Inhibition of Kynurenine Synthesis and / or Signaling for Treating Leukemia and Myelodysplasia
Patent Information
- Application Number
- JP2024540758
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-01-07
- Filing Date
- 2023-01-06
- Publication Date
- 2025-12-19
AI Technical Summary
Current treatments for acute myeloid leukemia (AML) and bone marrow dysplasia are limited by the development of treatment-resistant leukemia clones due to the role of the bone marrow niche in maintaining and promoting the disease, with unclear mechanisms of leukemia-osteoblast cell communication, particularly involving quinulenin synthesis and serotonin receptor 1b (HTR1B) signaling.
Inhibition of indoleamine 2,3-dioxygenase (IDO1) using inhibitors such as Epacadostat or CRISPR-CAS systems targeting IDO1 expression, and blocking quinulenin synthesis to disrupt the KYN-HTR1B-SAA-IDO1 axis, combined with chemotherapy or immunotherapy to reduce leukemia burden.
Significantly reduces leukemia proliferation and burden in bone marrow and spleen, improving survival rates by disrupting the positive feedback loop of leukemia progression and enhancing chemotherapy efficacy.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[Technical field]
[0001] The present disclosure relates to the treatment of leukemia and myelodysplasia via inhibition of kynurenine synthesis and / or signaling.
[0002] government support This invention was made with Government support under AR054447 and HL130937 awarded by the National Institutes of Health. The Government has certain rights in this invention. [Background technology]
[0003] Hematological malignancies have long been thought to be driven solely by genetic or epigenetic mutations within hematopoietic cells. In addition to these classical mechanisms demonstrated in animal models and human cells, there is growing evidence that the bone marrow (BM) microenvironment or niche plays a role in the pathogenesis, maintenance, and resistance to therapy of malignant clones. Thus, the niche may enable immune evasion, as well as activation of survival and differentiation pathways that support the maintenance of malignant cells, defense against oxidative stress, and protection from chemotherapy.
[0004] As mentioned above, recent studies have shown that the tumor microenvironment plays an important role in disease development. For example, osteoblasts, which are key cells in the formation of new bone, have been found to play a tumor suppressor role in AML, elucidating potential mechanisms for therapeutic targeting and development.
[0005] Acute myeloid leukemia (AML), a heterogeneous clonal hematopoietic neoplasm and one of the most common hematological malignancies in older adults, remains resistant to targeted therapies due to the emergence of pre-existing or novel therapy-resistant leukemic clones. Against this background, the cell-nonautonomous contribution of the niche to disease initiation, propagation and maintenance may be promising for the development of new niche-focused therapeutic approaches that sustain AML. Within the niche, in particular, alterations in the osteoblast compartment can lead to myelodysplastic syndromes (MDS) and AML in mice and are associated with myeloproliferative neoplasms, MDS and AML in patients. Moreover, osteoblasts may play a tumor suppressor role in myeloid disorders or be remodeled by dysplastic cells to enhance leukemia. Osteoblast numbers are reduced in MDS and AML patients and their ablation increases the leukemic burden, whereas preserving the osteoblast pool reduces the tumor burden and extends survival. However, the mechanisms mediating leukemic cell-osteoblast communication, the molecular events that influence leukemic outcome, and the questions of whether this crosstalk can be exploited for therapeutic purposes remain largely unexplored.
[0006] AML progression requires the presence of serotonin receptor 1b (HTR1B) in osteoblasts and is driven by AML-secreted kynurenine, which acts as an oncometabolite and HTR1B ligand. AML cells utilize kynurenine to induce a proinflammatory state in osteoblasts, which in turn induces the acute phase protein serum amyloid A (SAA) to act in a positive feedback loop on leukemic cells by increasing the expression of indoleamine 2,3-dioxygenase (IDO1), the rate-limiting enzyme in kynurenine synthesis, thereby enabling AML progression.
[0007] There is a need for therapies that do not directly target tumor cells but target other causes of AML, such as the tumor microenvironment (Krevvata M, et al., Inhibition of leukemia cell engraftment and disease progression in mice by osteoblasts. Blood. 2014 October; 124(18): p. 2834-46). Specifically, osteoblasts can be targeted to inhibit leukemia engraftment and disease progression (Krevvata M, et al., Inhibition of leukemia cell engraftment and disease progression in mice by osteoblasts. Blood. 2014 October; 124(18): p. 2834-46).
[0008] There is therefore a need to develop inhibitors of kynurenine synthesis, such as IDO1, for the treatment of leukemia as well as other myelodysplastic syndromes. [Prior art documents] [Non-patent literature]
[0009] [Non-Patent Document 1] Krevvata M, et al., Inhibition of leukemia cell engraftment and disease progression in mice by osteoblasts.Blood.October 2014;124(18):p.2834-46 Summary of the Invention
[0010] The present invention provides methods and compositions for treating leukemia, comprising administering a therapeutically effective amount of an inhibitor of indoleamine 2,3 dioxygenase (IDO1) to a mammal in need thereof. In some embodiments, the mammal is a human. The leukemia can be acute myeloid leukemia or acute lymphocytic leukemia. The inhibitor includes indiximod, epacadostat, BMS-986205, navoximode, PF-0684003, KHK2455 or LY3381916 or combinations thereof, or epacadostat. The inhibitor can be administered orally, intravenously, intramuscularly, topically, intraarterially, or subcutaneously.
[0011] The present invention also provides methods and compositions for inhibiting indoleamine 2,3 dioxygenase expression, which comprise introducing into a eukaryotic cell an engineered, non-naturally occurring clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated (Cas) (CRISPR-Cas) system comprising one or more vectors, the one or more vectors being operably linked to at least one nucleotide sequence encoding a CRISPR-Cas system guide RNA that hybridizes to a sequence encoding exon 3 or 4 of indoleamine 2,3 dioxygenase. and b) a second regulatory element operable in a eukaryotic cell operably linked to a nucleotide sequence encoding a Cas9 protein, wherein components (a) and (b) are located on the same vector or different vectors of the system, whereby the guide RNA targets a sequence encoding exon 3 or 4 of indoleamine 2,3 dioxygenase, and the Cas9 protein cleaves the DNA molecule, thereby decreasing expression of the indoleamine 2,3 dioxygenase protein, and wherein both the Cas9 protein and the guide RNA are non-naturally occurring.
[0012] The present invention provides methods and compositions for treating leukemia in a subject, comprising administering to the subject a therapeutically effective amount of a modulator of indoleamine 2,3 dioxygenase. The modulator can bind to the enzyme catalytic site of indoleamine 2,3 dioxygenase. The modulator can be a small molecule, a polynucleotide, or an antibody or antigen-binding portion thereof. In other embodiments, the modulator is a nucleic acid selected from the group consisting of single-stranded DNA (ssDNA), double-stranded DNA (dsDNA), donor / template DNA, s cDNA. DNA encoding one or more RNAs, sgRNA, guide RNA (gRNA), prime-edited guide RNA (pegRNA), microRNA (miRNA) inhibitors, miRNA mimics, short interfering RNA (siRNA), small synthetic RNA, synthetic RNA, antisense oligonucleotides, short hairpin RNA (shRNA), double-stranded RNA (dsRNA), antisense RNA, ribozymes, and combinations thereof. Preferably, the modulator can be a polynucleotide, such as a short interfering RNA (siRNA) or an antisense molecule. Modulators may be administered orally, intravenously, intramuscularly, topically, intraarterially, or subcutaneously.
[0013] The present invention also provides compositions and methods for treating myelodysplastic syndrome, comprising administering a therapeutically effective amount of an inhibitor of indoleamine 2,3 dioxygenase to a mammal in need thereof. The mammal may be a human. In one embodiment, the inhibitor comprises indiximod, epacadostat, BMS-986205, navoximode, PF-0684003, KHK2455 or LY3381916 or a combination thereof. In another embodiment, the inhibitor comprises epacadostat. Other inhibitors, such as siRNA or CRISPR / Cas systems, can be used as inhibitors. The inhibitor can be administered orally, intravenously, intramuscularly, topically, intraarterially, or subcutaneously.
[0014] The present invention provides methods and compositions for treating leukemia, comprising administering a therapeutically effective amount of an inhibitor of serum amyloid A1 (SAA1) to a mammal in need thereof. In some embodiments, the mammal is a human. In some embodiments, the leukemia is acute myeloid leukemia or acute lymphocytic leukemia. In some embodiments, the inhibitor comprises an anti-SAA1 antibody or an antigen-binding portion or combination thereof. In some embodiments, the anti-SAA1 antibody can be administered orally, intravenously, intramuscularly, topically, intraarterially, or subcutaneously. [Brief description of the drawings]
[0015] [Figure 1A] Survival curves of wild-type (WT) mice treated with vehicle (n = 4) or parathyroid hormone (PTH, n = 7) and injected with MLL / AF9 AML cells are shown. All survival curves shown are Kaplan-Meier curves with p-values of the log-rank (Mantel-Cox) test between groups indicated. All data are expressed as mean ± SEM with statistical analysis performed using unpaired t-tests. [Figure 1B] Representative epifluorescence images (radiance p / sec / cm2 / sr) of survival curves of MLL / AF9-injected WT mice, their spleen weights and leukemia progression 14 days after MLL / AF9 injection in Htr1b- / - (n=29) and Htr1b+ / + littermates (n=13) are shown. All survival curves shown are Kaplan-Meier curves with p-values of the log-rank (Mantel-Cox) test between groups indicated. All data are expressed as mean ± SEM with statistical analysis performed using unpaired t-tests. [Figure 1C]Representative epifluorescence images (radiance p / sec / cm2 / sr) of survival curves of MLL / AF9-injected WT mice, their spleen weights and leukemia progression 14 days after MLL / AF9 injection in Htr1bfl / fl;LepR-Cre:Htr1bLep-R- / - (n=8) and Htr1b+ / + littermates (n=6) are shown. All survival curves shown are Kaplan-Meier curves with p-values of the log-rank (Mantel-Cox) test between groups indicated. All data are expressed as mean ± SEM with statistical analysis performed using unpaired t-test. [Figure 1D] Representative epifluorescence images (radiance p / sec / cm2 / sr) of survival curves of MLL / AF9-injected WT mice, their spleen weights and leukemia progression 14 days after MLL / AF9 injection in Htr1bfl / fl;Col1a1-Cre:Htr1bc-osb- / - (n=11) and Htr1bc-osb+ / + littermates (n=12) (four Htr1bc-osb- / - mice developed leukemia);OCN-Cre:Htr1b littermates (n=10) are shown. Arrows indicate the systematic genetic interrogation approach followed. All survival curves shown are Kaplan-Meier curves with p-values of the log-rank (Mantel-Cox) test between groups indicated. All data are expressed as mean ± SEM with statistical analysis performed using unpaired t-tests. [Figure 1E] Representative epifluorescence images (radiance p / sec / cm2 / sr) of survival curves of MLL / AF9-injected WT mice 14 days after MLL / AF9 injection in Htr1bfl / fld-osb- / - (n=5) and Htr1bd-osb+ / +fl / flOsx- / -Osx+ / +Osx+ / + (DOX, n=6), Htr1bOsx- / - (without DOX; n=9) are shown. All survival curves shown are Kaplan-Meier curves with p-values of the log-rank (Mantel-Cox) test between groups indicated. All data are expressed as mean ± SEM with statistical analysis performed using unpaired t-test. [Figure 1F]Representative epifluorescence images (radiance p / sec / cm2 / sr) of survival curves of MLL / AF9-injected WT mice, their spleen weights, and leukemia progression 14 days after MLL / AF9 injection in Htr1b;Osx-Cre:Htr1b (doxycycline-DOX removal 24 h after MLL / AF9 injection; n=9) and Htr1b (DOX maintenance, n=6) mice are shown. All survival curves shown are Kaplan-Meier curves with p-values of the log-rank (Mantel-Cox) test between groups indicated. All data are expressed as mean ± SEM with statistical analysis performed using unpaired t-tests. [Figure 1G] Survival curves of MLL / AF9-injected WT mice, their spleen weights, and representative epifluorescence images (radiance p / sec / cm2 / sr) of leukemic progression 14 days after MLL / AF9 injection on day 12 after MLL / AF9 injection quantification of leukemic burden (total flux, photons / sec) are shown, Htr1b is represented by a red asterisk in the histograms of spleen weight and was excluded from statistical analysis. [Figure 1H] Representative epifluorescence images (radiance p / sec / cm2 / sr) of survival curves of MLL / AF9-injected WT mice, their spleen weights, and leukemia progression 14 days after MLL / AF9 injection are shown for WT mice injected with MLL / AF9 cells and treated with either vehicle (n=10) or the HTR1B antagonist SB224289 (SB9) (n=10). All survival curves shown are Kaplan-Meier curves with p-values of the log-rank (Mantel-Cox) test between groups indicated. All data are expressed as mean ± SEM with statistical analysis performed using unpaired t-tests. [Figure 2A] Volcano plots of metabolites with coefficient of variation (CV) < 30% comparing untreated OCI-AML3 cells (AML) to human osteoblasts (hOsb). Isotherms were fitted using non-linear regression fitting. All data are expressed as mean ± SEM. [Figure 2B]Volcano plots of metabolites with coefficient of variation (CV) < 30% comparing untreated OCI-AML3 cells (AML) A versus co-culture (24 h). Arrows point to kynurenine. Isotherms were fitted using non-linear regression fitting. All data are expressed as mean ± SEM. [Figure 2C] 1 shows the Trp catabolic scheme. [Figure 2D] Relative abundance of tryptophan (Trp) and its catabolic products: kynurenine (Kyn), serotonin (5-HT) and 5-hydroxytryptophan (5-HTP) in the indicated supernatants at 24 h are shown (n=6); Two-way ANOVA. [Figure 2E] Heatmap of the first 30 metabolites with CV<15% and histograms of fold change for AML vs. hOsb (scattered dots) or AML vs. co-culture (Y). Isotherms were fitted using nonlinear regression fitting. All data are expressed as mean ± SEM. [Figure 2F] Violin plots of Kyn / Trp ratio levels in serum circulating levels of control mice (n=19) versus MLL / AF9-injected (n=28) mice; unpaired t-test. Isotherms were fitted using nonlinear regression fitting. All data are expressed as mean ± SEM. [Figure 2G] Violin plots of Kyn / Trp ratio levels in bone marrow (BM) plasma from healthy (n=27), MDS (n=30) and AML (n=24) patients; one-way ANOVA. Isotherms were fitted using non-linear regression fitting. All data are expressed as mean ± SEM. [Figure 2H] Kyn / Trp levels in paired MDS stage BM plasma samples with their corresponding altered AML stage BM plasma samples are shown (n=6); paired t-test. Isotherms were fitted using nonlinear regression fitting. All data are expressed as mean±SEM. [Figure 2I]RNAseq analysis of BM mononuclear cells (BM-MNC) from MDS (n=30) and AML (n=30) patients for TPH1 and IDO1 (transcript-per-million-TPM-); Two-way ANOVA. Isotherms were fitted using nonlinear regression fitting. All data are presented as mean ± SEM. [Figure 2J] IDO1 / TPH1 mRNA ratios in BM-MNCs from healthy (n=32), MDS (n=10) and AML (n=20) patients; one-way ANOVA. Isotherms were fitted using nonlinear regression fitting. All data are expressed as mean ± SEM. [Figure 2K] Concentration dependence of Kyn-mediated competition of 350 at 54.1 μM and 24.4 μM, respectively (see Table 1 for details). Isotherms were fitted using nonlinear regression fitting. All data are expressed as mean ± SEM. [Figure 2L] Gi / o-mediated cAMP inhibition assay (n=14). Isotherms were fitted using nonlinear regression fitting. All data are expressed as mean±SEM. [Figure 2M] Binding of [3H]-5-HT (25 nM, 41.3 Ci / mmol) or [3H]-Kyn (50 μM, 0.125 Ci / mmol) was measured using Htr1b-overexpressing HEK293T membranes in the presence of increasing concentrations of SB9 (n=4). Isotherms were fitted using nonlinear regression fitting. All data are presented as mean ± SEM. [Figure 3A] Representative epifluorescence images of leukemia progression in WT mice injected with MLL / AF9-CRISPR / Cas9 edited cells (sgRNA: #146, #196 and #203) are shown (Ctrl: no leukemia). All data are expressed as mean ± SEM. Statistical analysis was performed using unpaired t-test unless otherwise stated. [Figure 3B]Survival curves of mice injected with the indicated sgRNA MLL / AF9 edited cells or Cas9 alone MLL / AF9 control cells are shown (n=3 for all groups). All data are expressed as mean ± SEM. Statistical analysis was performed using unpaired t-tests unless otherwise stated. [Figure 3C] Representative epifluorescence images of leukemia progression in WT mice injected with MLL / AF9-CRISPR / Cas9 edited cells (sgRNA: #610) and Ido1 mRNA levels in MLL / AF9-sgRNA #610 edited cells before injection are shown (n=4); unpaired t-test. All data are expressed as mean ± SEM. Statistical analysis was performed using unpaired t-test unless otherwise stated. [Figure 3D] Survival curves of WT mice injected with MLL / AF9- (green; n=5) are shown. All data are expressed as mean ± SEM. Statistical analysis was performed using unpaired t-test unless otherwise stated. [Figure 3E] IDO1 mRNA levels in OCI-AML3 cells nucleofected with Cas9 and sgRN#610 used in transplantation experiments are shown. All data are presented as mean ± SEM. Statistical analysis was performed using unpaired t-test unless otherwise stated. [Figure 3F] IDO1 mRNA levels in OCI-AML3 cells exposed to IFN-γ (overnight, 50 ng / ml, n=3); Two-way ANOVA. All data are expressed as mean ± SEM. Statistical analysis was performed using unpaired t-test unless otherwise stated. [Figure 3G] Summary of engraftment assay with OCI-AML3 CRISPR / Cas9-IDO1 targeted cells in NSG mice. All data are expressed as mean ± SEM. Statistical analysis was performed using unpaired t-test unless otherwise stated. [Figure 3H]AML burden in bone marrow, spleen, and spleen weight (mg) relative to total body weight (g) of NSG mice 3 weeks after injection of OCI-AML3 cells (Cas9, n=8; #126+170, n=10). All data are expressed as mean ± SEM. Statistical analysis was performed using unpaired t-test unless otherwise stated. [Figure 3I] Proliferation of OCI-AML3 cells after 72 hours of co-culture with primary human osteoblasts (n=7). Survival curves are Kaplan-Meier with p-values of the log-rank (Mantel-Cox) test between groups shown. [Figure 4A] Schematic diagram (left) and box plots (right) of the RNAseq analysis strategy of key secreted molecules significantly upregulated in primary human osteoblasts co-cultured with THP-1 AML cell line for 24 h (n=2); Wald test, two-tailed. All data are expressed as mean ± SEM. Statistical analysis was performed using one-way ANOVA unless otherwise stated. [Figure 4B] Box plots of IDO1 and TPH1 from RNAseq analysis of THP-1 cells exposed to primary human osteoblasts for 24 h are shown (n=2). Wald test, two-tailed. All data are expressed as mean ± SEM. Statistical analysis was performed using one-way ANOVA unless otherwise stated. [Figure 4C] IDO1 mRNA levels in OCI-AML3 cells exposed o / n to the indicated molecules are shown (UT and SAA1 n=15; IL-1α, -1β, -6, CXCL-1 and -8 n=6; IL-33, -34 and Htr1bCXCL-3, -5, CCL-2 and -20 n=3). All data are expressed as mean ± SEM. Statistical analysis was performed using one-way ANOVA unless otherwise stated. [Figure 4D] Ido1 mRNA levels in WEHI-3B cells exposed o / n to recombinant mouse SAA3 or recombinant human SAA1 (n=8). All data are presented as mean ± SEM. Statistical analysis was performed using one-way ANOVA unless otherwise stated. [Figure 4E]Saa3 mRNA relative levels in primary differentiated mouse calvaria from Htr1b- / -+ / + littermates exposed for 24 h to 5-HT (25 nM, n = 7–8), Kyn (25 nM, n = 5) or WEHI-3B cell line (n = 10–12); two-way ANOVA. All data are expressed as mean ± SEM. Statistical analysis was performed using one-way ANOVA unless otherwise stated. [Figure 4F] Violin plots of SAA3 peripheral blood (PB) serum levels in control (n=20) and MLL / AF9-injected mice (n=20); unpaired t-test. All data are expressed as mean ± SEM. Statistical analysis was performed using one-way ANOVA unless otherwise stated. [Figure 4G] Violin plots of SAA1 BM plasma levels in healthy (n=30), MDS (n=35) and AML (n=23) patients are shown. All data are expressed as mean ± SEM. Statistical analysis was performed using one-way ANOVA unless otherwise stated. [Figure 4H] SAA1 BM plasma levels in paired samples from patients (MDS and corresponding AML transformation stages) are shown (paired samples, n=6); paired t-test. All data are expressed as mean ± SEM. Statistical analysis was performed using one-way ANOVA unless otherwise stated. [Figure 4I] Multivariate data plots of BM plasma levels for SAA1 and Kyn / Trp ratio along with healthy, MDS or AML samples are shown, and Pearson correlation values are shown for Kyn / Trp ratio and SAA1 BM plasma levels. All data are presented as mean ± SEM. Statistical analysis was performed using one-way ANOVA unless otherwise stated. All data are presented as mean ± SEM. Statistical analysis was performed using one-way ANOVA unless otherwise stated. [Figure 5A]Proliferation of human THP-1 and OCI-AML3 (n=22) and murine WEHI-3B (n=8) AML cell lines exposed to SAA1 or SAA3 (1 μg / ml, 24–72 h), respectively, is shown. All data are expressed as mean ± SEM. Statistical analysis was performed using unpaired t-tests unless otherwise stated. [Figure 5B] Proliferation levels of human bone marrow mononuclear cells (BM-MNC) (n=8) isolated from MDS or AML (lineage-depleted) BM aspirates and exposed to SAA1 (5 μg / ml, 24 h) are shown. All data are expressed as mean ± SEM. Statistical analysis was performed using unpaired t-test unless otherwise stated. [Figure 5C] IDO1 mRNA levels in human bone marrow mononuclear cells (BM-MNCs) (n=8) isolated from MDS or AML (lineage-depleted) BM aspirates and exposed to SAA1 (5 μg / ml, 24 h) are shown. All data are expressed as mean ± SEM. Statistical analysis was performed using unpaired t-test unless otherwise stated. [Figure 5D] A schematic diagram of the patient-derived xenograft (PDX) model used is shown (left). Right: Proliferation of total human BM cells isolated from PDX mice injected with either healthy CD34+ (n=3) or patient-derived AML cells (n=8) exposed to vehicle (PBS) or SAA1 (1 μg / ml, 24 h). All data are expressed as mean ± SEM. Statistical analysis was performed using unpaired t-test unless otherwise stated. [Figure 5E] (D) IDO1 mRNA levels from cells; two-way ANOVA. In vivo expansion of leukemic blasts (hCD45+CD33+). All data are expressed as mean ± SEM. Statistical analysis was performed using unpaired t-test unless otherwise stated. [Figure 5F] Figure 1 shows in vivo expansion of leukemic blasts (hCD45+CD33+) in mice treated with either vehicle (n=10, n=7, respectively) or SAA1 (n=14, n=9, respectively) for 2 or 8 days. All data are expressed as mean ± SEM. Statistical analysis was performed using unpaired t-test unless otherwise stated. [Figure 5G] BM AML burden in mice treated with either vehicle (n=10, n=7, respectively) or SAA1 (n=14, n=9, respectively) for 2 or 8 days is shown. All data are expressed as mean ± SEM. Statistical analysis was performed using unpaired t-test unless otherwise stated. [Figure 5H] Proliferation of total human AML BM cells isolated from PDX mice and nucleofected with Cas9 (n=5), or Cas9 and a combination of sgRNA#126 and sgRNA#170 (n=8) exposed to vehicle or SAA1 (1 μg / ml, 24 h); two-way ANOVA. (I) CYP1A1 and CYP1A2 mRNA levels from cells in (D); two-way ANOVA. All data are presented as mean ± SEM. Statistical analysis was performed using unpaired t-test unless otherwise stated. [Figure 5I] (D) CYP1A1 and CYP1A2 mRNA levels from cells; two-way ANOVA. All data are expressed as mean ± SEM. Statistical analysis was performed using unpaired t-test unless otherwise stated. [Figure 5J] Violin plots for CYP1A1 and CYP1A2 mRNA levels in BM-MNCs from healthy (n=15) and AML (n=17) patients are shown. All data are expressed as mean ± SEM. Statistical analysis was performed using unpaired t-tests unless otherwise stated. [Figure 5K] CYP1A1 and CYP1A2 mRNA levels from cells in Figure 5(B) are shown. All data are expressed as mean ± SEM. Statistical analysis was performed using unpaired t-test unless otherwise stated. [Figure 5L] GSEA analysis of AHR activation signature genes in THP-1 cells co-cultured with human osteoblasts for 24 h. All data are expressed as mean ± SEM. Statistical analysis was performed using unpaired t-test unless otherwise stated. [Figure 6A]Survival curves comparing vehicle-treated mice (n=26) and epacadostat-treated mice (0.8 g / kg, n=18; 1.6 g / kg, n=13). Kaplan-Meier curves with p-values from the log-rank (Mantel-Cox) test. SAA3. All data are expressed as mean ± SEM. Statistical analysis was performed using unpaired t-test unless otherwise stated. [Figure 6B] SAA3 / Trp ratio serum levels in NSGS mice engrafted with CD34+ healthy cells (n=11) or patient-derived AML cells (n=27) are shown. All data are expressed as mean ± SEM. Statistical analysis was performed using unpaired t-test unless otherwise stated. [Figure 6C] Kyn / Trp ratio serum levels in NSGS mice engrafted with CD34+ healthy cells (n=11) or patient-derived AML cells (n=27) are shown. All data are expressed as mean ± SEM. Statistical analysis was performed using unpaired t-test unless otherwise stated. [Figure 6D] A schematic diagram illustrating pharmacological targeting of IDO1 (epacadostat) in patient-derived AML xenografts (PDX) in NSGS mice is shown. All data are expressed as mean ± SEM. Statistical analysis was performed using unpaired t-test unless otherwise stated. [Figure 6E] Kyn / Trp ratio in serum of PDX mice 5 weeks after AML transplantation in the BM of PDX mice (left) and AML burden in the BM of PDX mice at harvest (right) are shown (vehicle n=8; epacadostat n=10). All data are expressed as mean ± SEM. Statistical analysis was performed using unpaired t-test unless otherwise stated. [Figure 6F] Representative flow cytometry plots showing % human or mouse CD45++ in PDX mice treated with either vehicle (n=8) or epacadostat (n=8). All data are expressed as mean ± SEM. Statistical analysis was performed using unpaired t-test unless otherwise stated. [Figure 6G]Representative flow cytometry plots (left) and cell cycle analysis of leukemic blasts (CD45CD33 and IL-16) after 2 weeks of epacadostat treatment (vehicle n = 8; epacadostat n = 10). All data are expressed as mean ± SEM. Statistical analysis was performed using unpaired t-test unless otherwise stated. [Figure 6H] Cell cycle analysis of mice in Figure 6G is shown. All data are expressed as mean ± SEM. Statistical analysis was performed using unpaired t-test unless otherwise stated. [Figure 6I] A schematic diagram showing an in vivo PDX mouse model treated with combination therapy (Ara-C 60 mg / kg for 1-5 days + epacadostat 1.6 g / kg ad libitum for 3 weeks) is shown. AML burden in BM. All data are expressed as mean ± SEM. Statistical analysis was performed using unpaired t-test unless otherwise stated. [Figure 6J] A schematic diagram showing an in vivo PDX mouse model treated with combination therapy (Ara-C 60 mg / kg for 1-5 days + epacadostat 1.6 g / kg ad libitum for 3 weeks) is shown. AML burden in the spleen. All data are expressed as mean ± SEM. Statistical analysis was performed using unpaired t-test unless otherwise stated. [Figure 6K] AML burden after 11 weeks of transplantation and 3 weeks of combination therapy is shown; control chow (ctrl.n=4), Ara-C (n=3), epacadostat (Epac.n=4) and combination therapy (Ara-C+Epac.n=3); One-way ANOVA; unpaired t-test, p-values are shown for BM ctrl group vs. Ara-C and Epac group. All data are expressed as mean ± SEM. Statistical analysis was performed using unpaired t-test unless otherwise stated. [Figure 6L] A schematic model of the kynurenine-HTR1B-SAA-IDO1 axis representing AML-mediated osteoblast self-reinforcing niche remodeling is shown. [Figure 7A]Proliferation of human AML cell lines (MOLM-14, KG-1a, Kasumi-1 and HL-60) exposed to SAA1 (1 μg / ml) for 24, 48 or 72 hours (n=8 for all cell lines); Two-way ANOVA. [Figure 7B] Shown are AML burden, spleen weight and liver weight (relative to body weight) in PDX mice 4 weeks after transplantation of CD34+ healthy cells (n=3 mice) or patient-derived AML cells (n=8 mice). [Figure 7C] FIG. 1 shows short-term (2 days) versus long-term (8 days) SAA1 in vivo treatment. [Figure 7D] In vivo cell cycle analysis showing % of cells in G0-G1, G2-M and Sub-G1 within leukemic blasts (hCD45+CD33+) comparing 2-day treatment with vehicle (n=10 and n=7, respectively) or SAA1 (0.1 mg / kg; n=14 and n=9, respectively); 2-way ANOVA. Below, representative flow plots for BM AML burden (top) and proliferation analysis (bottom) in the 8-day treatment groups are shown. [Figure 7E] Schematic diagram of CRIPSR / Cas9 targeting of PDX-isolated AML human cells (left) and IDO1 mRNA levels in human AML cells nucleofected with Cas9 (n=7) or Cas9 and a combination of sgRNA#126 (sequence number 82) and sgRNA#170 (sequence number 103) (n=9). [Figure 7F] IDO1 mRNA levels in cells cultured with either vehicle or SAA1 (1 μg / ml) for 24 h are shown (n=3). Two-way ANOVA. [Figure 7G] Schematic of Kyn treatment in low-loading PDX (left) and SAA3 serum levels in NSGS mice injected with vehicle (n=5) or Kyn (20 mg / kg; n=6) for 1 week. [Figure 7H] The percentage of blast (hCD45+hCD33+) Edu+ cells from mice in FIG. 7G is shown. [Figure 7I]The AML burden in the BM and SP of the mice in FIG. 7G is shown. [Figure 7J] 1 shows mRNA levels of key AHR target genes in the indicated human AML and MDS cell lines exposed to SAA1. [Figure 7K] Shown are mRNA levels (FI vs. UT) of AHR targets in OCI-AML3 and THP-1 cells exposed to primary human osteoblasts for 24 hours. [Figure 8A] Kyn / Trp ratio levels in WT mice injected with or without MLL / AF9 cells and treated with either vehicle or epacadostat are shown (leukemia-free: Vehicle n=9, Epac. n=9; MLL / AF9-injected mice: Vehicle n=18, Epac. n=14). [Figure 8B] Survival curves comparing leukemic mice treated with either vehicle (n=19) or epacadostat (n=19) are shown. [Figure 8C] FIG. 1 shows in vivo leukemia burden quantification of mice shown in (A) treated with either vehicle or 0.8 g / kg epacadostat. [Figure 8D] Absolute levels of Kyn and Trp and the Kyn / Trp ratio in serum of WT mice injected with MLL / AF9 cells and treated with either vehicle (n=6) or 1.6 g / kg epacadostat ad libitum diet (n=9) are shown. [Figure 8E] (D) In vivo leukemia burden quantification in mice. [Figure 8F] Absolute levels of Kyn and Trp in serum of NSGS mice engrafted with either healthy CD34+ cells (n=11) or patient-derived AML cells (n=27) are shown. [Figure 8G] Multivariate data plots of SAA3, Kyn / Trp ratio serum levels and transplant disease in NSGS mice transplanted with CD34+ healthy cells (n=11) or patient-derived AML cells (n=27) are shown. [Figure 8H]AML burden in BM aspirates from PDXs in NSGS mice at randomization (3 weeks; vehicle n=8, epacadostat n=10). [Figure 8I] Kyn and Trp levels in serum of PDX mice harvested 5 weeks after transplantation and 12 days after epacadostat treatment are shown (n=8 vehicle, n=10 epacadostat). [Figure 8J] AML burden in BM aspirates of PDX NSG mice 8 weeks after transplantation at the time of randomization is shown (n=5 for all groups). [Figure 8K] Kyn / Trp ratio serum levels in all mice before treatment (n=20) and after 3 weeks of epacadostat diet (n=7) are shown. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0016] AML cells capture peripheral serotonin signaling pathways to dictate a cycle of feedback signals in niche osteoblasts that promote leukemia growth (Galan-Diez et al. Subversion of serotonin-receptor signaling in osteoblast by kynurenine drives Acute Myeloid Leukemia. Cancer Discover 2022 12(40):1106-1107). (Figure 6L). This outcome is achieved by preferential production of kynurenine by AML cells, which acts in this context as a cancer metabolite and a previously unrecognized ligand for HTR1B. Ditto AML niche remodeling induces a proinflammatory signature in osteoblasts. Among several proinflammatory molecules whose expression is upregulated in osteoblasts, leukemia-secreted Kyn specifically induces SAA expression via HTR1B. Ibid. In turn, osteoblast-secreted SAA acts in AML cells to upregulate IDO1 expression, self-reinforcing leukemia proliferation. SAA1-dependent IDO1 upregulation promotes AML progression in a cell-intrinsic manner by increasing kynurenine secretion (thus activating the AHR pathway, which enhances leukemia cell proliferation), as well as by promoting resistance and immune evasion (reviewed in Prendergast GC, et al., Discovery of IDO1 Inhibitors: From Bench to Bedside. Cancer Research. 2017; 77: 6795-811).
[0017] Moreover, disruption of certain pathways induced by leukemic cells in osteoblasts actually promotes AML growth. The balance between these two effects allows for stable leukemic proliferation that ultimately leads to lethality. When osteoblast numbers decrease, this balance is disrupted by a decrease in protective signals, but the Kyn-HTR1B-SAA-IDO1 pathway is maintained and is able to overcome the weakening protective effects more quickly, promoting AML growth. Id. Elevated kynurenine levels indicate disease in MDS and AML patients. The importance of Trp catabolism in leukemic cells is supported by other studies showing that serotonin levels are dramatically reduced in MDS and AML patients and leukemic mice (Ye H, et al. Subversion of Systemic Glucose Metabolism as a Mechanism to Support the Growth of Leukemia Cells. Cancer Cell. 2018; 34: 659-673. e6), and that the Kyn / Trp ratio is associated with several malignancies, including AML (Fukuno K, et al. Expression of indoleamine 2,3-dioxygenase in leukemic cells indicates an unfavorable prognosis in acute myeloid leukemia patients with intermediate-risk cytogenetics. Leuk Lymphoma. 2015; 56: 1398-405).
[0018] The identification of the Kyn-HTR1B-SAA-IDO1 axis in promoting AML growth may be relevant to other cancers and can be utilized in combination with chemotherapy or immunotherapy to overcome current challenges. Lemos H,et al., Immune control by amino acid catabolism during tumorigenesis and therapy.Nature Reviews Cancer.Nature Publishing Group;2019;19:162-75.
[0019] The term "modulator" refers to an agent that can regulate (e.g., downregulate, decrease, inhibit or upregulate, increase) the level / amount and / or activity of a protein, enzyme, or pathway.
[0020] The term "inhibitor" refers to an agent that can downregulate or otherwise decrease or suppress the level / amount and / or activity of a protein, enzyme, or pathway.
[0021] The term "therapeutically effective amount" is an amount sufficient to treat a particular disorder or disease or to obtain a pharmacological response that treats the disorder or disease.
[0022] The terms "subject", "individual" and "patient" are used interchangeably and refer to a mammal, such as a vertebrate, preferably a human. Mammals include, but are not limited to, human primates, non-human primates or murine, bovine, equine, canine or feline species. In the context of this disclosure, the term "subject" also encompasses tissues and cells that may be cultured in vitro or ex vivo or manipulated in vivo. The term "subject" can be used interchangeably with the term "organism".
[0023] The terms "polynucleotide", "nucleotide", "nucleotide sequence", "nucleic acid" and "oligonucleotide" are used interchangeably. They refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or their analogs. Examples of polynucleotides include, but are not limited to, coding or non-coding regions of a gene or gene fragment, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes and primers. One or more nucleotides within a polynucleotide can be further modified. The sequence of nucleotides can be interrupted by non-nucleotide components. Polynucleotides can also be modified after polymerization, for example, by conjugation with a labeling agent.
[0024] The phrase "pharmacologically acceptable" when used in connection with compositions and / or cells of the present disclosure refers to molecular entities and other components of such compositions that are physiologically acceptable and typically do not cause adverse reactions when administered to a mammal (e.g., human). Preferably, as used herein, the term "pharmacologically acceptable" means approved by a federal or state regulatory agency or listed in the United States Pharmacopeia or other generally recognized pharmacopoeias for use in mammals, more specifically, humans. "Acceptable" means that the carrier is compatible with the active ingredients of the composition (e.g., engineered exosomes or extracellular vesicles) and does not adversely affect the subject to which the composition or compositions are administered. Pharmaceutical compositions may include pharmaceutically acceptable carriers, excipients, or stabilizers in the form of lyophilized formulations or aqueous solutions.
[0025] The terms "gRNA", "guide RNA" and "CRISPR guide sequence" may be used interchangeably throughout and refer to a nucleic acid that contains a sequence that determines the specificity of the Cas DNA-binding protein of a CRISPR / Cas system. The gRNA hybridizes (complementarily, partially or completely) to a target nucleic acid sequence in the genome of a host cell. The gRNA or a portion thereof that hybridizes to the target nucleic acid can be 15-25 nucleotides, 18-22 nucleotides, or 19-21 nucleotides in length. In some embodiments, the gRNA sequence that hybridizes to the target nucleic acid is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length. In other embodiments, the gRNA sequence that hybridizes to the target nucleic acid is 10-30 or 15-25 nucleotides in length.
[0026] As used herein, "scaffold sequence", also referred to as tracrRNA, refers to a nucleic acid sequence that recruits Cas endonuclease to a target nucleic acid bound (hybridized) to a complementary gRNA sequence. Any scaffold sequence that includes at least one stem-loop structure and recruits an endonuclease can be used in the genetic elements and vectors described herein. Exemplary scaffold sequences will be apparent to those skilled in the art and can be found, for example, in Jinek, et al. Science (2012) 337 (6096): 816-821, Ran, et al. Nature Protocols (2013) 8: 2281-2308, PCT Application No. WO2014 / 093694 and PCT Application No. WO2013 / 176772.
[0027] "RNA interference" or "RNAi" is a form of post-transcriptional gene silencing ("PTGS") and involves, for example, the introduction of double-stranded RNA into cells (Fire, A. Trends Genet 15:358-363 (1999); Sharp, P. Genes Dev 13:139-141 (1999); Hunter, C. Curr Biol 9:R440-R442 (1999); Baulcombe. D. Curr Biol 9:R599-R601 (1999); Vaucheret et al. Plant J. 16:651-659 (1998)). The activator of RNAi is a long double-stranded (antiparallel duplex) RNA, one of the strands corresponds to or is complementary to the RNA to be inhibited. The RNA to be inhibited is the target RNA. The long double-stranded RNA is cleaved into smaller duplexes of about 20 to 25 nucleotide pairs, and the mechanism by which the smaller RNA then inhibits the expression of the target is largely unknown at this time. RNAi can function in human cells when the RNA strands are provided as pre-sized duplexes of about 19 nucleotide pairs, and RNAi with small unpaired 3' extensions at the end of each strand worked particularly well (Elbashir et al. Nature 411:494-498 (2001)).
[0028] The present invention provides methods and compositions for treating leukemia, comprising administering a therapeutically effective amount of an inhibitor of indoleamine 2,3 dioxygenase to a mammal in need thereof. In various embodiments, the mammal is a human. The leukemia can be acute myeloid leukemia or acute lymphocytic leukemia. In other embodiments, the inhibitor comprises indiximod, epacadostat, BMS-986205, navoximode, PF-0684003, KHK2455 or LY3381916 or combinations thereof. In some embodiments, the inhibitor comprises epacadostat. The IDO1 inhibitor can be administered alone or in combination with other chemotherapeutic agents, such as ARA-C. The IDO1 inhibitor can be administered orally, intravenously, intramuscularly, topically, intraarterially, or subcutaneously.
[0029] The present invention also provides methods and compositions for inhibiting indoleamine 2,3 dioxygenase expression, comprising introducing into a eukaryotic cell an engineered, non-naturally occurring clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated (Cas) (CRISPR-Cas) system comprising one or more vectors; contacting the cell with a vector comprising: a) at least one nucleotide sequence encoding a clustered regularly interspaced short palindromic repeats (CRISPR)-Cas system guide RNA that hybridizes to a nucleotide sequence in exon 3 or 4 encoding indoleamine 2,3 dioxygenase; and (b) a nucleotide sequence encoding a Cas protein.
[0030] The present invention also provides methods and compositions for treating leukemia in a subject, comprising administering to the subject a therapeutically effective amount of an inhibitor of indoleamine 2,3 dioxygenase. The inhibitor can bind to the enzyme catalytic site of indoleamine 2,3 dioxygenase. The inhibitor can be a small molecule, a polynucleotide, or an antibody or antigen-binding portion thereof. In certain embodiments, the modulator is a nucleic acid selected from the group consisting of single-stranded DNA (ssDNA), double-stranded DNA (dsDNA), donor / template DNA, s cDNA. DNA encoding one or more RNAs, sgRNA, guide RNA (gRNA), prime-edited guide RNA (pegRNA), microRNA (miRNA) inhibitors, miRNA mimics, short interfering RNA (siRNA), small synthetic RNA, synthetic RNA, antisense oligonucleotides, short hairpin RNA (shRNA), double-stranded RNA (dsRNA), antisense RNA, ribozymes, and combinations thereof. In a preferred embodiment, the polynucleotide is a short interfering RNA (siRNA) or an antisense molecule. In another preferred embodiment, the modulator comprises CRISPR / Cas system.CRISPR-Cas system can be in the form of RNA, plasmid and protein.Inhibitor can be administered orally, intravenously, intramuscularly, locally, intraarterially or subcutaneously, alone or in combination with other therapeutic agents such as ARA-C.
[0031] The present invention also provides methods and compositions for treating myelodysplastic syndromes, comprising administering a therapeutically effective amount of an inhibitor of indoleamine 2,3 dioxygenase to a mammal in need thereof. The mammal may be a human. In one embodiment, the inhibitor comprises indiximod, epacadostat, BMS-986205, navoximode, PF-0684003, KHK2455 or LY3381916 or a combination thereof. The inhibitor may be administered alone or in combination with other therapeutic agents. In one embodiment, the inhibitor comprises epacadostat. Myelodysplastic syndromes may also be treated by introducing an engineered, non-natural clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR associated (Cas) (CRISPR-Cas) system or the siRNA described above into eukaryotic cells. The inhibitor may be administered orally, intravenously, intramuscularly, topically, intraarterially, or subcutaneously.
[0032] The subject may be a human subject with hematopoietic malignancy. As used herein, hematopoietic malignancy refers to a malignant abnormality involving hematopoietic cells (e.g., blood cells, including progenitor cells and stem cells). Examples of hematopoietic malignancies include, but are not limited to, lymphoma, leukemia, or multiple myeloma. Leukemia includes acute myeloid leukemia, acute lymphocytic leukemia, chronic myeloid leukemia, acute lymphoblastic leukemia or chronic lymphoblastic leukemia, chronic lymphocytic leukemia, and myelodysplastic syndrome.
[0033] The methods and compositions may be used to treat lymphoma. Non-limiting examples of lymphoma include Hodgkin's lymphoma, non-Hodgkin's lymphoma, multiple myeloma, and immunoproliferative disorders (e.g., Epstein-Barr virus-associated lymphoproliferative disorders). Non-limiting examples of lymphoma include relapsed or refractory lymphoma, B-cell lymphoma, T-cell lymphoma, follicular lymphoma, double-hit lymphoma, mature B-cell neoplasm, mature T-cell and natural killer (NK) cell neoplasm, precursor lymphoid neoplasm, immunodeficiency-associated lymphoproliferative disorder, small lymphocytic lymphoma, Burkitt's lymphoma, and the like. The lymphoma may be low-grade lymphoma, intermediate-grade lymphoma, high-grade lymphoma, or low-grade lymphoma.
[0034] Small molecule inhibition The present disclosure describes the peripheral serotonin-signaling axis that AML cells utilize to remodel the osteoblastic niche in bone marrow to upregulate kynurenine expression, thereby promoting AML progression and growth. Pharmacological blockade of the kynurenine synthesis pathway significantly reduces leukemia burden in bone marrow and spleen of patient-derived xenograft models. The compositions and methods described herein for treating leukemia can be used as a sole intervention or as a combination therapy with existing chemotherapy / immunotherapy. The methods and compositions can improve AML treatment by targeting the serotonin-signaling axis, either as a sole therapy or in combination with other cancer therapeutics approved by regulatory agencies for these diseases.
[0035] AML cells utilize serotonin receptor 1b (Htr1b) signaling in osteoblasts to proliferate. Galan-Diez et al.Subversion of serotonin-receptor signaling in osteoblast by kynurenine drives Acute Myeloid Leukemia.Cancer Discover 2022 12(40):1106-1107. This proliferation pathway is driven not by serotonin (5-HT) but by another tryptophan catabolite, kynurenine, which acts as a novel ligand for HTR1B with functions distinct from its reported immunomodulatory properties. Using the same AML mouse model, patient-derived xenografts, and samples from AML and MDS patients, we observed that AML cells utilize kynurenine to remodel the BM niche and amplify their growth by inducing a proinflammatory signature in osteoblasts. Among several upregulated proinflammatory molecules, the acute phase protein serum amyloid A (SAA) is a signal released by osteoblasts that instructs AML cells to stimulate upregulation of indoleamine 2,3-dioxygenase-1 (IDO1, the rate-limiting enzyme in kynurenine synthesis), selectively promoting AML proliferation. Genetic and pharmacological inhibition of kynurenine-HTR1B interaction between leukemia cells and osteoblasts significantly inhibits AML proliferation.
[0036] Inhibiting kynurenine signaling abrogates leukemia progression by blocking its binding to serotonin receptor 1b (HTR1b).To evaluate the effect of inhibiting kynurenine synthesis in the progression of myeloid malignancies, we used transgenic mouse models as well as humanized mouse models to show that genetic ablation of the rate-limiting enzyme for the synthesis of kynurenine, indoleamine 2,3-dioxygenase, impedes or even prevents leukemia progression.To investigate the translational applicability of kynurenine synthesis inhibition, we also pharmacologically blocked IDO1 by using an FDA-approved drug (epacadostat) in AML patient-derived xenograft models, either as a sole intervention or as a combination therapy with 5-AZA, or in combination with an antibody or reagent that blocks SAA1. The inventors have found that the use of epacadostat or a combination of epacadostat and a standard chemotherapy regimen (e.g., ARAC) significantly reduces the leukemia burden in both the bone marrow and the spleen. The results show that secondary recipient mice with HTR1B genetic ablation remained leukemia-free after injection with MLL / AF9-induced blasts. Selective IDO1 inhibition using epacadostat abrogated kynurenine secretion and impaired cell cycle progression in vitro. In vivo treatment of AML-injected mice with epacadostat resulted in increased survival. In vivo treatment of wild-type mice with epacadostat reduced circulating kynurenine and tryptophan levels by 41%. Injection of IDO1-deficient AML cells into secondary recipients significantly attenuated or abrogated disease progression. Thus, IDO1 may be an effective therapeutic target for AML. The present methods / compositions can be used as monotherapy or in combination with existing chemo / immunotherapy.
[0037] Applications of the methods / compositions include (i) treatment for AML and / or myelodysplasia, (ii) combination therapy with chemo / immunotherapy for AML, (iii) modulation of bone marrow niche interactions in the context of stem cell transplantation and immunodeficiency disorders, and (iv) improvement of in vitro culture of hematopoietic stem cells. Treatment of AML that specifically targets the contribution of the tumor microenvironment to AML progression, such as the osteoblast compartment, may be effective in treating AML and improving patient outcomes.
[0038] In one embodiment, the inhibitor comprises one or more IDO1 inhibitors, such as indoximod (NLG8189), epacadostat (INCB024360), naboximide (GDC-0919) (NLG919), PF-06840003, linrodostat (BMS-986205), NLG802, LY-3381916, LPM-3480226, HTI-1090 (SHR9146), DN1406131 or KHK2455. See Tang et al. J. Hematol Oncol, 2021, 14:68, and Wang et al., Expert Opinion on Therapeutic Patents, 2022, Vol. 32, No. 11, 1145-1159.
[0039] The methods and compositions provide for at least about 2-fold, (at least) about 3-fold, (at least) about 4-fold, (at least) about 5-fold, (at least) about 6-fold, (at least) about 7-fold, (at least) about 8-fold, (at least) about 9-fold, (at least) about 10-fold, (at least) about 1.1-fold, (at least) about 1.2-fold, (at least) about 1.3-fold, (at least) about 1.4-fold, (at least) about 1.5-fold, (at least) about 1.6-fold, (at least) about 1.8-fold, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least at least 9 times, at least 10 times, (at least) about 15 times, (at least) about 20 times, (at least) about 50 times, (at least) about 100 times, (at least) about 120 times, about 2 times to about 500 times, about 1.1 times to about 10 times, about 1.1 times to about 5 times, about 1.5 times to about 5 times, about 2 times to about 5 times, about 3 times to about 4 times, about 5 times to about 1 0 fold, about 5 fold to about 200 fold, about 10 fold to about 150 fold, about 10 fold to about 20 fold, about 20 fold to about 150 fold, about 20 fold to about 50 fold, about 30 fold to about 150 fold, about 50 fold to about 100 fold, about 70 fold to about 150 fold, about 100 fold to about 150 fold, about 10 fold to about 100 fold, about 100 fold to about 200 fold inhibition of kynurenine synthesis.
[0040] The methods and compositions may provide an increased amount of kynurenine synthesis, up to 90%, up to 85%, up to 80%, up to 75%, up to 70%, up to 65%, up to 60%, up to 55%, up to 50%, up to 45%, up to 40%, up to 35%, up to 30%, up to 25%, up to 20%, up to 15%, up to 10%, about 10% to about 90%, about 15% to about 80%, about 20% to about 70%, about 25% to about 60%, about 30% to about 50%, about 30% to about 40%, about 25% to about 40%, about 20% to about 30%, about 25% to about 35%, about 10% to about 30%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75% , about 80%, about 85%, about 90%, about 95%, about 20% to about 50%, about 12.5% to about 80%, about 20% to about 70%, about 25% to about 60%, or about 25% to about 50%, about 1% to about 100%, about 5% to about 90%, about 10% to about 80%, about 5% to about 70%, about 5% to about 60%, about 10% to about 50%, about 15% to about 40%, about 5% to about 20%, about 1% to about The compositions and methods may result in a reduction in kynurenine synthesis of about 20%, about 10% to about 30%, about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100%, about 10% to about 90%, about 12.5% to about 80%, about 20% to about 70%, about 25% to about 60%, or about 25% to about 50%.
[0041] In various embodiments, the pharmaceutical composition can be administered intrathecally, subdurally, orally, intravenously, intramuscularly, topically, intraarterially, or subcutaneously.Other routes of administration of the pharmaceutical composition include oral, intravenous, subcutaneous, intramuscular, inhalation, or intranasal administration.In addition, the specifically targeted delivery of the composition can be delivered by targeted liposomes, nanoparticles, or other suitable means.
[0042] The compositions may be administered by bolus injection or chronic infusion. The claimed compositions may be administered at or near the site of the disease, disorder or injury in a therapeutically effective amount.
[0043] Targeted delivery of the present compositions (including, for example, nucleic acids, peptides, or small molecules) may be achieved using targeted liposomes, nanoparticles, or other suitable means.
[0044] The liposomes or nanoparticles are targeted to and taken up selectively by the desired tissue or cells.
[0045] The amount and / or activity of kynurenine synthesis can be modulated by introducing a polypeptide (eg, an antibody) or a small molecule that inhibits the gene expression or functional activity of kynurenine synthesis.
[0046] Agents that bind or modulate, for example, down-regulate the amount, activity of kynurenine synthesis, can be administered directly to subjects or target cells. Such agents can be administered in an amount effective to down-regulate the expression and / or activity of kynurenine synthesis, or by activating or down-regulating a second signal that controls kynurenine synthesis.
[0047] The methods and compositions can be used in the prevention and treatment of the diseases described herein.
[0048] The administration regimen may depend on several factors, including the serum or tissue turnover rate of the therapeutic composition, the level of symptoms, and the accessibility of the target cells in the biological matrix. Preferably, the administration regimen delivers sufficient therapeutic composition to result in improvement of the target disease while minimizing undesirable side effects.
[0049] The indoleamine 2,3 dioxygenase inhibitors and / or indoleamine 2,3 dioxygenase modulators of the present invention may be present in the pharmaceutical composition in an amount ranging from about 0.005% (w / w) to about 100% (w / w), from about 0.01% (w / w) to about 90% (w / w), from about 0.1% (w / w) to about 80% (w / w), from about 1% (w / w) to about 70% (w / w), from about 10% (w / w) to about 60% (w / w), from about 0.01% (w / w) to about 15% (w / w), or from about 0.1% (w / w) to about 20% (w / w) of the total weight of the pharmaceutical composition.
[0050] The indoleamine 2,3 dioxygenase inhibitor and / or the indoleamine 2,3 dioxygenase modulator may be present in two separate pharmaceutical compositions used in combination therapy.
[0051] The pharmaceutical compositions may be administered by any route, including, but not limited to, oral, transdermal, ocular, intraperitoneal, intravenous, intraventricular, intracisternal injection or infusion, subcutaneous, implant, sublingual, subcutaneous, intramuscular, intravenous, rectal, mucosal, ocular, intrathecal, intraarticular, intraarterial, intrathecal, bronchial and lymphatic administration. The pharmaceutical compositions may be administered parenterally or systemically.
[0052] The pharmaceutical composition of the present invention may be, for example, a solid, semi-solid or liquid formulation. Intranasal formulations may be delivered as sprays or drops. Inhalation formulations may be delivered using a nebulizer or similar device. Topical formulations may be in the form of gels, ointments, pastes, lotions, creams, poultices, poultices, bandages, skin patch aerosols, and the like. Transdermal formulations may be administered via transdermal patch or iontophoresis. Pharmaceutical compositions may also take the form of tablets, pills, capsules, semi-solids, powders, sustained release formulations, solutions, emulsions, suspensions, elixirs, aerosols, chewing bars, or any other suitable composition.
[0053] Pharmaceutical compositions may be administered locally via the implantation of a membrane, sponge, or another suitable material into which the desired molecule has been absorbed or encapsulated. When an implantation device is used, the device may be implanted into any suitable tissue or organ, and delivery of the desired molecule may be by diffusion, timed release bolus, or continuous administration.
[0054] To prepare such pharmaceutical compositions, one or more compounds of the invention can be mixed with pharma- ceutically acceptable carriers, adjuvants and / or diluents according to conventional pharmaceutical compounding techniques.
[0055] Pharmaceutically acceptable carriers that can be used in the compositions of the present invention include standard pharmaceutical carriers, such as phosphate buffered saline, water, and emulsions, such as oil / water emulsions or water / oil emulsions, and any of a variety of wetting agents. The compositions can further contain solid pharmaceutical excipients, such as starch, cellulose, talc, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, magnesium stearate, sodium stearate, glycerol monostearate, sodium chloride, dried skim milk, and the like. Liquid and semi-solid excipients can be selected from glycerol, propylene glycol, water, ethanol, and various oils, including those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, and the like. Liquid carriers, particularly for injection solutions, include water, saline, aqueous dextrose, and glycols. For examples of carriers, stabilizers, preservatives and adjuvants, see Remington's Pharmaceutical Sciences, edited by EW Martin, Mack Publishing Company, 18th Edition, 1990. Additional excipients, for example sweetening, flavoring and coloring agents, may also be present.
[0056] Pharmaceutically acceptable excipients can be selected from the group consisting of fillers, such as sugars and / or sugar alcohols, such as lactose, sorbitol, mannitol, maltodextrin, etc.; surfactants, such as sodium lauryl sulfate, Brij 96 or Tween 80; disintegrants, such as sodium starch glycolate, corn starch or its derivatives; binders, such as povidone, crospovidone, polyvinyl alcohol, hydroxypropylmethylcellulose; lubricants, such as stearic acid or its salts; flow improvers, such as silicon dioxide; sweeteners, such as aspartame; and / or coloring agents. Pharmaceutically acceptable carriers include any and all clinically useful solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption retarding agents, etc.
[0057] Pharmaceutical compositions may contain excipients to, for example, modify, maintain or preserve the pH, osmolality, viscosity, clarity, color, isotonicity, odor, sterility, stability, dissolution or release rate, adsorption or permeability of the composition. Suitable excipients include, but are not limited to, amino acids (such as glycine, glutamine, asparagine, arginine or lysine); antimicrobial agents; antioxidants (such as ascorbic acid, sodium sulfite or sodium bisulfite); buffers (borate, bicarbonate, Tris HCl, citrates, phosphates, other organic acids, etc.; bulking agents (such as mannitol or glycine); chelating agents (such as ethylenediaminetetraacetic acid (EDTA), ethylene glycol tetraacetic acid (EGTA)); complexing agents (such as caffeine, polyvinylpyrrolidone, beta cyclodextrin or hydroxypropyl beta cyclodextrin); fillers; monosaccharides; disaccharides and other carbohydrates (such as glucose, mannose or dextrin); proteins (such as serum albumin, gelatin or immunoglobulins); colours; flavourings and diluents; emulsifiers; hydrophilic polymers (such as polyvinylpyrrolidone); low molecular weight polypeptides; salts that form counter ions (such as sodium); preservatives (benzalkonium chloride, benzoic acid, salicylic acid, thimerosal, phenethyl alcohol, methylparaben, propylparaben, chlorhexidine, sorbic acid or hydrogen peroxide; solvents (such as glycerin, propylene glycol or polyethylene glycol); sugar alcohols (such as mannitol or sorbitol); suspending agents; surfactants or wetting agents (such as pluronics, PEG, sorbitan esters, polysorbates such as polysorbate 20, polysorbate 80, triton, tromethamine, lecithin, cholesterol, tyloxapearl, etc.); stability enhancing agents (sucrose or sorbitol); tonicity agents (alkali metal halides (in one embodiment, sodium or potassium chloride, mannitol sorbitol); delivery vehicles; diluents; excipients and / or pharmaceutical adjuvants. (Remington's Pharmaceutical Sciences, 18th Edition, A. R. Gennaro, ed., Mack Publishing Company, 1990).
[0058] Oral dosage forms can be tablets, capsules, bars, sachets, granules, syrups and aqueous or oily suspensions. Tablets can be formed from a mixture of the active compound with fillers, such as calcium phosphate; disintegrants, such as corn starch; lubricants, such as magnesium stearate; binders, such as microcrystalline cellulose or polyvinylpyrrolidone, and any other ingredients known in the art that allow the mixture to be compressed into tablets by known methods. Similarly, capsules, such as hard or soft gelatin capsules, containing the active compound can be prepared by known methods. The contents of the capsule can be formulated to provide a sustained release of the active compound using known methods. Other dosage forms for oral administration include, for example, aqueous suspensions containing the active compound in an aqueous medium in the presence of a non-toxic suspending agent, such as sodium carboxymethylcellulose, and oily suspensions containing the active compound in a suitable vegetable oil, such as peanut oil. The active compound can be formulated into granules with or without additional excipients. The granules can be ingested directly by the patient or added to a suitable liquid carrier (e.g., water) before ingestion. The granules may contain disintegrants to facilitate dispersion in liquid media, such as effervescent couples formed from an acid and a carbonate or bicarbonate. U.S. Patent No. 8,263,662.
[0059] Intravenous forms include, but are not limited to, bolus injection and drip injection.Exemplary intravenous dosage forms include, but are not limited to, water for injection USP; aqueous vehicles, including, but are not limited to, sodium chloride injection, Ringer's injection, dextrose injection, dextrose and sodium chloride injection, and lactated Ringer's injection; water-miscible vehicles, including, but are not limited to, ethyl alcohol, polyethylene glycol, and polypropylene glycol; and non-aqueous vehicles, including, but are not limited to, corn oil, cottonseed oil, peanut oil, sesame oil, ethyl oleate, isopropyl myristate, and benzyl benzoate.
[0060] Further pharmaceutical compositions include sustained- or controlled-delivery formulations, using, for example, liposome or micellar carriers, bio-erodible microparticles or porous beads, and depot injections.
[0061] The compound or compounds or pharmaceutical compositions can be administered as a single dose, or as two or more doses over time (which may or may not contain the same amount of the desired molecule), or as a continuous infusion via an implantation device or catheter. Pharmaceutical compositions can be prepared in single unit dosage form.
[0062] The appropriate administration frequency can be determined by those skilled in the art and can be administered once or several times a day (e.g., twice, three times, four times or five times a day). The compositions of the present invention can also be administered once a day or once every other day. The compositions can also be given twice a week, once a week, once a month or once every six months. In acute administration, treatment is typically administered over a period of hours or days, while chronic treatment can be administered over a period of weeks, months or even years. U.S. Patent No. 8,501,686.
[0063] The composition of the present invention can be administered by any of several standard methods, including but not limited to continuous infusion, bolus injection, intermittent infusion, inhalation, or a combination of these methods.For example, one administration mode that can be used includes continuous intravenous infusion.The infusion of the composition of the present invention can be preceded by bolus injection, if necessary.
[0064] The method of determining the most effective administration means and dosage may vary depending on the composition used in therapy, the purpose of therapy, the target cell being treated, and the subject or patient being treated.Single or multiple administrations can be performed with the dosage level and pattern selected by the treating physician.The specific dosage level for any particular subject depends on various factors, including the activity of the particular peptide, age, body weight, general health, sex, diet, administration time, administration route and excretion rate, drug combination, and the severity of the particular disease being treated.
[0065] For example, the indoleamine 2,3 dioxygenase inhibitor and / or indoleamine 2,3 dioxygenase modulator may be administered in the amount of about 0.0001 mg / kg to about 500 mg / kg, about 0.01 mg / kg to about 200 mg / kg, about 0.01 mg / kg to about 0.1 mg / kg, about 0.1 mg / kg to about 100 mg / kg, about 10 mg / kg to about 200 mg / kg, about 10 mg / kg ~20mg / kg, approximately 5mg / kg~15mg / kg, approximately 0.0001mg / kg~0.001mg / kg, approximately 0.001mg / kg~0.01mg / kg, approximately 0.01mg / kg~ Approximately 0.1mg / kg, approximately 0.1mg / kg to approximately 0.5mg / kg, approximately 0.5mg / kg to approximately 1mg / kg, approximately 1mg / kg to approximately 2.5mg / kg, approximately 2.5mg / kg to approximately 10mg / kg, approximately 1 0mg / kg to about 50mg / kg, about 50mg / kg to about 100mg / kg, about 100mg / kg to about 250mg / kg, about 0.1μg / kg to about 800μg / kg, about 0.5μg / kg to about 500μg / kg, about 1μg / kg to about 20μg / kg, about 1μg / kg to about 10μg / kg, about 10μg / kg to about 20μg / kg, about 20μg / kg to about 40μg / kg, about 40μg / kg In some embodiments, the dose may be administered at about 250 mg / kg to about 500 mg / kg, about 0.5 mg / kg to about 50 mg / kg, or any other suitable amount.
[0066] A therapeutically effective amount of an indoleamine 2,3 dioxygenase inhibitor and / or indoleamine 2,3 dioxygenase modulator of the present invention for combination therapy may be less than, the same as, or greater than when the agent is used alone.
[0067] The amount or dose of the indoleamine 2,3 dioxygenase inhibitor and / or indoleamine 2,3 dioxygenase modulator is about 0.01 mg to about 10 g, about 0.1 mg to about 9 g, about 1 mg to about 8 g, about 1 mg to about 7 g, about 5 mg to about 6 g, about 10 mg to about 5 g, about 20 mg to about 1 g, about 50 mg to about 800 mg, about 100 mg to about 500 mg, about 600 mg to about 800 mg, about 800 mg to about 1 g, about 0.01 mg to about 10 g, about 0.05 mg to about 10 g, about 0.5 mg to about 10 g, about 0.6 mg to about 10 g, about 0.7 mg to about 10 g, about 0.8 mg to about 10 g, about 0.9 mg to about 10 g, about 0.1 mg to about 10 g, about 0.2 mg to about 10 g, about 0.4 mg to about 10 g, about 0.5 mg to about 10 g, about 0.6 mg to about 10 g, about 0.7 mg to about 10 g, about 0.8 mg to about 10 g, about 0.9 ... The amount of protein may be in the range of about 0.1 mg to about 10 mg, about 2 mg to about 5 mg, about 1 mg to about 20 mg, about 30 μg to about 500 μg, about 40 pg to about 300 pg, about 0.1 μg to about 200 mg, about 0.1 μg to about 5 μg, about 5 μg to about 10 μg, about 10 μg to about 25 μg, about 25 μg to about 50 μg, about 50 μg to about 100 μg, about 100 μg to about 500 μg, about 500 μg to about 1 mg, or about 1 mg to about 2 mg.
[0068] Different dosing regimes may be used. In some embodiments, a daily dose, such as any of the above exemplary doses, is administered once, twice, three times, or four times a day for at least 3, 4, 5, 6, 7, 8, 9, or 10 days. Depending on the stage and severity of the cancer, shorter treatment times (e.g., up to 5 days) may be used with higher doses, or longer treatment times (e.g., 10 days or more, or weeks, or a month or more) may be used with lower doses. In some embodiments, a once-daily or twice-daily dose is administered every other day.
[0069] The invention provides a method for inhibiting indoleamine 2,3 dioxygenase expression, the method comprising introducing into a eukaryotic cell an engineered, non-naturally occurring clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated (Cas) (CRISPR-Cas) system comprising one or more vectors, the one or more vectors being operable in the eukaryotic cell to: a) at least one nucleotide sequence encoding a CRISPR-Cas system guide RNA that hybridizes to a sequence encoding exon 3 or 4 of indoleamine 2,3 dioxygenase; The system comprises a) a first regulatory element operable in a eukaryotic cell, and b) a second regulatory element operable in a eukaryotic cell operably linked to a nucleotide sequence encoding a Cas9 protein, wherein components (a) and (b) are located on the same vector or different vectors of the system, whereby the guide RNA targets a sequence encoding exon 3 or 4 of indoleamine 2,3 dioxygenase, and the Cas9 protein cleaves the DNA molecule, thereby decreasing expression of the indoleamine 2,3 dioxygenase protein, and wherein both the Cas9 protein and the guide RNA are non-naturally occurring.
[0070] The Cas enzyme can be a type II, type I, type III, type IV or type V CRISPR enzyme. In some embodiments, the Cas enzyme is a Cas9 enzyme (also known as Csn1 and Csx12). Cas9 can be wild type or mutant. In certain embodiments, the Cas enzyme is Cas9, Cpf1, C2c1, C2c2, C2c3, Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4 , Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, homologs thereof, orthologues thereof, or modified versions thereof. In one embodiment, the Cas enzyme is Cas9.
[0071] CRISPR interference (CRISPRi) or CRISPR activation (CRISPRa) can be used in the present system and method. CRISPRi is a transcription interference technique that allows sequence-specific suppression of gene expression and / or epigenetic modification in cells (Qi et al., (2013) Repurposing CRISPR as a RNA-guided platform for sequence-specific control of gene expression. Cell 152(5):1173-83). CRISPRi regulates gene expression mainly at the transcription level. CRISPRi can sterically suppress transcription, for example, by blocking transcription initiation or elongation. The target sequence can be a promoter and / or exon sequence (such as non-template strand and / or template strand) and / or intron (Ji et al., (2014). Specific gene repression by CRISPRi system transferred through bacterial conjugation. ACS Synthetic Biology 3(12):929-31). CRISPRi can also suppress transcription through effector domains. Fusing the repressor domain to a catalytically inactive Cas enzyme, such as deadCas9 (dCas9), can further suppress transcription. For example, the Kruppel associated box (KRAB) domain can be fused to dCas9 to suppress transcription of target genes (Gilbert et al., 2013, CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes. Cell 154(2):442-51).
[0072] In one embodiment, the IDO1 inhibitor can be a nucleic acid, such as single-stranded DNA (ssDNA), double-stranded DNA (dsDNA), donor / template DNA, scDNA. DNA encoding one or more RNAs, sgRNA, guide RNA (gRNA), prime-edited guide RNA (pegRNA), microRNA (miRNA) inhibitors, miRNA mimics, short interfering RNA (siRNA), small synthetic RNA, synthetic RNA, antisense oligonucleotides, short hairpin RNA (shRNA), double-stranded RNA (dsRNA), antisense RNA, ribozymes, and combinations thereof. In some embodiments, the polynucleotide is a short interfering RNA (siRNA) or an antisense molecule. In a preferred embodiment, the inhibitor comprises a CRISPR / Cas system. The CRISPR-Cas system can be in the form of RNA, plasmids, and proteins. The nucleic acid can be administered to the subject via any route described herein.
[0073] The method may utilize adeno-associated virus (AAV) mediated gene delivery. In addition, delivery vehicles such as nanoparticle-based and lipid-based nucleic acid or protein delivery systems can be used as alternatives to viral vectors. Further examples of alternative delivery vehicles include lentiviral vectors, lipid-based delivery systems, gene guns, hydrodynamics, electroporation or nucleofection microinjection, and biolistics. Various gene delivery methods are discussed in detail by Nayerossadat et al. (Adv Biomed Res. 2012; 1: 27) and Ibraheem et al. (Int J Pharm. 2014 January 1; 459 (1-2): 70-83).
[0074] The method may use nanoparticle-based siRNA delivery system. Nanoparticle-formulated siRNA delivery system may be based on polymer or liposome. Nanoparticles conjugated with cell-specific targeting ligands for effective siRNA delivery can increase the possibility of binding to cell surface receptors. Nanoparticles may be coated with PEG (polyethylene glycol), which can reduce uptake by the reticuloendothelial system (RES) and result in extended circulatory half-life. The method may use various nanoparticle-based delivery systems, such as cationic lipids, polymers, dendrimers, and inorganic nanoparticles, to provide effective and efficient siRNA delivery in vitro or in vivo.
[0075] The vector can be delivered to the host cell by suitable methods. The method of delivering the composition to the cell can include transfection of nucleic acid or polynucleotide (e.g., using a reagent such as liposome or nanoparticle); electroporation, delivery of protein, for example by mechanical deformation (e.g., Sharei et al. Proc. Natl. Acad. Sci. USA (2013) 110(6):2082-2087); or viral transduction. Exemplary viral vectors include, but are not limited to, recombinant retroviruses, alphavirus-based vectors, and adeno-associated virus (AAV) vectors. In some embodiments, the vector is a retrovirus. In one embodiment, the vector is a lentivirus. In another embodiment, the vector is an adeno-associated virus.
[0076] The vectors described herein can be transformed, transfected or otherwise introduced into a wide variety of host cells. Numerous transfection methods are known to those skilled in the art, such as lipofectamine, calcium phosphate co-precipitation, electroporation, DEAE-dextran treatment, microinjection, viral transduction, and other methods known in the art. Transduction refers to the entry of a virus into a cell and the expression (e.g., transcription and / or translation) of the sequence delivered by the viral vector genome. In the case of recombinant vectors, "transduction" generally refers to the entry of a recombinant viral vector into a cell and the expression of the nucleic acid of interest delivered by the vector genome.
[0077] The CRISPR (clustered regularly interspaced short palindromic repeats) system utilizes RNA-guided DNA binding and sequence-specific cleavage of target DNA. The guide RNA (gRNA) is complementary to the target DNA sequence. The guide RNA / Cas combination confers site specificity to the nuclease. The single guide RNA (sgRNA) contains approximately 20 nucleotides complementary to the target genomic DNA sequence and a constant RNA scaffold region. The Cas (CRISPR-associated) protein binds to the guide RNA (gRNA) or sgRNA and the target DNA to which the gRNA or sgRNA binds, introducing a double-stranded break. Geurts et al.,Science 325:433(2009);Mashimo et al.,PLoS ONE 5:e8870(2010);Carbery et al.,Genetics 186:451-459(2010);Tesson et al.,Nat.Biotech.29:695-696(2011).Wiedenheft et al. al.Nature 482:331-338(2012);Jinek et al.Science 337:816-821(2012);Mali et al.Science 339:823-826(2013);Cong et al.Science 339:819-823(2013).
[0078] In addition to the sequence that binds to the target nucleic acid, in some embodiments, gRNA also comprises a scaffold sequence. The expression of gRNA that codes for both the sequence that is complementary to the target nucleic acid and the scaffold sequence can have the dual function of both binding (hybridizing) to the target nucleic acid and recruiting endonuclease to the target nucleic acid, thereby resulting in site-specific CRISPR activity. In some embodiments, such chimeric gRNA can be referred to as single guide RNA (sgRNA).
[0079] The cleavage of the gene region may comprise cleaving one or two strands at the position of the target sequence by Cas enzyme.In one embodiment, such cleavage may result in a decrease in the transcription of the target gene.In another embodiment, the cleavage may further comprise repairing the cleaved target polynucleotide by homologous recombination with an exogenous template or donor DNA, and the repair results in the insertion, deletion or replacement of one or more nucleotides of the target polynucleotide.
[0080] In some embodiments, the gRNA sequence does not include the scaffold sequence, and the scaffold sequence is expressed as a separate transcript. In such embodiments, the gRNA sequence further comprises an additional sequence that is complementary to a portion of the scaffold sequence and that binds (hybridizes) to the scaffold sequence and functions to recruit an endonuclease to the target nucleic acid.
[0081] In some embodiments, the gRNA sequence is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or at least 100% complementary to the target nucleic acid (see also U.S. Pat. No. 8,697,359, incorporated by reference for its teachings of complementarity of gRNA sequences to target polynucleotide sequences).
[0082] The gRNA can have a length ranging from about 12 nucleotides to about 100 nucleotides. For example, the gRNA can have a length ranging from about 12 nucleotides (nt) to about 80 nt, about 12 nt to about 50 nt, about 12 nt to about 40 nt, about 12 nt to about 30 nt, about 12 nt to about 25 nt, about 12 nt to about 20 nt, or about 12 nt to about 19 nt. For example, the first segment (e.g., crRNA) can have a length ranging from about 19 nt to about 20 nt, about 19 nt to about 25 nt, about 19 nt to about 30 nt, about 19 nt to about 35 nt, about 19 nt to about 40 nt, about 19 nt to about 45 nt, about 19 nt to about 50 nt, about 19 nt to about 60 nt, about 19 nt to about 70 nt, about 19 nt to about 80 nt, about 19 nt to about 90 nt. , about 19 nt to about 100 nt, about 20 nt to about 25 nt, about 20 nt to about 30 nt, about 20 nt to about 35 nt, about 20 nt to about 40 nt, about 20 nt to about 45 nt, about 20 nt to about 50 nt, about 20 nt to about 60 nt, about 20 nt to about 70 nt, about 20 nt to about 80 nt, about 20 nt to about 90 nt, or about 20 nt to about 100 nt in length. The gRNA may have less than 12 nucleotides or more than 100 nucleotides.
[0083] The one or more sgRNAs can be about 5-100 nucleotides in length or longer (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 nucleotides in length, or longer). In one embodiment, the one or more sgRNAs can be about 15 to about 30 nucleotides in length (e.g., about 15-29, 15-26, 15-25; 16-30, 16-29, 16-26, 16-25; or about 18-30, 18-29, 18-26, or 18-25 nucleotides in length).
[0084] inhibitory nucleic acid In certain embodiments, the cargo or payload may be an inhibitory nucleic acid or polynucleotide that reduces expression of a target gene. Thus, the polynucleotide specifically targets a nucleotide sequence that encodes a target protein or polypeptide.
[0085] The nucleic acid target of a polynucleotide can be any location within the gene or transcript of the target protein or polypeptide.
[0086] The inhibitory nucleic acid can be RNA interference or RNAi, an antisense RNA, a ribozyme, or a combination thereof.
[0087] RNAi can be short interfering RNA or siRNA, short hairpin RNA or shRNA, microRNA or miRNA, double-stranded RNA (dsRNA), and the like.
[0088] The cargo or payload can be a short RNA molecule, such as short interfering RNA (siRNA), small temporal RNA (stRNA), and microRNA (miRNA). While short interfering RNA silences genes via the mRNA degradation pathway, stRNA and miRNA are approximately 21 or 22 nt RNAs that are processed from endogenously encoded hairpin-structured precursors and function to silence genes via translational repression. See, for example, McManus et al., RNA, 8(6):842-50 (2002); Morris et al., Science, 305(5688):1289-92 (2004); He and Hannon, Nat Rev Genet. 5(7):522-31 (2004).
[0089] Alternatively, a polynucleotide encoding an siRNA or shRNA may be used.
[0090] The inhibitory nucleic acid can be an antisense nucleic acid sequence that is complementary to the target region in the mRNA of the target protein or polypeptide.Antisense polynucleotides can bind to the target region and inhibit translation.Antisense oligonucleotides can be DNA or RNA, or comprise synthetic analogs of ribodeoxynucleotides.
[0091] Antisense oligonucleotides can be, for example, about 7, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80 or more nucleotides in length.
[0092] The cargo or payload can be a ribozyme. Ribozymes can be chemically synthesized and structurally modified using methods known in the art to enhance their stability and catalytic activity.
[0093] antibody The cargo or payload can be an antibody or a fragment thereof (eg, an antigen-binding portion).
[0094] The antibody or antigen-binding portion thereof may be: (a) a whole immunoglobulin molecule; (b) a single chain variable region fragment (scFv); (c) a Fab fragment; (d) a F(ab')2; and (e) a disulfide-linked Fv. The antibody or antigen-binding portion thereof may be monoclonal, polyclonal, chimeric, and humanized. The antibody may be a murine, rabbit, or human / humanized antibody.
[0095] [Example] The following examples and data are illustrative and not limiting. See also Galan-Diez et al. Subversion of serotonin-receptor signaling in osteoblast by kynurenine drives Acute Myeloid Leukemia. Cancer Discover 2022 12(40):1106-1107, which is incorporated herein by reference in its entirety.
[0096] [Example 1] mouse Wild-type (WT) C57BL / 6J (IMSR catalog no. JAX:000664, RRID:IMSR_JAX:000664), BALB / cJ (IMSR catalog no. JAX:000651, RRID:IMSR_JAX:000651), NOD.Cg-Prkdcscid Il2rgtm1Wjl / SzJ (NSG, IMSR catalog no. JAX:005557, RRID:IMSR_JAX:005557) and NOD.Cg-Prkdcscid Il2rgtm1Wjl Tg(CMV-IL3, CSF2, KITLG)1Eav / MloySzJ (NSGS, IMSR catalog no. JAX:013062, RRID:IMSR_JAX:013062) mice were purchased from Jackson Laboratories. All other animals used in the study were bred in our mouse facility, maintained on a C57BL / 6J background, and used at 8-10 weeks of age. Male and female mice were used interchangeably. Htr1b- / - mice were obtained from Dr. Rene Hen at Columbia University (Saudou F, et al. Enhanced aggressive behavior in mice lacking 5-HT1B receptor. Science. American Association for the Advancement of Science; 1994; 265: 1875-8.).Htr1b fl / fl mice were obtained from Dr. Greengard at Rockefeller University (Virk MS, et al. Opposing roles for serotonin in cholinergic neurons of the ventral and dorsal striatum. Proceedings of the National Academy of Sciences. National Acad Sciences; 2016; 113: 734-9.) and crossed with LepRCre, Col1a-Cre (33), OCN-Cre lines (34) or Osx-Cre (Rodda SJ, et al. Distinct roles for Hedgehog and canonical Wnt signaling in specification, differentiation and maintenance of osteoblast progenitors. Development. Oxford University Press for The Company of Biologists Limited; 2006; 133: 3231-44.) to generate homozygous mice lacking Htr1b in the indicated tissues. Osx-Cre mice were maintained on a doxycycline-containing diet (0.625 g / kg), and DOX was removed in the experimental groups 24 h after MLL / AF9 injection. All mouse genetic models were used with their respective WT littermates as controls. Experimental animals were kept in the Columbia University animal facility under specific pathogen-free conditions and in accordance with protocols approved by the Columbia University Institutional Animal Care and Use Committee (IACUC).
[0097] PTH bone anabolic treatment: Mice were injected intraperitoneally (ip) with 80 μg / kg / day PTH (Bachem) in PBS starting 1 week prior to MLL / AF9 injection and continued for an additional 2-3 weeks until mice were harvested.
[0098] SB224289-SB9-(TOCRIS Cat#1221) Treatment: Mice were injected intraperitoneally (ip) with SB9 (5mg / kg in 0.9% NaCl) one week after leukemia injection and daily for the duration of the experiment. Assuming a body weight (BW) of 20g and a total blood volume of 2ml per mouse, plus uniform distribution of the drug, the systemic concentration of SB9 should be approximately 50μg / ml. Based on the MW of SB9 (557.09), the final concentration with equal distribution in the blood should be 8.97521e-05 M (approximately 90μM).
[0099] Epacadostat (AdooQ Cat# A15554) Treatment: For WT C57BL / 6J mice, treatment was initiated simultaneously with the transplantation of MLL / AF9 cells. For patient-derived AML cells (PDX) transplanted into NSG mice, treatment was initiated 8 weeks after transplantation, concurrently with Ara-C, for a period of 3 weeks. Mice received 800mg / kg (low dose) or 1.6g / kg (high dose) of epacadostat-supplemented diet (Research Diets Inc.) ad libitum. For PDX transplanted into NSGS mice, treatment was initiated 3 weeks after transplantation by oral gavage at 300mg / kg (InvivoChem Cat#: V0942, dissolved in 10% DMSO, 40% PEG 300 and 50% NaCl 0.9%) daily for 2 weeks.
[0100] SAA1 (Peprotech Catalog No. 300-53) Treatment: For short-term treatment (2 days), mice were injected intravenously (iv) 72 and 48 hours before harvest. For long-term treatment (8 days), mice were injected iv daily. To obtain the same blood SAA1 concentration as used in vitro, we used a dose of 100 μg / kg SAA1 diluted in 0.9% NaCl. Assuming a body weight of 20 g, a total blood volume of 2 ml, and uniform distribution in mice, the systemic concentration of SAA1 should be approximately 1 μg / ml.
[0101] Serum for ELISA analysis was collected by cardiac puncture, left untouched at room temperature for 30 min, and centrifuged at 12.000 rpm for 15 min at 4 °C. Samples were flash frozen in liquid nitrogen and stored at -80 °C until further analysis.
[0102] Complete blood counts (at collection / endpoint) were assessed on cardiac puncture peripheral blood collected into EDTA-coated tubes (Becton Dickinson) using a Genesis (Oxford Science) hematology system.
[0103] [Example 2] Patient samples Primary MDS and AML Patient Samples: Bone marrow (BM) aspirates and bone biopsies from male and female MDS and AML patients aged 53–87 years were obtained from an Institutional Review Board (IRB) approved tissue repository at the Myelodysplastic Syndromes Center at New York Presbyterian-Columbia University Medical Center. 3–10 ml of BM aspirate was collected from the iliac crest at the back of the hip bone. 0.5–1 ml was used for BM plasma collection (2000 g at 4°C for 15 min), flash frozen in liquid nitrogen, and stored at −80°C until analysis. Study populations reflected those typically seen in the Columbia University Medical Center clinic. These included 60% males, 40% females, 60% Caucasian, 30% Hispanic, and 10% African American and non-Hispanic. MDS and AML are overwhelmingly diseases of older adults (median age at diagnosis: 74 years). Fewer than 15% of MDS patients are between 18 and 65 years of age, and more than 85% are over 65 years of age.
[0104] BM samples from the University of Pennsylvania were obtained from the Stem Cell and Xenograft Core. The Core has maintained an IRB-approved protocol for 20 years. All samples were de-identified and obtained as collected historically. Similar to CUMC, the race and sex of the Core samples reflects that of the patient population seen at the Hospital of the University of Pennsylvania.
[0105] Healthy Biopsies: Healthy BM aspirates and bone biopsies were obtained from the Orthopedic Surgery Department at Columbia University in collaboration with Dr. R. Shah. Healthy patients scheduled for elective hip or knee surgery were approached for participation in the study, reflecting surgery in men (44%) or women (56%) aged 18-65 (46%) to >65 (54%) years.
[0106] All studies were approved by the Columbia University Medical Center Institutional Review Board (IRB protocol numbers: AAAK3058 and AAAR3184) and informed written consent was obtained from all participants. Studies were conducted in accordance with the Declaration of Helsinki and in compliance with IRB regulations regarding the collection and use of specimen materials in research protocols. Isolation of BM mononuclear cells was performed by density gradient centrifugation using Ficoll-Paque standard procedures.
[0107] [Example 3] Cell lines and primary cell cultures OCI-AML3 (DSMZ catalog no. ACC-582, RRID: CVCL_1844), THP-1 (DSMZ catalog no. ACC-16, RRID: CVCL_0006) and MOLM-14 (DSMZ catalog no. ACC-777, RRID: CVCL_7916) cells were obtained from the DSMZ repository. SC (ATCC catalog no. CRL-9855, RRID:CVCL_6444), HL-60 (ATCC catalog no. CCL-240, RRID:CVCL_0002), MV4-11 (ATCC catalog no. CRL-9591, RRID:CVCL_0064), KG-1a (ATCC catalog no. CCL-246.1, RRID:CVCL_1824), Kasumi-1 (ATCC catalog no. CRL-2724, RRID:CVCL_0589) and HEK293T (ATCC catalog no. CRL-3216, RRID:CVCL_0063) cells were obtained from ATCC and WEHI-3B (ECACC catalog no. 86013003, RRID:CVCL_2239) from Sigma. The MDS-L cell line was a kind gift from Dr. Amit K. Verma (Albert Einstein College of Medicine). Cell lines that were not obtained directly from their source were verified by short tandem repeat DNA profiling. All cell lines were routinely tested for mycoplasma (Venor™ GeM Mycoplasma Detection Kit, Sigma-Aldrich Catalog No. MP0025).
[0108] OCI-AML3 and THP-1 cell lines and primary human osteoblasts were grown in MEM-Alpha 1x (Corning). HEK293T cells were grown in DMEM (Corning). SC, HL-60, MOLM-14, KG-1a, Kasumi-1 and MV4-11 were grown in IMDM (Gibco). MDS-L cell lines were grown in RPMI supplemented with 1x beta-mercaptoethanol and IL-3 (10 μg / ml). All media were supplemented with 10% FBS (Gibco, except primary human osteoblasts, OCI-AML3 and HL-60, which require 20%, 1% GlutaMAX (Gibco) and 1% antibiotic-antimycotic (Corning)) and incubated at 37°C, 5% CO 2 and cultured.
[0109] MLL / AF9 primary cells were maintained in StemSpan medium (StemCell Technologies) containing mGM-CSF (10 ng / ml), mSCF (25 ng / ml), mIL-6 (25 ng / ml), mIL-3 (10 ng / ml), mTPO (25 ng / ml) (Prepotech) and 1% P / S.
[0110] Human primary MDS and / or AML cells: Patient-derived AML cells for CRISPR experiments were cultured in Stemspan II (Stemcell Tech), 1% PS, complete with 100ng / mL human FLT3L and SCF, 50ng / mL human TPO, IL3 and IL6 (BioLegend) and 750nM SR1 (Cayman Chemical). For ex vivo culture, AML and / or MDS cells were cultured on StemMACS HSC Expansion Media XF supplemented with StemMACS HSC Expansion Cocktail (Miltenyi Biotec).
[0111] Primary human osteoblasts were obtained from explants of healthy patients undergoing hip / knee replacement surgery. Osteoblastic stromal cells were obtained from outgrowth cultures and differentiated in osteogenic medium (5 mM β-glycerol phosphate and 100 μg / ml ascorbic acid; Sigma) that was changed every other day for 10–13 days.
[0112] Primary calvaria-derived osteoblasts were prepared from 2-3 day old neonatal calvaria as previously described (Rached MT, et al. FoxO1 Is a Positive Regulator of Bone Formation by Favoring Protein Synthesis and Resistance to Oxidative Stress in Osteoblasts. Cell Metabolism. Elsevier Ltd; 2010; 11:147-60.). Briefly, mouse calvaria were sequentially digested for 20, 40, and 90 min at 37°C in alpha-MEM (Gibco) 10% FBS containing 0.1 mg / ml collagenase P (Worthington) and 0.25% trypsin (Gibco). Cells from the first two digestions were discarded, and cells released from the third digestion were plated and allowed to differentiate for 7-10 days as previously described.
[0113] Co-cultures were set up using 0.4 μm pore transwells (Falcon) with primary osteoblasts in the lower compartment and leukemia cells in the upper compartment. Both cells were starved overnight (o / n) and co-cultured together in alpha-MEM at an osteoblast-to-leukemia ratio of 1:10 for the indicated time periods.
[0114] Recombinant proteins: human IL-1α, IL-1β, IL-6, IL-33, IL-34, CXCL1, CXCL3, CXCL5, CXCL8, CCL2, CCL20, Apo-SAA1 (all from Peprotech) and recombinant mouse SAA3 (Cusabio) were treated with o / n treatment of the corresponding proteins at 50ng / ml. SAA1 treatment of human AML cell lines was performed at 1μg / ml for 24, 48 or 72 hours. Primary human MDS or AML lineage-depleted BM-MNC were treated at 5μg / ml for 24 hours. PDX-isolated human whole BM cells were treated at 1μg / ml for 24 hours.
[0115] [Example 4] Leukemia syngeneic mouse model and assessment of in vivo progression of leukemia All leukemia models were introduced by intravenous (i.v.) injection and transplanted into non-irradiated secondary recipient experimental animals. BALB / c mice were used for the WEHI-3B leukemia model (0.5 × 10 6 / cell / mouse), C57BL / 6J mice were used for MLL / AF9-dsRed (0.2 × 10 6 Leukemia progression was assessed by fluorescence (MLL / AF9 dsRed) using an IVIS-Spectrum Optical Imaging System (Caliper, Perkin Elmer). Mice were shaved to reduce light attenuation.
[0116] [Example 5] Xenograft model Four to six week-old NSG (CDX model) or NSGS (PDX model) mice were pretreated with sublethal (1.4 Gy) total body irradiation. After 24 hours, 1 × 10 6 pcs OCI-AML3 or 2×10 5 Human BM CD34 +(healthy) or primary AML patient samples were injected iv and engraftment levels were monitored. Mice were randomized after BM aspiration 3-4 weeks later and immunophenotypes were identified by the presence of mCD45 (BioLegend catalog no. 103133, RRID:AB_10899570), hCD45 (BioLegend catalog no. 368512, RRID:AB_2566372), hCD33 (BioLegend catalog no. 303404, RRID:AB_314348), and hCD34 (BioLegend catalog no. 343518, RRID:AB_1937203) cell populations. For low-burden PDX models (kynurenine injection), mice were treated 1 week after transplantation.
[0117] For combination therapy (epacadostat + chemotherapy) performed at the University of Pennsylvania, patient-derived AML cells were transplanted as previously described ( 48 ). Briefly, 6-week-old NSG males were sublethally treated with busulfan (30 mg / kg) 24 h prior to transplantation and 5 × 10 6 Patient-derived AML cells were injected iv. Engraftment was assessed and mice randomized at week 7.5 by BM aspirate as previously described. Randomized mice were treated with vehicle, cytosine arabinoside (Ara-C, 60 mg / kg / day x 5 days ip), epacadostat chow (1.6 g / kg, ad libitum) or both Ara-C and epacadostat chow for 3 weeks.
[0118] [Example 6] Immunofluorescence staining Tissues: After harvest, spleens and livers were fixed o / n in 4% PFA, washed in PBS and maintained in a 30% sucrose gradient for at least 16 hours prior to OCT. For bones, decalcification in 14% EDTA pH 7 for 7 days was followed by fixation for 72 hours prior to sucrose gradient and OCT embedding. All tissues were cut using a Leyca cryostat, dried at room temperature and stored at -80°C. Sections were rehydrated in PBS for 10 minutes and stained with DAPI. Cells: Osteoblasts were grown and differentiated on 12 mm coverslips, exposed to conditioned medium from OCI-AML3 cells at a 1:10 ratio for 30–60 min, fixed in 4% PFA for 15 min at RT, permeabilized (PBS 0.3% Triton X-100) for 15 min at RT, blocked (PBS 5% donkey normal serum, 0.3% Triton X-100), and stained o / n at 4 °C with p65 (Cell Signaling Technology catalogue no. 8242, RRID:AB_10859369) and DAPI (nuclei). Slides were mounted with anti-fade Prolong Gold (Invitrogen) mounting medium and images were acquired with a Zeiss LSM 710 confocal microscope. Images were analyzed with ImageJ (RRID:SCR_003070) software.
[0119] [Example 7] Metabolomics Cell culture supernatant samples (150 μl) were loaded onto an Ostro Protein Precipitation & Phospholipid Removal Plate (Waters: 186005518). 20 μl of internal standard and 450 μL of acetonitrile (0.2% formic acid) were added. After applying pressure through the plate, the samples were transferred to new vials and dried under a gentle stream of nitrogen. Samples were reconstituted in 100 μl of 80% methanol-20% water for analysis using an ABsciex 6500+ equipped with an Ace PFP column. Pooled quality control (QC) samples were injected six times for coefficient of variation (CV) calculations. Metabolites are considered as accurate quantification with a CV < 20%, and treated as less accurate results with a CV > 35%. PCA 2D score plots were calculated to show the degree of overlap between the three data point clusters in the PC score space. PLS-DA score plots were calculated with PC1 representing the differences between the three groups and PC2 differentiating between co-cultures and AML. Analysis of metabolomic data was performed with Matplotlib for Python.
[0120] [Example 8] Liquid chromatography-mass spectrometry (LC-MS) Cell culture supernatant samples were analyzed for the biogenic amines, tryptophan (Trp), kynurenine (Kyn) and serotonin (5-HT) by targeted LC-MS-based assays at the Biomarkers Core Laboratory (BCL) at Columbia University.
[0121] [Example 9] Serum / plasma levels of kynurenine, tryptophan, SAA3 and SAA1 Quantification of Kyn and Trp in serum from peripheral blood (mice) or BM plasma (patients) was assessed by ELISA using independent kits (ImmunoSmol) according to the manufacturer's instructions. The ratio between Kyn and Trp levels is shown. SAA3 in serum (Mouse SAA3 ELISA Kit Millipore) and SAA1 in patient BM plasma (Amyloid A1 DuoSet ELISA Kit (R&D)) were assessed according to the manufacturer's instructions.
[0122] [Example 10] Total RNA extraction and RT-qPCR gene expression analysis RNA isolation, cDNA preparation and real-time PCR analysis were performed according to standard protocols. Total RNA from cortical bones (clean, flushed femurs were centrifuged at 10.000g for 20 s to remove residual BM) was extracted using TRIzol (Invitrogen), followed by RNA purification using PureLink RNA Mini Kit (Ambion, Invitrogen). mRNA was reverse transcribed using a random hexamer RNA-to-cDNA kit (Takara). Specific forward and reverse primers were used in conjunction with PowerUp SYBR Green Master Mix (Applied Biosystems) for quantitative PCR. Expression levels were determined using a 20-fold increase in the expression of 1 ... -ΔΔCt Methods were used to analyze and normalized for expression of the housekeeping gene Hprt unless otherwise stated.
[0123] [Example 11] Radioligand binding assay Full-length mouse or human serotonin receptor 1b (Htr1b) (pCMV6-entry vector, Myc-DDK tagged, Origene, Cat. No. MR222524 and RC223874) were transiently transfected into HEK293T cells using Lipofectamine LTX (Invitrogen). Transfection efficiency was assessed 24 hours after transfection by flow cytometry using anti-Flag antibody (Sigma-Aldrich Cat. No. F3165, RRID:AB_259529). 25 nM [ 3 H]-5-HT (41.3 Ci / mmol, Perkin Elmer) or [ 3 Binding of [H]-Kyn (50 μM, 0.125 Ci / mmol) was performed using 100 μg of isolated HEK293 membranes in a final volume of 50 μl of binding buffer (10 mM Hepes, pH 7.4, 100 mM NaCl, 10 mM MgCl 2 , 1% ascorbic acid, 1x entacapone / pargyline) and incubated for 3 h at 4°C in the presence of various concentrations of unlabeled additives (5-HT, Kyn or SB9). Reactions were stopped by adding ice-cold PBS and filtered through 0.7 μm glass fiber filters (Data Support Company). Filters were dried and melted with scintillation cocktail. Radioactivity trapped on the filters was counted using an SL300 scintillation counter (Hidex). [0.01%] in the presence or absence of each compound was counted using a SL300 scintillation counter (Hidex). 3 H]-5-HT or [ 3 Nonspecific binding of [H]-Kyn to glass filters was measured in the absence of membranes. Specific binding was determined by subtracting the nonspecific binding signal from that measured in the presence of HTR1B-expressing membranes under appropriate conditions. LogEC 50 was determined by nonlinear regression curve analysis.
[0124] [ 3 H]-GR125743 (PerkinElmer) radioligand binding assays were performed in standard binding buffer (50 mM Tris, 10 mM MgCl 2, 0.1 mM EDTA, 0.1% BSA, 0.01% ascorbic acid, pH 7.4). 3 Competitive binding was assessed with [H]-GR125743 (1.38 nM) and HTR1B membranes (isolated from HEK293T stable transfectants) in a total volume of 150 μL. Assay plates were incubated in the dark at room temperature for 1 h and the reaction was stopped by filtration onto 96-well Filtermat A (PerkinElmer) presoaked in 0.3% polyethyleneimine, followed by three rapid washes with cold wash buffer (50 mM Tris, pH 7.4). Filters were dried and melted with scintillation cocktail (Meltilex, PerkinElmer). Radioactivity was counted using a Wallac TriLux Microbeta counter (PerkinElmer).
[0125] [Example 12] cAMP signaling assay The GloSensor cAMP assay was performed as previously reported with minor modifications (Patel N, et al. Structure-based discovery of potent and selective melatonin receptor agonists. Elife. 2020;9). Briefly, HEK293T cells were transfected with 4 μg of 5-HT 1B Receptor and 4 μg of GloSensor cAMP (Promega) plasmid were co-transfected o / n and plated in poly-L-lysine-coated 384-well white clear-bottom plates in 1% dialyzed FBS-supplemented DMEM for 24 h. Cells were removed from culture medium and loaded with luciferin (final concentration 1 mM) for 30 min at 37 °C. Cells were then stimulated with drugs diluted in assay buffer (HBSS, 20 mM HEPES, 1 mg / ml BSA, pH 7.4) for 15 min at room temperature, followed by addition of isoproterenol (100 nM). Plates were counted after 25 min in a Wallac TriLux Microbeta counter (PerkinElmer).
[0126] [Example 13] Proliferation assay Cell proliferation was performed using Cell Counting Kit 8 (WST-8, Abcam) according to the manufacturer's instructions. Briefly, 0.03 × 10 6 Cells were seeded in their corresponding medium (100 μl) on tissue culture clear-bottom microplates (Corning). Where indicated, cells were treated with the indicated compounds for the indicated time points. 10 μl / well of WST-8 solution was added and incubated at 37 °C for 2 h before measuring absorbance at 460 nm. For each experiment, the absorbance of blank wells (growth medium and vehicle / treatment) was subtracted from the values of those wells containing cells.
[0127] In vitro: The indicated cell lines were incubated in reduced serum medium and exposed to SAA1 (1 μg / ml) for 24-72 h as indicated.
[0128] Ex vivo xenografts (healthy CD34 + vs. patient-derived AML): Whole BM from NSGS mice was depleted of mouse cells using mouse CD45 magnetic beads (Miltenyi Biotec catalog number 130-052-301, RRID:AB_2877061) and passively selected human cells were used.
[0129] Ex vivo primary AML and MDS patient samples: MNCs from fresh BM patient aspirates were isolated and depleted from mature hematopoietic cells as previously described (lineage Cell Depletion Kit, Miltenyi Biotec Cat. No. 130-092-211). Isolated cells were seeded in StemMACS HSC Expansion Media XF (Miltenyi Biotec, Cat. Nos. 130-100-463 and 130-100-843) supplemented with StemMACS HSC Expansion Cocktail and treated with either vehicle (PBS) or SAA1 (5 μg / ml) for 24 hours.
[0130] Cell death was assessed using the Invitrogen Violet Annexin V / Dead Cell Apoptosis Kit (catalog no. A35136).
[0131] [Example 14] In vivo proliferation (Edu) cell cycle analysis Cell labeling was performed by i.p. injection of 50 mg / kg of freshly prepared 5-ethynyl-2'-deoxyuridine-Edu- (Cayman Chemical Company catalog number 20518) into mice. After 3-4 hours, BM was harvested and human cells were passively selected by mouse cell depletion using mouse CD45 magnetic beads (Miltenyi). Human BM cells were then stained with CD45 and CD33 to identify leukemic blasts. Cell cycle / proliferation analysis was performed using the Click-iT Plus EdU Flow Cytometry Assay Kit (Invitrogen, catalog number C10420) according to the manufacturer's instructions. A fixative viability dye (Biolegend) was used to identify the dead population. Single-color controls were used to set compensation and fluorescence minus one controls were used to set gates. Analysis was performed using FlowJo software.
[0132] [Example 15] CRISPR / Cas9-mediated Ido1 genomic targeting Chemically modified sgRNAs targeting IDO1 were obtained and designed with at least three mismatches to reduce possible off-target effects using the Synthego CRISPR design tool or CRISPOR. Analysis of the predicted coding protein genes for each sgRNA did not reveal enrichment of specific pathways or cellular processes, and no gene signatures specifically related to TP53 or DNA damage pathways were identified. Furthermore, the lack of random effects due to TP53 activation was demonstrated by p16 and p21 mRNA level assessment in the Cas9 alone control as well as in all sgRNAs used. 10 6For each cell, 3 μg of TrueCut Cas9 protein V2 (Invitrogen) and 1.5 μg of sgRNA were mixed in either SE (immortalized cell lines WEHI-3B and OCI-AML3) or P3 (primary mouse MLL / AF9 or patient-derived AML cells) buffer (Lonza, Amaxa X-Nucleofector Kit) and incubated for 10 min. Cells were then resuspended in the respective nucleofection buffer, mixed with Cas9 / sgRNA RNP complexes or Cas9 alone as a control, and electroporated with a Lonza 4D-Nucleofector (program DZ100, CM137 or DI100). After electroporation, cells were cultured in the respective medium at 37 °C until sequencing analysis and / or injection. Editing efficiency data, indel contribution and Sanger sequencing analyses were performed using Synthego Performance Analysis, ICE Analysis.2019.v2.0. (Synthego).
[0133] Table 3 shows the off-target sites for mouse sgRNA 146 (PAM in bold): CGCCAUGGUGAUGUACCCCA GGG (SEQ ID NO: 1). Mismatches with the guide sequence are shown in bold and underlined. Off-target sites located within non-coding regions are indicated by empty boxes in the gene column.
[0134] Table 4 shows the off-target sites for mouse sgRNA 196 (PAM bold):CUGCCCACACUGAGCACGGA CGG (SEQ ID NO: 22). Mismatches with the guide sequence are shown in bold and underlined. Off-target sites located within non-coding regions are indicated by empty boxes in the gene column.
[0135] Table 5 shows the off-target sites for mouse sgRNA 203 (PAM bold): CAGUCCGUCCGUGCUCAGUG TGG (SEQ ID NO: 41). Mismatches with the guide sequence are shown in bold and underlined. Off-target sites located within non-coding regions are indicated by empty boxes in the gene column.
[0136] Table 6 shows the off-target sites for mouse sgRNA 610 (PAM bold): UAGGGAACAGCAAUAUUGCG GGG (SEQ ID NO: 61). Mismatches with the guide sequence are shown in bold and underlined. Off-target sites located within non-coding regions are indicated by empty boxes in the gene column.
[0137] Table 7 shows the off-target sites for human sgRNA 126 (PAM in bold): GUGCAAGGCCGCUGUGACUUG TGG (SEQ ID NO: 82). Mismatches with the guide sequence are shown in bold and underlined. Off-target sites located within non-coding regions are indicated by empty boxes in the gene column.
[0138] Table 8 shows the off-target sites for human sgRNA 170 (PAM bold): UUUGCCCCACACAUAUGCCA UGG (SEQ ID NO: 103). Mismatches with the guide sequence are bold and underlined. Off-target sites located within non-coding regions are indicated by empty boxes in the gene column.
[0139] [Example 16] Plasmid constructs and lentiviral transduction Lentiviral particles were obtained by co-transfection of HEK293T cells with Lenti-X™ Packaging Single Shots (VSV-G) (Takara Bio Catalog No. 631275) and either empty vector or pLenti-IDO1-C-mGFP vector (Origene Catalog No. RC206592L2) according to the manufacturer's protocol. The supernatant containing the viral particles was concentrated using a PEG Virus Precipitation Kit (BioVision, Catalog No. K904) according to the manufacturer's protocol. Viral titers were quantified using Lenti-X™ GoStix™ Plus (Takara Bio Catalog No. 631280). 24 hours prior to evaluation of proliferation, 2x10 virions were cultured at the indicated multiplicity of infection (MOI) by spinoculation (1 hour at 32°C, 300xg) in the presence of 8ug / ml polybrene (Milipore). 6 OCI-AML3 cells were transduced with
[0140] [Example 17] RNA sequencing (RNAseq) Briefly, total RNA was extracted from primary human osteoblasts and THP-1 cells co-cultured in a transwell device using TRIzol. Paired-end transcriptome reads were processed using the STAR (Dobin A, et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics. 2013;29:15-21) aligner based on the Ensembl (RRID:SCR_002344) GRCh37 human genome assembly with default parameters. Read counts were extracted using featureCounts (Liao Y, et al. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics. 2014;30:923-30) and normalized gene expression was calculated as TPM (Transcripts Per Million). Differential expression analysis was performed by DEseq2 (RRID:SCR_015687) (Love MI, et al., Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15:550). RNA sequencing data have been deposited at GEO (GSE154374).
[0141] [Example 18] Multiplexed protein level analysis Cell culture supernatants were probed for IL-1α, IL-6, CXCL1, CXCL5, CXCL8, CCL2, CCL7, CCL8 and CCL20 using a custom multiplex panel (Invitrogen ProcartaPlex) according to the manufacturer's instructions. Supernatant samples were clarified by centrifugation at 10,000g for 10 min and kept on ice before loading.
[0142] [Example 19] Osteoblasts inhibit AML through a mechanism involving serotonin signaling We previously showed that maintaining osteoblast numbers by inhibiting the antiproliferative effects of gut-derived serotonin reduced leukemia burden and extended survival (Krevvata M, et al. Inhibition of leukemia cell engraftment and disease progression in mice by osteoblasts. Blood. 2014;124:2834-46.). Osteoblast numbers were maintained by treating leukemia mice with a regimen of intermittent parathyroid hormone (PTH), which increased osteoblast numbers without affecting serotonin signaling (Jilka RL, et al., Increased bone formation by prevention of osteoblast apoptosis with parathyroid hormone J Clin Invest. 1999;104:439-46). To maintain the integrity of the BM microenvironment and hematopoietic system, dsRed-MLL / AF9-induced blasts from leukemia mice were injected into non-irradiated wild-type (WT) recipient mice. PTH failed to suppress leukemia growth, as neither disease progression nor life span was affected in PTH-treated mice compared to vehicle-treated mice (Figure 1A). Furthermore, PTH did not affect serotonin signaling, as bone expression of cyclins D1, D2, and E1 (targets inhibited by serotonin-HTR1B signaling (Yadav VK, et al. Lrp5 Controls Bone Formation by Inhibiting Serotonin Synthesis in the Duodenum. Cell. Elsevier Inc; 2008; 135: 825-37)) was not altered in PTH-treated mice compared to vehicle-treated mice. These results suggested that engagement of specific pathways dependent on serotonin receptor signaling may result in a protective effect of osteoblasts against AML progression.
[0143] [Example 20] Ablation of serotonin receptor 1b (HTR1B) in osteoblasts prevents AML progression Since our results suggest that the protective effect of osteoblasts against leukemia progression does not depend only on osteoblast number, but rather on the engagement of serotonin receptor signaling, we investigated the specific signaling pathways involved. Among the 14 described serotonin receptors, only three, namely Htr1b, Htr2a and Htr2b, are expressed in primary osteoblasts. HTR1B is the main serotonin receptor that controls osteoblast number. Therefore, we analyzed the contribution of HTR1B to leukemia progression by the use of Htr1b- / - mice. Wild-type Htr1b+ / + mice injected with MLL / AF9 consistently developed leukemia and died within 14–19 days after transplantation (Figure 1B), and showed splenomegaly (Figure 1B), blast infiltration in the BM, liver and spleen, as well as peripheral blood neutrophilia, lymphopenia and monocytosis. In contrast, 100% (n=29) of Htr1b- / - littermate mice tested remained leukemia-free for at least the entire observation period of 90 days after transplantation (Figure 1B).At the time of harvest, all Htr1b- / - tissues analyzed were free of MLL / AF9 cells.
[0144] Given these findings, we sought to determine at what stage during osteoblast differentiation Htr1b expression is required for leukemia progression. To this end, we inactivated Htr1b in either leptin receptor-expressing (LepR+) mesenchymal stromal cells (MSCs) (Zhou BO, et al. Leptin-receptor-expressing mesenchymal stromal cells represent the main source of bone formed by adult bone marrow. Cell Stem Cell. 2014;15:154-68) or osteoblasts. We found that ablation of Htr1b expression in LepR+MSCs using a LepR-Cre line (32) did not prevent leukemia progression and lethality (Figure 1C). Next, we inactivated Htr1b in cells fully committed to the osteoblast fate (Htr1b c-osb - / -, Fig. 1D) using a collagen type I, alpha-1 (Col1a1)-Cre line (Dacquin R, et al., Mouse alpha1(I)-collagen promoter is the best known promoter to drive efficient Cre recombinase expression in osteoblast. Developmental Cell. 2002;224:245-51.), or in differentiating osteoblasts (Htr1b d-osb - / -, Fig. 1E) using an osteocalcin (OCN)-Cre line (34). In both scenarios, we observed a marked reduction in leukemia progression in mice injected with MLL / AF9 cells and either a 70% reduction in mortality in Htr1b c-osb - / - (Figure 1D) or a complete prevention of lethality in Htr1b d-osb - / - (Figure 1E) over the entire time period observed. In contrast, all WT control mice died within 14-17 days after MLL / AF9 transplantation. Recombination efficiency was two-fold more effective using OCN-Cre than Col1a-Cre at the Htr1bflfll locus, potentially explaining the difference in the level of protection against leukemia between the two conditional models.These data indicate that ablation of Htr1b in committed osteoblasts is sufficient to confer near-complete protection against AML and extend survival.
[0145] To determine whether Htr1b deletion in bone could limit AML progression after engraftment, we inducibly inactivated Htr1b after AML transplantation using the tetracycline-dependent Tg(Sp7-tTA,tetO-EGFP / cre)1Amc / J(Osx-Cre) line, which deletes the gene in cells at every stage of the osteoblast differentiation pathway in adult mice (Rodda SJ, et al., Distinct roles for Hedgehog and canonical Wnt signaling in specification, differentiation and maintenance of osteoblast progenitors. Development. Oxford University Press for The Company of Biologists Limited; 2006; 133:3231-44.). Because delaying Osx-Cre expression until postnatal restricted deletion to committed osteoblasts (Mizoguchi T, et al. Osterix marks distinct waves of primitive and definitive stromal progenitors during bone marrow development. Developmental Cell. 2014;29:340-9.), Htr1b fl / fl;Osx-Cre mice were born, weaned, and maintained on a doxycycline (DOX)-containing diet to suppress transgene activation. Removal of DOX after MLL / AF9 injection in Htr1b fl / fl;Osx-Cre mice increased survival (Figure 1F) and reduced leukemia burden (Figure 1G). Moreover, two mice showed complete protection against leukemia and survived throughout the entire observation period (Figure 1F). Detailed analysis of their leukemic burden showed an increase in signaling until day 12 post-transplant, followed by a steady decrease to basal levels, signifying complete clearance from AML (Supplementary Figure 1SL). These results suggest that activation of the pathway directed through Htr1b in osteoblasts by AML cells is a prerequisite to enable leukemic growth in the BM.Furthermore, inhibition of HTR1B signaling in osteoblasts following engraftment of AML can limit and in some cases eliminate disease, improving leukemic burden and survival.
[0146] To address whether the observed partial rescue was due to limited reduction in serum 5-HT levels, we investigated whether the selective Htr1b receptor antagonist SB224289 (SB9) (Gaster LM, et al. The selective 5-HT1B receptor inverse agonist 1'-methyl-5-[[2'-methyl-4"-(5-methyl-1,2,4-oxadiazol-3-yl)biphenyl-4-yl]carbonyl]-2,3,6,7-tetrahydro-spiro[furo[2,3-f]indole-3,4-"piperidine] (SB-224289) potently blocks terminal 5-HT autoreceptor function both in vitro and in vivo. J Med Chem. 1998;41:1218-35.) could confer a protective effect of similar magnitude to that observed upon inactivation of Htr1b in osteoblasts. However, as seen with later pharmacological inhibition of 5-HT synthesis, SB9 only partially protected MLL / AF9-injected mice (Fig. 1H). Although SB9-treated mice injected with MLL / AF9 showed a significant increase in survival rate compared to vehicle-treated mice (Fig. 1H), they eventually developed leukemia and died. Importantly, the administered SB9 dose was effective in abolishing the binding of 5-HT to HTR1B. SB9 successfully inhibited 5-HT signaling, as the expression of cyclins D1, D2 and E1 (which are suppressed in 5-HT signaling via HTR1B in bone (Yadav VK, et al. Lrp5 Controls Bone Formation by Inhibiting Serotonin Synthesis in the Duodenum. Cell. Elsevier Inc; 2008; 135: 825-37.)) was upregulated in bones of SB9-treated mice. As a control, expression of Col1a1, an osteoblast-specific gene, was not affected by SB9 treatment, thus effectively antagonizing 5-HT signaling.The partial rescue from AML progression by inhibition of either 5-HT synthesis or signaling (SB9), compared with the near complete protection seen after genetic Htr1b ablation, suggested that the primary leukemia-promoting effect of HTR1B may be mediated through ligands distinct from serotonin.
[0147] Figure 1A-H show that ablation of serotonin receptor 1b (Htr1b) in osteoblasts prevents AML progression. (A) Survival curves of wild-type (WT) mice treated with vehicle (n=4) or parathyroid hormone (PTH, n=7) and injected with MLL / AF9 AML cells. (B-E) Representative epifluorescence images (radiance p / sec / cm) of survival curves of MLL / AF9-injected WT mice, their spleen weights, and leukemia progression 14 days after MLL / AF9 injection. 2 / sr). (B) Htr1b - / - (n=29) and Htr1b + / + Littermate (n=13); (C) Htr1b fl / fl ;LepR-Cre:Htr1b Lep-R - / - (n=8) and Htr1b Lep-R + / + Littermate (n=6); (D) Htr1b fl / fl ;Col1a1-Cre:Htr1b c-osb - / - (n=11) and Htr1b c-osb + / + Littermates (n=12), 4 of which developed leukemia Htr1b c-osb - / - Mice are represented by red asterisks in the histograms of spleen weight and excluded from statistical analysis; (E) Htr1b fl / fl ;OCN-Cre:Htr1b d-osb - / - (n=5) and Htr1b d-osb + / + Litters (n=10). Orange arrows indicate the systematic genetic interrogation approach followed. (F) Htr1b fl / fl ;Osx-Cre:Htr1b Osx - / -(doxycycline-DOX-removal 24 h after MLL / AF9 injection; n = 9) and Htr1b Osx + / + (DOX maintenance, n=6) survival curves. (G) Quantification of leukemia burden (total flux, photons / sec) 12 days after MLL / AF9 injection, Htr1b Osx + / + (DOX, n=6), Htr1b Osx - / - (No DOX; n=9). (H) Survival curves of WT mice injected with MLL / AF9 cells and treated with either vehicle (n=10) or the HTR1B antagonist SB224289 (SB9) (n=10). All survival curves shown are Kaplan-Meier curves with p-values of the log-rank (Mantel-Cox) test between groups indicated. All data are expressed as mean ± SEM with statistical analysis performed using unpaired t-tests.
[0148] [Example 21] AML cells preferentially convert tryptophan to kynurenine In a disease-relevant approach, to investigate whether AML cells engage HTR1B in osteoblasts through ligands distinct from serotonin, we utilized an in vitro system using primary human osteoblasts from healthy individuals co-cultured with a human AML cell line (OCI-AML3). To evaluate the contribution of secreted soluble factors that may act as HTR1B putative ligands, we performed untargeted metabolomic profiling on supernatants from either cell types alone or co-cultures using a panel of 466 metabolites. We focused on those with coefficients of variation (CV) below 30% and integrated the data to identify metabolites that showed a stronger combination of fold change and statistical significance. Our strategy was to first identify metabolites highly secreted by AML cells but not osteoblasts (Figure 2A), and then select those that showed significant changes in their levels after co-culture (Figure 2B). This two-step analysis identified one metabolite: kynurenine (Kyn), whose levels were not only increased 20-fold in supernatants from AML cells compared to osteoblasts (see arrow in Figure 2A), but also, at the same time, was the metabolite whose secretion by AML cells was most decreased after co-culture with osteoblasts (see arrow in Figure 2B). Kyn is the major tryptophan (Trp) catabolite, as is serotonin (5-hydroxytryptamine, 5-HT). The ubiquitous indoleamine 2,3-dioxygenase (IDO1 / IDO2) or hepatic tryptophan 2,3-dioxygenase (TDO) enzymes catalyze the conversion of Trp to Kyn, whereas tryptophan hydroxylase-1 (TPH1) also catalyzes the production of duodenal serotonin from Trp (Figure 2C). Trp levels were similar among all supernatants analyzed (Figure 2D). Interestingly, 5-HT levels were below the detection limit, and levels of the 5-HT metabolite 5-hydroxytryptophan (5-HTP) were unchanged in co-culture supernatants (Figure 2D). These observations were further validated by liquid chromatography-mass spectrometry (LC-MS) targeted assays.
[0149] Stringent analysis focusing on metabolites with CV<15% revealed that pyridoxal-5'-phosphate (PLP, the active form of vitamin B6), like Kyn, was increased 29-fold in supernatants from AML cells compared to osteoblasts (Fig. 2E, grey histogram) and was the second most significantly decreased metabolite after Kyn in cocultures of AML with osteoblasts (Fig. 2E-blue histogram). PLP is a required cofactor for over 160 enzymes outlined in (Percudani R,et al.,A genomic overview of pyridoxal-phosphate-dependent enzymes.EMBO Rep.2003;4:850-4), including several in the Kyn pathway, suggesting that its downregulation may be another means of Kyn depletion in the presence of osteoblasts.
[0150] [Example 22] High kynurenine levels are a hallmark of MDS and AML To determine the in vivo significance of Kyn in AML, we measured circulating Kyn and Trp levels in leukemic mice and confirmed that the Kyn to Trp ratio (an indicator of IDO1 activity) was elevated in the peripheral serum of mice injected with MLL / AF9 cells compared to control vehicle-injected mice (Figure 2F). To assess whether our findings in vitro and in mouse models were recapitulated in human leukemia, specifically within the BM niche compartment, we investigated whether induction of Kyn secretion is a widespread feature of AML or preleukemic myelodysplastic syndrome (MDS) patients. We found that the Kyn / Trp ratio in the BM plasma of MDS and AML patients was significantly higher than that of age-matched healthy controls (Figure 2G). Furthermore, we compared Kyn / Trp ratio levels in BM plasma of paired samples from patients whose MDS had progressed to AML: in six paired samples analyzed, Kyn / Trp ratio levels were increased in BM plasma at the AML stage compared to their MDS stage samples (Figure 2H), suggesting that increased Kyn production correlates with disease progression.
[0151] RNAseq analysis of BM mononuclear cells (BM-MNCs) from MDS and AML patients showed that TPH1 expression was very low (0.74 ± 0.06 in MDS and 1.09 ± 0.11 in AML, transcripts per million -TPM-), whereas IDO1 expression was much higher (25.89 ± 1.12 in MDS and 30.48 ± 1.22 in AML) (Figure 2I). Quantitative PCR analysis of BM-MNCs from additional independent cohorts of healthy subjects, MDS and AML patients identified a similar progressive increase in the IDO1 / TPH1 ratio from healthy controls compared to patients. Moreover, this increase was similarly observed along the progression of disease severity from MDS to AML (Figure 2J).
[0152] Table 1 shows the clinical characteristics and TPM values of AML and MDS patients used in the RNAseq data. Table 1 is related to Figure 2I.
[0153] Taken together, these results identify kynurenine as a cancer metabolite and demonstrate preferential catabolism of Trp to the Kyn pathway in cells from MDS and AML patients, as well as increased levels of their metabolites in BM plasma. As disease pathogenesis progresses from MDS to AML, a progressive increase in Kyn production appears to occur.
[0154] [Example 23] Kynurenine binds to and regulates HTR1B signaling The increased preferential production of Kyn over 5-HT by leukemia cells, together with the partial protective effect caused by the HTR1B antagonist SB9, prompted us to investigate whether Kyn could be a previously unrecognized ligand of HTR1B. To address whether Kyn is a serotonin receptor ligand, we performed competitive binding and functional assays on HEK293T cells overexpressing mouse or human HTR1B. Kyn was able to compete with the binding of 25 nM [3H]-5-HT to mouse (IC50 of about 54 μM) and human (IC50 of about 24 μM) HTR1B in the membranes of HEK293T cells overexpressing mouse or human receptors, respectively (Figure 2K and Table 2); as a control, 5-HT showed similar competitive binding activity to both receptors (Table 2). Similarly, Kyn competed for binding of the potent serotonin receptor antagonist [3H]-GR125743 to HTR1B with a Ki of approximately 17 μM in membranes isolated from HEK293T cells stably overexpressing human HTR1B (Table 2). Moreover, consistent with its binding properties, Kyn acts as a partial agonist of Gi / o-mediated cAMP production via HTR1B with an EC50 of approximately 772 nM (Figure 2L and Table 2).
[0155] Because SB9, used to displace 5-HT binding to HTR1B, was unable to effectively disrupt AML in vivo (Fig. 1H), we investigated whether it could displace Kyn binding to HTR1B. However, at concentrations equivalent to those administered in vivo (approximately 90 μM, Fig. 1H), SB9 did not affect Kyn binding to mouse HTR1B receptors (Fig. 2M). Taken together, these experiments demonstrate that Kyn is a partial agonist of HTR1B in both mice and humans and can regulate its signaling.
[0156] Figure 2 Kynurenine is an increased cancer metabolite in the BM niche of MDS and AML patients that binds to HTR1B. (A-B) Volcano plots of metabolites with coefficient of variation (CV) < 30% comparing untreated OCI-AML3 cells (AML) vs. human osteoblasts (hOsb) (A) or untreated AML cells (AML) vs. co-cultures (24 h) (B), arrows point to kynurenine. (C) Trp catabolism scheme. (D) Relative abundance of tryptophan (Trp) and its catabolic metabolites: kynurenine (Kyn), serotonin (5-HT) and 5-hydroxytryptophan (5-HTP) in the indicated supernatants at 24 h (n=6); two-way ANOVA. (E) Heatmap of the first 30 metabolites with CV < 15% and histograms of fold change for AML vs. hOsb (grey) or AML vs. co-cultures (blue). (F) Violin plot of Kyn / Trp ratio levels in serum circulating levels of control mice (n=19) vs. MLL / AF9-injected (n=28) mice; unpaired t-test. (G) Violin plot of Kyn / Trp ratio levels in bone marrow (BM) plasma from healthy (n=27), MDS (n=30) and AML (n=24) patients; one-way ANOVA. (H) Kyn / Trp levels in MDS-stage BM plasma samples paired with their corresponding altered AML-stage BM plasma samples (n=6); paired t-test. (I) RNAseq analysis of BM mononuclear cells (BM-MNCs) from MDS (n=30) and AML (n=30) patients for TPH1 and IDO1 (transcript-per-million-TPM-); two-way ANOVA. (J) IDO1 / TPH1 mRNA ratio in BM-MNCs from healthy (n=32), MDS (n=10) and AML (n=20) patients; one-way ANOVA. (K) IDO1 / TPH1 mRNA ratio in HEK293T cells overexpressing mouse (n=4 experiments) or human receptors (n=2 experiments). 3 Concentration dependence of Kyn-mediated competition of [H]-5-HT (25 nM, 41.3 Ci / mmol) binding yielded IC of 54.1 μM and 24.4 μM, respectively. 50 (See Table 2 for details.) (L)G i / o Mediated cAMP inhibition assay (n=14). (M)3 H]-5-HT (25 nM, 41.3 Ci / mmol) or [ 3 Binding of [H]-Kyn (50 μM, 0.125 Ci / mmol) was measured with Htr1b-overexpressing HEK293T membranes in the presence of increasing concentrations of SB9 (n=4). Isotherms were fitted using nonlinear regression fitting, and best fit values and statistics for the fitting are shown in Table 2. All data are expressed as mean ± SEM. See also Table 2.
[0157] [Example 24] Kynurenine binds to and regulates HTR1B signaling To investigate the importance of Kyn to leukemia progression in vivo, we inhibited its synthesis by suppressing IDO activity in mouse and human AML cells. We used a CRISPR-Cas9 editing strategy to design a series of different single guide RNAs (sgRNAs) targeting Ido1 exons 3 or 4, which encode a critical portion of the enzyme catalytic site and are common to all IDO isoforms.
[0158] First, Ido1 was genetically ablated in the myelomonocytic leukemia cell line WEHI-3B. High deletion efficiency was achieved in WEHI-3B cells by combining two sgRNAs, specifically targeting exon 3. Mice receiving WEHI-3B control cells with Cas9 alone died within 2.5 weeks after injection, whereas mice injected with gRNA#146 (SEQ ID NO: 1) alone or in combination with gRNA#196 (SEQ ID NO: 22) showed a significant increase in survival. Importantly, the reduction in Kyn levels as well as the protective effect of Ido1 deletion were proportional to the efficiency of Ido1 deletion.
[0159] Next, we modified primary murine leukemia cells using sgRNAs targeting Ido1 exons 3 or 4. Ido1 exon-3 edited MLL / AF9 cells were transplanted into WT non-irradiated recipients and leukemia progression was monitored (Figure 3A). All mice receiving Cas9-alone MLL / AF9 control cells died within 3 weeks of injection (Figure 3B), whereas Ido1 deletion significantly attenuated (sgRNA#203 (SEQ ID NO:41) and sgRNA#196 (SEQ ID NO:22), approximately 40% deletion efficiency) or even abrogated disease progression (sgRNA#146 (SEQ ID NO:1), approximately 56% deletion efficiency), reduced serum Kyn levels, and increased overall survival (Figure 3B).
[0160] CRISPR-Cas9-mediated Ido1 targeting of exon 4 achieved 70% loss of expression of Ido1 at the mRNA level (Figure 3C). Injection of Ido1-sgRNA#610 (SEQ ID NO: 61) edited MLL / AF9 cells into WT non-irradiated recipients resulted in a significant increase in survival (Figure 3D). Thirty-six percent of mice administered MLL / AF9 edited cells survived, displaying complete protection against leukemia progression (Figure 3D). Of note, spleen weight and serum Kyn levels were proportional to the reduction in IDO1 levels as well as the survival benefit. Since the majority of MLL / AF9 cells (approximately 70%) were efficiently targeted by sgRNA#610 (SEQ ID NO: 61), we reasoned that a small residual fraction of unedited AML cells would outcompete the edited cells over time. Indeed, sequencing analysis of BM cells from dying mice revealed that IDO1 was expressed in 45% of mice. This showed a proportion of 60-100% unedited (WT) sequences, indicating that activity was not impaired. These results suggested that the small number of unedited cells present in the initially injected population had a clonal advantage over Ido1-edited cells and were responsible for disease progression. Only two of the non-rescued mice showed less than 10% unedited cells, but in one of them (BM#19), the in-frame deletion preserved IDO1 function and allowed AML to progress, while in the other (BM#12), the disrupted IDO1 frameshift may explain its prolonged survival.
[0161] The relevance of IDO1 in the progression of human leukemia was examined using the OCI-AML3 AML cell line. OCI-AML3 cells nucleofected with Cas9 and a combination of sgRNAs #126 (SEQ ID NO: 82) and #170 (SEQ ID NO: 103) (targeting exon 3 of IDO1) showed high deletion efficiency (about 85%, FIG. 3E), and when exposed to IFN-γ, a strong inducer of IDO1-CRISPR-Cas9, the targeted OCI-AML3 cells were unable to upregulate its expression (FIG. 3F). Transplantation of OCI-AML3 IDO1-targeted cells into sublethally irradiated NOD.Cg-Prkdcscid Il2rgtm1Wjl / SzJ (NSG) mice (Figure 3G) resulted in delayed disease progression as seen by a ∼60% reduction in BM AML burden, a ∼20% reduction in splenic AML burden, and a significant reduction in spleen weight (Figure 3H). Consistent with the reduction in AML burden, IDO1 expression levels at the time of harvest of BM from NSG mice showed a 73% reduction compared to control (Cas9 alone) injected mice, confirming residual proliferation of potential reversion mutants. Furthermore, serum Kyn levels were reduced by ∼30%. Notably, OCI-AML3 IDO1-targeted cells did not exhibit any intrinsic proliferation defect compared to control (Cas9 alone) cells, although their proliferation was reduced when co-cultured with primary human osteoblasts (Figure 3I). In contrast, simulating IDO1 upregulation caused by osteoblasts, overexpression of IDO1 in OCI-AML3 cells promoted their proliferation in a dose-dependent manner.
[0162] Collectively, these results demonstrate that IDO1 is required to sustain osteoblast-dependent AML cell proliferation and that genetic ablation of IDO1 dose-dependently suppresses AML proliferation, suggesting that disease severity inversely correlates with Ido1 expression.
[0163] Figure 3 Genetic inhibition of kynurenine production prevents AML progression. (A) Representative epifluorescence images of leukemia progression in WT mice injected with MLL / AF9-CRISPR / Cas9 edited cells (sgRNA: #146 (SEQ ID NO: 1), #196 (SEQ ID NO: 22) and #203 (SEQ ID NO: 41)) (Ctrl: no leukemia). (B) Survival curves of mice injected with the indicated sgRNA MLL / AF9 edited cells or Cas9 alone MLL / AF9 control cells (n=3 for all groups). (C) Representative epifluorescence images of leukemia progression in WT mice injected with MLL / AF9-CRISPR / Cas9 edited cells (sgRNA: #610) (SEQ ID NO: 61) and Ido1 mRNA levels of MLL / AF9-sgRNA#610 (SEQ ID NO: 61) edited cells before injection (n=4); unpaired t-test. (D) Survival curves of WT mice injected with MLL / AF9-sgRNA#610 (SEQ ID NO: 61) edited cells (n=11) or Cas9 alone control (n=9). Mice (WT) showing >60% unedited sequence in the harvested BM were selected from those injected with sgRNA#610. editing lost (green; n=5) (SEQ ID NO: 61). (E) IDO1 mRNA levels in OCI-AML3 cells nucleofected with Cas9 and sgRN#610 (SEQ ID NO: 61) used in the transplantation experiments. (F) IDO1 mRNA levels in OCI-AML3 cells exposed to IFN-γ (overnight, 50 ng / ml, n=3); two-way ANOVA. (G) Overview of transplantation assay with OCI-AML3 CRISPR / Cas9-IDO1 targeted cells in NSG mice. (H) AML burden in bone marrow, spleen, and spleen weight (mg) relative to total body weight (g) of NSG mice 3 weeks after injection of OCI-AML3 cells (Cas9, n=8; #126+170, n=10). (I) Proliferation of OCI-AML3 cells after 72 hours of co-culture with primary human osteoblasts (n=7). Survival curves are Kaplan-Meier with p-values of the log-rank (Mantel-Cox) test between groups shown. All data are expressed as mean ± SEM. Statistical analysis was performed using unpaired t-test unless otherwise stated.
[0164] [Example 25] AML cells induce a self-reinforced osteoblastic niche through SAA1-mediated IDO1 upregulation in an HTR1B-dependent manner Next, we sought to identify downstream molecular targets of Kyn in human osteoblasts that confer permissiveness to AML engraftment in the BM niche and support leukemic cell proliferation. To this end, and to rigorously compare our studies in mice and humans, we used the human THP-1 AML cell line, which harbors the MLL / AF9 fusion oncogene, which is most commonly involved in MLL rearrangements and a potent driver of tumor progression. We characterized the transcriptional profiles of co-cultures of THP-1 cells with primary human osteoblasts and integrated the data to identify crosstalk signals. RNA sequencing (RNAseq) analysis showed that 137 genes were significantly differentially expressed in osteoblasts exposed to AML cells compared to osteoblasts cultured alone. Among them, pathway enrichment analysis identified several inflammatory pathways (NF-κB, TNF and IL-17 signaling pathways) that regulate multiple aspects of innate and adaptive immune function that were significantly increased in osteoblasts exposed to AML cells. Consistent with these findings, leukemia cells increased NFκB1A expression and induced p65 translocation to the nucleus in primary osteoblasts isolated from healthy subjects, indicating that AML cells activate canonical NF-κB signaling in osteoblasts. Indeed, gene set enrichment analysis (GSEA), focusing on genes encoding secreted molecules, demonstrated that the expression of several pro-inflammatory cytokine and chemokine genes in the NF-κB pathway was highly upregulated in primary human osteoblasts exposed to AML cells (Figure 4A). This pro-inflammatory signature was induced in osteoblasts by AML cells and confirmed by qRT-PCR in primary osteoblasts from healthy human subjects co-cultured with THP-1 or OCI-AML3 AML cell lines. Selected targets were further validated by multiplex assessment of protein levels in the corresponding supernatants. Notably, apoptotic pathway signatures were upregulated in osteoblasts exposed to AML cells, and this upregulation correlated with an inflammatory signature in leukemic cells exposed to osteoblasts, suggesting that inflammation-induced apoptotic pathways may be a mechanism underlying bone loss in AML.
[0165] More specifically, parallel RNAseq analysis of THP-1 AML cells exposed to human primary osteoblasts showed that expression of IDO1 was increased (log FC 4.6) while TPH1 expression was unchanged (Figure 4B). Interestingly, after the initial differential expression analysis, pathway enrichment analysis highlighted several IDO1-activated pathways. GSEA analysis showed that Trp catabolism as well as the Kyn pathway itself was upregulated in THP-1 cells exposed to osteoblasts, and qRT-PCR analysis confirmed the upregulation of IDO1. Notably, genetic ablation of IDO1 by CRISPR / Cas9 editing in OCI-AML3 cells abolished the osteoblast-induced upregulation of IDO1 expression observed in AML cells when cocultured with primary human osteoblasts. Taken together, these results suggest that AML cells "prime" osteoblasts to secrete factors that stimulate IDO1 expression.
[0166] To identify these factors, we directly examined whether any of the proinflammatory candidate molecules identified to be induced in primary human osteoblasts by AML cells (Figure 4A) would affect IDO1 expression in the latter. Among them, the rapidly induced acute phase protein serum amyloid A1 (SAA1) was the only osteoblast-secreted molecule capable of upregulating IDO1 expression in OCI-AML3 leukemia cells (Figure 4C). Most importantly, the ability of SAA1 to upregulate IDO1 expression was observed across several human AML cell lines as well as MDS-L cell lines.
[0167] SAA1 is the functional human orthologue of mouse Saa3 (41). Like SAA1, SAA3 is an acute phase response protein and is highly induced during inflammation by IL-1β, TNF-α, and IL-6 via NF-κB signaling (42). Interestingly, these cytokines as well as the NF-κB pathway itself were found to be significantly upregulated in the RNAseq dataset of human osteoblasts exposed to AML cells (Figure 4A). To assess whether our findings in human cells were replicated in mouse models, we investigated whether Ido1 upregulation is a general consequence of SAA exposure. We found that recombinant mouse SAA3 upregulated Ido1 expression in mouse WEHI-3B AML cells (Figure 4D), as was the case in human AML cells exposed to SAA1 (Figure 4C). Moreover, recombinant human SAA1 was also able to upregulate Ido1 expression in WEHI-3B cells to a similar magnitude as SAA3 ( Fig. 4D ), underscoring the notion that this mode of regulation is conserved in mouse and human.
[0168] To test whether the AML-induced SAA response observed in osteoblasts depends on Kyn engagement of HTR1B, we used mouse primary osteoblasts isolated from Htr1b- / - or Htr1b+ / + littermate mice. Notably, both Kyn and WEHI-3B AML cells strongly upregulated Saa3 expression in mouse osteoblasts, whereas 5-HT had no effect (Figure 4E). More importantly, both Kyn and WEHI-3B cells failed to upregulate Saa3 expression in Htr1b- / - primary osteoblasts (Figure 4E). These results demonstrate that Kyn secreted by AML cells upregulates Saa3 expression in osteoblasts in an HTR1B-dependent manner. This upregulation serves as a positive feedback mechanism to amplify Ido1 expression in AML cells.
[0169] [Example 26] SAA1 levels are elevated in MDS and AML patients and correlate with disease progression and kynurenine levels To determine the in vivo significance of Saa3 in AML, we measured circulating SAA3 levels in leukemic mice and confirmed that they were elevated in the peripheral serum of mice injected with MLL / AF9 cells compared to control vehicle-injected mice (Figure 4F). The relevance of these findings to human disease was assessed by measuring SAA1 levels in the BM plasma of MDS and AML patients. Consistent with the increased SAA1 mRNA expression observed in osteoblasts upon exposure to AML cells (Figure 4A), BM plasma levels of SAA1 were 6.4- and 10.6-fold higher in MDS and AML patients, respectively, compared to age-matched healthy subjects (Figure 4G). More importantly, SAA1 concentrations in all paired human samples analyzed were higher in the BM plasma of patients who had transformed to AML compared to samples from previous MDS stages (Figure 4H), suggesting a role for SAA1 in AML pathogenesis. Interestingly, a correlation between the Kyn / Trp ratio and SAA1 levels in BM plasma was observed along the progression from MDS to AML ( Figure 4I ), highlighting the potential prognostic value of the two biomarkers in the progression from MDS to AML.
[0170] Figure 4 AML cells self-amplify kynurenine production via HTR1B-SAA signaling in osteoblasts. (A) Schematic diagram (left) and box plots (right) of the RNAseq analysis strategy of key secreted molecules significantly upregulated in primary human osteoblasts co-cultured with THP-1 AML cell line for 24 h (n=2); Wald test, two-tailed. (B) Box plots of IDO1 and TPH1 from RNAseq analysis of THP-1 cells exposed to primary human osteoblasts for 24 h (n=2); Wald test, two-tailed. (C) IDO1 mRNA levels in OCI-AML3 cells exposed o / n to the indicated molecules (UT and SAA1 n=15; IL-1α, -1β, -6, CXCL-1 and -8 n=6; IL-33, -34, CXCL-3, -5, CCL-2 and -20 n=3). (D) Ido1 mRNA levels in WEHI-3B cells exposed o / n to recombinant mouse SAA3 or recombinant human SAA1 (n=8). (E) Htr1b mRNA levels in WEHI-3B cells exposed for 24 h to 5-HT (25 nM, n=7–8), Kyn (25 nM, n=5) or WEHI-3B cell lines (n=10–12). - / - and Htr1b + / + Saa3 mRNA relative levels in early differentiated mouse calvaria from littermates; two-way ANOVA. (F) Violin plot of SAA3 peripheral blood (PB) serum levels in control (n=20) and MLL / AF9-injected mice (n=20); unpaired t-test. (G) Violin plot of SAA1 BM plasma levels in healthy (n=30), MDS (n=35) and AML (n=23) patients. (H) SAA1 BM plasma levels in paired samples from patients (MDS and corresponding AML transformation stages) (paired samples, n=6); paired t-test. (I) Multivariate data plot of BM plasma levels for SAA1 and Kyn / Trp ratio along healthy, MDS or AML samples; Pearson correlation values are shown for Kyn / Trp ratio and SAA1 BM plasma levels. All data are expressed as mean ± SEM. Statistical analysis was performed using one-way ANOVA unless otherwise stated.
[0171] [Example 27] SAA selectively promotes proliferation of AML cells In this regard, a compilation of data obtained from mouse and human samples, as well as models of AML or MDS, demonstrates that leukemic cells stimulate proinflammatory remodeling of the osteoblastic niche. This mechanism may be a means by which leukemia self-reinforces its progression, particularly via SAA1-mediated, HTR1B-dependent IDO1 upregulation. To examine this hypothesis, we first tested the effect of SAA on leukemic cell proliferation. AML cell lines exposed to SAA1 (human) or SAA3 (mouse) showed increased proliferation compared to vehicle-treated ones (Figure 5A and Figure 7A). Similarly, SAA1 promoted the proliferation of lineage-depleted AML and MDS BM MNCs isolated from patient aspirates (Figure 5B). In parallel, IDO1 mRNA levels were increased in all patient-derived BM MNCs upon exposure to SAA1 (Figure 5C).
[0172] To better understand SAA-induced AML growth-promoting activity in vivo, we utilized a patient-derived xenograft (PDX) model. Sublethally irradiated NSG™-SGM3 (NSGS) mice were injected with either healthy human CD34+ cells (PDX Healthy) or patient-derived AML cells (PDX AML), achieving a human engraftment range of 6-23% for the former and 43-65% for the latter 4 weeks after injection (Figure 7B). After BM isolation and CD45+ mouse cell depletion, total BM human cells were cultured and exposed to SAA1 for 24 h. While human cells from CD34+ Healthy-injected mice were non-responsive to SAA1, patient-derived cells from AML-injected mice displayed high proliferative activity compared to their vehicle-treated counterparts (Figure 5D). Remarkably, similar to our findings in patient-derived ex vivo cultures ( Fig. 5C ), IDO1 expression was only upregulated in response to SAA1 in PDX-AML isolated human cells ( Fig. 5E ), indicating that SAA1 concomitantly induces IDO1 expression and proliferation of leukemic cells but not healthy CD34+ cells.
[0173] To determine whether the SAA proliferation-promoting activity observed in vitro and ex vivo was recapitulated in vivo, we treated PDX mice with recombinant human SAA1. SAA1 was administered iv for 2 or 8 days at equimolar doses to those used in the in vitro and ex vivo assays (Figure 7C). Three hours before harvest, mice were injected with 5-ethynyl-2'-deoxyuridine (Edu) to analyze the in vivo leukemic blast cell cycle. SAA1 treatment maintained a significant increase in the proliferation rate of leukemic blasts (hCD45+CD33+) after 2 and 8 days of treatment, as shown by an increase in Edu+ cells (S phase; Figure 5F) and a decrease in G0-G1 cells while G2-M phases remained unchanged (Figure 7D). Furthermore, 8 days of treatment with SAA1 promoted leukemic blast survival (the % of Sub-G1 apoptotic cells was reduced, Figure 7D). Progressively, the increased proliferation rate and decreased apoptosis of leukemic blasts led to a 1.5-fold increase in AML burden in the BM at the end of the 8-day treatment period (Figure 5G).
[0174] To clearly assess whether the increased proliferation observed with SAA exposure was a direct consequence of concomitant upregulation of IDO1 expression, we performed CRISPR / Cas9 targeting of IDO1 in primary human AML cells isolated from PDX models, achieving approximately 70% deletion efficiency (Figure 7E). Upon exposure to SAA1, IDO1-edited primary human AML cells failed to upregulate IDO1 expression compared to control (Cas9 alone) cells (Figure 7F). More importantly, IDO1-targeted cells showed a two-fold decrease in their proliferation rate in response to SAA1 compared to controls (Figure 5H). Conversely, injection of Kyn into AML-low-burden PDX mice (to distinguish the stimulatory effect of exogenous Kyn from that of AML cells) increases serum SAA3 (Figure 7G) as well as the proliferation capacity of leukemic blasts (Figure 7H). As a result, AML burden increased in the BM and SP of the Kyn-treated group (Figure 7I).
[0175] These results suggest that SAA specifically promotes proliferation and cell cycle progression of leukemic cells. Furthermore, SAA-induced proliferation occurs via upregulation of IDO1 expression.
[0176] [Example 28] SAA engages the AHR pathway to increase IDO1 expression Since upregulation of IDO1 expression triggers Kyn synthesis, we investigated whether Kyn-induced SAA1 secretion stimulates AML proliferation by activating Kyn signaling in AML cells. Kyn is an agonist of the aryl hydrocarbon receptor (AHR) (Opitz CA, et al. An endogenous tumour-promoting ligand of the human aryl hydrocarbon receptor. Nature. Nature Publishing Group; 2011; 478: 197-203.) and is a ligand-activated transcription factor that can induce cell proliferation, as reviewed in (Mulero-Navarro S, et al. New Trends in Aryl Hydrocarbon Receptor Biology. Front Cell Dev Biol. 2016; 4: 45.). Therefore, we investigated whether SAA1 induces AHR-dependent transcription of classical target genes. Indeed, exposure of human AML and MDS cell lines to SAA1 upregulated the majority of the main AHR target genes (Figure 7J). Similar to what was observed with IDO1 expression (Figure 5E), gene expression of CYP1A1 and CYP1A2 was only upregulated in response to SAA1 in human BM cells isolated from PDX-AML, but not in those isolated from CD34+ healthy injected mice (Figure 5I), confirming the specificity of this mechanism to leukemic cells. We further confirmed these results in patient BM-MNCs, showing that both AHR target genes were specifically upregulated in samples from AML patients, but not from healthy subjects (Figure 5J). Finally, we reinforced this AHR target gene activation pattern in lineage-depleted AML and MDS BM MNCs isolated from patient aspirates (Figure 5K). Interestingly, the AHR activation signature was also upregulated in AML cells exposed to osteoblasts ( Fig. 5L ) and was further confirmed in cocultures of leukemic cells with human osteoblasts, which showed upregulation of CYP1A1 and CYP1A2 genes upon osteoblast exposure ( Fig. 7K ).Taken together, these data suggest that SAA production by osteoblasts upregulates IDO1 expression in AML cells via activation of the AHR pathway.
[0177] Figure 5. SAA1 selectively promotes leukemic cell proliferation by upregulating IDO1 expression via activation of the AHR pathway. (A) Proliferation of human THP-1 and OCI-AML3 (n=22) and murine WEHI-3B (n=8) AML cell lines exposed to SAA1 or SAA3 (1 μg / ml, 24-72 h), respectively. Proliferation (B) and IDO1 mRNA levels (C) of human bone marrow mononuclear cells (BM-MNC) (n=8) isolated from MDS or AML (lineage-depleted) BM aspirates and exposed to SAA1 (5 μg / ml, 24 h), paired t-test (D). Schematic of the patient-derived xenograft (PDX) model used (left). Right: healthy CD34 cells exposed to vehicle (PBS) or SAA1 (1 μg / ml, 24 h). + Proliferation of total human BM cells isolated from PDX mice injected with either SAA1 (n=3) or patient-derived AML cells (n=8). (E) IDO1 mRNA levels from cells in (D); two-way ANOVA. Leukemic blasts (hCD45 + CD33 +(F) In vivo proliferation and BM AML burden (G); two-way ANOVA. (H) Proliferation of total human AML BM cells isolated from PDX mice and nucleofected with Cas9 (n=5), or Cas9 and a combination of sgRNA#126 (SEQ ID NO:82) and sgRNA#170 (SEQ ID NO:103) (n=8) exposed to vehicle or SAA1 (1 μg / ml, 24 hr); two-way ANOVA. (I) CYP1A1 and CYP1A2 mRNA levels from cells in (D); two-way ANOVA. (J) Violin plots of CYP1A1 and CYP1A2 mRNA levels in BM-MNCs from healthy (n=15) and AML (n=17) patients. (K) CYP1A1 and CYP1A2 mRNA levels from cells in (B). (L) GSEA analysis of AHR activation signature genes in THP-1 cells co-cultured with human osteoblasts for 24 h. All data are expressed as mean ± SEM. Statistical analysis was performed using unpaired t-test unless otherwise stated. See also Figure 7.
[0178] Figure 7 SAA1 selectively promotes proliferation of AML cells. Related to Figure 5. (A) Proliferation of human AML cell lines (MOLM-14, KG-1a, Kasumi-1 and HL-60) exposed to SAA1 (1 μg / ml) for 24, 48 or 72 hours (n=8 for all cell lines); 2-way ANOVA. (B) AML burden, spleen weight and liver weight (relative to body weight) in PDX mice 4 weeks after transplantation of CD34+ healthy cells (n=3 mice) or patient-derived AML cells (n=8 mice). (C) Diagram showing short-term (2 days) vs long-term (8 days) SAA1 in vivo treatment. (D) In vivo cell cycle analysis showing % of cells in G0-G1, G2-M and Sub-G1 within leukemic blasts (hCD45+CD33+) comparing 2-day treatment with vehicle (n=10 and n=7, respectively) or SAA1 (0.1 mg / kg; n=14 and n=9, respectively); 2-way ANOVA. On the right, representative flow plots for BM AML burden (top) and proliferation analysis (bottom) in the 8-day treatment groups. (E) Schematic of CRIPSR / Cas9 targeting of PDX-isolated AML human cells (left) and IDO1 mRNA levels in human AML cells nucleofected with Cas9 (n=7) or Cas9 and a combination of sgRNA#126 (SEQ ID NO:82) and sgRNA#170 (SEQ ID NO:103) (n=9). (F) IDO1 mRNA levels in cells from (E) cultured for 24 h with either vehicle or SAA1 (1 μg / ml) (n=3). Two-way ANOVA. (G) Schematic of Kyn treatment in low-loaded PDX (left) and SAA3 serum levels in NSGS mice injected with vehicle (n=5) or Kyn (20 mg / kg; n=6) for 1 week. (H) Percentage of blast (hCD45+hCD 33+) Edu+ cells in mice from (G). (I) AML burden in BM and SP of mice from (G). (J) mRNA levels of key AHR target genes (expressed as FI above basal levels in untreated cells: red lineage) in indicated human AML and MDS cell lines exposed o / n to SAA1 (1 μg / ml) (OCI-AML3 n=17, all other cell lines n=4–8).(K) mRNA levels of AHR targets in OCI-AML3 and THP-1 cells exposed to primary human osteoblasts for 24 h (FI vs. UT); two-way ANOVA. All data are expressed as mean ± SEM. Statistical analysis was performed using unpaired t-test unless otherwise stated.
[0179] [Example 29] Reducing AML Growth by Pharmacological Targeting of the Kynurenine-HTR1B-SAA-IDO1 Axis in Xenografts The demonstration that IDO1 ablation has a strong anti-leukemic effect prompted us to explore the therapeutic potential of inhibiting IDO1 activity for leukemic growth. Therefore, we analyzed the effect of epacadostat, a potent selective and competitive inhibitor of IDO1 enzyme activity, in leukemic progression (Liu X, et al. Selective inhibition of IDO1 effectively regulates mediators of antitumor immunity. Blood. 2010; 115: 3520-30., 46; and HK, et al. Hydroxyamidine inhibitors of indoleamine-2,3-dioxygenase potently suppress systemic tryptophan catabolism and the growth of IDO-expressing tumors. Molecular Cancer Therapeutics. 2010; 9: 489-98.). WT mice administered epacadostat ad libitum (0.8 g / kg) showed a 54% reduction in basal (leukemia-free) circulating Kyn / Trp levels (Figure 8A) and showed no obvious systemic toxicity, consistent with previous reports (Yue EW, et al. INCB24360 (Epacadostat), a Highly Potent and Selective Indoleamine-2,3-dioxygenase 1 (IDO1) Inhibitor for Immuno-oncology. ACS Med Chem Lett. 2017;8:486-91.). In MLL / AF9 leukemia mice, we observed a small but significant increase in survival when mice were treated with epacadostat (Figure 8B). However, despite a trend toward delayed leukemic progression ( Fig. 8C ), the in vivo pharmacology of epacadostat at the selected doses did not appear to reduce the 1.5-fold increase in systemic Kyn / Trp levels observed in MLL / AF9 leukemic mice ( Fig. 8A ).Doubling the epacadostat dose (1.6 g / kg) reduced serum Kyn levels by 35% (Figure 8D), significantly delayed AML burden (Figure 8E), and significantly extended survival compared to the lower dose (Figure 6A). Thus, reduced Kyn levels proportionally impact leukemia burden and overall survival.
[0180] We subsequently investigated the effect of pharmacological inhibition of the Kyn pathway in clinically relevant PDX models of human AML. First, we confirmed that the regulation of the Kyn-HTR1B-SAA axis was recapitulated in response to xenograft AML. Consistent with our findings in mouse models and patient samples, immunodeficient (NSGS) mice engrafted with patient-derived human AML cells exhibited higher peripheral levels of SAA3 (Figure 6B) and Kyn / Trp ratio (Figure 6C and Figure 8F) compared to PDX mice engrafted with CD34+ healthy cells. Furthermore, mirroring the findings in patient samples (Figure 4I), we observed a positive correlation between both biomarkers and disease status (Figure 8G). These results not only demonstrate a conserved response and activation of this axis in mammals, but also strengthen the concept for the evaluation of both Kyn and SAA1 as biomarkers in the diagnosis of AML progression.
[0181] Patient-derived de novo AML cells were injected into sublethally irradiated NSGS mice (Figure 6D), and BM aspiration was performed 3 weeks after transplantation to randomize the groups (Figure 8H). To control daily intake of epacadostat, we chose daily oral gavage (300 mg / kg) for 12 days. Although we only achieved a reduction in Kyn / Trp levels in the blood by about 20%, likely due to the short treatment period (Figure 6E and Figure 8I), epacadostat-treated animals concomitantly showed a reduction in AML BM burden by about 20% compared to the vehicle-treated group (Figure 6F). Furthermore, in vivo evaluation of the cell cycle of leukemic blasts (hCD45+CD33+) showed that epacadostat-treated leukemic blasts were less proliferative than vehicle-treated ones (Figure 6G). Interestingly, while G0-G1 and G2-M populations remained unchanged, epacadostat treatment increased leukemic blast apoptosis (Figure 6H), in contrast to the anti-apoptotic effect observed with SAA1 treatment (Figure S11D).
[0182] The therapeutic potential of targeting the kynurenine-HTR1B-SAA-IDO1 axis in an established PDX leukemia model was studied by inhibiting Kyn synthesis as an adjuvant treatment for chemotherapy (Figure 6I). Eight weeks after transplantation, at the time of randomization, BM aspirates showed approximately 50% AML burden (Figure 8J). Leukemic mice were then treated for 3 weeks with control chow, chemotherapy alone (Ara-C for 5 days; (48)), epacadostat diet (ad libitum, 1.6 g / kg) or combination therapy (Ara-C + epacadostat). As previously described in this model (48), leukemia burden decreases by day 8 after initiation of treatment with single-agent Ara-C, but relapse consistently occurs between days 22 and 29 after initiation of treatment (Figure 6I). As expected for a day 22 evaluation, Ara-C alone treated mice had a modest reduction in overall leukemia burden (Figure 6J), although not significant (likely due to the small number of mice), possibly indicating ongoing relapse. The effect of Ara-C was more sustained in the spleen than in the BM, consistent with previous results in this model (48, 49). Consistent with the results above (Figure 6F), epacadostat as a sole intervention also reduced leukemia burden in the BM of NSG mice (Figure 6J and Figure 8K), with a more pronounced effect in the spleen, as did Ara-C (Figure 6K). Importantly, we evaluated the effect of epacadostat / Ara-C combination at day 22 after the start of treatment. Combination treatment significantly reduced leukemia burden in the BM and spleen, but this effect was synergistic only in the BM (Figures 6J and 6K). Thus, epacadostat inhibition of IDO1 enhances the response to Ara-C in this preclinical model.
[0183] Taken together, our results reveal that leukemic cells induce a self-perpetuating proinflammatory niche by suppressing serotonin signaling in osteoblasts and exploiting the kynurenine-HTR1B-SAA-IDO1 axis (Figure 6L). These results provide strong evidence for a central role of the kynurenine-HTR1B-SAA-IDO1 axis in the progression of human AML. Moreover, they provide proof of principle that targeting this axis could be therapeutically beneficial in terms of complementing standard induction therapy and the described immunosuppressive effects of Kyn.
[0184] Figures 6A-6L show the results of pharmacological targeting of the kynurenine-HTR1B-SAA-IDO1 axis in patient-derived xenografts. (A) Survival curves comparing vehicle-treated mice (n=26) and epacadostat-treated mice (n=18 for 0.8 g / kg, n=13 for 1.6 g / kg). Kaplan-Meier curves with p-values from the log-rank (Mantel-Cox) test. CD34 + Serum levels of SAA3 (B) and Kyn / Trp ratio (C) in NSGS mice transplanted with healthy cells (n=11) or patient-derived AML cells (n=27). (D) Schematic illustrating pharmacological targeting of IDO1 (epacadostat) in patient-derived AML xenografts (PDX) in NSGS mice. (E) Kyn / Trp ratio in serum of PDX mice 5 weeks after AML transplantation and 2 weeks of epacadostat treatment (n=8 vehicle, n=10 epacadostat). (F) Human or mouse CD45 in the BM of PDX mice. + Representative flow cytometry plots showing % of cells (left) and AML burden (right) in the BM of PDX mice at the time of harvest (n=8 vehicle; n=10 epacadostat). (G) Leukemic blasts (CD45 + CD33 +(H) Cell cycle analysis of mice in (G). (I) Schematic showing an in vivo PDX mouse model treated with combination therapy (Ara-C 60 mg / kg for 1–5 days + epacadostat 1.6 g / kg ad libitum for 3 weeks). (J) AML burden in BM and (11 weeks after transplantation, 3 weeks after combination therapy) in BM (J) and spleen (K); control chow (ctrl. n=4), Ara-C (n=3), epacadostat (Epac. n=4) and combination therapy (Ara-C+Epac. n=3); One-way ANOVA; unpaired t-test, p-values are shown for BM ctrl group vs. Ara-C and Epac groups. (L) Schematic model of the kynurenine-HTR1B-SAA-IDO1 axis representing AML-mediated osteoblast self-reinforcing niche remodeling. All data are expressed as mean ± SEM. Statistical analysis was performed using unpaired t-test unless otherwise stated. See also Figure 8.
[0185] Figure 8 Epacadostat prevents AML progression. Related to Figure 6. (A) Kyn / Trp ratio levels in WT mice treated with either vehicle or epacadostat, with or without injection of MLL / AF9 cells (leukemia-free: Vehicle n=9, Epac.n=9; MLL / AF9-injected mice: Vehicle n=18, Epac.n=14). One-way ANOVA. (B) Survival curves comparing leukemic mice treated with either vehicle (n=19) or epacadostat (n=19); Kaplan-Meier curves with p-values from the log-rank (Mantel-Cox) test. (C) In vivo leukemia burden quantification of mice shown in (A) treated with either vehicle or 0.8 g / kg epacadostat. (D) Absolute levels of Kyn and Trp and Kyn / Trp ratio in serum of WT mice injected with MLL / AF9 cells and treated with either vehicle (n=6) or 1.6 g / kg ad libitum epacadostat diet (n=9). (E) In vivo leukemia burden quantification in mice from (D). (F) Absolute levels of Kyn and Trp in serum of NSGS mice transplanted with either healthy CD34+ cells (n=11) or patient-derived AML cells (n=27). (G) Multivariate data plot of SAA3, Kyn / Trp ratio serum levels and transplant disease in NSGS mice transplanted with CD34+ healthy cells (n=11) or patient-derived AML cells (n=27), showing Pearson correlation values for Kyn / Trp ratio and SAA3 serum levels. (H) AML burden in BM aspirates from PDX in NSGS mice at randomization (3 weeks; vehicle n=8, epacadostat n=10). (I) Kyn and Trp levels in serum of PDX mice harvested 5 weeks after transplantation and 12 days after epacadostat treatment (n=8 vehicle, n=10 epacadostat). (J) AML burden in BM aspirates of PDX NSG mice 8 weeks after transplantation at the time of randomization (n=5 for all groups). (K) Kyn / Trp ratio serum levels in all mice before treatment (n=20) and after 3 weeks of epacadostat diet (n=7). All data are expressed as mean ± SEM. Statistical analysis was performed using unpaired t-test unless otherwise stated.
[0186] [Example 30] Inhibition assay of SAA1 proliferation Monoclonal antibodies will be prepared against SAA1 using standard hybridoma techniques. Supernatants of potential clones will be tested for their blocking ability in a luciferase reporter assay. To optimize the initial assay, stable mouse macrophage RAW 264.7 NFkB-Luc cells will be exposed to SAA1 in a dose-responsive and time-dependent manner. After determining the optimal dose of positive control (lipopolysaccharide, LPS), the duration of anti-SAA1 and cells will be treated with the dosed antibody subclones to assess their ability to block LPS and / or SAA1 NFkB activation.
[0187] Cell proliferation was performed using Cell Counting Kit 8 (WST-8, Abcam) according to the manufacturer's instructions. Briefly, 0.03 × 10 6 Cells are seeded in their corresponding medium (100 μl) on tissue culture clear bottom microplates (Corning). Where indicated, cells are treated with the indicated compounds for the indicated time points. 10 μl / well of WST-8 solution is added and after 2 h of incubation at 37 °C, absorbance is measured at 460 nm. For each experiment, the absorbance of blank wells (growth medium and vehicle / treated) is subtracted from the values of those wells containing cells. For in vitro, the indicated cell lines are incubated in reduced serum medium and exposed to SAA1 (1 μg / ml) or SAA1 + anti-SAA1 monoclonal antibody for 24-72 h as indicated.
[0188] Ex vivo xenografts (healthy CD34 + Vs. patient-derived AML: Whole BM from NSGS mice was depleted of mouse cells using mouse CD45 magnetic beads (Miltenyi Biotec catalog number 130-052-301, RRID:AB_2877061), corresponding to the passively selected human cells used.
[0189] Ex vivo primary AML and MDS patient samples: MNCs from fresh aspirates of BM patients are isolated and depleted from mature hematopoietic cells as previously described (lineage Cell Depletion Kit, Miltenyi Biotec Cat. No. 130-092-211). Isolated cells are seeded in StemMACS HSC Expansion Media XF (Miltenyi Biotec, Cat. Nos. 130-100-463 and 130-100-843) supplemented with StemMACS HSC Expansion Cocktail and treated with either vehicle (PBS) or SAA1 (5 μg / ml).
[0190] Monoclonal anti-SAA1 inhibits SAA1 proliferation in leukemia cells in a dose-dependent manner. Specifically, blocking anti-SAA1 antibodies show 1) anti-proliferative effects specific to targeted leukemia cells (i.e., not affecting healthy controls), 2) broad applicability (not limited to the mutational landscape), and 3) relapse prevention through disruption of the AML niche crosstalk hijacked by leukemia to grow.
[0191] statistical analysis Sample size determination for the in vivo experiments was estimated by considering a multifactorial analysis of variance. The minimum number of mice assigned to each treatment group, n=5, would reach a power of 0.85. The type I error probability associated with our test of the null hypothesis was 0.05. Samples and mice were randomly assigned to the different experimental groups. Male and female mice were used. The researchers were not blinded. Blinding during animal experiments was not possible because the mice received specific leukemia injection diet feeding and / or daily treatments. No data were excluded from the study. We ensure that all experiments were reproducible by repeating at least twice, and typically 3-4 times, using different stocks of cell lines, patient or mouse samples and reagents. Every single data point in all figures represents a biological replicate from a separate mouse, a separate experiment (cell line), or, in the case of primary cultures of human or mouse osteoblasts, measurements were performed on independently grown cultures. In the case of human data, each data point corresponds to an independent patient sample. The binding experiments were reproduced by two independent groups at the Department of Psychiatry, Columbia University (Dr. M. Quick) and the Division of Chemical Biology and Medicinal Chemistry, Eshelman School of Pharmacy, University of North Carolina at Chapel Hill (Dr. B. Roth). Details of experimental repetitions can be found in the legends of each figure.
[0192] Statistics: All numerical results are reported as mean ± SEM. Data fitting of binding isotherms was performed using nonlinear regression analysis in GraphPad Prism (RRID: SCR_002798), and best fit values and errors represent the mean and SEM of the fitting. All numerical values used for graphs and detailed statistical analysis can be found in the figure legends and summarized in Table 5. Data were assumed to be normally distributed, so the statistical significance of differences between experimental groups was analyzed primarily using one-way ANOVA, two-way ANOVA, and unpaired t-tests, depending on the number of groups and conditions, unless otherwise stated in the figure legends. Differences were considered statistically significant when p ≤ 0.05 and are denoted as follows: *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001; ****p ≤ 0.0001.
[0193] Values shown in Table 5 are means ± standard error of the mean (SEM). Half-maximal inhibitory concentration (IC50); inhibition constant (Ki); half-maximal effective concentration (EC50); 5-hydroxytryptophan (5-HT); kynurenine (Kyn).
[0194] Data analysis software: All statistical analyses were performed using GraphPad Prism 9 (RRID:SCR_002798) software. In vivo quantification of leukemia progression was performed using Living Image v4.7.2 (Perkin Elmer, RRID:SCR_014247). Confocal images were analyzed using ImageJ (RRID:SCR_003070) software. Analysis of metabolomics data was performed using Matplotlib for Python (RRID:SCR_008624). Flow cytometry data analysis was performed using FlowJo (RRID:SCR_008520) software. CRIPSR editing analysis was performed using Synthego Performance Analysis,ICE Analysis.2019.v2.0.Synthego. Biorender was used to create all figures, cartoons and schematics shown along with the manuscript under the Columbia University academic license. RNAseq data analysis was performed using the following software: STAR 2.7 (RRID: SCR_004463), featurecounts 1.6.5 (RRID: SCR_012919), R 3.6.3, Python 3.7.3 (IPython, RRID: SCR_001658) and GSEApy 0.9.18.
[0195] Data availability: RNA sequencing data generated during this study are publicly available at Gene Expression Omnibus (GEO) under GSE154374 (RRID: SCR_005012). The original / source data for Figure 9A is available in the Protein Data Bank (#6E45, https: / / www.rcsb.org / structure / 6E45). Derived data supporting the findings in Figure 2I are presented in Table 1.
[0196] The foregoing description of specific embodiments sufficiently reveals the general nature of the present disclosure, so that others can easily modify and / or adapt such specific embodiments to various applications without departing from the general concept of the present disclosure by applying knowledge within the skill of the relevant art and without undue experimentation. Such adaptations and modifications are therefore intended to be within the meaning and range of equivalents of the disclosed embodiments, based on the teaching and guidance presented herein. It should be understood that the expressions or terms in this specification are for purposes of explanation rather than limitation, and that the terms or terms in this specification should be interpreted by those skilled in the art in light of the teaching and guidance presented herein, in combination with the knowledge of those skilled in the art. It should be understood that the dimensions described or shown are drawings according to an example, and that other dimensions can be used without departing from the present disclosure.
[0197] The above subject matter is provided for illustrative purposes only and should not be construed as limiting. Various modifications and changes can be made to the subject matter described herein without departing from the true spirit and scope of the invention encompassed by the present disclosure, as defined by the set of enumerations in the following claims and structures and functions or steps equivalent to these enumerations, without following the exemplary embodiments and applications shown and described. [Table 1] TIFF2025503594000003.tif145158 [Table 2] [Table 3] [Table 4] [Table 5] [Table 6]
Table 7
Table 8
Table 9
Claims
1. A pharmaceutical composition for treating leukemia, comprising a therapeutically effective amount of an inhibitor of indoleamine 2,3 dioxygenase.
2. The pharmaceutical composition of claim 1, wherein the leukemia is acute myeloid leukemia or acute lymphocytic leukemia.
3. 2. The pharmaceutical composition of claim 1, wherein the inhibitor comprises indiximod, epacadostat, BMS-986205, navoximod, PF-0684003, KHK2455, or LY3381916, or a combination thereof.
4. 4. The pharmaceutical composition of claim 3, wherein the inhibitor comprises epacadostat.
5. 10. The pharmaceutical composition of claim 1, wherein the pharmaceutical composition is administered orally, intravenously, intramuscularly, topically, intraarterially, or subcutaneously.
6. A pharmaceutical composition for inhibiting indoleamine 2,3 dioxygenase expression, comprising: an engineered, non-naturally occurring clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated (Cas) (CRISPR-Cas) system comprising one or more vectors; 1. A pharmaceutical composition comprising: (a) at least one nucleotide sequence encoding a guide RNA of a CRISPR-Cas system that hybridizes with a nucleotide sequence of exon 3 or 4 encoding indoleamine 2,3 dioxygenase; and (b) a nucleotide sequence encoding a Cas protein.
7. 7. The pharmaceutical composition of claim 6, wherein the Cas protein is Cas9.
8. A pharmaceutical composition for treating leukemia, comprising an effective amount of a modulator of indoleamine 2,3 dioxygenase.
9. 9. The pharmaceutical composition of claim 8, wherein the modulator binds to the enzyme catalytic site of indoleamine 2,3 dioxygenase.
10. 9. The pharmaceutical composition of claim 8, wherein the modulator is a small molecule, a polynucleotide, or an antibody or antigen-binding portion thereof.
11. 11. The pharmaceutical composition of claim 10, wherein the modulator is a nucleic acid selected from the group consisting of single-stranded DNA (ssDNA), double-stranded DNA (dsDNA), donor / template DNA, s cDNA, DNA encoding one or more RNAs, sgRNA, guide RNA (gRNA), prime-editing guide RNA (pegRNA), microRNA (miRNA) inhibitor, miRNA mimic, short interfering RNA (siRNA), small synthetic RNA, synthetic RNA, antisense oligonucleotide, short hairpin RNA (shRNA), double-stranded RNA (dsRNA), antisense RNA, ribozyme, and combinations thereof.
12. 11. The pharmaceutical composition of claim 10, wherein the polynucleotide is a short interfering RNA (siRNA) or an antisense molecule.
13. The pharmaceutical composition of claim 8 , wherein the modulator comprises a CRISPR / Cas system.
14. 14. The pharmaceutical composition of claim 13, wherein the CRISPR-Cas system is in the form of an RNA, a plasmid, or a protein.
15. 9. The pharmaceutical composition of claim 8, wherein the pharmaceutical composition is administered orally, intravenously, intramuscularly, topically, intraarterially, or subcutaneously.
16. A pharmaceutical composition for treating myelodysplastic syndrome, comprising a therapeutically effective amount of an inhibitor of indoleamine 2,3 dioxygenase.
17. 17. The pharmaceutical composition of claim 16, wherein the inhibitor comprises indiximod, epacadostat, BMS-986205, navoximod, PF-0684003, KHK2455, or LY3381916, or a combination thereof.
18. 18. The pharmaceutical composition of claim 17, wherein the inhibitor comprises epacadostat.
19. 17. The pharmaceutical composition of claim 16, wherein the pharmaceutical composition is administered orally, intravenously, intramuscularly, topically, intraarterially, or subcutaneously.
20. A pharmaceutical composition for treating leukemia, comprising a therapeutically effective amount of an inhibitor of serum amyloid A1 (SAA1).
21. 21. The pharmaceutical composition of claim 20, wherein the leukemia is acute myeloid leukemia or acute lymphocytic leukemia.
22. 22. The pharmaceutical composition of claim 21, wherein the inhibitor comprises an anti-SAA1 antibody or an antigen-binding portion thereof, or a combination.
23. 23. The pharmaceutical composition of claim 22, wherein the anti-SAA1 antibody is administered orally, intravenously, intramuscularly, topically, intraarterially, or subcutaneously.
24. A pharmaceutical composition for treating myelodysplastic syndrome, comprising a therapeutically effective amount of an inhibitor of serum amyloid A1 (SAA1).