein the Xpandomer copies are operably linked to the cap-branch construct.

31. 31. The method of claim 30, wherein the capture oligonucleotide structure and the extend oligonucleotide are immobilized on the same solid support, the extend oligonucleotide comprises a cleavable hairpin structure, and the cleavable hairpin structure is cleaved during the cleaving step to provide a binding site for the DNA amplicon product.

32. 31. The method of claim 30, wherein the capture oligonucleotide structure is immobilized on a first substrate in a first chamber of a microfluidic card, the extend oligonucleotide is immobilized on a second substrate in a second chamber of the microfluidic card, the first chamber configured to generate a population of the single-stranded DNA template construct, and the second chamber configured to generate a population of Xpandomer copies of the single-stranded DNA template construct.

33. 31. The method of claim 30, wherein the capture oligonucleotide structures are immobilized on a bead support, the extension oligonucleotides are immobilized on a COC chip support, the bead support is configured to generate a population of single-stranded DNA template constructs, and the COC chip support is configured to generate a population of Xpandomer copies of the DNA template constructs.

34. wherein the capture oligonucleotide structures and the extender oligonucleotides are immobilized on a bead support, the bead support being configured to generate a population of the single-stranded DNA template constructs and a population of Xpandomer copies of the DNA template constructs.

30. The method according to claim 30.

35. 31. The method of claim 30, wherein the extender oligonucleotide is provided by a branched oligonucleotide structure, the branched oligonucleotide structure comprising a first extender oligonucleotide operably linked to a second extender oligonucleotide by a chemical branching agent, the first extender oligonucleotide comprising a leader sequence, a concentrator sequence, and a first cleavable moiety interposed between the chemical branching agent and the leader sequence and the concentrator sequence, and the second extender oligonucleotide comprising a second cleavable moiety.

Images