Method for improving expression level of botulinum toxin light chain

By constructing a recombinant expression system of the wild-type lysis tag NT11 and its mutant mut7 in Escherichia coli and combining it with the overexpression of the molecular chaperone htpG, the problem of efficient expression of botulinum toxin light chain in host bacteria was solved, realizing an efficient and simplified production process and high-activity expression.

CN121717869APending Publication Date: 2026-03-24BEIJING UNIV OF CHEM TECH
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-24
Publication Date
2026-03-24

AI Technical Summary

Technical Problem

In existing technologies, type A botulinum toxin light chains are difficult to express efficiently in host bacteria, and the use of traditional lysis-promoting tags requires subsequent enzymatic digestion, which increases process costs and complexity.

Method used

Using the wild-type fusion tag NT11 and its mutants, such as mut7, a recombinant expression system was constructed in E. coli through genetic engineering. By combining the overexpression of the molecular chaperone htpG, the expression vector and fusion tag were optimized to achieve efficient expression without enzyme digestion.

Benefits of technology

The expression level of botulinum toxin light chain was increased to 647 mg/L, which is 20-43% higher than that of traditional methods, while maintaining high activity and simplifying the production process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121717869A_ABST
    Figure CN121717869A_ABST
Patent Text Reader

Abstract

The invention provides a method for improving the expression level of a meat toxin light chain. The method comprises the following steps: connecting a dissolution-promoting tag to an N end or a C end of meat toxin light chain protein to form soluble meat toxin light chain recombinant protein; the dissolution-promoting tag is a wild dissolution-promoting tag NT11 or a mutant protein mut7 of the wild dissolution-promoting tag NT11, enzyme digestion removal is not needed, the activity of a meat toxin light chain is hardly influenced and interfered, and the fusion protein can keep 93% of substrate enzyme digestion activity. The method further comprises overexpressing a molecular chaperone htpG in the genome of the host bacterium. According to the invention, a BoNT / A-LC high-efficiency expression system is constructed through multi-strategy optimization, so that the yield of BoNT / A-LC is increased by nearly 20% compared with that of wild type NT11-Lc, the yield reaches 647 mg / L through overexpression of a molecular chaperone htpG, and after combinatorial optimization, the yield is 8.5 times that of only expressed BoNT / A Lc, 1.79 times that of NT11-Lc and 1.43 times that of Mut7-Lc.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of protein engineering technology and relates to a method for improving the expression level of botulinum toxin light chain and a genetically engineered bacterium. Background Technology

[0002] The light chain (LC) of botulinum toxin type A (BoNT / A), acting as a zinc-dependent metalloproteinase, specifically cleaves the SNAP-25 protein in neurons, thereby blocking neurotransmitter release and leading to flaccid paralysis. Due to its high efficiency and persistence, BoNT / A-LC has irreplaceable value in basic neurobiological research and various clinical indications (such as dystonia, chronic pain, and cosmetic wrinkle removal). However, the production of natural BoNT / A and the isolation of BoNT / A-LC are limited by the cultivation of highly toxic strains and complex extraction and purification processes, resulting in high costs, low yields, and biosafety risks. Therefore, heterologous expression systems allow the use of simple and safe culture media, improving process safety and simplifying subsequent production and purification processes. The expression of the target protein can be enhanced through a series of methods, such as optimizing fermentation conditions, expression vectors, overexpressing molecular chaperones, and fusing lysis-promoting tags, thus enabling large-scale industrial production of exogenous proteins.

[0003] BoNT / A-LC, as the active site of full-length botulinum toxin, specifically cleaves snap25, a key protein responsible for neurotransmitter release. However, achieving high-efficiency expression levels in host bacteria while maintaining high activity remains a significant challenge. Although screening for traditional lysis-promoting tags (TrxA, NusA, MBP, GST, etc.) can efficiently express BoNT / A Lc, subsequent enzymatic cleavage is necessary to remove these tags and obtain the light chain with normal activity and function. This introduces additional processing costs and complications for industrial production. Summary of the Invention

[0004] One of the objectives of this invention is to provide a solubilizing tag that addresses the problem of low or no expression of existing botulinum toxin type A or its light chain derivatives. This tag can not only efficiently improve the expression level of the target protein, but also does not require subsequent cleavage of the tag and does not affect or interfere with the activity of the target protein.

[0005] The second objective of this invention is to provide a method for improving the expression level of botulinum toxin light chain, which can efficiently improve the expression level of the target protein without affecting or interfering with the activity of the target protein.

[0006] Therefore, the first aspect of the present invention provides a solubilizing tag for improving the expression level of botulinum toxin light chain, which is a mutant protein of wild solubilizing tag NT11, and its amino acid sequence is shown in SEQ ID NO.8.

[0007] The second aspect of the present invention provides a nucleotide molecule encoding the solubilizing tag described in the first aspect of the present invention, which is a mutant encoding the wild-type solubilizing tag NT11, and its nucleotide sequence is shown in SEQ ID NO.20.

[0008] According to the present invention, the nucleic acid molecule is a DNA molecule as follows:

[0009] (a1) A DNA molecule whose coding region includes the nucleotide sequence shown in SEQ ID NO.20;

[0010] (a2) A DNA molecule with a nucleotide sequence as shown in SEQ ID NO.20;

[0011] (a3) has 75% or more identity with the nucleotide sequence described in (a1) or (a2) and encodes a DNA molecule of the solubilizing tag described in the first aspect of the invention;

[0012] (a4) hybridizes under stringent conditions with the nucleotide sequence described in (a1) or (a2) and encodes a DNA molecule of the lysing tag described in the first aspect of the invention.

[0013] A third aspect of the present invention provides a method for improving the expression level of botulinum toxin light chain, comprising: attaching a solubilizing tag to the N-terminus or C-terminus of a botulinum toxin light chain protein to form a soluble botulinum toxin light chain recombinant protein; wherein the solubilizing tag is a wild-type solubilizing tag NT11 or a solubilizing tag as described in the first aspect of the present invention, and the amino acid sequence of the botulinum toxin light chain protein is shown in SEQ ID NO.25.

[0014] According to the present invention, the method further includes overexpressing the molecular chaperone htpG in the genome of a host bacterium, which includes amplifying the molecular chaperone htpG from the genome of the host bacterium, then ligating it downstream of the target gene by the Gibson method, and linking an RBS between the stop codon of the target gene and the molecular chaperone htpG; wherein the target gene is NT11-Lc or NT11-mut7-Lc, and the sequence of the RBS is shown in SEQ ID NO.27.

[0015] The fourth aspect of this invention provides a genetically engineered bacterium that enhances the expression level of botulinum toxin light chain. This bacterium is a host bacterium containing a nucleotide molecule encoding a lysis-promoting tag, wherein the lysis-promoting tag is the wild-type lysis-promoting tag NT11 or the lysis-promoting tag as provided in the first aspect of this invention. The sequence of the nucleotide molecule encoding the wild-type lysis-promoting tag NT11 is shown in SEQ ID NO. 13, and the nucleotide molecule encoding the lysis-promoting tag described in the first aspect of this invention is the nucleotide molecule described in the second aspect of this invention.

[0016] In some embodiments of the present invention, the sequence of the nucleotide molecule encoding the solubilization tag is fused to the 3′ or 5′ end of the nucleotide sequence of the botulinum toxin light chain gene encoding the botulinum toxin light chain protein by adding a linker sequence; optionally, a 6his tag is attached to the 5′ or 3′ end of the nucleotide sequence of the botulinum toxin light chain gene encoding the botulinum toxin light chain protein; preferably, the nucleotide sequence of the botulinum toxin light chain gene encoding the botulinum toxin light chain protein is as shown in SEQ ID NO. 26; and / or, the linker sequence is GGGGS or (GGGGS)n.

[0017] According to the present invention, the genetic engineering further includes overexpressing the molecular chaperone htpG in the genome of a host bacterium, which includes amplifying the molecular chaperone htpG from the genome of the host bacterium, then ligating it downstream of the target gene by the Gibson method, and linking an RBS between the stop codon of the target gene and the molecular chaperone htpG; wherein the target gene is NT11-Lc or NT11-mut7-Lc, and the sequence of the RBS is shown in SEQ ID NO.27.

[0018] The fifth aspect of the present invention provides the application of genetically engineered bacteria as described in the fourth aspect of the present invention in the fermentation of botulinum toxin light chains.

[0019] The sixth aspect of the present invention provides an application of a solubilizing tag for improving the expression level of botulinum toxin light chain, comprising linking the solubilizing tag to the N-terminus or C-terminus of the botulinum toxin light chain protein to form a soluble botulinum toxin light chain recombinant protein; wherein the solubilizing tag is a wild-type solubilizing tag NT11 or a solubilizing tag as described in the first aspect of the present invention, and the amino acid sequence of the botulinum toxin light chain protein is shown in SEQ ID NO.25.

[0020] The seventh aspect of the present invention provides a botulinum toxin light chain recombinant protein, which is a soluble botulinum toxin light chain recombinant protein composed of a solubilizing tag linked to the N-terminus or C-terminus of the botulinum toxin light chain protein; wherein the solubilizing tag is a wild-type solubilizing tag NT11 or a solubilizing tag as described in the first aspect of the present invention.

[0021] This invention uses *E. coli* as the host and constructs a high-efficiency BoNT / A-LC expression system through multi-strategy optimization. NT11 mutants mut1-11 are obtained sequentially through point mutations and constructed at one end of the botulinum toxin light chain. Then, through induced expression and screening using fusion tags, a solubilizing tag NT11 that requires no enzyme digestion and hardly affects or interferes with the activity of the botulinum toxin light chain is obtained. This tag can be constructed at either the N-terminus or C-terminus of the light chain. A single-point mutation library of NT11 is constructed based on alanine scanning, and screening of this library reveals that NT11 variants (e.g., mut7-11) have higher solubilizing effects than wild-type NT11. The variant mut7 has the highest expression level, reaching 451 mg / L, which is 20% higher than the NT11-Lc fusion protein.

[0022] This invention is based on the overexpression of the NT11 tag with higher expression efficiency than wild type, combined with the molecular chaperone htpG. Through combination optimization, the expression level of botulinum toxin light chain reaches 647 mg / L, which is 8.5 times that of BoNT / A Lc expression alone and 1.43 times that of mut7-Lc expression, while the substrate SNAP25 cleavage activity is maintained above 93%. Attached Figure Description

[0023] The present invention will now be described in further detail with reference to the accompanying drawings:

[0024] Figure 1 The diagram shows the construction strategy of the NT11 fusion botulinum toxin light chain expression vector and the SDS-PAGE results; the left figure is a diagram of the construction strategy of the NT11 fusion botulinum toxin light chain expression vector, and the right figure is an SDS-PAGE diagram.

[0025] Figure 2 The Western blot diagram of the target protein cleaving the substrate snap25 is shown in the top figure, and the substrate cleavage efficiency statistics are shown in the bottom figure.

[0026] Figure 3 Diagram of alanine single-point mutation strategy for the fusion tag NT11.

[0027] Figure 4 SDS-PAGE gel images (top) and expression level statistics (bottom) of different mutant NT11-target protein expressed in Escherichia coli.

[0028] Figure 5 The expression level of the target protein after overexpression of htpG in Mut7-Lc is shown. Detailed Implementation

[0029] To facilitate understanding of the present invention, it will be described in detail below with reference to the accompanying drawings and embodiments. However, before describing the present invention in detail, it should be understood that the present invention is not limited to the specific embodiments described. It should also be understood that the terminology used herein is for describing specific embodiments only and is not intended to be restrictive.

[0030] Unless otherwise defined, all terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. While any methods and materials similar to or equivalent to those described herein may also be used in the practice or testing of this invention, preferred methods and materials are now described.

[0031] I. Terminology

[0032] The term "dNTPs Mix" as used in this invention refers to reagents that can be used in polymerase chain reaction (PCR), sequencing, filling, cut translation, cDNA synthesis and TdT tailing reaction, wherein dNTP represents "2′-deoxynucleotide-5′-triphosphate", and Mix contains four nucleotides (dATP, dCTP, dGTP, dTTP).

[0033] The term "botulinum toxin light chain" as used in this invention refers to a portion of botulinum toxin type A, which is a Zn-containing light chain. 2+ The amino acid sequence of the endopeptidase-dependent protein is responsible for cleaving synaptosome-associated proteins such as SNAP25. In botulinum neurotoxin, the light chain has a molecular weight of 50 kDa, and the heavy chain has a molecular weight of 100 kDa.

[0034] In this invention, the term "RBS" refers to a ribosome binding site between the target gene and the promoter.

[0035] The terms "wild" and "wild type" used in this invention can be used interchangeably.

[0036] In this invention, the terms "protein" and "protein protein" can be used interchangeably.

[0037] Fusion expression refers to the fusion of two target gene segments connected by a linker into a single target gene segment.

[0038] II. Implementation Plan

[0039] As mentioned earlier, BoNT / A-LC, as the active site of full-length botulinum toxin, specifically cleaves snap25, a key protein responsible for neurotransmitter release. However, achieving high-efficiency expression levels in host bacteria while maintaining high activity remains a significant challenge. Although screening for traditional lysis-promoting tags (TrxA, NusA, MBP, GST, etc.) can efficiently express BoNT / A Lc, subsequent enzymatic digestion is necessary to remove these tags and obtain the light chain with normal activity and function. This introduces additional processing costs and complications for industrial production. To address these challenges, the inventors have conducted extensive research on the expression of BoNT / A-LC.

[0040] The inventors noted that *Escherichia coli* has been one of the most widely used hosts for recombinant protein expression since the 1970s. *E. coli* has advantages such as rapid growth, simple culture conditions, and a wealth of molecular tools for research applications; currently, over 100 protein products expressed in *E. coli* have been successfully commercialized. Therefore, we chose *E. coli* as the host bacterium and used genetic engineering techniques to construct an expression system for recombinant functional BoNT / A light chains in *E. coli*.

[0041] Specifically, this invention uses Escherichia coli as the host, constructs a high-efficiency BoNT / A-LC expression system through multi-strategy optimization, obtains the fusion tag NT11 which can be used without enzyme digestion through fusion tag screening, constructs an NT11 single-point mutation library based on alanine scanning, and screens to obtain the mut7 mutant which is superior to wild-type NT11, thereby obtaining this invention.

[0042] More specifically, this invention obtained a wild-type thrombolytic tag NT11 (its amino acid sequence is shown in SEQ ID NO.1) that hardly affects or interferes with the activity of the botulinum toxin light chain through screening. It can be constructed at both the N-terminus and C-terminus of the light chain. Through alanine scanning mutation library screening, the mutant proteins Mut1-11 of the wild-type thrombolytic tag NT11 (their amino acid sequences are shown in SEQ ID NO.2-12, respectively) were found to have higher thrombolytic effects than wild-type NT11. Among them, the mutant protein mut7 (its amino acid sequence is shown in SEQ ID NO.8) had the highest expression level, reaching 451 mg / L, which is more than 20% higher than that of the NT11-Lc fusion protein.

[0043] In this invention, the sequence of the nucleotide molecule encoding the wild-type soluble tag NT11 is shown in SEQ ID NO.13.

[0044] In this invention, the nucleotide sequences of the mutant protein Mut1-11 encoding the wild-type lysis-promoting tag NT11 are shown in SEQ ID NO. 14-24, and the nucleotide sequences of the mutant protein Mut7 encoding the wild-type lysis-promoting tag NT11 are shown in SEQ ID NO. 20.

[0045] According to the present invention, the nucleic acid molecule is a DNA molecule as follows:

[0046] (a1) A DNA molecule whose coding region includes the nucleotide sequence shown in SEQ ID NO.20;

[0047] (a2) A DNA molecule with a nucleotide sequence as shown in SEQ ID NO.20;

[0048] (a3) has 75% or more identity with the nucleotide sequence described in (a1) or (a2) and encodes a DNA molecule of a mutant of the wild-type lysing tag NT11;

[0049] (a4) hybridizes under stringent conditions with the nucleotide sequence described in (a1) or (a2) and encodes a DNA molecule of a mutant of the wild-type lysing tag NT11 in this invention.

[0050] Based on the above, the present invention provides an application of a lysis-promoting tag for improving the expression level of botulinum toxin light chain, comprising linking the lysis-promoting tag to the N-terminus or C-terminus of the botulinum toxin light chain protein to form a soluble botulinum toxin light chain recombinant protein; wherein, the lysis-promoting tag is a wild-type lysis-promoting tag NT11 or a mutant protein of the wild-type lysis-promoting tag NT11 as described above, preferably a mutant protein of the wild-type lysis-promoting tag NT11 mut7.

[0051] The present invention obtains recombinant botulinum toxin light chain protein by gene fusion of the above-mentioned fusion tag and light chain, and its construction strategy is as follows: Figure 1 As shown, the botulinum toxin light chain recombinant protein is a soluble botulinum toxin light chain recombinant protein composed of a solubilizing tag linked to the N-terminus or C-terminus of the botulinum toxin light chain protein; wherein, the solubilizing tag is the wild-type solubilizing tag NT11 or a mutant protein of the wild-type solubilizing tag NT11 as described above in this invention, preferably the mutant protein mut7 of the wild-type solubilizing tag NT11.

[0052] In this invention, the amino acid sequence of the botulinum toxin light chain protein is shown in SEQ ID NO.25.

[0053] Those skilled in the art should understand that the objective of this invention is to provide a method for improving the expression level of botulinum toxin light chains, comprising: attaching a solubilizing tag to the N-terminus or C-terminus of a botulinum toxin light chain protein to form a soluble botulinum toxin light chain recombinant protein; wherein the solubilizing tag is a wild-type solubilizing tag NT11 or a mutant protein mut7 of the wild-type solubilizing tag NT11 of this invention.

[0054] According to the present invention, the method further includes overexpressing the molecular chaperone htpG in the genome of a host bacterium, which includes amplifying the molecular chaperone htpG from the genome of the host bacterium, then ligating it downstream of the target gene by the Gibson method, and linking an RBS between the stop codon of the target gene and the molecular chaperone htpG; wherein the target gene is NT11-Lc or NT11-mut7-Lc, and the sequence of the RBS is shown in SEQ ID NO.27.

[0055] Specifically, the present invention provides a method for constructing a recombinant genetically engineered bacterium that produces a transmembrane peptide recombinant protein, comprising fusing the sequence of a nucleotide molecule encoding the above-mentioned fusion tag to the 3′ or 5′ end of a nucleotide molecule sequence encoding botulinum toxin light chain (L) by adding a linker sequence, and optionally attaching a 6his tag to the 5′ or 3′ end of the nucleotide molecule sequence encoding botulinum toxin light chain, and then expressing it in a host cell to obtain a recombinant genetically engineered bacterium that produces a transmembrane peptide recombinant protein as described above in the present invention.

[0056] Currently, most countries obtain botulinum toxin by isolating and extracting it from Clostridium botulinum, which is a complex and dangerous process, and the final yield of the target protein is low, approximately 1-30 mg / L. Therefore, this invention selects Escherichia coli or Bacillus subtilis as host cells to construct a heterologous expression system.

[0057] In this invention, the expression vector is selected from pet28a.

[0058] In this invention, the recombinant expression vector includes a 6his affinity tag or other tags.

[0059] Preferably, the nucleotide sequence of the botulinum toxin light chain gene encoding the botulinum toxin light chain protein is shown in SEQ ID NO. 26.

[0060] In some preferred embodiments of the present invention, the linker sequence is GGGGS or (GGGGS). n .

[0061] In some specific preferred embodiments of the present invention, some of the primers used to construct the recombinant genetically engineered bacteria producing the above-mentioned transmembrane peptide recombinant protein using Escherichia coli BL21 (Beijing TransGen Biotech Co., Ltd.) as the chassis bacteria are shown in Table 1:

[0062] Table 1

[0063] Primers Sequence 5'-3' Sequencing F GACTCACTATAGGGGAATTGTGAGC Sequencing R GGATTTTCCGGCATCCAAATTGTA Mut1-F CGAACCGCACGATTATAACTATGAAAAACTGGTGCCG Mut2-R TATAATCGTGCGGTTCGCTCGCCATG

[0064] Based on the above method, the present invention provides a genetically engineered bacterium that improves the expression level of botulinum toxin light chain. This bacterium is a host bacterium containing a nucleotide molecule encoding a lysis tag, wherein the lysis tag is the wild-type lysis tag NT11 or a mutant protein mut7 of the wild-type lysis tag NT11 as described in the present invention. The sequence of the nucleotide molecule encoding the wild-type lysis tag NT11 is shown in SEQ ID NO.5, and the nucleotide molecule encoding the mutant protein mut7 of the wild-type lysis tag NT11 as described in the present invention is as follows.

[0065] In some embodiments of the present invention, the sequence of the nucleotide molecule encoding the solubilization tag is fused to the 3′ or 5′ end of the nucleotide sequence of the botulinum toxin light chain gene encoding the botulinum toxin light chain protein by adding a linker sequence; optionally, a 6his tag is attached to the 5′ or 3′ end of the nucleotide sequence of the botulinum toxin light chain gene encoding the botulinum toxin light chain protein; preferably, the nucleotide sequence of the botulinum toxin light chain gene encoding the botulinum toxin light chain protein is as shown in SEQ ID NO. 6; and / or, the linker sequence is GGGGS or (GGGGS)n.

[0066] According to the present invention, the genetic engineering further includes overexpressing the molecular chaperone htpG in the genome of a host bacterium, which includes amplifying the molecular chaperone htpG from the genome of the host bacterium, then ligating it downstream of the target gene by the Gibson method, and linking an RBS between the stop codon of the target gene and the molecular chaperone htpG; wherein the target gene is NT11-Lc or NT11-mut7-Lc, and the sequence of the RBS is shown in SEQ ID NO.7.

[0067] The present invention further provides the application of the genetically engineered bacteria described above in the fermentation of botulinum toxin light chains.

[0068] This invention constructs a high-efficiency BoNT / A-LC expression system through multi-strategy optimization. The fusion tag NT11, which can be used without enzyme digestion, was obtained through fusion tag screening. A single-point mutation library of NT11 was constructed based on alanine scanning, and the mut7 mutant was obtained through screening, which increased the BoNT / A-LC yield to 451 mg / L, which is 20% higher than that of wild-type NT11-Lc. Finally, through the overexpression of the molecular chaperone htpG, the combination optimization resulted in a final yield of 647 mg / L, which is 1.43 times the expression level of Mut7-Lc.

[0069] III. Examples

[0070] Unless otherwise specified, the experimental methods described below are standard laboratory methods. Unless otherwise specified, the experimental materials described below are commercially available. The invention will be further described below with reference to specific embodiments to provide a better understanding of it; however, the scope of protection of the invention is not limited to the following description.

[0071] Example 1: Preparation, Expression, and Purification of Recombinant Protein

[0072] Using *E. coli* BL21 as the substrate bacteria, the light chain portion of BoNT / A was amplified by PCR. The selected fusion tag NT11 (VSEPHDYNYEK) was fused to one end of the botulinum toxin light chain via Gibson ligation, and a 6-hi tag was ligated to the C-terminus of the target gene. After successful plasmid construction, it was transformed into *E. coli* Trans10 competent cells, plated on plates with the appropriate antibiotics, and cultured overnight. The next day, single colonies were picked for colony PCR verification. Single colonies with correct bacterial counts were picked and cultured overnight at 37°C and 200 rpm in 4 ml LB medium containing 50 μg / mL Kanab antibiotics, followed by plasmid extraction.

[0073] The plasmid was added to the prepared *E. coli* cells BL21. After incubation at 37°C with shaking for 1 h, 100 μL was plated onto LB agar plates containing 50 μg / ml kana resistance and incubated overnight at 37°C. A single colony was picked and inoculated into 5 ml of LB medium containing the corresponding resistance (50 μg / L kana) and incubated overnight at 37°C with shaking. The next day, 1 ml of the seed culture was inoculated into 100 ml of TB medium containing the corresponding resistance (50 mg / L kana) and incubated until the OD value was between 0.8 and 1.0. IPTG (final concentration 0.6 mmol / L) was added to induce expression, and expression was carried out at 16°C and 220 rpm for 16 h. The culture was then centrifuged at 4°C and 5000g for 10 min. The bacterial cells were resuspended in 50 mmol / L Tris-HCl (pH=7.5) and then homogenized. The homogenized cells were centrifuged at 10000 r at 4℃, and the supernatant was collected for subsequent SDS-page and Western blot validation.

[0074] SDS-page gel image of the target protein as shown below Figure 1 As shown below, the molecular weight of the target protein is approximately 60 kDa, as indicated by the arrow in the figure.

[0075] Example 2: Western blot verification of SNAP25 cleavage of recombinant protein substrate

[0076] After diluting the crude enzyme solution to the same concentration, it was incubated with toxin cleavage reaction buffer (50 mmol / L HEPES, 2 mmol / L DTT, 10 μmol / L ZnCl2, pH 7.5) at a ratio of 2:1 at 37°C for 15 min. Then, 25 μL of different light chain fusion proteins and 50 μL of snap25 (concentration 10 mg / L) protein were incubated together at 37°C for 1 h.

[0077] The mixture was subjected to SDS-PAGE electrophoresis, and the proteins in the gel were transferred to a PV membrane using 1× transfer buffer at 400 mA for 0.5 hours. The membrane was blocked with 5% skim milk for 2.5 hours, washed three times (5 minutes each) with 1×TBST buffer, and then incubated overnight at 4°C with rabbit serum containing Snap25 (1:1000) as the primary antibody (1:1000). The next day, the membrane was incubated for 1 hour at room temperature with HRP-conjugated goat anti-rabbit IgG (1:2000) as the secondary antibody. During this time, the membrane was washed three times with TBST buffer (5 minutes each), and Western blot analysis was performed using a chromogenic solution (solution a to solution b in a 1:1 ratio). Using Snap25 (10 mg / L) without incubation of light chain proteins as a control, the concentration of Snap25 after incubation with light chain proteins was analyzed using Imaje J software to calculate the substrate cleavage efficiency of the proteins.

[0078] Cutting results as follows Figure 2 As shown.

[0079] Example 3: Construction of alanine scanning site-directed mutagenesis

[0080] The amino acids in NT11 were sequentially mutated to alanine, and plasmids containing the mutation sites were constructed using loop p, resulting in mutants mut1 and mut11. The construction strategy is as follows: Figure 3 mutant expression levels such as Figure 4 As shown.

[0081] Example 4: Overexpression of the molecular chaperone htpG

[0082] The molecular chaperone htpG was amplified from the E. coli genome and then ligated downstream of the target gene using the Gibson method. The stop codon of the target gene and the molecular chaperone htpG were linked by RBS (TTTGTTTAACTTTAAGAAGGAGA).

[0083] This combined optimization strategy increased the expression level of Mut7-Lc to 647 mg / L, which is 8.5 times that of BoNT / A Lc expression alone and 1.43 times that of Mut7-Lc expression alone. Figure 5 As shown.

[0084] It should be noted that the embodiments described above are merely preferred embodiments of the present invention, used to explain the present invention, and do not constitute any limitation on the present invention. The present invention has been described with reference to typical embodiments, but it should be understood that the terms used therein are descriptive and explanatory terms, not limiting terms. Modifications can be made to the present invention within the scope of the claims, and revisions can be made to the present invention without departing from the scope and spirit of the present invention. Although the present invention described herein relates to specific methods, materials, and embodiments, it does not mean that the present invention is limited to the specific examples disclosed herein; on the contrary, the present invention can be extended to all other methods and applications having the same function.

Claims

1. A lysis-enhancing tag for improving the expression level of botulinum toxin light chain, which is a mutant protein of wild-type lysis-enhancing tag NT11, the amino acid sequence of which is shown in SEQ ID NO.

8.

2. A nucleotide molecule encoding the solubilizing tag of claim 1, wherein the nucleotide sequence is a mutant encoding the wild-type solubilizing tag NT11, and the nucleotide sequence is shown in SEQ ID NO.

20.

3. The nucleotide molecule according to claim 2, characterized in that, The nucleic acid molecule is the following DNA molecule: (a1) A DNA molecule whose coding region includes the nucleotide sequence shown in SEQ ID NO.20; (a2) A DNA molecule with a nucleotide sequence as shown in SEQ ID NO.20; (a3) has 75% or more identity with the nucleotide sequence described in (a1) or (a2) and encodes a DNA molecule of the lysing tag described in claim 1; (a4) hybridizes under stringent conditions with the nucleotide sequence described in (a1) or (a2) and encodes a DNA molecule with the lysing tag as described in claim 1.

4. A method for increasing the expression level of botulinum toxin light chains, comprising: It includes attaching a solubilizing tag to the N-terminus or C-terminus of a botulinum toxin light chain protein to form a soluble botulinum toxin light chain recombinant protein; wherein the solubilizing tag is a wild-type solubilizing tag NT11 or the solubilizing tag as described in claim 1, and the amino acid sequence of the botulinum toxin light chain protein is shown in SEQ ID NO.

25.

5. The method according to claim 4, characterized in that, The method further includes overexpressing the molecular chaperone htpG in the host bacterium's genome, which includes amplifying the molecular chaperone htpG from the host bacterium's genome, then ligating it downstream of the target gene using the Gibson method, and linking an RBS between the target gene's stop codon and the molecular chaperone htpG; wherein the target gene is NT11-Lc or NT11-mut7-Lc, and the sequence of the RBS is shown in SEQ ID NO.

27.

6. A genetically engineered bacterium that enhances the expression level of botulinum toxin light chains, wherein the bacterium is a host bacterium containing a nucleotide molecule encoding a lysis-promoting tag, wherein, The solubilizing tag is the wild-type solubilizing tag NT11 or the solubilizing tag as described in claim 1, the sequence of the nucleotide molecule encoding the wild-type solubilizing tag NT11 is shown in SEQ ID NO.13, and the nucleotide molecule encoding the solubilizing tag as described in claim 1 is the nucleotide molecule as described in claim 2 or 3.

7. The genetically engineered bacterium according to claim 4, characterized in that, The sequence of the nucleotide molecule encoding the solubilization tag is fused to the 3′ or 5′ end of the nucleotide sequence of the botulinum toxin light chain gene encoding the botulinum toxin light chain protein by adding a linker sequence; optionally, a 6his tag is attached to the 5′ or 3′ end of the nucleotide sequence of the botulinum toxin light chain gene encoding the botulinum toxin light chain protein; preferably, the nucleotide sequence of the botulinum toxin light chain gene encoding the botulinum toxin light chain protein is as shown in SEQ ID NO.26; and / or, the linker sequence is GGGGS or (GGGGS)n.

8. The genetically engineered bacteria according to claim 6 or 7, characterized in that, The genetic engineering also includes overexpressing the molecular chaperone htpG in the genome of the host bacterium, which includes amplifying the molecular chaperone htpG from the genome of the host bacterium, then ligating it downstream of the target gene using the Gibson method, and linking an RBS between the stop codon of the target gene and the molecular chaperone htpG; wherein the target gene is NT11-Lc or NT11-mut7-Lc, and the sequence of the RBS is shown in SEQ ID NO.

27.

9. The use of a genetically engineered bacterium as described in any one of claims 4-8 in the fermentation production of botulinum toxin light chains.

10. An application of a solubilizing tag for improving the expression level of botulinum toxin light chain, comprising linking the solubilizing tag to the N-terminus or C-terminus of a botulinum toxin light chain protein to form a soluble botulinum toxin light chain recombinant protein; wherein, The solubilizing tag is the wild-type solubilizing tag NT11 or the solubilizing tag as described in claim 1, and the amino acid sequence of the botulinum toxin light chain protein is shown in SEQ ID NO.

25.

11. A botulinum toxin light chain recombinant protein, comprising a soluble botulinum toxin light chain recombinant protein composed of a solubilizing tag linked to the N-terminus or C-terminus of the botulinum toxin light chain protein; wherein, The solubility label is the wild solubility label NT11 or the solubility label as described in claim 1.