Compounds for use in the prevention and / or treatment of infections caused by SARS-COV-2

Abstract

The present invention relates to the field of treatment and / or prevention of viral infections caused by SARS-CoV-2. The present invention relates to N-(2(quinolyl)-valyl-O-methylaspartyl-(2,6-difluorophenoxy)methyl ketone, or a pharma- ceutically acceptable salt or solvate thereof, for use in the prophylaxis and / or treatment of viral infections caused by SARS-CoV-2. The present invention also relates to pharmaceutical compositions and kits of elements comprising such compounds for the same use.

Description

[Technical field]

[0001] The present invention is in the field of treatment and / or prevention of viral infections, in particular viral infections caused by SARS-CoV-2.

[0002] Indeed, the present invention relates to a specific compound, N-(2(quinolyl)-valyl-O-methylaspartyl-(2,6-difluorophenoxy)methyl ketone or a pharma- ceutically acceptable salt or solvate thereof, for use in the treatment and / or prevention of infectious diseases caused by SARS-CoV-2, as well as pharmaceutical compositions and kits comprising such compounds. [Background technology]

[0003] Coronaviruses are single-stranded, enveloped RNA viruses that belong to the Coronaviridae family.

[0004] Since the early 2000s, several severe infectious diseases caused by coronaviruses affecting humans have emerged. Indeed, the severe acute respiratory syndrome coronavirus (SARS-CoV) was first identified in China in November 2002, and another coronavirus causing severe and sometimes fatal respiratory tract infections in humans was detected in Saudi Arabia in June 2012 and named the Middle East respiratory syndrome coronavirus (MERS-CoV).

[0005] In December 2019, a major outbreak of pneumonia cases caused by a novel coronavirus emerged in Wuhan, China, and spread rapidly worldwide. The World Health Organization (WHO) first named the corresponding coronavirus 2019-nCOV and then SARS-CoV-2, and named the associated disease coronavirus disease 2019 (COVID-19). The disease spread rapidly worldwide, so WHO declared it a pandemic on March 11, 2020.

[0006] At the level of genome sequence, SARS-CoV-2, the first identified virus, shows approximately 80% nucleotide identity with SARS-CoV and 50% with MERS-CoV. Moreover, SARS-CoV-2 is rapidly becoming considered a less severe but more contagious virus than SARS-CoV and MERS-CoV.

[0007] Many people infected with SARS-CoV-2 exhibit mild to moderate respiratory illness with at least one of the following symptoms: fever, headache, muscle pain, fatigue, dry cough, dyspnea, loss of taste, and loss of smell, but recover without the need for special treatment. Nevertheless, older people and those in whom COVID-19 is associated with other medical diseases or problems, such as obesity, cardiovascular disease, diabetes, chronic respiratory disease, and cancer, may develop severe illness. In these cases, the illness may progress to pneumonia, also known as COVID-19-associated pneumonia or COVID-19 pneumonia, and / or multiple organ failure. Complications of COVID-19 may include acute respiratory distress syndrome (ARDS), acute respiratory failure, and liver or cardiac damage.

[0008] For these reasons, numerous companies and public research institutes are attempting to identify antiviral compounds that can prevent and / or treat infections caused by SARS-CoV-2.

[0009] The inventors have already proposed N-(2(quinolyl)-valyl-glutamyl(2,6-difluorophenoxy)methyl ketone as a potential anti-SARS-CoV-2 compound in WO 2006 / 023114. The latter is also known as "QVE-OPh", "Quinolyl-Val-Glu-OPh" or "QVD-OPh negative control". Indeed, QVD-OPh, i.e. N-(2(quinolyl)-valyl-aspartyl-(2,6-difluorophenoxy)methyl ketone, is chemically very close to QVE-OPh, since both compounds differ from each other by the side chain of one amino acid, which is aspartic acid (Asp or D) in QVD-OPh and glutamic acid (Glu or E) in QVE-OPh. With regard to activity, QVD-OPh is a broad caspase inhibitor, whereas QVE-OPh does not show caspase inhibitory activity and is therefore used as its negative control.

[0010] QVD-OPh can also be applied in a methylated form, more specifically in an O-methylated form. In this form, referred to in the present disclosure as QVDM-OPh, the hydrogen atom of the carboxyl group in the aspartic acid side chain is replaced by a methyl group via an esterification reaction. QVD-OPh has already been proposed as an antiviral compound in WO 2014 / 023363. More specifically, experimental data provided in this publication show that QVD-OPh inhibits HIV-infected cells of the apoptotic phenotype due to its caspase inhibitory activity and also inhibits viral replication. The possible anti-HIV activity of QVD-OPh has been confirmed by Laforge et al., 2018 (J. Clin. Invest., vol. 128, pages 1627-1640), where AIDS disease progression has been abrogated in SIV-infected rhesus macaques due to QVD-OPh treatment allowing long-term suppression of viral replication. Nevertheless, no data against other types of viruses are presented either in WO 2014 / 023363 or in Laforge et al., 2018.

[0011] Even though QVE-OPh does not show any caspase inhibitory activity, the inventors have demonstrated in US Pat. No. 5,399,433 that this compound is able to inhibit viral replication, more specifically HIV and SARS-CoV-2 viral replication. In fact, this compound is highly effective in suppressing in vitro infection caused by SARS-CoV-2, by inhibiting replication in cells and by suppressing virus production and new infections, without any toxicity. The experimental data on the anti-SARS-CoV-2 activity of QVE-OPh are only in vitro data. Moreover, it should be noted that this publication compares QVE-OPh with QVD-OPh and QVDM-OPh only in experiments on HIV. [Prior art documents] [Patent documents]

[0012] [Patent Document 1] International Publication No. 2021 / 228846 [Patent Document 2] International Publication No. 2009 / 092897 Summary of the Invention [Problem to be solved by the invention]

[0013] The inventors aim to identify further anti-SARS-CoV-2 compounds with improved properties. [Means for solving the problem]

[0014] With the present invention, the objectives set out by the inventors can be achieved.

[0015] Indeed, the inventors have shown that QVDM-OPh exhibits inhibitory activity against SARS-CoV-2 both in vitro and in vivo. More specifically, the compound is effective in suppressing SARS-CoV-2 infection in vitro by inhibiting viral replication in cells and by abrogating in vitro viral production and new infections without any toxicity. Furthermore, the anti-SARS-CoV-2 activity of QVDM-OPh has been confirmed in vivo in hamsters with COVID-19, where viral replication in the lungs is significantly reduced by QVDM-OPh treatment. At the time of filing this application, it was not at all clear that QVDM-OPh had such activity. Even if QVDM-OPh was described as an anti-HIV and anti-SARS-CoV-2 compound in Patent Document 1, this does not mean that QVDM-OPh, known for its anti-HIV activity, definitely has anti-SARS-CoV-2 activity. Indeed, on the one hand, HIV and SARS-CoV-2 belong to two very different types of viruses, namely retroviruses and coronaviruses, and, on the other hand, QVD-OPh and QVDM-OPh are defined as limited spectrum antiviral agents (page 6, lines 8-10 of patent document 1).

[0016] Even more surprisingly, there was no indication that QVDM-OPh could exhibit stronger anti-SARS-CoV-2 activity than QVD-OPh, as shown in Example 1 below (Figures 5 and 9) for inhibition of virus production and new infections. Regarding the difference between QVD-OPh and QVDM-OPh, Patent Document 2 describes that non-O-methylated compounds are less hydrophobic, which facilitates their use in aqueous media (paragraph

[0057] ), and that QVD-OPh is less stable than QVDM-OPh (paragraph

[0068] ). However, the difference in antiviral activity was not mentioned or suggested in the prior art. In particular, in Patent Document 1 (page 30, lines 24-32), the same antiviral effect against HIV viral replication is observed for QVE-OPh, QVD-OPh, and QVDM-OPh.

[0017] Furthermore, the inventors showed that in vivo in COVID-19-affected hamsters, QVDM-OPh exhibited stronger anti-SARS-Cov-2 activity than QVE-OPh, as confirmed by comparison of the levels of viral load and viral replication in the lungs (Figure 10).

[0018] The present invention therefore relates to a compound of formula (I) for use in the prevention and / or treatment of a viral infection caused by SARS-CoV-2 [ka] or a pharma- ceutically acceptable salt or solvate thereof.

[0019] The chemical name of the compound of formula (I) is N-(2(quinolyl)-valyl-O-methylaspartyl-(2,6-difluorophenoxy)methyl ketone, i.e., QVDM-OPh, which is the O-methylated form of QVD-OPh. The compound of formula (I) is a pan-caspase inhibitor, commercially available from Avantor® and provided by VWR under the references BIOV2787-1 and BIOV2787-5.

[0020] The expression "pharmaceutical acceptable salt" of a compound of formula (I) means a salt that is pharmaceutical acceptable and has substantially similar biological activity compared to the biological activity of the compound of formula (I), i.e. compared to the anti-SARS-CoV-2 activity of the compound of formula (I). It is clear that the pharmaceutical acceptable salt of the compound of formula (I) is non-toxic. Typically, the pharmaceutical acceptable salt applied in the present invention is any acid addition salt obtained from the compound of formula (I). The acid addition salt can be an inorganic acid addition salt or an organic acid addition salt. Illustrative non-limiting examples of such acid addition salts can include hydrochloride, chloride, hydrobromide, bromide, phosphate, hydrogen phosphate, dihydrogen phosphate, sulfate, hydrogen sulfate, borate, acetate, bitartrate, carbonate, citrate, formate, lactate, nitrate, oxalate, stearate, and succinate. More specifically, the pharma- ceutically acceptable salt of the compound of formula (I) applied in the present invention is the hydrochloride salt, which can be obtained by using hydrogen chloride, which can form a complex with at least one nitrogen atom of the compound of formula (I).

[0021] The expression "a pharma- ceutically acceptable solvate" of a compound of formula (I) refers to a molecular complex comprising a compound of formula (I) and a stoichiometric or substoichiometric amount of one or more pharma- ceutically acceptable solvent molecules, such as ethanol or water. The term "hydrate" refers to when the aforementioned solvent is water.

[0022] Pharmaceutically acceptable salts or solvates of the compounds of formula (I) may be prepared by techniques well known in the art, such as, for example, techniques involving precipitation, filtration, crystallization, evaporation, lyophilization, and / or ion exchange resins.

[0023] The compounds applied in the present invention, or any pharma- ceutically acceptable salts or solvates thereof, are used for the prophylaxis and / or treatment of viral infections caused by SARS-CoV-2.

[0024] As used herein, the terms "treat," "treating," and "treatment" are meant to include alleviating, reducing, or suppressing a condition or disease, particularly a viral infection caused by SARS-CoV-2, and / or signs, symptoms, and / or complications associated therewith. Signs or symptoms associated with a condition or disease may be biochemical, cellular, histological, functional or physical, subjective or objective. Complications associated with a condition or disease, particularly a viral infection caused by SARS-CoV-2, may be COVID-19 pneumonia, acute respiratory distress syndrome (ARDS), acute respiratory failure, and liver or cardiac damage.

[0025] As used herein, the terms "prevent," "preventing," and "prevention" are meant to include not only delaying or preventing the onset of a condition or disease, particularly a viral infection caused by SARS-CoV-2, and / or signs, symptoms, and / or complications associated therewith, but also preventing a patient from contracting a condition or disease, particularly a viral infection caused by SARS-CoV-2, or reducing the risk that a patient will contract a condition or disease, particularly a viral infection caused by SARS-CoV-2.

[0026] As used herein, the term "SARS-CoV-2" is understood to refer to the originally identified SARS-CoV-2 as well as any variants or mutants thereof. The originally identified SARS-CoV-2 was the first virus strain discovered, the latter also known as 2019-nCoV, HCoV-19, SARS2, COVID-19 virus, Wuhan coronavirus, Wuhan Seafood Market Pneumonia Virus, and Human Coronavirus 2019. The entire genome (29903bp ss-RNA) of this coronavirus is available on the NCBI (National Center for Biotechnology Information) website at https: / / www.ncbi.nlm.nih.gov / as reference sequence NC_045512.2.

[0027] The "mutant or variant" of the initially identified SARS-CoV-2 may be any mutant or variant already identified in at least some countries, such as the alpha variant (also known as variant B.1.1.7), beta variant (also known as variant B.1.351), gamma variant (also known as variant P.1), delta variant (also known as variant B.1.617.2), and omicron variant (also known as variant B.1.1.529) and its sublineages (also known as variants BA.1, BA.2, BA.3, BA.4 and BA.5). The "mutant or variant" of the initially identified SARS-CoV-2 may also include any mutant or variant whose whole genome shows at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or even at least 99% identity to the reference sequence NC_045512.2.

[0028] As used herein, the expression "percent identity between two nucleotide sequences" refers to the percentage of identical nucleotide residues between the two sequences compared, and this percentage is obtained after performing the best alignment (optimal alignment) between both sequences.The person skilled in the art knows various techniques that allow to obtain such a percent identity and involve homology algorithms or computer programs such as BLAST programs.

[0029] The percent identity is statistical, and the differences between the two sequences are randomly distributed along the sequences. The differences between the two sequences can consist of various types of sequence modifications, such as deletions, substitutions, or additions of nucleotide residues.

[0030] The compound applied in the present invention, or any pharma- ceutically acceptable salt or solvate thereof, can be formulated as a pharmaceutical composition.Accordingly, the present invention also relates to a pharmaceutical composition comprising as an active ingredient a compound of formula (I) or a pharma-ceutically acceptable salt or solvate thereof, as defined above, for use in the prevention and / or treatment of viral infections caused by SARS-CoV-2.

[0031] Typically, the pharmaceutical compositions applied in the present invention further comprise at least one pharma- ceutically acceptable vehicle.

[0032] As used herein, the expression "pharmaceutical acceptable vehicle" refers to any substance added to the active ingredient applied in the present invention to facilitate transport, avoid substantial degradation in the above-mentioned composition, and / or increase half-life. Advantageously, such pharmaceutical acceptable vehicle refers to molecular entities and compositions that are sterile and non-pyrogenic and, where appropriate, do not produce harmful, allergic, or other undesirable reactions when administered to animals, particularly mammals, especially humans. It is selected depending on the type of application of the pharmaceutical composition of the present invention, and in particular depending on its method of administration. Advantageously, pharmaceutical acceptable vehicle refers to any kind of non-toxic solid, semi-solid, or liquid carrier, filler, diluent, additive, excipient, buffer, encapsulating material, or formulation auxiliary.

[0033] The pharmaceutical composition applied in the present invention can be administered by systemic route, parenteral route, such as intravenous, intraarterial, intraperitoneal, intrathecal, intraventricular, intrasternal, intracranial, intramuscular or subcutaneous route, topical route, ocular route, oral route, and mucosal route, such as oral, nasal, intranasal, rectal and vaginal route.

[0034] As solid pharmaceutical compositions for oral administration applied in the present invention, tablets, pills, powders, granules, or capsules can be used, in which the active ingredient is mixed with one or more conventionally used inert diluents, such as starch, calcium carbonate, sucrose, lactose, or gelatin, and optionally other substances such as lubricants, colorants, or coatings, which may be magnesium stearate or talc.

[0035] As the liquid pharmaceutical composition for oral or ocular administration applied in the present invention, pharma- ceutically acceptable suspensions, solutions, emulsions, and syrups containing conventionally used inert diluents and, in some cases, other substances such as wetting agents, humectants, sweeteners, flavors, preservatives, or thickeners can be used.

[0036] The sterile pharmaceutical composition for parenteral administration applied in the present invention can be a sterile aqueous or non-aqueous solution, suspension, or emulsion.As a solvent or vehicle, water, propylene glycol, polyethylene glycol, vegetable oil, injection ester such as ethyl oleate, or other suitable organic solvent can be used.This composition can also contain adjuvants such as wetting agents, isotonicity agents, or emulsifiers.

[0037] The pharmaceutical compositions for topical administration applied in the present invention can be, for example, creams, lotions, oral sprays, nasal or eye drops, or aerosols.

[0038] In certain embodiments, the pharmaceutical composition applied in the present invention further comprises at least one additional therapeutic agent.

[0039] Thus, the pharmaceutical composition applied in the present invention comprises or consists of (i) a compound of formula (I) as defined above or a pharma- ceutically acceptable salt or solvate thereof, (ii) at least one pharma- ceutically acceptable vehicle, and optionally (iii) at least one further therapeutic agent. In particular, the pharmaceutical composition applied in the present invention comprises or consists of (i) a compound of formula (I) as defined above or a pharma- ceutically acceptable salt or solvate thereof, (ii) at least one pharma- ceutically acceptable vehicle, and (iii) at least one further therapeutic agent.

[0040] Typically, the further therapeutic agent present in the pharmaceutical composition applied in the present invention may be a therapeutic agent already used for the prevention and / or treatment of a viral infection caused by SARS-CoV-2, as well as a therapeutic agent already used for the prevention and / or treatment of symptoms or complications arising in a viral infection caused by SARS-CoV-2. Advantageously, the further therapeutic agent present in the pharmaceutical composition applied in the present invention is selected in the group consisting of antiviral agents, anti-inflammatory agents, analgesics, muscle relaxants, anesthetics, diuretics, and antibiotics.

[0041] It is clear that when the pharmaceutical composition applied in the present invention comprises at least one further therapeutic agent which is at least one antiviral agent, said at least one further antiviral agent is different from the compound of formula (I) or a pharma- ceutically acceptable salt or solvate thereof.

[0042] A first example of an antiviral agent that can be used in the present invention is QVE-OPh or a pharma- ceutically acceptable salt or solvate thereof, in particular as disclosed in WO 02 / 04393. What has already been disclosed for the pharma- ceutically acceptable salts or solvates of QVDM-OPh also applies mutatis mutandis to the pharma- ceutically acceptable salts or solvates of QVE-OPh. In other words, the at least one further therapeutic agent in the pharmaceutical composition applied in the present invention may be N-(2(quinolyl)-valyl-glutamyl-(2,6-difluorophenoxy)methyl ketone or a pharma- ceutically acceptable salt or solvate thereof.

[0043] Other antiviral agents that can be used in the present invention include viral RNA-dependent RNA polymerase modifiers, such as nucleotide analogues and fusion inhibitors. The latter prevent the fusion of the SARS-CoV-2 envelope with the cell membrane and the entry of SARS-CoV-2 into the cell. Advantageously, the fusion inhibitor is a serine / protease inhibitor, an inhibitor of angiotensin-converting enzyme 2 (ACE2), or an antimalarial / parasiticide. Thus, the fusion inhibitors that can be used in the present invention are selected from the group consisting of remdesivir, camostat mesilate, nafamostat mesilate, chloroquine phosphate, hydroxychloroquine, cepharanthine, selamectin, and salts thereof, such as mefloquine and mefloquine hydrochloride.

[0044] The anti-inflammatory agent that can be used in the present invention can include monoclonal antibodies. The latter are preferably directed against inflammatory interleukins and their receptors, such as IL-6 and its receptor. Thus, the monoclonal antibodies that can be used in the present invention are selected from the group consisting of tocilizumab, sarilumab, and siltuximab.

[0045] Alternatively, or in addition, the further therapeutic agent present in the pharmaceutical composition applied in the present invention is selected in the group consisting of cisatracurium besylate, dexamethasone sodium phosphate, dexmedetomidine hydrochloride, fentanyl citrate, furosemide, hydromorphone hydrochloride, ketamine hydrochloride, lorazepam, midazolam hydrochloride, morphine sulfate, norepinephrine bitartrate, rocuronium bromide, vancomycin hydrochloride, and vecuronium bromide.

[0046] In a particular embodiment, the pharmaceutical composition applied in the present invention comprises at least two or at least three further therapeutic agents selected in the same or different lists among the previously defined lists.

[0047] In a further particular embodiment, the pharmaceutical composition applied in the present invention comprises or consists of (i) a compound of formula (I) as defined hereinbefore or a pharma- ceutically acceptable salt or solvate thereof, (ii) at least one pharma- ceutically acceptable vehicle, (iii1) at least one further antiviral agent, such as those defined hereinbefore, and (iii2) at least one anti-inflammatory agent, such as those defined hereinbefore.

[0048] The dosage of the pharmaceutical composition applied in the present invention must be a pharmacologic effective amount. "Pharmaceutical effective amount" means an amount sufficient to prevent or treat a disease with a suitable benefit / risk ratio applicable to medical treatment, and the level of the effective amount can be selected by those skilled in the art according to factors such as, for example, the formulation method, the patient's condition including weight, sex, and age, the degree of disease, the form of the drug, the route of administration, the administration period when a single or divided dose is applied in this administration, excretion rate, and reaction sensitivity. As those skilled in the art will recognize, the effective amount can vary depending on the route of administration, the use of excipients, and the possibility of use with other therapeutic agents.

[0049] The present invention also provides a method for the prevention and / or treatment of a viral infection caused by SARS-CoV-2, comprising: (a) a compound of formula (I) as hereinbefore defined, or a pharma- ceutically acceptable salt or solvate thereof, or a pharmaceutical composition comprising same; (b) at least one further therapeutic agent, in particular as defined hereinbefore, or a pharmaceutical composition comprising at least one further therapeutic agent.

[0050] What has already been disclosed for pharmaceutical compositions comprising a compound of formula (I) or a pharma- ceutically acceptable salt or solvate thereof also applies mutatis mutandis to pharmaceutical compositions comprising at least one further therapeutic agent.

[0051] A kit of parts may also be defined as a combination of components (a) and (b) as described above.

[0052] Such kits of elements are of particular interest in the present invention when the compound of formula (I) or a pharma- ceutically acceptable salt or solvate thereof and the at least one further therapeutic agent cannot be formulated in the same pharmaceutical composition and / or when the compound of formula (I) or a pharma- ceutically acceptable salt or solvate thereof, or a pharmaceutical composition comprising same, and the at least one further therapeutic agent or a pharmaceutical composition comprising same are administered separately or sequentially.

[0053] Thus, the kit of elements as applied in the present invention can be used together, separately or sequentially for the prevention and / or treatment of viral infections, in particular those caused by SARS-CoV-2.

[0054] As used herein, use together means that component (a) as defined above is administered to a patient at the same time as component (b) as defined above. The site of administration at the patient level, and therefore the route of administration, may be the same or may be different.

[0055] As used herein, separate or sequential use means that components (a) and (b) as defined above are administered separately or sequentially, when the period during which component (a) exerts a pharmacological effect on the patient and the period during which component (b) exerts a pharmacological effect on the patient at least partially intersect.

[0056] As used herein, "patient," "patient in need," "subject," and "subject in need" refer to either a subject at risk of developing a viral infection caused by SARS-CoV-2 or a subject already contaminated with SARS-CoV-2. The subject may be a non-human animal or a human. Contamination can be confirmed by detection of SARS-CoV-2 proteins or antibodies specific for SARS-CoV-2 in a sample from the subject, such as a saliva, blood, or nasopharyngeal sample. Patients contaminated with SARS-CoV-2 may be symptomatic, microsymptomatic, or asymptomatic. A subject in need may also be a subject experiencing medium and long-term effects after recovering from the initial illness. These medium and long-term effects are referred to as the "post-COVID-19 state" or "long COVID," specifically "Neuro-Long COVID."

[0057] Furthermore, the compound of formula (I) or a pharma- ceutically acceptable salt or solvate thereof for use as defined above, the pharmaceutical composition for use as defined above, and / or the kit of elements for use as defined above are applied for use in the abrogation, inhibition, and / or reduction of viral replication and / or viral protein synthesis in a subject infected with SARS-CoV-2. In this embodiment, the subject may also be a non-human animal or a human. The abrogation or inhibition of viral replication and / or viral protein synthesis may be either partial or total.

[0058] As used herein, the term "viral replication" includes all steps of the viral replication cycle. In particular, this expression includes the main steps of SARS-CoV-2 replication, including virus entry into cells, formation of viral replication and transcription complexes, viral genome RNA replication, transcription and translation of negative templates to form structural proteins, and assembly of viral particles.

[0059] The ability of a compound of formula (I) or a pharma- ceutically acceptable salt or solvate thereof, a pharmaceutical composition, or a kit of elements as defined above to abrogate, inhibit, and / or reduce viral replication and / or viral protein synthesis can be evaluated, for example, in vitro. Example 1 below suggests techniques for this evaluation, including Western blot and qRT-PCR analysis.

[0060] Furthermore, the compound of formula (I) or a pharma- ceutically acceptable salt or solvate thereof for use as hereinbefore defined, the pharmaceutical composition for use as hereinbefore defined, and / or the kit of elements for use as hereinbefore defined are applied for use in the prophylaxis of COVID-19 complications such as COVID-19 pneumonia, acute respiratory distress syndrome (ARDS), acute respiratory failure, and liver or cardiac damage.

[0061] The present invention relates to a method for preventing and / or treating a viral infection caused by SARS-CoV-2 in a patient in need of such prevention and / or treatment, comprising the step of administering to a patient in need of such prevention and / or treatment a compound of formula (I) as defined previously or a pharma- ceutically acceptable salt or solvate thereof, a pharmaceutical composition as defined previously or a kit of elements as defined previously.

[0062] As already disclosed for the pharmaceutical compositions, the compound of formula (I) or a pharma- ceutically acceptable salt or solvate thereof, and components (a) and (b) of the kit of elements, may be administered by systemic routes, by parenteral routes, such as intravenous, intraarterial, intraperitoneal, intrathecal, intraventricular, intrasternal, intracranial, intramuscular, or subcutaneous routes, by topical routes, by ocular routes, by oral routes, and by mucosal routes, such as oral, nasal, intranasal, rectal, and vaginal routes.

[0063] Moreover, as already disclosed for the pharmaceutical composition, the compound of formula (I) or a pharma- ceutically acceptable salt or solvate thereof, and components (a) and (b) of the kit of elements are administered in pharma- ceutical effective amounts. The definitions given above for the pharmaceutical composition also apply mutatis mutandis to the compound of formula (I) or a pharma- ceutically acceptable salt or solvate thereof, and components (a) and (b) of the kit of elements.

[0064] In certain embodiments, this method of prevention and / or treatment can be applied to abrogate, inhibit, and / or reduce viral replication and / or viral protein synthesis in a subject infected with SARS-CoV-2.

[0065] In other specific embodiments, this method of prevention and / or treatment can be applied to prevent complications of COVID-19, such as COVID-19 pneumonia, acute respiratory distress syndrome (ARDS), acute respiratory failure, and liver or cardiac damage, particularly in patients in need of prevention and / or treatment, more particularly in subjects infected with SARS-CoV-2.

[0066] Other characteristics and advantages of the present invention will become more apparent to those skilled in the art on reading the following examples, given by way of example and not of limitation, with reference to the attached drawings, in which: [Brief description of the drawings]

[0067] [Figure 1]Figure 1 shows the toxicity test of QVDM-OPh peptide in Vero E6 / TMPRS22 cells. Vero-E6 / TMPRSS2 cells were infected or not with SARS-CoV-2 at MOI 0.05, incubated with various concentrations of QVDM-OPh at 25, 50, and 100 M concentrations on each day and harvested after 72 hours. Cells were washed twice with PBS and stained with viability fixative dye for 30 min at 4°C, then washed, fixed with 2% paraformaldehyde (PFA) and analyzed on a Fortessa flux cytometer. 30,000 events were recorded in triplicate for each condition. Analysis was performed using FlowJo software and the percentage of survival was calculated according to the analysis report. Results represent the mean + / - SD of four independent experiments with three independent points for each condition separately. [Diagram 2]Figure 2 shows the effect of QVDM-OPh peptide on infection and mortality induced by SARS-CoV-2 in full treatment conditions. Flow cytometry analysis for intracellular detection of Sars-CoV-2 spike (S) protein expression in infected cells treated or not with various compounds. (A) Vero-E6 / TMPRSS2 cells uninfected or infected with SARS-CoV-2 at an MOI of 0.05 were incubated with various concentrations of QVDM-OPh (10, 25, 50, 100 μM), Vx765 (25 μM), or Remdesivir (10 μM) for 1 h prior to infection. Cells were then cultured in drug-containing medium until the end of the experiment without removing the virus from the culture (full treatment). 72 h after infection, cells were harvested and stained for mortality and infection rate analysis. Percentage of infection is shown in each analysis plot. (B) Results show the percentage of infection detected by spike protein staining in various infected and treated cells compared to the infected and untreated groups. Results represent the mean value + / - SD of four independent experiments with three independent points for each condition separately. Statistical significance was assessed by applying a one-way ANOVA test followed by Dunnett's post-hoc test using GraphPad Prism software (GraphPad Software Inc., USA) (****P<0.0001). [Diagram 3]Figure 3 shows the effect of QVDM-OPh peptide on in vitro viral replication and viral protein expression in full treatment conditions. Western blot analysis for intracellular detection of Sars-CoV-2 spike (S) and nucleocapsid (N) proteins in infected cells treated or not with various compounds. (A-B) Vero E6 / TMRPSS2 cells were pretreated with the indicated concentrations of QVDM-OPh peptide or remdesivir for 1 h before infection with virus at MOI=0.05. Cells were then cultured in drug-containing medium until the end of the experiment (full treatment). Wells containing non-infected cells served as negative control for infection. 72 h after infection, cells were lysed with RIPA buffer and Western blot analysis was performed to detect the expression of spike protein (S), full length and S1 domain, as well as nucleocapsid protein (N). GAPDH was used as a loading control. Results represent the mean ± SD of four independent experiments with three independent points per condition. [Figure 4] Figure 4 shows the effect of QVDM-OPh peptide on in vitro viral replication in full treatment conditions. Intracellular qRT-PCR analysis of Sars-CoV-2 spike (S), nucleocapsid (N), and NSP6 genes in infected cells treated or not with QVDM-OPH. (ABC) Vero E6 / TMRPSS2 cells were pretreated with the indicated concentrations of QVDM-OPH peptide for 1 h before infection with virus at MOI=0.05. Cells were then cultured in drug-containing medium until the end of the experiment (full treatment). Wells containing non-infected cells were used as negative control for infection. 72 h after infection, cells were lysed in LBP buffer for RNA purification and RT-qPCR analysis was performed to detect gene expression of spike protein (S), nucleocapsid protein (N), and NSP6. Relative mRNA abundance of each gene was normalized to the mRNA expression of GAPDH. Fold changes were calculated using the ΔΔCt method. Results represent the mean ± SD of four independent experiments with three independent points per condition. [Diagram 5] Figure 5 shows the antiviral activity of QVDM-OPh peptide against SARS-CoV-2 in vitro in full treatment conditions. The amount of virus in the infected cell supernatant was quantified by qRT-PCR. (AB) Vero E6 / TMRPSS2 cells were pretreated for 1 h with the indicated concentrations of QVD-OPh (QVD), QVDM-OPh (QVDM), or remdesivir and then infected with virus at an MOI of 0.05. Wells containing uninfected cells were used as negative controls for infection. Cells were then cultured in drug-containing medium until the end of the experiment (full treatment). Supernatants were harvested 72 h after infection and viral RNA was extracted. Real-time PCR analysis was performed on the supernatants using probes against either the N or NSP6 gene of SARS-CoV-2. Results represent the mean + SEM (n = 3). Comparison of differences between means was examined using one-way ANOVA test followed by Dunnett's post hoc test. ***p<0.001 when compared with untreated group. [Figure 6] Figure 6 shows the effect of QVDM-OPh peptide on infection and mortality induced by SARS-CoV-2 in post-entry treatment conditions. Flow cytometry analysis for detection of Sars-CoV-2 spike (S) protein expression in infected cells treated or not with various compounds. (A) Vero E6 / TMPRSS2 were infected with virus at an MOI of 0.05 for 2 hours, after which the virus was removed from the medium. Cells were then incubated (post-entry) with various concentrations of QVDM-OPh (10, 25, 50, and 100 μM), Vx765 (25 μM), or Remdesivir (10 μM) for 72 hours. Drugs were added daily in the medium at various concentrations until the end of the experiment. After 72 hours of infection, cells were harvested and stained for mortality and infection rate analysis. Percentage of infection is shown in each analysis plot. (B) Results represent the mean + SEM of percent inhibition of spike protein staining expression compared to untreated control group (n=3). [Figure 7]Figure 7 shows the effect of QVDM-OPh peptide on in vitro viral replication and viral protein expression in post-entry treatment conditions. Western blot analysis for intracellular detection of Sars-CoV-2 spike (S) and nucleocapsid (N) proteins in infected cells treated or not with various compounds. (AB) Vero E6 / TMPRSS2 cells were infected and then treated with the indicated concentrations of QVDM-OPh or remdesivir in the same conditions as described in Figure 6. Wells containing non-infected cells were used as negative control for infection. 72 hours after infection, cells were lysed with RIPA buffer and Western blot analysis was performed to detect the expression of spike protein (S), full length and S1 domain, and nucleocapsid protein (N). GAPDH was used as a loading control. Results represent the mean ± SD of four independent experiments with three independent points per condition. [Figure 8] Figure 8 shows the effect of QVDM-OPh peptide on in vitro viral replication in post-entry treatment conditions. Intracellular qRT-PCR analysis of Sars-CoV-2 spike (S), nucleocapsid (N), and NSP6 genes in infected cells treated or not with QVDM-OPh. (ABC) Vero E6 / TMPRSS2 cells were infected with virus at an MOI of 0.05 for 2 h, after which the virus was removed from the medium. Cells were then incubated with various concentrations of QVDM-OPh for 72 h (post-entry). Drugs were added daily in the medium at various concentrations until the end of the experiment. Wells containing non-infected cells were used as negative controls for infection. After 72 h of infection, cells were lysed in LBP buffer for RNA purification and RT-qPCR analysis was performed to detect gene expression of spike protein (S), nucleocapsid protein (N), and NSP6. The relative mRNA abundance of each gene was normalized to the mRNA expression of GAPDH. Fold changes were calculated using the ΔΔCt method. Results represent the mean ± SD of four independent experiments with three independent points per condition. [Figure 9]Figure 9 shows the antiviral activity of QVDM-OPh peptide against SARS-CoV-2 in vitro in post-entry treatment conditions. The amount of virus in the infected cell supernatant was quantified by qRT-PCR. (AB) Vero E6 / TMPRSS2 cells were infected with virus at an MOI of 0.05 for 2 h, after which the virus was removed from the medium. Cells were then incubated (post-entry) with various concentrations of QVD-OPh (QVD), QVDM-OPh (QVDM), or remdesivir, where indicated. Drugs were added daily in various concentrations of medium until the end of the experiment. Wells containing non-infected cells served as negative controls for infection. Supernatants were collected 72 h after infection and viral RNA was extracted. Real-time PCR analysis was performed on the supernatants using probes against either the N or NSP6 gene of SARS-CoV-2. Results represent the mean + SEM (n = 3). Comparison of differences between mean values ​​was performed using one-way ANOVA followed by Dunnett's post-hoc test. ***p<0.001 when compared with the untreated group. [Figure 10]Figure 10 shows the effect of QVDM-OPh and QVE-OPh against SARS-CoV-2 in the COVID-19 Golden Syrian Hamster model. Golden Syrian hamsters were randomized on D-3 and inoculated with SARS-CoV-2 at 105 pfu TCID50 per animal. All groups were administered SARS-CoV-2 via the intranasal (IN) route on day 0 (D0). QVDM-OPh and QVD-OPh peptides or vehicle were administered via the intraperitoneal (IP) route on D0 in a total volume of 10 mL / kg per inoculation time point. Test products were inoculated on day 0 (t+1 hours) and day 1. Day 2 (D2) was the last day of the study. (A) Average body weight change curves (vs. D0) between vehicle, QVE-OPH, and QVDM-OPH treated animal groups on D0, D1, and D2 post-infection are shown. (B) Viral RNA expression levels (mean + SD) in lungs of golden Syrian hamsters inoculated with SARS-CoV-2 at 2 dpi, n=5 per point. Results are shown as 2-ΔCT. Mann-Whitney test comparing infected animals to sham (A) is shown. *P<0.05, **P<0.01. (C) Percentage of reduction in viral replication at 2 dpi in lungs from golden Syrian hamsters inoculated with SARS-CoV-2 and treated with QVE-OPH or QVDM-OPH compared to vehicle. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS EXAMPLES

[0068] Example 1 material and method Cells, viruses, and drugs The African green monkey kidney Vero E6 / TMPRSS2 cell line was kindly provided by Dr. Andreola Marie-Aline, University of Bordeaux, and maintained in Eagle's medium (Dulbecco's modified Eagle's medium, Gibco Invitrogen, supplemented with 10% heat-inactivated FBS, 1% PS (penicillin 10,000 U / ml, streptomycin 10,000 μg / ml) (Gibco Invitrogen)) at 37 °C in a humidified atmosphere of 5% CO2. The BetaCoV / France / IDF0372 / 2020 strain was provided by the Institut Pasteur (Paris, France) and supplied by the National Reference Centre for Respiratory Viruses, headed by Prof. Sylvie van der Werf. The human sample from which the BetaCoV / France / IDF0372 / 2020 strain was isolated was kindly provided by Dr. X. Lescure and Prof. Y. Yazdanpanah, Bichat Hospital, Paris, France. In addition, the BetaCoV / France / IDF0372 / 2020 strain was provided through the European Virus Archive goes Global (Evag) platform, a project funded by the European Union's Horizon 2020 research and innovation program under grant number 653316. Viral stocks were generated in Vero-E6 cells infected at a multiplicity of infection of 1 × 10-4 PFU. Virus was harvested 3 days after infection, clarified, and then aliquoted before storage at -80 °C. Viral stocks were titrated in Vero-E6 cells by conventional plaque assay using a semi-solid overlay (Avicel, RC581-NFDR080I, DuPont). All infection experiments were performed in a biosafety level 3 (BLS-3) laboratory at the Cordelier Research Center (CRC). Pan-caspase inhibitors, Q-VD(OME)-OPH, also known as QVDM-OPH (catalog no. BIOV2787-5), and QVE-OPH, were purchased from Avantor-VWR and Hello Bio.Remdesivir was purchased from COGER (catalog number AG--CR1-3713-M005), and the caspase-1 inhibitor Vx765 (catalog number BIOV2781-5) was purchased from Avantor-VWR.

[0069] Assessment of antiviral activity, toxicity, and infection inhibition To evaluate the toxicity and antiviral effect of QVDM-OPh in Vero E6 cells, the percentage of death and the percentage of infected cells were measured by flow cytometry. 4The cells were cultured overnight in 24-well cell culture Petri dishes at a density of 1000 cells / well. The next day, the cells were pretreated for 1 hour with various concentrations of the indicated QVDM-OPh, Vx765, or Remdesivir at various doses, or not. Then, the virus was added at an MOI of 0.05 and infected at 250 μl / well for 2 hours. Then, complete medium was added to the cell culture to a final volume of 500 μl / well. The drugs were added to the cell culture at the same concentration each day. 72 hours after infection, the cell supernatant was collected and immediately frozen at -80°C for virus extraction and qRT-PCR amplification. Cells were harvested and a portion was used for flow cytometry analysis to measure infection rates using intracellular staining against spike protein (SARS-CoV-2 Spike Protein-Alexa647, Cat. No. 51-6490-82, eBioscience) and Cytofix / cytoperm fixation permeabilization kit (Cat. No. 554714, BD) according to the manufacturer's instructions. Viability405 / 452 fixation dye (Cat. No. 130-109-814, Miltenyi Biotec) was used to analyze toxicity according to the manufacturer's instructions. Briefly, cells were washed twice with PBS and then subjected to viability fixation dye staining for 30 min at 4°C. Cells were then permeabilized with Cytofix / cytoperm buffer for 20 min and washed twice with permawash buffer, after which anti-spike-Alexa647 was added to the cells for 30 min at 4°C. After staining, cells were fixed with 2% paraformaldehyde (FPA) and then analyzed on a Fortessa flow cytometer. 30,000 events were recorded in triplicate for each condition. Analysis was performed using FlowJo software. The other part of the cells was lysed in RIPA lysis buffer (Invitrogen, Cat. No. 10230544) containing protease (Roche) and phosphatase inhibitors (Invitrogen) for further quantification and immunoblotting analysis, or in LBP buffer for RNA purification and RT-qPCR analysis. Each condition was performed in triplicate (n=3) in the same experiment and repeated four independent experiments.

[0070] Addition time experiment QVDM-OPh (10, 25, 50, and 100 μM), Vx765 (25 μM), and remdesivir (5 and 10 μM) were used for time-of-addition experiments. Vero E6 cells (75 × 10 3 Cells / well) were treated with QVDM-OPh, Vx765, and remdesivir at different stages of viral infection. In "full-time" treatment, Vero E6 cells were pretreated with drug for 1 h before viral infection and then incubated with virus in the presence of drug for 2 h until the end of the experiment. In "post-entry" experiments, virus was added to cells and allowed to infect for 2 h, after which the virus-containing supernatant was replaced with drug-containing medium until the end of the experiment.

[0071] RNA extraction and quantitative real-time RT-PCR (qRT-PCR) in Vero E6 / TMPRSS2 cells Viral RNA extraction from supernatant Two hundred microliters of cell culture supernatant was used for viral RNA extraction using the MiniBEST Viral RNA / DNA Extraction Kit (Takara, Catalog No. 9766) according to the manufacturer's instructions. RNA was eluted in 30 μL of ribonuclease-free water.

[0072] Intracellular RNA purification After washing with PBS, cells were lysed with LBP and stored at -80°C. RNA purification was performed using the "Nucleospin RNA PLUS" kit (Machery Nagel, reference number 740984.250) according to the manufacturer's recommended procedures. RNA was eluted in 30 μL of ribonuclease-free water.

[0073] Quantitative real-time RT-PCR (qRT-PCR) Total RNA was converted to cDNA using PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Cat. No. RR047A) according to the manufacturer's recommended procedure. Quantitative PCR was performed using TB Green Premix Ex Taq II (Takara, Cat. No. RR820A). Briefly, each reaction consisted of a total volume of 25 μL, containing 1 μL of each primer [0.4 μM / μL], 2 μl of cDNA (5 ng / μL), 12.5 μl of TB Green Premix Ex Taq II, and 8.5 μL of ribonuclease-free water.

[0074] Real-time PCR was performed using a Bio-Rad CFX384 Real-Time System PCR instrument. Thermal cycling conditions used were initial denaturation at 95°C for 30 s, followed by 40 cycles of 96°C for 5 s and amplification at 60°C for 30 s. Primers used for the SARS-CoV-2 nucleocapsid (N), nonstructural protein 6 (NSP6), and spike (S) genes were designed and described by Abdel-Sater et al., 2021 ("A Rapid and Low-Cost protocol for the detection of B.1.1.7 lineage of SARS-CoV-2 by using SYBR Green-Based RT-qPCR", medRxiv preprint doi:https: / / doi.org / 10.1101 / 2021.01.27.21250048) and purchased from Eurofins. For relative quantification of extracellular viral mRNA, SARS-CoV-2 cDNA (Ct of approximately 20 for N and NSP6 genes) was used as a positive control. Using the ΔCt method, calculated Ct values ​​were converted to fold reduction in treated samples compared to the positive control (fold change in viral RNA = 2^ΔCt).

[0075] For intracellular mRNA, threshold cycle (Ct) values ​​were obtained for each gene using the instrument's software and the automated Ct function. The relative mRNA abundance of each gene was normalized to the mRNA expression of GAPDH. Fold changes were calculated using the ΔΔCt method. The specific SARS-CoV-2 (N, NSP6, and S) and human (GAPDH) primer sequences used in the experiments are as follows: N-qF: CGTTTGGTGGACCCTCAGAT (Sequence No. 1 in the sequence listing) N-qR: CCCCACTGCGTTCTCCATT (Sequence No. 2 in the Sequence Listing) NSP6-qF: GGTTGATACTAGTTTGTCTGGTTTT (SEQ ID NO: 3 in the sequence listing) NSP6-qR: AACGAGTGTCAAGACATTCATAAG (SEQ ID NO: 4 in the sequence listing) S-qF: GGTTCCATGCTATACATGTCTC (SEQ ID NO: 5 in the sequence listing) S-qR: GGTCTTCGAATCTAAAGTAGTACCA (Sequence No. 6 in the Sequence Listing) GAPDH-qF: AAGGTCGGAGTCAACGGATTT (SEQ ID NO: 7 in the sequence listing) GAPDH-qR: TGAAGGGGTCATTGATGGCA (SEQ ID NO: 8 in the sequence listing)

[0076] Western blot analysis For Western blot analysis, 40 μg of protein from each point was resolved in a 4–12% Bis-Tris-SDS-NUPAGE gel (Invitrogen) and then transferred to a nitrocellulose membrane (Amersham Bioscience). After blocking with 5% BSA in TBS buffer containing 0.05% Tween 20, the membrane was probed with mouse anti-spike (S1-NTD) (E7M5X) (Ozyme, Cat. No. 42172S), rabbit anti-nucleocapsid (Fisher Scientific, Cat. No. MA536086). Equal protein loading was assessed by probing the membrane with rabbit anti-GAPDH (Protein Tech, Cat. No. 60004-1-AP). The membrane was treated with horseradish peroxidase-linked goat anti-mouse or anti-rabbit secondary antibodies (Amersham Biosciences). Immunoreactive proteins were detected and quantified by enhanced chemiluminescence (Pierces, USA) using a CCD camera (GBOX, SYNGENE Pxi-4, Ozyme).

[0077] result Treatment with various concentrations of QVDM-OPh peptide had no toxic effect on Vero E6 / TMPRSS2 cells 72 h after infection, regardless of whether the cells were infected with virus at an MOI of 0.05 (Fig. 1 ).

[0078] The antiviral effect and mortality of various concentrations of QVDM-OPh were evaluated by flux cytometry analysis using intracellular staining for SARS-CoV-2 spike protein and a viability dye to measure mortality. Remdesivir was used as a positive control and Vx765 as a negative control during the study. The effect of QVDM-OPh on SARS-CoV-2 replication was also evaluated by Western blot analysis of viral protein expression for spike and nucleocapsid proteins. The results obtained by flux cytometry and Western blot show a significant inhibition of viral replication by QVDM-OPh at doses of 10 μM (inhibition rate of about 50%) and 25 μM (inhibition rate of about 70%). It is completely inhibited at a concentration of 50 μM (inhibition rate of about 99%). This effect was observed at daily doses at 72 h post-infection, with the virus still present in the culture medium (full treatment condition). This reduction is comparable to that obtained with remdesivir (Figures 2 and 3).

[0079] Next, the inventors investigated the mRNA expression of SARS-CoV-2 viral genes, more specifically, the gene expression of spike (S), nucleocapsid (N), and nonstructural protein 6 or accessory protein ORF6 (NSP6) in infected cells treated or not with QVDM-OPh. Indeed, QVDM-OPh treatment can significantly reduce the relative expression of structural proteins, spike, nucleocapsid, and NSP6 genes in cells (Figure 4).

[0080] Finally, we examined whether QVDM-OPh inhibited the secretion / production of virus from cells into the medium. To this end, we analyzed the supernatants of infected cells treated or not with various inhibitors in full treatment conditions after virus extraction and qRT-PCR of nucleocapsid (N) and NSP6 gene expression. SARS-CoV-2 was significantly reduced in the supernatants of infected and QVDM-OPh-treated Vero E6 / TMPRSS2 cells, similar to remdesivir (Figure 5).

[0081] All these results were repeated in post-penetration treatment conditions, where cells were infected for 2 hours, after which the virus was completely removed from the medium and replaced with fresh medium. All drugs were added 2 hours post-infection at various concentrations and added daily for 72 hours. The experiments performed in post-penetration conditions show the same effects as those described in all experiments in full treatment conditions (Figures 6, 7, 8, and 9).

[0082] Our findings show that QVDM-OPh is highly effective in suppressing SARS-CoV-2 infection in vitro by inhibiting viral replication in cells and abrogating viral production and new infections without any toxicity at concentrations of 25 μM and 50 μM.

[0083] Furthermore, when comparing QVDM-OPh and QVD-OPh used at the same concentration (Figures 5 and 9), QVDM-OPh is able to inhibit virus secretion / production from cells into the medium more efficiently than QVD-OPh applied at the same concentration.

[0084] Example 2 material and method COVID-19 Golden Syrian Hamster Model 1. Ethics Statement Animal care and experimental procedures were performed in accordance with French and European regulations and the National Research Council Guide for the Care and Use of Laboratory Animals. The animal facility is approved by the French authorities (permission number B 91 962 106). All procedures on animals used in this study, including surgery, anesthesia, and euthanasia, where applicable, were submitted to the Animal Care Committee of Oncodesign (Oncomet), which was approved by the French authorities (CNREEA permit number 91).

[0085] The BSL3 animal facility has been approved by the French authorities (approval number D92-032-02). All procedures on animals used in this study (including surgery, anesthesia, and euthanasia, if applicable) were submitted to the CEA Animal Care Committee approved by the French authorities (CETEA DSV number 44).

[0086] 2. Rearing conditions Animals were maintained in specific pathogen-free health conditions according to FELASA guidelines. Animals were individually identified. Animals are kept in a vivarium with controlled environmental conditions: temperature: 21°C ± 2°C, humidity: 55 ± 10%, photoperiod (12 h light / 12 h dark), H14 filtered air, minimum 12 air changes per hour, no recirculation.

[0087] Each cage was labeled with a specific code. The animal enclosures provided sterile, adequate space, bedding material, food and water, environmental and social enrichment (group housing), i.e., A3 facility: IsoRat900N biological containment system (Techniplast, France), poplar bedding (Select fine, Safe, France), A04 SP-10 feed (Safe, France), tap water, and environmental enrichment with tunnels and wooden sticks.

[0088] 3. SARS-CoV-2 -SARS-CoV-2 strain "Slovakia / SK-BMC5 / 2020" was originally provided by the European Virus Archive global (EVAg) (GISAID EPI_ISL_417879, https: / / www.european-virus-archive.com / virus / sars-cov-2-strainslovakiask-bmc52020), produced and titrated in Vero E6 / TMPRSS2 cells by Oncodesign, and used for hamster infection. This strain belongs to the GH clade.

[0089] -Virus production is 50x106 The infections were performed in T175 flasks seeded with 1000 cells of Vero E6 / TMPRSS2 cells in a final volume of 40 mL. Cell counts and viability were assessed by 0.25% trypan blue exclusion assay with a ViCell instrument. After a 48-h infection time frame (with SARS-CoV-2 virus at MOIs of 0.001-0.005), cytopathogenic effects were confirmed under microscopic observation. Culture supernatants were harvested, centrifuged (5000 g for 5 min) and aliquoted (1 mL aliquots).

[0090] - The TCID50 titer of the virus stock was measured in Vero E6 / TMPRSS2 cells. Approximately 2 hours before the test, cells were plated at 2x10 per well in a volume of 200 μL of complete growth medium (DMEM 10% FCS). 4 Cells were plated in 96-well plates at a density of 1:100, ...

[0091] Experimental design and procedures 1.Animals Twelve healthy golden Syrian hamsters (female), 6-8 weeks old upon receipt, were obtained from Janvier Labs.

[0092] 2. Randomization The animals were weighed and then assigned to two homogenous groups of 5 animals, labeled on the tail.

[0093] 3. Treatment Treatment was administered via the intraperitoneal (IP) route in a total volume of 10 mL / kg per inoculation time point. Test products were inoculated on day 0 (t+1 hour) and day 1. Treatment with test substances was administered according to the schedule shown below. · Inoculation of group A animals (vehicle) was performed by the intraperitoneal (IP) route (volume 10 mL / kg) using sodium chloride 0.9% supplemented with 2.5% DMSO. · Group B animals (Q-VDM-OPH) received the test compound (10 mL / kg volume, 10 mg / kg dose) by IP route on days 0 (t+1 h) and 2 times on day 1. · Group C animals (Q-VE-OPH) received the test compound (10 mL / kg volume, 10 mg / kg dose) by IP route on days 0 (t+1 h) and 2 times on day 1.

[0094] 4.SARS-CoV-2 load The route of administration of SARS-CoV-2 was selected by Oncodesign. Virus was administered to isoflurane-anesthetized animals via the intranasal route (IN) in a total volume of 70 μL (35 μL per nostril). 10 5 All groups received SARS-CoV-2 via the IN route on day 0.

[0095] 5. Death of animals at 2 days post-infection (dpi). Animals (n=12) were sacrificed 2 days post-infection (2 dpi). Animals were deeply anesthetized with a cocktail of Zoletil (30 mg / kg-0.6 mL / kg) and Xylazine (10 mg / kg-0.5 mL / kg) injected by IP route. After gentle cervical dislocation, a thoracotomy was performed and the lungs were harvested.

[0096] The right upper lobe was placed in RNAlater overnight at 4°C and then stored at -80°C until RNA was extracted for viral load quantification by qRT-PCR. The middle lobe, mid-lung lobe, and right lower lobe were snap frozen in liquid nitrogen (one lobe per tube) and then stored at -80°C until further use.

[0097] Ex vivo analysis 1. Measurement of viral load in the lungs by genomic RT-qPCR Quantification of viral load by RT-qPCR was performed in lungs using the viral ORF1ab gene. Viral RNA extraction was performed using the Macherey Nagel Viral RNA Kit (reference number 740452.4). RNA was frozen at -80°C until qRT-PCR was performed. Full qRT-PCR was performed using the SuperScript® III One-Step qRT-PCR System Kit (commercial kit number 1732-020, Life Technologies) with primers and qRT-PCR conditions targeting the ORF1ab gene. Amplification was performed using Bio-Rad's CFX384 and associated software. The primers and probes applied for this quantification are as follows: ORF1ab_Fw: CCGCAAGGTTCTTCTTCGTAAG (SEQ ID NO: 9 in the sequence listing) ORF1ab_Rv: TGCTATGTTTAGTGTTCCAGTTTTC (SEQ ID NO: 10 in the sequence listing) ORF1ab_probe: Hex-AAGGATCAGTGCCAAGCTCGTCGCC-BHQ-1 (SEQ ID NO: 11 in the Sequence Listing), where Hex at the 5' end position represents hexachlorofluorescein, and BHQ-1 at the 3' end position represents black hole quencher-1.

[0098] 2. Animal Monitoring Clinical monitoring Following SARS-CoV-2 infection, animals were monitored daily for survival, behavior, and body weight. Following SARS-CoV-2 infection, model-specific clinical follow-up observations were recorded daily using the parameters listed below. -Weight loss -Pile erection (none-slight-significant) -Behavior (normal - not very mobile - aloof or isolated) -Posture (normal-abnormal-hunched) - Cough (yes or no) - Sneezing (with or without)

[0099] Humane Endpoints The humane endpoints were as follows: -20% weight loss (compared to the first day of treatment or maximum weight) lasting up to 2 days - Signs of pain, suffering, or distress, posturing in pain, facial expressions of pain, abnormal behavior, or vocalizations - Poor health, emaciation, cachexia, dehydration Bladder outlet obstruction or diarrhea during a 48 hour period -Lack of spontaneous response to external stimuli for a long period of time -Fast labored breathing -Anemia, significant bleeding - Bloody or mucopurulent discharge from any orifice - Neurological signs: circling, convulsions, hind limb paralysis -Continuous decrease in body temperature - Abdominal bloating

[0100] Anesthesia and analgesia Isoflurane gas anesthesia was used for inoculation of test products and blood sampling from the jugular vein (if applicable). Non-pharmacological treatments were used for all painful procedures. In addition, pharmacological treatments (localized treatments) compatible with the study may be used upon recommendation of the attending veterinarian.

[0101] Euthanasia Euthanasia of animals was performed under deep anesthesia using a cocktail of Zoletil (30 mg / kg-0.6 mL / kg) and Xylazine (10 mg / kg-0.5 mL / kg) injected by IP route. After gentle cervical dislocation, thoracotomy and maximal terminal blood sampling were performed before tissue collection. When a physical method for euthanasia (cervical dislocation) was required, it was performed by skilled and experienced technicians.

[0102] statistical analysis Statistical analysis was performed using Prism software (GraphPad, version 8, San Diego, USA). For in vitro experiments, one-way ANOVA test followed by Dunnett's post-hoc test was used. For in vivo experiments, quantitative data were compared across animal groups using the Mann-Whitney test. Data represent mean ± SEM. Statistics were calculated based on one-way ANOVA test. *p<0.05, ***p<0.01, ***p<0.001.

[0103] result To complete the in vitro studies on the antiviral effect of QVDM-OPh against SARS-CoV-2, the inventors performed an in vivo assay in a COVID19 golden Syrian hamster model to demonstrate the efficacy of the QVDM-OPh peptide in inhibiting viral replication in the lungs and to compare it with QVE-OPh.

[0104] The clinical scores and changes in body weight relative to day 0 show promising results in the infected and QVDM-OPh-treated groups, as well as in the infected and QVE-OPh-treated groups, compared to the infected and untreated groups (Figure 10A). Despite stopping the assay at dpi2 and euthanizing the animals at this point, the results are very promising, showing a significant reduction in viral load and viral replication in the lungs of infected and treated animals compared to the untreated group (Figure 10B and Figure 10C, respectively). Furthermore, the reduction in viral load and viral replication is more significant in animals treated with QVDM-OPh (70% viral replication reduction) compared to animals treated with QVE-QVE-OPh (52% viral replication reduction).

[0105] All these in vitro and in vivo results confirm the antiviral effect of QVDM-OPh against SARS-CoV-2 replication.

Claims

1. A method for preventing and / or treating a viral infection caused by SARS-CoV-2 in a patient in need of such prevention and / or treatment, comprising administering to said patient a compound of formula (I) 【Chemistry 1】 or a pharma- ceutically acceptable salt or solvate thereof.

2. A method for preventing and / or treating a viral infection caused by SARS-CoV-2 in a patient in need of such prevention and / or treatment, comprising the step of administering to said patient in need of such prevention and / or treatment a pharmaceutical composition comprising, as an active ingredient, a compound of formula (I) or a pharma-ceutically acceptable salt or solvate thereof as described in claim 1.

3. The method of claim 2 , wherein the pharmaceutical composition further comprises at least one pharma- ceutically acceptable vehicle.

4. The method of claim 2 or 3, wherein the pharmaceutical composition further comprises at least one additional therapeutic agent.

5. A method for preventing and / or treating a viral infection caused by SARS-CoV-2 in a patient in need of such prevention and / or treatment, comprising administering to said patient in need of such prevention and / or treatment: (a) a compound of formula (I) as defined in claim 1 or a salt or solvate thereof, or a pharmaceutical composition as defined in any one of claims 2 to 4; (b) administering a kit of parts comprising or consisting of at least one additional therapeutic agent, or a pharmaceutical composition comprising at least one additional therapeutic agent.

6. 6. The method of claim 4 or 5, wherein the at least one additional therapeutic agent is selected from the group consisting of antiviral agents, anti-inflammatory agents, analgesics, muscle relaxants, anesthetics, diuretics, and antibiotics.

7. 7. The method of claim 5 or 6, wherein the at least one additional therapeutic agent is N-(2(quinolyl)-valyl-glutamyl-(2,6-difluorophenoxy)methyl ketone or a pharma- ceutically acceptable salt or solvate thereof.

8. The method of claim 6, wherein the antiviral agent is a viral RNA-dependent RNA polymerase modifier or a fusion inhibitor.

9. The method of claim 6 , wherein the anti-inflammatory agent is a monoclonal antibody.

10. The method of any one of claims 1 to 9, wherein the method is applied to abrogate, inhibit and / or reduce viral replication and / or viral protein synthesis in a subject infected with SARS-CoV-2.

11. The method according to any one of claims 1 to 9, wherein the method is applied to prevent complications of COVID-19, such as COVID-19 pneumonia, acute respiratory distress syndrome (ARDS), acute respiratory failure, and liver or cardiac damage.

Images