Probiotic vaccines and related methods of use

JP2025505821A5Pending Publication Date: 2026-03-03SALVITUS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024549118
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-03-18
Filing Date
2023-02-21
Publication Date
2026-03-03

AI Technical Summary

Benefits of technology

【0018】 [18] 以下の詳細な説明および添付の図面を検討することにより、当業者であれば、本発明の他の特徴および利点がより容易に明らかになる。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

Provided herein are probiotic cancer vaccines, recombinant phages, and methods of their use.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] Related Applications

[01] This application claims priority to U.S. Provisional Patent Application No. 63,311,977, filed February 19, 2022, U.S. Provisional Patent Application No. 63 / 312,052, filed February 20, 2022, and U.S. Provisional Patent Application No. 63 / 321,638, filed March 18, 2022, all of which are incorporated by reference in their entireties. [Background technology]

[0002]

[02] FIELD OF THEINVENTION

[0003]

[03] The present invention relates to recombinant phages, probiotic vaccines, and methods of using them.

[0004]

[04] Related Technology

[0005]

[05] Cancer is becoming more common today as a result of genetic abnormalities and epigenetic changes in cell development and apoptosis pathways. Tumor initiation and growth are caused by overexpression of genes related to cell growth and proliferation in cancer, as well as down-expression of genes that control cell death activity. Alterations in cellular pathways often occur due to random mutations and unhealthy lifestyle habits. Immune-competent individuals are vulnerable to alterations in innate immunity that involve activation of diverse immune responses to destroy competent tumor cells. Tumor-initiating cells undergo apoptosis and necrosis, surrounding tissues are stressed, and the gut microbiota all generate anti-cancer immune responses and signals.

[0006]

[06] Immunotherapy is a form of cancer treatment that activates the immune system to attack and eradicate cancer cells. Cytotoxic T lymphocytes (CTLs) are essential for successful antitumor immune responses. T cells that attack cancer cells require presentation of tumor antigens to naive T cells that undergo activation, clonal expansion, and ultimately perform cytolytic effector functions. Effective antigen presentation is essential for successful CTL effector function. Therefore, the development of effective strategies to initiate tumor antigen presentation to T cells is critical for immunotherapy strategies for the treatment of cancer.

[0007]

[07] Similarly, B cells can suppress tumor growth by promoting the production of tumor-reactive antibodies, tumor killing by NK cells, phagocytosis by macrophages, and priming of CD4+ and CD8+ T cells.B cells can promote tumor growth through the production of autoantibodies and tumor growth factors. Summary of the Invention [Problem to be solved by the invention]

[0008]

[08] Because the clinical outcomes of many types of cancer range from poor to fatal, there is a need for the development of new preventative and / or therapeutic treatments. Summary of the Invention [Means for solving the problem]

[0009]

[09] Provided herein is a probiotic vaccine comprising: LPESFDGDPASNTAPLQPEQLQVF (SEQ ID NO: 1; HER2), PESFDGDPASNTAPLQPEQLQ (SEQ ID NO: 2; HER2), QPEKVQTLEAWVIHGG (SEQ ID NO: 3; CD38), ISKRNIQFSCKNIYR (SEQ ID NO: 4; CD38), TFGSVEVHNL (SEQ ID NO:5; CD38), QTLEA (SEQ ID NO:6; CD38), IQFSC (SEQ ID NO: 7; CD38), and A recombinant filamentous phage genome comprising a nucleic acid encoding a polypeptide comprising a foreign peptide epitope selected from the group consisting of: AFPEDRSQPG (SEQ ID NO: 8; PD-1), or a fragment or variant thereof; a bacterium infected with the recombinant phage; The present invention provides a probiotic vaccine comprising:

[0010]

[10] In a particular embodiment of the vaccine of the invention, the foreign peptide epitope is functionally expressed on a coat protein selected from the group consisting of pIII, pVI, pVII, pVIII and pIX, hi a particular embodiment, the coat protein is pIII.

[0011]

[11] In further embodiments, the phage is a filamentous phage, such as M13, fd, IKe, CTX-φ, Pfl, Pf2, Pf3, f1, MKE; M13K3; Myoviridae (Pl-like viruses; P2-like viruses; Mu-like viruses; SPOI-like viruses; phiH-like viruses); Siphoviridae (lambda-like viruses, gamma-like viruses, Tl-like viruses; T5-like viruses; c2-like viruses; L5-like viruses; psiMl-like viruses; phiC31-like viruses). Viruses; N15-like viruses; Podoviridae (phi29-like viruses; P22-like viruses; N4-like viruses); Tectiviridae (Tectivirus); Corticoviridae (Corticovirus); Lipothrixviridae (Alphalipothrixvirus, Betalipovirus, Betalipothrixvirus, Gammalipothrixvirus, Deltalipothrixvirus; Plasmaviridae (Plasmavirus); Rudiviridae (Rudivirus); Fuselloviridae (Fusellovirus); Inoviridae (Inovirus, Plectrovirus, M13-like virus, fd-like virus); Microviridae (Microvirus, Spiromicrovirus, Bdellomicrovirus, Chlamydiamicrovirus);The phage is selected from the group consisting of phages of the Leviviridae (Levivirus, Allolevivirus) and Cystoviridae (Cystovirus). In a particular embodiment, the phage is M13K3;

[0012]

[12] In yet other embodiments, the bacteria (e.g., probiotic bacteria) infected with the recombinant phages according to the invention provided herein are selected from the group consisting of E. coli Nissle 1917, E. coli ER2738, Bacillus amyloliquefaciens; Bacillus polyfermenticus, strain Bispan; Bifidobacterium animalis subsp. lactis, strain BB-12; Bifidobacterium animalis subsp. lactis, strain GPS1209; Bifidobacterium animalis subsp. Lactis, strain HN019(DR1064);Bifidobacterium bifidum, strain BB-12;Bifidobacterium bifidum, strain Rosell-71;Bifidobacterium breve, strain M-16V;Bifidobacterium longum;Bifidobacterium thermophilum;Lactobacillus acidophilus, strain La-1;Lactobacillus brevis, strain HA-112;Lactobacillus fermentum, strain HA-179;Lactobacillus helveticus helveticus, Lafti L10 strain; Lactobacillus helveticus, Rosell-52 strain; Lactobacillus paracasei, Lafti L26 strain; Lactobacillus paracasei subsp.paracasei, strain 431; Lactobacillus rhamnosus, strain HN001(DR20); Streptococcus salivarius, strain DSM 13084; Streptococcus thermophilus; Bacillus coagulans, GBI-30, 6086; Bifidobacterium animalis subsp. lactis BB-12; Bifidobacterium longum subsp. infantis; Escherichia coli Nissle 1917; Escherichia coli ER2738; Lactobacillus acidophilus acidophilus NCFM, Lactobacillus paracasei Stl1 (or NCC2461), Lactobacillus johnsonii Lai (also called Lactobacillus LCI, Lactobacillus johnsonii NCC533), Lactobacillus plantarum 299v, Lactobacillus reuteri ATCC 55730 (Lactobacillus reuteri SD2112), Lactobacillus reuteri Protectis (DSM 17938, daughter strain of ATCC 55730), Lactobacillus reuteri Prodentis (DSM 17938 / ATCC 55730 and ATCC PTA 5289), Lactobacillus rhamnosus GG, Saccharomyces boulardii, Lactobacillus rhamnosus GR-1 and Lactobacillus reuteriThe recombinant phage of the present invention may be selected from the following: Lactobacillus acidophilus NCFM and Bifidobacterium bifidum BB-12, Lactobacillus acidophilus CL1285 and Lactobacillus casei LBC80R, Lactobacillus plantarum HEAL 9 and Lactobacillus paracasei 8700:2, Lactobacillus bulgaricus, Lactococcus thermophilus, and Lactobacillus bifidus. In a particular embodiment, the bacterium infected with the recombinant phage of the present invention provided herein is F factor positive. In another embodiment, the bacterium is F factor positive selected from Escherichia coli Nissle1917 or Escherichia coli ER2738. In a particular embodiment, the bacterium is E. coli Nissle 1917. In another embodiment, the bacterium is E. coli ER2738.

[0013]

[13] In certain embodiments, the probiotic vaccine produces both IgG and IgA antibodies that bind to the foreign peptide epitope. In other embodiments, the probiotic vaccine includes bacteria that continuously produce lysogenic phages. In yet another embodiment of the probiotic vaccine, the peptide -TSGSGSGSGSGSGSG- is used as a linker between the coat protein and the foreign peptide epitope.

[0014]

[14] As used herein, the following: LPESFDGDPASNTAPLQPEQLQVF (SEQ ID NO: 1), PESFDGDPASNTAPLQPEQLQ (SEQ ID NO: 2), QPEKVQTLEAWVIHGG (SEQ ID NO: 3), ISKRNIQFSCKNIYR (SEQ ID NO: 4), TFGSVEVHNL (SEQ ID NO:5), QTLEA (SEQ ID NO:6), IQFSC (SEQ ID NO: 7), and AFPEDRSQPG (SEQ ID NO: 8) Also provided is a recombinant filamentous phage genome comprising a nucleic acid encoding a polypeptide comprising a foreign peptide epitope, or a fragment or variant thereof, selected from the group consisting of:

[0015]

[15] In a particular embodiment of the recombinant phage, the foreign peptide epitope is functionally expressed on a coat protein selected from the group consisting of pIII, pVI, pVII, pVIII and pIX. In a particular embodiment of the recombinant phage, the coat protein is pIII. In further embodiments, the phage is a filamentous phage, such as M13, fd, IKe, CTX-φ, Pfl, Pf2, Pf3, f1, MKE; M13K3; Myoviridae (Pl-like viruses; P2-like viruses; Mu-like viruses; SPOI-like viruses; phiH-like viruses); Siphoviridae (lambda-like viruses, gamma-like viruses, Tl-like viruses; T5-like viruses; c2-like viruses; L5-like viruses; psiMl-like viruses; phiC31-like viruses; N15-like viruses); Pooviridae (phi29-like viruses; P22-like viruses; N4-like viruses); Tectiviridae (Tectivirus); Corticoviridae (Corticovirus); Liposliviridae (Like viruses); Lipothrixviridae (Alphalipothrixvirus, Betalipothrixvirus, Gammalipothrixvirus, Deltalipothrixvirus); Plasmaviridae (Plasmavirus); Rudiviridae (Rudivirus); Fuselloviridae (Fusellovirus); Inoviridae (Inovirus, Plectrovirus, M13-like virus, fd-like virus);The phage is selected from the group consisting of phages of the Microviridae (Microvirus, Spiromicrovirus, Bdellomicrovirus, Chlamydiamicrovirus); Leviviridae (Levivirus, Allolevivirus) and Cystoviridae (Cystovirus). In yet another embodiment, the phage is a filamentous phage selected from the group consisting of M13, fd, IKe, CTX-φ, Pfl, Pf2, Pf3, f1, MKE, and M13K3. In a particularly preferred embodiment, the phage is M13K3. In yet another embodiment, the recombinant phage produces IgG antibodies that bind to the foreign peptide epitope. In yet another embodiment of the recombinant phage, the peptide TSGGSGSGSGSGSGSG is used as a linker between the foreign peptide epitope and the coat protein.

[0016]

[16] Also provided herein is a method of preventing or treating cancer, comprising administering to a patient in need thereof one or more of the probiotic vaccines provided herein, or one or more of the recombinant phages provided herein. In certain embodiments, the cancer is selected from the group consisting of multiple myeloma, epithelial cancer, epithelial ovarian cancer, mucosal melanoma, non-small cell lung cancer, melanoma, head and neck cancer, renal cell carcinoma, Hodgkin's lymphoma, cutaneous squamous cell carcinoma, glioblastoma, esophageal cancer, gastric cancer, duodenal cancer, small intestine cancer, appendix cancer, large intestine cancer, colon cancer, rectal cancer, colorectal cancer, anal cancer, pancreatic cancer, liver cancer, gallbladder cancer, spleen cancer, kidney cancer, bladder cancer, prostate cancer, testicular cancer, uterine cancer, endometrial cancer, ovarian cancer, vaginal cancer, vulvar cancer, breast cancer, lung cancer, thyroid cancer, thymic cancer, The cancer is selected from the group consisting of brain cancer, nervous system cancer, glioma, oral cancer, skin cancer, blood cancer, lymphoma, eye cancer, osteosarcoma, myeloma, muscle cancer, non-small cell lung cancer (NSCLC), head and neck squamous cell carcinoma (HNSCC), urothelial cancer, non-muscle invasive bladder cancer [NMIBC], colon or rectal cancer, esophageal cancer or certain gastroesophageal junction (GEJ) cancer, cervical cancer, renal cell carcinoma (RCC), advanced endometrial cancer, cutaneous squamous cell carcinoma (cSCC), and / or triple-negative breast cancer (TNBC), etc. In certain embodiments, the cancer is multiple myeloma.

[0017]

[17] Also provided herein is a kit comprising a probiotic vaccine of the invention, or a recombinant phage of the invention, and instructions for administration of the probiotic vaccine or recombinant phage.

[0018]

[18] Other features and advantages of the present invention will become more readily apparent to those of ordinary skill in the art upon review of the following detailed description and accompanying drawings. [Brief description of the drawings]

[0019]

[19] [Figure 1]FIG. 1 shows the nucleic acid sequence of the insertion site of the nucleic acid encoding SEQ ID NO:8 in Example 3 to form the construct M13KE-AFP10 RF I DNA. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0020] Detailed Description

[20] Provided herein is a novel probiotic vaccine comprising: LPESFDGDPASNTAPLQPEQLQVF (SEQ ID NO: 1), PESFDGDPASNTAPLQPEQLQ (SEQ ID NO: 2), QPEKVQTLEAWVIHGG (SEQ ID NO: 3), ISKRNIQFSCKNIYR (SEQ ID NO: 4), TFGSVEVHNL (SEQ ID NO:5), QTLEA (SEQ ID NO:6), IQFSC (SEQ ID NO: 7), and A recombinant phage (e.g., filamentous phage) genome comprising a nucleic acid encoding a polypeptide comprising a foreign peptide epitope selected from the group consisting of: AFPEDRSQPG (SEQ ID NO: 8), or a fragment or variant thereof; a bacterium infected with the recombinant phage; The present invention provides a probiotic vaccine comprising:

[0021] [twenty one] The term "probiotic vaccine" as used herein refers to a combination of probiotic bacteria infected with a recombinant phage.

[0022] [twenty two] As described herein, the probiotic vaccines of the present invention are particularly useful in methods of treating and / or preventing cancer or infectious diseases. Probiotic-based vaccines do not require strict storage conditions or transportation, unlike conventional vaccines. Conventional live vaccines usually require storage at low temperatures before administration. Furthermore, conventional vaccinations have been developed using attenuated strains of pathogenic bacteria, such as Salmonella, Mycobacterium, and Bacillus, which have many drawbacks, such as the possibility that attenuated strains may become pathogenic again in the body. Attenuated strain vaccines also induce additional immune responses in individuals, which reduces the effectiveness of the vaccine. Survival rate in the harsh acidic conditions of the human intestine is also an issue that contributes to the failure of conventional vaccines compared to probiotic oral vaccines. Conventional vaccines generally cannot survive harsh acidic conditions and, as a result, cannot reach the inside of the mucosal layer. Probiotics, on the other hand, thrive in acidic environments. Probiotics are suitable for vaccine development because they are resistant to acid and bile.

[0023] [twenty three] The term "vaccine" as used herein refers to a composition capable of stimulating the immune system of an organism such that protection against harmful antigens is provided, either through prophylaxis or therapy. Preferably, the vaccine or vaccine composition further comprises one or more immune adjuvant substances.

[0024] [twenty four] The terms "preventing", "prevention", "prophylaxis", "prevent" as used herein generally mean avoiding or minimizing the onset or progression of a disease or condition before its onset, while the terms "treating", "treatment" or "treat" include the alleviation, amelioration, or cure of a disease (such as, for example, cancer) or condition (or a symptom of a disease or condition) after its onset. The term "preventing" includes "reducing the likelihood of occurrence" or "reducing the likelihood of recurrence."

[0025] [twenty five] An "effective amount" or "effective dose" as used herein is an amount that provides a desired effect. For therapeutic purposes, an effective amount is an amount sufficient to provide a beneficial or desired clinical result. The preferred effective amount for a given application can be easily determined by one of ordinary skill in the art, for example, by considering the subject's size, age, weight, the type of disease / disorder to be prevented or treated, and the time since the onset of the disease / disorder. In the present invention, in terms of prevention or treatment, an effective amount of a composition is an amount sufficient to induce a humoral and / or cell-mediated immune response against the disease or disorder.

[0026]

[26] According to different aspects and embodiments of the invention described herein, a "subject" or "host" preferably refers to a mammal, and most preferably to a human. The subject may be one suspected of having, possibly having, or being at risk of developing cancer and / or infectious diseases (e.g., via Korean Fever Virus infection, etc.). Foreign peptide epitopes

[0027]

[27] The term "foreign peptide epitope" as used herein refers to any peptide or sequence that is not native or natural relative to the host phage strain used to produce the recombinant phage of the present invention. In other words, the foreign peptide epitope and the nucleic acid encoding it are heterologous (i.e., foreign) to the peptide sequence of the particular phage strain utilized. In certain embodiments, the length of the foreign peptide epitope may be in a range selected from the group consisting of 4-20 amino acids, 4-25 amino acids, 5-20 amino acids, 5-25 amino acids, 5-30 amino acids, 5-35 amino acids, 5-40 amino acids, 5-45 amino acids, and 5-50 amino acids. In certain embodiments, the length of the foreign peptide epitope is in the range of 5-20 amino acids.

[0028]

[28] In accordance with the present invention, an exogoneous peptide epitope (e.g., an antigenic peptide) for use in the recombinant phage and / or probiotic vaccines provided herein comprises or consists of an amino acid sequence set forth in any one of SEQ ID NOs: 1-8, or a fragment or variant thereof, as follows: LPESFDGDPASNTAPLQPEQLQVF (SEQ ID NO: 1), PESFDGDPASNTAPLQPEQLQ (SEQ ID NO: 2), QPEKVQTLEAWVIHGG (SEQ ID NO: 3), ISKRNIQFSCKNIYR (SEQ ID NO: 4), TFGSVEVHNL (SEQ ID NO:5), QTLEA (SEQ ID NO:6), IQFSC (SEQ ID NO: 7), and AFPEDRSQPG (sequence number 8).

[0029]

[29] The epitope used to cultivate the recombinant phage in the probiotic bacterial cell depends on the type of cancer to be treated or prevented, or the type of infectious disease to be prevented. For example, in an embodiment using HER2 foreign peptide epitopes for the treatment of cancer, including breast cancer, bladder cancer, pancreatic cancer, ovarian cancer, and / or gastric cancer, at least one foreign peptide epitope, or a fragment or variant thereof, is selected from LPESFDGDPASNTAPLQPEQLQVF (SEQ ID NO: 1) or PESFDGDPASNTAPLQPEQLQ (SEQ ID NO: 2). In another embodiment, the foreign peptide epitope comprises LPESFDGDPASNTAPLQPEQLQVF (SEQ ID NO: 1) or PESFDGDPASNTAPLQPEQLQ (SEQ ID NO: 2) with 5 or less, 4 or less, 3 or less, 2 or less, or 1 amino acid substitution in SEQ ID NO: 1 or 2. Thus, provided herein is a method of preventing or treating cancer, including breast cancer, bladder cancer, pancreatic cancer, ovarian cancer, and / or gastric cancer, comprising administering to a patient in need thereof a recombinant phage or probiotic vaccine comprising at least one foreign peptide epitope selected from LPESFDGDPASNTAPLQPEQLQVF (SEQ ID NO: 1) or PESFDGDPASNTAPLQPEQLQ (SEQ ID NO: 2), or a fragment or variant thereof.

[0030]

[30] In another embodiment of using CD38 foreign peptide epitopes in the treatment of cancer, including leukemia, lymphoma, myeloma, multiple myeloma, CLL, etc., at least one foreign peptide epitope, or a fragment or variant thereof, is selected from QPEKVQTLEAWVIHGG (SEQ ID NO: 3), ISKRNIQFSCKNIYR (SEQ ID NO: 4), TFGSVEVHNL (SEQ ID NO: 5), QTLEA (SEQ ID NO: 6), and IQFSC (SEQ ID NO: 7). In another embodiment, the foreign peptide epitope comprises QPEKVQTLEAWVIHGG (SEQ ID NO: 3), ISKRNIQFSCKNIYR (SEQ ID NO: 4), TFGSVEVHNL (SEQ ID NO: 5), QTLEA (SEQ ID NO: 6), and IQFSC (SEQ ID NO: 7) with 5 or less, 4 or less, 3 or less, 2 or less, or 1 amino acid substitution in SEQ ID NOs: 3-7. Thus, provided herein is a method of preventing or treating cancer, including leukemia, lymphoma, myeloma, multiple myeloma, and / or chronic lymphocytic leukemia (CLL), comprising administering to a patient in need thereof a recombinant phage or probiotic vaccine comprising at least one foreign peptide epitope, or a fragment or variant thereof, selected from QPEKVQTLEAWVIHGG (SEQ ID NO: 3), ISKRNIQFSCKNIYR (SEQ ID NO: 4), TFGSVEVHNL (SEQ ID NO: 5), QTLEA (SEQ ID NO: 6), and IQFSC (SEQ ID NO: 7).

[0031]

[31] In another embodiment, it is envisioned herein that a foreign peptide epitope selected from QPEKVQTLEAWVIHGG (SEQ ID NO: 3), ISKRNIQFSCKNIYR (SEQ ID NO: 4), TFGSVEVHNL (SEQ ID NO: 5), QTLEA (SEQ ID NO: 6), and IQFSC (SEQ ID NO: 7), or a fragment or variant thereof, can prevent infection with Korean fever virus. Accordingly, provided herein is a method of preventing Korean fever virus infection, comprising administering to a patient in need thereof a recombinant phage or probiotic vaccine comprising at least one foreign peptide epitope selected from QPEKVQTLEAWVIHGG (SEQ ID NO: 3), ISKRNIQFSCKNIYR (SEQ ID NO: 4), TFGSVEVHNL (SEQ ID NO: 5), QTLEA (SEQ ID NO: 6), and IQFSC (SEQ ID NO: 7), or a fragment or variant thereof.

[0032]

[32] In another embodiment of using PD-1 foreign peptide epitopes in the treatment of cancer, at least one foreign peptide epitope corresponding to AFPEDRSQPG (SEQ ID NO:8), or a fragment or variant thereof, can treat or prevent PD-1 mediated cancers, such as mucosal cancer, gastric cancer, melanoma, non-small cell lung cancer (NSCLC), head and neck squamous cell carcinoma (HNSCC), urothelial cancer, non-muscle invasive bladder cancer [NMIBC], colon or rectal cancer, esophageal cancer or certain gastroesophageal junction (GEJ) cancers, cervical cancer, renal cell carcinoma (RCC), advanced endometrial cancer, cutaneous squamous cell carcinoma (cSCC), and / or triple negative breast cancer (TNBC). In another embodiment, the foreign peptide epitope comprises AFPEDRSQPG (SEQ ID NO:8) with no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 amino acid substitution(s) in SEQ ID NO:8. Thus, provided herein is a method of preventing or treating cancer, comprising administering to a patient in need thereof a recombinant phage or probiotic vaccine comprising at least one foreign peptide epitope corresponding to AFPEDRSQPG (SEQ ID NO: 8), or a fragment or variant thereof, wherein the cancer is selected from the group consisting of gastric cancer, melanoma, non-small cell lung cancer (NSCLC), head and neck squamous cell carcinoma (HNSCC), urothelial carcinoma, non-muscle invasive bladder cancer [NMIBC], colon or rectal cancer, esophageal or certain gastroesophageal junction (GEJ) cancer, cervical cancer, renal cell carcinoma (RCC), advanced endometrial cancer, cutaneous squamous cell carcinoma (cSCC), and / or triple-negative breast cancer (TNBC).

[0033]

[33] The term "fragment" or grammatical variations thereof, as used herein, refers to a smaller peptide (e.g., a subset of amino acids) compared to the complete reference peptide sequence from which it is derived. For example, a fragment may have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more fewer amino acids than the complete reference peptide.

[0034]

[34] The terms "variant thereof," "variant," or grammatical variations thereof, as used herein, refer to biologically active polypeptides having at least about 80% amino acid sequence identity with a reference sequence polypeptide, after aligning sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering conservative substitutions as part of the sequence identity. Such variants include, for example, polypeptides in which one or more amino acid residues have been added or deleted at the N-terminus or C-terminus of the polypeptide. In some embodiments, the variants have at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% amino acid sequence identity. In some embodiments, the variants have at least about 85% amino acid sequence identity. In some embodiments, the variants have at least about 90% amino acid sequence identity. In some embodiments, the variants have at least about 95% amino acid sequence identity with a native sequence polypeptide.

[0035]

[35] "Percent (%) amino acid sequence identity" and "homology" with respect to a peptide or polypeptide sequence, as used herein, are defined as the percentage of amino acid residues in a candidate sequence that are identical to amino acid residues in a particular peptide or polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and without considering any conservative substitutions as part of the sequence identity. Alignment to determine percent amino acid sequence identity can be accomplished in a variety of ways that are within the skill of the art, such as using publicly available computer software, such as BLAST, BLAST-2, ALIGN, or MEGALIGN® (DNASTAR) software. Those skilled in the art can determine appropriate parameters for measuring alignment, including algorithms necessary to achieve maximum alignment over the entire length of the sequences being compared.

[0036]

[36] In certain embodiments, amino acid substitutions may include, but are not limited to, replacing one amino acid in a polypeptide with another. Exemplary conservative substitutions are shown in Table 1. In other embodiments, conservative amino acid substitutions may be introduced into a peptide of interest and the products may be screened for a desired activity, such as, for example, increased immunogenicity.

[0037]

[37] In some embodiments, the modification may include the introduction of at least one conservative substitution into a peptide or protein, where at least one characteristic of an amino acid is preserved, such as the size, shape, or charge of the amino acid. A "conservative amino acid substitution" refers to a substitution of a structurally and / or functionally similar amino acid that can be made without substantially changing the function of the protein. An example of a conservative substitution is the replacement of an amino acid from the following groups with another amino acid from the same group (U.S. Patent No. 5,767,063; Kyte and Doolittle, J. Mol. Biol. 157:105-132 (1982)): · (1) Hydrophobic: norleucine, methionine, alanine, valine, leucine, lysine; (2) Neutral hydrophilic: cysteine, serine, threonine, asparagine, glutamine; · (3) Acidic: aspartic acid, glutamic acid; · (4) Basic: histidine, lysine, arginine; · (5) Residues influencing chain orientation: glycine, proline; ·(6) Aromatic: tryptophan, tyrosine, phenylalanine.

[0038] Table 1 [Table 1-1]

[0039] [Table 1-2]

[0040]

[38] For example, substitutions can be made by changing Val to Leu, Ser to Thr, or Asp to Glu. Other substitutions are also considered conservative depending on the environment of the particular amino acid and its role in the three-dimensional structure of the protein. For example, Glu can be substituted with Gln and Asp can be substituted with Asn if it is desired to change the pKa of an amino acid side chain while maintaining the size and structure of the side chain.

[0041]

[39] In some embodiments, the amino acid residues selected for modification (e.g., replacement with another amino acid residue) are selected from the group consisting of His, Glu, Asp, Cys, Lys, and Tyr. In some embodiments, the amino acid residues selected for modification include histidine and glutamic acid residues. These amino acid residues usually have pKa values ​​from about pH 6 to about pH 8 (even in the context of the whole protein), and therefore have high buffering capacity. In some embodiments, the at least one conservative amino acid substitution is selected from the group consisting of histidine to arginine, glutamic acid to glutamine, aspartic acid to asparagine, lysine to arginine, and tyrosine to phenylalanine.

[0042]

[40] In some embodiments, at least one of the one or more amino acid modifications comprises the substitution of an amino acid with an alanine residue. Substitution or replacement of an amino acid residue with alanine residues that has high buffering capacity may be advantageous in applications where it is desirable to reduce the buffering capacity of a peptide or protein. It should be noted that norleucine is not encoded and is modified after substitution. bacteria

[0043]

[41] As described above, the invention provided herein is a probiotic vaccine comprising a recombinant phage and a bacterium infected with the recombinant phage. In a particular embodiment, any bacterium that has the F factor (i.e., sex factor) (F + Bacteria that produce pili and sex pili for conjugation with other bacteria are suitable for use herein. + The cells are F - When mated with a cell, the result is two F + The cells are then formed and, together, conjugated to other F - This allows the plasmid to be transferred to cells. +When the pili of a cell interact with a recipient cell and a mating contact is formed, one strand of DNA is cleaved, unwound, and transferred to the recipient. Exemplary F factor-containing bacteria include E. coli Nissle 1917 and E. coli ER2738.

[0044]

[42] Thus, in certain embodiments, examples of probiotic bacteria for use according to the present invention include Escherichia coli Nissle 1917, Escherichia coli ER2738, Bacillus coagulans GBI-30, 6086, Bifidobacterium animalis subsp. lactis BB-12, Bifidobacterium longum subsp. infantis, Lactobacillus acidophilus NCFM, Lactobacillus paracasei Stl1 (or NCC2461), Lactobacillus johnsonii Lai (Lactobacillus LCI, Lactobacillus johnsonii) Also known as NCC533.), Lactobacillus plantarum 299v, Lactobacillus reuteri ATCC 55730 (Lactobacillus reuteri SD2112), Lactobacillus reuteri Protectis (DSM 17938, daughter strain of ATCC 55730), Lactobacillus reuteri Prodentis (DSM 17938 / ATCC 55730 and ATCC PTA 5289 in combination), Lactobacillus rhamnosus GG, Saccharomyces boulardii, Lactobacillus rhamnosus GR-1 and Lactobacillus reuteri The probiotic bacteria may be selected from a mixture of Lactobacillus acidophilus NCFM and Bifidobacterium bifidum BB-12, a mixture of Lactobacillus acidophilus CL1285 and Lactobacillus casei LBC80R, a mixture of Lactobacillus plantarum HEAL 9 and Lactobacillus paracasei 8700:2, Lactobacillus bulgaricus, Lactococcus thermophilus and / or Lactobacillus bifidus. In some embodiments, the probiotic bacteria for use according to the present disclosure may be a mixture of any two or more of the above strains described herein. In certain embodiments, the probiotic bacteria is Escherichia coli Nissle 1917 or Escherichia coli ER2738. In another embodiment, the probiotic bacterium is E. coli Nissle 1917. In yet another embodiment, the probiotic bacterium is E. coli ER2738.

[0045]

[43] In other embodiments, bacteria suitable for use herein are small (typical linear dimensions of about 1 micron), non-compartmentalized organisms that have at least one circular DNA chromosome and a 70S ribosome. The term "bacteria" as used herein encompasses all varieties of bacteria (e.g., endophytic bacteria, those that occur naturally in closed systems, environmental bacteria, or bacteria released for bioremediation or other efforts).

[0046]

[44] In the probiotic vaccines of the invention provided herein, the recombinant phages of the invention are loaded (e.g., infected) into donor bacteria (e.g., probiotic bacteria and / or resident bacteria) for delivery to a subject (e.g., a human patient) in need thereof. Probiotic bacteria are, for example, live bacteria that can provide a health benefit to the host and / or at least are not harmful (e.g., not pathogenic) to the host (e.g., a human patient). Thus, embodiments of the invention contemplate the use of donor bacteria (e.g., probiotic bacteria and / or resident bacteria) that have been introduced or infected with a non-lytic or inducible bacteriophage, and that can express and generate bacteriophage-based delivery particles in situ. Probiotics have also been shown to penetrate the inner mucosal layer of the intestine, aiding in the invasion of harmful bacteria and protecting against a number of intestinal infections.

[0047]

[45] In certain embodiments, examples of probiotic bacteria for infection with recombinant phages according to the present invention as used herein include those listed in the "PROBIO" database ("http: / / bidd.group / probio / homepage.htm"; Shamekhi et al., Clin Transl Oncol (2020) 22(8): 1227-39. doi:10.1007 / s12094-019-02270-0; which is incorporated by reference in its entirety for all purposes), which includes 329 probiotics currently on the market and 115 probiotic bacteria in clinical trials. In a particular embodiment, the recombinant phage according to the invention is selected from the group consisting of Bacillus amyloliquefaciens; Bacillus polyfermenticus, strain Bispan; Bifidobacterium animalis subsp. lactis, strain BB-12; Bifidobacterium animalis subsp. lactis, strain GPS1209; Bifidobacterium animalis subsp.Lactis, strain HN019(DR1064);Bifidobacterium bifidum, strain BB-12;Bifidobacterium bifidum, strain Rosell-71;Bifidobacterium breve, strain M-16V;Bifidobacterium longum;Bifidobacterium thermophilum;Lactobacillus acidophilus, strain La-1;Lactobacillus brevis, strain HA-112;Lactobacillus fermentum, strain HA-179;Lactobacillus helveticus The subject cultures are infected with or have been introduced with specific probiotic bacteria having immune-modulating capabilities selected from the group consisting of Lactobacillus helveticus, strain Lafti L10; Lactobacillus helveticus, strain Rosell-52; Lactobacillus paracasei, strain Lafti L26; Lactobacillus paracasei subsp. paracasei, strain 431; Lactobacillus rhamnosus, strain HN001(DR20); Streptococcus salivarius, strain DSM 13084; and Streptococcus thermophilus. See, e.g., Table 1 in Singh et al., Front Immunol. 2022;13: 1002674; published online October 3, 2022. doi: 10.3389 / fimmu.2022.1002674, which is incorporated by reference in its entirety for all purposes.

[0048]

[46] In other embodiments, the recombinant bacteriophage of the present disclosure may be used to inhibit or inhibit bacteria other than E. coli, including, but not limited to, Bacteroides thetaiotamicron (e.g., Bl), B. fragilis (e.g., ATCC 51477-B1, B40-8, Bf-1), B. caccae (e.g., phiHSCOI), B. ovatus (e.g., phiHSC02), Clostridium difficile (e.g., phiC2, phiC5, phiC6, phiCS, phiCD119, phiCD27), Klebsiella pneumoniae (e.g., KP01 K2, KI Contemplated herein are targeting Staphylococcus aureus (e.g., phiNMI, 80α), Enterococcus faecalis (e.g., IME-EF1), Enterococcus faecium (e.g., ENB6, C33), and Pseudomonas aeruginosa (e.g., phiKMV, PAK-P1, LKD16, LKA1, delta, sigma-1, Jl).

[0049]

[47] Thus, the bacteriophages of the present disclosure can target (e.g., specifically target) bacterial cells of any one or more of the bacterial genera and / or species listed above. Other bacterial cells and microorganisms can also be targeted.

[0050]

[48] An "endogenous" bacterial cell, as used herein, may refer to a non-pathogenic bacterium that is part of the normal internal ecosystem, e.g., the bacterial flora.

[0051]

[49] In yet another embodiment, the bacterial cell of the present disclosure is an anaerobic bacterial cell (e.g., a cell that does not require oxygen for growth). Anaerobic bacterial cells include facultative anaerobic cells, such as Escherichia coli, Shewanella oneidensis, and Listeria monocytogenes. Anaerobic bacterial cells also include obligate anaerobic cells, such as Bacteroides and Clostridium. In humans, for example, anaerobic bacterial cells are most commonly found in the gastrointestinal tract. Thus, the bacteriophage of the present disclosure may target (e.g., specifically target) anaerobic bacterial cells. Recombinant bacteriophage

[0052]

[50] Provided herein is a recombinant filamentous phage genome, comprising: LPESFDGDPASNTAPLQPEQLQVF (SEQ ID NO: 1), PESFDGDPASNTAPLQPEQLQ (SEQ ID NO: 2), QPEKVQTLEAWVIHGG (SEQ ID NO: 3), ISKRNIQFSCKNIYR (SEQ ID NO: 4), TFGSVEVHNL (SEQ ID NO:5), QTLEA (SEQ ID NO:6), IQFSC (SEQ ID NO: 7), and AFPEDRSQPG (SEQ ID NO: 8) Also provided is a recombinant filamentous phage genome comprising a nucleic acid encoding a polypeptide comprising a foreign peptide epitope, or a fragment or variant thereof, selected from the group consisting of:

[0053]

[51] In a particular embodiment of the recombinant phage, the foreign peptide epitope is functionally expressed on a coat protein selected from the group consisting of pIII, pVI, pVII, pVIII and pIX. In a particular embodiment of the recombinant phage, the coat protein is pIII. The term "functionally expressed" as used herein refers to the expression of the foreign peptide epitope such that the epitope is displayed on the surface of the phage and is capable of eliciting an immune response.

[0054]

[52] In further embodiments, the phage is a filamentous phage, such as M13, fd, IKe, CTX-φ, Pfl, Pf2, Pf3, f1, MKE; M13K3; Myoviridae (Pl-like viruses; P2-like viruses; Mu-like viruses; SPOI-like viruses; phiH-like viruses); Siphoviridae (lambda-like viruses, gamma-like viruses, Tl-like viruses; T5-like viruses; c2-like viruses; L5-like viruses; psiMl-like viruses; phiC31-like viruses). viridae (phi29-like viruses; P22-like viruses; N4-like viruses); Tectiviridae (Tectivirus); Corticoviridae (Corticovirus); Lipothrixviridae (Alphalipothrixvirus, Betalipovirus, Betalipothrixvirus, Gammalipothrixvirus, Deltalipothrixvirus; Plasmaviridae (Plasmavirus); Rudiviridae (Rudivirus); Fuselloviridae (Fusellovirus); Inoviridae (Inovirus, Plectrovirus, M13-like virus, fd-like virus); Microviridae (Microvirus, Spiromicrovirus, Bdellomicrovirus, Chlamydiamicrovirus);phage of the Leviviridae (Levivirus, Allolevivirus) and Cystoviridae (Cystovirus). In yet another embodiment, the phage is a filamentous phage selected from the group consisting of M13, fd, IKe, CTX-φ, Pfl, Pf2, Pf3, f1, MKE, and M13K3. In a particularly preferred embodiment, the phage is M13K3. In yet another embodiment, the recombinant phage produces IgG antibodies that bind to the foreign peptide epitope;

[0055]

[53] In certain embodiments of the present disclosure, nucleic acids encoding foreign peptide epitopes are recombinantly incorporated into natural, modified (e.g., rationally modified), or adaptively evolved bacteriophages for delivery to microbial cell populations, e.g., probiotic bacterial cells. Bacteriophages, or phages, are viruses that infect and grow in bacteria. Bacteriophages are composed of proteins that encapsulate a DNA or RNA genome and may have a relatively simple or complex structure. Their genomes may encode as few as four genes or as many as hundreds of genes. Bacteriophages replicate using either a lytic cycle, which results in lysis of the bacterial cell, or a lysogenic cycle (non-lytic cycle), which leaves the bacterial cell intact.

[0056]

[54] In some embodiments, the bacteriophage of the present disclosure is a non-lytic phage (also referred to as a temperate or temperate phage). The phrase "bacteria continuously produce temperate phage" as used herein refers to a non-lytic phage infection of bacteria, such as a probiotic bacterium as defined herein, in which recombinant temperate phage is actively secreted from the infected cell in the absence of lysis. Exemplary temperate (non-lytic) phages include, but are not limited to, filamentous phages, such as f1, M13, fd, IKe, CTX-φ, Pfl, Pf2, and Pf3. Thus, after introducing a foreign peptide epitope into a bacterial cell with a phage, the bacterial cell may remain viable and stably maintain expression of the antigenic epitope. In some embodiments, temperate bacteriophages can be used as delivery vehicles. Naturally temperate phages, when used in conjunction with phagemid systems, function as cargo shuttles and do not essentially lyse target cells.

[0057]

[55] Examples of non-lysogenic or non-lysogenic bacteriophages for use in accordance with the present disclosure include, but are not limited to, Myoviridae (Pl-like viruses; P2-like viruses; Mu-like viruses; SPOI-like viruses; phiH-like viruses); Siphoviridae (lambda-like viruses, gamma-like viruses, Tl-like viruses; T5-like viruses; c2-like viruses; L5-like viruses; psiMl-like viruses; phiC31-like viruses; N15-like viruses); Podoviridae (phi29-like viruses; P22-like viruses; N4-like viruses); Tectiviridae (Tectivirus); Corticoviridae (Corticovirus); Lipothrixviridae (Lipid viruses); viridae (Alphalipothrixvirus, Betalipothrixvirus, Gammalipothrixvirus, Deltalipothrixvirus); Plasmaviridae (Plasmavirus); Rudiviridae (Rudivirus); Fuselloviridae (Fusellovirus); Inoviridae (Inovirus, Plectrovirus, M13-like viruses, f1-like viruses); Microviridae (Microvirus, Spiromicrovirus, Bdellomicrovirus, Chlamydiamicrovirus);Included are those selected from the group consisting of phages of the Leviviridae (Levivirus, Allolevivirus) and Cystoviridae (Cystovirus). Such phages may be naturally occurring or modified phages. In some embodiments, the bacteriophage is an E. coli phage (e.g., a phage that infects E. coli). One of skill in the art will readily appreciate that other bacteriophages can be used in accordance with the present disclosure;

[0058]

[56] In certain embodiments, the bacteriophage used herein is a filamentous phage. Filamentous phages constitute a large family of bacterial viruses that infect many Gram-negative bacteria. Suitable well-known filamentous phages include, for example, fl, M13, fd, Ike, etc., which infect Escherichia coli. Phages fl, M13, and fd have been used in the past for filamentous phage display. Their genomes are more than 98% identical, and their gene products are interchangeable.

[0059]

[57] A unique aspect of filamentous phage assembly, in contrast to the assembly of many other bacteriophages, is that it is a secretory process. Incorporation of the coat polypeptide into the growing phage occurs at the cytoplasmic membrane, and the nascent phage is extruded from the cell upon assembly. The E. coli cell does not lyse during this process. It is well known to those skilled in the art that five viral coat proteins (pIII, pVI, pVII, pVIII, pIX) are inserted into the cytoplasmic membrane before being incorporated into the phage particle. For example, the majority of pIII translocates across the membrane to the periplasm, while its C-terminal hydrophobic tail anchors the protein within the membrane.

[0060]

[58] In another embodiment, the bacteriophage used to prepare the recombinant phage according to the invention is M13 bacteriophage. M13 is a filamentous bacteriophage of the Inoviridae family, composed of a circular single-stranded DNA. M13 phage is about 900 nm long, 6-7 nm in diameter, and composed of five proteins. A minor coat protein, P3, is attached to a receptor at the tip of the F pilus of the E. coli host cell. Thus, in a particular embodiment, the probiotic vaccine according to the invention and its use in a method for treating or preventing cancer comprises delivering to a bacterial cell a recombinant M13 bacteriophage according to the invention, modified to functionally express at least one foreign peptide epitope in one of its coat proteins selected from the group consisting of pIII, pVI, pVII, pVIII, and pIX. In a particular embodiment, the foreign peptide epitope is functionally expressed in gene pIII of the M13 bacteriophage.

[0061]

[59] Bacteriophages for use herein can be isolated from any environment in which bacteria reside. In some embodiments, recombinant bacteriophages of the invention are isolated (e.g., harvested, obtained) from fecal or sewage, terrestrial or marine environments. Treatment method cancer

[0062]

[60] Also provided herein is a method for preventing or treating cancer or an infectious disease, comprising administering to a patient in need thereof a probiotic vaccine according to the invention as described herein or a recombinant phage according to the invention as described herein.

[0063]

[61] The term "cancer" or grammatical variations thereof, as used herein, refers to a malignant neoplasm. In particular, the term "cancer" refers to any member of a class of diseases or disorders characterized by the uncontrolled division of cells and the ability of these cells to invade other tissues, either by growing directly into adjacent tissues by invasion, or by seeding at distant sites by metastasis. Metastasis is defined as the stage at which cancer cells are carried through the bloodstream or lymphatic system. In certain embodiments, the cancer is multiple myeloma, epithelial cancer, epithelial ovarian cancer, mucosal melanoma, non-small cell lung cancer, melanoma, head and neck cancer, renal cell carcinoma, Hodgkin's lymphoma, cutaneous squamous cell carcinoma, glioblastoma, esophageal cancer, gastric cancer, duodenal cancer, small intestine cancer, appendix cancer, large intestine cancer, colon cancer, rectal cancer, colorectal cancer, anal cancer, pancreatic cancer, liver cancer, gallbladder cancer, spleen cancer, kidney cancer, bladder cancer, prostate cancer, testicular cancer, uterine cancer, endometrial cancer, ovarian cancer, vaginal cancer, vulvar cancer, breast cancer, lung cancer, thyroid cancer, thymic cancer, brain cancer, The cancer is selected from the group consisting of tumors, nervous system cancers, gliomas, oral cancers, skin cancers, blood cancers, lymphomas, eye cancers, osteosarcoma, myeloma, muscle cancers, non-small cell lung cancer (NSCLC), head and neck squamous cell carcinoma (HNSCC), urothelial cancer, non-muscle invasive bladder cancer [NMIBC], colon or rectal cancer, esophageal cancer or certain gastroesophageal junction (GEJ) cancers, cervical cancer, renal cell carcinoma (RCC), advanced endometrial cancer, cutaneous squamous cell carcinoma (cSCC), and / or triple negative breast cancer (TNBC), etc. In certain embodiments, the cancer is multiple myeloma.

[0064]

[62] In certain embodiments, as described above, provided herein is a method for preventing or treating breast cancer, bladder cancer, pancreatic cancer, ovarian cancer, and / or gastric cancer, comprising administering to a patient in need thereof a recombinant phage or probiotic vaccine comprising at least one foreign peptide epitope selected from LPESFDGDPASNTAPLQPEQLQVF (SEQ ID NO: 1) or PESFDGDPASNTAPLQPEQLQ (SEQ ID NO: 2), or a fragment or variant thereof.

[0065]

[63] In another embodiment, there is provided a method of preventing or treating multiple myeloma, as described above, comprising administering to a patient in need thereof a recombinant phage or probiotic vaccine comprising at least one foreign peptide epitope, or a fragment or variant thereof, selected from QPEKVQTLEAWVIHGG (SEQ ID NO: 3), ISKRNIQFSCKNIYR (SEQ ID NO: 4), TFGSVEVHNL (SEQ ID NO: 5), QTLEA (SEQ ID NO: 6), and IQFSC (SEQ ID NO: 7).

[0066]

[64] In another embodiment of using PD-1 foreign peptide epitopes in the treatment of cancer, at least one foreign peptide epitope corresponding to AFPEDRSQPG (SEQ ID NO:8), or a fragment or variant thereof, can treat or prevent PD-1 mediated cancers, such as mucosal cancer, gastric cancer, melanoma, non-small cell lung cancer (NSCLC), head and neck squamous cell carcinoma (HNSCC), urothelial cancer, non-muscle invasive bladder cancer [NMIBC], colon or rectal cancer, esophageal cancer or certain gastroesophageal junction (GEJ) cancers, cervical cancer, renal cell carcinoma (RCC), advanced endometrial cancer, cutaneous squamous cell carcinoma (cSCC), and / or triple negative breast cancer (TNBC). In another embodiment, the foreign peptide epitope comprises AFPEDRSQPG (SEQ ID NO:8) with no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 amino acid substitution(s) in SEQ ID NO:8. Thus, provided herein is a method of preventing or treating cancer, comprising administering to a patient in need thereof a recombinant phage or probiotic vaccine comprising at least one foreign peptide epitope corresponding to AFPEDRSQPG (SEQ ID NO: 8), or a fragment or variant thereof, wherein the cancer is selected from the group consisting of gastric cancer, melanoma, non-small cell lung cancer (NSCLC), head and neck squamous cell carcinoma (HNSCC), urothelial carcinoma, non-muscle invasive bladder cancer [NMIBC], colon or rectal cancer, esophageal or certain gastroesophageal junction (GEJ) cancer, cervical cancer, renal cell carcinoma (RCC), advanced endometrial cancer, cutaneous squamous cell carcinoma (cSCC), and / or triple-negative breast cancer (TNBC). Infectious Disease

[0067]

[65] Viral hemorrhagic fevers (VHFs) are a group of clinically similar diseases that can be caused by enveloped RNA viruses primarily selected from the families Arenaviridae, Filoviridae, Hantaviridae, and Flaviviridae. Clinically, the group of diseases share in common fever, fatigue, dizziness, myalgia, and other associated symptoms that can progress to vascular leakage, hemorrhage, and multiple organ failure. See, e.g., Perdomo-Celis et al., Vaccines 2019, 7(1), 11; …doi.org / 10.3390 / vaccines7010011; which is incorporated by reference in its entirety for all purposes.

[0068]

[66] VHFs can be transmitted from person to person through direct contact with contaminated body fluids or tissues. Many of them are also zoonotic in nature, with each virus spreading through different mechanisms. Some of them are transmitted through ingesting raw meat or body fluids from infected animals, direct contact with rats or bats, or inhalation or contact with materials contaminated with rat feces. Others are vector-borne diseases transmitted through the bite of infected mosquitoes or ticks. These diseases are clinically diverse, ranging from asymptomatic to severe illness and death, and progress rapidly within hours to days. The lack of approved specific treatments contributes to the disease burden and unfavorable clinical outcomes.

[0069]

[67] In another embodiment, as described above, there is provided herein a method for preventing infection and / or symptoms of Korean fever virus (e.g., Hantaviridae or Hantavirus) belonging to the genus coronavirus, such as Hantaviridae or Hantavirus, such as viral hemorrhagic fever (VHF), comprising administering to a patient in need thereof a recombinant phage or probiotic vaccine comprising at least one foreign peptide epitope, or a fragment or variant thereof, selected from QPEKVQTLEAWVIHGG (SEQ ID NO: 3), ISKRNIQFSCKNIYR (SEQ ID NO: 4), TFGSVEVHNL (SEQ ID NO: 5), QTLEA (SEQ ID NO: 6), and IQFSC (SEQ ID NO: 7). Administration of probiotic vaccines

[0070]

[68] The probiotic vaccine of the present invention can be delivered to a patient (e.g., a patient with cancer) or a laboratory animal by any suitable delivery route. In some embodiments, live probiotic bacterial cells can be delivered in vivo via fermented dairy products and / or probiotic-enriched foods. Exemplary delivery foods can be selected from probiotic solutions, gummies, tablets, yogurt, pickled vegetables, fermented bean pastes (e.g., tempeh, miso, doenjang), kefir, buttermilk or carnemelk, kimchi, pao tsai, sauerkraut, soy sauce, za tsai, and the like. In other embodiments, the probiotic bacteria can be delivered in vivo as tablets, capsules, powders and / or sachets containing freeze-dried bacteria.

[0071]

[69] In other embodiments, the probiotic vaccines of the present invention can be administered to a patient by injection, infusion, inoculation, direct surgical administration, or any combination thereof. In some embodiments, the probiotic vaccines are administered to humans in the deltoid or axillary region. For example, the vaccines are administered as intradermal injections in the axillary region. In other embodiments, the vaccines are administered intravenously.

[0072]

[70] A suitable carrier for administering cells can be selected by a person skilled in the art through routine techniques.For example, the pharmaceutical carrier can be a buffered saline, such as a cell culture medium, and can contain DMSO to maintain cell viability.In certain embodiments, the cells are administered in an injectable cryopreservation medium.The composition containing cells can contain DMSO and hexastarch as cryoprotectants, and Plasmalyte A and / or dextrose solution as protein components, and human serum albumin as protein components.

[0073]

[71] The amount of probiotic vaccine to administer to a patient as a cancer vaccine to practice the methods described herein, and the most convenient route of such administration, will depend on a variety of factors, as will the formulation of the vaccine itself. These factors include the physical characteristics of the patient (e.g., age, weight, sex), the physical characteristics of the tumor (e.g., location, size, growth rate, accessibility), and the extent to which other therapeutic modalities (e.g., chemotherapy, radiation therapy) have been administered in relation to the overall treatment plan. While there are a wide variety of factors to consider when practicing the methods of the present invention to prevent or therapeutically treat cancer or infectious diseases, a mammal, preferably a human, can be administered a single dose of about 5×10 IgG in about 0.05 mL to about 2 mL of solution (e.g., saline). 6 ~about 2×10 8 In another embodiment, a mammal, preferably a human, may be administered about 1×10 probiotic vaccine cells. 3 ~Approx. 1×1015 , 1×10 4 ~Approx. 1×10 14 , 1×10 5 ~Approx. 1×10 13 , 1×10 5 ~Approx. 1×10 12 , 1×10 5 ~ approx. 1x10 11 , 1x10 5 ~ approx. 1x10 10 , 1x10 5 ~ approx. 1x10 9 , 1x10 5 ~ approx. 1x10 8 , 1x10 6 ~ approx. 1x10 12 , 1x10 6 ~ approx. 1x10 11 , 1x10 6 ~ approx. 1x10 10 , 1x10 6 ~ approx. 1x10 9 , 1x10 6 ~ approx. 1x10 8 In one administration, the probiotic vaccine cells may be administered in a volume of about 0.05 mL to about 2 mL of a solution (for example, physiological saline).

[0074]

[72] Additional doses may be administered depending on the factors listed above and other factors such as the severity of the tumor pathology. In a further embodiment, about 1x10 4 / ml, approx. 1x10 5 / ml, approx. 1x10 6 / ml, approx. 1x10 7 / ml, approx. 1x10 8 / ml, approx. 1x10 9 / ml, approx. 1x10 10 / ml, approx. 1x10 11 / ml, approx. 1x10 12 / ml, approx. 1x10 13 / ml, approx. 1x10 14 / ml, approx. 1x10 15 About 1 to about 5 administrations of about 1x10 / ml of probiotic vaccine cells are administered at 2 week intervals. 8About 1 to about 5 doses of 1 ml of probiotic vaccine cells are administered at 2-week intervals. Concomitant treatment

[0075]

[73] The probiotic vaccination provided herein can be combined with other treatments. For example, patients receiving the probiotic vaccination of the present invention can also receive chemotherapy, immuno-oncology therapy, radiation therapy, and / or surgery directly and / or before, simultaneously, or after the probiotic vaccination. Chemotherapy is used to shrink and slow the growth of cancer. Chemotherapy is recommended for many cancers after the initial surgery for the cancer, but sometimes chemotherapy is administered before surgery to shrink the cancer. The number of cycles of chemotherapy treatment varies depending on the stage of the disease. Chemotherapy may neutralize the anti-tumor immune response generated by vaccine therapy. In addition, chemotherapy can be safely combined with immunotherapy, as long as the combination is rationally designed, possibly with additive or synergistic effects. Examples of chemotherapeutic agents that can be used to treat patients with cancer include, but are not limited to, carboplatin, cisplatin, cyclophosphamide, docetaxel, doxorubicin, etoposide, gemcitabine, oxaliplatin, paclitaxel, TAXOL®, topotecan, and vinorelbine. In some embodiments, the patient receiving the probiotic vaccination has already undergone chemotherapy, radiation therapy, and / or surgery for gynecological or peritoneal cancer. Immunotherapy (immuno-oncology therapy) refers to generating, promoting, and / or modulating an immune response by inducing the production of selected targets, such as TNF, and antibodies against such targets. Immunotherapies for use in combination with the probiotic vaccines of the present invention (or the recombinant phages of the present invention) include treatment with KEYTRUDA® (pembrolizumab), OPDIVO® (nivolumab), and the like.

[0076]

[74] In addition to or in addition to chemotherapeutic treatment, patients receiving the probiotic vaccine of the present invention can be treated with other treatments that are beneficial for the particular cancer. For example, patients with ovarian, fallopian tube, or peritoneal cancer can be treated with a COX-2 inhibitor, such as those described in WO2005 / 037995 by Yu and Akasaki, before, simultaneously, or after the probiotic vaccination of the present invention. In another embodiment, patients receiving the probiotic vaccine of the present invention can be treated with bevacizumab (Avastin®) before, simultaneously, or after the probiotic vaccination.

[0077]

[75] Also provided herein is a kit comprising a probiotic vaccine or a recombinant phage according to the invention and instructions for administration of said probiotic vaccine or said recombinant phage. EXAMPLES

[0078]

[76] The following examples are provided to better illustrate the disclosure of the claims and should not be interpreted as limiting the scope of the disclosure.To the extent that specific materials are mentioned, they are merely for illustrative purposes and are not intended to limit the scope of the disclosure.Those skilled in the art can develop equivalent means or reactants without exerting the inventive capacity and without departing from the scope of the disclosure. material and method Example 1 - HER2 epitope-containing probiotic vaccine:

[0079]

[77] Here, a bacteriophage oral vaccine is provided that contains a HER2 epitope functionally expressed on M13KE phage infecting Nissle 1917 E. coli cells. Specifically, the HER2 epitope is incorporated into the coat protein genes of MKE, fl and / or M13 bacteriophage, resulting in a vaccination that overcomes immunological resistance to HER2. The carrier acts as an adjuvant, improving epitope stability and B cell presentation.

[0080]

[78] It was found that antibodies against two distinct regions at the N-terminus and C-terminus of the fragment exhibited growth inhibitory activity. Epitope mapping of the C-terminal antibodies revealed that a 24 amino acid region containing two distinct epitopes (LPESFDGDPASNTAPLQPEQLQVF) mediated efficient growth inhibition. These results indicate that antibodies targeting this region of domain III of HER2 bind to HER2 on live cells and exhibit growth inhibition, unlike the well-known monoclonal antibodies trastuzumab and pertuzumab.

[0081]

[79] In a specific embodiment of the invention provided herein, the P4378-394 B cell epitope (PESFDGDPASNTAPLQPEQLQ) from the extracellular domain of HER2 was presented by insertion into gene III (i.e., pIII) of filamentous phage. Previously, preclinical studies have shown that immunization with the P4378-394 epitope as a single epitope or multi-epitope formulation induces HER2-specific IgG antibodies with strong anti-tumor activity. Furthermore, a clinical phase I trial using a multi-epitope vaccine containing the P4378-394 epitope showed that the vaccine was safe, well tolerated, and effective in overcoming immunological resistance to HER2.

[0082]

[80] An mRNA sequence encoding the amino acid sequence of -ESFDGDPASNTAPLQPEQL- was inserted between the pIII signal peptide and pIII protein coding sequences of M13KE RF I DNA to construct M13KE-RF I DNA, as described in Example 3 below. Preparation of M13KE vector

[0083]

[81] E. coli ER2738 was infected with M13KE phage during logarithmic growth phase. After incubation, bacteria were collected by centrifugation and used for plasmid extraction with Axygen MidiPrep Plasmid Extraction Kit. M13KE RF I DNA was further purified and then loaded onto agarose gel for QC.

[0084]

[82] M13KE RF I DNA was digested with Kpn 1 / Eag I and then separated by agarose gel electrophoresis. Construction of M13KE-HER2 phage

[0085]

[83] DNA encoding the HER2 epitope was synthesized, digested with Kpn 1 / Eag I, and ligated with M13KE RF I DNA. The HER2-M13KE RF I DNA construct was transformed into competent cells of E. coli ER2738. After resuscitation, they were infected with logarithmic-phase E. coli ER2738 and cultured overnight at 32°C on TOP agar LB plates containing IPTG / X-gal. As a result, many blue spots were observed on the plate where M13KE-HER2 was transformed into E. coli ER2738, but no blue spots were observed in the control group. Several blue spots were selected and verified by sequencing. The results showed that all clones had the correct construct corresponding to the mRNA sequence of GAATCATTTGACGGAGATCCCGCTAGTAACACCGCGCCGCTGCAGCCGGAGCAGTTG. Preparation of phages

[0086]

[84] Logarithmic growth phase E. coli ER2738 was infected with M13KE phage carrying the correct HER2 epitope sequence. After overnight incubation, the culture supernatant was harvested, supplemented with glycerol to a final concentration of 10%, and stored at -20°C.

[0087]

[85] The M13K3-HER2 phage described above is used to infect Nissle 1917 E. coli, which is confirmed to be male and used as a probiotic. The bacteria carrying the bacteriophage that infects this Nissle bacterium and expresses the HER2 epitope are then used as a probiotic oral vaccine for the patient to generate anti-HER2 antibodies against his or her cancer (e.g., breast cancer, bladder cancer, pancreatic cancer, ovarian cancer, and / or gastric cancer). A probiotic phage (e.g., phage + E. coli) containing the epitope described above is produced. Although oral administration of the M113KE-HER2 probiotic is contemplated herein to generate IgA and IgG antibodies in the patient, injection of the phage alone (separate from the probiotic bacteria) can generate IgG in the patient that has reactivity against HER2 on the patient's human cancer cells. Example 2 - Construction of a CD38 epitope-containing probiotic vaccine:

[0088]

[86] An mRNA sequence encoding the amino acid sequence of QPEKVQTLEAWVIHGG (SEQ ID NO:3), ISKRNIQFSCKNIYR (SEQ ID NO:4), TFGSVEVHNL (SEQ ID NO:5), QTLEA (SEQ ID NO:6), and / or IQFSC (SEQ ID NO:7) is inserted between the pIII signal peptide and pIII protein coding sequences of M13KE-RF I DNA to construct M13KE-RF I DNA. Preparation of M13KE vector

[0089]

[87] E. coli ER2738 is infected with M13KE phage during logarithmic growth phase. After incubation, bacteria are collected by centrifugation and used for plasmid extraction with Axygen MidiPrep Plasmid Extraction Kit. M13KE RF I DNA is further purified and then loaded onto an agarose gel for QC.

[0090]

[88] M13KE RF I DNA is digested with Kpn 1 / Eag I and then separated by agarose gel electrophoresis. Construction of M13KE-CD38 phage

[0091]

[89] DNA encoding CD38 epitopes (QPEKVQTLEAWVIHGG (SEQ ID NO: 3), ISKRNIQFSCKNIYR (SEQ ID NO: 4), TFGSVEVHNL (SEQ ID NO: 5), QTLEA (SEQ ID NO: 6), and / or IQFSC (SEQ ID NO: 7)) is synthesized, digested with Kpn 1 / Eag I, and ligated with M13KE RF I DNA. The HER2-M13KE RF I DNA constructs are transformed into E. coli ER2738 competent cells. After recovery, they are infected with E. coli ER2738 in logarithmic growth phase and cultured overnight at 32°C on TOP agar LB plates containing IPTG / X-gal. As a result, many blue spots appear on the plate where M13KE-CD38 was transformed into E. coli ER2738, but no blue spots are observed in the control group. Several blue spots are selected and verified by sequencing. As a result, all clones were found to have the following sequence: QPEKVQTLEAWVIHGG (SEQ ID NO: 3); It is shown to have the correct construct corresponding to the mRNA sequence encoding ISKRNIQFSCKNIYR (SEQ ID NO: 4), TFGSVEVHNL (SEQ ID NO: 5), QTLEA (SEQ ID NO: 6), and / or IQFSC (SEQ ID NO: 7). Preparation of phages

[0092]

[90] Logarithmic-phase E. coli ER2738 was infected with M13KE phage carrying the correct CD38 foreign peptide epitope. After overnight incubation, the culture supernatant was harvested, supplemented with glycerol to a final concentration of 10%, and stored at -20°C.

[0093]

[91] The M13K3-CD38 phage is used to infect Nissle 1917 E. coli, which is used as a probiotic. The bacteria carrying the bacteriophage that infects the Nissle bacteria and expresses the CD38 epitope are then used as a probiotic oral vaccine for the patient to generate anti-CD38 antibodies against his or her cancer (e.g., multiple myeloma). A probiotic phage (e.g., phage + E. coli) containing the epitope is produced. Although oral administration of the M113KE-CD38 probiotic is contemplated herein to generate both IgA and IgG anti-CD38 antibodies in the patient, injection of the phage alone (separate from the probiotic bacteria) can generate IgG in the patient that has reactivity against CD38 on the patient's human cancer cells. Example 3 - Construction of a probiotic vaccine containing PD-1 / AFP10 epitope:

[0094]

[92] An mRNA sequence encoding the amino acid sequence of -AFPEDRSQPG- (SEQ ID NO: 8, referred to herein as "AFP10") was inserted between the pIII silin signal peptide and the pIII protein coding sequence of M13KE RF I DNA to construct M13KE-AFP10 RF I DNA, the sequence information of which is shown in FIG. 1. Preparation of M13KE vector

[0095]

[93] E. coli ER2738 was infected with M13KE phage during logarithmic growth phase. After incubation, bacteria were collected by centrifugation and used for plasmid extraction with Axygen MidiPrep Plasmid Extraction Kit. M13KE RF I DNA was further purified and then loaded onto agarose gel for QC.

[0096]

[94] M13KE RF I DNA was digested with Kpn 1 / Eag I and then separated by agarose gel electrophoresis. Construction of M13KE-AFP10 phage

[0097]

[95] DNA encoding the AFP10 epitope was synthesized, digested with Kpn 1 / Eag I, and ligated with M13KE RF I DNA. The AFP10-M13KE RF I DNA construct was transformed into competent cells of E. coli ER2738. After resuscitation, they were infected with logarithmic-phase E. coli ER2738 and cultured overnight at 32°C on TOP agar LB plates containing IPTG / X-gal. As a result, many blue spots were observed on the plate where M13KE-AFP10 was transformed into E. coli ER2738, but no blue spots were observed in the control group. Several blue spots were selected and verified by sequencing. The results showed that all clones had the correct construct corresponding to the correct mRNA sequence. Preparation of phages

[0098]

[96] Exponentially growing E. coli ER2738 was infected with M13KE phage containing the correct AFP10 epitope sequence. After overnight incubation, the culture supernatant was harvested, glycerol was added to a final concentration of 10%, and then stored at -20°C.

[0099]

[97] The M13K3-AFP10 phage described above is used to infect Nissle 1917 E. coli and used as a probiotic. The bacteria carrying the bacteriophage that infects the Nissle bacterium and expresses the AFP10 epitope are The probiotic oral vaccine is used in the patient to generate PD-1 antibodies against his or her cancer, such as gastric cancer, melanoma, non-small cell lung cancer (NSCLC), head and neck squamous cell carcinoma (HNSCC), urothelial cancer, non-muscle invasive bladder cancer [NMIBC]), colon or rectal cancer, esophageal cancer or certain gastroesophageal junction (GEJ) cancer, cervical cancer, renal cell carcinoma (RCC), advanced endometrial cancer, cutaneous squamous cell carcinoma (cSCC), and / or triple-negative breast cancer (TNBC). A probiotic phage (i.e., phage + E. coli) containing the above epitopes is produced. Although oral administration of M113KE-AFP10 probiotic is contemplated herein to generate IgA and IgG anti-PD-1 antibodies in the patient, injection of the phage alone (separate from the probiotic bacteria) can generate IgG in the patient with reactivity against PD-1 on the patient's human cancer cells.

[0100]

[98] The above description of the disclosed embodiments is provided to enable those skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles described herein may be applied to other embodiments without departing from the spirit or scope of the present invention. It is therefore understood that the description and drawings presented herein represent presently preferred embodiments of the invention, and thus represent the subject matter broadly contemplated by the present invention. Moreover, it is understood that other embodiments that may become obvious to those skilled in the art are fully within the scope of the present invention, and thus the scope of the present invention is not limited thereto.

Claims

1. A probiotic vaccine comprising: (i) LPESFDGDPASNTAPLQPEQLQVF (SEQ ID NO: 1); PESFDGDPASNTAPLQPEQLQ (SEQ ID NO: 2), QPEKVQTLEAWVIHGG (SEQ ID NO: 3), ISKRNIQFSCKNIYR (SEQ ID NO: 4), TFGSVEVHNL (SEQ ID NO: 5), QTLEA (SEQ ID NO: 6), IQFSC (SEQ ID NO: 7), and A recombinant filamentous phage genome comprising a nucleic acid encoding a polypeptide comprising a foreign peptide epitope selected from the group consisting of: AFPEDRSQPG (SEQ ID NO: 8), or a fragment or variant thereof; (ii) bacteria infected with the recombinant phage; Probiotic vaccines, including:

2. 2. The probiotic vaccine of claim 1, wherein the foreign peptide epitope is functionally expressed on a coat protein selected from the group consisting of pIII, pVI, pVII, pVIII and pIX, preferably the coat protein is pIII.

3. Phages include filamentous phage, including M13, fd, IKe, CTX-φ, Pfl, Pf2, Pf3, f1, and MKE; M13K3; Myoviridae (Pl-like viruses; P2-like viruses; Mu-like viruses; SPOI-like viruses; phiH-like viruses); Siphoviridae (λ-like viruses; γ-like viruses; Tl-like viruses; T5-like viruses; c2-like viruses; L5-like viruses; psiMl-like viruses; phiC31-like viruses; N15-like viruses). Podoviridae (phi29-like viruses; P22-like viruses; N4-like viruses); Tectiviridae (Tectiviruses); Corticoviridae (Corticoviruses); Lipothrixviridae (Alphalipothrixviruses, Betalipothrixviruses) Betalipothrixvirus, Gammalipothrixvirus, Deltalipothrixvirus); Plasmaviridae (Plasmavirus); Rudiviridae (Rudivirus); Fuselloviridae (Fuselovirus) Ilovirus); Inoviridae (Inovirus, Plectrovirus, M13-like virus, fd-like virus); Microviridae (Microvirus, Spiromicrovirus, Bdellomicrovirus, Chlamydiamicrovirus);3. The probiotic vaccine according to claim 1 or 2, which is selected from the group consisting of phages of the Leviviridae (Levivirus, Allolevivirus) and Cystoviridae (Cystovirus) families, preferably M13K3.

4. The bacterium is selected from the group consisting of E. coli Nissle 1917, E. coli ER2738, Bacillus amyloliquefaciens; Bacillus polyfermenticus, strain Bispan; Bifidobacterium animalis subsp. lactis, strain BB-12; Bifidobacterium animalis subsp. lactis, strain BB-12; Lactis, strain GPS1209; Bifidobacterium animalis subsp. lactis, strain HN019 (DR1064); Bifidobacterium bifidum, strain BB-12; Bifidobacterium bifidum, strain Rosell-71; Bifidobacterium breve, strain M-16V; Bifidobacterium longum longum); Bifidobacterium thermophilum; Lactobacillus acidophilus, La-1 strain; Lactobacillus brevis, HA-112 strain; Lactobacillus fermentum, HA-179 strain; Lactobacillus helveticus, Lafti L10 strain; Lactobacillus helveticus, Rosell-52 strain; Lactobacillus paracasei, Lafti L26 strain; Lactobacillus paracasei subsp. paracasei, 431 strain; Lactobacillus rhamnosusrhamnosus, strain HN001 (DR20); Streptococcus salivarius, strain DSM 13084; Streptococcus thermophilus; Bacillus coagulans, GBI-30, 6086, Bifidobacterium animalis subsp. lactis BB-12, Bifidobacterium longum subsp. infantis longum subsp. infantis), Escherichia coli Nissle 1917, Lactobacillus acidophilus NCFM, Lactobacillus paracasei Sti1 (or NCC2461), Lactobacillus johnsonii Lai (also called Lactobacillus LCI or Lactobacillus johnsonii NCC533), Lactobacillus plantarum plantarum 299v, Lactobacillus reuteri ATCC 55730 (Lactobacillus reuteri SD2112), Lactobacillus reuteri Protectis (DSM 17938, daughter strain of ATCC 55730), Lactobacillus reuteri Prodentis (combination of DSM 17938 / ATCC 55730 and ATCC PTA 5289), Lactobacillus rhamnosus GG, Saccharomyces boulardii, a mixture of Lactobacillus rhamnosus GR-1 and Lactobacillus reuteri RC-14, Lactobacillus acidophilus NCFM and Bifidobacterium bifidum3. The probiotic vaccine according to claim 1, wherein the bacterium is selected from the group consisting of a mixture of Lactobacillus acidophilus CL1285 and Lactobacillus casei LBC80R, a mixture of Lactobacillus plantarum HEAL 9 and Lactobacillus paracasei 8700:2, Lactobacillus bulgaricus, Lactococcus thermophilus, and Lactobacillus bifidus, preferably the bacterium is F factor positive and is selected from Escherichia coli Nissle 1917 or Escherichia coli ER2738, and / or the probiotic vaccine produces both IgG and IgA antibodies that bind to the foreign peptide epitope.

5. 1. A recombinant filamentous phage genome, comprising: LPESFDGDPASNTAPLQPEQLQVF (SEQ ID NO: 1), PESFDGDPASNTAPLQPEQLQ (SEQ ID NO: 2), QPEKVQTLEAWVIHGG (SEQ ID NO: 3), ISKRNIQFSCKNIYR (SEQ ID NO: 4), TFGSVEVHNL (SEQ ID NO: 5), QTLEA (SEQ ID NO: 6), IQFSC (SEQ ID NO: 7), and AFPEDRSQPG (SEQ ID NO: 8) a recombinant filamentous phage genome comprising a nucleic acid encoding a polypeptide comprising a foreign peptide epitope, or a fragment or variant thereof, selected from the group consisting of:

6. 6. The recombinant phage of claim 5, wherein the foreign peptide epitope is functionally expressed on a coat protein selected from the group consisting of pIII, pVI, pVII, pVIII and pIX, and preferably the coat protein is pIII.

7. The phage (i) filamentous phages, including M13, fd, IKe, CTX-φ, Pfl, Pf2, Pf3, f1, and MKE; M13K3; Myoviridae (Pl-like viruses; P2-like viruses; Mu-like viruses; SPOI-like viruses; phiH-like viruses); Siphoviridae (λ-like viruses; γ-like viruses; Tl-like viruses; T5-like viruses; c2-like viruses; L5-like viruses; psiMl-like viruses; phiC31-like viruses; N15-like viruses); Podoviridae (phi29-like viruses; P22-like viruses; N4-like viruses); Tectiviridae (Tectiviruses); Corticoviridae (Corticoviruses); Lipothrixviridae (Alphalipothrixviruses, Betalipothrixviruses) Betalipotrixvirus, Gammalipothrixvirus, Deltalipothrixvirus); Plasmaviridae (Plasmavirus); Rudiviridae (Rudivirus); Fuselloviridae (Fuselovirus); Inoviridae (Inovirus, Plectrovirus, M13-like virus, fd-like virus); Microviridae (Microvirus, Spiromicrovirus, Bdellomicrovirus, Chlamydiamicrovirus);selected from the group consisting of phages of the Leviviridae (Levivirus, Allolevivirus) and Cystoviridae (Cystovirus) families, preferably a filamentous phage selected from the group consisting of M13, fd, IKe, CTX-φ, Pfl, Pf2, Pf3, f1, MKE, and M13K3, more preferably M13K3; and / or (ii) The recombinant phage of claim 5 or 6, wherein the recombinant phage produces an IgG antibody that binds to the foreign peptide epitope.

8. A probiotic vaccine according to claim 1 or 2 or one or more recombinant phages according to claim 5 or 6 for preventing or treating cancer.

9. Cancers include multiple myeloma, epithelial cancer, epithelial ovarian cancer, mucosal melanoma, non-small cell lung cancer (NSCLC), melanoma, head and neck cancer, renal cell carcinoma, Hodgkin's lymphoma, cutaneous squamous cell carcinoma, glioblastoma, esophageal cancer, stomach cancer, duodenal cancer, small intestine cancer, appendix cancer, colon cancer, rectal cancer, colorectal cancer, anal cancer, pancreatic cancer, liver cancer, gallbladder cancer, spleen cancer, kidney cancer, bladder cancer, prostate cancer, testicular cancer, uterine cancer, endometrial cancer, ovarian cancer, vaginal cancer, vulvar cancer, breast cancer, lung cancer, thyroid cancer, thymus cancer, brain tumors, nervous system cancer, glioma, oral cancer, 9. The probiotic vaccine or one or more recombinant phages of claim 8, wherein the cancer is selected from the group consisting of skin cancer, blood cancer, lymphoma, eye cancer, osteosarcoma, myeloma, muscle cancer, head and neck squamous cell carcinoma (HNSCC), urothelial cancer, non-muscle-invasive bladder cancer (NMIBC), rectal cancer, esophageal cancer or certain gastroesophageal junction (GEJ) cancer, cervical cancer, renal cell carcinoma (RCC), advanced endometrial cancer, cutaneous squamous cell carcinoma (cSCC), and / or triple-negative breast cancer (TNBC), preferably multiple myeloma.

10. A recombinant phage or probiotic vaccine comprising at least one foreign peptide epitope selected from LPESFDGDPASNTAPLQPEQLQVF (SEQ ID NO: 1) or PESFDGDPASNTAPLQPEQLQ (SEQ ID NO: 2), or a fragment or variant thereof, for preventing or treating breast cancer, bladder cancer, pancreatic cancer, ovarian cancer, and / or gastric cancer.

11. (i) for the prevention or treatment of cancer, including leukemia, lymphoma, myeloma, multiple myeloma, and / or chronic lymphocytic leukemia (CLL); or (ii) To prevent Korean fever virus infection; A recombinant phage or probiotic vaccine comprising at least one foreign peptide epitope, or a fragment or variant thereof, selected from QPEKVQTLEAWVIHGG (SEQ ID NO: 3), ISKRNIQFSCKNIYR (SEQ ID NO: 4), TFGSVEVHNL (SEQ ID NO: 5), QTLEA (SEQ ID NO: 6), and IQFSC (SEQ ID NO: 7).

12. A recombinant phage or probiotic vaccine comprising at least one foreign peptide epitope corresponding to AFPEDRSQPG (SEQ ID NO: 8), or a fragment or variant thereof, for preventing or treating cancer, wherein the cancer is selected from the group consisting of gastric cancer, melanoma, non-small cell lung cancer (NSCLC), head and neck squamous cell carcinoma (HNSCC), urothelial cancer, non-muscle-invasive bladder cancer (NMIBC), colon or rectal cancer, esophageal or certain gastroesophageal junction (GEJ) cancer, cervical cancer, renal cell carcinoma (RCC), advanced endometrial cancer, cutaneous squamous cell carcinoma (cSCC), and / or triple-negative breast cancer (TNBC).

13. 3. The probiotic vaccine of claim 1 or 2, wherein the bacterium continuously produces lysogenic phages.

14. 7. The probiotic vaccine of claim 1 or 2, or the probiotic vaccine of claim 5 or 6, wherein -TSGSGSGSGSGSGSG- is used as a linker between the coat protein and the foreign peptide epitope.

15. A kit comprising the probiotic vaccine of claim 1 or 2 or the probiotic vaccine of claim 5 or 6 and instructions for administration of said probiotic vaccine or said recombinant phage.