Low-immunogenic cell

Genome editing to delete HLA class Ia and II genes and introduce PD-L1, PD-L2, and B2M in pluripotent stem cells addresses immune rejection, creating low-immunogenic cells suitable for allogeneic therapies.

JP2025176117APending Publication Date: 2025-12-03HEALIOS KK
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
JP2025145433
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2020-05-26
Filing Date
2025-09-02
Publication Date
2025-12-03

AI Technical Summary

Technical Problem

Current methods for producing low-immunogenic pluripotent stem cells face challenges in effectively addressing immune rejection and ensuring functional safety, with existing gene deletions leading to vulnerabilities and incomplete immune evasion.

Method used

Genome editing is employed to delete endogenous genes encoding HLA class Ia and II, introduce exogenous genes for HLA class Ib, PD-L1, and PD-L2, and optionally B2M, to create pluripotent stem cells with enhanced immune evasion and differentiation potential.

Benefits of technology

The resulting cells exhibit low immunogenicity, resisting immune rejection and maintaining pluripotency, suitable for allogeneic cell therapies with reduced immune activation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025176117000001
    Figure 2025176117000001
  • Figure 2025176117000002
    Figure 2025176117000002
  • Figure 2025176117000003
    Figure 2025176117000003
Patent Text Reader

Abstract

To provide a low-immunogenic human cell having high functionality, and a method for producing the low-immunogenic human cell.SOLUTION: The present invention provides a highly functional low-immunogenic cell, namely, a low-immunogenic human cell that (1) lacks an endogenous gene encoding an α chain of human leukocyte antigen (HLA) class Ia, (2) lacks an endogenous gene encoding HLA class II or an expression regulatory factor thereof, (3) includes an exogenous gene encoding an α chain of HLA class Ib, (4) includes an exogenous gene encoding human PD-L1, and (5) includes an exogenous gene encoding human PD-L2.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present disclosure relates to genetically modified human pluripotent stem cells with extremely low immunogenicity and methods for producing such cells. [Background technology]

[0002] In humans, major histocompatibility complexes (MHCs) are known as human leukocyte antigens (HLA) and are expressed in most cells and tissues. HLAs primarily consist of six antigen loci: A, B, C, DR, DQ, and DP. Each of these is further composed of complex combinations of dozens of different types (alleles), resulting in tens of thousands of possible combinations. HLAs play an important role in the immune system within the human body, and their primary role is to present antigens for self- and non-self-recognition. If non-self cells or tissues are transplanted into another person (allotransplantation), these HLAs are recognized as the most important antigens (foreign substances) by immune cells such as cytotoxic T cells (CTLs), resulting in rejection and failure of the graft to take hold. Therefore, although most of the cell medicines currently on the market are autologous cell products, it is believed that the use of allogeneic cells will be essential for the widespread use of cell medicines, and for this purpose, it will be necessary to overcome the problem of immune rejection.

[0003] The Center for iPS Cell Research and Application at Kyoto University is attempting to solve this problem by stockpiling several types of iPS cells established from HLA-homologous donors. As of 2019, they have already created iPS cells with four HLA types that are common in Japanese people, and they claim that this stock of iPS cells will cover approximately 40% of the Japanese population. However, this method makes it extremely difficult to obtain cells that cover everyone, and it is extremely expensive. Furthermore, the possibility of immune rejection cannot be completely eliminated.

[0004] Meanwhile, attempts to produce low-immunogenic cells by deleting HLA genes have been made for a long time. For example, CellGenesis has disclosed genetically modified cells that lack at least one MHC antigen (Patent Document 1). Morphogenesis has also disclosed a method for producing human stem cells that have been depleted of the HLA-B and HLA-C genes (Patent Document 2). In recent years, the rapid spread and development of genome editing technology has made it possible to easily and accurately modify the genes of cells, and an increasing number of companies are entering the regenerative medicine and cell-based pharmaceutical fields. As a result, attempts to produce low-immunogenic pluripotent stem cells are progressing rapidly.

[0005] Universal Cell (acquired by Astellas Pharma) and the University of Washington are developing universal donor cells obtained by deleting the B2M and RFXANK genes in pluripotent stem cells (Patent Documents 3 and 4). The University of California has also developed hypoimmunogenic iPS cells by deleting the B2M and CIITA genes and overexpressing CD47 (Non-Patent Document 1). Meanwhile, Harvard University has disclosed therapeutic cells obtained by deleting the B2M gene or CIITA gene, or by knocking in the PD-L1 gene or HLA-G gene (Patent Document 5). Kyoto University has produced human iPS cells in which only the HLA-A and HLA-B genes have been individually deleted, as well as the CIITA gene (Non-Patent Document 2).

[0006] In this way, various hypoimmunogenic cells have been produced by deleting and introducing various genes, including HLA genes. However, there have been few detailed analyses of how the deletion of HLA genes affects the expression of other genes involved in immune rejection. Furthermore, there have been few analyses of which genes should be knocked in to obtain more highly functional hypoimmunogenic cells. Given these current circumstances, there is still a need for highly functional hypoimmunogenic cells. [Prior art documents] [Patent documents]

[0007] [Patent Document 1] International Publication No. 1995 / 017911 [Patent Document 2] International Publication No. 98 / 42838 [Patent Document 3] International Publication No. 2016 / 183041 [Patent Document 4] International Publication No. 2012 / 145384 [Patent Document 5] International Publication No. 2013 / 158292 [Non-patent literature]

[0008] [Non-Patent Document 1] Tobias Deuse et al., Nature Biotechnology, volume 37, pages 252-258, 2019 [Non-patent document 2] Huaigeng Xu et al., Cell Stem Cell, 24, 1-13, 2019 Summary of the Invention [Problem to be solved by the invention]

[0009] Highly functional, low immunogenic cells are needed. [Means for solving the problem]

[0010] The inventors believed that producing low-immunogenic cells to replace stock iPS cells could contribute to the development of allogeneic cell medicines, and used genome editing tools to examine combinations of proteins involved in various immune rejection reactions. First, to avoid CTL-mediated immune responses, the inventors deleted the endogenous genes encoding the α chains of HLA class Ia (HLA-A, HLA-B, and HLA-C), which bind to the T cell receptor (TCR) of CTLs. Furthermore, to delete HLA class II, which binds to the TCR of helper T cells, they deleted the endogenous gene encoding RFXANK, a transcriptional regulator of HLA class II genes. Cells lacking these genes were generally thought to be immune-resistant. However, unexpectedly, they also lost expression of intact HLA class Ib (HLA-E). Cells lacking HLA class Ib are vulnerable to attack by NK cells, making them unsuitable as a cell source for transplantation. Therefore, the need arose for introducing a gene encoding HLA class Ib. To address this need, the inventors introduced a gene encoding HLA class Ib, as well as genes encoding PD-L1 and PD-L2, which bind to PD-1 and PD-2 on CTLs and suppress CTL activity. Ultimately, they demonstrated that the expression level of HLA class I could be increased by further introducing a gene encoding the common light chain β2 microglobulin (B2M) shared by HLA class Ia and HLA class Ib. As a result of these findings, the inventors have discovered that by deleting the endogenous genes encoding the α chains of HLA class Ia molecules HLA-A, HLA-B, and HLA-C, deleting the endogenous gene encoding RFXANK in human pluripotent stem cells, and then introducing into the genome exogenous genes encoding PD-L1 and PD-L2, exogenous genes encoding the α chains of HLA class Ib molecules HLA-E and / or HLA-G, and an exogenous gene encoding β2-microglobulin, it is possible to produce human pluripotent stem cells that are highly safe and retain the ability to induce differentiation. Based on these findings, the inventors have conducted further intensive research and have completed the present invention.

[0011] That is, the present invention provides the following. [1] (1) A gene encoding the α chain of human leukocyte antigen (HLA) class Ia is deleted. (2) Defective in the endogenous gene encoding HLA class II or its expression regulator; (3) containing an exogenous gene encoding the α chain of HLA class Ib; (4) containing an exogenous gene encoding human PD-L1; and (5) Contains an exogenous gene encoding human PD-L2 Low immunogenic human cells. [2] The cell described in [1], which does not express endogenous HLA class Ib on the cell surface. [3] A cell according to [1] or [2], wherein the endogenous gene encoding the α chain of HLA class Ia is an endogenous gene encoding the α chain of HLA-A, an endogenous gene encoding the α chain of HLA-B, and an endogenous gene encoding the α chain of HLA-C. [4] The cell according to any one of [1] to [3], wherein the endogenous gene encoding HLA class II or an expression regulator thereof is (a) or (b) below: (a) endogenous genes encoding the α and / or β chains of HLA-DP, endogenous genes encoding the α and / or β chains of HLA-DQ, endogenous genes encoding the α and / or β chains of HLA-DR, endogenous genes encoding the α and / or β chains of HLA-DM, and endogenous genes encoding the α and / or β chains of HLA-DO; (b) An endogenous gene encoding human RFXANK, an endogenous gene encoding human RFX5, an endogenous gene encoding human RFXAP, or an endogenous gene encoding human CIITA. [5] A cell described in any one of [1] to [4], wherein the exogenous gene encoding the α chain of HLA class Ib is an exogenous gene encoding the α chain of HLA-E and / or an exogenous gene encoding the α chain of HLA-G. [6] (6) The cell according to any one of [1] to [5], which contains an exogenous gene encoding human β2 microglobulin. [7] (7) A cell according to any one of [1] to [6], which contains a suicide gene. [8] The cell according to any one of [1] to [7], wherein the site containing the exogenous gene or suicide gene is a safe harbor region of the genome. [9] The cell according to [8], wherein the safe harbor region is the AAVS1 region, the CCR5 region, or the ROSA26 region.

[10] The cells according to any one of [1] to [9], wherein the low immunogenic human cells are pluripotent stem cells or differentiated cells thereof.

[11] A method for producing low immunogenic human cells, comprising the steps of: (i) deleting the endogenous gene encoding the α chain of HLA class Ia in a human parent cell; (ii) deleting an endogenous gene encoding HLA class II or an expression regulator thereof from a human parent cell; (iii) introducing an exogenous gene encoding the α chain of HLA class Ib into a human parent cell; (iv) introducing an exogenous gene encoding human PD-L1 into a human parent cell; and (v) introducing an exogenous gene encoding human PD-L2 into a human parent cell.

[12] The method according to

[11] , wherein the low-immunogenic human cells do not express endogenous HLA class Ib on the cell surface.

[13] The method according to

[11] or

[12] , wherein the endogenous gene encoding the α chain of HLA class Ia is an endogenous gene encoding the α chain of HLA-A, an endogenous gene encoding the α chain of HLA-B, and an endogenous gene encoding the α chain of HLA-C.

[14] The method according to any one of

[11] to

[13] , wherein the endogenous gene encoding HLA class II or an expression regulator thereof is (a) or (b) below: (a) endogenous genes encoding the α and / or β chains of HLA-DP, endogenous genes encoding the α and / or β chains of HLA-DQ, endogenous genes encoding the α and / or β chains of HLA-DR, endogenous genes encoding the α and / or β chains of HLA-DM, and endogenous genes encoding the α and / or β chains of HLA-DO; (b) An endogenous gene encoding human RFXANK, an endogenous gene encoding human RFX5, an endogenous gene encoding human RFXAP, or an endogenous gene encoding human CIITA.

[15] The method according to any one of

[11] to

[14] , wherein the exogenous gene encoding the α chain of HLA class Ib is an exogenous gene encoding the α chain of HLA-E and / or an exogenous gene encoding the α chain of HLA-G.

[16] The method according to any one of

[11] to

[15] , further comprising the following steps: (vi) introducing an exogenous gene encoding human β2 microglobulin into a human parent cell;

[17] The method according to any one of

[11] to

[16] , further comprising the following steps: (vii) introducing a suicide gene into a human parent cell;

[18] The method according to any one of

[11] to

[17] , wherein the site where the exogenous gene or suicide gene is introduced is a safe harbor region of the genome.

[19] The method according to

[18] , wherein the safe harbor region is the AAVS1 region, the CCR5 region, or the ROSA26 region.

[20] The method according to any one of

[11] to

[19] , wherein the human parent cell is a pluripotent stem cell or a differentiated cell thereof. [Effects of the Invention]

[0012] Human pluripotent stem cells can be obtained by deleting the endogenous genes encoding the α chains of HLA class Ia (HLA-A, HLA-B, and HLA-C), deleting the endogenous gene encoding the HLA class II transcription factor RFXANK, and introducing exogenous genes encoding the immune checkpoint proteins PD-L1 and PD-L2 into the genome. To complement the lack of endogenous HLA class Ib expression, exogenous genes encoding the α chains of HLA-E and / or HLA-G can be introduced into the genome. This allows for the production of human pluripotent stem cells that retain differentiation induction potential and exhibit low immunogenicity. Furthermore, the inventors discovered that the additional introduction of an exogenous gene encoding B2M into the genome can enhance HLA class Ib expression, resulting in an unexpectedly improved immunogenicity of the cells. Based on these findings, the inventors successfully produced the low immunogenic cells of the present invention. Additionally, the introduction of a suicide gene into the genome makes it possible to induce apoptosis at will. The low immunogenic cells obtained by the present invention still maintained pluripotency and could be induced to differentiate into any cell type.

[0013] The hypoimmunogenic cells obtained by the present invention can be used as a raw material for allogeneic cell-based medicines. Transplantation of cells obtained by inducing differentiation of these cells does not result in rejection by T cells or NK cells from the recipient, or the degree of immune rejection is extremely low. Furthermore, the hypoimmunogenic cells suppress the activation of antigen-presenting cells such as B cells, macrophages, monocytes, and dendritic cells. Therefore, these cells can be safely used in transplantation medicine and cell therapy. [Brief explanation of the drawings]

[0014] [Figure 1] FIG. 1 shows the results of gene editing of HLA class Ia-deficient iPS cell clone 2E1. [Figure 2] FIG. 1 shows the results of flow cytometry analysis of the cell surface expression level of HLA class I in clone 2E1. [Figure 3] FIG. 1 shows the results of flow cytometry analysis of the cell surface expression level of HLA-E in clone 2E1. [Figure 4] FIG. 1 shows the results of flow cytometry analysis of the cell surface expression levels of undifferentiation markers in clone 2E1. [Figure 5] FIG. 1 shows the results of analyzing RNA expression patterns in clone 2E1 and the second candidate clone (2H3). [Figure 6] FIG. 1 shows the results of gene editing of HLA class Ia&II-deficient iPS cell clone 6B7. [Figure 7] FIG. 1 shows the results of flow cytometry analysis of the cell surface expression level of HLA class I in clone 6B7. [Figure 8] FIG. 1 shows the results of flow cytometry analysis of the cell surface expression level of HLA class II in clone 6B7. [Figure 9] FIG. 1 shows the results of flow cytometry analysis of the cell surface expression level of HLA-E in clone 6B7. [Figure 10] FIG. 1 shows the results of flow cytometry analysis of the cell surface expression levels of undifferentiation markers in clone 6B7. [Figure 11] FIG. 1 shows the results of analyzing the RNA expression pattern in clone 6B7. [Figure 12] FIG. 1 shows the results of analyzing the amount of urea synthesis in hepatocytes differentiated from clone 6B7 (A) and the results of analyzing the angiogenic ability of vascular endothelial cells differentiated from clone 6B7 (B). [Figure 13] This figure shows the results of flow cytometry analysis of the cell surface expression levels of PD-L1, PD-L2, HLA-G, and B2M in iPS cell clone 9G11, which is HLA class Ia & II deficient and has been transfected with PD-L1, PD-L2, HLA-G, B2M, and iCasp9 genes. [Figure 14]FIG. 1 shows the results of flow cytometry analysis of the cell surface expression levels of HLA-A, HLA-B, HLA-C, and HLA class II in blood cells derived from clone 9G11 iPS cells. [Figure 15] Figure 1 shows the results of flow cytometry analysis of the cell surface expression levels of PD-L1, PD-L2, HLA-G, and B2M in blood cells derived from clone 9G11 iPS cells. [Figure 16] FIG. 1 shows the results of flow cytometry analysis of the cell surface expression levels of undifferentiation markers in clone 9G11. [Figure 17] FIG. 1 shows the results of karyotype analysis of clone 9G11. [Figure 18] A: A diagram showing the cell morphology of hepatocytes differentiated from clone 9G11 and the results of analyzing urea synthesis; B: A diagram showing the cell morphology of vascular endothelial cells differentiated from 6B7 and the results of analyzing their angiogenic ability. [Figure 19] FIG. 1 shows the proliferation rates of T cells (CD4-positive cells and CD8-positive cells) relative to CD45-positive cells differentiated from clone 9G11. [Figure 20] FIG. 1 shows the cytotoxic activity of T cells (CD8-positive cells) against CD45-positive cells differentiated from clone 9G11. [Figure 21] FIG. 1 shows the cytotoxic activity of NK cells against clone 9G11. [Figure 22] FIG. 1 shows the change in cell viability due to the addition of rapamycin to confirm the function of the suicide gene of clone 9G11. [Figure 23] FIG. 1 shows that forced expression of an exogenous B2M gene increases the expression level of the HLA-G gene in HLA class Ia&II-deficient iPS cells. DETAILED DESCRIPTION OF THE INVENTION

[0015] The present invention will be described in detail below.

[0016] The present invention provides low immunogenic human cells (hereinafter referred to as low immunogenic human cells of the present invention) having the following characteristics (1) to (5): (1) The endogenous gene encoding the α chain of HLA class Ia is deleted. (2) They lack the endogenous genes encoding HLA class II or its expression regulators. (3) Contains an exogenous gene encoding the α chain of HLA class Ib. (4) Contains an exogenous gene encoding human PD-L1. (5) Contains an exogenous gene encoding human PD-L2.

[0017] The hypoimmunogenic human cells of the present invention refer to cells that, when introduced into a recipient's body, are not recognized as non-self by the recipient and thus do not initiate an immune rejection reaction that would normally occur, are not attacked by the recipient's T cells or NK cells, suppress the activation of antigen-presenting cell populations, or, even if an immune rejection reaction does occur, have a significantly low reactivity. In other words, the hypoimmunogenic human cells of the present invention are cells that are immunotolerant to the recipient's immune system. The low immunogenic human cells of the present invention have acquired immune tolerance to the recipient's immune system by deleting the endogenous genes (1) and (2) above and introducing the exogenous genes (3), (4), and (5) above, and therefore can be used as a cellular pharmaceutical for the recipient.

[0018] The low immunogenic human cells of the present invention are not particularly limited as long as they are cells into which the endogenous genes (1) and (2) above can be deleted and the exogenous genes (3), (4), and (5) above can be introduced. Examples of such cells include pluripotent stem cells. Pluripotent stem cells include embryonic stem cells (ES cells), induced pluripotent stem cells (iPS cells), embryonic tumor cells (EC cells), and embryonic germ stem cells (EG cells), with ES cells or iPS cells being preferred.

[0019] When the pluripotent stem cells are ES cells, they can be prepared by a method known per se. Methods for producing ES cells include, for example, a method for culturing the inner cell mass of a human blastocyst stage embryo (see, for example, Manipulating the Mouse Embryo: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press (1994)), a method for culturing early embryos produced by somatic cell nuclear transfer (Wilmut et al., Nature, 385, 810 (1997); Cibelli et al., Science, 280, 1256 (1998); Akira Iritani et al., Proteins, Nucleic Acids, and Enzymes, 44, 892 (1999); Baguisi et al., Nature Biotechnology, 17, 456 (1999); Wakayama et al., Nature, 394, 369 (1998); Wakayama et al., Nature Genetics, 22, 127 (1999); Wakayama et al., Proc. Natl. Acad. Sci. USA, 96, 14984 (1999); Rideout III et al., Nature Genetics, 24,109 (2000)). ES cells can be obtained from designated institutions or commercially available. For example, human ES cell lines H1, H7, H9, H13, and H14 are available from the WiCell Research Institute in the United States; HES1-6 are available from ES Cell International in Australia; SA002, SA181, and SA611 are available from Cellartis AB in Sweden; HUES1-17 are available from the HUES Cell Facility in the United States; KhES-1 to KhES-5 are available from the Institute for Frontier Medical Sciences, Kyoto University; and SEES1-SEES7 are available from the National Center for Child Health and Development. When ES cells are produced by somatic cell nuclear transfer, the type of somatic cell and the source from which the somatic cells are collected are the same as those for producing iPS cells, described below.

[0020] When the pluripotent stem cells are iPS cells, they can be generated by introducing a nuclear reprogramming substance into a somatic cell. The somatic cells that can be used as the starting material for generating iPS cells may be any cells other than human germ cells. Examples include keratinizing epithelial cells (e.g., keratinizing epidermal cells), mucosal epithelial cells (e.g., epithelial cells of the tongue surface), exocrine gland epithelial cells (e.g., mammary gland cells), hormone-secreting cells (e.g., adrenal medullary cells), metabolic / storage cells (e.g., hepatocytes), luminal epithelial cells that form interface surfaces (e.g., type I alveolar cells), luminal epithelial cells of the inner chain ducts (e.g., vascular endothelial cells), ciliated cells with transport capacity (e.g., airway epithelial cells), cells that secrete extracellular matrix (e.g., fibroblasts), contractile cells (e.g., smooth muscle cells), cells of the blood and immune system (e.g., T lymphocytes), sensory cells (e.g., rod cells), autonomic nervous system neurons (e.g., cholinergic neurons), supporting cells of sensory organs and peripheral neurons (e.g., companion cells), neurons and glial cells of the central nervous system (e.g., astrocytes), pigment cells (e.g., retinal pigment epithelial cells), and their precursor cells (tissue precursor cells). There are no particular limitations on the degree of differentiation of cells, and both undifferentiated progenitor cells (including somatic stem cells) and terminally differentiated mature cells can be used as the source of somatic cells in the present invention. Examples of undifferentiated progenitor cells include tissue stem cells (somatic stem cells) such as adipose-derived stromal (stem) cells, neural stem cells, hematopoietic stem cells, mesenchymal stem cells, and dental pulp stem cells.

[0021] As nuclear reprogramming substances introduced into somatic cells to generate iPS cells, various combinations of reprogramming genes have been reported so far (e.g., WO2007 / 069666, Nature Biotechnology, 26, 101-106 (2008), Cell, 126, 663-676 (2006), Cell, 131, 861-872 (2007), Nat. Cell Biol., 11, 197-203 (2009), Nature, 451, 141-146 (2008), Science, 318, 1917-1920 (2007), Stem Cells, 26, 1998-2005 (2008), Cell Research (2008) 600-603, Nature 454: 646-650). (2008), Cell Stem Cell, 2: 525-528(2008), WO2008 / 118820, Nat. Cell Biol., 11, 197-203(2009), Nat. Cell Biol., 11, 197-203(2009), Science, 324: 797-801(2009)). In addition, proteins encoded by the above-mentioned reprogramming genes can also be introduced into somatic cells as nuclear reprogramming substances (Cell Stem Cell, 4: 381-384(2009), Cell Stem Cell, doi:10.1016 / j.stem.2009.05.005(2009)).

[0022] iPS cell colonies can be selected using drug resistance and reporter activity as indicators (Cell, 126, 663-676 (2006), Nature, 448, 313-317 (2007)) or by visual morphological observation (Cell, 131, 861-872 (2007)). Identification of iPS cells can be confirmed using the expression of various ES cell-specific genes and teratoma formation as indicators.

[0023] Currently, there are various methods for generating iPS cells (iPSCs). These include the method established by Yamanaka et al. by introducing four factors, Oct3 / 4, Sox2, Klf4, and c-Myc, into mouse fibroblasts (Takahashi K, Yamanaka S., Cell, (2006) 126: 663-676), human cell-derived iPSCs established by introducing the same four factors into human fibroblasts (Takahashi K, Yamanaka S., et al. Cell, (2007) 131: 861-872), Nanog-iPSCs established by selecting using Nanog expression as an indicator after introducing the above four factors (Okita, K., Ichisaka, T., and Yamanaka, S. (2007). Nature 448, 313-317), and iPSCs generated using a method that does not include c-Myc (Nakagawa M, Other methods that can be used include iPSCs established by introducing six factors using a virus-free method (Yamanaka S., et al. Nature Biotechnology, (2008) 26, 101-106), and iPSCs established by introducing six factors using a virus-free method (Okita K et al. Nat. Methods 2011 May;8(5):409-12, Okita K et al. Stem Cells. 31(3):458-66.). Alternatively, methods for producing iPSCs such as those described by Thomson et al., which were established by introducing four factors, OCT3 / 4, SOX2, NANOG, and LIN28 (Yu J., Thomson JA. et al., Science (2007) 318: 1917-1920), those described by Daley et al. (Park IH, Daley GQ. et al., Nature (2007) 451: 141-146), and those described by Sakurada et al. (JP Patent Publication No. 2008 / 307007) can also be used. As induced pluripotent stem cell lines, any of the various human iPSC lines established by the NIH, RIKEN, Kyoto University, etc. can be used, such as RIKEN's HiPS-RIKEN-1A, HiPS-RIKEN-2A, HiPS-RIKEN-12A, and Nips-B2 lines, and Kyoto University's 253G1, 253G4, 1201C1, 1205D1, 1210B2, 1383D2, 1383D6, 201B7, 409B2, 454E2, 606A1, 610B1, 648A1, 1231A31, and FfI-01s04 lines.

[0024] The low immunogenic human cells of the present invention may also be cells differentiated from the pluripotent stem cells that have been deficient in the endogenous genes (1) and (2) above and have been introduced with the exogenous genes (3), (4), and (5) above. Pluripotent stem cells can be differentiated into specific cells according to known methods. For example, pluripotent stem cells can be differentiated into T cells (WO 2016 / 076415 or WO 2017 / 221975), corneal epithelial cells (WO 2016 / 114285), cardiomyocytes (WO 2007 / 126077, WO 2016 / 049099, WO 2016 / 175303, or WO 2017 / 108705), pancreatic β cells (WO 2017 / 126077), and the like. The cells can be differentiated into cells such as hepatocytes (International Publication No. 2019 / 208788), hepatocytes (International Publication No. 2013 / 183571 or International Publication No. 2019 / 073951), skeletal muscle cells (International Publication No. 2010 / 008100, International Publication No. 2014 / 533491 or International Publication No. 2017 / 188458), retinal pigment epithelial cells (International Publication No. 2015 / 053375), etc.

[0025] The hypoimmunogenic human cells of the present invention are deficient in the endogenous gene encoding the α chain of HLA class Ia. HLA class Ia is a transmembrane protein present in all nucleated cells. It has thousands of different polymorphisms, resulting in a high degree of diversity in the HLA class Ia expressed on the cell surface among individuals. This diversity plays a crucial role in distinguishing between self and non-self. HLA class Ia presented on the cell surface is recognized by T cell receptors (TCRs) on the surface of CTLs. Cells presenting recognized HLA class Ia are recognized as foreign by CTLs and eliminated by the immune system. Therefore, cells lacking HLA class Ia expression are suitable as a source of transplant cells because they can avoid recognition by CTLs.

[0026] HLA class Ia is a dimer consisting of an α chain encoded by each HLA class Ia gene and a β chain, which is β2 microglobulin. Here, β2 microglobulin is a common component that associates not only with the α chain of HLA class Ia but also with the α chain of HLA class Ib. Deleting the endogenous gene encoding β2 microglobulin to reduce HLA class Ia expression has been performed in other low-immunogenic cells, but this also reduces HLA class Ib expression, which is inconvenient. Therefore, in the low-immunogenic human cells of the present invention, the endogenous gene encoding the α chain of HLA class Ia is deleted to reduce HLA class Ia expression alone.

[0027] The endogenous gene encoding the α chain of HLA class Ia that is deficient in the low immunogenic human cells of the present invention includes at least one gene selected from the group consisting of an endogenous gene encoding the α chain of HLA-A, an endogenous gene encoding the α chain of HLA-B, and an endogenous gene encoding the α chain of HLA-C, preferably an endogenous gene encoding the α chain of HLA-A, an endogenous gene encoding the α chain of HLA-B, and an endogenous gene encoding the α chain of HLA-C.

[0028] As used herein, deleting an endogenous gene means disrupting or removing the endogenous gene so that it is unable to produce complete mRNA. Specific means for deleting an endogenous gene include isolating genomic DNA from a target cell in which the endogenous gene is to be deleted using standard methods, and then, for example, (1) disrupting the function of the exon or promoter by inserting another DNA fragment (e.g., a drug resistance gene or a reporter gene) into the exon or promoter region of the endogenous gene, (2) deleting the gene by excising all or part of the endogenous gene using the Cre-loxP system or the Flp-frt system, (3) inserting a stop codon into the protein-coding region to disable complete protein translation, or (4) inserting a DNA sequence that terminates gene transcription (e.g., a poly A addition signal) into the transcription region to disable complete mRNA synthesis, thereby inactivating the gene (hereinafter referred to as a gene deletion targeting vector), and integrating the DNA strand having the DNA sequence into the endogenous gene locus of the target cell by homologous recombination.

[0029] The homologously recombinant cells can be obtained, for example, by introducing the above-mentioned targeting vector into a subject cell.

[0030] For example, when a targeting vector for gene deletion is designed to disrupt the function of an exon or promoter region of an endogenous gene by inserting another DNA fragment into the exon or promoter region of the endogenous gene, the vector can be configured, for example, as follows:

[0031] First, since another DNA fragment is inserted into the exon or promoter portion of an endogenous gene by homologous recombination, the targeting vector for gene deletion must contain sequences (5' arm and 3' arm) 5' upstream and 3' downstream of the other DNA fragment that are homologous to the target site, respectively.

[0032] Although there are no particular limitations on the other DNA fragments to be inserted, if a drug resistance gene or a reporter gene is used, target cells in which the gene deletion targeting vector has been integrated into the chromosome can be selected using drug resistance or reporter activity as an indicator. Examples of drug resistance genes include, but are not limited to, the neomycin phosphotransferase II (nptII) gene and the hygromycin phosphotransferase (hpt) gene, and examples of reporter genes include, but are not limited to, the β-galactosidase (lacZ) gene and the chloramphenicol acetyltransferase (cat) gene.

[0033] The drug resistance or reporter gene is preferably under the control of any promoter that can function in the target cells. Examples include viral promoters such as the SV40-derived early promoter, cytomegalovirus (CMV) long terminal repeat (LTR), Rous sarcoma virus (RSV) LTR, murine leukemia virus (MoMuLV) LTR, and adenovirus (AdV)-derived early promoter, as well as the β-actin gene promoter, PGK gene promoter, and transferrin gene promoter. However, when the drug resistance or reporter gene is inserted into an endogenous gene so as to be under the control of the endogenous promoter of the HLA class I gene, a promoter controlling the transcription of the gene is not required in the targeting vector for gene deletion.

[0034] Furthermore, the targeting vector for gene deletion preferably has a sequence (polyadenylation (poly A) signal, also called a terminator) downstream of the drug resistance or reporter gene that terminates transcription of mRNA from the gene. For example, a terminator sequence derived from a viral gene or from various mammalian or avian genes can be used. Preferably, a terminator derived from SV40 is used.

[0035] Typically, genetic recombination in cells is largely non-homologous, with introduced DNA randomly integrated at any chromosomal location. Therefore, selection by detecting drug resistance or reporter gene expression (positive selection) is not sufficient to efficiently select clones in which homologous recombination has occurred at the target site; instead, Southern hybridization or PCR analysis is required to confirm the integration site for all selected clones. Therefore, if, for example, the herpes simplex virus-derived thymidine kinase (HSV-tk) gene, which confers ganciclovir sensitivity, is ligated to the outside of the sequence homologous to the target site of the gene deletion targeting vector, cells into which the vector has been randomly integrated will contain the HSV-tk gene and therefore will be unable to grow in ganciclovir-containing media. However, cells into which homologous recombination has occurred at the endogenous locus will lack the HSV-tk gene and will therefore be resistant to ganciclovir and will be selected (negative selection). Alternatively, if, for example, the diphtheria toxin gene is linked instead of the HSV-tk gene, cells into which the vector has been randomly inserted will be killed by the toxin they themselves produce, making it possible to select homologous recombinants in the absence of drugs.

[0036] Any of the calcium phosphate coprecipitation, electroporation, lipofection, retroviral infection, aggregation, microinjection, gene gun (particle gun), and DEAE-dextran methods can be used to introduce a targeting vector for gene deletion into target cells. However, as mentioned above, most gene recombination in cells is non-homologous, and the frequency of obtaining homologous recombinants is low. Therefore, electroporation is generally chosen because it allows for easy processing of a large number of cells. For electroporation, the same conditions as those used for gene transfer into normal animal cells can be used. For example, target cells in the logarithmic growth phase are treated with trypsin to disperse them into single cells, and then 10 6 ~10 8The cells are suspended in a medium at a concentration of cells / ml and transferred to a cuvette, to which 10 to 100 μg of a targeting vector for gene deletion is added, followed by application of an electric pulse of 200 to 600 V / cm.

[0037] Target cells incorporating a gene-deficient targeting vector can be identified by Southern hybridization or PCR screening of chromosomal DNA isolated from colonies obtained by culturing single cells. However, if a drug resistance gene or reporter gene is used as another DNA fragment, transformants can be selected at the cell stage using their expression as an indicator. For example, if a vector containing the nptII gene is used as a positive selection marker, the target cells after gene transfection are cultured in a medium containing a neomycin-based antibiotic such as G418, and the resulting resistant colonies are selected as candidate transformants. Alternatively, if a vector containing the HSV-tk gene is used as a negative selection marker, the cells are cultured in a medium containing ganciclovir, and the resulting resistant colonies are selected as candidate homologously recombinant cells. The resulting colonies are transferred to culture plates and repeatedly treated with trypsin and exchanged with medium. Some are kept for culture, while the remaining colonies are subjected to PCR or Southern hybridization to confirm the presence of the introduced DNA.

[0038] Furthermore, when a virus is used as a targeting vector for gene deletion, one method involves infecting target cells with a virus containing DNA that has a positive selection marker gene inserted between the 5' and 3' arms and a negative selection marker gene outside the arms. For example, when using a retrovirus or lentivirus, cells are seeded in an appropriate culture vessel such as a dish, the viral vector is added to the culture medium (optionally, polybrene may also be present), and after culturing for 1 to 2 days, a selection agent is added as described above, and the culture is continued to select cells into which the vector has been incorporated.

[0039] Another preferred embodiment for deleting endogenous genes is the CRISPR-Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats CRISPR-Associated proteins 9) system. The CRISPR-Cas9 system uses the genomic DNA cleavage enzyme Cas9 and sgRNA, an RNA molecule that recognizes a targeted site in the genome, to cleave any region in the genomic DNA and introduce a gene mutation. The in / del base changes that occur during the repair process in vivo following genomic DNA cleavage result in a frameshift in the DNA encoding amino acids, resulting in the deletion of the target endogenous gene.

[0040] Cas9 functions as an endonuclease that recognizes protospacer adjacent motif (PAM) sequences in DNA and cleaves them upstream. Cas9 contains two functional domains with endonuclease activity, allowing it to cleave double-stranded DNA to produce blunt ends. Specifically, Cas9 forms a complex with a single-stranded nucleic acid (sgRNA) containing a base sequence (CRISPR-RNA (crRNA)) that specifically binds to an endogenous gene, generating a double-strand break (DSB) 5' to the PAM in the endogenous gene. Therefore, in the present invention, Cas9 refers to a protein that forms a complex with a guide RNA and has double-stranded DNA cleavage activity.

[0041] Examples of Cas9 include, but are not limited to, SpCas9 derived from Streptococcus pyogenes, StCas9 derived from Streptococcus thermophilus, and NmCas9 derived from Neisseria meningitidis.

[0042] Cas9 may also be a mutant Cas9. The mutant Cas9 is not particularly limited as long as it maintains the ability to form a complex with a guide RNA and has a mutation in which one of the two functional domains with endonuclease activity contained in Cas9 is inactivated. Examples of such mutant Cas9 include a mutation in which the 10th aspartic acid of Cas9 is substituted with alanine (D10A mutation), a mutation in which the 840th histidine is substituted with alanine (H840A mutation), and / or a mutation in which the 863rd asparagine is substituted with alanine (N863A mutation). The present invention also includes a Cas9 having one mutation selected from the group.

[0043] The crRNA is not particularly limited as long as it has a base sequence complementary to the endogenous gene and is adjacent to the 5' side of the PAM in the endogenous gene. The length of the crRNA base sequence is not particularly limited as long as it can ensure specificity for the endogenous gene, but is usually 10 to 30 bases long, preferably 15 to 25 bases long, and more preferably 20 bases long.

[0044] The PAM varies depending on the type of Cas9; for example, when Streptococcus pyogenes-derived Cas9 (SpCas9) is used, it is NGG (N is A, G, T, or C; the same applies below), when Streptococcus thermophilus-derived Cas9 (StCas9) is used, it is NNAGAAW, and when Neisseria meningitidis-derived Cas9 (NmCas9) is used, it is NNNNGATT.

[0045] The single-stranded nucleic acid (sgRNA) containing a base sequence that specifically binds to an endogenous gene may further contain a base sequence required for Cas9 recruitment (trans-activating RNA (tracrRNA)). The base sequence of the tracrRNA can be a known base sequence. The tracrRNA may be directly linked to the 3' end of the crRNA, or a spacer sequence may be inserted between them.

[0046] Alternatively, the crRNA and tracrRNA may be associated via complementary binding (i.e., may form a double-stranded nucleic acid). Even when gene editing is performed using such a double-stranded nucleic acid, the method of introduction into target cells described below is the same as when introducing a single-stranded nucleic acid.

[0047] Cas9 and sgRNA can be introduced into target cells by known methods. For example, Cas9 and sgRNA can be introduced into target cells by inserting a nucleic acid sequence encoding Cas9 and a nucleic acid sequence transcribing sgRNA into an appropriate expression vector and then introducing the expression vector into target cells.

[0048] Examples of nucleic acid sequences encoding Cas9 include genomic DNA and synthetic DNA. Genomic DNA encoding Cas9 can be directly amplified by polymerase chain reaction (hereinafter referred to as "PCR") using a primer set complementary to the cas9 gene, using a genomic DNA fraction prepared from the microorganism as a template. Furthermore, nucleic acid sequences transcribing sgRNA can be prepared by DNA synthesis and PCR.

[0049] An expression vector containing a nucleic acid sequence encoding Cas9 and a nucleic acid sequence transcribing sgRNA can be produced, for example, by ligating a nucleic acid sequence fragment encoding Cas9 and a nucleic acid sequence fragment transcribing sgRNA downstream of a promoter in an appropriate expression vector. Examples of expression vectors that can be used include animal cell expression plasmids (e.g., pA1-11, pXT1, pRc / CMV, pRc / RSV, pcDNAI / Neo); and animal virus vectors such as retrovirus, lentivirus, adenovirus, and adeno-associated virus. Any promoter may be used as long as it is suitable for the host used to express the gene. For example, the SRα promoter, SV40 promoter, LTR promoter, CMV (cytomegalovirus) promoter, RSV (Rous sarcoma virus) promoter, MoMuLV (Moloney murine leukemia virus) LTR, HSV-TK (herpes simplex virus thymidine kinase) promoter, etc. are used. Among these, the CMV promoter, SRα promoter, etc. are preferred.

[0050] In addition to the above, the expression vector may optionally contain an enhancer, a poly(A) addition signal, a selection marker, an SV40 replication origin (hereinafter sometimes abbreviated as SV40 ori), etc. Examples of selection markers include the dihydrofolate reductase gene (hereinafter sometimes abbreviated as dhfr, for methotrexate (MTX) resistance) and the neomycin resistance gene (hereinafter sometimes abbreviated as neor, for G418 resistance).

[0051] By introducing an expression vector containing the above-mentioned nucleic acid sequence encoding Cas9 and a nucleic acid sequence transcribing the sgRNA into target cells and culturing them, Cas9 and the sgRNA form a complex in the target cells, cleaving the endogenous gene targeted by the sgRNA. During DSB repair by the non-homologous end joining (NHEJ) pathway, small insertions and / or deletions (ins / dels) are introduced into the endogenous gene, resulting in a frameshift and site-specific mutation or disruption of the endogenous gene.

[0052] Alternatively, the Cas9 protein itself can be used without using the expression vectors described above. The Cas9 protein can be combined with an sgRNA to form a complex, which can then be introduced into target cells to cleave the endogenous gene targeted by the sgRNA. As described above, the low immunogenic human cells of the present invention lack the endogenous gene encoding the α chain of HLA class Ia.

[0053] HLA class II is a transmembrane protein found exclusively on antigen-presenting cells such as macrophages, dendritic cells, and B cells. HLA class II presents peptide antigens derived from extracellular proteins, including extracellular pathogen proteins ingested by immune cells through phagocytosis, on the cell surface. The peptide antigens presented by HLA class II interact with the TCR of CD4+ helper T cells, activating them. Activated T cells recognize and activate B cells that also present peptide antigens via HLA class II, triggering events such as phagocyte recruitment, local inflammation, humoral responses, and CTL activation. Therefore, cells lacking HLA class II expression are suitable as a cell source for transplantation because they avoid the occurrence of these events.

[0054] HLA class II is a dimer consisting of two homologous subunits, the α chain and the β chain. Therefore, in one embodiment, the endogenous genes encoding the α chain and / or the β chain of HLA class II are deleted in the low immunogenic human cells of the present invention to deficiently express HLA class II. The endogenous gene encoding HLA class II that is deficient in the low immunogenic human cells of the present invention includes at least one endogenous gene selected from the group consisting of an endogenous gene encoding the HLA-DP α and / or β chain, an endogenous gene encoding the HLA-DQ α and / or β chain, an endogenous gene encoding the HLA-DR α and / or β chain, an endogenous gene encoding the HLA-DM α and / or β chain, and an endogenous gene encoding the HLA-DO α and / or β chain, preferably an endogenous gene encoding the HLA-DP α and / or β chain, an endogenous gene encoding the HLA-DQ α and / or β chain, an endogenous gene encoding the HLA-DR α and / or β chain, an endogenous gene encoding the HLA-DM α and / or β chain, and an endogenous gene encoding the HLA-DO α and / or β chain.

[0055] Furthermore, the expression of each HLA class II gene is controlled by its expression control factor. The mechanism of expression control is not particularly limited, and the expression (e.g., transcription) may be controlled by directly binding to the target gene, or by indirectly binding to the target gene. For example, RFXANK controls the transcription of each HLA class II gene, which is a target gene, by directly binding to DNA. Therefore, in another embodiment of the low-immunogenic human cells of the present invention, the cells are deficient in endogenous genes encoding HLA class II expression control factors. Examples of endogenous genes encoding HLA class II expression control factors include endogenous genes encoding RFXANK, endogenous genes encoding RFX5, endogenous genes encoding RFXAP, and endogenous genes encoding CIITA, preferably endogenous genes encoding RFXANK.

[0056] Specific means for deleting an endogenous gene encoding HLA class II or an expression regulator thereof may be the same as the means for deleting an endogenous gene encoding HLA class Ia described above.

[0057] The hypoimmunogenic human cells of the present invention contain an exogenous gene encoding the α chain of HLA class Ib.

[0058] HLA class Ib has a wide variety of functions, including the presentation of specific antigens, regulation of NK cell activity, and function as an Fc receptor. It also suppresses the activation of antigen-presenting cells such as B cells, macrophages, monocytes, and dendritic cells. As described above, the low-immunogenic human cells of the present invention are deficient in the endogenous genes encoding the α-chain of HLA class Ia and the endogenous genes encoding HLA class II or its expression regulators, but not the endogenous gene encoding β2-microglobulin. Therefore, it was thought that the expression of endogenous β2-microglobulin was not impaired, and naturally, the expression of endogenous HLA class Ib was also not impaired. However, it was discovered that the expression of intact HLA class Ib (HLA-E) was also lost during the cell production process. Cells that do not express HLA class Ib (HLA-E) are rejected by NK cells, making them unsuitable as a cell source for transplantation. Therefore, to complement the expression of endogenous HLA class Ib, the low-immunogenic human cells of the present invention contain an exogenous gene encoding the α-chain of HLA class Ib.

[0059] The exogenous gene encoding the α-chain of HLA class Ib to be introduced into the low-immunogenic human cells of the present invention is at least one gene selected from the group consisting of exogenous genes encoding the α-chain of HLA-E, HLA-F, and HLA-G, preferably an exogenous gene encoding the α-chain of HLA-E and / or an exogenous gene encoding the α-chain of HLA-G. Furthermore, because the signal peptide of the HLA-G α-chain is important for the expression of HLA-E on the membrane surface, the exogenous gene encoding the α-chain of HLA class Ib to be introduced into the low-immunogenic human cells of the present invention is most preferably an exogenous gene encoding the α-chain of HLA-E or an exogenous gene encoding the α-chain of HLA-G. When the low-immunogenic human cells of the present invention are used as a cell source for transplantation, the exogenous gene encoding the α-chain of HLA class Ib to be introduced is preferably the same as the gene encoding the α-chain of the recipient's HLA class Ib allele.

[0060] As used herein, introducing an exogenous gene means introducing the exogenous gene into a target site in the genome, thereby making the exogenous gene expressible in a target cell. A specific method for introducing an exogenous gene is to isolate the DNA of the exogenous gene according to a conventional method, and then insert a DNA fragment of the exogenous gene into a target site in the target cell, thereby constructing a DNA strand (hereinafter referred to as a targeting vector for gene introduction) having a DNA sequence that is constructed so that the exogenous gene is expressed in the target cell. Since the homologous recombination method fixes the gene insertion site, it is expected that, in the absence of random integration, there will be little difference in expression levels between clones and little effect on other genes.

[0061] The homologously recombinant cells can be obtained, for example, by introducing the above-mentioned targeting vector into a subject cell.

[0062] For example, when a targeting vector for gene introduction is designed to insert a DNA fragment of an exogenous gene into a target site so that the exogenous gene is expressed in a target cell, the vector can be configured, for example, as follows:

[0063] First, in order for the DNA fragment of the exogenous gene to be inserted into the target site by homologous recombination, the targeting vector for gene introduction must contain sequences (5' arm and 3' arm) that are homologous to the target site 5' upstream and 3' downstream of the DNA fragment of the exogenous gene, respectively.

[0064] To select target cells in which the targeting vector for gene introduction has been integrated into the chromosome, it is preferable that the targeting vector for gene introduction contains a drug resistance gene and a reporter gene in addition to the exogenous gene to be inserted. Here, the drug resistance gene and reporter gene may be the same as those used in the targeting vector for gene deletion.

[0065] The drug resistance or reporter gene is preferably under the control of any promoter that can function in the target cell, which may be the same as that used in the targeting vector for gene deletion.

[0066] Furthermore, the targeting vector for gene introduction preferably has a polyA signal downstream of the drug resistance or reporter gene, and may be the same as that used in the targeting vector for gene deletion.

[0067] Furthermore, it is preferable to link the HSV-tk gene or diphtheria toxin gene to the outside of the sequence homologous to the target site of the targeting vector for gene transfer, since this allows selection of cells targeted to the target site by homologous recombination.

[0068] The targeting vector for gene transfer may be introduced into the target cells using the same method as that used for the targeting vector for gene deletion.

[0069] Homologously recombinant cells into which a targeting vector for gene introduction has been integrated may be selected by the same method as that for selecting homologously recombinant cells into which a targeting vector for gene deletion has been integrated.

[0070] Furthermore, when a virus is used as a targeting vector for gene introduction, an example is a method in which target cells are infected with a virus containing DNA in which an exogenous gene and a positive selection marker gene are inserted between the 5' and 3' arms and a negative selection marker gene is inserted outside the arms. The virus, the method for infecting cells, and the method for selecting cells into which the vector has been incorporated may be the same as those used for the targeting vector for gene deletion.

[0071] The target site of a gene transfer targeting vector is not particularly limited as long as it can render the exogenous gene expressible in the target cell. Examples of such sites include safe harbor regions within the genome. A safe harbor region is a region where the integration of an exogenous gene does not result in phenotypic changes and is selected as a target site for the integration of exogenous genes into cells used as pharmaceuticals. Examples of safe harbor regions include the AAVS1 (Adeno-associated virus integration site 1) region, the CCR5 (CC chemokine receptor 5) region, and the ROSA26 region. Introducing an exogenous gene into a site other than a safe harbor region is undesirable because it can disrupt the gene at the introduced site, resulting in unexpected phenotypes or suppressing the expression of the introduced exogenous gene. Introducing an exogenous gene into a safe harbor region fixes the integration site of the exogenous gene, which is expected to minimize differences in the expression level of the exogenous gene between the resulting homologous recombinants and minimize the impact on other genes.

[0072] Another preferred embodiment for introducing an exogenous gene is the PiggyBac method. The PiggyBac method uses a transposon vector incorporating a DNA fragment containing the exogenous gene and a transposase expression vector that expresses a transposase. The genes and other components contained in the transposon vector and transposase expression vector may be contained in the above-mentioned separate vectors or in a single vector. The transposon vector and transposase expression vector can have, for example, the following configurations:

[0073] To enable excision of a DNA fragment containing a foreign gene from a transposon-based vector using a transposase, the transposon-based vector contains terminal inverted repeats 5' upstream and 3' downstream of the DNA fragment containing the foreign gene. The transposase recognizes the terminal inverted repeats contained in the transposon-based vector and excises the DNA fragment containing the foreign gene flanked by the terminal inverted repeats from the transposon-based vector.

[0074] To select target cells in which an exogenous gene has been integrated into the target site, it is preferable that the DNA fragment containing the exogenous gene also contains a drug resistance gene or a reporter gene in the transposon vector. Here, the drug resistance gene and reporter gene may be the same as those used in the targeting vector for gene transfer.

[0075] The drug resistance and reporter genes are preferably under the control of any promoter that can function in the target cells, which may be the same as that used in the targeting vector for gene transfer.

[0076] Furthermore, the transposon vector preferably has a polyA signal downstream of the drug resistance or reporter gene, and may be the same as that used in the targeting vector for gene transfer.

[0077] Furthermore, in addition to the gene encoding the transposase, the transposase expression vector may contain a drug resistance gene, a reporter gene, a promoter, a polyA signal, etc. The drug resistance gene, reporter gene, promoter, and polyA signal may be the same as those contained in the transposon-based vector.

[0078] The transposon vector and transposase expression vector may be introduced into target cells using the same methods as those used for targeting vectors for gene introduction.

[0079] Cells into which an exogenous gene has been integrated into the target site may be selected by the same method as that for selecting homologously recombinant cells into which a targeting vector for gene transfer has been integrated.

[0080] As described above, the DNA fragment of a foreign gene introduced into a transposon vector and a transposase expression vector can be used to integrate the DNA fragment of the foreign gene into the transposase target sequence TTAA in the genome of a target cell. Unlike the homologous recombination method using the above-mentioned targeting vector for gene introduction, this method does not allow for the site of integration of the foreign gene to be limited because the target sequence is TTAA. However, it is possible to subsequently remove the foreign gene integrated into the genome without leaving any trace by expressing the transposase.

[0081] The hypoimmunogenic human cells of the present invention also comprise an exogenous gene encoding human PD-L1 and an exogenous gene encoding human PD-L2, respectively.

[0082] PD-L1 and PD-L2 are transmembrane proteins belonging to the immunoglobulin superfamily and are known as immune tolerance factors. Specifically, PD-L1 and PD-L2 suppress peripheral immune activity and thus play important roles as checkpoints in autoimmune tolerance, hyperimmunity, and inflammatory responses. Cells that constitutively express PD-L1 and PD-L2 suppress T cell proliferation and cytotoxic function, enabling them to avoid immune responses. Therefore, the hypoimmunogenic human cells of the present invention contain exogenous genes encoding human PD-L1 and human PD-L2, respectively.

[0083] The specific means for introducing the exogenous genes encoding PD-L1 and PD-L2 may be the same as the means for introducing the exogenous gene encoding the α chain of HLA class Ib described above.

[0084] The hypoimmunogenic human cells of the present invention can be obtained in the manner described above. As described above, the hypoimmunogenic human cells of the present invention are capable of avoiding immune responses. Furthermore, the hypoimmunogenic human cells of the present invention maintain the characteristics of the parent cells. For example, when the cells into which the endogenous genes (1) and (2) above are deleted and the exogenous genes (3), (4), and (5) above are introduced are human pluripotent stem cells, the resulting hypoimmunogenic human cells of the present invention maintain the expression of undifferentiated markers and have a similar overall gene expression pattern as the original human pluripotent stem cells. Furthermore, the hypoimmunogenic human cells of the present invention maintain the ability to differentiate into various cells, similar to the original human pluripotent stem cells.

[0085] Next, the inventors analyzed the hypoimmunogenic human cells of the present invention into which an exogenous gene encoding β2 microglobulin had been further introduced. Because the endogenous gene encoding β2 microglobulin is not inherently defective in the low-immunogenic human cells of the present invention, it was initially thought that the introduction of an exogenous gene encoding β2 microglobulin would not significantly affect the expression of HLA class Ib on the cell surface of the low-immunogenic human cells of the present invention. In fact, there have been reports of cells into which only an exogenous gene encoding the α chain of HLA class Ib has been introduced, and of cells in which the gene encoding β2 microglobulin has been deleted to deficiently express HLA class I, in which the α chain and β chain (β2 microglobulin) of HLA class Ib are linked and expressed as a single molecule. However, the idea of ​​introducing an exogenous gene encoding β2 microglobulin into cells containing endogenous β2 microglobulin had never been conceived, and in fact, no such example had been reported. However, unexpectedly, it was found that the number of HLA class Ib α chain and β2 microglobulin molecules on the cell surface increased in the low-immunogenic human cells of the present invention into which an exogenous gene encoding β2 microglobulin had also been introduced. Therefore, to further enhance the low immunogenicity of the low immunogenic human cells of the present invention by increasing the number of HLA class Ib molecules on the cell surface, the low immunogenic human cells of the present invention may further comprise an exogenous gene encoding human β2 microglobulin. Such low immunogenic human cells further comprising an exogenous gene encoding exogenous human β2 microglobulin have not been reported to date, and it can be said that arriving at such a configuration would require an extensive amount of trial and error on the part of those skilled in the art. From the above, it can be said that the low immunogenic human cells of the present invention are completely new low immunogenic cells that could not be achieved by conventional ideas. Therefore, the low immunogenic human cells of the present invention further introduced with an exogenous gene encoding β2-microglobulin can be expected to have even lower immunogenicity than before the introduction by increasing the number of HLA class I molecules on the cell surface.

[0086] β2 microglobulin is a common component that associates with the α chains of HLA class Ia and HLA class Ib, which are HLA class I. Specific means for introducing an exogenous gene encoding β2 microglobulin may be the same as the means for introducing an exogenous gene encoding the α chain of HLA class Ib described above.

[0087] The hypoimmunogenic human cells of the present invention may also contain a suicide gene. In particular, when the cells into which the endogenous genes (1) and (2) above are deleted and the exogenous genes (3), (4), and (5) above are introduced are human pluripotent stem cells, it is desirable to introduce a suicide gene to avoid risks such as tumorigenicity of the resulting hypoimmunogenic human cells of the present invention. This makes it possible to remove only the hypoimmunogenic human cells of the present invention if undesirable side effects, such as canceration, occur after transplantation.

[0088] Suicide genes that can be introduced into the hypoimmunogenic human cells of the present invention include, but are not limited to, the HSV-tk gene and its mutants (e.g., HSV-TK, HSV-TK39, etc.), and iCaspase 9 (e.g., AP1903-binding, Rapamycin-binding, etc.). Specific methods for introducing suicide genes may be the same as those for introducing the exogenous gene encoding the α chain of HLA class Ib. However, the expression of the suicide gene introduced into the hypoimmunogenic human cells of the present invention may be optionally manipulated. Therefore, in the suicide gene introduction targeting vector used to introduce the suicide gene, the suicide gene is linked to a conditional promoter. Examples of conditional promoters include promoters containing the Tet operator DNA sequence (tetO). The promoter containing the Tet operator DNA sequence (tetO) is driven by a complex of reverse tetracycline-controlled transactivator (rtTA) and doxycycline (Dox).

[0089] The present invention also provides a method for producing low immunogenic human cells (hereinafter referred to as the method for producing low immunogenic human cells of the present invention), which comprises the following steps (i) to (v): (i) deleting the endogenous gene encoding the α chain of HLA class Ia in a human parent cell; (ii) deleting an endogenous gene encoding HLA class II or an expression regulator thereof from a human parent cell; (iii) introducing an exogenous gene encoding the α chain of HLA class Ib into a human parent cell; (iv) introducing an exogenous gene encoding human PD-L1 into a human parent cell; and (v) introducing an exogenous gene encoding human PD-L2 into a human parent cell.

[0090] In the method for producing low immunogenic human cells of the present invention, the human parent cells used in each of steps (i) to (v) may be the same as the cells into which the endogenous genes (1) and (2) can be deleted and the exogenous genes (3), (4), and (5) can be introduced in the production of low immunogenic human cells of the present invention.

[0091] In the method for producing low immunogenic human cells of the present invention, the endogenous gene deleted and the exogenous gene introduced in each of steps (i) to (v) may be the same as the endogenous gene deleted and the exogenous gene introduced in the low immunogenic human cells of the present invention. Furthermore, in the method for producing low immunogenic human cells of the present invention, the specific means for deleting an endogenous gene and the specific means for introducing an exogenous gene in each of steps (i) to (v) may be the same as the specific means for deleting an endogenous gene and the specific means for introducing an exogenous gene in the low immunogenic human cells of the present invention. In the method for producing low immunogenic human cells of the present invention, the target site for introducing an exogenous gene in each of steps (iii) to (v) may also be the same as the target site for introducing an exogenous gene in the low immunogenic human cells of the present invention. Furthermore, in the method for producing low immunogenic human cells of the present invention, the steps (i) to (v) may be performed in any order as long as the low immunogenic human cells of the present invention can be obtained.

[0092] The hypoimmunogenic human cells obtained as described above, like the hypoimmunogenic human cells of the present invention, evade immune responses and maintain the characteristics of the parent human cells. For example, when the parent human cells are human pluripotent stem cells, the hypoimmunogenic human cells obtained maintain the expression levels of undifferentiated markers, have very similar overall gene expression patterns, and maintain the ability to differentiate into various cells, just like the parent human pluripotent stem cells.

[0093] The method for producing low immunogenic human cells of the present invention may further comprise the step (vi) of introducing an exogenous gene encoding human β2 microglobulin into a human parent cell. In the method for producing low immunogenic human cells of the present invention, the human parent cell used in step (vi), the exogenous gene encoding human β2 microglobulin to be introduced, the specific means for introducing the exogenous gene, the target site for introducing the exogenous gene, and the like may be the same as those described in the production of low immunogenic human cells of the present invention.

[0094] The low-immunogenic human cells of the present invention, which have been further introduced with an exogenous gene encoding β2-microglobulin obtained as described above, are expected to have even lower immunogenicity by increasing the number of HLA class I molecules on the cell surface.

[0095] The method for producing hypoimmunogenic human cells of the present invention may also further comprise the step (vii) of introducing a suicide gene into a human parent cell. In the method for producing hypoimmunogenic human cells of the present invention, the human parent cells used in step (vii), the suicide gene to be introduced, the specific means for introducing the suicide gene, the target site for introducing the suicide gene, etc. may be the same as those described in the production of hypoimmunogenic human cells of the present invention.

[0096] The low immunogenic human cells of the present invention, into which a suicide gene has been further introduced as described above, can be selectively removed if undesirable side effects such as canceration occur after transplantation.

[0097] The present invention also provides a pharmaceutical comprising the hypoimmunogenic human cells of the present invention (hereinafter referred to as the pharmaceutical of the present invention). The hypoimmunogenic human cells of the present invention can evade immune responses and therefore can be used as a cell source for transplantation. Therefore, a pharmaceutical comprising the hypoimmunogenic human cells of the present invention can be used as a pharmaceutical for regenerative therapy.

[0098] The pharmaceutical agent of the present invention is preferably administered parenterally to a subject. Examples of parenteral administration methods include intravenous, intraarterial, intramuscular, intraperitoneal, and subcutaneous administration. The dosage is appropriately selected depending on the condition, weight, age, etc. of the subject, but typically, the number of cells is 1×10 per administration for a subject weighing 60 kg. 6 ~1×10 10The pharmaceutical composition of the present invention is administered so that the total number of cells reaches 100. The pharmaceutical composition may be administered once or multiple times. The pharmaceutical composition of the present invention may be in a known form suitable for parenteral administration, such as an injection or infusion. The pharmaceutical composition of the present invention may also contain physiological saline, phosphate buffered saline (PBS), a culture medium, etc., in order to stably maintain the cells. The pharmaceutical composition may also contain a pharmaceutically acceptable carrier (e.g., human serum albumin), a preservative, etc., for the purpose of stabilization. [Example]

[0099] Hereinafter, the present disclosure will be described in more detail with reference to examples, but these are merely illustrative examples and the present disclosure is not limited to these examples.

[0100] [Example 1] Production of HLA class Ia-deficient iPS cells To avoid the immune rejection response of T cells due to HLA mismatch, the α-chain genes of HLA-A, HLA-B, and HLA-C, which belong to HLA class Ia, were deleted using the CRISPR-Cas9 method.

[0101] The following crRNA sequences were used as guide RNAs (gRNAs) for each of the HLA class Ia α-chain genes. The underlined sequences are PAM sequences. #HLA-A: ACAGCGACGCCGCGAGCCAG AGG (SEQ ID NO: 1) #HLA-B: CCTCCTCCGCGGGTATGACC AGG (SEQ ID NO: 2) #HLA-C: AGCGACGCCGCGAGTCCAAG AGG (SEQ ID NO: 3)

[0102] gRNA containing each crRNA sequence was synthesized and mixed with tracrRNA (Thermo Fisher Scientific) to generate double-stranded gRNA. This double-stranded gRNA was mixed with Cas9 protein (Alt-R Sp HiFi Cas9 Nuclease V3, Integrated DNA Technologies) to generate Cas9-gRNA complexes. These complexes are hereafter referred to as the "HLAA-gRNA-Cas9 complex," "HLAB-gRNA-Cas9 complex," and "HLAC-gRNA-Cas9 complex," respectively. Each complex was mixed and used immediately before transfection into iPS cells.

[0103] The parent iPS cell line used was iPS cell clone 06E (TC-1133HKK_06E_MCB). This parent line will be referred to as "unedited iPS cells" below. First, the iPS cell suspension was mixed with the HLAB-gRNA-Cas9 complex, and the HLAB-gRNA-Cas9 complex was introduced into the unedited iPS cells using electroporation (Neon Transfection System, Thermo Fisher Scientific). The cells were then cultured for 5 days. After 5 days, the HLAC-gRNA-Cas9 complex was introduced and cultured for another 5 days. The HLAA-gRNA-Cas9 complex was then introduced and cultured for another 5 days. Single-cell cloning was performed from the gRNA-Cas9 complex-introduced iPS cells to isolate gene-edited cells.

[0104] Single-cell cloning was performed as follows. Five days after transfection with the three gRNA-Cas9 complexes, cells were seeded into a 96-well plate so that each well contained one calculated cell. Twelve days after seeding into the 96-well plate, 238 clones of cells were passaged into 24-well and 96-well plates. The cells in the 96-well plate were used for screening. Meanwhile, the cells in the 24-well plate were continued to be cultured, and one week after seeding, only candidate clones based on the screening results were passaged into 9cm dishes. The cells cultured on the 9cm dishes were cryopreserved.

[0105] Screening was performed as follows. Two days after seeding from one 96-well plate to another, 238 clones were immunostained with an anti-HLA-A / B / C antibody (clone W6 / 32). 53 clones with significantly reduced signal were selected. Genomes were extracted from fixed and stained cells of these 53 clones, and the presence or absence of genomic mutations was analyzed using an in vitro Cas9 cleavage assay. Specifically, each well of the 96-well plate in which the cells had been cultured was washed with PBS. After removing the PBS, 101 μL of a solution (TAKARA, Lysis Buffer for PCR, 9170A) containing 100 μL of lysis buffer and 1 μL of proteinase K was added. The cells were lysed in lysis buffer with proteinase K and transferred to a 0.2 mL PCR tube. The tube was then incubated at 60°C for 5 minutes in a thermal cycler to completely lyse the cells. The proteinase K was then inactivated by incubation at 98°C for 2 minutes. The reaction was terminated by lowering the temperature to 22°C, and a genome extract was obtained. Next, using this genome as a template, DNA fragments near the gRNA target sequences for HLA-A, HLA-B, and HLA-C were amplified by PCR. These PCR fragments were then mixed with the gRNA-Cas9 complex for each gene and incubated at 37°C for 60 minutes. The DNA fragment lengths were then analyzed by agarose gel electrophoresis. The genome-edited PCR fragments were not cleaved by the gRNA-Cas9 complex, resulting in a single DNA fragment. On the other hand, the unedited PCR fragments were cleaved by the gRNA-Cas9 complex, resulting in two DNA fragments. In cells in which both genomes had been edited, resulting in base insertion or deletion (In / Del), a single DNA fragment was observed. When In / Del occurred in one genome and the other genome was unedited, three DNA fragments were observed. When both genomes are unedited, two DNA fragments are observed. The HLA-B and HLA-C loci were also analyzed in the same way.

[0106] In vitro Cas9 cleavage assay was performed on 53 single-cell-derived colonies that showed reduced HLA class I protein expression by immunohistochemistry. No mutations were observed in both gene strands at all three loci of HLA-A, HLA-B, and HLA-C (a total of six mutations). Therefore, six clones with a total of five mutations were isolated. Next, DNA fragments containing the gRNA target sequence were amplified from these six candidate clones by PCR, and their sequences were analyzed by Sanger sequencing. When the two genomes have different sequences, the Sanger sequence waveforms overlap around the gRNA target sequence, making the results unclear. These overlapping Sanger sequence waveforms were analyzed using online software (TIDE) (https: / / tide.deskgen.com / ) and visually to decode the sequences of each gene strand and confirm the actual gene insertions / deletions. Two of these six clones (18B12 and 17E10) were confirmed to have frameshift mutations at five locations.

[0107] The gene editing results of the HLA-A(- / +):HLA-B(- / -):HLA-C(- / -) cell clone 18B12 are shown below. #HLA-A: +1nt / no mutation #HLA-B: -10nt / -1+17nt #HLA-C: +1nt / -13nt

[0108] The following primers were used to amplify a DNA fragment containing the vicinity of the gRNA target sequence by PCR. #HLA-A, Fwd: AATCAGTGTCGTCGCGGTCG (SEQ ID NO: 4) #HLA-A, Rev: AGTCTGTGAGTGGGCCTTCAC (SEQ ID NO: 5) #HLA-B, Fwd: GAGACACAGATCTCCAAGACCAACA (SEQ ID NO: 6) #HLA-B, Rev: CCTGAGAGGAAAAGTCACGGTTC (SEQ ID NO: 7) #HLA-C, Fwd: AGGGAAACGGCCTCTGCGGA (SEQ ID NO: 8) #HLA-C, Rev: TCTGTGCCTGGCGCTTGTAC (SEQ ID NO: 9) The lengths of the PCR products when the above primers were used were as follows: #HLA-A: 497bp #HLA-B: 889bp #HLA-C: 329bp

[0109] To introduce mutations into the HLA-A gene, which had not been mutated in the HLA-A(- / +):HLA-B(- / -):HLA-C(- / -) iPS cell clone 18B12, the HLA-A-gRNA-Cas9 complex was reintroduced, and single-cell cloning and screening were performed as described above to isolate HLA-A(- / -):HLA-B(- / -):HLA-C(- / -) iPS cells.

[0110] Four days after transfection with the HLAA-gRNA-Cas9 complex, cells were seeded into a 96-well plate so that each well contained one cell. 12 days after seeding into the 96-well plate, the cells were passaged into 24-well and 96-well plates. The cells in the 96-well plate were harvested the day after passaging, and genomic DNA was extracted. The extracted genomic DNA was analyzed for the presence or absence of genomic mutations using an in vitro Cas9 cleavage assay. Analysis of 75 single-cell-derived colonies (clones) revealed that 11 clones contained a single DNA fragment in the HLA-A gene, making them candidate clones in which both strands of the genomic DNA had been edited. Next, DNA fragments containing the gRNA target sequence were amplified from these 11 candidate clones by PCR, and their sequences were analyzed by Sanger sequencing. Frameshift mutations were confirmed in both strands of the HLA-A gene in all isolated clones. The isolated HLA-A(- / -):HLA-B(- / -):HLA-C(- / -) cells are hereafter referred to as "HLA class Ia-deficient iPS cells (HGEC-0006 cells)."

[0111] Of the 11 clones obtained, the gene editing results for HLA class Ia-deficient iPS cell clone 2E1 are shown below (Figure 1). #HLA-A: -13nt / +1nt #HLA-B: -10nt / -1+17nt #HLA-C: +1nt / -13nt

[0112] The cell surface expression of HLA class Ia proteins in the HLA class Ia-deficient iPS cell clone 2E1 was analyzed using flow cytometry. A suspension of 200,000 iPS cells was mixed with an antibody (clone G46-2.6) that recognizes HLA class I and incubated on ice for 30 minutes in a 20 μL solution. Then, 1 mL of 2% BSA-containing PBS was added to disperse unbound antibody. After centrifugation, the pellet was collected to recover only antibody-bound cells. Using fluorescently labeled antibodies, the cell surface expression of antibody-bound proteins was analyzed using flow cytometry (BD FACSVerse). A significant decrease in cell surface expression of class I proteins was confirmed (Figure 2).

[0113] Next, to confirm how the deletion of HLA-A, HLA-B, and HLA-C proteins affects HLA class Ib expression, we analyzed the cell surface expression of HLA-E in class Ia-deficient iPS cell clone 2E1 using flow cytometry. Anti-HLA-E antibody (clone 3D2) was used as the antibody against HLA-E. The results confirmed HLA-E expression, but it was reduced to about half that of unedited iPS cells (Figure 3).

[0114] To confirm whether the loss of HLA-A, HLA-B, and HLA-C proteins altered the undifferentiated state of iPS cells, we analyzed the expression of undifferentiated markers in the HLA class Ia-deficient iPS cell clone 2E1 using flow cytometry. Antibodies for undifferentiated markers were used: anti-SSEA-4 antibody (clone MC813-70) and anti-TRA-1-60 antibody (clone TRA-1-60). The results confirmed that the expression levels of undifferentiated markers in the HLA class Ia-deficient iPS cell clone 2E1 were nearly equivalent to those of the parent unedited iPS cells (Figure 4).

[0115] To confirm whether the deletion of HLA-A, HLA-B, and HLA-C proteins altered the global gene expression patterns of iPS cells, we performed transcriptome analysis (Takara Bio, Inc., Agilent Array Expression Analysis). The Human SurePrint G3 Human Gene Expression 8x60K v3 contains probes covering 26,083 Entrez gene RNAs and 30,606 lncRNAs. HLA class Ia-deficient iPS cell clone 2E1 and HLA class Ia-deficient iPS cell clone 2H3 (second candidate clone), along with unedited iPS cells as a control, were cultured in 6 cm dishes. 600 μL of Buffer RLT with 2-ME (QIAGEN) was added directly to the culture dish to lyse the cells, which were then transferred to a 1.5 mL tube. The cells were further lysed by pipetting and frozen at -80°C. Agilent Microarray expression analysis of this sample confirmed that the RNA expression pattern of HLA class Ia-deficient iPS cell clone 2E1 was nearly identical to that of the parent, unedited iPS cell clone 06E (Figure 5). The RNA expression pattern of the second candidate clone, 2H3, was also similar to that of unedited iPS cell clone 06E.

[0116] [Example 2] Production of HLA class Ia & II deficient iPS cells To suppress the immune rejection response of T cells caused by HLA mismatches, the RFXANK gene was further deleted in the HLA class Ia-deficient iPS cell clone 2E1 obtained in Example 1. Because the RFXANK gene is a transcription factor that controls the expression of HLA class II genes, deletion of the RFXANK gene is expected to significantly reduce the expression levels of HLA class II genes. The gene deletion was performed using the CRISPR-Cas9 method.

[0117] The following crRNA sequence was used as a guide RNA (gRNA) for the RFXANK gene. The underlined PAM sequence is shown. #RFXANK: TGAGACCGTTCGCTTCCTGC TGG(SEQ ID NO: 10)

[0118] A gRNA containing the RFXANK crRNA sequence was synthesized and mixed with tracrRNA (Thermo Fisher Scientific) to generate a double-stranded gRNA. This double-stranded gRNA was then mixed with Cas9 protein (Alt-R Sp HiFi Cas9 Nuclease V3, Integrated DNA Technologies) to generate a Cas9-gRNA complex. This complex is referred to as the "RFXANK-gRNA-Cas9 complex." This complex was mixed with iPS cells immediately before transfection and used.

[0119] The RFXANK-gRNA-Cas9 complex was introduced into the HLA class Ia-deficient iPS cell clone 2E1 using electroporation (Neon Transfection System, Thermo Fisher Scientific). Single-cell cloning and screening were performed using the same method as in Example 1, and HLA-A(- / -):HLA-B(- / -):HLA-C(- / -):RFXANK(- / -) iPS cells were isolated.

[0120] Four days after transfection with the RFXANK-gRNA-Cas9 complex, cells were seeded onto a 96-well plate so that each well contained one calculated cell. Twelve days after seeding onto the 96-well plate, the cells were passaged onto 24-well and 96-well plates. The cells from the 96-well plate were harvested the day after seeding, and genomes were extracted. The extracted genomes were used to analyze the presence or absence of genomic mutations using an in vitro Cas9 cleavage assay. Meanwhile, the cells in the 24-well plate were continued to be cultured, and one week after seeding, only candidate clones based on the screening results were passaged onto 9cm dishes. The cells cultured on the 9cm dishes were cryopreserved.

[0121] Screening was performed using the following method. Using the in vitro Cas9 cleavage assay described above, 256 single-cell-derived colonies (clones) were analyzed. Four clones were identified as candidate clones in which both genomes had been edited. DNA fragments containing the gRNA target sequence were then amplified by PCR from these four candidate clones, and their sequences were analyzed by Sanger sequencing. Two of these four candidate clones were confirmed to have gene deletion mutations with frameshifts at two RFXANK loci. The isolated HLA-A(- / -):HLA-B(- / -):HLA-C(- / -):RFXANK(- / -) cells are hereafter referred to as "HLA class Ia & II-deficient iPS cells (HGEC-0009 cells)."

[0122] Of the two clones obtained, the gene editing results for HLA class Ia & II-deficient iPS cell clone 6B7 are shown below (Figure 6). #HLA-A: -13nt / +1nt #HLA-B: -10nt / -17+1nt #HLA-C: +1nt / -13nt #RFXANK: -11nt / -10nt

[0123] The following primers were used to amplify a DNA fragment containing the vicinity of the gRNA target sequence by PCR. #RFXANK, Fwd: ATACCCACTCATGACGTGACCTG (SEQ ID NO: 11) #RFXANK, Rev: CAGCCGCATCTCAAAGACAAG (SEQ ID NO: 12) The lengths of the PCR products when the above primers were used were as follows: #RFXANK: 410bp

[0124] The cell surface expression level of HLA class Ia protein in HLA class Ia&II-deficient iPS cell clone 6B7 was analyzed using flow cytometry in the same manner as in Example 1. As a result, a significant decrease in the cell surface expression level of HLA class I protein was confirmed in HLA class Ia&II-deficient iPS cell clone 6B7, as in the cells obtained in Example 1 (Figure 7).

[0125] To confirm the cell surface expression of HLA class II proteins in the HLA class Ia & II-deficient iPS cell clone 6B7, we needed to induce differentiation of these iPS cells into HLA class II-expressing cells. Therefore, we used iPS cell-derived hematopoietic cells, including dendritic cell-like cells, as HLA class II-expressing cells. Differentiation of iPS cells into hematopoietic progenitor cells, including dendritic cell-like cells, was performed as described previously (Biochem Biophys Res Commun. 2019 Jul 12;515(1):1-8.). To induce differentiation of hematopoietic differentiated cells into hematopoietic cells, including dendritic cell-like cells, iPS cell-derived hematopoietic progenitor cells were seeded on OP9 feeder cells and cultured for 4–7 days in the presence of 100 ng / mL FLT3L, 20 ng / mL SCF, and 20 ng / mL GM-CSF. To detect the appearance of dendritic cell-like cells, antibodies recognizing dendritic cell markers, anti-CD11c antibody (clone REA618, MiltenyBiotec, 130-114-110) and anti-CD11b antibody (clone ICRF44, BD Pharmingen, 558123), were used.

[0126] To confirm the reduced expression of HLA class II proteins due to RFXANK deficiency, we differentiated iPS cells into hematopoietic cells, including dendritic cells, using the method described above, and then analyzed the cell surface expression of HLA class II proteins in dendritic cell-like cells derived from HLA class Ia & II-deficient iPS cell clone 6B7 using flow cytometry. Antibodies recognizing dendritic cell markers were anti-CD11c antibody (clone REA618, MiltenyBiotec, 130-114-110) and anti-CD11b antibody (clone ICRF44, BD Pharmingen, 558123). Anti-HLA-DR / DQ / DP antibody (clone Tu39, BD Pharmingen, 557715) was used to recognize HLA class II (Figure 8).

[0127] Next, to confirm the expression of HLA class Ib when RFXANK was deleted in addition to the deletion of HLA-A, HLA-B, and HLA-C proteins, the cell surface expression of HLA-E in HLA class Ia&II-deficient iPS cell clone 6B7 was analyzed by flow cytometry as in Example 1. Anti-HLA-E antibody (clone 3D2) was used to detect HLA-E. As a result, HLA-E expression was not detected in HLA class Ia&II-deficient iPS cell clone 6B7 (Figure 9).

[0128] To confirm whether the loss of RFXANK in addition to the loss of HLA-A, HLA-B, and HLA-C proteins altered the undifferentiated state of iPS cells, the cell surface expression of undifferentiated markers in HLA class Ia&II-deficient iPS cell clone 6B7 was analyzed using flow cytometry in the same manner as in Example 1. As a result, it was confirmed that the expression levels of undifferentiated markers in HLA class Ia&II-deficient iPS cell clone 6B7 were almost equivalent to those of the parent line, unedited iPS cell clone 06E (Figure 10).

[0129] We analyzed whether the deficiency of RFXANK in addition to the deficiency of HLA-A, HLA-B, and HLA-C proteins altered the overall gene expression pattern of iPS cells using the same method as in Example 1. As a result, we confirmed that the RNA expression pattern in HLA class Ia & II-deficient iPS cell clone 6B7 was equivalent to that of the parent unedited iPS cell clone 06E (Figure 11).

[0130] We confirmed that the HLA class Ia & II-deficient iPS cell clone 6B7 retains the ability to differentiate into multiple lineages. Specifically, we induced differentiation into vascular endothelial cells, blood cells, and liver cells, and confirmed that differentiation induction was successful. The methods for inducing differentiation into each cell type are described below. The differentiation of iPS cells into hematopoietic progenitor cells was performed according to the literature (Biochem Biophys Res Commun. 2019 Jul 12;515(1):1-8.). To evaluate the differentiation potential into hematopoietic progenitor cells, the cell surface expression of hematopoietic progenitor-specific proteins was measured by flow cytometry. Anti-CD45 antibody (clone HI30, BD Pharmingen, 563880), anti-CD43 antibody (clone 1G10, BD Pharmingen, 555475), and anti-CD34 antibody (clone 8G12, BD Pharmingen, 340441) were used as hematopoietic progenitor cell markers. The differentiation of iPS cells into hepatocytes was performed according to the literature (PNAS. 2012 Jul 31;109(31):12538-43 (first half, up to DE induction), and Hepatology, 2010 Jan;51(1):297-305 and Stembook, Cai J. et al., Protocol for directed differentiation of human pluripoteit stem cells toward a hepatocyte fate (second half, using HCM)). To evaluate the differentiation potential into hepatocytes, we assessed urea synthesis, a liver-specific function (Figure 12A). The urea synthesis ability of clone 6B7 was almost equivalent to that of unedited iPS cell clone 06E. The differentiation of iPS cells into vascular endothelial cells was performed according to the literature (Nat Cell Biol. 2015 Aug; 17(8): 994-1003). Anti-CD31 antibody (clone WM59, BD Pharmingen, 555445) and anti-CD144 antibody (clone 55-7H1, BD Pharmingen, 560410) were used as markers for vascular cells. Vascular formation was assessed as one of the evaluations of differentiation potential into vascular cells (Figure 12B). The vasculogenic potential of clone 6B7 was nearly equivalent to that of unedited iPS cell clone 06E. These results confirmed that the differentiation potential of HLA class Ia & II-deficient iPS cell clone 6B7 was comparable to that of unedited iPS cell clone 06E.

[0131] [Example 3] Production of universal donor iPS cells <<Forced expression of genes that enhance immune evasion>> To suppress immune rejection by T cells and NK cells, universal donor iPS cells were produced by forcibly expressing the following factors in the HLA class Ia & II-deficient iPS cell clone 6B7 obtained in Example 2. The PiggyBac method was used for gene transfer. Furthermore, a constitutively active EF1alpha promoter region was used to forcibly express the cDNA of each factor.

[0132] The following vectors were prepared for gene transfer using the PiggyBac method. PD-L1 and PD-L2 were linked by the P2A sequence and expressed simultaneously in a single vector. #PB_PD-L1_P2A_PD-L2_Puro_Vector #PB_B2M_Puro_Vector #PB_HLAG_Puro_Vector #PB_iCasp9_Puro_Vector In addition, the following vector was prepared as the PiggyBac transposase. #hPBase_Hygro_Vector

[0133] The vectors used for gene transfer via the PiggyBac method were constructed as follows: A synthetic PiggyBac 3' ITR sequence (SEQ ID NO: 13)-restriction enzyme MCS-PiggyBac 5' ITR sequence (SEQ ID NO: 14) was inserted into the PstI and EcoRI restriction enzyme sites of the pHSG298 plasmid. The EF1A promoter (amplified by PCR from pBApo-EF1a Pur DNA plasmid), each gene of interest (PD-L1-P2A-PD-L2: SEQ ID NO: 15, HLAG: SEQ ID NO: 16, B2M: SEQ ID NO: 17, iCasp9 CDS (synthetic): SEQ ID NO: 19), and IRES-Puro-hGHpolyA (synthetic): SEQ ID NO: 23 were inserted into the MCS to construct a PB_CDS_Puro_Vector expressing each gene of interest.

[0134] The hPBase_Hygro_Vector was constructed as follows: the EF1A promoter (amplified by PCR), human codon-optimized PBase (artificially synthesized, SEQ ID NO: 18), and IRES-Hygro-hGHpolyA (artificially synthesized, SEQ ID NO: 24) were inserted into the SalI and KpnI restriction enzyme sites of the pHSG298 plasmid to construct the hPBase vector.

[0135] The five types of plasmid DNA were then introduced by electroporation (Neon Transfection System, Thermo Fisher Scientific) into the HLA class Ia & II-deficient iPS cell clone 6B7 obtained in Example 2. The transfected cells were designated "HGEC-0012 cells."

[0136] The day after transfection, the medium was replaced with puromycin- and hygromycin-containing liquid medium, and drug-resistant cell selection began. From 2 to 5 days after electroporation, the medium was replaced with puromycin-containing liquid medium daily, and drug selection continued. Six days after electroporation, the medium was replaced with drug-free liquid medium, and cell culture continued. Seven days after electroporation, cells were seeded into 96-well plates at a calculated density of one cell per well, and culture continued. Twelve days after seeding into the 96-well plates, cells were passaged into 24-well and 96-well plates. 12 + 1 days after seeding into the 96-well plates at a calculated density of one cell per well, the cells on the 96-well plates were harvested the day after passage, and expression levels of each transduced factor were analyzed by quantitative RT-PCR to screen for clones overexpressing all transduced factors.

[0137] Primary screening by quantitative RT-PCR was performed as follows. Reverse transcription was performed to analyze cells on a 96-well plate (SuperPrep Cell Lysis and RT Kit for qPCR, TOYOBO, SCQ-401). Quantitative PCR (StepOne Plus Real-Time PCR System, ThermoFisher Scientific) was performed using the reverse transcription product as a template to analyze the expression level of the transgene. PCR reactions were performed using either THUNDERBIRD Probe qPCR Mix (TOYOBO, QPS-101) or TaqMan Fast Advanced Master Mix (ThermoFisher Scientific, 4444557). TaqMan Gene Expression Assays (FAM and / or VIC) (ThermoFisher Scientific) were used to detect the following factors: GAPDH (Hs02758991_g1), PD-L1 (Hs00204257_m1), PD-L2 (Hs00228839_m1), HLAG (Hs00365950_g1), and B2M (Hs00187842_m1). Fluorescent probes and primers for detecting iCasp9 were synthesized (sequences are listed below).

[0138] The sequences of the artificially synthesized fluorescent probe (FAM) and primers are shown below. #iCasp9-fwd: GAACTGCTGAAGCTGGAATC (SEQ ID NO: 20) #iCasp9-rev: CATTTCCTCTCAGGCTTTCCAG (SEQ ID NO: 21) #iCasp9-probe(5'6-FAM, 3'BHQ1):ATCTGGCGTTGACGGCTTTGGAGATGTG (SEQ ID NO: 22)

[0139] Two hundred forty-two single-cell-derived clones were isolated from twenty 96-well plates, and one clone was seeded into two wells: a 24-well plate for continuous culture and a 96-well plate for screening. Cells from the 96-well plate for screening were harvested one day after seeding and analyzed by reverse transcription-quantitative PCR as described above. Eighteen clones were confirmed to overexpress PD-L1, HLA-G, B2M, and iCasp9 mRNA. For comparison, the untransfected HLA class Ia & II-deficient iPS cell clone 6B7 was used. Meanwhile, one week after seeding, only the 18 clones seeded into the 24-well plate for continuous culture were passaged into two 9-cm dishes. Six days after seeding, a secondary screening was performed using one 9-cm dish of cells by flow cytometry to quantify protein surface expression. The remaining 9-cm dish of cells was cryopreserved after culture.

[0140] Secondary screening by flow cytometry was performed as follows. After detaching the cells from the dish, the cell suspension was mixed with fluorescently labeled antibodies, and the expression levels of proteins expressed on the cell surface were quantitatively analyzed using a FACSVerse flow cytometer (BD). The antibodies used are listed below: anti-PD-L1 antibody-APC conjugated (clone MIH1, Invitrogen, 12-5888-42), anti-B2M antibody-PECy7 conjugated (clone 2M2, BioLegend, 316318), and anti-HLAG antibody-PE conjugated (clone MEM-G / 9, Abcam, ab24384). High cell surface expression of PD-L1, HLA-G, and B2M was confirmed in all 18 clones. Universal donor iPS cell clones were isolated using the above method.

[0141] <Evaluation of the obtained cells> The cell surface overexpression levels of HLA-G, B2M, PD-L1, and PD-L2 in universal donor iPS cell clone 9G11 were confirmed using the same method as described above. The antibodies used were as follows: anti-PD-L1 antibody-APC conjugated (clone MIH1, Invitrogen, 12-5888-42), anti-PD-L2 antibody-PE conjugated (clone MIH18, Invitrogen, 17-5983-42), and anti-HLAG antibody-PE conjugated (clone MEM-G / 9, Abcam, ab24384). High cell surface expression of HLA-G, B2M, PD-L1, and PD-L2 was confirmed (Figure 13).

[0142] After the universal donor iPS cell clone 9G11 was differentiated into a blood cell population (CD45-positive cells) containing hematopoietic progenitor cells, the cell surface expression of HLA class Ia protein was analyzed by flow cytometry as in Example 1 to confirm the expression level. The differentiation of universal donor iPS cells into blood progenitor cells was performed as in Example 2. As a result, a significant decrease in the cell surface expression levels of HLA-A, HLA-B, and HLA-C proteins was confirmed (Figure 14). Furthermore, the cell surface expression levels of HLA class II protein were analyzed by flow cytometry as in Example 2. As a result, a significant decrease in the cell surface expression levels of HLA class II proteins (HLA-DR, DP, DQ) was confirmed (Figure 14). Furthermore, the overexpression levels of HLA-G, PD-L1, and PD-L2 on the cell surface were confirmed by the same method as above. The antibodies used were: anti-PD-L1 antibody-APC-conjugated (clone MIH1, Invitrogen, 12-5888-42), anti-PD-L2 antibody-PE-conjugated (clone MIH18, Invitrogen, 17-5983-42), anti-B2M antibody-PECy7-conjugated (clone 2M2, BioLegend, 316318), and anti-HLAG antibody-PE-conjugated (clone MEM-G / 9, Abcam, ab24384). High expression of HLA-G on the cell surface was confirmed. Although endogenous expression of PD-L1 and PD-L2 was also observed, slight increases in expression were also observed (Figure 15).

[0143] To confirm whether the forced expression of HLA-G, B2M, PD-L1, PD-L2, and iCasp9 in addition to the loss of HLA-A, HLA-B, HLA-C, and RFXANK proteins altered the undifferentiated state of iPS cells, the expression of iPS cell undifferentiation markers in the universal donor iPS cell clone 9G11 was analyzed by flow cytometry as in Example 1. Antibodies against cell surface undifferentiation markers were used: anti-TRA-1-81 antibody (clone TRA-1-81), anti-SSEA-4 antibody (clone MC813-70), and anti-TRA-1-60 antibody (clone TRA-1-60). Intracellular Oct3 / 4 protein expression was also analyzed by flow cytometry. To stain intracellular proteins, the cell suspension was treated with Permeabilization Buffer (BD) and then stained with anti-Oct3 / 4 antibody (clone C30A3). As a result, it was confirmed that the universal donor iPS cell clone 9G11 robustly expressed each undifferentiated marker (Figure 16). The expression of undifferentiated markers was also confirmed by immunostaining. Furthermore, alkaline phosphatase staining confirmed that the undifferentiated state was not affected.

[0144] To confirm that gene expression patterns did not change significantly before and after gene editing, we performed a comparative RNA-seq analysis using the universal donor iPS cell clone 9G11 and unedited iPS cells, and the results confirmed that gene expression patterns did not change significantly before and after gene editing. Furthermore, to investigate the presence of known genetic mutations that may increase the risk of cancer during the culture process for gene editing and cloning, highly sensitive genomic mutation analysis was performed on the universal donor iPS cell clone 9G11 using the QIAseq Targeted DNA Panel (Comprehensive Cancer Panel). The results confirmed that no known mutations that increase the risk of cancer occurred during the culture process for gene editing and cloning.

[0145] Karyotypic analysis was performed to examine the presence or absence of karyotypic abnormalities during the culture process for gene editing and cloning. As a result, no karyotypic abnormalities were detected in the universal donor iPS cell clone 9G11 (Figure 17).

[0146] To confirm whether the loss of HLA-A, HLA-B, HLA-C, and RFXANK proteins, as well as the forced expression of HLA-G, B2M, PD-L1, PD-L2, and iCasp9, in addition to the loss of HLA-A, HLA-B, HLA-C, and RFXANK proteins, altered the ability of iPS cells to differentiate into multiple lineages, we attempted to induce the differentiation of universal donor iPS cell clone 9G11 into multiple lineages. The retention of pluripotency was confirmed using the same method as in Example 2 (Figure 18).

[0147] Example 4: Evaluation of immune evasion mechanisms and safety features of universal donor iPS cells <T cell response> It is expected that the gene editing of universal donor iPS cell clones will make them more susceptible to T cell-mediated immune responses. To confirm the attenuation of T cell responses due to HLA mismatches in the universal donor iPS cell clone 9G11, flow cytometry analysis was performed using T cell proliferation as an indicator. A cell population (CD45+ cells) containing hematopoietic progenitor cells derived from universal donor iPS cells (clone 9G11) was used as the target cells. Differentiation of universal donor iPS cells into hematopoietic progenitor cells was performed as described in Example 2. T cells and target cells were cocultured for 5 or 7 days, and T cell proliferation was assessed using EdU reagent. The EdU positivity rates of CD4+ and CD8+ T cells were calculated as the proliferation rate of each cell type. Additionally, THP-1 cells were used as the target cells to assess T cell proliferation as a positive control for the test system.

[0148] The results are shown in Figure 19. When T cells were used alone, almost no cell proliferation was observed (they did not incorporate EdU). When co-cultured with their positive control, THP-1, or unedited iPS cell-derived CD45-positive cells (06E), the T cells responded and showed cell proliferation (incorporated EdU). In contrast, when co-cultured with the universal donor iPS cell clone 9G11, the T cell response was significantly reduced (decreased EdU incorporation). These results confirmed that gene editing allows differentiated cells derived from the universal donor iPS cell clone to more easily evade T cell-mediated immune responses.

[0149] <Avoiding cytotoxic activity by T cells> To confirm the attenuation of T cell cytotoxicity against the universal donor iPS cell clone 9G11, we performed a flow cytometry cytotoxicity assay. CD8+ cells were used as effector cells, and a cell population containing hematopoietic progenitor cells (CD45+ cells) derived from iPS cells (clone 9G11 and unedited cells) was used as target cells. CD45+ cells were cultured in the presence of 50 ng / mL IFNγ for 2 days, and live cells were stained with Cell Tracer Violet (Thermo Fisher Scientific) at a final concentration of 5 μM. Primed CD8+ cells were mixed at different cell ratios and co-cultured for 3 hours. To label damaged target cells, 250 μL of 0.1 μM SYTOX solution, a dead cell marker, was added. Cell Tracer Violet and SYTOX fluorescence were then measured using a flow cytometer (Miltenyi Biotec MACSQuant). The percentage of dead (SYTOX-positive) cells among all target cells (Cell Tracer Violet-positive) was measured and used as an index of cytotoxicity. Unprimed T cells were used as a negative control and were subtracted as background values. As a result, it was confirmed that, while the unedited cells were damaged by the primed CD8-positive cells, the universal donor iPS cell clone 9G11 was less susceptible to damage, as expected (Figure 20).

[0150] <Avoiding cytotoxic activity by NK cells> Next, we evaluated the cytotoxic activity of NK cells against iPS cells using the following method. It is expected that the gene editing of universal donor iPS cell clones will make them more susceptible to NK cell-mediated immune responses. To confirm that the NK cell response was attenuated in the universal donor iPS cell clone 9G11, we performed flow cytometry analysis using NK cell proliferation as an indicator. The target cells used were unedited iPS cell clone 06E, HLA class Ia & II-deficient iPS cell clone 6B7, and universal donor iPS cell clone 9G11.

[0151] To label target cells with the viability marker calcein, 0.03 mM Calcein-AM solution was added to the target cell suspension (100,000 cells / 100 μL) to a final concentration of 500 nM for K562 cells and 1500 nM for iPS cells. The cells were incubated at 37°C in a 5% CO2 incubator for 30 minutes. Five mL of PBS was added, and the mixture was centrifuged at 200 x g for 4 minutes, after which the supernatant was removed. 250,000 or 500,000 effector cells (NK cells) were mixed with 50,000 target cells and incubated at 37°C in a 5% CO2 incubator for 2 hours. 0.25% BSA-PBS solution was added, and the mixture was centrifuged at 300 x g for 5 minutes, after which the supernatant was removed. Next, 250 μL of 0.1 nM SYTOX solution, a dead cell marker, was added to label damaged target cells. Calcein and SYTOX fluorescence were then measured using a flow cytometer (Miltenyi Biotec MACSQuant). The percentage of dead cells (SYTOX-positive) among all target cells (calcein-positive) was calculated as an index of cytotoxicity. Appropriate negative control reactions were performed and subtracted as background values ​​for calculation.

[0152] Measurement of cytotoxic activity by NK cells revealed that, compared to unedited iPS cells expressing HLA class I proteins on their surface, HLA class Ia & II-deficient iPS cell clone 6B7 expressed almost no HLA class I proteins on its cell surface, as described above, and as expected, more cells were killed by NK cells than unedited iPS cells. In universal donor iPS cell clone 9G11, forced expression of HLA-G and B2M resulted in high expression of HLA class I proteins on its cell surface, as described above, and as expected, only cells were killed by NK cells at the same level or less than unedited iPS cells (Figure 21). Therefore, it was revealed that the cells of the present invention have a high ability to evade cytotoxic activity by NK cells.

[0153] <Functional evaluation of suicide genes> Next, we performed experiments to confirm the functionality of the introduced suicide gene. To confirm the functionality of the suicide gene iCaspase9 introduced into universal donor iPS cells as a safety measure, we tested cell death induction in vitro by adding rapamycin. To evaluate the efficiency of cell death induction, we used the CellTiter Glo Assay Kit (Promega), which luminescently measures cell viability based on ATP levels, an indicator of cell viability. The iCaspase9-transfected cells (clone B) and unedited cells (parental) lacking iCaspase9 were cultured for 24 hours at various rapamycin concentrations (0 nM, 0.003 nM, 0.01 nM, 0.03 nM, 0.1 nM, 0.3 nM, and 1 nM). Cell viability was then measured. At rapamycin concentrations of 0.1 nM or higher, cell viability of iCaspase9-transfected cells was significantly reduced compared to unedited cells (Figure 22). These results confirmed that cell death was induced by iCaspase9 at rapamycin concentrations of 0.1 nM or higher.

[0154] [Example 5] HLA class Ib expression in the presence or absence of B2M In order to examine whether the exogenous B2M introduced into the cells of the present invention in Example 3 is necessary for the production of the cells of the present invention, a comparative test was conducted to determine whether the expression of HLA class Ib is maintained when the exogenous B2M is removed. "Combination 1" #PB_B2M_Puro_Vector #PB_HLAG_Puro_Vector "Combination 2" #PB_HLAG_Puro_Vector

[0155] The PiggyBac gene expression vector of "Combination 1" or "Combination 2" was introduced into the HLA class Ia & II-deficient iPS cells obtained in Example 2 using electroporation. Drug selection was performed using the method described in Example 3. From day 6 after electroporation, the liquid medium was replaced with drug-free liquid medium, and cell culture was continued. Cells in this state are hereinafter referred to as "pooled cells."

[0156] The cell surface expression of the overexpressed factors was analyzed by flow cytometry. After detaching the cells from the dish, they were mixed with fluorescently labeled antibodies, and the expression levels of the proteins on the cell surface were quantified using a flow cytometer (BD FACSVerse). The antibodies used are as follows: anti-B2M antibody-PECy7 conjugated (clone 2M2, BioLegend, 316318), anti-HLA-G antibody-PE conjugated (clone MEM-G / 9, Abcam, ab24384). When the two combinations were compared in pooled cells, higher expression of HLA-G and B2M was confirmed on the cell surface by introducing B2M (combination 1) (Figure 23). Because the presence of B2M resulted in a higher amount of total HLA class I (estimated from cell surface expression of B2M), it was expected that the introduction of B2M would result in more highly functional cells of the present invention. [Industrial Applicability]

[0157] The cells disclosed herein are useful, for example, in the field of regenerative medicine. This application is based on Japanese Patent Application No. 2020-091787 (filing date: May 26, 2020), the contents of which are incorporated in their entirety herein.

Claims

1. (1) The endogenous gene encoding the α chain of HLA-A, the endogenous gene encoding the α chain of HLA-B, and the endogenous gene encoding the α chain of HLA-C are deleted; (2) Deletion of the endogenous gene encoding the HLA class II expression regulator; (3) containing an exogenous gene encoding the α chain of HLA-G; (4) containing an exogenous gene encoding human PD-L1; (5) containing an exogenous gene encoding human PD-L2; and (6) Low immunogenic human cells containing an exogenous gene encoding human β2 microglobulin.

2. The cell of claim 1, which does not express endogenous HLA class Ib on its cell surface.

3. (7) The cell according to claim 1 or 2, which contains a suicide gene.

4. The cell according to any one of claims 1 to 3, wherein the site containing the exogenous gene or suicide gene is a safe harbor region of the genome.

5. The cell of claim 4, wherein the safe harbor region is the AAVS1 region, the CCR5 region, or the ROSA26 region.

6. The cell according to any one of claims 1 to 5, wherein the low immunogenic human cell is a pluripotent stem cell or a differentiated cell thereof.

7. A method for producing hypoimmunogenic human cells, comprising the steps of: (i) deleting the endogenous gene encoding the HLA-A α chain, the endogenous gene encoding the HLA-B α chain, and the endogenous gene encoding the HLA-C α chain of a human parent cell; (ii) deleting an endogenous gene encoding an HLA class II expression regulator; (iii) introducing an exogenous gene encoding the α chain of HLA-G into a human parent cell; (iv) introducing an exogenous gene encoding human PD-L1 into a human parent cell; (v) introducing an exogenous gene encoding human PD-L2 into a human parent cell; and (vi) introducing an exogenous gene encoding human β2 microglobulin into a human parent cell;

8. The method of claim 7, wherein the low-immunogenic human cells do not express endogenous HLA class Ib on the cell surface.

9. 9. The method of claim 7 or 8, further comprising the steps of: (vii) introducing a suicide gene into a human parent cell;

10. The method according to any one of claims 7 to 9, wherein the site where the exogenous gene or suicide gene is introduced is a safe harbor region of the genome.

11. The method of claim 10, wherein the safe harbor region is the AAVS1 region, the CCR5 region, or the ROSA26 region.

12. The method according to any one of claims 7 to 11, wherein the human parent cell is a pluripotent stem cell or a differentiated cell thereof.

Citation Information

Patent Citations

  • Genetically modified cells, tissues and organs for treating disease

    JP2018500897A

  • Homologous recombination for universal donor cells and chimeric mammalian hosts

    WO1995017911A1

  • Universal stem cells

    WO1998042838A1

  • Beta-2 microglobulin-deficient cells

    WO2012145384A1

  • HLA class ii deficient cells, HLA class i deficient cells capable of expressing HLA class ii proteins, and uses thereof

    WO2013158292A1